Science.gov

Sample records for t1 transgenic lines

  1. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A two-year field trial was conducted to assess the impacts of two transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. The arthropods were classified into five guilds, including herbivores, parasitoids, predators...

  2. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    PubMed

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  3. Cryopreservation of Xenopus transgenic lines.

    PubMed

    Buchholz, Daniel R; Fu, Liezhen; Shi, Yun-Bo

    2004-01-01

    Xenopus laevis has been widely used for molecular, cellular, and developmental studies. With the development of the sperm-mediated transgenic method, it is now possible to study gene function during vertebrate development by using this popular model. On the other hand, like other animal species, it is labor intensive, and the maintenance of transgenic lines is expensive. In this article, we investigated the possibility of using sperm-cryopreservation as a means to preserve transgenic frog lines. We demonstrated that cryopreserved sperms are viable but not fertile under our in vitro fertilization (IVF) conditions. However, by microinjecting cryopreserved sperm nuclei, we successfully regenerated a transgenic line carrying a double promoter transgene construct, where the marker gene encoding the green fluorescent protein (GFP) is driven by the gamma-crystallin gene promoter and a gene of interest, encoding a fusion protein of GFP with the matrix metalloproteinase stromelysin-3 (ST3-GFP), is driven by a heat shock-inducible promoter. We demonstrated the functional transmission of the ST3-GFP transgene by analyzing the phenotype of the F1 animals after heat-shock to induce its expression. Our method thus provides an inexpensive means to preserve transgenic frog lines and a convenient way for distribution of transgenic lines. Furthermore, the ease with which to microinject nuclei compared to the technically demanding transgenesis procedure with variable outcome should facilitate more laboratories to use transgenic Xenopus laevis for functional studies in vivo. Mol. Reprod. Dev. 67: 65-69, 2004.

  4. Cryopreservation of transgenic mouse lines.

    PubMed

    Pomeroy, K O

    1993-01-01

    A transgenic animal represents an enormous investment in time and money. Animals can be destroyed through disease, fire, malfuncnons in the control of the environment, negligence, sabotage, or accidental disposal. Researchers can protect valuable transgenic lines from accrdental destruction by "banking" them in liquid nitrogen. Cryopreservation can also reduce animal costs by decreasing the number of live animals investigators must maintain. Often, when one is trying to produce a transgenic animal, some lines will be derived that may not initially appear interesting. These animals can be stored in liquid nitrogen for future recovery and study. The maintenance of just one line of mice, say 25 mice at 15 cents/d, can cost over $1000 (US) in a single year. PMID:21390665

  5. Transgenic cry1C(⁎) gene rough rice line T1C-19 does not change the host preferences of the non-target stored product pest, Rhyzopertha dominica (Fabricius) (Coleoptera: Bostrichidae), and its parasitoid wasp, Anisopteromalus calandrae (Howard) (Hymenoptera: Pteromalidae).

    PubMed

    Sun, Xiao; Yan, Miao-Jun; Zhang, Aijun; Wang, Man-Qun

    2015-10-01

    Rough rice grains are often stored for extended periods before they are used or consumed. However, during storage, the rough rice is vulnerable to insect infestation, resulting in significant economic loss. Previous studies have shown that volatiles cues, physical characteristics, and taste chemicals on the grains could be the important key behavior factors for storage insect pests to locate the hosts and select oviposition sites. It is also well known that the transgenic Bt rough rice line T1C-19, which expresses a cry1C(⁎) gene has a high resistance to Lepidoptera pests. However, there were no evidences to show the consequences of host preference for non-target insect pests after growing Bt transgenic rice. In this study, the potential key factors of Bt rough rice were investigated for their impacts on the behaviors of non-target pest lesser grain borer Rhyzopertha dominica, the main weevil pest of grain and its parasitic wasps Anisopteromalus calandrae, the natural enemy of the beetle. Both electronic nose and electronic tongue analyses showed that the parameters of Bt rough rice were analogous to those of the non-Bt rough rice. The volatile profiles of Bt and non-Bt rough rice examined by gas chromatographic mass spectrometry (GC-MS) were similar. For most volatile compounds, there were no significantly quantitative differences in compound quantities between Bt and non-Bt rough rice. The densities of sclereids and trichomes on the rough rice husk surface were statistically equal in Bt and non-Bt rough rice. The non-target pest, R. dominica, and its parasitoid wasp, A. calandrae, were attracted to both rough rice and could not distinguish the transgenic T1C-19 from the isogenic rough rice. These results demonstrated that Bt rough rice has no negative impacts on the host preference behaviors of non-target stored product pest R. dominica and its parasitoid A. calandrae.

  6. Transgenic American chestnuts show enhanced blight resistance and transmit the trait to T1 progeny.

    PubMed

    Newhouse, Andrew E; Polin-McGuigan, Linda D; Baier, Kathleen A; Valletta, Kristia E R; Rottmann, William H; Tschaplinski, Timothy J; Maynard, Charles A; Powell, William A

    2014-11-01

    American chestnut (Castanea dentata) is a classic example of a native keystone species that was nearly eradicated by an introduced fungal pathogen. This report describes progress made toward producing a fully American chestnut tree with enhanced resistance to the blight fungus (Cryphonectria parasitica). The transgenic American chestnut 'Darling4,' produced through an Agrobacterium co-transformation procedure to express a wheat oxalate oxidase gene driven by the VspB vascular promoter, shows enhanced blight resistance at a level intermediate between susceptible American chestnut and resistant Chinese chestnut (Castanea mollissima). Enhanced resistance was identified first with a leaf-inoculation assay using young chestnuts grown indoors, and confirmed with traditional stem inoculations on 3- and 4-year-old field-grown trees. Pollen from 'Darling4' and other events was used to produce transgenic T1 seedlings, which also expressed the enhanced resistance trait in leaf assays. Outcrossed transgenic seedlings have several advantages over tissue-cultured plantlets, including increased genetic diversity and faster initial growth. This represents a major step toward the restoration of the majestic American chestnut.

  7. Expression of an endochitinase gene from Trichoderma virens confers enhanced tolerance to Alternaria blight in transgenic Brassica juncea (L.) czern and coss lines.

    PubMed

    Kamble, Suchita; Mukherjee, Prasun K; Eapen, Susan

    2016-01-01

    An endochitinase gene 'ech42' from the biocontrol fungus 'Trichoderma virens' was introduced to Brassica juncea (L). Czern and Coss via Agrobaterium tumefaciens mediated genetic transformation method. Integration and expression of the 'ech42' gene in transgenic lines were confirmed by PCR, RT-PCR and Southern hybridization. Transgenic lines (T1) showed expected 3:1 Mendelian segregation ratio when segregation analysis for inheritance of transgene 'hpt' was carried out. Fluorimetric analysis of transgenic lines (T0 and T1) showed 7 fold higher endochitinase activity than the non-transformed plant. Fluorimetric zymogram showed presence of endochitinase (42 kDa) in crude protein extract of transgenic lines. In detached leaf bioassay with fungi Alternaria brassicae and Alternaria brassicicola, transgenic lines (T0 and T1) showed delayed onset of lesions as well as 30-73 % reduction in infected leaf area compared to non-transformed plant. PMID:27186020

  8. Field tests of transgenic barley lines in North Dakota

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Testing transgenic barley lines for FHB in the greenhouse does not necessarily give the same results as field tests. The objective of this project was to test 18 transgenic lines in replicated trials in an inoculated FHB nursery. Several programs have developed barley lines expressing anti-fungal a...

  9. Response of sensitive human ataxia and resistant T-1 cell lines to accelerated heavy ions

    SciTech Connect

    Tobias, C.A.; Blakely, E.A.; Chang, P.Y.; Lommel, L.; Roots, R.

    1983-07-01

    The radiation dose responses of fibroblast from a patient with Ataxia telangiectasis (AT-2SF) and an established line of human T-1 cells were studied. Nearly monoenergetic accelerated neon and argon ions were used at the Berkeley Bevalac with various residual range values. The LET of the particles varied from 30 keV/..mu..m to over 1000 keV/..mu..m. All Ataxia survival curves were exponential functions of the dose. Their radiosensitivity reached peak values at 100 to 200 keV/..mu..m. Human T-1 cells have effective sublethal damage repair as has been evidenced by split dose experiments, and they are much more resistant to low LET than to high LET radiation. The repair-misrepair model has been used to interpret these results. We have obtained mathematical expressions that describe the cross sections and inactivation coefficients for both human cell lines as a function of the LET and the type of particle used. The results suggest either that high-LET particles induce a greater number of radiolesions per track or that heavy-ions at high LET induce lesions that kill cells more effectively and that are different from those produced at low LET. We assume that the lesions induced in T-1 and Ataxia cells are qualitatively similar and that each cell line attempts to repair these lesions. The result in most irradiated Ataxia cells, however, is either lethal misrepair or incomplete repair leading to cell death. 63 references, 10 figures, 1 table.

  10. Calcium signaling properties of a thyrotroph cell line, mouse TαT1 cells.

    PubMed

    Tomić, Melanija; Bargi-Souza, Paula; Leiva-Salcedo, Elias; Nunes, Maria Tereza; Stojilkovic, Stanko S

    2015-12-01

    T1 cells are mouse thyrotroph cell line frequently used for studies on thyroid-stimulating hormone beta subunit gene expression and other cellular functions. Here we have characterized calcium-signaling pathways in TαT1 cells, an issue not previously addressed in these cells and incompletely described in native thyrotrophs. TαT1 cells are excitable and fire action potentials spontaneously and in response to application of thyrotropin-releasing hormone (TRH), the native hypothalamic agonist for thyrotrophs. Spontaneous electrical activity is coupled to small amplitude fluctuations in intracellular calcium, whereas TRH stimulates both calcium mobilization from intracellular pools and calcium influx. Non-receptor-mediated depletion of intracellular pool also leads to a prominent facilitation of calcium influx. Both receptor and non-receptor stimulated calcium influx is substantially attenuated but not completely abolished by inhibition of voltage-gated calcium channels, suggesting that depletion of intracellular calcium pool in these cells provides a signal for both voltage-independent and -dependent calcium influx, the latter by facilitating the pacemaking activity. These cells also express purinergic P2Y1 receptors and their activation by extracellular ATP mimics TRH action on calcium mobilization and influx. The thyroid hormone triiodothyronine prolongs duration of TRH-induced calcium spikes during 30-min exposure. These data indicate that TαT1 cells are capable of responding to natively feed-forward TRH signaling and intrapituitary ATP signaling with acute calcium mobilization and sustained calcium influx. Amplification of TRH-induced calcium signaling by triiodothyronine further suggests the existence of a pathway for positive feedback effects of thyroid hormones probably in a non-genomic manner.

  11. Host status of three transgenic plum lines to Mesocriconema xenoplax

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gastrodianin anti-fungal protein (GAFP) increases tolerance against Phytophthora root rot and root knot nematode (Meloidogyne incognita) in transgenic plum lines. However, nothing is known about the potential of GAFP lectin to confer resistance to the ring nematode Mesocriconema xenoplax. Three t...

  12. Accumulation of nickel in transgenic tobacco

    NASA Astrophysics Data System (ADS)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TF<1) at all levels of metal treatment. Among the 4 transgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  13. Mice Transgenic for CD4-Specific Human CD4, CCR5 and Cyclin T1 Expression: A New Model for Investigating HIV-1 Transmission and Treatment Efficacy

    PubMed Central

    Zheng, Jian Hua; Zhang, Cong; Chen, Ken; Dutta, Monica; Deneroff, Kathryn; Ochsenbauer, Christina; Kappes, John C.; Littman, Dan R.; Goldstein, Harris

    2013-01-01

    Mice cannot be used to evaluate HIV-1 therapeutics and vaccines because they are not infectible by HIV-1 due to structural differences between several human and mouse proteins required for HIV-1 entry and replication including CD4, CCR5 and cyclin T1. We overcame this limitation by constructing mice with CD4 enhancer/promoter-regulated human CD4, CCR5 and cyclin T1 genes integrated as tightly linked transgenes (hCD4/R5/cT1 mice) promoting their efficient co-transmission and enabling the murine CD4-expressing cells to support HIV-1 entry and Tat-mediated LTR transcription. All of the hCD4/R5/cT1 mice developed disseminated infection of tissues that included the spleen, small intestine, lymph nodes and lungs after intravenous injection with an HIV-1 infectious molecular clone (HIV-IMC) expressing Renilla reniformis luciferase (LucR). Furthermore, localized infection of cervical-vaginal mucosal leukocytes developed after intravaginal inoculation of hCD4/R5/cT1 mice with the LucR-expressing HIV-IMC. hCD4/R5/cT1 mice reproducibly developed in vivo infection after inoculation with LucR-expressing HIV-IMC which could be bioluminescently quantified and visualized with a high sensitivity and specificity which enabled them to be used to evaluate the efficacy of HIV-1 therapeutics. Treatment with highly active anti-retroviral therapy or one dose of VRC01, a broadly neutralizing anti-HIV-1 antibody, almost completed inhibited acute systemic HIV-1 infection of the hCD4/R5/cT1 mice. hCD4/R5/cT1 mice could also be used to evaluate the capacity of therapies delivered by gene therapy to inhibit in vivo HIV infection. VRC01 secreted in vivo by primary B cells transduced with a VRC01-encoding lentivirus transplanted into hCD4/R5/cT1 mice markedly inhibited infection after intravenous challenge with LucR-expressing HIV-IMC. The reproducible infection of CD4/R5/cT1 mice with LucR-expressing HIV-IMC after intravenous or mucosal inoculation combined with the availability of Luc

  14. Novel cell lines derived from transgenic mice expressing recombinant human proteins. Transgenic hepatoma-derived cell lines.

    PubMed

    Perraud, F; Dalemans, W; Ali-Hadji, D; Pavirani, A

    1992-01-01

    We have used transgenic mouse technology to establish immortalized hepatoma cell lines stably secreting heterologous proteins, such as human alpha 1-antitrypsin and human factor IX. Hepatocyte-specific regulatory DNA sequences were used to target both the expression of an onc gene and the gene coding for the human protein to the liver of transgenic mice which eventually developed hepatocellular carcinomas. Tumour cells were subsequently established as permanent cell lines, which maintained a differentiated phenotype under specific culture conditions, being capable of producing biologically active and correctly processed human alpha 1-antitrypsin and factor IX. Moreover, a preliminary analysis has shown that certain cell lines express elevated total cytochrome P450 activity. These cells could therefore represent a useful alternative to the use of animals or primary cultures in drug safety testing. PMID:1369183

  15. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer.

    PubMed

    Silva, Vera L; Ferreira, Debora; Nobrega, Franklin L; Martins, Ivone M; Kluskens, Leon D; Rodrigues, Ligia R

    2016-01-01

    The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line- 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 -CPTASNTSC and 4T1pep2-EVQSSKFPAHVS) were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy. PMID:27548261

  16. Case Study: Polycystic Livers in a Transgenic Mouse Line

    SciTech Connect

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  17. Decoding method for T1 line format for ccitt 32K bit per second adpcm clear channel transmission and 64 KBPS clear channel transmission

    SciTech Connect

    Blondeau, E.E. Jr.; Czarnecki, S.J.

    1988-05-24

    In a data transmission system having first and second digital switching systems connected via T1 line transmission facilities for bidirectional data transmissions, a decoding method for T1 line zero bit suppression is described comprising the steps of: receiving an encoded T1 line frame including bundled channels; testing indicator bits of the received T1 line frame to determine whether any channel of the T1 line frame has been altered for the transmission; first transferring the received T1 line frame as received, performed in response to the indicated bits showing that no alteration have been made to the received T1 line frame; decoding mapping bits of the received T1 line frame to determine which channels of the bundle of the received T1 line frame have been altered for the encoded transmission; replacing the contents of each of the altered channel of the bundle with zeroes; iterating the steps of decoding and replacing for each of the bundles of the received T1 line frame; and second transferring the received T1 line frame with the altered channels being replaced with zeroes.

  18. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer

    PubMed Central

    Nobrega, Franklin L.; Martins, Ivone M.

    2016-01-01

    The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line– 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 –CPTASNTSC and 4T1pep2—EVQSSKFPAHVS) were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy. PMID:27548261

  19. Generation and characterization of transgenic plum lines expressing gafp-1 with the bul409 promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Gastrodia anti fungal protein (GAFP-1) is a mannose-binding lectin that can confer increased disease resistance in transgenic tobacco and plum. In all previously-generated transgenic lines, the gene was under the control of the 35SCaMV promoter. In this study, transgenic plum lines were create...

  20. Efficient selection and evaluation of transgenic lines of Crambe abyssinica

    PubMed Central

    Li, Xueyuan; Fan, Jing; Gruber, Jens; Guan, Rui; Frentzen, Margrit; Zhu, Li-Hua

    2013-01-01

    Crambe abyssinica is a dedicated oilseed crop suitable for production of industrial feedstocks. Genetic modification of crambe has progressed substantially in the last few years, but the transformation efficiency needs to be further improved. Meanwhile, developing a reliable molecular system including Southern blot and qRT-PCR analyses is desired for effectively evaluating transgenic lines and gene expression levels of both endogenous and transgenes. In this study, we have developed an efficient transformation protocol with hygromycin as the selective agent for crambe transformation. In the regeneration test, addition of hygromycin at concentration of 5 mg L−1 resulted in 18% of shoot regeneration using crambe hypocotyls as explants, while no regeneration occurred when the hygromycin concentration reached 10 mg L−1. Based on this result, the hygromycin concentration up to 10 mg L−1 was used in the subsequent transformations. The results showed that the transformation efficiency under constant low selection pressure (H3-H3) was similar to that under higher selection pressure first, followed by transfer to lower selection pressure (H10-H3). The PCR, Southern blot and fatty acid composition analyses confirmed the integration of transgenes in the crambe genome. We have also optimized the Southern and qRT-PCR methods for future studies on crambe or related species. For Southern blot analysis on crambe, more than 50 μg DNA is required for a clear band. The choice of enzymes for DNA digestion was not rigid for confirmation of the T-DNA integration, while for determining the copy number of transgenes, suitable enzymes should be chosen. Increasing the enzyme concentration could improve the digestion and 20 μl enzyme was recomended for a complete digestion of up to 80 μg crambe DNA. For qRT-PCR analysis, around 20 days after flowering was observed to be the suitable sampling time for expresseion analysis of genes invovled in the seed oil biosynthesis. PMID:23750164

  1. Efficient selection and evaluation of transgenic lines of Crambe abyssinica.

    PubMed

    Li, Xueyuan; Fan, Jing; Gruber, Jens; Guan, Rui; Frentzen, Margrit; Zhu, Li-Hua

    2013-01-01

    Crambe abyssinica is a dedicated oilseed crop suitable for production of industrial feedstocks. Genetic modification of crambe has progressed substantially in the last few years, but the transformation efficiency needs to be further improved. Meanwhile, developing a reliable molecular system including Southern blot and qRT-PCR analyses is desired for effectively evaluating transgenic lines and gene expression levels of both endogenous and transgenes. In this study, we have developed an efficient transformation protocol with hygromycin as the selective agent for crambe transformation. In the regeneration test, addition of hygromycin at concentration of 5 mg L(-1) resulted in 18% of shoot regeneration using crambe hypocotyls as explants, while no regeneration occurred when the hygromycin concentration reached 10 mg L(-1). Based on this result, the hygromycin concentration up to 10 mg L(-1) was used in the subsequent transformations. The results showed that the transformation efficiency under constant low selection pressure (H3-H3) was similar to that under higher selection pressure first, followed by transfer to lower selection pressure (H10-H3). The PCR, Southern blot and fatty acid composition analyses confirmed the integration of transgenes in the crambe genome. We have also optimized the Southern and qRT-PCR methods for future studies on crambe or related species. For Southern blot analysis on crambe, more than 50 μg DNA is required for a clear band. The choice of enzymes for DNA digestion was not rigid for confirmation of the T-DNA integration, while for determining the copy number of transgenes, suitable enzymes should be chosen. Increasing the enzyme concentration could improve the digestion and 20 μl enzyme was recomended for a complete digestion of up to 80 μg crambe DNA. For qRT-PCR analysis, around 20 days after flowering was observed to be the suitable sampling time for expresseion analysis of genes invovled in the seed oil biosynthesis.

  2. In vivo immunomodulatory effects of Antrodia camphorata polysaccharides in a T1/T2 doubly transgenic mouse model for inhibiting infection of Schistosoma mansoni

    SciTech Connect

    Cheng, P.-C.; Hsu, C.-Y.; Chen, C.-C.; Lee, K.-M.

    2008-03-01

    Antrodia camphorata (A. camphorata) is a fungus commonly used for treatment of viral hepatitis and cancer in Chinese folk medicine. Extract of A. camphorate is reported to possess anti-inflammatory, antihepatitis B virus and anticancer activities. In this study, we tested the in vivo effects of polysaccharides derived from A. camphorata (AC-PS) on immune function by detection of cytokine expression and evaluation of the immune phenotype in a T1/T2 doubly transgenic mouse model. The protective effect of AC-PS in mice was tested by infection with Schistosoma mansoni. The induction of large amounts of IFN-{gamma}, IL-2 and TNF-a mRNA were detected after 2 and 4 weeks of oral AC-PS administration in BALB/c and C57BL/6 mice. In transgenic mice, 3 to 6 weeks of oral AC-PS administration increased the proportion of CD4{sup +} T cells and B cells within the spleen. More specifically, there was an increase of Th1 CD4{sup +} T cells and Be1 cells among spleen cells as observed by detection the of Type1/Type2 marker molecules. By using a disease model of parasitic infection, we found that AC-PS treatment inhibited infection with S. mansoni in BALB/C and C57BL/6 mice. AC-PS appears to influence the immune system of mice into developing Th1 responses and have potential for preventing infection with S. mansoni.

  3. Generation of Doubled Haploid Transgenic Wheat Lines by Microspore Transformation

    PubMed Central

    Liu, Weiguo; Konzak, Calvin F.; von Wettstein, Diter; Rustgi, Sachin

    2013-01-01

    Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i) pretreatment of immature spikes with CuSO4 solution (500 mg/L) at 4°C for 10 days; (ii) electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii) induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv) co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v) elimination of AGL-1 cells after co-cultivation with timentin (200–400 mg/L). PMID:24260351

  4. Development of Transgenic Cotton Lines Expressing Allium sativum Agglutinin (ASAL) for Enhanced Resistance against Major Sap-Sucking Pests

    PubMed Central

    Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1–2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects. PMID:24023750

  5. Toxicity assessment of transgenic papaya ringspot virus of 823-2210 line papaya fruits.

    PubMed

    Lin, Hsin-Tang; Yen, Gow-Chin; Huang, Ting-Tzu; Chan, Lit-Fu; Cheng, Ying-Huey; Wu, Jhaol-Huei; Yeh, Shyi-Dong; Wang, Sheng-Yang; Liao, Jiunn-Wang

    2013-02-20

    The transgenic papaya is a valuable strategy for creating plants resistant to papaya ringspot virus (PRSV) infection and increasing production. This study was further performed to evaluate the comparative toxicity effects of the newly developed transgenic line of the fruits of two backcross transgenic papaya lines (2210 and 823) and one hybrid line (823-2210) and compare to their parent non-transgenic (TN-2) counterparts. The stability analysis of coat protein (CP) of PRSV was investigated using the digestion stability assays in simulated gastric fluid (SGF), simulated intestinal fluid (SIF), and bile salts to detect the CP fragments. Results revealed that the CP fragments were rapidly hydrolyzed in SGF and were undetectable in organs and gastrointestinal contents in rats. For the genotoxicity, three in vitro assays were conducted and exhibited that non-transgenic and backcross transgenic papaya fruits were negative. Moreover, a repeated animal feeding study was conducted by feeding 2 g/kg of body weight (bw) of non-transgenic and backcross transgenic papaya fruits for 28 days in rats. There were no biological or toxicological significances between non-transgenic and backcross transgenic papaya fruits in rats. The results demonstrated that the backcross transgenic papaya fruit can be recognized as an equivalent substitution for traditional papaya in food safety.

  6. Safety assessment of transgenic Bacillus thuringiensis rice T1c-19 in Sprague-Dawley rats from metabonomics and bacterial profile perspectives.

    PubMed

    Cao, Sishuo; He, Xiaoyun; Xu, Wentao; Luo, YunBo; Yuan, Yanfang; Liu, Pengfei; Cao, Bo; Shi, Hui; Huang, Kunlun

    2012-03-01

    Bacillus thuringiensis rice is facing commercialization as the main food source in the near future. The unintended effects of genetically modified (GM) organisms are the most important barriers to their promotion. We aimed to establish a new in vivo evaluation model for genetically modified foods by using metabonomics and bacterial profile approaches. T1c-19 rice flour or its transgenic parent MH63 was used at 70% wt/wt to produce diets that were fed to rats for ∼ 90 days. Urine metabolite changes were detected using (1)H NMR. Denaturing gradient gel electrophoresis and real-time polymerase chain reaction (RT-PCR) were used to detect the bacterial profiles between the two groups. The metabonomics was analyzed for metabolite changes in rat urine, when compared with the non-GM rice group, where rats were fed a GM rice diet. Several metabolites correlated with rat age and sex but not with GM rice diet. Significant biological differences were not identified between the GM rice diet and the non-GM rice diet. The bacteria related to rat urine metabolites were also discussed. The results from metabonomics and bacterial profile analyses were comparable with the results attained using the traditional method. Because metabonomics and bacterial profiling offer noninvasive, dynamic approaches for monitoring food safety, they provide a novel process for assessing the safety of GM foods.

  7. Stripe rust resistance and dough quality of new wheat - Dasypyrum villosum translocation lines T1DL•1V#3S and T1DS•1V#3L and the location of HMW-GS genes.

    PubMed

    Zhao, W C; Gao, X; Dong, J; Zhao, Z J; Chen, Q G; Chen, L G; Shi, Y G; Li, X Y

    2015-07-17

    The transfer of agronomically useful genes from wild wheat species into cultivated wheat is one of the most effective approaches to improvement of wheat varieties. To evaluate the transfer of genes from Dasypyrum villosum into Triticum aestivum, wheat quality and disease resistance was evaluated in two new translocation lines, T1DL•1V#3S and T1DS•1V#3L. We examined the levels of stripe rust resistance and dough quality in the two lines, and identified and located the stripe rust resistant genes and high molecular weight glutenin subunit (HMW-GS) genes Glu-V1 of D. villosum. Compared to the Chinese Spring (CS) variety, T1DL•1V#3S plants showed moderate resistance to moderate susceptibility to the stripe rust races CYR33 and Su11-4. However, T1DS•1V#3L plants showed high resistance or immunity to these stripe rusts. The genes for resistance to stripe rust were located on 1VL of D. villosum. In comparison to CS, the dough from T1DS•1V#3L had a significantly shorter developing time (1.45 min) and stable time (1.0 min), a higher weakness in gluten strength (208.5 FU), and a lower farinograph quality index (18). T1DL•1V#3S had a significantly longer developing time (4.2 min) and stable time (5.25 min), a lower weakness in gluten strength (53 FU) and a higher farinograph quality index (78.5). We also found that T1DS•1V#3L had reduced gluten strength and dough quality compared to CS, but T1DL•1V#3S had increased gluten strength and dough quality. The results of SDS-PAGE analysis indicated that Glu-V1 of D. villosum was located on short arm 1VS and long arm 1VL. These results prove that the new translocation lines, T1DS•1V#3L and T1DS•1V#3L, have valuable stripe rust resistance and dough quality traits that will be important for improving wheat quality and resistance in future wheat breeding programs.

  8. Comparison of three transgenic Bt rice lines for insecticidal protein expression and resistance against a target pest, Chilo suppressalis (Lepidoptera: Crambidae).

    PubMed

    Wang, Ya-Nan; Ke, Kai-Qie; Li, Yun-He; Han, Lan-Zhi; Liu, Yan-Min; Hua, Hong-Xia; Peng, Yu-Fa

    2016-02-01

    Two transgenic rice lines (T2A-1 and T1C-19b) expressing cry2A and cry1C genes, respectively, were developed in China, targeting lepidopteran pests including Chilo suppressalis (Walker) (Lepidoptera: Crambidae). The seasonal expression of Cry proteins in different tissues of the rice lines and their resistance to C. suppressalis were assessed in comparison to a Bt rice line expressing a cry1Ab/Ac fusion gene, Huahui 1, which has been granted a biosafety certificate. In general, levels of Cry proteins were T2A-1 > Huahui 1 > T1C-19b among rice lines, and leaf > stem > root among rice tissues. The expression patterns of Cry protein in the rice line plants were similar: higher level at early stages than at later stages with an exception that high Cry1C level in T1C-19b stems at the maturing stage. The bioassay results revealed that the three transgenic rice lines exhibited significantly high resistance against C. suppressalis larvae throughout the rice growing season. According to Cry protein levels in rice tissues, the raw and corrected mortalities of C. suppressalis caused by each Bt rice line were the highest in the seedling and declined through the jointing stage with an exception for T1C-19b providing an excellent performance at the maturing stage. By comparison, T1C-19b exhibited more stable and greater resistance to C. suppressalis larvae than T2A-1, being close to Huahui 1. The results suggest cry1C is an ideal Bt gene for plant transformation for lepidopteran pest control, and T1C-19b is a promising Bt rice line for commercial use for tolerating lepidopteran rice pests.

  9. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  10. Stable expression of a bacterial GUS gene in vegetatively propagated transgenic pear lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The stability of a transgene in the genomes of in vitro propagated transgenic pear lines was assessed. A bacterial GUS reporter gene under the control of an Arabidopsis sucrose transporter gene promoter was introduced into pear cultivar ‘Old Home’ through Agrobacterium-mediated leaf-explant transfo...

  11. Nas transgenic mouse line allows visualization of Notch pathway activity in vivo

    PubMed Central

    Souilhol, Céline; Cormier, Sarah; Monet, Marie; Vandormael-Pournin, Sandrine; Joutel, Anne; Babinet, Charles; Cohen-Tannoudji, Michel

    2006-01-01

    The Notch signalling pathway plays multiple and important roles in mammals. However, several aspects of its action, in particular the precise mapping of its sites of activity, remain unclear. To address this issue, we have generated a transgenic line carrying a construct consisting of a nls-lacZ reporter gene under the control of a minimal promoter and multiple RBP-Jκ binding sites. Here we show that this transgenic line, we named NAS for Notch Activity Sensor, displays an expression profile that is consistent with current knowledge on Notch activity sites in mice, even though it may not report on all these sites. Moreover, we observe that NAS transgene expression is abolished in a RBP-Jκ deficient background indicating that it indeed requires Notch/RBP-Jκ signalling pathway activity. Thus, the NAS transgenic line constitutes a valuable and versatile tool to gain further insights into the complex and various functions of the Notch signalling pathway. PMID:16708386

  12. Live image profiling of neural crest lineages in zebrafish transgenic lines.

    PubMed

    Kwak, Jina; Park, Ok Kyu; Jung, Yoo Jung; Hwang, Byung Joon; Kwon, Seung-Hae; Kee, Yun

    2013-03-01

    Zebrafish transgenic lines are important experimental tools for lineage tracing and imaging studies. It is crucial to precisely characterize the cell lineages labeled in transgenic lines to understand their limitations and thus properly interpret the data obtained from their use; only then can we confidently select a line appropriate for our particular research objectives. Here we profiled the cell lineages labeled in the closely related neural crest transgenic lines Tg(foxd3:GFP), Tg(sox10:eGFP) and Tg(sox10:mRFP). These fish were crossed to generate embryos, in which foxd3 and sox10 transgenic neural crest labeling could be directly compared at the cellular level using live confocal imaging. We have identified key differences in the cell lineages labeled in each line during early neural crest development and demonstrated that the most anterior cranial neural crest cells initially migrating out of neural tube at the level of forebrain and anterior midbrain express sox10:eGFP and sox10:mRFP, but not foxd3:GFP. This differential profile was robustly maintained in the differentiating progeny of the neural crest lineages until 3.5dpf. Our data will enable researchers to make an informed choice in selecting transgenic lines for future neural crest research.

  13. Cell lines from MYCN transgenic murine tumours reflect the molecular and biological characteristics of human neuroblastoma.

    PubMed

    Cheng, Andy J; Cheng, Ngan Ching; Ford, Jette; Smith, Janice; Murray, Jayne E; Flemming, Claudia; Lastowska, Maria; Jackson, Michael S; Hackett, Christopher S; Weiss, William A; Marshall, Glenn M; Kees, Ursula R; Norris, Murray D; Haber, Michelle

    2007-06-01

    Overexpression of the human MYCN oncogene driven by a tyrosine hydroxylase promoter causes tumours in transgenic mice that recapitulate the childhood cancer neuroblastoma. To establish an in vitro model to study this process, a series of isogenic cell lines were developed from these MYCN-driven murine tumours. Lines were established from tumours arising in homozygous and hemizygous MYCN transgenic mice. Hemizygous tumours gave rise to cell lines growing only in suspension. Homozygous tumours gave rise to similar suspension lines as well as morphologically distinct substrate-adherent lines characteristic of human S-type neuroblastoma cells. FISH analysis demonstrated selective MYCN transgene amplification in cell lines derived from hemizygous mice. Comparative genomic hybridisation (CGH) and fluorescence in situ hybridisation (FISH) analysis confirmed a range of neuroblastoma-associated genetic changes in the various lines, in particular, gain of regions syntenic with human 17q. These isogenic lines together with the transgenic mice thus represent valuable models for investigating the biological characteristics of aggressive neuroblastoma.

  14. Transgenic soybean overexpressing GmSamT1 exhibits resistance to multiple-HG types of soybean cysts nematode heterodera glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean (Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyzes the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heter...

  15. Assessment of Fecundity and Germ Line Transmission in Two Transgenic Pig Lines Produced by Sleeping Beauty Transposition

    PubMed Central

    Garrels, Wiebke; Holler, Stephanie; Cleve, Nicole; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A.

    2012-01-01

    Recently, we described a simplified injection method for producing transgenic pigs using a non-autonomous Sleeping Beauty transposon system. The founder animals showed ubiquitous expression of the Venus fluorophore in almost all cell types. To assess, whether expression of the reporter fluorophore affects animal welfare or fecundity, we analyzed reproductive parameters of two founder boars, germ line transmission, and organ and cell specific transgene expression in animals of the F1 and F2 generation. Molecular analysis of ejaculated sperm cells suggested three monomeric integrations of the Venus transposon in both founders. To test germ line transmission of the three monomeric transposon integrations, wild-type sows were artificially inseminated. The offspring were nursed to sexual maturity and hemizygous lines were established. A clear segregation of the monomeric transposons following the Mendelian rules was observed in the F1 and F2 offspring. Apparently, almost all somatic cells, as well as oocytes and spermatozoa, expressed the Venus fluorophore at cell-type specific levels. No detrimental effects of Venus expression on animal health or fecundity were found. Importantly, all hemizygous lines expressed the fluorophore in comparable levels, and no case of transgene silencing or variegated expression was found after germ line transmission, suggesting that the insertions occurred at transcriptionally permissive loci. The results show that Sleeping Beauty transposase-catalyzed transposition is a promising approach for stable genetic modification of the pig genome. PMID:24705079

  16. Runx1 and Runx3 Are Downstream Effectors of Nanog in Promoting Osteogenic Differentiation of the Mouse Mesenchymal Cell Line C3H10T1/2.

    PubMed

    Saito, Tadahito; Ohba, Shinsuke; Yano, Fumiko; Seto, Ichiro; Yonehara, Yoshiyuki; Takato, Tsuyoshi; Ogasawara, Toru

    2015-06-01

    Previously, we reported that the transcription factor Nanog, which maintains the self-renewal of embryonic stem cells (ESCs), promotes the osteogenic differentiation of the mouse mesenchymal cell line C3H10T1/2 through a genome reprogramming process. In the present study, to clarify the mechanism underlying the multipotency of mesenchymal stem cells (MSCs) and to develop a novel approach to bone regenerative medicine, we attempted to identify the downstream effectors of Nanog in promoting osteogenic differentiation of mouse mesenchymal cells. We demonstrated that Runx1 and Runx3 are the downstream effectors of Nanog, especially in the early and intermediate osteogenic differentiation of the mouse mesenchymal cell line C3H10T1/2. PMID:26053522

  17. [Construction of Fat-1 eukaryotic expression vector of excision markers and the establishment of transgenic sheep cell lines].

    PubMed

    Lima, A; Zhu, Heping; Wang, Ruiyao; Yan, Tao; Su, Xiaohu; Li, Lu; Wang, Bingping; Na, Shunwendoule; Qi, Guichun; Zhou, Huanmin

    2016-02-01

    In order to establish marker-free transgenic cell lines, we cloned Fat-1 gene, attB and Loxp sequences by PCR. Then we inserted these sequences to pN1-EGFP vector and got pEGFP-N1-Fat-1 expression vector. PhiC31 integrase mRNA which was generated by in vitro transcription and a pEGFP-N1-Fat-1 expression vector co-electroporated into sheep fetal fibroblasts, and then we got transgenic cell lines expressing green fluorescence. Prokaryotic expression and purification of Cre recombinant protein was performed. Cre recombinant protein was transducted into stably-transfected cell colonies. We identified cell colonies by sequencing and established marker-free transgenic cell lines and eventually- established marker-free transgenic cell lines which were building more safely basic for producing Fat-1 transgenic animals. PMID:27382771

  18. [Construction of Fat-1 eukaryotic expression vector of excision markers and the establishment of transgenic sheep cell lines].

    PubMed

    Lima, A; Zhu, Heping; Wang, Ruiyao; Yan, Tao; Su, Xiaohu; Li, Lu; Wang, Bingping; Na, Shunwendoule; Qi, Guichun; Zhou, Huanmin

    2016-02-01

    In order to establish marker-free transgenic cell lines, we cloned Fat-1 gene, attB and Loxp sequences by PCR. Then we inserted these sequences to pN1-EGFP vector and got pEGFP-N1-Fat-1 expression vector. PhiC31 integrase mRNA which was generated by in vitro transcription and a pEGFP-N1-Fat-1 expression vector co-electroporated into sheep fetal fibroblasts, and then we got transgenic cell lines expressing green fluorescence. Prokaryotic expression and purification of Cre recombinant protein was performed. Cre recombinant protein was transducted into stably-transfected cell colonies. We identified cell colonies by sequencing and established marker-free transgenic cell lines and eventually- established marker-free transgenic cell lines which were building more safely basic for producing Fat-1 transgenic animals.

  19. Cyclin T1-Dependent Genes in Activated CD4+ T and Macrophage Cell Lines Appear Enriched in HIV-1 Co-Factors

    PubMed Central

    Yu, Wendong; Ramakrishnan, Rajesh; Wang, Yan; Chiang, Karen; Sung, Tzu-Ling; Rice, Andrew P.

    2008-01-01

    HIV-1 is dependent upon cellular co-factors to mediate its replication cycle in CD4+ T cells and macrophages, the two major cell types infected by the virus in vivo. One critical co-factor is Cyclin T1, a subunit of a general RNA polymerase II elongation factor known as P-TEFb. Cyclin T1 is targeted directly by the viral Tat protein to activate proviral transcription. Cyclin T1 is up-regulated when resting CD4+ T cells are activated and during macrophage differentiation or activation, conditions that are also necessary for high levels of HIV-1 replication. Because Cyclin T1 is a subunit of a transcription factor, the up-regulation of Cyclin T1 in these cells results in the induction of cellular genes, some of which might be HIV-1 co-factors. Using shRNA depletions of Cyclin T1 and transcriptional profiling, we identified 54 cellular mRNAs that appear to be Cyclin T1-dependent for their induction in activated CD4+ T Jurkat T cells and during differentiation and activation of MM6 cells, a human monocytic cell line. The promoters for these Cyclin T1-dependent genes (CTDGs) are over-represented in two transcription factor binding sites, SREBP1 and ARP1. Notably, 10 of these CTDGs have been reported to be involved in HIV-1 replication, a significant over-representation of such genes when compared to randomly generated lists of 54 genes (p value<0.00021). The results of siRNA depletion and dominant-negative protein experiments with two CTDGs identified here, CDK11 and Casein kinase 1 gamma 1, suggest that these genes are involved either directly or indirectly in HIV-1 replication. It is likely that the 54 CTDGs identified here include novel HIV-1 co-factors. The presence of CTDGs in the protein space that was available for HIV-1 to sample during its evolution and acquisition of Tat function may provide an explanation for why CTDGs are enriched in viral co-factors. PMID:18773076

  20. In vitro determination of carcinogenicity of sixty-four compounds using a bovine papillomavirus DNA-carrying C3H/10T(1/2) cell line.

    PubMed

    Kowalski, L A; Laitinen, A M; Mortazavi-Asl, B; Wee, R K; Erb, H E; Assi, K P; Madden, Z

    2000-01-01

    A new in vitro test for predicting rodent carcinogenicity is evaluated against a testing database of 64 chemicals including both genotoxic and nongenotoxic carcinogens and carcinogens that normally require addition of an S-9 microsomal fraction for detection in the bacterial mutagenicity assay. The assay uses focus formation in a stable, bovine papillomavirus type 1 (BPV-1) DNA carrying C3H/10T(1/2) mouse embryo fibroblast cell line (T1) that does not require transfection, infection with virus, isolation of primary cells from animals, or addition of a microsomal fraction. Of a total database of 64 compounds, 92% of the carcinogens, promoters, or noncarcinogens were correctly predicted. Based on previously reported results, the test of bacterial mutagenicity would have correctly predicted 58% of carcinogens, promoters or noncarcinogens and the Syrian hamster embryo test would have correctly predicted 87% of carcinogens, promoters, or noncarcinogens of this database. Of carcinogens that normally require addition of an S-9 fraction, T1 cells correctly predicted rodent carcinogenicity of polyaromatic hydrocarbons, aflatoxins, azo-compounds, nitrosamines, and hydrazine without the addition of an S-9 fraction. Of nongenotoxic carcinogens, T1 cells correctly predicted diethylstilbestroel, diethylhexylphthalate, acetamides, alkyl halides, ethyl carbamate, and phorbol ester tumour promoters.

  1. Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes.

    PubMed

    Yang, R L; Wang, A X; Zhang, J; Dong, Y; Yang, M S; Wang, J M

    2016-01-01

    We characterized new transgenic varieties of poplar with multiple insect-resistant and salt stress tolerant genes. Two insect-resistant Bacillus thuringiensis (Bt) genes, Cry1Ac and Cry3A, and a salt-tolerant gene, Betaine aldehyde dehydrogenase (BADH) were inserted into a vector, p209-Cry1Ac-Cry3A-BADH. The clone of Populus x euramericana was transformed by the vector using the Agrobacterium-mediated method. Three transgenic lines were assessed using genetic detection and resistance expression analysis. PCR revealed that exogenous genes Cry1Ac, Cry3A, BADH and selective marker gene NPTII were present in three transgenic lines. Quantitative real-time PCR (qPCR) showed significant differences in the transcriptional abundance of three exogenous genes in different lines. Results of assays for Bt toxic proteins showed that the Cry1Ac and Cry3A toxic protein content of each line was 12.83-26.32 and 2108.91-2724.79 ng/g, respectively. The Cry1Ac toxic protein content of different lines was significantly different; the Cry3A toxic protein content was about 100 times higher than that of the Cry1Ac toxic protein. The insect-resistance test revealed the mortality rate of transgenic lines to Hyphantria cunea L1 larvae varied by 42.2-66.7%, which was significantly higher than non-transgenic lines. The mortality rate of L1 and L2 Plagiodera versicolora larvae was 100%. The insecticidal effect of transgenic lines to P. versicolora larvae was higher than that to H. cunea larvae. NaCl stress tolerance of three transgenic lines under 3-6% NaCl concentration was significantly higher than that of non-transgenic lines. PMID:27173305

  2. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    PubMed

    Zhang, Luhua; Chen, Haiwei; Li, Yanlan; Li, Yanan; Wang, Shengjun; Su, Jinping; Liu, Xuejun; Chen, Defu; Chen, Xiwen

    2014-01-01

    Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.). To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA) from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer), and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  3. Transgenic retinoic acid sensor lines in zebrafish indicate regions of available embryonic retinoic acid

    PubMed Central

    Mandal, Amrita; Rydeen, Ariel; Anderson, Jane; Sorrell, Mollie R.J.; Zygmunt, Tomas; Torres-Vázquez, Jesús; Waxman, Joshua S.

    2013-01-01

    Background Retinoic acid (RA) signaling plays a critical role in vertebrate development. Transcriptional reporters of RA signaling in zebrafish, thus far, have not reflected the broader availability of embryonic RA, necessitating additional tools to enhance our understanding of the spatial and temporal activity of RA signaling in vivo. Results We have generated novel transgenic RA sensors in which a RA receptor (RAR) ligand-binding domain (RLBD) is fused to the Gal4 DNA binding domain (GDBD) or a VP16-GDBD (VPBD) construct. Stable transgenic lines expressing these proteins when crossed with UAS reporter lines are responsive to RA. Interestingly, the VPBD RA sensor is significantly more sensitive than the GDBD sensor and demonstrates there may be almost ubiquitous availability of RA within the early embryo. Using confocal microscopy to compare the expression of the GDBD RA sensor to our previously established RA signaling transcriptional reporter line, Tg(12XRARE:EGFP), illustrates these reporters have significant overlap, but that expression from the RA sensor is much broader. We also identify previously unreported domains of expression for the Tg(12XRARE:EGFP) line. Conclusions Our novel RA sensor lines will be useful and complementary tools for studying RA signaling during development and anatomical structures independent of RA signaling. PMID:23703807

  4. Characterization of prostatic epithelial cell lines derived from transgenic adenocarcinoma of the mouse prostate (TRAMP) model.

    PubMed

    Foster, B A; Gingrich, J R; Kwon, E D; Madias, C; Greenberg, N M

    1997-08-15

    To develop a syngeneic transplantable system to study immunotherapeutic approaches for the treatment of prostate cancer, three cell lines were established from a heterogeneous 32 week tumor of the transgenic adenocarcinoma mouse prostate (TRAMP) model. TRAMP is a transgenic line of C57BL/6 mice harboring a construct comprised of the minimal -426/+28 rat probasin promoter driving prostate-specific epithelial expression of the SV40 large T antigen. TRAMP males develop histological prostatic intraepithelial neoplasia by 8-12 weeks of age that progress to adenocarcinoma with distant metastases by 24-30 weeks of age. The three cell lines (TRAMP-C1, TRAMP-C2, and TRAMP-C3) express cytokeratin, E-cadherin, and androgen receptor by immunohistochemical analysis and do not appear to have a mutated p53. Although TRAMP-C1 and TRAMP-C2 are tumorigenic when grafted into syngeneic C57BL/6 hosts, TRAMP-C3 grows readily in vitro but does not form tumors. The T antigen oncoprotein is not expressed by the cell lines in vitro or in vivo. The rationale for establishing multiple cell lines was to isolate cells representing various stages of cellular transformation and progression to androgen-independent metastatic disease that could be manipulated in vitro and, in combination with the TRAMP model, provide a system to investigate therapeutic interventions, such as immunotherapy prior to clinical trials. PMID:9269988

  5. Proteomic analysis of livers from a transgenic mouse line with activated polyamine catabolism.

    PubMed

    Cerrada-Gimenez, Marc; Häyrinen, Jukka; Juutinen, Sisko; Reponen, Tuula; Jänne, Juhani; Alhonen, Leena

    2010-02-01

    We have generated a transgenic mouse line that over expresses the rate-controlling enzyme of the polyamine catabolism, spermidine/spermine N (1)-acetyltransferase, under the control of a heavy metal inducible promoter. This line is characterized by a notable increase in SSAT activity in liver, pancreas and kidneys and a moderate increase in the rest of the tissues. SSAT induction results in an enhanced polyamine catabolism manifested as a depletion of spermidine and spermine and an overaccumulation of putrescine in all tissues. To study how the activation of polyamine catabolism affects other metabolic pathways, protein expression pattern of the livers of transgenic animals was analyzed by two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. A total of 23 proteins were shown to be differentially expressed in the transgenic from the wild-type animals. Many of the identified proteins showed expression patterns associated with polyamine catabolism activation. However, the expression pattern of other proteins, such as repression of GST pi and selenium-binding protein 2 and 60 kDa heat-shock protein, could be explained by the overexpression of peroxisome proliferator-activated receptor gamma co-activator 1alpha in response to depleted ATP pools. The activation of the latter proteins is thought to lead to the improved insulin sensitivity seen in the MT-SSAT animals.

  6. (E)-β-farnesene gene reduces Lipaphis erysimi colonization in transgenic Brassica juncea lines

    PubMed Central

    Verma, Shiv Shankar; Sinha, Rakesh Kumar; Jajoo, Anajna

    2015-01-01

    Aphids are the major concern that significantly reduces the yield of crops. (E)-β-farnesene (Eβf) is the principal component of the alarm pheromone of many aphids. The results of current research support the direct defense response of (E)-β-farnesene (Eβf) against aphid Lipaphis erysimi (L.) Kaltenbach in Brassica juncea. Eβf gene was isolated from Mentha arvensis and transformed into B. juncea, showed direct repellent against aphid colonization. The seasonal mean population (SMP) recorded under field condition showed significantly higher aphid colonization in wild type in comparison to most of the transgenic lines, and shows positive correlation with the repellency of transgenic plant expressing (E)-β-farnesene. The current research investigation provides direct evidence for aphid control in B. juncea using Eβf, a non-toxic mode of action. PMID:26251882

  7. Molecular biology of deregulated gene expression in transformed C3H/10T1/2 mouse embryo cell lines induced by specific insoluble carcinogenic nickel compounds.

    PubMed

    Landolph, Joseph R; Verma, Anuradha; Ramnath, Jamuna; Clemens, Farrah

    2002-10-01

    In the past, exposure of workers to mixtures of soluble and insoluble nickel compounds by inhalation during nickel refining correlated with increased incidences of lung and nasal cancers. Insoluble nickel subsulfide and nickel oxide (NiO) are carcinogenic in animals by inhalation; soluble nickel sulfate is not. Particles of insoluble nickel compounds were phagocytized by C3H/10T1/2 mouse embryo cells and induced morphological transformation in these cells with the following order of potency: NiO (black) > NiO (green) > nickel subsulfide. Foci induced by black/green NiO and nickel monosulfide developed into anchorage-independent transformed cell lines. Random arbitrarily primed-polymerase chain reaction mRNA differential display showed that nine c-DNA fragments are differentially expressed between nontransformed and nickel compound-transformed 10T1/2 cell lines in 6% of total mRNA; 130 genes would be differentially expressed in 100% of the mRNA. Fragment R3-2 was a sequence in the mouse calnexin gene, fragment R3-1 a portion of the Wdr1 gene, and fragment R2-4 a portion of the ect-2 protooncogene. These three genes were overexpressed in transformed cell lines. Fragment R1-2 was 90% homologous to a fragment of the DRIP/TRAP-80 (vitamin D receptor interacting protein/thyroid hormone receptor-activating protein 80) genes and was expressed in nontransformed but not in nickel-transformed cell lines. Specific insoluble carcinogenic nickel compounds are phagocytized into 10T1/2 cells and likely generate oxygen radicals, which would cause mutations in protooncogenes, and chromosome breakage, and mutations in tumor suppressor genes, inactivating them. These compounds also induce methylation of promoters of tumor suppressor genes, inactivating them. This could lead to permanent overexpresssion of the ect-2, calnexin, and Wdr1 genes and suppression of expression of the DRIP/TRAP-80 gene that we observed, which likely contribute to induction and maintenance of transformed

  8. Establishment of Gal4 transgenic zebrafish lines for analysis of development of cerebellar neural circuitry.

    PubMed

    Takeuchi, Miki; Matsuda, Koji; Yamaguchi, Shingo; Asakawa, Kazuhide; Miyasaka, Nobuhiko; Lal, Pradeep; Yoshihara, Yoshihiro; Koga, Akihiko; Kawakami, Koichi; Shimizu, Takashi; Hibi, Masahiko

    2015-01-01

    The cerebellum is involved in some forms of motor coordination and motor learning. Here we isolated transgenic (Tg) zebrafish lines that express a modified version of Gal4-VP16 (GFF) in the cerebellar neural circuits: granule, Purkinje, or eurydendroid cells, Bergmann glia, or the neurons in the inferior olive nuclei (IO) which send climbing fibers to Purkinje cells, with the transposon Tol2 system. By combining GFF lines with Tg lines carrying a reporter gene located downstream of Gal4 binding sequences (upstream activating sequence: UAS), we investigated the anatomy and developmental processes of the cerebellar neural circuitry. Combining an IO-specific Gal4 line with a UAS reporter line expressing the photoconvertible fluorescent protein Kaede demonstrated the contralateral projections of climbing fibers. Combining a granule cell-specific Gal4 line with a UAS reporter line expressing wheat germ agglutinin (WGA) confirmed direct and/or indirect connections of granule cells with Purkinje cells, eurydendroid cells, and IO neurons in zebrafish. Time-lapse analysis of a granule cell-specific Gal4 line revealed initial random movements and ventral migration of granule cell nuclei. Transgenesis of a reporter gene with another transposon Tol1 system visualized neuronal structure at a single cell resolution. Our findings indicate the usefulness of these zebrafish Gal4 Tg lines for studying the development and function of cerebellar neural circuits.

  9. Characterization of transgenic zebrafish lines that express GFP in the retina, pineal gland, olfactory bulb, hatching gland, and optic tectum.

    PubMed

    Fang, Wei; Bonaffini, Sarah; Zou, Jian; Wang, Xiaolei; Zhang, Cen; Tsujimura, Taro; Kawamura, Shoji; Wei, Xiangyun

    2013-01-01

    Transgenic animals are powerful tools to study gene function invivo. Here we characterize several transgenic zebrafish lines that express green fluorescent protein (GFP) under the control of the LCR(RH2)-RH2-1 or LCR(RH2)-RH2-2 green opsin regulatory elements. Using confocal immunomicroscopy, stereo-fluorescence microscopy, and Western blotting, we show that the Tg(LCR(RH2)-RH2-1:GFP)(pt112) and Tg(LCR(RH2)-RH2-2:GFP)(pt115) transgenic zebrafish lines express GFP in the pineal gland and certain types of photoreceptors. In addition, some of these lines also express GFP in the hatching gland, optic tectum, or olfactory bulb. Some of the expression patterns differ significantly from previously published similar transgenic fish lines, making them useful tools for studying the development of the corresponding tissues and organs. In addition, the variations of GFP expression among different lines corroborate the notion that transgenic expression is often subjected to position effect, thus emphasizing the need for careful verification of expression patterns when transgenic animal models are utilized for research.

  10. The LCK gene is involved in the t(1;7)(p34;q34) in the T-cell acute lymphoblastic leukemia derived cell line, HSB-2.

    PubMed

    Burnett, R C; David, J C; Harden, A M; Le Beau, M M; Rowley, J D; Diaz, M O

    1991-11-01

    HSB-2 is a cell line derived from a patient who had T-cell acute lymphoblastic leukemia (T-cell ALL) with a t(1;7)(p34;q34). We used a genomic probe from the T-cell receptor beta (TCR beta) locus (7q34) to identify DNA rearrangements in HSB-2. Two rearranged BglII DNA fragments were cloned, and one of these clones was shown to contain the translocation breakpoint on the derivative chromosome I [der(I)]. We used a probe derived from this clone to isolate an unrearranged phage clone encompassing the breakpoint at Ip34. The restriction map of this clone was compared to the published maps of known protooncogenes located at Ip32-34. By restriction mapping, Southern blot analysis, and DNA sequencing we showed that the translocation breakpoint on chromosome I is located within the first intron of the LCK gene. The LCK gene codes for p56lck, a member of the SRC family of cytoplasmic tyrosine protein kinases. There are two classes of LCK transcripts (type I and type II), each expressed from a distinct promoter, and each having a unique 5' untranslated region (UTR); the protein coding regions of the two classes are identical. The breakpoint in the t(1;7) separates the two LCK promoters and juxtaposes the constant region of the TCR beta locus with the proximal promoter and with the protein-coding region of the LCK gene on the der(I) chromosome.

  11. Evaluating Tissue-Specific Recombination in a Pdgfrα-CreERT2 Transgenic Mouse Line.

    PubMed

    O'Rourke, Megan; Cullen, Carlie L; Auderset, Loic; Pitman, Kimberley A; Achatz, Daniela; Gasperini, Robert; Young, Kaylene M

    2016-01-01

    In the central nervous system (CNS) platelet derived growth factor receptor alpha (PDGFRα) is expressed exclusively by oligodendrocyte progenitor cells (OPCs), making the Pdgfrα promoter an ideal tool for directing transgene expression in this cell type. Two Pdgfrα-CreERT2 mouse lines have been generated for this purpose which, when crossed with cre-sensitive reporter mice, allow the temporally restricted labelling of OPCs for lineage-tracing studies. These mice have also been used to achieve the deletion of CNS-specific genes from OPCs. However the ability of Pdgfrα-CreERT2 mice to induce cre-mediated recombination in PDGFRα+ cell populations located outside of the CNS has not been examined. Herein we quantify the proportion of PDGFRα+ cells that become YFP-labelled following Tamoxifen administration to adult Pdgfrα-CreERT2::Rosa26-YFP transgenic mice. We report that the vast majority (>90%) of PDGFRα+ OPCs in the CNS, and a significant proportion of PDGFRα+ stromal cells within the bone marrow (~38%) undergo recombination and become YFP-labelled. However, only a small proportion of the PDGFRα+ cell populations found in the sciatic nerve, adrenal gland, pituitary gland, heart, gastrocnemius muscle, kidney, lung, liver or intestine become YFP-labelled. These data suggest that Pdgfrα-CreERT2 transgenic mice can be used to achieve robust recombination in OPCs, while having a minimal effect on most PDGFRα+ cell populations outside of the CNS. PMID:27626928

  12. Evaluating Tissue-Specific Recombination in a Pdgfrα-CreERT2 Transgenic Mouse Line

    PubMed Central

    O’Rourke, Megan; Cullen, Carlie L.; Auderset, Loic; Pitman, Kimberley A.; Achatz, Daniela; Gasperini, Robert; Young, Kaylene M.

    2016-01-01

    In the central nervous system (CNS) platelet derived growth factor receptor alpha (PDGFRα) is expressed exclusively by oligodendrocyte progenitor cells (OPCs), making the Pdgfrα promoter an ideal tool for directing transgene expression in this cell type. Two Pdgfrα-CreERT2 mouse lines have been generated for this purpose which, when crossed with cre-sensitive reporter mice, allow the temporally restricted labelling of OPCs for lineage-tracing studies. These mice have also been used to achieve the deletion of CNS-specific genes from OPCs. However the ability of Pdgfrα-CreERT2 mice to induce cre-mediated recombination in PDGFRα+ cell populations located outside of the CNS has not been examined. Herein we quantify the proportion of PDGFRα+ cells that become YFP-labelled following Tamoxifen administration to adult Pdgfrα-CreERT2::Rosa26-YFP transgenic mice. We report that the vast majority (>90%) of PDGFRα+ OPCs in the CNS, and a significant proportion of PDGFRα+ stromal cells within the bone marrow (~38%) undergo recombination and become YFP-labelled. However, only a small proportion of the PDGFRα+ cell populations found in the sciatic nerve, adrenal gland, pituitary gland, heart, gastrocnemius muscle, kidney, lung, liver or intestine become YFP-labelled. These data suggest that Pdgfrα-CreERT2 transgenic mice can be used to achieve robust recombination in OPCs, while having a minimal effect on most PDGFRα+ cell populations outside of the CNS. PMID:27626928

  13. Transgenic rose lines harboring an antimicrobial protein gene, Ace-AMP1, demonstrate enhanced resistance to powdery mildew ( Sphaerotheca pannosa).

    PubMed

    Li, Xiangqian; Gasic, Ksenjia; Cammue, Bruno; Broekaert, Willem; Korban, Schuyler S

    2003-12-01

    An antimicrobial protein gene, Ace-AMP1, was introduced into Rosa hybrida cv. Carefree Beauty via Agrobacterium-mediated transformation. A total of 500 putative transgenic plants were obtained from 100 primary embryogenic calli co-cultivated with A. tumefaciens following selection on a regeneration medium containing 100 mg/l kanamycin. Polymerase chain reaction analysis of these putative transgenic lines, using primers for both Ace-AMP1 and neomycin phosphotransferase ( npt II) genes, showed that 62% of these plants were positive for both transgenes. These lines were further confirmed for stable integration of Ace-AMP1 and npt II genes by Southern blotting. Transcription of the Ace-AMP1 transgene in various transgenic rose lines was determined using Northern blotting. Transgenic rose lines inoculated with conidial spores of Sphaerotheca pannosa (Wallr.: Fr.) Lev. var. rosae showed enhanced resistance to powdery mildew using both a detached-leaf assay and an in vivo greenhouse whole-plant assay. PMID:14508687

  14. Enhancement of tolerance to soft rot disease in the transgenic Chinese cabbage (Brassica rapa L. ssp. pekinensis) inbred line, Kenshin.

    PubMed

    Vanjildorj, Enkhchimeg; Song, Seo Young; Yang, Zhi Hong; Choi, Jae Eul; Noh, Yoo Sun; Park, Suhyoung; Lim, Woo Jin; Cho, Kye Man; Yun, Han Dae; Lim, Yong Pyo

    2009-10-01

    We developed a transgenic Chinese cabbage (Brassica rapa L. ssp. pekinensis) inbred line, Kenshin, with high tolerance to soft rot disease. Tolerance was conferred by expression of N-acyl-homoserine lactonase (AHL-lactonase) in Chinese cabbage through an efficient Agrobacterium-mediated transformation method. To synthesize and express the AHL-lactonase in Chinese cabbage, the plant was transformed with the aii gene (AHL-lactonase gene from Bacillus sp. GH02) fused to the PinII signal peptide (protease inhibitor II from potato). Five transgenic lines were selected by growth on hygromycin-containing medium (3.7% transformation efficiency). Southern blot analysis showed that the transgene was stably integrated into the genome. Among these five transgenic lines, single copy number integrations were observed in four lines and a double copy number integration was observed in one transgenic line. Northern blot analysis confirmed that pinIISP-aii fusion gene was expressed in all the transgenic lines. Soft rot disease tolerance was evaluated at tissue and seedling stage. Transgenic plants showed a significantly enhanced tolerance (2-3-fold) to soft rot disease compared to wild-type plants. Thus, expression of the fusion gene pinIISP-aii reduces susceptibility to soft rot disease in Chinese cabbage. We conclude that the recombinant AHL-lactonase, encoded by aii, can effectively quench bacterial quorum-sensing and prevent bacterial population density-dependent infections. To the best of our knowledge, the present study is the first to demonstrate the transformation of Chinese cabbage inbred line Kenshin, and the first to describe the effect of the fusion gene pinIISP-aii on enhancement of soft rot disease tolerance.

  15. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies.

    PubMed

    Marquart, Gregory D; Tabor, Kathryn M; Brown, Mary; Strykowski, Jennifer L; Varshney, Gaurav K; LaFave, Matthew C; Mueller, Thomas; Burgess, Shawn M; Higashijima, Shin-Ichi; Burgess, Harold A

    2015-01-01

    Transgenic methods enable the selective manipulation of neurons for functional mapping of neuronal circuits. Using confocal microscopy, we have imaged the cellular-level expression of 109 transgenic lines in live 6 day post fertilization larvae, including 80 Gal4 enhancer trap lines, 9 Cre enhancer trap lines and 20 transgenic lines that express fluorescent proteins in defined gene-specific patterns. Image stacks were acquired at single micron resolution, together with a broadly expressed neural marker, which we used to align enhancer trap reporter patterns into a common 3-dimensional reference space. To facilitate use of this resource, we have written software that enables searching for transgenic lines that label cells within a selectable 3-dimensional region of interest (ROI) or neuroanatomical area. This software also enables the intersectional expression of transgenes to be predicted, a feature which we validated by detecting cells with co-expression of Cre and Gal4. Many of the imaged enhancer trap lines show intrinsic brain-specific expression. However, to increase the utility of lines that also drive expression in non-neuronal tissue we have designed a novel UAS reporter, that suppresses expression in heart, muscle, and skin through the incorporation of microRNA binding sites in a synthetic 3' untranslated region. Finally, we mapped the site of transgene integration, thus providing molecular identification of the expression pattern for most lines. Cumulatively, this library of enhancer trap lines provides genetic access to 70% of the larval brain and is therefore a powerful and broadly accessible tool for the dissection of neural circuits in larval zebrafish.

  16. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies

    PubMed Central

    Marquart, Gregory D.; Tabor, Kathryn M.; Brown, Mary; Strykowski, Jennifer L.; Varshney, Gaurav K.; LaFave, Matthew C.; Mueller, Thomas; Burgess, Shawn M.; Higashijima, Shin-ichi; Burgess, Harold A.

    2015-01-01

    Transgenic methods enable the selective manipulation of neurons for functional mapping of neuronal circuits. Using confocal microscopy, we have imaged the cellular-level expression of 109 transgenic lines in live 6 day post fertilization larvae, including 80 Gal4 enhancer trap lines, 9 Cre enhancer trap lines and 20 transgenic lines that express fluorescent proteins in defined gene-specific patterns. Image stacks were acquired at single micron resolution, together with a broadly expressed neural marker, which we used to align enhancer trap reporter patterns into a common 3-dimensional reference space. To facilitate use of this resource, we have written software that enables searching for transgenic lines that label cells within a selectable 3-dimensional region of interest (ROI) or neuroanatomical area. This software also enables the intersectional expression of transgenes to be predicted, a feature which we validated by detecting cells with co-expression of Cre and Gal4. Many of the imaged enhancer trap lines show intrinsic brain-specific expression. However, to increase the utility of lines that also drive expression in non-neuronal tissue we have designed a novel UAS reporter, that suppresses expression in heart, muscle, and skin through the incorporation of microRNA binding sites in a synthetic 3′ untranslated region. Finally, we mapped the site of transgene integration, thus providing molecular identification of the expression pattern for most lines. Cumulatively, this library of enhancer trap lines provides genetic access to 70% of the larval brain and is therefore a powerful and broadly accessible tool for the dissection of neural circuits in larval zebrafish. PMID:26635538

  17. A novel transgenic line of mice exhibiting autosomal recessive male-specific lethality and non-alcoholic fatty liver disease.

    PubMed

    Sollars, Vincent E; McEntee, Benjamin J; Engiles, Julie B; Rothstein, Jay L; Buchberg, Arthur M

    2002-10-15

    We have isolated a Meis1a transgenic mouse line exhibiting recessive male-specific lethality and non-alcoholic fatty liver disease (NAFLD), which coincides with pubescence and is androgen-dependent. The phenotype is due to disruption of an endogenous locus, since other Meis1a transgenic lines do not exhibit these phenotypes. Necropsy analysis revealed hepatic microvesicular steatosis in pubescent male homozygous mice, which is absent in transgenic females. The transgene insertion site was localized to chromosome 1 and further refined by cloning the flanking regions. Sequence analysis shows that the integration site disrupts a putative metallo-beta-lactamase gene with a 21.3 kb deletion encompassing exons 5-7.

  18. Relationship between expression of epidermal growth factor and simian virus 40 T antigen in a line of transgenic mice.

    PubMed

    Lafond, R E; Giammalvo, J T; Norkin, L C

    1995-09-01

    The pattern of expression of the simian virus 40 (SV40) T antigen gene and resultant dysplasia were re-examined in a line of transgenic mice in which the T antigen gene was under the control of the SV40 early promoter. We found that T antigen expression in the kidney, and resulting dysplastic lesions, occurred exclusively in the distal convoluted tubules and the ascending limbs of Henle. Epidermal growth factor (EGF) expression in the kidney of normal mice was similarly immunolocalized. The correlation between high EGF immunoreactivity in normal mouse tissues and T antigen expression in the transgenic counterpart was also seen in the choroid plexus epithelium and in the submandibular glands of male mice. T antigen was not found in the submandibular gland of transgenic females. Similarly, EGF was only rarely detected in the normal female submandibular gland. In contrast to the correlation between T antigen expression in the transgenic mice and EGF expression in the corresponding tissues of the normal mice, within the dysplastic lesions of the transgenic mice EGF expression was severely diminished. Adenocarcinomas of the male submandibular gland from another line of transgenic mice that expresses the Int-1 transgene, showed similarly reduced levels of immunostaining for EGF. Thus, reduced expression of EGF might be a general feature of dysplasia and tumorigenesis in those tissues that normally express EGF.

  19. A Transgenic Mouse Line Expressing the Red Fluorescent Protein tdTomato in GABAergic Neurons

    PubMed Central

    Besser, Stefanie; Sicker, Marit; Marx, Grit; Winkler, Ulrike; Eulenburg, Volker; Hülsmann, Swen; Hirrlinger, Johannes

    2015-01-01

    GABAergic inhibitory neurons are a large population of neurons in the central nervous system (CNS) of mammals and crucially contribute to the function of the circuitry of the brain. To identify specific cell types and investigate their functions labelling of cell populations by transgenic expression of fluorescent proteins is a powerful approach. While a number of mouse lines expressing the green fluorescent protein (GFP) in different subpopulations of GABAergic cells are available, GFP expressing mouse lines are not suitable for either crossbreeding to other mouse lines expressing GFP in other cell types or for Ca2+-imaging using the superior green Ca2+-indicator dyes. Therefore, we have generated a novel transgenic mouse line expressing the red fluorescent protein tdTomato in GABAergic neurons using a bacterial artificial chromosome based strategy and inserting the tdTomato open reading frame at the start codon within exon 1 of the GAD2 gene encoding glutamic acid decarboxylase 65 (GAD65). TdTomato expression was observed in all expected brain regions; however, the fluorescence intensity was highest in the olfactory bulb and the striatum. Robust expression was also observed in cortical and hippocampal neurons, Purkinje cells in the cerebellum, amacrine cells in the retina as well as in cells migrating along the rostral migratory stream. In cortex, hippocampus, olfactory bulb and brainstem, 80% to 90% of neurons expressing endogenous GAD65 also expressed the fluorescent protein. Moreover, almost all tdTomato-expressing cells coexpressed GAD65, indicating that indeed only GABAergic neurons are labelled by tdTomato expression. This mouse line with its unique spectral properties for labelling GABAergic neurons will therefore be a valuable new tool for research addressing this fascinating cell type. PMID:26076353

  20. Transgenic mouse lines for non-invasive ratiometric monitoring of intracellular chloride

    PubMed Central

    Batti, Laura; Mukhtarov, Marat; Audero, Enrica; Ivanov, Anton; Paolicelli, Rosa Chiara; Zurborg, Sandra; Gross, Cornelius; Bregestovski, Piotr; Heppenstall, Paul A.

    2013-01-01

    Chloride is the most abundant physiological anion and participates in a variety of cellular processes including trans-epithelial transport, cell volume regulation, and regulation of electrical excitability. The development of tools to monitor intracellular chloride concentration ([Cli]) is therefore important for the evaluation of cellular function in normal and pathological conditions. Recently, several Cl-sensitive genetically encoded probes have been described which allow for non-invasive monitoring of [Cli]. Here we describe two mouse lines expressing a CFP-YFP-based Cl probe called Cl-Sensor. First, we generated transgenic mice expressing Cl-Sensor under the control of the mouse Thy1 mini promoter. Cl-Sensor exhibited good expression from postnatal day two (P2) in neurons of the hippocampus and cortex, and its level increased strongly during development. Using simultaneous whole-cell monitoring of ionic currents and Cl-dependent fluorescence, we determined that the apparent EC50 for Cli was 46 mM, indicating that this line is appropriate for measuring neuronal [Cli] in postnatal mice. We also describe a transgenic mouse reporter line for Cre-dependent conditional expression of Cl-Sensor, which was targeted to the Rosa26 locus and by incorporating a strong exogenous promoter induced robust expression upon Cre-mediated recombination. We demonstrate high levels of tissue-specific expression in two different Cre-driver lines targeting cells of the myeloid lineage and peripheral sensory neurons. Using these mice the apparent EC50 for Cli was estimated to be 61 and 54 mM in macrophages and DRG, respectively. Our data suggest that these mouse lines will be useful models for ratiometric monitoring of Cli in specific cell types in vivo. PMID:23734096

  1. A Transgenic Mouse Line Expressing the Red Fluorescent Protein tdTomato in GABAergic Neurons.

    PubMed

    Besser, Stefanie; Sicker, Marit; Marx, Grit; Winkler, Ulrike; Eulenburg, Volker; Hülsmann, Swen; Hirrlinger, Johannes

    2015-01-01

    GABAergic inhibitory neurons are a large population of neurons in the central nervous system (CNS) of mammals and crucially contribute to the function of the circuitry of the brain. To identify specific cell types and investigate their functions labelling of cell populations by transgenic expression of fluorescent proteins is a powerful approach. While a number of mouse lines expressing the green fluorescent protein (GFP) in different subpopulations of GABAergic cells are available, GFP expressing mouse lines are not suitable for either crossbreeding to other mouse lines expressing GFP in other cell types or for Ca2+-imaging using the superior green Ca2+-indicator dyes. Therefore, we have generated a novel transgenic mouse line expressing the red fluorescent protein tdTomato in GABAergic neurons using a bacterial artificial chromosome based strategy and inserting the tdTomato open reading frame at the start codon within exon 1 of the GAD2 gene encoding glutamic acid decarboxylase 65 (GAD65). TdTomato expression was observed in all expected brain regions; however, the fluorescence intensity was highest in the olfactory bulb and the striatum. Robust expression was also observed in cortical and hippocampal neurons, Purkinje cells in the cerebellum, amacrine cells in the retina as well as in cells migrating along the rostral migratory stream. In cortex, hippocampus, olfactory bulb and brainstem, 80% to 90% of neurons expressing endogenous GAD65 also expressed the fluorescent protein. Moreover, almost all tdTomato-expressing cells coexpressed GAD65, indicating that indeed only GABAergic neurons are labelled by tdTomato expression. This mouse line with its unique spectral properties for labelling GABAergic neurons will therefore be a valuable new tool for research addressing this fascinating cell type. PMID:26076353

  2. Quantitative proteomic analysis of wheat grain proteins reveals differential effects of silencing of omega-5 gliadin genes in transgenic lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel wheat lines with altered flour compositions can be used to decipher the roles of specific gluten proteins in flour quality. Grain proteins from transgenic wheat lines in which genes encoding the omega-5 gliadins were silenced by RNA interference (RNAi) were analyzed in detail by quantitative 2...

  3. Transgene expression and silencing in a tick cell line: A model system for functional tick genomics.

    PubMed

    Kurtti, Timothy J; Mattila, Joshua T; Herron, Michael J; Felsheim, Roderick F; Baldridge, Gerald D; Burkhardt, Nicole Y; Blazar, Bruce R; Hackett, Perry B; Meyer, Jason M; Munderloh, Ulrike G

    2008-10-01

    The genome project of the black legged tick, Ixodes scapularis, provides sequence data for testing gene function and regulation in this important pathogen vector. We tested Sleeping Beauty (SB), a Tc1/mariner group transposable element, and cationic lipid-based transfection reagents for delivery and genomic integration of transgenes into I. scapularis cell line ISE6. Plasmid DNA and dsRNA were effectively transfected into ISE6 cells and they were successfully transformed to express a red fluorescent protein (DsRed2) and a selectable marker, neomycin phosphotransferase (NEO). Frequency of transformation was estimated as 1 transformant per 5000-10,000 cells and cultures were incubated for 2-3 months in medium containing the neomycin analog G418 in order to isolate transformants. Genomic integration of the DsRed2 transgene was confirmed by inverse PCR and sequencing that demonstrated a TA nucleotide pair inserted between SB inverted/direct repeat sequences and tick genomic sequences, indicating that insertion of the DsRed2 gene into the tick cell genome occurred through the activity of SB transposase. RNAi using dsRNA transcribed from the DsRed2 gene silenced expression of red fluorescent protein in transformed ISE6 cells. SB transposition in cell line ISE6 provides an effective means to explore the functional genomics of I. scapularis. PMID:18722527

  4. The transposition frequency of Tag1 elements is increased in transgenic Arabidopsis lines.

    PubMed Central

    Bhatt, A M; Lister, C; Crawford, N; Dean, C

    1998-01-01

    Tag1 was identified as a highly active endogenous transposable element in transgenic Arabidopsis thaliana Landsberg erecta plants carrying the maize transposable element Activator (Ac). Here, we describe experiments designed to determine the basis for the high activity of Tag1. The frequency of transposition of Tag1 elements was compared in lines containing or lacking Ac transposase to assess the effect of Ac transposase on Tag1 activity. Three populations of nontransgenic plants, including nontransformed regenerants, were also analyzed. The high level of activity of Tag1 did not correlate with the presence or absence of Ac transposase but was significantly higher in transgenic lines. This result was maintained through at least six generations after transformation. These data suggest that Tag1 transposition is stimulated by processes that occur during the Agrobacterium transformation and that thereafter remain active. Two Tag1 elements are tightly linked in the Landsberg erecta genome and map to the lower arm of chromosome 1. Tag1 elements were found in only a few A. thaliana ecotypes but were present in four other Arabidopsis species. PMID:9501115

  5. Construction and characterization of a sox9b transgenic reporter line.

    PubMed

    Plavicki, Jessica S; Baker, Tracie R; Burns, Felipe R; Xiong, Kong M; Gooding, Alex J; Hofsteen, Peter; Peterson, Richard E; Heideman, Warren

    2014-01-01

    The transcription factor SOX9 is a member of the SRY-related high-mobility-group box (SOX) superfamily of genes. In mammals, Sox9 plays important roles in many developmental processes including craniofacial, skeletal and heart morphogenesis, retinal and brain development, and gonad differentiation. Human mutations in SOX9 or the SOX9 promoter result in campomelic dysplasia, a severe genetic disorder, which disrupts skeletal, craniofacial, cardiac, neural and reproductive development. Due to the duplication of the teleost fish genome, zebrafish (Danio rerio) have two Sox9 genes: sox9a and sox9b. Loss of sox9b in zebrafish results in loss of function phenotypes that are similar to those observed in humans and mice. In order to generate a transgenic sox9b:EGFP reporter line, we cloned a 2450 bp fragment of the sox9b promoter and fused it to an EGFP reporter. Consistent with reported sox9b expression and function, we observed sox9b:EGFP in the developing heart, skeletal and craniofacial structures, brain, retina, and ovaries. Our resulting transgenic line is a useful tool for identifying and studying sox9b function in development and visualizing a number of zebrafish organs and tissues in which sox9b is normally expressed. PMID:25896205

  6. An Improved BAC Transgenic Fluorescent Reporter Line for Sensitive and Specific Identification of Striatonigral Medium Spiny Neurons

    PubMed Central

    Ade, Kristen K.; Wan, Yehong; Chen, Meng; Gloss, Bernd; Calakos, Nicole

    2011-01-01

    The development of BAC transgenic mice expressing promoter-specific fluorescent reporter proteins has been a great asset for neuroscience by enabling detection of neuronal subsets in live tissue. For the study of basal ganglia physiology, reporters driven by type 1 and 2 dopamine receptors have been particularly useful for distinguishing the two classes of striatal projection neurons – striatonigral and striatopallidal. However, emerging evidence suggests that some of the transgenic reporter lines may have suboptimal features. The ideal transgenic reporter line should (1) express a reporter with high sensitivity and specificity for detecting the cellular subset of interest and that does not otherwise alter the biology of the cells in which it is expressed, and (2) involve a genetic manipulation that does not cause any additional genetic effects other than expression of the reporter. Here we introduce a new BAC transgenic reporter line, Drd1a-tdTomato line 6, with features that approximate these ideals, offering substantial benefits over existing lines. In this study, we investigate the integrity of dopamine-sensitive behaviors and test the sensitivity and specificity of tdTomato fluorescence for identifying striatonigral projection neurons in mice. Behaviorally, hemizygous Drd1a-tdTomato line 6 mice are similar to littermate controls; while hemizygous Drd2-EGFP mice are not. In characterizing the sensitivity and specificity of line 6 mice, we find that both are high. The results of this characterization indicate that line 6 Drd1a-tdTomato+/− mice offer a useful alternative approach to identify both striatonigral and striatopallidal neurons in a single transgenic line with a high degree of accuracy. PMID:21713123

  7. Beneficial ‘unintended effects’ of a cereal cystatin in transgenic lines of potato, Solanum tuberosum

    PubMed Central

    2012-01-01

    Background Studies reported unintended pleiotropic effects for a number of pesticidal proteins ectopically expressed in transgenic crops, but the nature and significance of such effects in planta remain poorly understood. Here we assessed the effects of corn cystatin II (CCII), a potent inhibitor of C1A cysteine (Cys) proteases considered for insect and pathogen control, on the leaf proteome and pathogen resistance status of potato lines constitutively expressing this protein. Results The leaf proteome of lines accumulating CCII at different levels was resolved by 2-dimensional gel electrophoresis and compared with the leaf proteome of a control (parental) line. Out of ca. 700 proteins monitored on 2-D gels, 23 were significantly up- or downregulated in CCII-expressing leaves, including 14 proteins detected de novo or up-regulated by more than five-fold compared to the control. Most up-regulated proteins were abiotic or biotic stress-responsive proteins, including different secretory peroxidases, wound inducible protease inhibitors and pathogenesis-related proteins. Accordingly, infection of leaf tissues by the fungal necrotroph Botryris cinerea was prevented in CCII-expressing plants, despite a null impact of CCII on growth of this pathogen and the absence of extracellular Cys protease targets for the inhibitor. Conclusions These data point to the onset of pleiotropic effects altering the leaf proteome in transgenic plants expressing recombinant protease inhibitors. They also show the potential of these proteins as ectopic modulators of stress responses in planta, useful to engineer biotic or abiotic stress tolerance in crop plants of economic significance. PMID:23116303

  8. Phototropism and gravitropism in transgenic lines of Arabidopsis altered in the phytochrome pathway.

    PubMed

    Hopkins, Jane A; Kiss, John Z

    2012-07-01

    Phytochromes are a family of photoreceptor molecules, absorbing primarily in red and far-red, that are important in many aspects of plant development. These studies investigated the role of phytochromes in phototropism and gravitropism of seedlings of Arabidopsis thaliana. We used two transgenic lines, one which lacked phytochromes specifically in the roots (M0062/UASBVR) and the other lacked phytochromes in the shoots (CAB3::pBVR). These transgenic plants are deficient in the phytochrome chromophore in specific tissues due the expression of biliverdin IXa reductase (BVR), which binds to precursors of the chromophore. Experiments were performed in both light and dark conditions to determine whether roots directly perceive light signals or if the signal is perceived in the shoot and then transmitted to the root during tropistic curvature. Kinetics of tropisms and growth were assayed by standard methods or with a computer-based feedback system. We found that the perception of red light occurs directly in the root during phototropism in this organ and that signaling also may occur from root to shoot in gravitropism.

  9. Putrescine accumulation in Arabidopsis thaliana transgenic lines enhances tolerance to dehydration and freezing stress

    PubMed Central

    Alet, Analía I; Sanchez, Diego H; Cuevas, Juan C; del Valle, Secundino; Altabella, Teresa; Tiburcio, Antonio F; Marco, Francisco; Ferrando, Alejandro; Espasandín, Fabiana D; González, María E; Carrasco, Pedro

    2011-01-01

    Polyamines have been globally associated to plant responses to abiotic stress. Particularly, putrescine has been related to a better response to cold and dehydration stresses. It is known that this polyamine is involved in cold tolerance, since Arabidopsis thaliana plants mutated in the key enzyme responsible for putrescine synthesis (arginine decarboxilase, ADC; EC 4.1.1.19) are more sensitive than the wild type to this stress. Although it is speculated that the overexpression of ADC genes may confer tolerance, this is hampered by pleiotropic effects arising from the constitutive expression of enzymes from the polyamine metabolism. Here, we present our work using A. thaliana transgenic plants harboring the ADC gene from oat under the control of a stress-inducible promoter (pRD29A) instead of a constitutive promoter. The transgenic lines presented in this work were more resistant to both cold and dehydration stresses, associated with a concomitant increment in endogenous putrescine levels under stress. Furthermore, the increment in putrescine upon cold treatment correlates with the induction of known stress-responsive genes, and suggests that putrescine may be directly or indirectly involved in ABA metabolism and gene expression. PMID:21330789

  10. Fasudil hydrochloride induces osteoblastic differentiation of stromal cell lines, C3H10T1/2 and ST2, via bone morphogenetic protein-2 expression.

    PubMed

    Kanazawa, Ippei; Yamaguchi, Toru; Yano, Shozo; Yamauchi, Mika; Sugimoto, Toshitsugu

    2010-01-01

    Rho-kinase (ROK), downstream of the mevalonate pathway, is detrimental to vessels, and suppressing its activity is a target for the treatment of human disease such as coronary artery disease and pulmonary hypertension. Recent studies have shown that ROK has a crucial role in bone metabolism. However, the role of ROK in stromal cells is still unclear. The present study was undertaken to investigate the effect of a ROK inhibitor, fasudil hydrochloride, on stromal cell lines, C3H10T1/2 and ST2. In both cells, Fasudil significantly stimulated alkaline phosphatase activity and enhanced cell mineralization. Moreover, fasudil significantly increased the mRNA expression of collagen-I, osteocalcin, and bone morphogenetic protein-2 (BMP-2). Supplementation of noggin, a BMP-2 antagonist, significantly reversed the fasudil-induced collagen-I and osteocalcin mRNA expression in both cells. These findings suggest that fasudil induces the osteoblastic differentiation of stromal cells via enhancing BMP-2 expression, and that this drug might be beneficial for not only atherosclerosis but also osteoporosis by promoting bone formation. PMID:20154408

  11. Successful derivation of EGFP-transgenic embryonic stem cell line from a genetically non-permissive FVB/N mouse

    PubMed Central

    Singh, Gurbind; Totiger, Tulasigeri M; Seshagiri, Polani B

    2012-01-01

    Derivation of embryonic stem (ES)-cell lines from genetically non-permissive mouse strains, such as FVB/N, has been difficult, despite this strain offering advantages for mouse transgenesis for developmental studies. We earlier generated β-actin promoter-driven enhanced green fluorescent protein (EGFP)-transgenic FVB/N mice, expressing EGFP in all cells. Here, by optimizing culture system and using RESGROTM ES-cell culture medium, we successfully derived EGFP-transgenic ES-cell line, ‘GS-2’ line, from F1 hybrid blastocysts, from wild-type 129/SvJ female X EGFP-transgenic homozygous FVB/N male. The GS-2 ES-cell line exhibited all defining criteria of a typical ES-cell line, including normal colony morphology and karyotype (40,XY), high replication-expansion efficiency (passages: >100), expression of pluripotent markers (Oct-4, Nanog, Sox-2, SSEA-1 and others) and, embryoid body (EB) development and EB differentiation to ecto-/meso-/endo-dermal cell types, expressing nestin, BMP-4 and α-fetoprotein, respectively. GS-2 ES-cells formed (i) teratoma containing three germ lineage-derived cell types, (ii) chimeric blastocysts and fetuses, following their aggregation with wild-type 8-cell embryos, (iii) functional cardiac clusters and (iv) predominantly neural cell types when EBs were developed in KOSR-supplemented medium. Taken together, we derived a robust EGFP-transgenic GS-2 ES-cell line, from a non-permissive transgenic (FVB/N) mouse by a single cross to 129/SvJ wild-type mouse. The GS-2 ES-cell line exhibited full differentiation potential, in vitro/in vivo, providing enormous opportunity for stem cell research, including experimental cell transplantation studies. PMID:23671805

  12. Establishment of oct4:gfp transgenic zebrafish line for monitoring cellular multipotency by GFP fluorescence.

    PubMed

    Kato, Hiroyuki; Abe, Kota; Yokota, Shinpei; Matsuno, Rinta; Mikekado, Tsuyoshi; Yokoi, Hayato; Suzuki, Tohru

    2015-01-01

    The establishment of induced pluripotent stem (iPS) cell technology in fish could facilitate the establishment of novel cryopreservation techniques for storing selected aquaculture strains as frozen cells. In order to apply iPS cell technology to fish, we established a transgenic zebrafish line, Tg(Tru.oct4:EGFP), using green fluorescent protein (GFP) expression under the control of the oct4 gene promoter as a marker to evaluate multipotency in iPS cell preparations. We used the oct4 promoter from fugu (Takifugu rubripes) due to the compact nature of the fugu genome and to facilitate future applications of this technology in marine fishes. During embryogenesis, maternal GFP fluorescence was observed at the cleavage stage and zygotic GFP expression was observed from the start of the shield stage until approximately 24 h after fertilization. gfp messenger RNA (mRNA) was expressed by whole embryonic cells at the shield stage, and then restricted to the caudal neural tube in the latter stages of embryogenesis. These observations showed that GFP fluorescence and the regulation of gfp mRNA expression by the exogenous fugu oct4 promoter are well suited for monitoring endogenous oct4 mRNA expression in embryos. Bisulfite sequencing revealed that the rate of CpG methylation in the transgenic oct4 promoter was high in adult cells (98%) and low in embryonic cells (37%). These findings suggest that, as with the endogenous oct4 promoter, demethylation and methylation both take place normally in the transgenic oct4 promoter during embryogenesis. The embryonic cells harvested at the shield stage formed embryonic body-like cellular aggregates and maintained GFP fluorescence for 6 d when cultured on Transwell-COL Permeable Supports or a feeder layer of adult fin cells. Loss of GFP fluorescence by cultured cells was correlated with cellular differentiation. We consider that the Tg(Tru.oct4:EGFP) zebrafish line established here is well suited for monitoring multipotency in

  13. Establishment of oct4:gfp transgenic zebrafish line for monitoring cellular multipotency by GFP fluorescence.

    PubMed

    Kato, Hiroyuki; Abe, Kota; Yokota, Shinpei; Matsuno, Rinta; Mikekado, Tsuyoshi; Yokoi, Hayato; Suzuki, Tohru

    2015-01-01

    The establishment of induced pluripotent stem (iPS) cell technology in fish could facilitate the establishment of novel cryopreservation techniques for storing selected aquaculture strains as frozen cells. In order to apply iPS cell technology to fish, we established a transgenic zebrafish line, Tg(Tru.oct4:EGFP), using green fluorescent protein (GFP) expression under the control of the oct4 gene promoter as a marker to evaluate multipotency in iPS cell preparations. We used the oct4 promoter from fugu (Takifugu rubripes) due to the compact nature of the fugu genome and to facilitate future applications of this technology in marine fishes. During embryogenesis, maternal GFP fluorescence was observed at the cleavage stage and zygotic GFP expression was observed from the start of the shield stage until approximately 24 h after fertilization. gfp messenger RNA (mRNA) was expressed by whole embryonic cells at the shield stage, and then restricted to the caudal neural tube in the latter stages of embryogenesis. These observations showed that GFP fluorescence and the regulation of gfp mRNA expression by the exogenous fugu oct4 promoter are well suited for monitoring endogenous oct4 mRNA expression in embryos. Bisulfite sequencing revealed that the rate of CpG methylation in the transgenic oct4 promoter was high in adult cells (98%) and low in embryonic cells (37%). These findings suggest that, as with the endogenous oct4 promoter, demethylation and methylation both take place normally in the transgenic oct4 promoter during embryogenesis. The embryonic cells harvested at the shield stage formed embryonic body-like cellular aggregates and maintained GFP fluorescence for 6 d when cultured on Transwell-COL Permeable Supports or a feeder layer of adult fin cells. Loss of GFP fluorescence by cultured cells was correlated with cellular differentiation. We consider that the Tg(Tru.oct4:EGFP) zebrafish line established here is well suited for monitoring multipotency in

  14. Characterization of trans-immortalized hepatic cell lines established from transgenic mice.

    PubMed

    Perraud, F; Dalemans, W; Gendrault, J L; Dreyer, D; Ali-Hadji, D; Faure, T; Pavirani, A

    1991-07-01

    Hepato-specific regulatory (promoter/enhancer) DNA sequences were used for targeting the expression of onc genes, such as murine c-myc and Simian Virus 40 T Antigen, to hepatocytes of transgenic mice which subsequently developed hepatocellular carcinomas after a variable period of time (depending on the type of onc gene employed). Several trans-immortalized cell lines were established and compared with respect to the expression of adult hepatic markers and response to growth factors. Despite the morphological differences observed between trans-hepatomas, owing to the expression of the two different onc genes, all tumor-derived cell lines behaved in a comparable fashion during long-term culture displaying an adult hepatic phenotype for at least 40 passages. They differed, however, in response to epidermal growth factor. When the gene coding for human alpha 1-antitrypsin was placed under the control of the same hepato-specific promoter/enhancer, high levels of the human recombinant protein could be harvested from the supernatants of trans-hepatoma-derived cell lines. PMID:1711473

  15. CRISPR/Cas9-mediated conversion of eGFP- into Gal4-transgenic lines in zebrafish.

    PubMed

    Auer, Thomas O; Duroure, Karine; Concordet, Jean-Paul; Del Bene, Filippo

    2014-12-01

    Here we present a protocol for the conversion of eGFP-transgenic zebrafish lines into lines expressing Gal4 from the same locus. This conversion allows the in-depth analysis of the former eGFP-expressing cell population; with the Gal4-upstream activating sequence (UAS) system, diverse UAS transgenes can be transactivated. Site-specific targeting of the gene encoding eGFP is achieved using the clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) system. A single-guide RNA (sgRNA) that targets eGFP is injected into embryos together with a donor vector containing an optimized version of Gal4 (KalTA4) to trigger integration of the donor into the targeted eGFP genomic location. To enable screening for successful integration events, injection is performed in a UAS:RFP transgenic background; fish showing mosaic eGFP-to-RFP conversion are raised to adulthood. The progeny of these adult fish are then screened for stable germline transmission, and converted progeny are used to generate stable lines. We have been able to generate two stably converted transgenic lines within 4 months.

  16. Developing a Triple Transgenic Cell Line for High-Efficiency Porcine Reproductive and Respiratory Syndrome Virus Infection

    PubMed Central

    Zhang, Linlin; Cui, Zhengzhi; Zhou, Lei; Kang, Youmin; Li, Li; Li, Jinxiu; Dai, Yunping; Yu, Shuyang; Li, Ning

    2016-01-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating pathogens in the swine industry worldwide. Due to the lack of robust cell lines and small animal models, the pathogenesis of PRRSV infection and mechanism for protective vaccination are still not yet well understood. To obtain useful cell lines, several groups have attempted to construct different transgenic cell lines with three PRRSV receptors: CD163, CD169, and CD151. The results showed that CD163 is essential for PRRSV entry into target cells and replication, and both CD169 and CD151 play key roles during PRRSV infection. However, their interplay and combined effect remains unclear. In this study, we generated transgenic BHK-21 derived cell lines co-expressing different combinations of the three receptors, which were transfected with CD163 alone, or the combination of CD163 and CD169, or the combination of CD163 and CD151, or the combination of CD163, CD169, and CD151 using the PiggyBac transposon system. Our results showed that the synergistic interaction among the three receptors was important to improve the susceptibility of cells during PRRSV infection. Through a series of comparable analyses, we confirmed that the cell line co-expressing triple receptors sustained viral infection and replication, and was superior to the current cell platform used for the PRRSV study, MARC-145 cells. Moreover, we found that PRRSV infection of the transgenic cell lines could trigger IFN-stimulated gene responses similar to those of porcine alveolar macrophages and MARC-145 cells. In summary, we developed a stable transgenic cell line susceptible to PRRSV, which may not only provide a useful tool for virus propagation, vaccine development, and pathogenesis studies, but also establish the foundation for small animal model development. PMID:27182980

  17. Investigation of rice transgene flow in compass sectors by using male sterile line as a pollen detector.

    PubMed

    Yuan, Q H; Shi, L; Wang, F; Cao, B; Qian, Q; Lei, X M; Liao, Y L; Liu, W G; Cheng, L; Jia, S R

    2007-08-01

    Rice is the most important staple food in the world. The rapid development of transgenic rice and its future commercialization have raised concerns regarding transgene flow and its potential environmental risk. It is known that rice is a self-pollinated crop; the outcrossing rate between common cultivars is generally less than 1%. In order to improve the detection sensitivity of rice transgene flow, a male sterile (ms) line BoA with a high outcrossing rate was used as a pollen detector in this study. A concentric circle design was adopted, in which the transgenic rice B2 containing bar gene as a pollen donor was planted in the center circle and the recipient BoA was planted in eight compass sectors. The frequency of transgene flow in compass sectors was analyzed by continuous sampling to generate cumulative data. The results of two years with sound reproducibility demonstrated that the rice gene flow was closely associated with the wind direction. According to the mean frequency of transgene flow, the eight sectors can be divided into two groups: a higher frequency group downstream of the prevailing wind (DPW) with a mean frequency ranging from 6.47 to 26.24%, and a lower frequency group lateral to or upstream of the prevailing wind (UPW) with a mean frequency of 0.39 to 3.03%. On the basis of the cumulative data, 90-96% of the cumulative gene flow events occurred in the four DPW sectors, while it was 4-10% in the four UPW sectors. By using these systematic data, simulation models and isograms of transgene flow in the eight compass sectors were calculated and drawn, respectively.

  18. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    PubMed Central

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  19. Wound-Inducible Biosynthesis of Phytoalexin Hydroxycinnamic Acid Amides of Tyramine in Tryptophan and Tyrosine Decarboxylase Transgenic Tobacco Lines1

    PubMed Central

    Guillet, Gabriel; De Luca, Vincenzo

    2005-01-01

    The wound-activated biosynthesis of phytoalexin hydroxycinnamic acid amides of tyramine was compared in untransformed and transgenic tobacco (Nicotiana tabacum) lines that express tryptophan decarboxylase (TDC), tyrosine decarboxylase (TYDC), or both activities. Transgenic in vitro-grown tobacco lines expressing TDC activity accumulated high levels of tryptamine but not hydroxycinnamic amides of tryptamine. In contrast, transgenic tobacco lines expressing TYDC accumulated tyramine as well as p-coumaroyltyramine and feruloyltyramine. The MeOH-soluble and cell wall fractions showed higher concentrations of wound-inducible p-coumaroyltyramine and feruloyltyramine, especially at and around wound sites, in TYDC and TDC ×TYDC tobacco lines compared to wild-type or TDC lines. All the enzymes involved in the biosynthesis of hydroxycinnamic acid amides of tyramine were found to be similarly wound inducible in all tobacco genotypes investigated. These results provide experimental evidence that, under some circumstances, TYDC activity can exert a rate-limiting control over the carbon flux allocated to the biosynthesis of hydroxycinnamic acid amides of tyramine. PMID:15665252

  20. Inheritance and expression of a transgene insert in an aneuploid tobacco line.

    PubMed

    Matzke, M A; Moscone, E A; Park, Y D; Papp, I; Oberkofler, H; Neuhuber, F; Matzke, A J

    1994-11-15

    A T-DNA locus comprising nptII, uidA and nos genes--all under the control of the nos promoter (this locus was designated K because it encodes resistance to Kanamycin)--was found to be inherited erratically in a transgenic tobacco line. This anomalous behavior was partially explained following a karyotype analysis of plants representing several generations: these plants were aneuploids, presumably for the K-containing chromosome. During four generations of sexual propagation, transgenic plants that were either trisomic or tetrasomic for the K-containing chromosome (i.e. 2n = 49 or 2n = 50, respectively) were obtained. The trisomic plants (2n = 48 + 1) were virtually indistinguishable phenotypically from normal euploids (2n = 4x = 48), whereas the tetrasomic plants (2n = 48 + 2) were smaller, had somewhat misshapen leaves and exhibited reduced fertility. Although the amount of NPTII protein in different trisomic (K--, KK-, KKK) and tetrasomic (KK--, KKK-) plants was generally consistent with a K dosage effect, the genetic behavior of each trisomic--with respect to segregation of KanR and marker gene activity in progeny--was unique and not completely explicable by invoking aneuploidy. Specifically, unexpected gains or losses of K could occur, suggesting the formation of double reductional gametes and/or frequent gene conversion at this locus. The susceptibility of K locus marker genes to trans-inactivation in the trisomic and tetrasomic lines was tested by crossing in partially homologous silencing loci. In all transgenotypes tested, the three K marker genes were sensitive to trans-silencing, which was accompanied by methylation in all copies of the nos promotor. In addition to this directed inactivation/methylation, the K locus could also undergo infrequent, spontaneous partial methylation, which produced stable epialleles. In most plants, however, the multiple copies of the nos promoter at this locus remained unmethylated and active through four generations in all

  1. Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

    PubMed

    Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

    2003-06-01

    The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

  2. Two types of transgenic lines for doxycycline-inducible, cell-specific gene expression in zebrafish ultraviolet cone photoreceptors.

    PubMed

    West, Megan C; Campbell, Leah J; Willoughby, John J; Jensen, Abbie M

    2014-03-01

    Temporal and spatial control of gene expression is important for studying the molecular and cellular mechanisms of development, physiology, and disease. We used the doxycycline (Dox)-inducible, Tet-On system to develop transgenic zebrafish for inducible, cell specific control of gene expression in the ultraviolet (UV) cone photoreceptors. Two constructs containing the reverse tetracycline-controlled transcriptional transactivator (rtTA) gene driven by the UV opsin-specific promoter (opn1sw1) were used to generate stable transgenic zebrafish lines using the Tol2-based transgenesis method. One construct included a self-reporting GFP (opn1sw1:rtTA, TRE:GFP) and the other incorporated an epitope tag on the rtTA protein (opn1sw1:rtTA(flag)). UV cone-specific expression of TRE-controlled transgenes was induced by Dox treatment in larvae and adults. Induction of gene expression was observed in 96% of all larval UV cones within 16 h of Dox treatment. UV cone-specific expression of two genes from a bidirectional TRE construct injected into one-cell Tg(opn1sw1:rtTA(flag)) embryos were also induced by Dox treatment. In addition, UV cone-specific expression of Crb2a(IntraWT) was induced by Dox treatment in progeny from crosses of the TRE-response transgenic line, Tg(TRE:HA-Crb2a(IntraWT)), to the Tg(opn1sw1:rtTA, TRE:GFP) line and the Tg(opn1sw1:rtTA(flag)) line. These lines can be used in addition to the inducible, rod-specific gene expression system from the Tet-On Toolkit to elucidate the photoreceptor-specific effects of genes of interest in photoreceptor cell biology and retinal disease.

  3. Comparison of the rhizosphere bacterial communities of Zigongdongdou soybean and a high-methionine transgenic line of this cultivar.

    PubMed

    Liang, Jingang; Sun, Shi; Ji, Jun; Wu, Haiying; Meng, Fang; Zhang, Mingrong; Zheng, Xiaobo; Wu, Cunxiang; Zhang, Zhengguang

    2014-01-01

    Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91) that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample) were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars.

  4. Comparison of the physiological characteristics of transgenic insect-resistant cotton and conventional lines

    PubMed Central

    Li, Xiaogang; Ding, Changfeng; Wang, Xingxiang; Liu, Biao

    2015-01-01

    The introduction of transgenic insect-resistant cotton into agricultural ecosystems has raised concerns regarding its ecological effects. Many studies have been conducted to compare the differences in characteristics between transgenic cotton and conventional counterparts. However, few studies have focused on the different responses of transgenic cotton to stress conditions, especially to the challenges of pathogens. The aim of this work is to determine the extent of variation in physiological characteristics between transgenic insect-resistant cotton and the conventional counterpart infected by cotton soil-borne pathogens. The results showed that the difference in genetic backgrounds is the main factor responsible for the effects on biochemical characteristics of transgenic cotton when incubating with cotton Fusarium oxysporum. However, genetic modification had a significantly greater influence on the stomatal structure of transgenic cotton than the effects of cotton genotypes. Our results highlight that the differences in genetic background and/or genetic modifications may introduce variations in physiological characteristics and should be considered to explore the potential unexpected ecological effects of transgenic cotton. PMID:25737015

  5. Recombineering-Based Procedure for Creating BAC Transgene Constructs for Animals and Cell Lines

    PubMed Central

    Hollenback, Steven M.; Lyman, Suzanne; Cheng, JrGang

    2011-01-01

    The use of BAC/P1 as a vector for the generation of a transgene has gained popularity after the genomic annotation of many organisms was completed (often based on the respective BAC library). Large-scale generation of BAC transgenic mice has proven that BAC transgene approaches have less integration position effects and dosage artifacts when compared with traditional transgenic approaches. Also, a BAC can achieve the same tissue-specific expression as a Knock-in of the same gene with less effort and shorter time of establishment. The λ-RED recombinogenic system has been used to manipulate DNA constructs with site-directed mutagenesis, truncation, and tagging with an epitope tag or as a fusion protein by homologous recombination, as well as used here to modify many BACs with various transgenes. The recombineering plasmid, pKD46, is used to fabricate BAC transgenic constructs that can be used in generating transgenic organisms as well as used in mammalian cell culture. PMID:21732318

  6. Comparison of the physiological characteristics of transgenic insect-resistant cotton and conventional lines.

    PubMed

    Li, Xiaogang; Ding, Changfeng; Wang, Xingxiang; Liu, Biao

    2015-03-04

    The introduction of transgenic insect-resistant cotton into agricultural ecosystems has raised concerns regarding its ecological effects. Many studies have been conducted to compare the differences in characteristics between transgenic cotton and conventional counterparts. However, few studies have focused on the different responses of transgenic cotton to stress conditions, especially to the challenges of pathogens. The aim of this work is to determine the extent of variation in physiological characteristics between transgenic insect-resistant cotton and the conventional counterpart infected by cotton soil-borne pathogens. The results showed that the difference in genetic backgrounds is the main factor responsible for the effects on biochemical characteristics of transgenic cotton when incubating with cotton Fusarium oxysporum. However, genetic modification had a significantly greater influence on the stomatal structure of transgenic cotton than the effects of cotton genotypes. Our results highlight that the differences in genetic background and/or genetic modifications may introduce variations in physiological characteristics and should be considered to explore the potential unexpected ecological effects of transgenic cotton.

  7. Chromatin Insulator Elements Block Transgene Silencing in Engineered Human Embryonic Stem Cell Lines at a Defined Chromosome 13 Locus

    PubMed Central

    MacArthur, Chad C.; Xue, Haipeng; Van Hoof, Dennis; Lieu, Pauline T.; Dudas, Miroslav; Fontes, Andrew; Swistowski, Andrzej; Touboul, Thomas; Seerke, Rina; Laurent, Louise C.; Loring, Jeanne F.; German, Michael S.; Zeng, Xianmin; Rao, Mahendra S.; Lakshmipathy, Uma; Chesnut, Jonathan D.

    2012-01-01

    Lineage reporters of human embryonic stem cell (hESC) lines are useful for differentiation studies and drug screening. Previously, we created reporter lines driven by an elongation factor 1 alpha (EF1α) promoter at a chromosome 13q32.3 locus in the hESC line WA09 and an abnormal hESC line BG01V in a site-specific manner. Expression of reporters in these lines was maintained in long-term culture at undifferentiated state. However, when these cells were differentiated into specific lineages, reduction in reporter expression was observed, indicating transgene silencing. To develop an efficient and reliable genetic engineering strategy in hESCs, we used chromatin insulator elements to flank single-copy transgenes and integrated the combined expression constructs via PhiC31/R4 integrase-mediated recombination technology to the chromosome 13 locus precisely. Two copies of cHS4 double-insulator sequences were placed adjacent to both 5′ and 3′ of the promoter reporter constructs. The green fluorescent protein (GFP) gene was driven by EF1α or CMV early enhancer/chicken β actin (CAG) promoter. In the engineered hESC lines, for both insulated CAG-GFP and EF1α-GFP, constitutive expression at the chromosome 13 locus was maintained during prolonged culture and in directed differentiation assays toward diverse types of neurons, pancreatic endoderm, and mesodermal progeny. In particular, described here is the first normal hESC fluorescent reporter line that robustly expresses GFP in both the undifferentiated state and throughout dopaminergic lineage differentiation. The dual strategy of utilizing insulator sequences and integration at the constitutive chromosome 13 locus ensures appropriate transgene expression. This is a valuable tool for lineage development study, gain- and loss-of-function experiments, and human disease modeling using hESCs. PMID:21699412

  8. Developing Fiber Specific Promoter-Reporter Transgenic Lines to Study the Effect of Abiotic Stresses on Fiber Development in Cotton

    PubMed Central

    Chen, Junping; Burke, John J.

    2015-01-01

    Cotton is one of the most important cash crops in US agricultural industry. Environmental stresses, such as drought, high temperature and combination of both, not only reduce the overall growth of cotton plants, but also greatly decrease cotton lint yield and fiber quality. The impact of environmental stresses on fiber development is poorly understood due to technical difficulties associated with the study of developing fiber tissues and lack of genetic materials to study fiber development. To address this important question and provide the need for scientific community, we have generated transgenic cotton lines harboring cotton fiber specific promoter (CFSP)-reporter constructs from six cotton fiber specific genes (Expansin, E6, Rac13, CelA1, LTP, and Fb late), representing genes that are expressed at different stages of fiber development. Individual CFSP::GUS or CFSP::GFP construct was introduced into Coker 312 via Agrobacterium mediated transformation. Transgenic cotton lines were evaluated phenotypically and screened for the presence of selectable marker, reporter gene expression, and insertion numbers. Quantitative analysis showed that the patterns of GUS reporter gene activity during fiber development in transgenic cotton lines were similar to those of the native genes. Greenhouse drought and heat stress study showed a correlation between the decrease in promoter activities and decrease in fiber length, increase in micronaire and changes in other fiber quality traits in transgenic lines grown under stressed condition. These newly developed materials provide new molecular tools for studying the effects of abiotic stresses on fiber development and may be used in study of cotton fiber development genes and eventually in the genetic manipulation of fiber quality. PMID:26030401

  9. Two step male release strategy using transgenic mosquito lines to control transmission of vector-borne diseases.

    PubMed

    Carvalho, Danilo Oliveira; Costa-da-Silva, André Luis; Lees, Rosemary Susan; Capurro, Margareth Lara

    2014-04-01

    Mosquitoes are responsible for the transmission of pathogens that cause devastating human diseases such as malaria and dengue. The current increase in mean global temperature and changing sea level interfere with precipitation frequency and some other climatic conditions which, in general, influence the rate of development of insects and etiologic agents causing acceleration as the temperature rises. The most common strategy employed to combat target mosquito species is the Integrated Vector Management (IVM), which comprises the use of multiple activities and various approaches to preventing the spread of a vector in infested areas. IVM programmes are becoming ineffective; and the global scenario is threatening, requiring new interventions for vector control and surveillance. Not surprisingly, there is a growing need to find alternative methods to combat the mosquito vectors. The possibility of using transgenic mosquitoes to fight against those diseases has been discussed over the last two decades and this use of transgenic lines to suppress populations or to replace them is still under investigation through field and laboratory trials. As an alternative, the available transgenic strategies could be improved by coupling suppression and substitution strategies. The idea is to first release a suppression line to significantly reduce the wild population, and once the first objective is reached a second release using a substitution line could be then performed. Examples of targeting this approach against vectors of malaria and dengue are discussed. PMID:24513036

  10. Impact of six transgenic Bacillus thuringiensis rice lines on four nontarget thrips species attacking rice panicles in the paddy field.

    PubMed

    Akhtar, Z R; Tian, J C; Chen, Y; Fang, Q; Hu, C; Peng, Y F; Ye, G Y

    2013-02-01

    As a key component of ecological risk assessments, nontarget effects of Bacillus thuringiensis (Bt) rice have been tested under laboratory and field conditions for various organisms. A 2-yr field experiment was conducted to observe the nontarget effects of six transgenic rice lines (expressing the Cry1Ab or fused protein of Cry1Ab and Cry1Ac) on four nontarget thrips species including Frankliniella intonsa (Trybom), F. tenuicornis (Uzel), Haplothrips aculeatus (F.), and H. tritici (Kurd), as compared with their rice parental control lines. Two sampling methods including the beat plate and plastic bag method were used to monitor the population densities of the four thrips species for 2 yr. The results showed that the seasonal average densities of four tested thrips species in Bt rice plots were significantly lower than or very similar to those in the non-Bt rice plots depending on rice genotypes, sampling methods, and years. Among all six tested Bt rice lines, transgenic B1 and KMD2 lines suppressed the population of these tested thrips species the most. Our results indicate that the tested Bt rice lines are unlikely to result in high population pressure of thrips species in comparison with non-Bt rice. In some cases, Bt rice lines could significantly suppress thrips populations in the rice ecosystem. In addition, compatibility of Bt rice, with rice host plant resistance to nontarget sucking pests is also discussed within an overall integrated pest management program for rice.

  11. Visualization of craniofacial development in the sox10: kaede transgenic zebrafish line using time-lapse confocal microscopy.

    PubMed

    Gfrerer, Lisa; Dougherty, Max; Liao, Eric C

    2013-01-01

    Vertebrate palatogenesis is a highly choreographed and complex developmental process, which involves migration of cranial neural crest (CNC) cells, convergence and extension of facial prominences, and maturation of the craniofacial skeleton. To study the contribution of the cranial neural crest to specific regions of the zebrafish palate a sox10: kaede transgenic zebrafish line was generated. Sox10 provides lineage restriction of the kaede reporter protein to the neural crest, thereby making the cell labeling a more precise process than traditional dye or reporter mRNA injection. Kaede is a photo-convertible protein that turns from green to red after photo activation and makes it possible to follow cells precisely. The sox10: kaede transgenic line was used to perform lineage analysis to delineate CNC cell populations that give rise to maxillary versus mandibular elements and illustrate homology of facial prominences to amniotes. This protocol describes the steps to generate a live time-lapse video of a sox10: kaede zebrafish embryo. Development of the ethmoid plate will serve as a practical example. This protocol can be applied to making a time-lapse confocal recording of any kaede or similar photoconvertible reporter protein in transgenic zebrafish. Furthermore, it can be used to capture not only normal, but also abnormal development of craniofacial structures in the zebrafish mutants.

  12. Diversity of Reporter Expression Patterns in Transgenic Mouse Lines Targeting Corticotropin-Releasing Hormone-Expressing Neurons.

    PubMed

    Chen, Yuncai; Molet, Jenny; Gunn, Benjamin G; Ressler, Kerry; Baram, Tallie Z

    2015-12-01

    Transgenic mice, including lines targeting corticotropin-releasing factor (CRF or CRH), have been extensively employed to study stress neurobiology. These powerful tools are poised to revolutionize our understanding of the localization and connectivity of CRH-expressing neurons, and the crucial roles of CRH in normal and pathological conditions. Accurate interpretation of studies using cell type-specific transgenic mice vitally depends on congruence between expression of the endogenous peptide and reporter. If reporter expression does not faithfully reproduce native gene expression, then effects of manipulating unintentionally targeted cells may be misattributed. Here, we studied CRH and reporter expression patterns in 3 adult transgenic mice: Crh-IRES-Cre;Ai14 (tdTomato mouse), Crfp3.0CreGFP, and Crh-GFP BAC. We employed the CRH antiserum generated by Vale after validating its specificity using CRH-null mice. We focused the analyses on stress-salient regions, including hypothalamus, amygdala, bed nucleus of the stria terminalis, and hippocampus. Expression patterns of endogenous CRH were consistent among wild-type and transgenic mice. In tdTomato mice, most CRH-expressing neurons coexpressed the reporter, yet the reporter identified a few non-CRH-expressing pyramidal-like cells in hippocampal CA1 and CA3. In Crfp3.0CreGFP mice, coexpression of CRH and the reporter was found in central amygdala and, less commonly, in other evaluated regions. In Crh-GFP BAC mice, the large majority of neurons expressed either CRH or reporter, with little overlap. These data highlight significant diversity in concordant expression of reporter and endogenous CRH among 3 available transgenic mice. These findings should be instrumental in interpreting important scientific findings emerging from the use of these potent neurobiological tools. PMID:26402844

  13. Study of heat and radiation response of a malignant, melanin-producing cell line derived from C3H 10T1/2 cells transformed in culture by radiation

    SciTech Connect

    Raaphorst, G.P.; Vadasz, J.; Azzam, E.I.

    1986-12-01

    The mouse C3H 10T1/2 cell line was transformed to the malignant state using ionizing radiation. One of the transformed lines (R25) that was isolated, displayed some properties similar to malignant melanoma cells. The cells became dark and pigmented after prolonged time in culture and this cell line produced tumors in C3H mice. The radiation survival curve of R25 had a large shoulder which was also observed for human melanoma cell lines. R25 was more resistant to heating at 45.0 degrees C than the normal cell line. Heating at 45.0 degrees C before irradiation resulted in a reduction of the survival curve shoulder. The heat and radiation sensitivity of R25 did not appear to be related to the melanin content of these cells.

  14. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    SciTech Connect

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  15. Assessment of fetal cell chimerism in transgenic pig lines generated by Sleeping beauty transposition.

    PubMed

    Garrels, Wiebke; Holler, Stephanie; Taylor, Ulrike; Herrmann, Doris; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A

    2014-01-01

    Human cells migrate between mother and fetus during pregnancy and persist in the respective host for long-term after birth. Fetal microchimerism occurs also in twins sharing a common placenta or chorion. Whether microchimerism occurs in multiparous mammals such as the domestic pig, where fetuses have separate placentas and chorions, is not well understood. Here, we assessed cell chimerism in litters of wild-type sows inseminated with semen of transposon transgenic boars. Segregation of three independent monomeric transposons ensured an excess of transgenic over non-transgenic offspring in every litter. Transgenic siblings (n = 35) showed robust ubiquitous expression of the reporter transposon encoding a fluorescent protein, and provided an unique resource to assess a potential cell trafficking to non-transgenic littermates (n = 7) or mothers (n = 4). Sensitive flow cytometry, fluorescence microscopy, and real-time PCR provided no evidence for microchimerism in porcine littermates, or piglets and their mothers in both blood and solid organs. These data indicate that the epitheliochorial structure of the porcine placenta effectively prevents cellular exchange during gestation. PMID:24811124

  16. Assessment of Fetal Cell Chimerism in Transgenic Pig Lines Generated by Sleeping Beauty Transposition

    PubMed Central

    Garrels, Wiebke; Holler, Stephanie; Taylor, Ulrike; Herrmann, Doris; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A.

    2014-01-01

    Human cells migrate between mother and fetus during pregnancy and persist in the respective host for long-term after birth. Fetal microchimerism occurs also in twins sharing a common placenta or chorion. Whether microchimerism occurs in multiparous mammals such as the domestic pig, where fetuses have separate placentas and chorions, is not well understood. Here, we assessed cell chimerism in litters of wild-type sows inseminated with semen of transposon transgenic boars. Segregation of three independent monomeric transposons ensured an excess of transgenic over non-transgenic offspring in every litter. Transgenic siblings (n = 35) showed robust ubiquitous expression of the reporter transposon encoding a fluorescent protein, and provided an unique resource to assess a potential cell trafficking to non-transgenic littermates (n = 7) or mothers (n = 4). Sensitive flow cytometry, fluorescence microscopy, and real-time PCR provided no evidence for microchimerism in porcine littermates, or piglets and their mothers in both blood and solid organs. These data indicate that the epitheliochorial structure of the porcine placenta effectively prevents cellular exchange during gestation. PMID:24811124

  17. Generation and characterization of transgenic plum lines expressing the Gastrodia anti-fungal protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Gastrodia anti-fungal protein (GAFP) is a monocot mannose-binding plant lectin isolated from the Asiatic orchid Gastrodia elata. This lectin has provided documented disease resistance in transgenic tobacco and cotton against several root diseases, but it's potential to confer disease resistance...

  18. Molecular cytogenetic analyses of HIG, a novel human cell line carrying t(1;3)(p36.3;q25.3) established from a patient with chronic myelogenous leukemia in blastic crisis.

    PubMed

    Hosoya, Noriko; Ogawa, Seishi; Motokura, Tohru; Hangaishi, Akira; Wang, Lili; Qiao, Ying; Nannya, Yasuhito; Kogi, Mieko; Hirai, Hisamaru

    2003-12-01

    Chromosomal abnormalities involving 1p36, 3q21, and/or 3q26 have been reported in a subset of myeloid neoplasms having characteristic dysmegakaryopoiesis, and the overexpression of EVI1 on 3q26 or of MEL1 on 1p36 has been implicated in their pathogenesis. We describe molecular cytogenetic analyses of a novel human cell line, HIG, established from a unique case in which a novel translocation t(1;3)(p36;q26) appeared as the sole additional chromosomal abnormality at the time of blastic transformation of chronic myelogenous leukemia. The patient displayed clinical features resembling those of the 3q21q26 syndrome. The HIG cell line retained der(1)t(1;3)(p36;q26) but lost t(9;22)(q34;q11). To identify the relevant gene that would be deregulated by this translocation, we molecularly cloned the translocation's breakpoints. They were distant from the breakpoint cluster regions of the 3q21q26 syndrome or t(1;3)(p36;q21), and neither the EVI1 nor the MEL1 transcript was detected in the HIG cell line. None of the genes located within 150 kilobase pairs of the breakpoints were aberrantly expressed, suggesting that in this case other gene(s) more distant from the breakpoints are deregulated by possible remote effects. Further analyses of the deregulated genes in the HIG cell line should provide important insight into the mechanisms involved in these types of leukemias.

  19. A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis.

    PubMed

    Marquès-Bueno, Maria Mar; Morao, Ana K; Cayrel, Anne; Platre, Matthieu P; Barberon, Marie; Caillieux, Erwann; Colot, Vincent; Jaillais, Yvon; Roudier, François; Vert, Grégory

    2016-01-01

    Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis.

  20. A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis

    PubMed Central

    Platre, Matthieu Pierre; Barberon, Marie; Caillieux, Erwann; Colot, Vincent

    2016-01-01

    Summary Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936

  1. A transgenic Tbx6;CreERT2 line for inducible gene manipulation in the presomitic mesoderm.

    PubMed

    Peter Lopez, T; Fan, Chen-Ming

    2012-06-01

    The rhythmic segmentation process of the presomitic mesoderm (PSM) orchestrates the formation of somites, the fundamental units for the vertebrate axial body plan. To aid the investigation of molecular components governing the conversion from PSM into somites, we generated a transgenic mouse line that expresses a tamoxifen (tmx) inducible CreER(T2) under the control of a 2.5 kb enhancer element of Tbx6, a gene essential for PSM formation and somite patterning. Combined with Cre reporters, this Tbx6;CreER(T2) line displays robust tmx-inducible Cre activity in the PSM at various embryonic stages. This tool should be useful for studying gene function during somitogenesis by either conditional inactivation or mis-expression, and potentially coupled with cell marking.

  2. Fluorescence-Activated Cell Sorting and Gene Expression Profiling of GFP-Positive Cells from Transgenic Zebrafish Lines.

    PubMed

    Tanabe, Hideyuki; Seki, Masahide; Itoh, Mari; Deepak, Ailani; Lal, Pradeep; Horiuchi, Terumi; Suzuki, Yutaka; Kawakami, Koichi

    2016-01-01

    Gene expression profiling is a useful approach for deeper understanding of the specificity of cells, tissues, and organs in the transcriptional level. Recent development of high-throughput next-generation sequence (NGS) allows the RNA-seq method for this profiling. This method provides precise information of transcripts about the quantitation and the structure such as the splicing variants. In this chapter, we describe a method for gene expression profiling of GFP-positive cells from transgenic zebrafish by RNA-seq. We labeled specific cells in the brain with GFP by crossing a Gal4 driver line with the UAS:GFP line, isolated those cells by fluorescence-activated cell sorting (FACS), and analyzed by RNA-seq. PMID:27464803

  3. Enteric plexuses of two choline-acetyltransferase transgenic mouse lines: chemical neuroanatomy of the fluorescent protein-expressing nerve cells.

    PubMed

    Wilhelm, Márta; Lawrence, J Josh; Gábriel, Robert

    2015-02-01

    We studied cholinergic circuit elements in the enteric nervous system (ENS) of two distinct transgenic mouse lines in which fluorescent protein expression was driven by the choline-acetyltransferase (ChAT) promoter. In the first mouse line, green fluorescent protein was fused to the tau gene. This construct allowed the visualization of the fiber tracts and ganglia, however the nerve cells were poorly resolved. In the second mouse line (ChATcre-YFP), CRE/loxP recombination yielded cytosolic expression of yellow fluorescent protein (YFP). In these preparations the morphology of enteric neurons could be well studied. We also determined the neurochemical identity of ENS neurons in muscular and submucous layers using antibodies against YFP, calretinin (CALR), calbindin (CALB), and vasoactive intestinal peptide (VIP). Confocal microscopic imaging was used to visualize fluorescently-conjugated secondary antibodies. In ChATcre-YFP preparations, YFP was readily apparent in somatodendritic regions of ENS neurons. In the myenteric plexus, YFP/CALR/VIP staining revealed that 34% of cholinergic cells co-labeled with CALR. Few single-stained CR-positive cells were observed. Neither YFP nor CALR co-localized with VIP. In GFP/CALB/CALR staining, all co-localization combinations were represented. In the submucosal plexus, YFP/CALR/VIP staining revealed discrete neuronal populations. However, in separate preparations, double labeling was observed for YFP/CALR and CALR/VIP. In YFP/CALR/CALB staining, all combinations of double staining and triple labeling were verified. In conclusion, the neurochemical coding of ENS neurons in these mouse lines is consistent with many observations in non-transgenic animals. Thus, they provide useful tools for physiological and pharmacological studies on distinct neurochemical subtypes of ENS neurons.

  4. Establishment of transgenic lines for jumpstarter method using a composite transposon vector in the ladybird beetle, Harmonia axyridis.

    PubMed

    Kuwayama, Hisashi; Gotoh, Hiroki; Konishi, Yusuke; Nishikawa, Hideto; Yaginuma, Toshinobu; Niimi, Teruyuki

    2014-01-01

    In this post-genomic era, genome-wide functional analysis is indispensable. The recent development of RNA interference techniques has enabled researchers to easily analyze gene function even in non-model organisms. On the other hand, little progress has been made in the identification and functional analyses of cis-regulatory elements in non-model organisms. In order to develop experimental platform for identification and analyses of cis-regulatory elements in a non-model organism, in this case, the ladybird beetle, Harmonia axyridis, we established transgenic transposon-tagged lines using a novel composite vector. This vector enables the generation of two types of insertion products (jumpstarter and mutator). The jumpstarter portion carries a transposase gene, while the mutator segment carries a reporter gene for detecting enhancers. The full-composite element is flanked by functional termini (required for movement); however, the mutator region has an extra terminus making it possible for the mutator to remobilize on its own, thus leaving an immobile jumpstarter element behind. Each insertion type is stable on its own, but once crossed, jumpstarters can remobilize mutators. After crossing a jumpstarter and mutator line, all tested G2 females gave rise to at least one new insertion line in the next generation. This jumping rate is equivalent to the P-element-mediated jumpstarter method in Drosophila. These established transgenic lines will offer us the ideal experimental materials for the effective screening and identification of enhancers in this species. In addition, this jumpstarter method has the potential to be as effective in other non-model insect species and thus applicable to any organism. PMID:24959904

  5. Establishment of transgenic lines for jumpstarter method using a composite transposon vector in the ladybird beetle, Harmonia axyridis.

    PubMed

    Kuwayama, Hisashi; Gotoh, Hiroki; Konishi, Yusuke; Nishikawa, Hideto; Yaginuma, Toshinobu; Niimi, Teruyuki

    2014-01-01

    In this post-genomic era, genome-wide functional analysis is indispensable. The recent development of RNA interference techniques has enabled researchers to easily analyze gene function even in non-model organisms. On the other hand, little progress has been made in the identification and functional analyses of cis-regulatory elements in non-model organisms. In order to develop experimental platform for identification and analyses of cis-regulatory elements in a non-model organism, in this case, the ladybird beetle, Harmonia axyridis, we established transgenic transposon-tagged lines using a novel composite vector. This vector enables the generation of two types of insertion products (jumpstarter and mutator). The jumpstarter portion carries a transposase gene, while the mutator segment carries a reporter gene for detecting enhancers. The full-composite element is flanked by functional termini (required for movement); however, the mutator region has an extra terminus making it possible for the mutator to remobilize on its own, thus leaving an immobile jumpstarter element behind. Each insertion type is stable on its own, but once crossed, jumpstarters can remobilize mutators. After crossing a jumpstarter and mutator line, all tested G2 females gave rise to at least one new insertion line in the next generation. This jumping rate is equivalent to the P-element-mediated jumpstarter method in Drosophila. These established transgenic lines will offer us the ideal experimental materials for the effective screening and identification of enhancers in this species. In addition, this jumpstarter method has the potential to be as effective in other non-model insect species and thus applicable to any organism.

  6. Megaesophagus in a Line of Transgenic Rats: A Model of Achalasia

    PubMed Central

    Pang, J.; Borjeson, T. M.; Muthupalani, S.; Ducore, R. M.; Carr, C. A.; Feng, Y.; Sullivan, M. P.; Cristofaro, V.; Luo, J.; Lindstrom, J. M.; Fox, J. G.

    2015-01-01

    Megaesophagus is defined as the abnormal enlargement or dilatation of the esophagus, characterized by a lack of normal contraction of the esophageal walls. This is called achalasia when associated with reduced or no relaxation of the lower esophageal sphincter (LES). To date, there are few naturally occurring models for this disease. A colony of transgenic (Pvrl3-Cre) rats presented with megaesophagus at 3 to 4 months of age; further breeding studies revealed a prevalence of 90% of transgene-positive animals having megaesophagus. Affected rats could be maintained on a total liquid diet long term and were shown to display the classic features of dilated esophagus, closed lower esophageal sphincter, and abnormal contractions on contrast radiography and fluoroscopy. Histologically, the findings of muscle degeneration, inflammation, and a reduced number of myenteric ganglia in the esophagus combined with ultrastructural lesions of muscle fiber disarray and mitochondrial changes in the striated muscle of these animals closely mimic that seen in the human condition. Muscle contractile studies looking at the response of the lower esophageal sphincter and fundus to electrical field stimulation, sodium nitroprusside, and L-nitro-L-arginine methyl ester also demonstrate the similarity between megaesophagus in the transgenic rats and patients with achalasia. No primary cause for megaesophagus was found, but the close parallel to the human form of the disease, as well as ease of care and manipulation of these rats, makes this a suitable model to better understand the etiology of achalasia as well as study new management and treatment options for this incurable condition. PMID:24457157

  7. T-1 Training Area

    SciTech Connect

    2014-11-07

    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  8. T-1 Training Area

    ScienceCinema

    None

    2016-07-12

    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  9. Development of transgenic lines of Eimeria tenella expressing M2e-enhanced yellow fluorescent protein (M2e-EYFP).

    PubMed

    Liu, Xianyong; Zou, Jun; Yin, Guangwen; Su, Huali; Huang, Xiaoxi; Li, Jianan; Xie, Li; Cao, Yingqiong; Cui, Yujuan; Suo, Xun

    2013-03-31

    Eimeria parasites are obligate intracellular apicomplexan protists that can cause coccidiosis, resulting in substantial economic losses in the poultry industry annually. As the component of anticoccidial vaccines, seven Eimeria spp. of chickens are characterized with potent immunogenicity. Whether genetically modified Eimeria spp. maintains this property or not needs to be verified. In this study, two identical transgenic lines of Eimeria tenella were developed by virtue of single sporocyst isolation from a stably transfected population expressing fused protein of M2 ectodomain of avian influenza virus (M2e) and enhanced yellow fluorescent protein (EYFP). The chromosomal integration and expression of M2e-EYFP were confirmed by Southern blot, plasmid rescue and Western blot analysis. We found that the reproduction of transgenic parasites was higher than that of the parental strain. Chickens challenged with wild type E. tenella after immunization with 200 oocysts of transgenic parasites had similar performance compared to those in non-immunized and non-challenged group. In another trial, the performance of transgenic parasite-immunized birds was also comparable to that of the Decoquinate Premix-treated chickens. These results suggest that this transgenic line of E. tenella is capable of inducing potent protection against homologous challenge as a live anticoccidial vaccine. Taking together, our study indicates that transgenic eimerian parasites have the potential to be developed as a vaccine vehicle for animal use in the future.

  10. A minimal cytomegalovirus intron A variant can improve transgene expression in different mammalian cell lines.

    PubMed

    Quilici, L S; Silva-Pereira, I; Andrade, A C; Albuquerque, F C; Brigido, M M; Maranhão, A Q

    2013-01-01

    The expression enhancement by cytomegalovirus promoter and different intron A (IA) variants were evaluated in CHO-K1, HepG2, HEK-293 and COS-7 cells by assessing the levels of luciferase activity. This data along with mRNA levels measurement indicated that the construct harboring an IA variant with a 200-nucleotide deletion (Δ200) had the greatest impact on increasing luciferase expression among all constructs evaluated. Based on these results, we redesigned pCMV-IA variants and cloned them into plasmids expressing a humanized antibody. These plasmids were then used to transfect CHO-K1 cells. Production of the antibody was not augmented with the Δ200 promoter variant. The 600-nucleotide deletion (Δ600) and whole IA promoter variants expressed similar levels of the recombinant protein. These data indicate that the IA-based enhanced expression of transgenes depends on a small region within the intron.

  11. High efficiency production of germ-line transgenic Japanese medaka (Oryzias latipes) by electroporation with direct current-shifted radio frequency pulses.

    PubMed

    Hostetler, Heather A; Peck, Stephanie L; Muir, William M

    2003-08-01

    Although there have been several studies showing the production of transgenic fish through electroporation techniques, success rates have been low and few studies show germ-line integration and expression. When electroporation has been successful, the device used is no longer commercially available. The goal of this experiment was to find an alternative efficient method of generating transgenic Japanese medaka (Oryzias latipes) using a commercially available electroporation device. The Gene Pulser II and RF module (Bio-Rad Laboratories, USA), along with two reporter gene constructs, were used. In contrast to other electroporation devices, which are based on a single pulse with exponential decay or square wave technology, the Gene Pulser II incorporates a direct current (DC)-shifted radio frequency (RF) signal. With this technique, over 1000 embryos can be electroporated in less than 30 min. The plasmid pCMV-SPORT-beta-gal (Invitrogen, USA) was used in the supercoiled form to optimize parameters for gene transfer into single-celled embryos, and resulted in up to 100% somatic gene transfer. Similar conditions were used to generate fish transgenic for both the pCMV-EGFP plasmid (Clontech, USA) and a cytomegalovirus (CMV) driven phytase-EGFP construct. The conditions used were a voltage of 25 V, a percent modulation of 100%, a radio frequency of 35 kHz, a burst duration of 10 ms, 3 bursts, and a burst interval of 1.0 s. Seventy percent of the embryos electroporated with the pCMV-EGFP construct survived to sexual maturity, and of those, 85% were capable of passing the transgene on to their offspring. Transgenic second generation back-crossed (BC2) fry were subjected to Southern blot analysis, which confirmed germ-line integration, and observation for green fluorescence protein, which confirmed protein expression. DC-shifted RF pulses are effective and efficient in the production of transgenic medaka, and germ-line integration and expression can be achieved without

  12. Transgenically mediated shRNAs targeting conserved regions of foot-and-mouth disease virus provide heritable resistance in porcine cell lines and suckling mice

    PubMed Central

    2013-01-01

    Foot-and-mouth disease virus (FMDV) is responsible for substantial economic losses in livestock breeding each year, and the development of new strategies is needed to overcome the limitations of existing vaccines and antiviral drugs. In this study, we evaluated the antiviral potential of transgenic porcine cells and suckling mice that simultaneously expressed two short-hairpin RNAs (shRNAs) targeting the conserved regions of the viral polymerase protein 3D and the non-structural protein 2B. First, two recombinant shRNA-expressing plasmids, PB-EN3D2B and PB-N3D2B, were constructed and the efficiency of the constructs for suppressing an artificial target was demonstrated in BHK-21 cells. We then integrated PB-EN3D2B into the genome of the porcine cell line IBRS-2 using the piggyBac transposon system, and stable monoclonal transgenic cell lines (MTCL) were selected. Of the 6 MTCL that were used in the antiviral assay, 3 exhibited significant resistance with suppressing ratios of more than 94% at 48 hours post-challenge (hpc) to both serotype O and serotype Asia 1 FMDV. MTCL IB-3D2B-6 displayed the strongest antiviral activity, which resulted in 100% inhibition of FMDV replication until 72 hpc. Moreover, the shRNA-expressing fragment of PB-N3D2B was integrated into the mouse genome by DNA microinjection to produce transgenic mice. When challenged with serotype O FMDV, the offspring of the transgenic mouse lines N3D2B-18 and N3D2B-81 exhibited higher survival rates of 19% to 27% relative to their non-transgenic littermates. The results suggest that these heritable shRNAs were able to suppress FMDV replication in the transgenic cell lines and suckling mice. PMID:23822604

  13. Umbelliprenin is Potentially Toxic Against the HT29, CT26, MCF-7, 4T1, A172, and GL26 Cell Lines, Potentially Harmful Against Bone Marrow-Derived Stem Cells, and Non-Toxic Against Peripheral Blood Mononuclear Cells

    PubMed Central

    Rashidi, Mohsen; Ziai, Seyed Ali; Moini Zanjani, Taraneh; Khalilnezhad, Ahad; Jamshidi, Hamidreza; Amani, Davar

    2016-01-01

    Background Resistance to chemotherapy is a growing concern, thus natural anticancer agents are drawing the attention of many scientists and clinicians. One natural anticancer agent, umbelliprenin, is a coumarin produced by many species of Ferula. Objectives We aimed to examine the inhibitory effect of umbelliprenin on human and mouse bone marrow-derived stem cells (BMDSCs), peripheral blood mononuclear cells (PBMCs), and different cancer cell lines. Materials and Methods In this in vitro experimental study, the HT29, CT26, MCF-7, 4T1, A172, and GL26 cancer cells and human and mouse BMDSCs and PBMCs were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), incubated at 37°C for 24 hours in a 5% CO2 atmosphere, and then were treated with different concentrations of umbelliprenin dissolved in dimethyl sulfoxide (DMSO) (3, 6, 12, 25, 50, 100, and 200 µg/mL) for 24, 48, and 72 hours at 37°C. Each experiment was performed in triplicate. Finally, the cell survival rate was assessed by MTT assay. The IC50 values were calculated based on the log values using GraphPad Prism version 5 software for windows (La Jolla CA, USA) and were expressed as mean ± SEM. Results Umbelliprenin inhibited the cancer cells in a concentration-dependent (P < 0.05) but not time-dependent manner (P > 0.05). The most sensitive and resistant cell lines at the 24-hour incubation time were 4T1 (IC50, 30.9 ± 3.1 µg/mL) and A172 (IC50, 51.9 ± 6.7 µg/mL); at the 48-hour incubation time: 4T1 (IC50, 30.6 ± 2.6 µg/mL) and CT26 (IC50, 53.2 ± 3.6 µg/mL); and at the 72-hour incubation time: HT29 (IC50, 37.1 ± 1.4 µg/mL) and 4T1 (IC50, 62.2 ± 4.8 µg/mL). Both human and mouse BMDSCs showed the highest resistance at the 24-hour incubation time (IC50s, 254.7 ± 21 and 204.4 ± 4.5 µg/mL, respectively) and the highest sensitivity at the 72-hour incubation time (IC50s, 120.4 ± 5 and 159.0 ± 7.3 µg/mL, respectively). The PBMCs of both human and mouse origin revealed very

  14. Comparative transcriptional and proteomic profiling of bread wheat cultivar and its derived transgenic line over-expressing a low molecular weight glutenin subunit gene in the endosperm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have carried out a parallel transcriptional and proteomic comparison of seeds from a transformed bread wheat line that over-expresses a transgenic low molecular weight glutenin subunit gene relative to the corresponding non-transformed genotype. Proteomic analyses showed that, during seed develop...

  15. Transgenic maize lines with cell-type specific expression of fluorescent proteins in plastids.

    PubMed

    Sattarzadeh, Amir; Fuller, Jonathan; Moguel, Salvador; Wostrikoff, Katia; Sato, Shirley; Covshoff, Sarah; Clemente, Tom; Hanson, Maureen; Stern, David B

    2010-02-01

    Plastid number and morphology vary dramatically between cell types and at different developmental stages. Furthermore, in C4 plants such as maize, chloroplast ultrastructure and biochemical functions are specialized in mesophyll and bundle sheath cells, which differentiate acropetally from the proplastid form in the leaf base. To develop visible markers for maize plastids, we have created a series of stable transgenics expressing fluorescent proteins fused to either the maize ubiquitin promoter, the mesophyll-specific phosphoenolpyruvate carboxylase (PepC) promoter, or the bundle sheath-specific Rubisco small subunit 1 (RbcS) promoter. Multiple independent events were examined and revealed that maize codon-optimized versions of YFP and GFP were particularly well expressed, and that expression was stably inherited. Plants carrying PepC promoter constructs exhibit YFP expression in mesophyll plastids and the RbcS promoter mediated expression in bundle sheath plastids. The PepC and RbcS promoter fusions also proved useful for identifying plastids in organs such as epidermis, silks, roots and trichomes. These tools will inform future plastid-related studies of wild-type and mutant maize plants and provide material from which different plastid types may be isolated. PMID:20051034

  16. Transgenic maize lines with cell-type specific expression of fluorescent proteins in plastids.

    PubMed

    Sattarzadeh, Amir; Fuller, Jonathan; Moguel, Salvador; Wostrikoff, Katia; Sato, Shirley; Covshoff, Sarah; Clemente, Tom; Hanson, Maureen; Stern, David B

    2010-02-01

    Plastid number and morphology vary dramatically between cell types and at different developmental stages. Furthermore, in C4 plants such as maize, chloroplast ultrastructure and biochemical functions are specialized in mesophyll and bundle sheath cells, which differentiate acropetally from the proplastid form in the leaf base. To develop visible markers for maize plastids, we have created a series of stable transgenics expressing fluorescent proteins fused to either the maize ubiquitin promoter, the mesophyll-specific phosphoenolpyruvate carboxylase (PepC) promoter, or the bundle sheath-specific Rubisco small subunit 1 (RbcS) promoter. Multiple independent events were examined and revealed that maize codon-optimized versions of YFP and GFP were particularly well expressed, and that expression was stably inherited. Plants carrying PepC promoter constructs exhibit YFP expression in mesophyll plastids and the RbcS promoter mediated expression in bundle sheath plastids. The PepC and RbcS promoter fusions also proved useful for identifying plastids in organs such as epidermis, silks, roots and trichomes. These tools will inform future plastid-related studies of wild-type and mutant maize plants and provide material from which different plastid types may be isolated.

  17. Molecular biology of nickel carcinogenesis: identification of differentially expressed genes in morphologically transformed C3H10T1/2 Cl 8 mouse embryo fibroblast cell lines induced by specific insoluble nickel compounds.

    PubMed

    Verma, Rini; Ramnath, Jamuna; Clemens, Farrah; Kaspin, Lisa C; Landolph, Joseph R

    2004-01-01

    Inhalation of mixtures of insoluble and soluble nickel compounds by humans during nickel refining has been associated with excess lung and nasal sinus cancers. Insoluble nickel subsulfide (Ni3S2) and nickel oxide (NiO) are carcinogenic to rodents by inhalation. We previously showed that insoluble Ni3S2, crystalline nickel monosulfide (NiS), and green (high temperature, HT) and black (low temperature, LT) NiO, induced morphological transformation in cultured C3H/10T1/2 Cl 8 (10T1/2) mouse embryo cells. To understand molecular mechanisms of carcinogenesis by insoluble nickel compounds, we used random, arbitrarily primed-polymerase chain reaction (RAP-PCR) mRNA differential display and identified nine cDNA fragments that were differentially expressed between nontransformed and nickel-transformed cell lines in approximately 10.0% of the total mRNA. Expression of the calnexin gene (encoding a type I membrane protein/molecular chaperone), the ect-2 proto-oncogene, and the stress-inducible gene, Wdr1, was upregulated. Expression of six genes--the vitamin D interacting protein/thyroid hormone activating protein 80 (DRIP/TRAP-80) gene, the insulin-like growth factor receptor 1 (IGFR1) gene, the small nuclear activating protein (SNAP C3) gene, and three unknown genes, was down-regulated, in nickel-transformed cell lines. We hypothesize that these resulting aberrations in gene expression could contribute to the induction and/or maintenance of morphological transformation induced by specific insoluble nickel compounds. PMID:14971661

  18. A new transgenic mouse line for tetracycline inducible transgene expression in mature melanocytes and the melanocyte stem cells using the Dopachrome tautomerase promoter.

    PubMed

    Woods, Susan L; Bishop, J Michael

    2011-04-01

    We have generated a novel transgenic mouse to direct inducible and reversible transgene expression in the melanocytic compartment. The Dopachrome tautomerase (Dct) control sequences we used are active early in the development of melanocytes and so this system was designed to enable the manipulation of transgene expression during development in utero and in the melanocyte stem cells as well as mature melanocytes. We observed inducible lacZ and GFP reporter transgene activity specifically in melanocytes and melanocyte stem cells in mouse skin. This mouse model will be a useful tool for the pigment cell community to investigate the contribution of candidate genes to normal melanocyte and/or melanoma development in vivo. Deregulated expression of the proto-oncogene MYC has been observed in melanoma, however whether MYC is involved in tumorigenesis in pigment cells has yet to be directly investigated in vivo. We have used our system to over-express MYC in the melanocytic compartment and show for the first time that increased MYC expression can indeed promote melanocytic tumor formation.

  19. Transfer of hygromycin resistance into Brassica napus using total DNA of a transgenic B. nigra line.

    PubMed

    Golz, C; Köhler, F; Schieder, O

    1990-09-01

    The successful transfer of a marker gene (hpt gene) from Brassica nigra into B. napus via direct gene transfer was demonstrated. Total DNA was isolated from a hygromycin-resistant callus line, which contained three to five copies of the hpt gene. This line had been produced via direct gene transfer with the hygromycin resistance-conferring plasmid pGL2. The treatment of B. napus protoplasts with genomic DNA of B. nigra (HygR) resulted in relative transformation frequencies of 0.1-0.4%. Similar transformation rates were obtained in direct gene transfer experiments using B. napus protoplasts and plasmid pGL2.

  20. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry

    PubMed Central

    Ikeda, Keiko; Takahashi, Masanori; Sato, Shigeru; Igarashi, Hiroyuki; Ishizuka, Toru; Yawo, Hiromu; Arata, Satoru; Southard-Smith, E. Michelle; Kawakami, Kiyoshi; Onimaru, Hiroshi

    2015-01-01

    The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG) and the pre-Bötzinger complex group (preBötC). The pFRG partially overlaps in the retrotrapezoid nucleus (RTN), which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I) neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg) rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems. PMID:26147470

  1. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry.

    PubMed

    Ikeda, Keiko; Takahashi, Masanori; Sato, Shigeru; Igarashi, Hiroyuki; Ishizuka, Toru; Yawo, Hiromu; Arata, Satoru; Southard-Smith, E Michelle; Kawakami, Kiyoshi; Onimaru, Hiroshi

    2015-01-01

    The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG) and the pre-Bötzinger complex group (preBötC). The pFRG partially overlaps in the retrotrapezoid nucleus (RTN), which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I) neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg) rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems.

  2. Effect of vegetation of transgenic Bt rice lines and their straw amendment on soil enzymes, respiration, functional diversity and community structure of soil microorganisms under field conditions.

    PubMed

    Fang, Hua; Dong, Bin; Yan, Hu; Tang, Feifan; Wang, Baichuan; Yu, Yunlong

    2012-01-01

    With the development of transgenic crops, there is an increasing concern about the possible adverse effects of their vegetation and residues on soil environmental quality. This study was carried out to evaluate the possible effects of the vegetation of transgenic Bt rice lines Huachi B6 (HC) and TT51 (TT) followed by the return of their straw to the soil on soil enzymes (catalase, urease, neutral phosphatase and invertase), anaerobic respiration activity, microbial utilization of carbon substrates and community structure, under field conditions. The results indicated that the vegetation of the two transgenic rice lines (HC and TT) and return of their straw had few adverse effects on soil enzymes and anaerobic respiration activity compared to their parent and distant parent, although some transient differences were observed. The vegetation and subsequent straw amendment of Bt rice HC and TT did not appear to have a harmful effect on the richness, evenness and community structure of soil microorganisms. No different pattern of impact due to plant species was found between HC and TT. It could be concluded that the vegetation of transgenic Bt rice lines and the return of their straw as organic fertilizer may not alter soil microbe-mediated functions.

  3. Regeneration of multiple shoots from transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a cry9Aa2 gene conferring insect resistance

    PubMed Central

    2011-01-01

    Background The recovery of high performing transgenic lines in clonal crops is limited by the occurrence of somaclonal variation during the tissue culture phase of transformation. This is usually circumvented by developing large populations of transgenic lines, each derived from the first shoot to regenerate from each transformation event. This study investigates a new strategy of assessing multiple shoots independently regenerated from different transformed cell colonies of potato (Solanum tuberosum L.). Results A modified cry9Aa2 gene, under the transcriptional control of the CaMV 35S promoter, was transformed into four potato cultivars using Agrobacterium-mediated gene transfer using a nptII gene conferring kanamycin resistance as a selectable marker gene. Following gene transfer, 291 transgenic lines were grown in greenhouse experiments to assess somaclonal variation and resistance to potato tuber moth (PTM), Phthorimaea operculella (Zeller). Independently regenerated lines were recovered from many transformed cell colonies and Southern analysis confirmed whether they were derived from the same transformed cell. Multiple lines regenerated from the same transformed cell exhibited a similar response to PTM, but frequently exhibited a markedly different spectrum of somaclonal variation. Conclusions A new strategy for the genetic improvement of clonal crops involves the regeneration and evaluation of multiple shoots from each transformation event to facilitate the recovery of phenotypically normal transgenic lines. Most importantly, regenerated lines exhibiting the phenotypic appearance most similar to the parental cultivar are not necessarily derived from the first shoot regenerated from a transformed cell colony, but can frequently be a later regeneration event. PMID:21995716

  4. Transgenic barley lines prove the involvement of TaCBF14 and TaCBF15 in the cold acclimation process and in frost tolerance.

    PubMed

    Soltész, Alexandra; Smedley, Mark; Vashegyi, Ildikó; Galiba, Gábor; Harwood, Wendy; Vágújfalvi, Attila

    2013-04-01

    The enhancement of winter hardiness is one of the most important tasks facing breeders of winter cereals. For this reason, the examination of those regulatory genes involved in the cold acclimation processes is of central importance. The aim of the present work was the functional analysis of two wheat CBF transcription factors, namely TaCBF14 and TaCBF15, shown by previous experiments to play a role in the development of frost tolerance. These genes were isolated from winter wheat and then transformed into spring barley, after which the effect of the transgenes on low temperature stress tolerance was examined. Two different types of frost tests were applied; plants were hardened at low temperature before freezing, or plants were subjected to frost without a hardening period. The analysis showed that TaCBF14 and TaCBF15 transgenes improve the frost tolerance to such an extent that the transgenic lines were able to survive freezing temperatures several degrees lower than that which proved lethal for the wild-type spring barley. After freezing, lower ion leakage was measured in transgenic leaves, showing that these plants were less damaged by the frost. Additionally, a higher Fv/Fm parameter was determined, indicating that photosystem II worked more efficiently in the transgenics. Gene expression studies showed that HvCOR14b, HvDHN5, and HvDHN8 genes were up-regulated by TaCBF14 and TaCBF15. Beyond that, transgenic lines exhibited moderate retarded development, slower growth, and minor late flowering compared with the wild type, with enhanced transcript level of the gibberellin catabolic HvGA2ox5 gene.

  5. Opposing effects of APP/PS1 and TrkB.T1 genotypes on midbrain dopamine neurons and stimulated dopamine release in vivo.

    PubMed

    Kärkkäinen, E; Yavich, L; Miettinen, P O; Tanila, H

    2015-10-01

    Brain derived neurotrophic factor (BDNF) signaling disturbances in Alzheimer׳s disease (AD) have been demonstrated. BDNF levels fall in AD, but the ratio between truncated and full-length BDNF receptors TrkB.T1 and TrkB.TK, respectively, increases in brains of AD patients and APPswe/PS1dE9 (APP/PS1) AD model mice. Dopaminergic (DAergic) system disturbances in AD and detrimental effects of BDNF signaling deficits on DAergic system functions have also been indicated. Against this, we investigated changes in nigrostriatal dopamine (DA) system in mice carrying APP/PS1 and/or TrkB.T1 transgenes, the latter line modeling the TrkB.T1/TK ratio change in AD. Employing in vivo voltammetry, we found normal short-term DA release in caudate-putamen of mice carrying APP/PS1 or TrkB.T1 transgenes but impaired capacity to recruit more DA upon prolonged stimulation. However, mice carrying both transgenes did not differ from wild-type controls. Immunohistochemistry revealed normal density of tyrosine hydroxylase positive axon terminals in caudate-putamen in all genotypes and intact presynaptic machinery for DA release and reuptake, as shown by unchanged levels of SNAP-25, α-synuclein and DA transporter. However, we observed increased DAergic neurons in substantia nigra of TrkB.T1 mice resulting in decreased tyrosine hydroxylase per neuron in TrkB.T1 mice. The finding of unchanged nigral DAergic neurons in APP/PS1 mice largely confirms earlier reports, but the unexpected increase in midbrain DA neurons in TrkB.T1 mice is a novel finding. We suggest that both APP/PS1 and TrkB.T1 genotypes disrupt DAergic signaling, but via separate mechanisms. PMID:26168899

  6. Opposing effects of APP/PS1 and TrkB.T1 genotypes on midbrain dopamine neurons and stimulated dopamine release in vivo.

    PubMed

    Kärkkäinen, E; Yavich, L; Miettinen, P O; Tanila, H

    2015-10-01

    Brain derived neurotrophic factor (BDNF) signaling disturbances in Alzheimer׳s disease (AD) have been demonstrated. BDNF levels fall in AD, but the ratio between truncated and full-length BDNF receptors TrkB.T1 and TrkB.TK, respectively, increases in brains of AD patients and APPswe/PS1dE9 (APP/PS1) AD model mice. Dopaminergic (DAergic) system disturbances in AD and detrimental effects of BDNF signaling deficits on DAergic system functions have also been indicated. Against this, we investigated changes in nigrostriatal dopamine (DA) system in mice carrying APP/PS1 and/or TrkB.T1 transgenes, the latter line modeling the TrkB.T1/TK ratio change in AD. Employing in vivo voltammetry, we found normal short-term DA release in caudate-putamen of mice carrying APP/PS1 or TrkB.T1 transgenes but impaired capacity to recruit more DA upon prolonged stimulation. However, mice carrying both transgenes did not differ from wild-type controls. Immunohistochemistry revealed normal density of tyrosine hydroxylase positive axon terminals in caudate-putamen in all genotypes and intact presynaptic machinery for DA release and reuptake, as shown by unchanged levels of SNAP-25, α-synuclein and DA transporter. However, we observed increased DAergic neurons in substantia nigra of TrkB.T1 mice resulting in decreased tyrosine hydroxylase per neuron in TrkB.T1 mice. The finding of unchanged nigral DAergic neurons in APP/PS1 mice largely confirms earlier reports, but the unexpected increase in midbrain DA neurons in TrkB.T1 mice is a novel finding. We suggest that both APP/PS1 and TrkB.T1 genotypes disrupt DAergic signaling, but via separate mechanisms.

  7. An α-smooth muscle actin (acta2/αsma) zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells.

    PubMed

    Whitesell, Thomas R; Kennedy, Regan M; Carter, Alyson D; Rollins, Evvi-Lynn; Georgijevic, Sonja; Santoro, Massimo M; Childs, Sarah J

    2014-01-01

    Mural cells of the vascular system include vascular smooth muscle cells (SMCs) and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma), which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.

  8. Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

    PubMed

    Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

    2010-04-01

    Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

  9. Detection of feral GT73 transgenic oilseed rape (Brassica napus) along railway lines on entry routes to oilseed factories in Switzerland.

    PubMed

    Hecht, Mirco; Oehen, Bernadette; Schulze, Jürg; Brodmann, Peter; Bagutti, Claudia

    2014-01-01

    To obtain a reference status prior to cultivation of genetically modified oilseed rape (OSR, Brassica napus L.) in Switzerland, the occurrence of feral OSR was monitored along transportation routes and at processing sites. The focus was set on the detection of (transgenic) OSR along railway lines from the Swiss borders with Italy and France to the respective oilseed processing factories in Southern and Northern Switzerland (Ticino and region of Basel). A monitoring concept was developed to identify sites of largest risk of escape of genetically modified plants into the environment in Switzerland. Transport spillage of OSR seeds from railway goods cars particularly at risk hot spots such as switch yards and (un)loading points but also incidental and continuous spillage were considered. All OSR plants, including their hybridization partners which were collected at the respective monitoring sites were analyzed for the presence of transgenes by real-time PCR. On sampling lengths each of 4.2 and 5.7 km, respectively, 461 and 1,574 plants were sampled in Ticino and the region of Basel. OSR plants were found most frequently along the routes to the oilseed facilities, and in larger amounts on risk hot spots compared to sites of random sampling. At three locations in both monitored regions, transgenic B. napus line GT73 carrying the glyphosate resistance transgenes gox and CP4 epsps were detected (Ticino, 22 plants; in the region of Basel, 159).

  10. Effects of expression of human or bovine growth hormone genes on sperm production and male reproductive performance in four lines of transgenic mice.

    PubMed

    Bartke, A; Naar, E M; Johnson, L; May, M R; Cecim, M; Yun, J S; Wagner, T E

    1992-05-01

    Reproductive performance was studied in transgenic males from lines expressing and transmitting four hybrid genes: mouse metallothionein-I/human growth hormone (GH) (MT/hGH), MT/hGH placental variant (MT/hGH.V), MT/bovine GH (MT/bGH) and phosphoenolpyruvate carboxykinase/bGH (PEPCK/bGH). Each male was exposed to three normal females for 1 week and to three different normal females for another week. Females were examined for vaginal plugs and necropsied on day 14 of pregnancy. Males were killed for analysis of organ weights, numbers of testicular spermatids, numbers of epididymal sperm and measurements of plasma glucose concentration. Fertility of MT/hGH and MT/hGH.V transgenic males was significantly lower than in normal males, primarily because most males failed to impregnate any females. In females that became pregnant, the numbers of corpora lutea, total fetuses and live fetuses did not differ from those in females mated to normal (nontransgenic) males. Fetal crown-rump length on day 14 of pregnancy did not differ between litters sired by normal or by transgenic males. Weights of testes and seminal vesicles were significantly greater in all four types of transgenic male, but daily sperm production per unit weight (g-1) of testis was not affected and epididymal sperm reserves were either normal or slightly higher than normal. Plasma glucose concentrations were significantly higher in PEPCK/bGH mice than in other mice. Average or individual reproductive performance of transgenic males from the various lines did not correlate with any of the parameters examined except for significantly heavier seminal vesicles in MT/hGH and MT/hGH.V males than in normal males; these transgenic males exhibited a high incidence of infertility. Since hGH and hGH.V, but not bGH, are lactogenic in rodents, it was concluded that chronic stimulation of GH and prolactin receptors by ectopically produced human GHs in transgenic mice compromises male fertility by an unknown mechanism

  11. In vivo two-photon fluorescence imaging with Cr:forsterite lasers using transgenic lines tagged by HcRed

    NASA Astrophysics Data System (ADS)

    Tsai, Tsung-Han; Chen, Szu-Yu; Tai, Shih-Peng; Lin, Cheng-Yung; Tsai, Huai-Jen; Sun, Chi-Kuang

    2005-03-01

    Transgenic lines carrying a specific tissue tagged by green-fluorescence-protein (GFP) have been a powerful tool to developmental biology because they encapsulate the expression of endogenous genes. Traditionally with two-photon fluorescence microscopy based on a femtosecond Ti:sapphire laser (with a wavelength between 700-980nm), green fluorescence can be excited by simultaneous absorption of two photons for high-resolution three-dimensional (3D) optical imaging. However for in vivo biological applications, Ti:sapphire-laser based optical technology presents several limitations including finite penetration depth, strong on-focus cell damage, and phototoxicity. For high optical penetration and minimized photodamages, two-photon imaging based on light sources with an optical wavelength located around the biological penetration window (~1300nm) is desired, where unwanted light-tissue interactions including scattering, absorption, and photodamages can all be minimized. Previous experiments around the optical penetration window indicated inefficient green fluorescence excitation of GFP through three-photon absorption. Red fluorescence protein is thus highly desired for future non-invasive in vivo two-photon imaging. Screening from embryos injected with DNA fragment containing a heart-specific regulatory element of zebrafish cardiac myosin light chain 2 gene (cmlc2) fused with HcRed gene, we generate a zebrafish line that has strong two-photon red fluorescence expressed in cardiac cells based on a 1230nm femtosecond light source working in the biological penetration window. Combined with its nonlinearity, high penetration depth, and minimized photodamages, this method provides superb imaging capability compared with the traditional GFP based two-photon microscopy, offering deep insight into the noninvasive in vivo studies of gene expression in vertebrate embryos.

  12. Transgene-free human induced pluripotent stem cell line (HS5-SV.hiPS) generated from cesarean scar-derived fibroblasts.

    PubMed

    Rungsiwiwut, Ruttachuk; Pavarajarn, Wipawee; Numchaisrika, Pranee; Virutamasen, Pramuan; Pruksananonda, Kamthorn

    2016-01-01

    Transgene-free human HS5-SV.hiPS line was generated from human cesarean scar-derived fibroblasts using temperature-sensitive Sendai virus vectors carrying Oct4, Sox2, cMyc and Klf4 exogenous transcriptional factors. The viral constructs were eliminated from HS5-SV.hiPS line through heat treatment. Transgene-free HS5-SV.hiPS cells expressed pluripotent associated transcription factors Oct4, Nanog, Sox2, Rex1 and surface markers SSEA-4, TRA-1-60 and OCT4. HS5-SV.hiPS cells formed embryoid bodies and differentiated into three embryonic germ layers in vivo. HS5-SV.hiPS cells maintained their normal karyotype (46, XX) after culture for extended period. HS5-SV.hiPS displayed the similar pattern of DNA fingerprinting to the parenteral scar-derived fibroblasts. PMID:27345776

  13. Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells.

    PubMed

    Ohmoto, Makoto; Matsumoto, Ichiro; Yasuoka, Akihito; Yoshihara, Yoshihiro; Abe, Keiko

    2008-08-01

    We established transgenic mouse lines expressing a transneuronal tracer, wheat germ agglutinin (WGA), under the control of mouse T1R3 gene promoter/enhancer. In the taste buds, WGA transgene was faithfully expressed in T1R3-positive sweet/umami taste receptor cells. WGA protein was transferred not laterally to the synapse-bearing, sour-responsive type III cells in the taste buds but directly to a subset of neurons in the geniculate and nodose/petrosal ganglia, and further conveyed to a rostro-central region of the nucleus of solitary tract. In addition, WGA was expressed in solitary chemoreceptor cells in the nasal epithelium and transferred along the trigeminal sensory pathway to the brainstem neurons. The solitary chemoreceptor cells endogenously expressed T1R3 together with bitter taste receptors T2Rs. This result shows an exceptional signature of receptor expression. Thus, the t1r3-WGA transgenic mice revealed the sweet/umami gustatory pathways from taste receptor cells and the trigeminal neural pathway from solitary chemoreceptor cells.

  14. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

    PubMed

    Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

    2015-10-29

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing.

  15. Transgene stacking and marker elimination in transgenic rice by sequential Agrobacterium-mediated co-transformation with the same selectable marker gene.

    PubMed

    Ramana Rao, Mangu Venkata; Parameswari, Chidambaram; Sripriya, Rajasekaran; Veluthambi, Karuppannan

    2011-07-01

    Rice chitinase (chi11) and tobacco osmotin (ap24) genes, which cause disruption of fungal cell wall and cell membrane, respectively, were stacked in transgenic rice to develop resistance against the sheath blight disease. The homozygous marker-free transgenic rice line CoT23 which harboured the rice chi11 transgene was sequentially re-transformed with a second transgene ap24 by co-transformation using an Agrobacterium tumefaciens strain harbouring a single-copy cointegrate vector pGV2260::pSSJ1 and a multi-copy binary vector pBin19∆nptII-ap24 in the same cell. pGV2260::pSSJ1 T-DNA carried the hygromycin phosphotransferase (hph) and β-glucuronidase (gus) genes. pBin19∆nptII-ap24 T-DNA harboured the tobacco osmotin (ap24) gene. Co-transformation of the gene of interest (ap24) with the selectable marker gene (SMG, hph) occurred in 12 out of 18 T(0) plants (67%). Segregation of hph from ap24 was accomplished in the T(1) generation in one (line 11) of the four analysed co-transformed plants. The presence of ap24 and chi11 transgenes and the absence of the hph gene in the SMG-eliminated T(1) plants of the line 11 were confirmed by DNA blot analyses. The SMG-free transgenic plants of the line 11 harboured a single copy of the ap24 gene. Homozygous, SMG-free T(2) plants of the transgenic line 11 harboured stacked transgenes, chi11 and ap24. Northern blot analysis of the SMG-free plants revealed constitutive expression of chi11 and ap24. The transgenic plants with stacked transgenes displayed high levels of resistance against Rhizoctonia solani. Thus, we demonstrate the development of transgene-stacked and marker-free transgenic rice by sequential Agrobacterium-mediated co-transformation with the same SMG.

  16. T24 HRAS transformed NIH/3T3 mouse cells (GhrasT-NIH/3T3) in serial tumorigenic in vitro/in vivo passages give rise to increasingly aggressive tumorigenic cell lines T1-A and T2-A and metastatic cell lines T3-HA and T4-PA.

    PubMed

    Ray, Durwood B; Merrill, Gerald A; Brenner, Frederic J; Lytle, Laurie S; Lam, Tan; McElhinney, Aaron; Anders, Joel; Rock, Tara Tauber; Lyker, Jennifer Kier; Barcus, Scott; Leslie, Kara Hust; Kramer, Jill M; Rubenstein, Eric M; Pryor Schanz, Karen; Parkhurst, Amy J; Peck, Michelle; Good, Kimberly; Granath, Kristi Lemke; Cifra, Nicole; Detweiler, Jessalee Wantz; Stevens, Laura; Albertson, Richard; Deir, Rachael; Stewart, Elisabeth; Wingard, Katherine; Richardson, Micah Rose; Blizard, Sarah B; Gillespie, Lauren E; Kriley, Charles E; Rzewnicki, Daniel I; Jones, David H

    2016-01-01

    Cancer cells often arise progressively from "normal" to "pre-cancer" to "transformed" to "local metastasis" to "metastatic disease" to "aggressive metastatic disease". Recent whole genome sequencing (WGS) and spectral karyotyping (SKY) of cancer cells and tumorigenic models have shown this progression involves three major types of genome rearrangements: ordered small step-wise changes, more dramatic "punctuated evolution" (chromoplexy), and large catastrophic steps (chromothripsis) which all occur in random combinations to generate near infinite numbers of stochastically rearranged metastatic cancer cell genomes. This paper describes a series of mouse cell lines developed sequentially to mimic this type of progression. This starts with the new GhrasT-NIH/Swiss cell line that was produced from the NIH/3T3 cell line that had been transformed by transfection with HRAS oncogene DNA from the T24 human bladder carcinoma. These GhrasT-NIH/Swiss cells were injected s.c. into NIH/Swiss mice to produce primary tumors from which one was used to establish the T1-A cell line. T1-A cells injected i.v. into the tail vein of a NIH/Swiss mouse produced a local metastatic tumor near the base of the tail from which the T2-A cell line was established. T2-A cells injected i.v. into the tail vein of a nude NIH/Swiss mouse produced metastases in the liver and one lung from which the T3-HA (H=hepatic) and T3-PA (P=pulmonary) cell lines were developed, respectively. T3-HA cells injected i.v. into a nude mouse produced a metastasis in the lung from which the T4-PA cell line was established. PCR analysis indicated the human T24 HRAS oncogene was carried along with each in vitro/in vivo transfer step and found in the T2-A and T4-PA cell lines. Light photomicrographs indicate that all transformed cells are morphologically similar. GhrasT-NIH/Swiss cells injected s.c. produced tumors in 4% of NIH/Swiss mice in 6-10 weeks; T1-A cells injected s.c. produced tumors in 100% of NIH/Swiss mice in 7

  17. Generation and phenotypic analysis of a transgenic line of rabbits secreting active recombinant human erythropoietin in the milk.

    PubMed

    Mikus, Tomás; Poplstein, Martin; Sedláková, Jirina; Landa, Vladimír; Jeníkova, Gabriela; Trefil, Pavel; Lidický, Jan; Malý, Petr

    2004-10-01

    Production of recombinant human erythropoietin (rhEPO) for therapeutic purposes relies on its expression in selected clones of transfected mammalian cells. Alternatively, this glycoprotein can be produced by targeted secretion into the body fluid of transgenic mammals. Here, we report on the generation of a transgenic rabbits producing rhEPO in the lactating mammary gland. Transgenic individuals are viable, fertile and transmit the rhEPO gene to the offspring. Northern blot data indicated that the expression of the transgene in the mammary gland is controlled by whey acidic protien (WAP) regulatory sequences during the period of lactation. While the hybridization with total RNA revealed the expression only in the lactating mammary gland, the highly sensitive combinatory approach using RT-PCR/hybridization technique detected a minor ectopic expression. The level of rhEPO secretion in the founder female, measured in the period of lactation, varied in the range of 60-178 and 60-162 mIU/ml in the milk and blood plasma, respectively. Biological activity of the milk rhEPO was confirmed by a standard [3H]-thymidine incorporation test. Thus, we describe the model of a rhEPO-transgenic rabbit, valuable for studies of rhEPO glycosylation and function, which can be useful for the development of transgenic approaches designed for the preparation of recombinant proteins by alternative biopharmaceutical production.

  18. Phenotype and Hierarchy of Two Transgenic T Cell Lines Targeting the Respiratory Syncytial Virus KdM282-90 Epitope Is Transfer Dose-Dependent.

    PubMed

    Morabito, Kaitlyn M; Erez, Noam; Graham, Barney S; Ruckwardt, Tracy J

    2016-01-01

    In this study, we compared two lines of transgenic CD8+ T cells specific for the same KdM282-90 epitope of respiratory syncytial virus in the CB6F1 hybrid mouse model. Here we found that these two transgenic lines had similar in vivo abilities to control viral load after respiratory syncytial virus infection using adoptive transfer. Transfer of the TRBV13-2 line resulted in higher levels of IL-6 and MIP1-α in the lung than TRBV13-1 transfer. Interestingly, when large numbers of cells were co-transferred, the lines formed a hierarchy, with TRBV13-2 being immunodominant over TRBV13-1 in the mediastinal lymph node despite no identifiable difference in proliferation or apoptosis between the lines. This hierarchy was not established when lower cell numbers were transferred. The phenotype and frequency of proliferating cells were also cell transfer dose-dependent with higher percentages of CD127loCD62LloKLRG1lo and proliferating cells present when lower numbers of cells were transferred. These results illustrate the importance of cell number in adoptive transfer experiments and its influence on the phenotype and hierarchy of the subsequent T cell response. PMID:26752171

  19. [Transgenic tobacco plants with ribosome inactivating protein gene cassin from Cassia occidentalis and their resistance to tobacco mosaic virus].

    PubMed

    Ruan, Xiao-Lei; Liu, Li-Fang; Li, Hua-Ping

    2007-12-01

    Cassin, the new gene of ribosome-inactivating protein (RIP) isolated from Cassia occidentalis, was inserted into expression vector pBI121 to produce plant expression vector pBI121-cassin (Figs.1, 2). pBI121-cassin was introduced into tobacco cultivar 'K326' by the Agrobacteriurm tumefaciens transformation method and more than 100 independent transformants were obtained. Southern blot hybridization analysis showed that a single gene locus was inserted into the chromosome of the transgenic tobacco lines (Fig.5) and PCR analysis of segregation population of progeny indicated that the inheritance of transgene was dominant in transgenic lines (Fig.4, Table 1). Results of RT-PCR and Northern blot hybridization analysis showed that transgene could be transcribed correctly (Figs.5, 6) . Three self-pollination lines of transgenic T(1) and T(2) were challenged with TMV at different concentration titers by mechanical inoculation. The transgenic lines exhibited different levels of resistance to TMV with the nontransgenic plants. After both titers of TMV concentration were inoculated, transgenic lines were considered as the highly resistant type with a delay of 4-13 d in development of symptoms and 10%-25% of test plants were infected, while nontransgenic control plants were susceptible typical symptoms on the newly emerged leaves (Table 2). One T(2) line, T(2)-8-2-1, was regarded as an immune type because it did not show any symptoms during 70 d and all plants were shown to be virus free by ELISA tests.

  20. T1 Radiculopathy: Electrodiagnostic Evaluation

    PubMed Central

    Radecki, Jeffrey; Zimmer, Zachary R.

    2008-01-01

    Electromyography (EMG) studies are useful in the anatomical localization of nerve injuries and, in most cases, isolating lesions to a single nerve root level. Their utility is important in identifying specific nerve-root-level injuries where surgical or interventional procedures may be warranted. In this case report, an individual presented with right upper extremity radicular symptoms consistent with a clinical diagnosis of cervical radiculopathy. EMG studies revealed that the lesion could be more specifically isolated to the T1 nerve root and, furthermore, provided evidence that the abductor pollicis brevis receives predominantly T1 innervation. PMID:19083061

  1. Transgenic rice plants expressing the snowdrop lectin gene (gna) exhibit high-level resistance to the whitebacked planthopper (Sogatella furcifera).

    PubMed

    Nagadhara, D; Ramesh, S; Pasalu, I C; Rao, Y Kondala; Sarma, N P; Reddy, V D; Rao, K V

    2004-11-01

    Transgenic rice plants, expressing snowdrop lectin [Galanthus nivalis agglutinin (GNA)], obtained by Agrobacterium-mediated genetic transformation, were evaluated for resistance against the insect, the whitebacked planthopper (WBPH). The transgene gna was driven by the phloem-specific, rice-sucrose synthase promoter RSs1, and the bar was driven by the CaMV 35S promoter. In our previous study, the transgenic status of these lines was confirmed by Southern, Northern and Western blot analyses. Both the transgenes, gna and bar, were stably inherited and co-segregated into progenies in T1 to T5 generations. Insect bioassays on transgenic plants revealed the potent entomotoxic effects of GNA on the WBPH. Also, significant decreases were observed in the survival, development and fecundity of the insects fed on transgenic plants. Furthermore, intact GNA was detected in the total proteins of WBPHs fed on these plants. Western blot analysis revealed stable and consistent expression of GNA throughout the growth and development of transgenic plants. Transgenic lines expressing GNA exhibited high-level resistance against the WBPH. As reported earlier, these transgenics also showed substantial resistance against the brown planthopper and green leafhopper.

  2. The HSP terminator of Arabidopsis thaliana induces a high level of miraculin accumulation in transgenic tomatoes.

    PubMed

    Hirai, Tadayoshi; Kurokawa, Natsuko; Duhita, Narendra; Hiwasa-Tanase, Kyoko; Kato, Kazuhisa; Kato, Ko; Ezura, Hiroshi

    2011-09-28

    High-level accumulation of the target recombinant protein is a significant issue in heterologous protein expression using transgenic plants. Miraculin, a taste-modifying protein, was accumulated in transgenic tomatoes using an expression cassette in which the miraculin gene was expressed by the cauliflower mosaic virus (CaMV) 35S promoter and the heat shock protein (HSP) terminator (MIR-HSP). The HSP terminator was derived from heat shock protein 18.2 in Arabidopsis thaliana . Using this HSP-containing cassette, the miraculin concentration in T0 transgenic tomato lines was 1.4-13.9% of the total soluble protein (TSP), and that in the T1 transgenic tomato line homozygous for the miraculin gene reached 17.1% of the TSP. The accumulation level of the target protein was comparable to levels observed with chloroplast transformation. The high-level accumulation of miraculin in T0 transgenic tomato lines achieved by the HSP terminator was maintained in the successive T1 generation, demonstrating the genetic stability of this accumulation system. PMID:21861502

  3. Effects of Defoliating Insect Resistance QTLs and a crylAc Transgene in Soybean Near-Isogenic Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Additional sources of resistance would be desirable to manage defoliating insect resistance to crystal proteins coded by transgenes from Bacillus thuringiensis (Bt) and to sustain the deployment of Bt crops. The objective of this study was to evaluate the effects and interactions of three soybean (G...

  4. Transgenic mouse lines expressing rat AH receptor variants - A new animal model for research on AH receptor function and dioxin toxicity mechanisms

    SciTech Connect

    Pohjanvirta, Raimo

    2009-04-15

    Han/Wistar (Kuopio; H/W) rats are exceptionally resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) toxicity mainly because of their mutated aryl hydrocarbon receptor (AHR) gene. In H/W rats, altered splicing of the AHR mRNA generates two AHR proteins: deletion (DEL) and insertion (INS) variants, with the INS isoform being predominantly expressed. To gain further insight into their functional properties, cDNAs of these and rat wild-type (rWT) isoform were transferred into C57BL/6J-derived mice by microinjection. The endogenous mouse AHR was eliminated by selective crossing with Ahr-null mice. A single mouse line was obtained for each of the three constructs. The AHR mRNA levels in tissues were generally close to those of C57BL/6 mice in INS and DEL mice and somewhat higher in rWT mice; in testis, however, all 3 constructs exhibited marked overexpression. The transgenic mouse lines were phenotypically normal except for increased testis weight. Induction of drug-metabolizing enzymes by TCDD occurred similarly to that in C57BL/6 mice, but there tended to be a correlation with AHR concentrations, especially in testis. In contrast to C57BL/6 mice, the transgenics did not display any major gender difference in susceptibility to the acute lethality and hepatotoxicity of TCDD; rWT mice were highly sensitive, DEL mice moderately resistant and INS mice highly resistant. Co-expression of mouse AHR and rWT resulted in augmented sensitivity to TCDD and abolished the natural resistance of female C57BL/6 mice, whereas mice co-expressing mouse AHR and INS were resistant. Thus, these transgenic mouse lines provide a novel promising tool for molecular studies on dioxin toxicity and AHR function.

  5. Transgenic Pearl Millet Male Fertility Restorer Line (ICMP451) and Hybrid (ICMH451) Expressing Brassica juncea Nonexpressor of Pathogenesis Related Genes 1 (BjNPR1) Exhibit Resistance to Downy Mildew Disease

    PubMed Central

    Khareedu, Venkateswara Rao; Vudem, Dashavantha Reddy

    2014-01-01

    Brassica juncea Nonexpressor of pathogenesis-related genes 1 (BjNPR1) has been introduced into pearl millet male fertility restorer line ICMP451 by Agrobacterium tumefaciens-mediated genetic transformation. Transgenic pearl millet plants were regenerated from the phosphinothricin-resistant calli obtained after co-cultivation with A. tumefaciens strain LBA4404 harbouring Ti plasmid pSB111-bar-BjNPR1. Molecular analyses confirmed the stable integration and expression of BjNPR1 in transgenic pearl millet lines. Transgenes BjNPR1 and bar were stably inherited and disclosed co-segregation in subsequent generations in a Mendelian fashion. Transgenic pearl millet hybrid ICMH451-BjNPR1 was developed by crossing male-sterile line 81A X homozygous transgenic line ICMP451-BjNPR1. T3 and T4 homozygous lines of ICMP451-BjNPR1 and hybrid ICMH451-BjNPR1 exhibited resistance to three strains of downy mildew pathogen, while the untransformed ICMP451 and the isogenic hybrid ICMH451 plants were found susceptible. Following infection with S. graminicola, differential expression of systemic acquired resistance pathway genes, UDP-glucose salicylic acid glucosyl transferase and pathogenesis related gene 1 was observed in transgenic ICMP451-BjNPR1 and untransformed plants indicating the activation of systemic acquired resistance pathway contributing to the transgene-mediated resistance against downy mildew. The transgenic pearl millet expressing BjNPR1 showed resistance to multiple strains of S. graminicola and, as such, seems promising for the development of durable downy mildew resistant hybrids. PMID:24603762

  6. Enhancement of Recombinant Adeno-Associated Virus Type 2-Mediated Transgene Expression in a Lung Epithelial Cell Line by Inhibition of the Epidermal Growth Factor Receptor

    PubMed Central

    Smith, Andrew D.; Collaco, Roy F.; Trempe, James P.

    2003-01-01

    Recombinant adeno-associated viruses (rAAVs) have attracted considerable interest as gene delivery systems because they show long-term expression in vivo and transduce numerous cell types. Limitations to successful gene transduction from rAAVs have prompted investigations of a variety of treatments to enhance transgene expression from rAAV vectors. Tyrphostin-1, an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, dramatically enhances rAAV transgene expression. Elegant studies have demonstrated that a single-strand D-sequence-binding protein (ssDBP) is phosphorylated by EGFR and binds to the D sequence element in the AAV terminal repeat (TR). Binding of the Tyr-phosphorylated ssDBP prevents conversion of single-stranded vector DNA to a double-strand conformation. We observed dramatic increases in transgene expression in lung epithelial cells (IB3) with tyrphostin treatment. Gel shift analysis of ssDBP revealed that its DNA binding characteristics were unchanged after tyrphostin treatment or adenovirus infection. Tyrphostin stimulated rAAV transgene expression to a greater extent than adenovirus coinfection. Southern hybridizations revealed that the vector DNA remained in the single-strand conformation in tyrphostin-treated cells but double-stranded replicative form monomer DNA was most abundant in adenovirus-infected cells. Northern analyses revealed that tyrphostin treatment enhanced mRNA accumulation more than in adenovirus-infected cultures even though replicative form DNA was undetectable. Analysis of the JNK, ERK, and p38K mitogen-activated protein kinase pathways revealed that tyrphostin treatment stimulated the activity of JNK and p38K. Our data suggest that tyrphostin-induced alteration of stress response pathways results in dramatic enhancement of transcription on linear vector DNA templates in the IB3 cell line. These results expand the downstream targets of the EGFR in regulating rAAV transduction. PMID:12743297

  7. Heterologous protein expression by transimmortalized differentiated liver cell lines derived from transgenic mice (hepatomas/alpha 1 antitrypsin/ONC mouse).

    PubMed

    Dalemans, W; Perraud, F; Le Meur, M; Gerlinger, P; Courtney, M; Pavirani, A

    1990-07-01

    A number of therapeutic plasma proteins are synthesized by human hepatocytes. Since many of these proteins undergo liver-specific post-translational modifications which are required for full biological activity, it may therefore be necessary to develop hepatocyte-based expression systems for their production. Using transgenic mice we have developed a transimmortalisation technique for the isolation of differentiated hepatic cell lines, already engineered to secrete human alpha 1 antitrypsin (alpha 1 AT), a plasma protein which is produced mainly in liver cells. This was achieved by co-expression of the mouse c-myc proto-oncogene and a genomic copy of the human alpha 1 AT gene, both under the control of the human alpha 1 AT promoter. Transgenic mice carrying this construct developed hepatomas producing human alpha 1 AT. Under defined culture conditions, cell lines secreting active alpha 1 AT were derived from these tumours. These cells maintain a differentiated hepatic phenotype and continue to secrete human alpha 1 AT for at least 40 generations. PMID:2257132

  8. FlEx-based transgenic reporter lines for visualization of Cre and Flp activity in live zebrafish

    PubMed Central

    Boniface, Emily J.; Lu, Jianjun; Vicotroff, Tristan; Zhu, Meiying; Chen, Wenbiao

    2013-01-01

    Summary Site-specific recombinases such as Cre and Flp are invaluable tools for genetic manipulations, but their usage in zebrafish has been limited. Incorporating recently developed flip-excision (FlEx) design that allows stable inversions, we have established zebrafish reporter lines that express bright and ubiquitous EGFP, but switch to express mCherry in the presence of Cre or Flp. Here, we demonstrate the stable inversion in the reporter lines, both in somatic cells and in the germ line by Cre or Flp, and the subsequent reinversion using the other recombinase. Using the reporter lines, we characterized cardiomyocyte-specific Cre lines and neuronal progenitor-specific and tamoxifen-dependent Cre lines. We also used the reporter lines for screening Cre- and Flp-based enhancer trap lines. Similar to the widely used Cre reporter lines in mice, these FlEx-based reporter lines will facilitate the use of recombinases for genetic manipulations in zebrafish. PMID:19415631

  9. FlEx-based transgenic reporter lines for visualization of Cre and Flp activity in live zebrafish.

    PubMed

    Boniface, Emily J; Lu, Jianjun; Victoroff, Tristan; Zhu, Meiying; Chen, Wenbiao

    2009-07-01

    Site-specific recombinases such as Cre and Flp are invaluable tools for genetic manipulations, but their usage in zebrafish has been limited. Incorporating recently developed flip-excision (FlEx) design that allows stable inversions, we have established zebrafish reporter lines that express bright and ubiquitous EGFP, but switch to express mCherry in the presence of Cre or Flp. Here, we demonstrate the stable inversion in the reporter lines, both in somatic cells and in the germ line by Cre or Flp, and the subsequent reinversion using the other recombinase. Using the reporter lines, we characterized cardiomyocyte-specific Cre lines and neuronal progenitor-specific and tamoxifen-dependent Cre lines. We also used the reporter lines for screening Cre- and Flp-based enhancer trap lines. Similar to the widely used Cre reporter lines in mice, these FlEx-based reporter lines will facilitate the use of recombinases for genetic manipulations in zebrafish.

  10. Efficient generation of marker-free transgenic rice plants using an improved transposon-mediated transgene reintegration strategy.

    PubMed

    Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong; Qu, Shaohong

    2015-01-01

    Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops.

  11. Efficient generation of marker-free transgenic rice plants using an improved transposon-mediated transgene reintegration strategy.

    PubMed

    Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong; Qu, Shaohong

    2015-01-01

    Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops. PMID:25371551

  12. Establishment of transgenic lines to monitor and manipulate Yap/Taz-Tead activity in zebrafish reveals both evolutionarily conserved and divergent functions of the Hippo pathway.

    PubMed

    Miesfeld, Joel B; Link, Brian A

    2014-08-01

    To investigate the role of Hippo pathway signaling during vertebrate development transgenic zebrafish lines were generated and validated to dynamically monitor and manipulate Yap/Taz-Tead activity. Spatial and temporal analysis of Yap/Taz-Tead activity suggested the importance of Hippo signaling during cardiac precursor migration and other developmental processes. When the transcriptional co-activators, Yap and Taz were restricted from interacting with DNA-binding Tead transcription factors through expression of a dominant negative transgene, cardiac precursors failed to migrate completely to the midline resulting in strong cardia bifida. Yap/Taz-Tead activity reporters also allowed us to investigate upstream and downstream factors known to regulate Hippo signaling output in Drosophila. While Crumbs mutations in Drosophila eye disc epithelia increase nuclear translocation and activity of Yorkie (the fly homolog of Yap/Taz), zebrafish crb2a mutants lacked nuclear Yap positive cells and down-regulated Yap/Taz-Tead activity reporters in the eye epithelia, despite the loss of apical-basal cell polarity in those cells. However, as an example of evolutionary conservation, the Tondu-domain containing protein Vestigial-like 4b (Vgll4b) was found to down-regulate endogenous Yap/Taz-Tead activity in the retinal pigment epithelium, similar to Drosophila Tgi in imaginal discs. In conclusion, the Yap/Taz-Tead activity reporters revealed the dynamics of Yap/Taz-Tead signaling and novel insights into Hippo pathway regulation for vertebrates. These studies highlight the utility of this transgenic tool-suite for ongoing analysis into the mechanisms of Hippo pathway regulation and the consequences of signaling output.

  13. Identification of a bipotential precursor cell in hepatic cell lines derived from transgenic mice expressing cyto-Met in the liver.

    PubMed

    Spagnoli, F M; Amicone, L; Tripodi, M; Weiss, M C

    1998-11-16

    Met murine hepatocyte (MMH) lines were established from livers of transgenic mice expressing constitutively active human Met. These lines harbor two cell types: epithelial cells resembling the parental populations and flattened cells with multiple projections and a dispersed growth habit that are designated palmate. Epithelial cells express the liver-enriched transcription factors HNF4 and HNF1alpha, and proteins associated with epithelial cell differentiation. Treatments that modulate their differentiation state, including acidic FGF, induce hepatic functions. Palmate cells show none of these properties. However, they can differentiate along the hepatic cell lineage, giving rise to: (a) epithelial cells that express hepatic transcription factors and are competent to express hepatic functions; (b) bile duct-like structures in three-dimensional Matrigel cultures. Derivation of epithelial from palmate cells is confirmed by characterization of the progeny of individually fished cells. Furthermore, karyotype analysis confirms the direction of the phenotypic transition: palmate cells are diploid and the epithelial cells are hypotetraploid. The clonal isolation of the palmate cell, an immortalized nontransformed bipotential cell that does not yet express the liver-enriched transcription factors and is a precursor of the epithelial-hepatocyte in MMH lines, provides a new tool for the study of mechanisms controlling liver development. PMID:9817765

  14. Characterization of the BAC Id3-enhanced green fluorescent protein transgenic mouse line for in vivo imaging of astrocytes

    PubMed Central

    Lamantia, Cassandra; Tremblay, Marie-Eve; Majewska, Ania

    2014-01-01

    Abstract. Astrocytes are highly ramified glial cells with critical roles in brain physiology and pathology. Recently, breakthroughs in imaging technology have expanded our understanding of astrocyte function in vivo. The in vivo study of astrocytic dynamics, however, is limited by the tools available to label astrocytes and their processes. Here, we characterize the bacterial artificial chromosome transgenic Id3-EGFP knock-in mouse to establish its usefulness for in vivo imaging of astrocyte processes. Using fixed brain sections, we observed enhanced green fluorescent protein expression in astrocytes and blood vessel walls throughout the brain, although the extent and cell type specificity of expression depended on the brain area and developmental age. Using in vivo two-photon imaging, we visualized astrocytes in cortical layers 1–3 in both thin skull and window preparations. In adult animals, astrocytic cell bodies and fine processes could be followed over many hours. Our results suggest that Id3 mice could be used for in vivo imaging of astrocytes and blood vessels in development and adulthood. PMID:26157970

  15. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    PubMed

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  16. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    PubMed

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow. PMID:26975052

  17. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor

    PubMed Central

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow. PMID:26975052

  18. Agonistic effect of selected isoflavones on arylhydrocarbon receptor in a novel AZ-AhR transgenic gene reporter human cell line.

    PubMed

    Bialesova, Lucia; Novotna, Aneta; Macejova, Dana; Brtko, Julius; Dvorak, Zdenek

    2015-07-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that controls the expression of a diverse set of genes. Structurally diverse compounds bind to AhR and act as AhR agonists. Well characterised family of natural AhR ligands are isoflavones, which are compounds found predominantly in soy beans or red clover. In this study we have examined agonistic effect of selected isoflavones (genistein, daidzein, biochanin A, formononetin and equol) on AhR in the novel transgenic gene reporter human cell line AZ-AhR, a stably transfected AhR-responsive cell line allowing rapid and sensitive assessment of AhR transcriptional activity. We demonstrated that biochanin A, formononetin and genistein at concentration 10(-4) mol/l exerted agonistic effects on AhR with fold activation of 309- fold, 108-fold and 27-fold, which is about 84.8%, 29.6% and 7.4%, respectively, of the value attained by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Daidzein and equol did not show any significant effects on AhR. PMID:25926549

  19. Testing Transgenic Spring Wheat and Barley Lines for Reaction to Fusarium Head Blight: 2010 Field Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2010 field screening nursery, with 88 barley plots was located at UMore Park, Rosemount MN. Trial entries (n=18) and an the untransformed 2-row control Conlon (susceptible) were submitted by USDA-ARS, RRVARC Fargo. Barley lines with known reactions to Fusarium head blight (FHB) were also incl...

  20. Testing Transgenic Spring Wheat and Barley Lines for Reaction to Fusarium Head Blight: 2009 Field Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2009 field screening nursery, with 128 wheat and 208 barley plots was located at UMore Park, Rosemount MN. Trial entries and untransformed controls were submitted by the University of Minnesota (19+1 wheat), the Donald Danforth Plant Science Center (4+2 wheat) and USDA (48+1 barley). Lines wit...

  1. Additive transgene expression and genetic introgression in multiple green-fluorescent protein transgenic crop x weed hybrid generations.

    PubMed

    Halfhill, M D; Millwood, R J; Weissinger, A K; Warwick, S I; Stewart, C N

    2003-11-01

    The level of transgene expression in crop x weed hybrids and the degree to which crop-specific genes are integrated into hybrid populations are important factors in assessing the potential ecological and agricultural risks of gene flow associated with genetic engineering. The average transgene zygosity and genetic structure of transgenic hybrid populations change with the progression of generations, and the green fluorescent protein (GFP) transgene is an ideal marker to quantify transgene expression in advancing populations. The homozygous T(1) single-locus insert GFP/ Bacillus thuringiensis (Bt) transgenic canola ( Brassica napus, cv Westar) with two copies of the transgene fluoresced twice as much as hemizygous individuals with only one copy of the transgene. These data indicate that the expression of the GFP gene was additive, and fluorescence could be used to determine zygosity status. Several hybrid generations (BC(1)F(1), BC(2)F(1)) were produced by backcrossing various GFP/Bt transgenic canola ( B. napus, cv Westar) and birdseed rape ( Brassica rapa) hybrid generations onto B. rapa. Intercrossed generations (BC(2)F(2) Bulk) were generated by crossing BC(2)F(1) individuals in the presence of a pollinating insect ( Musca domestica L.). The ploidy of plants in the BC(2)F(2) Bulk hybrid generation was identical to the weedy parental species, B. rapa. AFLP analysis was used to quantify the degree of B. napus introgression into multiple backcross hybrid generations with B. rapa. The F(1) hybrid generations contained 95-97% of the B. napus-specific AFLP markers, and each successive backcross generation demonstrated a reduction of markers resulting in the 15-29% presence in the BC(2)F(2) Bulk population. Average fluorescence of each successive hybrid generation was analyzed, and homozygous canola lines and hybrid populations that contained individuals homozygous for GFP (BC(2)F(2) Bulk) demonstrated significantly higher fluorescence than hemizygous hybrid

  2. Additive transgene expression and genetic introgression in multiple green-fluorescent protein transgenic crop x weed hybrid generations.

    PubMed

    Halfhill, M D; Millwood, R J; Weissinger, A K; Warwick, S I; Stewart, C N

    2003-11-01

    The level of transgene expression in crop x weed hybrids and the degree to which crop-specific genes are integrated into hybrid populations are important factors in assessing the potential ecological and agricultural risks of gene flow associated with genetic engineering. The average transgene zygosity and genetic structure of transgenic hybrid populations change with the progression of generations, and the green fluorescent protein (GFP) transgene is an ideal marker to quantify transgene expression in advancing populations. The homozygous T(1) single-locus insert GFP/ Bacillus thuringiensis (Bt) transgenic canola ( Brassica napus, cv Westar) with two copies of the transgene fluoresced twice as much as hemizygous individuals with only one copy of the transgene. These data indicate that the expression of the GFP gene was additive, and fluorescence could be used to determine zygosity status. Several hybrid generations (BC(1)F(1), BC(2)F(1)) were produced by backcrossing various GFP/Bt transgenic canola ( B. napus, cv Westar) and birdseed rape ( Brassica rapa) hybrid generations onto B. rapa. Intercrossed generations (BC(2)F(2) Bulk) were generated by crossing BC(2)F(1) individuals in the presence of a pollinating insect ( Musca domestica L.). The ploidy of plants in the BC(2)F(2) Bulk hybrid generation was identical to the weedy parental species, B. rapa. AFLP analysis was used to quantify the degree of B. napus introgression into multiple backcross hybrid generations with B. rapa. The F(1) hybrid generations contained 95-97% of the B. napus-specific AFLP markers, and each successive backcross generation demonstrated a reduction of markers resulting in the 15-29% presence in the BC(2)F(2) Bulk population. Average fluorescence of each successive hybrid generation was analyzed, and homozygous canola lines and hybrid populations that contained individuals homozygous for GFP (BC(2)F(2) Bulk) demonstrated significantly higher fluorescence than hemizygous hybrid

  3. Generation and Characterisation of a Pax8-CreERT2 Transgenic Line and a Slc22a6-CreERT2 Knock-In Line for Inducible and Specific Genetic Manipulation of Renal Tubular Epithelial Cells.

    PubMed

    Espana-Agusti, Judit; Zou, Xiangang; Wong, Kim; Fu, Beiyuan; Yang, Fengtang; Tuveson, David A; Adams, David J; Matakidou, Athena

    2016-01-01

    Genetically relevant mouse models need to recapitulate the hallmarks of human disease by permitting spatiotemporal gene targeting. This is especially important for replicating the biology of complex diseases like cancer, where genetic events occur in a sporadic fashion within developed somatic tissues. Though a number of renal tubule targeting mouse lines have been developed their utility for the study of renal disease is limited by lack of inducibility and specificity. In this study we describe the generation and characterisation of two novel mouse lines directing CreERT2 expression to renal tubular epithelia. The Pax8-CreERT2 transgenic line uses the mouse Pax8 promoter to direct expression of CreERT2 to all renal tubular compartments (proximal and distal tubules as well as collecting ducts) whilst the Slc22a6-CreERT2 knock-in line utilises the endogenous mouse Slc22a6 locus to specifically target the epithelium of proximal renal tubules. Both lines show high organ and tissue specificity with no extrarenal activity detected. To establish the utility of these lines for the study of renal cancer biology, Pax8-CreERT2 and Slc22a6-CreERT2 mice were crossed to conditional Vhl knockout mice to induce long-term renal tubule specific Vhl deletion. These models exhibited renal specific activation of the hypoxia inducible factor pathway (a VHL target). Our results establish Pax8-CreERT2 and Slc22a6-CreERT2 mice as valuable tools for the investigation and modelling of complex renal biology and disease. PMID:26866916

  4. Re-interpreting some common objections to three transgenic applications: GM foods, xenotransplantation and germ line gene modification (GLGM).

    PubMed

    Carter, Lucy

    2004-12-01

    Concerns about safety to the individual, the wider community and the potential impact on the environment are typical consequentialist objections to transgenesis that feature prominently in public debates about its ethical acceptability. I consider some of these claims with respect to their motivation, validity and their overall influence on public policy using three well-discussed applications of transgenesis: GM foods, xenotransplantation and germ line gene modification (GLGM).

  5. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons

    PubMed Central

    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua

    2016-01-01

    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  6. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons.

    PubMed

    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua

    2016-01-01

    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  7. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack)

    PubMed Central

    2012-01-01

    Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT) and a synthetic green fluorescent protein gene (gfp). Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants. PMID:23006412

  8. The substantive equivalence of transgenic (Bt and Chi) and non-transgenic cotton based on metabolite profiles.

    PubMed

    Modirroosta, Bentol Hoda; Tohidfar, Masoud; Saba, Jalal; Moradi, Foad

    2014-03-01

    Compositional studies comparing transgenic with non-transgenic counterpart plants are almost universally required by governmental regulatory bodies. In the present study, two T(2) transgenic cotton lines containing chitinase (Line 11/57) and Bt lines (Line 61) were compared with non-transgenic counterpart. To do this, biochemical characteristics of leaves and seeds, including amino acids, fatty acids, carbohydrates, anions, and cations contents of the studied lines were analyzed using GC/MS, high-performance liquid chromatography (HPLC), and ion chromatography (IC) analyzers, respectively. polymerase chain reaction (PCR) and Western blot analyses confirmed the presence and expression of Chi and Bt genes in the studied transgenic lines. Although, compositional analysis of leaves contents confirmed no significant differences between transgenic and non-transgenic counterpart lines, but it was shown that glucose content of chitinase lines, fructose content of transgenic lines (Bt and chitinase) and asparagine and glutamine of chitinase lines were significantly higher than the non-transgenic counterpart plants. Both the transgenic lines (Bt and chitinase) showed significant decrease in the amounts of sodium in comparison to the non-transgenic counterpart plants. The experiments on the seeds showed that histidine, isoleucine, leucine, and phenylalanine contents of all transgenic and non-transgenic lines were the same, whereas other amino acids were significantly increased in the transgenic lines. Surprisingly, it was observed that the concentrations of stearic acid, myristic acid, oleic acid, and linoleic acid in the chitinase line were significantly different than those of non-transgenic counterpart plants, but these components were the same in both Bt line and its non-transgenic counterpart. It seems that more changes observed in the seed contents than leaves is via this point that seeds are known as metabolites storage organs, so they show greater changes in the

  9. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na+/H+ Antiporter Gene Compared to 1.9 kb Coding Region with 5′ UTR in Transgenic Lines of Rice

    PubMed Central

    Amin, U. S. M.; Biswas, Sudip; Elias, Sabrina M.; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I.

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na+/H+ antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5′ UTR with CDS and the other of 2.3 kb, including 5′ UTR, CDS, and the 3′ UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5′ and 3′ UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3′ UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P < 0.05) and the electrolyte leakage significantly lower (P < 0.05) in the order 2.3 kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P < 0.01) compared, respectively, to the best 1.9 kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance. PMID:26834778

  10. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    PubMed

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P < 0.05) and the electrolyte leakage significantly lower (P < 0.05) in the order 2.3 kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P < 0.01) compared, respectively, to the best 1.9 kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance. PMID:26834778

  11. Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

    PubMed

    Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

    2005-04-01

    Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants.

  12. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  13. Human papillomavirus type 16 E7 oncoprotein upregulates the retinoic acid receptor-beta expression in cervical cancer cell lines and K14E7 transgenic mice.

    PubMed

    Gutiérrez, Jorge; García-Villa, Enrique; Ocadiz-Delgado, Rodolfo; Cortés-Malagón, Enoc M; Vázquez, Juan; Roman-Rosales, Alejandra; Alvarez-Rios, Elizabeth; Celik, Haydar; Romano, Marta C; Üren, Aykut; Lambert, Paul F; Gariglio, Patricio

    2015-10-01

    Persistent infection with high-risk human papillomaviruses is the main etiological factor in cervical cancer (CC). The human papillomavirus type 16 (HPV16) E7 oncoprotein alters several cellular processes, regulating the expression of many genes in order to avoid cell cycle control. Retinoic acid receptor beta (RARB) blocks cell growth, inducing differentiation and apoptosis. This tumor suppressor gene is gradually silenced in late passages of foreskin keratinocytes immortalized with HPV16 and in various tumors, including CC, mainly by epigenetic modifications. We investigated the effect of E7 oncoprotein on RARB gene expression. We found that HPV16 E7 increases RARB mRNA and RAR-beta protein expression both in vitro and in the cervix of young K14E7 transgenic mice. In E7-expressing cells, RARB overexpression is further increased in the presence of the tumor suppressor p53 (TP53) R273C mutant. This effect does not change when either C33-A or E7-expressing C33-A cell line is treated with Trichostatin A, suggesting that E7 enhances RARB expression independently of histone deacetylases inhibition. These findings indicate that RARB overexpression is part of the early molecular events induced by the E7 oncoprotein.

  14. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  15. An inbred line of transgenic mice expressing an internally deleted gene for type II procollagen (COL2A1). Young mice have a variable phenotype of a chondrodysplasia and older mice have osteoarthritic changes in joints.

    PubMed Central

    Helminen, H J; Kiraly, K; Pelttari, A; Tammi, M I; Vandenberg, P; Pereira, R; Dhulipala, R; Khillan, J S; Ala-Kokko, L; Hume, E L

    1993-01-01

    Studies were carried out on a line of transgenic mice that expressed an internally deleted COL2A1 gene and developed a phenotype resembling human chondrodysplasias (Vandenberg et al. 1991. Proc. Natl. Acad. Sci. USA. 88:7640-7644. Marked differences in phenotype were observed with propagation of the mutated gene in an inbred strain of mice in that approximately 15% of the transgenic mice had a cleft palate and a lethal phenotype, whereas the remaining mice were difficult to distinguish from normal littermates. 1-d- and 3-mo-old transgenic mice that were viable showed microscopic signs of chondrodysplasia with reduced amounts of collagen fibrils in the cartilage matrix, dilatation of the rough surfaced endoplasmic reticulum in the chondrocytes, and decrease of optical path difference in polarized light microscopy. The transgenic mice also showed signs of disturbed growth as evidenced by lower body weight, lower length and weight of the femur, decreased bone collagen, decreased bone mineral, and decreased resistance of bone to breakage. Comparisons of mice ranging in age from 1 d to 15 mo demonstrated that there was decreasing evidence of a chondrodysplasia as the mice grew older. Instead, the most striking feature in the 15-mo-old mice were degenerative changes of articular cartilage similar to osteoarthritis. Images PMID:8349798

  16. Morphological analysis of the early development of telencephalic and diencephalic gonadotropin-releasing hormone neuronal systems in enhanced green fluorescent protein-expressing transgenic medaka lines.

    PubMed

    Takahashi, Akiko; Islam, M Sadiqul; Abe, Hideki; Okubo, Kataaki; Akazome, Yasuhisa; Kaneko, Takeshi; Hioki, Hiroyuki; Oka, Yoshitaka

    2016-03-01

    Teleosts possess two or three paralogs of gonadotropin-releasing hormone (GnRH) genes: gnrh1, gnrh2, and gnrh3. Some species have lost the gnrh1 and/or gnrh3 genes, whereas gnrh2 has been completely conserved in the teleost species analyzed to date. In most teleosts that possess gnrh1, GnRH1 peptide is the authentic GnRH that stimulates gonadotropin release, whereas GnRH2 and GnRH3, if present, are neuromodulatory. Progenitors of GnRH1 and GnRH3 neurons originate from olfactory placodes and migrate to their destination during early development. However, because of the relatively low affinity/specificity of generally available antibodies that recognize GnRH1 or GnRH3, labeling of these neurons has only been possible using genetic manipulation. We used a model teleost, medaka, which possesses all three paralogous gnrh genes, to analyze development of forebrain GnRH neurons composed of GnRH1 and GnRH3 neurons. Here, we newly generated transgenic medaka lines that express enhanced green fluorescent protein under the control of promoters for gnrh1 or gnrh3, to detect GnRH neurons and facilitate immunohistochemical analysis of the neuronal morphology. We used a combination of immunohistochemistry and three-dimensional confocal microscopy image reconstructions to improve identification of neurites from GnRH1 or GnRH3 neuronal populations with greater precision. This led us to clearly identify the hypophysiotropic innervation of GnRH1 neurons residing in the ventral preoptic area (vPOA) from as early as 10 days post hatching. Furthermore, these analyses also revealed retinopetal projections of nonhypophysiotropic GnRH1 neurons in vPOA, prominent during early developmental stages, and multiple populations of GnRH3 neurons with different origins and migratory pathways.

  17. Transgenic expression of human glial cell line-derived neurotrophic factor from integration-deficient lentiviral vectors is neuroprotective in a rodent model of Parkinson's disease.

    PubMed

    Lu-Nguyen, Ngoc B; Broadstock, Martin; Schliesser, Maximilian G; Bartholomae, Cynthia C; von Kalle, Christof; Schmidt, Manfred; Yáñez-Muñoz, Rafael J

    2014-07-01

    Standard integration-proficient lentiviral vectors (IPLVs) are effective at much lower doses than other vector systems and have shown promise for gene therapy of Parkinson's disease (PD). Their main drawback is the risk of insertional mutagenesis. The novel biosafety-enhanced integration-deficient lentiviral vectors (IDLVs) may offer a significant enhancement in biosafety, but have not been previously tested in a model of a major disease. We have assessed biosafety and transduction efficiency of IDLVs in a rat model of PD, using IPLVs as a reference. Genomic insertion of lentivectors injected into the lesioned striatum was studied by linear amplification-mediated polymerase chain reaction (PCR), followed by deep sequencing and insertion site analysis, demonstrating lack of significant IDLV integration. Reporter gene expression studies showed efficient, long-lived, and transcriptionally targeted expression from IDLVs injected ahead of lesioning in the rat striatum, although at somewhat lower expression levels than from IPLVs. Transgenic human glial cell line-derived neurotrophic factor (hGDNF) expression from IDLVs was used for a long-term investigation of lentivector-mediated, transcriptionally targeted neuroprotection in this PD rat model. Vectors were injected before striatal lesioning, and the results showed improvements in nigral dopaminergic neuron survival and behavioral tests regardless of lentiviral integration proficiency, although they confirmed lower expression levels of hGDNF from IDLVs. These data demonstrate the effectiveness of IDLVs in a model of a major disease and indicate that these vectors could provide long-term PD treatment at low dose, combining efficacy and biosafety for targeted central nervous system applications.

  18. Morphological analysis of the early development of telencephalic and diencephalic gonadotropin-releasing hormone neuronal systems in enhanced green fluorescent protein-expressing transgenic medaka lines.

    PubMed

    Takahashi, Akiko; Islam, M Sadiqul; Abe, Hideki; Okubo, Kataaki; Akazome, Yasuhisa; Kaneko, Takeshi; Hioki, Hiroyuki; Oka, Yoshitaka

    2016-03-01

    Teleosts possess two or three paralogs of gonadotropin-releasing hormone (GnRH) genes: gnrh1, gnrh2, and gnrh3. Some species have lost the gnrh1 and/or gnrh3 genes, whereas gnrh2 has been completely conserved in the teleost species analyzed to date. In most teleosts that possess gnrh1, GnRH1 peptide is the authentic GnRH that stimulates gonadotropin release, whereas GnRH2 and GnRH3, if present, are neuromodulatory. Progenitors of GnRH1 and GnRH3 neurons originate from olfactory placodes and migrate to their destination during early development. However, because of the relatively low affinity/specificity of generally available antibodies that recognize GnRH1 or GnRH3, labeling of these neurons has only been possible using genetic manipulation. We used a model teleost, medaka, which possesses all three paralogous gnrh genes, to analyze development of forebrain GnRH neurons composed of GnRH1 and GnRH3 neurons. Here, we newly generated transgenic medaka lines that express enhanced green fluorescent protein under the control of promoters for gnrh1 or gnrh3, to detect GnRH neurons and facilitate immunohistochemical analysis of the neuronal morphology. We used a combination of immunohistochemistry and three-dimensional confocal microscopy image reconstructions to improve identification of neurites from GnRH1 or GnRH3 neuronal populations with greater precision. This led us to clearly identify the hypophysiotropic innervation of GnRH1 neurons residing in the ventral preoptic area (vPOA) from as early as 10 days post hatching. Furthermore, these analyses also revealed retinopetal projections of nonhypophysiotropic GnRH1 neurons in vPOA, prominent during early developmental stages, and multiple populations of GnRH3 neurons with different origins and migratory pathways. PMID:26287569

  19. Enhanced cadmium-induced testicular necrosis and renal proximal tubule damage caused by gene-dose increase in a Slc39a8-transgenic mouse line.

    PubMed

    Wang, Bin; Schneider, Scott N; Dragin, Nadine; Girijashanker, Kuppuswami; Dalton, Timothy P; He, Lei; Miller, Marian L; Stringer, Keith F; Soleimani, Manoocher; Richardson, Douglas D; Nebert, Daniel W

    2007-04-01

    Resistance to cadmium (Cd)-induced testicular necrosis is an autosomal recessive trait defined as the Cdm locus. Using positional cloning, we previously identified the Slc39a8 (encoding an apical-surface ZIP8 transporter protein) as the gene most likely responsible for the phenotype. In situ hybridization revealed that endothelial cells of the testis vasculature express high ZIP8 levels in two sensitive inbred mouse strains and negligible amounts in two resistant strains. In the present study, we isolated a 168.7-kb bacterial artificial chromosome (BAC), carrying only the Slc39a8 gene, from a Cd-sensitive 129/SvJ BAC library and generated BAC-transgenic mice. The BTZIP8-3 line, having three copies of the 129/SvJ Slc39a8 gene inserted into the Cd-resistant C57BL/6J genome (having its normal two copies of the Slc39a8 gene), showed tissue-specific ZIP8 mRNA expression similar to wild-type mice, mainly in lung, testis, and kidney. The approximately 2.5-fold greater expression paralleled the fact that the BTZIP8-3 line has five copies, whereas wild-type mice have two copies, of the Slc39a8 gene. The ZIP8 mRNA and protein localized especially to endothelial cells of the testis vasculature in BTZIP8-3 mice. Cd treatment reversed Cd resistance (seen in nontransgenic littermates) to Cd sensitivity in BTZIP8-3 mice; reversal of the testicular necrosis phenotype confirms that Slc39a8 is unequivocally the Cdm locus. ZIP8 also localized specifically to the apical surface of proximal tubule cells in the BTZIP8-3 kidney. Cd treatment caused acute renal failure and signs of proximal tubular damage in the BTZIP8-3 but not nontransgenic littermates. BTZIP8-3 mice should be a useful model for studying Cd-induced disease in kidney. PMID:17108009

  20. Transgenic Animals.

    ERIC Educational Resources Information Center

    Jaenisch, Rudolf

    1988-01-01

    Describes three methods and their advantages and disadvantages for introducing genes into animals. Discusses the predictability and tissue-specificity of the injected genes. Outlines the applications of transgenic technology for studying gene expression, the early stages of mammalian development, mutations, and the molecular nature of chromosomes.…

  1. Improved Nutritive Quality and Salt Resistance in Transgenic Maize by Simultaneously Overexpression of a Natural Lysine-Rich Protein Gene, SBgLR, and an ERF Transcription Factor Gene, TSRF1

    PubMed Central

    Wang, Meizhen; Liu, Chen; Li, Shixue; Zhu, Dengyun; Zhao, Qian; Yu, Jingjuan

    2013-01-01

    Maize (Zea mays L.), as one of the most important crops in the world, is deficient in lysine and tryptophan. Environmental conditions greatly impact plant growth, development and productivity. In this study, we used particle bombardment mediated co-transformation to obtain marker-free transgenic maize inbred X178 lines harboring a lysine-rich protein gene SBgLR from potato and an ethylene responsive factor (ERF) transcription factor gene, TSRF1, from tomato. Both of the target genes were successfully expressed and showed various expression levels in different transgenic lines. Analysis showed that the protein and lysine content in T1 transgenic maize seeds increased significantly. Compared to non-transformed maize, the protein and lysine content increased by 7.7% to 24.38% and 8.70% to 30.43%, respectively. Moreover, transgenic maize exhibited more tolerance to salt stress. When treated with 200 mM NaCl for 48 h, both non-transformed and transgenic plant leaves displayed wilting and losing green symptoms and dramatic increase of the free proline contents. However, the degree of control seedlings was much more serious than that of transgenic lines and much more increases of the free proline contents in the transgenic lines than that in the control seedlings were observed. Meanwhile, lower extent decreases of the chlorophyll contents were detected in the transgenic seedlings. Quantitative RT-PCR was performed to analyze the expression of ten stress-related genes, including stress responsive transcription factor genes, ZmMYB59 and ZmMYC1, proline synthesis related genes, ZmP5CS1 and ZmP5CS2, photosynthesis-related genes, ZmELIP, ZmPSI-N, ZmOEE, Zmrbcs and ZmPLAS, and one ABA biosynthesis related gene, ZmSDR. The results showed that with the exception of ZmP5CS1 and ZmP5CS2 in line 9–10 and 19–11, ZmMYC1 in line 19–11 and ZmSDR in line 19–11, the expression of other stress-related genes were inhibited in transgenic lines under normal conditions. After salt

  2. T1 Adenocarcinoma of the Rectum

    PubMed Central

    Bentrem, David J.; Okabe, Satoshi; Wong, W Douglas; Guillem, Jose G.; Weiser, Martin R.; Temple, Larissa K.; Ben-Porat, Leah S.; Minsky, Bruce D.; Cohen, Alfred M.; Paty, Philip B.

    2005-01-01

    Background: Recent studies suggest local excision may be acceptable treatment of T1 adenocarcinoma of the rectum, but there is little comparative data with radical surgery to assess outcomes and quantify risk. We performed a retrospective evaluation of patients with T1 rectal cancers treated by either transanal excision or radical resection at our institution to assess patient selection, cancer recurrence, and survival. Methods: All patients who underwent surgery for T1 adenocarcinomas of the rectum (0–15 cm from anal verge) by either transanal excision (TAE) or radical resection (RAD) between January 1987 and January 2004 were identified from a prospective database. Data were analyzed using Fisher exact test, Kaplan-Meier method, and log-rank test. Results: Three hundred nineteen consecutive patients with T1 lesions were treated by transanal excision (n = 151) or radical surgery (n = 168) over the 17-year period. RAD surgery was associated with higher tumor location in the rectum, slightly larger tumor size, a similar rate of adverse histology, and a lymph node metastasis rate of 18%. Despite these features, patients who underwent RAD surgery had fewer local recurrences, fewer distant recurrences, and significantly better recurrence-free survival (P = 0.0001). Overall and disease-specific survival was similar for RAD and TAE groups. Conclusion: Despite a similar risk profile in the 2 surgical groups, patients with T1 rectal cancer treated by local excision were observed to have a 3- to 5-fold higher risk of tumor recurrence compared with patients treated by radical surgery. Local excision should be reserved for low-risk cancers in patients who will accept an increased risk of tumor recurrence, prolonged surveillance, and possible need for aggressive salvage surgery. Radical resection is the more definitive surgical treatment of T1 rectal cancers. PMID:16192807

  3. Every silver lining has a cloud: the scientific and animal welfare issues surrounding a new approach to the production of transgenic animals.

    PubMed

    Combes, Robert D; Balls, Michael

    2014-05-01

    The scientific basis and advantages of using recently developed CRISPR/Cas-9 technology for transgenesis have been assessed with respect to other production methods, laboratory animal welfare, and the scientific relevance of transgenic models of human diseases in general. As the new technology is straightforward, causes targeted DNA double strand breaks and can result in homozygous changes in a single step, it is more accurate and more efficient than other production methods and speeds up transgenesis. CRISPR/Cas-9 also obviates the use of embryonic stem cells, and is being used to generate transgenic non-human primates (NHPs). While the use of this method reduces the level of animal wastage resulting from the production of each new strain, any long-term contribution to reduction will be offset by the overall increase in the numbers of transgenic animals likely to result from its widespread usage. Likewise, the contribution to refinement of using a more-precise technique, thereby minimising the occurrence of unwanted genetic effects, will be countered by a probable substantial increase in the production of transgenic strains of increasingly sentient species. For ethical and welfare reasons, we believe that the generation of transgenic NHPs should be allowed only in extremely exceptional circumstances. In addition, we present information, which, on both welfare and scientific grounds, leads us to question the current policy of generating ever-more new transgenic models in light of the general failure of many of them, after over two decades of ubiquitous use, to result in significant advances in the understanding and treatment of many key human diseases. Because this unsatisfactory situation is likely to be due to inherent, as well as possibly avoidable, limitations in the transgenic approach to studying disease, which are briefly reviewed, it is concluded that a thorough reappraisal of the rationale for using genetically-altered animals in fundamental research and

  4. Advanced Colloids Experiment (ACE-T1)

    NASA Technical Reports Server (NTRS)

    Meyer, William V.; Sicker, Ron; Brown, Dan; Eustace, John

    2015-01-01

    Increment 45 - 46 Science Symposium presentation of Advanced Colloids Experiment (ACE-T1) to RPO. The purpose of this event is for Principal Investigators to present their science objectives, testing approach, and measurement methods to agency scientists, managers, and other investigators.

  5. [Transgenic plants].

    PubMed

    Blum, H E

    2002-12-01

    Advances in molecular genetics and recombinant DNA technology have revolutionized our understanding of the pathogenesis as well as the diagnosis, therapy and prevention of human diseases. Similar developments characterize plant biotechnology with the production of plant derived biomedical as well as health products. Apart from the fundamentals of molecular plant genetics, the production of transgenic plants as well as the clinical relevance, benefits, limitations and potential problems of plant biotechnology will be reviewed in some detail. It is a particular challenge to physicians in an increasingly informed environment to be informed about the new developments in molecular biology and recombinant DNA technology and to have a qualified opinion about their clinical relevance.

  6. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  7. Dose correction for post-contrast T1 mapping of the heart: the MESA study.

    PubMed

    Gai, Neville D; Sandfort, Veit; Liu, Songtao; Lima, João A C; Bluemke, David A

    2016-02-01

    value normalized myocardium). Weight-based contrast dosing administered in mmol/kg results in a bias in T1 values which can lead to erroneous conclusions. After adjustment for lean muscle mass based on plasma volume, results from T1(myo,c) were in line with ECV derived results. Furthermore, the use of a modified equivalent dose adjusted for BMI, age, sex and hematocrit can be adopted for quantitative imaging. PMID:26362875

  8. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.

    PubMed

    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru

    2016-10-01

    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding. PMID:27055463

  9. Transgenic peppers that are highly tolerant to a new CMV pathotype.

    PubMed

    Lee, Yun Hee; Jung, Min; Shin, Sun Hee; Lee, Ji Hee; Choi, Soon Ho; Her, Nam Han; Lee, Jang Ha; Ryu, Ki Hyun; Paek, Kee Yoeup; Harn, Chee Hark

    2009-02-01

    The CMV (cucumber mosaic virus) is the most frequently occurring virus in chili pepper farms. A variety of peppers that are resistant to CMVP0 were developed in the middle of 1990s through a breeding program, and commercial cultivars have since been able to control the spread of CMVP0. However, a new pathotype (CMVP1) that breaks the resistance of CMVP0-resistant peppers has recently appeared and caused a heavy loss in productivity. Since no genetic source of this new pathotype was available, a traditional breeding method cannot be used to generate a CMVP1-resistant pepper variety. Therefore, we set up a transformation system of pepper using Agrobacterium that had been transfected with the coat protein gene, CMVP0-CP, with the aim of developing a new CMVP1-resistant pepper line. A large number of transgenic peppers (T(1), T(2) and T(3)) were screened for CMVP1 tolerance using CMVP1 inoculation. Transgenic peppers tolerant to CMVP1 were selected in a plastic house as well as in the field. Three independent T(3) pepper lines highly tolerant to the CMVP1 pathogen were found to also be tolerant to the CMVP0 pathogen. These selected T(3) pepper lines were phenotypically identical or close to the non-transformed lines. However, after CMVP1 infection, the height and fruit size of the non-transformed lines became shorter and smaller, respectively, while the T(3) pepper lines maintained a normal phenotype.

  10. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  11. Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3.

    PubMed

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

  12. Transgenic mouse offspring generated by ROSI

    PubMed Central

    MOREIRA, Pedro; PÉREZ-CEREZALES, Serafín; LAGUNA, Ricardo; FERNÁNDEZ-GONZALEZ, Raúl; SANJUANBENITO, Belén Pintado; GUTIÉRREZ-ADÁN, Alfonso

    2015-01-01

    The production of transgenic animals is an important tool for experimental and applied biology. Over the years, many approaches for the production of transgenic animals have been tried, including pronuclear microinjection, sperm-mediated gene transfer, transfection of male germ cells, somatic cell nuclear transfer and the use of lentiviral vectors. In the present study, we developed a new transgene delivery approach, and we report for the first time the production of transgenic animals by co-injection of DNA and round spermatid nuclei into non-fertilized mouse oocytes (ROSI). The transgene used was a construct containing the human CMV immediate early promoter and the enhanced GFP gene. With this procedure, 12% of the live offspring we obtained carried the transgene. This efficiency of transgenic production by ROSI was similar to the efficiency by pronuclear injection or intracytoplasmic injection of male gamete nuclei (ICSI). However, ICSI required fewer embryos to produce the same number of transgenic animals. The expression of Egfp mRNA and fluorescence of EGFP were found in the majority of the organs examined in 4 transgenic lines generated by ROSI. Tissue morphology and transgene expression were not distinguishable between transgenic animals produced by ROSI or pronuclear injection. Furthermore, our results are of particular interest because they indicate that the transgene incorporation mediated by intracytoplasmic injection of male gamete nuclei is not an exclusive property of mature sperm cell nuclei with compact chromatin but it can be accomplished with immature sperm cell nuclei with decondensed chromatin as well. The present study also provides alternative procedures for transgene delivery into embryos or reconstituted oocytes. PMID:26498042

  13. Inorganic nanoparticle-based T1 and T1/T2 magnetic resonance contrast probes

    NASA Astrophysics Data System (ADS)

    Hu, Fengqin; Zhao, Yong Sheng

    2012-09-01

    Magnetic resonance imaging (MRI) yields high spatially resolved contrast with anatomical details for diagnosis, deeper penetration depth and rapid 3D scanning. To improve imaging sensitivity, adding contrast agents accelerates the relaxation rate of water molecules, thereby greatly increasing the contrast between specific issues or organs of interest. Currently, the majority of T1 contrast agents are paramagnetic molecular complexes, typically Gd(iii) chelates. Various nanoparticulate T1 and T1/T2 contrast agents have recently been investigated as novel agents possessing the advantages of both the T1 contrast effect and nanostructural characteristics. In this minireview, we describe the recent progress of these inorganic nanoparticle-based MRI contrast agents. Specifically, we mainly report on Gd and Mn-based inorganic nanoparticles and ultrasmall iron oxide/ferrite nanoparticles.

  14. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    PubMed Central

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  15. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

    PubMed

    de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  16. A transgenic line with Gal4 insertion useful to study morphogenesis of craniofacial perichondrium, vascular endothelium-associated cells, floor plate, and dorsal midline radial glia during zebrafish development

    PubMed Central

    Nakayama, Sohei; Ikenaga, Takanori; Kawakami, Koichi; Ono, Fumihito; Hatta, Kohei

    2013-01-01

    Zebrafish is a good model for studying vertebrate development because of the availability of powerful genetic tools. We are interested in the study of the craniofacial skeletal structure of the zebrafish. For this purpose, we performed a gene trap screen and identified a Gal4 gene trap line, SAGFF(LF)134A. We then analyzed the expression pattern of SAGFF(LF)134A;Tg(UAS:GFP) and found that GFP was expressed not only in craniofacial skeletal elements but also in the vascular system, as well as in the nervous system. In craniofacial skeletal elements, strong GFP expression was detected not only in chondrocytes but also in the perichondrium. In the vascular system, GFP was expressed in endothelium-associated cells. In the spinal cord, strong GFP expression was found in the floor plate, and later in the dorsal radial glia located on the midline. Taking advantage of this transgenic line, which drives Gal4 expression in specific tissues, we crossed SAGFF(LF)134A with several UAS reporter lines. In particular, time-lapse imaging of photoconverted floor-plate cells of SAGFF(LF)134A;Tg(UAS:KikGR) revealed that the floor-plate cells changed their shape within 36 hours from cuboidal/trapezoidal to wine glass shaped. Moreover, we identified a novel mode of association between axons and glia. The putative paths for the commissural axons, including pax8-positive CoBL interneurons, were identified as small openings in the basal endfoot of each floor plate. Our results indicate that the transgenic line would be useful for studying the morphogenesis of less-well-characterized tissues of interest, including the perichondrium, dorsal midline radial glia, late-stage floor plate, and vascular endothelium-associated cells. PMID:22348745

  17. Soybean dwarf virus-resistant transgenic soybeans with the sense coat protein gene.

    PubMed

    Tougou, Makoto; Yamagishi, Noriko; Furutani, Noriyuki; Shizukawa, Yoshiaki; Takahata, Yoshihito; Hidaka, Soh

    2007-11-01

    We transformed a construct containing the sense coat protein (CP) gene of Soybean dwarf virus (SbDV) into soybean somatic embryos via microprojectile bombardment to acquire SbDV-resistant soybean plants. Six independent T(0) plants were obtained. One of these transgenic lines was subjected to further extensive analysis. Three different insertion patterns of Southern blot hybridization analysis in T(1) plants suggested that these insertions introduced in T(0) plants were segregated from each other or co-inherited in T(1) progenies. These insertions were classified into two types, which overexpressed SbDV-CP mRNA and accumulated SbDV-CP-specific short interfering RNA (siRNA), or repressed accumulation of SbDV-CP mRNA and siRNA by RNA analysis prior to SbDV inoculation. After inoculation of SbDV by the aphids, most T(2) plants of this transgenic line remained symptomless, contained little SbDV-specific RNA by RNA dot-blot hybridization analysis and exhibited SbDV-CP-specific siRNA. We discuss here the possible mechanisms of the achieved resistance, including the RNA silencing.

  18. Production of transgenic livestock: promise fulfilled.

    PubMed

    Wheeler, M B

    2003-01-01

    The introduction of specific genes into the genome of farm animals and its stable incorporation into the germ line has been a major technological advance in agriculture. Transgenic technology provides a method to rapidly introduce "new" genes into cattle, swine, sheep, and goats without crossbreeding. It is a more extreme methodology, but in essence, not really different from crossbreeding or genetic selection in its result. Methods to produce transgenic animals have been available for more than 20 yr, yet recently lines of transgenic livestock have been developed that have the potential to improve animal agriculture and benefit producers and/or consumers. There are a number of methods that can be used to produce transgenic animals. However, the primary method to date has been the microinjection of genes into the pronuclei of zygotes. This method is one of an array of rapidly developing transgenic methodologies. Another method that has enjoyed recent success is that of nuclear transfer or "cloning." The use of this technique to produce transgenic livestock will profoundly affect the use of transgenic technology in livestock production. Cell-based, nuclear transfer or cloning strategies have several distinct advantages for use in the production of transgenic livestock that cannot be attained using pronuclear injection of DNA. Practical applications of transgenesis in livestock production include enhanced prolificacy and reproductive performance, increased feed utilization and growth rate, improved carcass composition, improved milk production and/or composition, and increased disease resistance. One practical application of transgenics in swine production is to improve milk production and/or composition. To address the problem of low milk production, transgenic swine over-expressing the milk protein bovine alpha-lactalbumin were developed and characterized. The outcomes assessed were milk composition, milk yield, and piglet growth. Our results indicate that

  19. Phenotyping transgenic wheat for drought resistance.

    PubMed

    Saint Pierre, Carolina; Crossa, José L; Bonnett, David; Yamaguchi-Shinozaki, Kazuko; Reynolds, Matthew P

    2012-03-01

    Realistic experimental protocols to screen for drought adaptation in controlled conditions are crucial if high throughput phenotyping is to be used for the identification of high performance lines, and is especially important in the evaluation of transgenes where stringent biosecurity measures restrict the frequency of open field trials. Transgenic DREB1A-wheat events were selected under greenhouse conditions by evaluating survival and recovery under severe drought (SURV) as well as for water use efficiency (WUE). Greenhouse experiments confirmed the advantages of transgenic events in recovery after severe water stress. Under field conditions, the group of transgenic lines did not generally outperform the controls in terms of grain yield under water deficit. However, the events selected for WUE were identified as lines that combine an acceptable yield-even higher yield (WUE-11) under well irrigated conditions-and stable performance across the different environments generated by the experimental treatments.

  20. Transgenic hepatocarcinogenesis in the rat.

    PubMed Central

    Hully, J. R.; Su, Y.; Lohse, J. K.; Griep, A. E.; Sattler, C. A.; Haas, M. J.; Dragan, Y.; Peterson, J.; Neveu, M.; Pitot, H. C.

    1994-01-01

    Although transgenic hepatocarcinogenesis has been accomplished in the mouse with a number of genetic constructs targeting the oncogene to expression primarily in the liver, no example of this process has yet been developed in the rat. Because our understanding of the multistage nature of hepatocarcinogenesis is most advanced in the rat, we have developed a strain of transgenic rats carrying the promoter-enhancer sequences of the mouse albumin gene linked 5' to the simian virus-40 T antigen gene. A line of transgenic rats bearing this transgene has been developed from a single founder female. Five to six copies of the transgene, possibly in tandem, occur within the genome of the transgenic animals, which are maintained by heterozygous matings. Livers of transgenic animals are histologically normal after weaning; at 2 months of age, small foci of vacuolated cells appear in this organ. By 4 months of age, all animals exhibit focal lesions and nodules consisting primarily of small basophilic cells, many of which exhibit considerable cytoplasmic vacuolization. Mating of animals each bearing the transgene results in rats with a demyelinating condition that develops acutely in pregnant females and more chronically in males. Ultrastructural studies of these cells indicate that the vacuoles contain substantial amounts of glycogen, with the cells resembling hepatoblasts. Malignant neoplasms with both a glandular and a hepatoblastoma/hepatocellular carcinoma pattern arise from the nodules. Enzyme and immunohistochemical studies of all lesions reveal many similarities in gene expression to comparable lesions in rats subjected to chemically induced hepatocarcinogenesis, with certain exceptions. The placental form of glutathione-S-transferase is absent from all lesions in the transgenic animal, as is the expression of connexin 32. A significant number of lesions express serum albumin, and many, but not all, exhibit the T antigen. Lesions expressing the T antigen also contain

  1. {open_quotes}Horizontal{close_quotes} gene transfer from a transgenic potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs - if at all - at an extremely low frequency

    SciTech Connect

    Schlueter, K.; Fuetterer, J.; Potrykus, I.

    1995-10-01

    The frequency of possible {open_quotes}horizontal{close_quotes} gene transfer between a plant and a tightly associated bacterial pathogen was studied in a model system consisting of transgenic Solanum tuberosum, containing a {beta}-lactamase gene linked to a pBR322 origin of replication, and Erwinia chrysanthemi. This experimental system offers optimal conditions for the detection of possible horizontal gene transfer events, even when they occur at very low frequency. Horizontal gene transfer was not detected under conditions mimicking a {open_quotes}natural{close_quotes} infection. The gradual, stepwise alteration of artificial, positive control conditions to idealized natural conditions, however, allowed the characterization of factors that affected gene transfer, and revealed a gradual decrease of the gene transfer frequency from 6.3 x 10{sup -2} under optimal control conditions to a calculated 2.0 x 10{sub -17} under idealized natural conditions. These data, in combination with other published studies, argue that horizontal gene transfer is so rare as to be essentially irrelevant to any realistic assessment of the risk involved in release experiments involving transgenic plants. 22 refs., 3 figs., 2 tabs.

  2. SirT1 gain-of-function increases energy efficiency and prevents diabetes in mice

    PubMed Central

    Banks, Alexander S.; Kon, Ning; Knight, Colette; Matsumoto, Michihiro; Gutiérrez-Juárez, Roger; Rossetti, Luciano; Gu, Wei; Accili, Domenico

    2011-01-01

    Summary In yeast, worms and flies, an extra copy of the gene encoding the Sirtuin Sir2 increases metabolic efficiency, as does administration of polyphenols like resveratrol, thought to act through Sirtuins. But evidence that Sirtuin gain-of-function results in increased metabolic efficiency in mammals is limited. We generated transgenic mice with moderate overexpression of SirT1, designed to mimic the Sirtuin gain-of-function that improves metabolism in C.elegans. These mice exhibit normal insulin sensitivity, but decreased food intake and locomotor activity, resulting in decreased energy expenditure. However, in various models of insulin resistance and diabetes, SirT1 transgenics display improved glucose tolerance due to decreased hepatic glucose production and increased adiponectin levels, without changes in body weight or composition. We conclude that SirT1 gain-of-function primes the organism for metabolic adaptation to insulin resistance, increasing hepatic insulin sensitivity and decreasing whole-body energy requirements. These findings have important implications for Sirtuin-based therapies in humans. PMID:18840364

  3. Transgenic resistance.

    PubMed

    Cillo, Fabrizio; Palukaitis, Peter

    2014-01-01

    Transgenic resistance to plant viruses is an important technology for control of plant virus infection, which has been demonstrated for many model systems, as well as for the most important plant viruses, in terms of the costs of crop losses to disease, and also for many other plant viruses infecting various fruits and vegetables. Different approaches have been used over the last 28 years to confer resistance, to ascertain whether particular genes or RNAs are more efficient at generating resistance, and to take advantage of advances in the biology of RNA interference to generate more efficient and environmentally safer, novel "resistance genes." The approaches used have been based on expression of various viral proteins (mostly capsid protein but also replicase proteins, movement proteins, and to a much lesser extent, other viral proteins), RNAs [sense RNAs (translatable or not), antisense RNAs, satellite RNAs, defective-interfering RNAs, hairpin RNAs, and artificial microRNAs], nonviral genes (nucleases, antiviral inhibitors, and plantibodies), and host-derived resistance genes (dominant resistance genes and recessive resistance genes), and various factors involved in host defense responses. This review examines the above range of approaches used, the viruses that were tested, and the host species that have been examined for resistance, in many cases describing differences in results that were obtained for various systems developed in the last 20 years. We hope this compilation of experiences will aid those who are seeking to use this technology to provide resistance in yet other crops, where nature has not provided such.

  4. Transgenic resistance.

    PubMed

    Cillo, Fabrizio; Palukaitis, Peter

    2014-01-01

    Transgenic resistance to plant viruses is an important technology for control of plant virus infection, which has been demonstrated for many model systems, as well as for the most important plant viruses, in terms of the costs of crop losses to disease, and also for many other plant viruses infecting various fruits and vegetables. Different approaches have been used over the last 28 years to confer resistance, to ascertain whether particular genes or RNAs are more efficient at generating resistance, and to take advantage of advances in the biology of RNA interference to generate more efficient and environmentally safer, novel "resistance genes." The approaches used have been based on expression of various viral proteins (mostly capsid protein but also replicase proteins, movement proteins, and to a much lesser extent, other viral proteins), RNAs [sense RNAs (translatable or not), antisense RNAs, satellite RNAs, defective-interfering RNAs, hairpin RNAs, and artificial microRNAs], nonviral genes (nucleases, antiviral inhibitors, and plantibodies), and host-derived resistance genes (dominant resistance genes and recessive resistance genes), and various factors involved in host defense responses. This review examines the above range of approaches used, the viruses that were tested, and the host species that have been examined for resistance, in many cases describing differences in results that were obtained for various systems developed in the last 20 years. We hope this compilation of experiences will aid those who are seeking to use this technology to provide resistance in yet other crops, where nature has not provided such. PMID:25410101

  5. Improved production of genetically modified fetuses with homogeneous transgene expression after transgene integration site analysis and recloning in cattle.

    PubMed

    Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira

    2011-02-01

    Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.

  6. Lines

    ERIC Educational Resources Information Center

    Mires, Peter B.

    2006-01-01

    National Geography Standards for the middle school years generally stress the teaching of latitude and longitude. There are many creative ways to explain the great grid that encircles our planet, but the author has found that students in his college-level geography courses especially enjoy human-interest stories associated with lines of latitude…

  7. Refinement of the Citrus tristeza virus resistance gene (Ctv) positional map in Poncirus trifoliata and generation of transgenic grapefruit (Citrus paradisi) plant lines with candidate resistance genes in this region.

    PubMed

    Rai, Mamta

    2006-06-01

    Citrus tristeza virus (CTV) is a major pathogen of Citrus. A single dominant gene Ctv present in the trifoliate relative of Citrus, Poncirus trifoliata confers broad spectrum resistance against CTV. Refinement of genetic maps has delimited this gene to a 121 kb region, comprising of ten candidate Ctv resistance genes. The ten candidate genes were individually cloned in Agrobacterium based binary vector and transformed into three CTV susceptible grapefruit varieties. Two of the candidate R-genes, R-2 and R-3 are exclusively expressed in transgenic plants and in Poncirus trifoliata, while five other genes are also expressed in non-transformed Citrus controls. Northern blotting with a CTV derived probe for assessment of infection in virus inoculated plants over a span of three growth periods, each comprising of six to eight weeks, indicates either an absence of initiation of infection or it's slow spread in R-2 plant lines or an initial appearance of infection and it's subsequent obliteration in some R-1 and R-4 plant lines. Limited genome walk up- and downstream form R-1 gene, based on it's 100% sequence identity between Poncirus and Citrus, indicates promoter identity of 92% between the two varieties. Further upstream and downstream sequencing indicates the presence of an O-methyl transferase and a Copia like gene respectively in Citrus instead of the amino acid transporter like gene upstream and a sugar transporter like gene downstream in Poncirus. The possibility of recombinations in the resistance locus of Citrus and the need for consistent monitoring for virus infection and gene expression in the transgenic Citrus trees is discussed. PMID:16830176

  8. The hrpZ gene of Pseudomonas syringae pv. phaseolicola enhances resistance to rhizomania disease in transgenic Nicotiana benthamiana and sugar beet.

    PubMed

    Pavli, Ourania I; Kelaidi, Georgia I; Tampakaki, Anastasia P; Skaracis, George N

    2011-01-01

    To explore possible sources of transgenic resistance to the rhizomania-causing Beet necrotic yellow vein virus (BNYVV), Nicotiana benthamiana plants were constructed to express the harpin of Pseudomonas syringae pv. phaseolicola (HrpZ(Psph)). The HrpZ protein was expressed as an N-terminal fusion to the PR1 signal peptide (SP/HrpZ) to direct harpin accumulation to the plant apoplast. Transgene integration was verified by mPCR in all primary transformants (T0), while immunoblot analysis confirmed that the protein HrpZ(Psph) was produced and the signal peptide was properly processed. Neither T0 plants nor selfed progeny (T1) showed macroscopically visible necrosis or any other macroscopic phenotypes. However, plants expressing the SP/HrpZ(Psph) showed increased vigor and grew faster in comparison with non-transgenic control plants. Transgenic resistance was assessed after challenge inoculation with BNYVV on T1 progeny by scoring of disease symptoms and by DAS-ELISA at 20 and 30 dpi. Transgenic and control lines showed significant differences in terms of the number of plants that became infected, the timing of infection and the disease symptoms displayed. Plants expressing the SP/HrpZ(Psph) developed localized leaf necrosis in the infection area and had enhanced resistance upon challenge with BNYVV. In order to evaluate the SP/HrpZ-based resistance in the sugar beet host, A. rhizogenes-mediated root transformation was exploited as a transgene expression platform. Upon BNYVV inoculation, transgenic sugar beet hairy roots showed high level of BNYVV resistance. In contrast, the aerial non-transgenic parts of the same seedlings had virus titers that were comparable to those of the seedlings that were untransformed or transformed with wild type R1000 cells. These findings indicate that the transgenically expressed SP/HrpZ protein results in enhanced rhizomania resistance both in a model plant and sugar beet, the natural host of BNYVV. Possible molecular mechanisms

  9. The hrpZ gene of Pseudomonas syringae pv. phaseolicola enhances resistance to rhizomania disease in transgenic Nicotiana benthamiana and sugar beet.

    PubMed

    Pavli, Ourania I; Kelaidi, Georgia I; Tampakaki, Anastasia P; Skaracis, George N

    2011-01-01

    To explore possible sources of transgenic resistance to the rhizomania-causing Beet necrotic yellow vein virus (BNYVV), Nicotiana benthamiana plants were constructed to express the harpin of Pseudomonas syringae pv. phaseolicola (HrpZ(Psph)). The HrpZ protein was expressed as an N-terminal fusion to the PR1 signal peptide (SP/HrpZ) to direct harpin accumulation to the plant apoplast. Transgene integration was verified by mPCR in all primary transformants (T0), while immunoblot analysis confirmed that the protein HrpZ(Psph) was produced and the signal peptide was properly processed. Neither T0 plants nor selfed progeny (T1) showed macroscopically visible necrosis or any other macroscopic phenotypes. However, plants expressing the SP/HrpZ(Psph) showed increased vigor and grew faster in comparison with non-transgenic control plants. Transgenic resistance was assessed after challenge inoculation with BNYVV on T1 progeny by scoring of disease symptoms and by DAS-ELISA at 20 and 30 dpi. Transgenic and control lines showed significant differences in terms of the number of plants that became infected, the timing of infection and the disease symptoms displayed. Plants expressing the SP/HrpZ(Psph) developed localized leaf necrosis in the infection area and had enhanced resistance upon challenge with BNYVV. In order to evaluate the SP/HrpZ-based resistance in the sugar beet host, A. rhizogenes-mediated root transformation was exploited as a transgene expression platform. Upon BNYVV inoculation, transgenic sugar beet hairy roots showed high level of BNYVV resistance. In contrast, the aerial non-transgenic parts of the same seedlings had virus titers that were comparable to those of the seedlings that were untransformed or transformed with wild type R1000 cells. These findings indicate that the transgenically expressed SP/HrpZ protein results in enhanced rhizomania resistance both in a model plant and sugar beet, the natural host of BNYVV. Possible molecular mechanisms

  10. Generation and Characterization of an Nse-CreERT2 Transgenic Line Suitable for Inducible Gene Manipulation in Cerebellar Granule Cells

    PubMed Central

    Pohlkamp, Theresa; Steller, Laura; May, Petra; Günther, Thomas; Schüle, Roland; Frotscher, Michael

    2014-01-01

    We created an Nse-CreERT2 mouse line expressing the tamoxifen-inducible CreERT2 recombinase under the control of the neuron-specific enolase (Nse) promoter. By using Cre reporter lines we could show that this Nse-CreERT2 line has recombination activity in the granule cells of all cerebellar lobules as well as in postmitotic granule cell precursors in the external granular layer of the developing cerebellum. A few hippocampal dentate gyrus granule cells showed Cre-mediated recombination as well. Cre activity could be induced in both the developing and adult mouse brain. The established mouse line constitutes a valuable tool to study the function of genes expressed by cerebellar granule cells in the developing and adult brain. In combination with reporter lines it is a useful model to analyze the development and maintenance of the cerebellar architecture including granule cell distribution, migration, and the extension of granule cell fibers in vivo. PMID:24950299

  11. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress.

    PubMed

    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P; Dobaria, Jentilal R

    2016-01-01

    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163

  12. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress

    PubMed Central

    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P.; Dobaria, Jentilal R.

    2016-01-01

    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163

  13. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress.

    PubMed

    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P; Dobaria, Jentilal R

    2016-01-01

    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity.

  14. Sampling Submicron T1 Bacteriophage Aerosols

    PubMed Central

    Harstad, J. Bruce

    1965-01-01

    Liquid impingers, filter papers, and fritted bubblers were partial viable collectors of radioactive submicron T1 bacteriophage aerosols at 30, 55, and 85% relative humidity. Sampler differences for viable collection were due to incomplete physical collection (slippage) and killing of phage by the samplers. Dynamic aerosols of a mass median diameter of 0.2 μ were produced with a Dautrebande generator from concentrated aqueous purified phage suspensions containing extracellular soluble radioactive phosphate as a physical tracer. There was considerable destruction of phage by the Dautrebande generator; phage titers of the Dautrebande suspension decreased exponentially, but there was a progressive (linear) increase in tracer titers. Liquid impingers recovered the most viable phage but allowed considerable (30 to 48%) slippage, which varies inversely with the aerosol relative humidity. Filter papers were virtually complete physical collectors of submicron particles but were the most destructive. Fritted bubbler slippage was more than 80%. With all samplers, phage kill was highest at 85% relative humidity and lowest at 55% relative humidity. An electrostatic precipitator was used to collect aerosol samples for particle sizing with an electron microscope. The particle size was slightly larger at 85% relative humidity than at 30 or 55% relative humidity. Images Fig. 1 Fig. 4 PMID:5866038

  15. [Progress in transgenic fish techniques and application].

    PubMed

    Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

    2011-05-01

    Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

  16. Edible Safety Assessment of Genetically Modified Rice T1C-1 for Sprague Dawley Rats through Horizontal Gene Transfer, Allergenicity and Intestinal Microbiota

    PubMed Central

    Zhao, Kai; Ren, Fangfang; Han, Fangting; Liu, Qiwen; Wu, Guogan; Xu, Yan; Zhang, Jian; Wu, Xiao; Wang, Jinbin; Li, Peng; Shi, Wei; Zhu, Hong; Lv, Jianjun; Zhao, Xiao; Tang, Xueming

    2016-01-01

    In this study, assessment of the safety of transgenic rice T1C-1 expressing Cry1C was carried out by: (1) studying horizontal gene transfer (HGT) in Sprague Dawley rats fed transgenic rice for 90 d; (2) examining the effect of Cry1C protein in vitro on digestibility and allergenicity; and (3) studying the changes of intestinal microbiota in rats fed with transgenic rice T1C-1 in acute and subchronic toxicity tests. Sprague Dawley rats were fed a diet containing either 60% GM Bacillus thuringiensis (Bt) rice T1C-1 expressing Cry1C protein, the parental rice Minghui 63, or a basic diet for 90 d. The GM Bt rice T1C-1 showed no evidence of HGT between rats and transgenic rice. Sequence searching of the Cry1C protein showed no homology with known allergens or toxins. Cry1C protein was rapidly degraded in vitro with simulated gastric and intestinal fluids. The expressed Cry1C protein did not induce high levels of specific IgG and IgE antibodies in rats. The intestinal microbiota of rats fed T1C-1 was also analyzed in acute and subchronic toxicity tests by DGGE. Cluster analysis of DGGE profiles revealed significant individual differences in the rats' intestinal microbiota. PMID:27706188

  17. Neuroanatomy and transgenic technologies

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  18. Efficient Generation of Mice with Consistent Transgene Expression by FEEST.

    PubMed

    Gao, Lei; Jiang, Yonghua; Mu, Libing; Liu, Yanbin; Wang, Fengchao; Wang, Peng; Zhang, Aiqun; Tang, Nan; Chen, Ting; Luo, Minmin; Yu, Lei; Gao, Shaorong; Chen, Liang

    2015-01-01

    Transgenic mouse models are widely used in biomedical research; however, current techniques for producing transgenic mice are limited due to the unpredictable nature of transgene expression. Here, we report a novel, highly efficient technique for the generation of transgenic mice with single-copy integration of the transgene and guaranteed expression of the gene-of-interest (GOI). We refer to this technique as functionally enriched ES cell transgenics, or FEEST. ES cells harboring an inducible Cre gene enabled the efficient selection of transgenic ES cell clones using hygromycin before Cre-mediated recombination. Expression of the GOI was confirmed by assaying for the GFP after Cre recombination. As a proof-of-principle, we produced a transgenic mouse line containing Cre-activatable tTA (cl-tTA6). This tTA mouse model was able to induce tumor formation when crossed with a transgenic mouse line containing a doxycycline-inducible oncogene. We also showed that the cl-tTA6 mouse is a valuable tool for faithfully recapitulating the clinical course of tumor development. We showed that FEEST can be easily adapted for other genes by preparing a transgenic mouse model of conditionally activatable EGFR L858R. Thus, FEEST is a technique with the potential to generate transgenic mouse models at a genome-wide scale. PMID:26573149

  19. An evaluation of new and established methods to determine T-DNA copy number and homozygosity in transgenic plants.

    PubMed

    Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K; Clemente, Tom E; Long, Stephen P

    2016-04-01

    Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL-)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T-DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL-PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T-DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T-DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided.

  20. An evaluation of new and established methods to determine T-DNA copy number and homozygosity in transgenic plants.

    PubMed

    Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K; Clemente, Tom E; Long, Stephen P

    2016-04-01

    Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL-)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T-DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL-PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T-DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T-DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided. PMID:26670088

  1. Establishment of mesenchymal stem cell lines derived from the bone marrow of green fluorescent protein-transgenic mice exhibiting a diversity in intracellular transforming growth factor-β and bone morphogenetic protein signaling.

    PubMed

    Sawada, Shunsuke; Chosa, Naoyuki; Takizawa, Naoki; Yokota, Jun; Igarashi, Yasuyuki; Tomoda, Koichi; Kondo, Hisatomo; Yaegashi, Takashi; Ishisaki, Akira

    2016-03-01

    Cytokines and their intercellular signals regulate the multipotency of mesenchymal stem cells (MSCs). The present study established the MSC lines SG‑2, ‑3, and ‑5 from the bone marrow of green fluorescent protein (GFP)‑transgenic mice. These cell lines clearly expressed mouse MSC markers Sca‑1 and CD44, and SG‑2 and ‑5 cells retained the potential for osteogenic and adipogenic differentiation in the absence of members of the transforming growth factor (TGF)‑β superfamily. By contrast, SG‑3 cells only retained adipogenic differentiation potential. Analysis of cytokine and cytokine receptor expression in these SG cell lines showed that bone morphogenetic protein (BMP) receptor 1B was most highly expressed in the SG‑3 cells, which underwent osteogenesis in response to BMP, while TGF‑β receptor II was most highly expressed in SG‑3 and ‑5 cells. However, it was unexpectedly noted that phosphorylation of Smad 2, a major transcription factor, was induced by TGF‑β1 in SG‑2 cells but not in SG‑3 or ‑5 cells. Furthermore, TGF‑β1 clearly induced the expression of Smad‑interacting transcription factor CCAAT/enhancer binding protein‑β in SG‑2 but not in SG‑3 or ‑5 cells. These results demonstrated the establishment of TGF‑β‑responsive SG‑2 MSCs, BMP‑responsive SG‑3 MSCs and TGF‑β/BMP‑unresponsive SG‑5 MSCs, each of which was able to be traced by GFP fluorescence after transplantation into in vivo experimental models. In conclusion, the present study suggested that these cell lines may be used to explore how the TGF‑β superfamily affects the proliferation and differentiation status of MSCs in vivo. PMID:26781600

  2. Controlling transgene expression in subcutaneous implants using a skin lotion containing the apple metabolite phloretin.

    PubMed

    Gitzinger, Marc; Kemmer, Christian; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

    2009-06-30

    Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida-mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies.

  3. Transcriptional changes related to secondary wall formation in xylem of transgenic lines of tobacco altered for lignin or xylan content which show improved saccharification

    PubMed Central

    Cook, Charis M.; Daudi, Arsalan; Millar, David J.; Bindschedler, Laurence V.; Khan, Safina; Bolwell, G. Paul; Devoto, Alessandra

    2012-01-01

    In this study, an EST library (EH663598–EH666265) obtained from xylogenic tissue cultures of tobacco that had been previously generated was annotated. The library proved to be enriched in transcripts related to the synthesis and modification of secondary cell walls. The xylem-specific transcripts for most of the genes of the lignification and xylan pathways were identified and several full-length sequences obtained. Gene expression was determined in available tobacco lines down-regulated for enzymes of the phenylpropanoid pathway: CINNAMATE 4-HYDROXYLASE (sc4h), CINNAMOYL-COA REDUCTASE (asccr) and lignification-specific peroxidase (asprx). In addition, lines down-regulated in the nucleotide-sugar pathway to xylan formation through antisense expression of UDP-GLUCURONIC ACID DECARBOXYLASE (asuxs) were also analysed. It is shown herein that most transcripts were down-regulated for both lignin and xylan synthesis pathways in these lines, while CELLULOSE SYNTHASE A3 was up-regulated in lignin-modified lines. The analysis indicates the existence of interdependence between lignin and xylan pathways at the transcriptional level and also shows that levels of cellulose, xylan and lignin are not necessarily directly correlated to differences in transcription of the genes involved upstream, as shown by cell wall fractionation and sugar analysis. It is therefore suggested that cell wall biosynthesis regulation occurs at different levels, and not merely at the transcriptional level. In addition, all lines analyzed showed improved enzymic saccharification of secondary but not primary walls. Nevertheless, this demonstrates potential industrial applicability for the approach undertaken to improve biomass utility. PMID:22119077

  4. Editor's Highlight: Identification and Characterization of Teratogenic Chemicals Using Embryonic Stem Cells Isolated From a Wnt/β-Catenin-Reporter Transgenic Mouse Line.

    PubMed

    Kugler, Josephine; Kemler, Rolf; Luch, Andreas; Oelgeschläger, Michael

    2016-08-01

    Embryonic stem cells (ESCs) are commonly used for the analysis of gene function in embryonic development and provide valuable models for human diseases. In recent years, ESCs have also become an attractive tool for toxicological testing, in particular for the identification of teratogenic compounds. We have recently described a Bmp-reporter ESC line as a new tool to identify teratogenic compounds and to characterize the molecular mechanisms mediating embryonic toxicity. Here we describe the use of a Wnt/β-Catenin-reporter ESC line isolated from a previously described mouse line that carries the LacZ reporter gene under the control of a β-Catenin responsive promoter. The reporter ESC line stably differentiates into cardiomyocytes within 12 days. The reporter was endogenously induced between day 3-5 of differentiation reminiscent of its expression in vivo, in which strong LacZ activity is detected around gastrulation. Subsequently its expression becomes restricted to mesodermal cells and cells undergoing an epithelial to mesenchymal transition. The Wnt/β-Catenin-dependent expression of the reporter protein allowed quantification of dose- and time-dependent effects of teratogenic chemicals. In particular, valproic acid reduced reporter activity on day 7 whereas retinoic acid induced reporter activity on day 5 at concentrations comparable to the ones inhibiting the formation of functional cardiomyocytes, the classical read-out of the embryonic stem cell test (EST). In addition, we were also able to show distinct effects of teratogenic chemicals on the Wnt/β-Catenin-reporter compared with the previously described Bmp-reporter ESCs. Thus, different reporter cell lines provide complementary tools for the identification and analysis of potentially teratogenic compounds.

  5. Stability of transgenes in long-term micropropagation of plants of transgenic birch (Betula platyphylla).

    PubMed

    Zeng, Fansuo; Qian, Jingjing; Luo, Wei; Zhan, Yaguang; Xin, Ying; Yang, Chuanping

    2010-01-01

    The stability of integration and expression level of transgenes in long-term micropropagation clones of transgenic birch (Betula platyphylla Suk.) was examined. Multiplexed PCR and reverse primer PCR demonstrated stable integration of transgenes into regenerated plants. Expression levels of the bgt and gus genes among shoot plantlets, subcultured 4, 7, 9 and 15 times, were significantly different. The transcriptional expression level of extraneous genes in regenerated plants decreased with increasing subculture number. Transcriptional gene silencing (TGS) occured in regenerated transgenic lines. The silencing rate of GUS in the 5th subculture plants was 22-65%. TGS in regenerated plants could be reactivated with 5-azacytidine (Azac) at 50-200 microM. GUS and BGT protein expression was reactivated in the micropropagated transgenic birch plants when treated with Azac. A decrease in expression level with increasing number of subcultures is thus associated with DNA methylation.

  6. Generation of transgenic Hydra by embryo microinjection.

    PubMed

    Juliano, Celina E; Lin, Haifan; Steele, Robert E

    2014-09-11

    As a member of the phylum Cnidaria, the sister group to all bilaterians, Hydra can shed light on fundamental biological processes shared among multicellular animals. Hydra is used as a model for the study of regeneration, pattern formation, and stem cells. However, research efforts have been hampered by lack of a reliable method for gene perturbations to study molecular function. The development of transgenic methods has revitalized the study of Hydra biology(1). Transgenic Hydra allow for the tracking of live cells, sorting to yield pure cell populations for biochemical analysis, manipulation of gene function by knockdown and over-expression, and analysis of promoter function. Plasmid DNA injected into early stage embryos randomly integrates into the genome early in development. This results in hatchlings that express transgenes in patches of tissue in one or more of the three lineages (ectodermal epithelial, endodermal epithelial, or interstitial). The success rate of obtaining a hatchling with transgenic tissue is between 10% and 20%. Asexual propagation of the transgenic hatchling is used to establish a uniformly transgenic line in a particular lineage. Generating transgenic Hydra is surprisingly simple and robust, and here we describe a protocol that can be easily implemented at low cost.

  7. Generation of Transgenic Hydra by Embryo Microinjection

    PubMed Central

    Juliano, Celina E.; Lin, Haifan; Steele, Robert E.

    2014-01-01

    As a member of the phylum Cnidaria, the sister group to all bilaterians, Hydra can shed light on fundamental biological processes shared among multicellular animals. Hydra is used as a model for the study of regeneration, pattern formation, and stem cells. However, research efforts have been hampered by lack of a reliable method for gene perturbations to study molecular function. The development of transgenic methods has revitalized the study of Hydra biology1. Transgenic Hydra allow for the tracking of live cells, sorting to yield pure cell populations for biochemical analysis, manipulation of gene function by knockdown and over-expression, and analysis of promoter function. Plasmid DNA injected into early stage embryos randomly integrates into the genome early in development. This results in hatchlings that express transgenes in patches of tissue in one or more of the three lineages (ectodermal epithelial, endodermal epithelial, or interstitial). The success rate of obtaining a hatchling with transgenic tissue is between 10% and 20%. Asexual propagation of the transgenic hatchling is used to establish a uniformly transgenic line in a particular lineage. Generating transgenic Hydra is surprisingly simple and robust, and here we describe a protocol that can be easily implemented at low cost. PMID:25285460

  8. Studies of an expanded trinucleotide repeat in transgenic mice

    SciTech Connect

    Bingham, P.; Wang, S.; Merry, D.

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  9. Molecular Analyses of Transgenic Plants.

    PubMed

    Trijatmiko, Kurniawan Rudi; Arines, Felichi Mae; Oliva, Norman; Slamet-Loedin, Inez Hortense; Kohli, Ajay

    2016-01-01

    One of the major challenges in plant molecular biology is to generate transgenic plants that express transgenes stably over generations. Here, we describe some routine methods to study transgene locus structure and to analyze transgene expression in plants: Southern hybridization using DIG chemiluminescent technology for characterization of transgenic locus, SYBR Green-based real-time RT-PCR to measure transgene transcript level, and protein immunoblot analysis to evaluate accumulation and stability of transgenic protein product in the target tissue. PMID:26614292

  10. Transgenic plants with enhanced growth characteristics

    DOEpatents

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  11. Transgenic Spartina alterniflora for phytoremediation.

    PubMed

    Czakó, Mihály; Feng, Xianzhong; He, Yuke; Liang, Dali; Márton, László

    2006-01-01

    Perennial monoculture forming grasses are very important natural remediators of pollutants. Their genetic improvement is an important task because introduction of key transgenes can dramatically improve their remediation potential. Transfer of key genes for mercury phytoremediation into the salt marsh cordgrass (Spartina alterniflora) is reported here. S. alterniflora plays an important role in the salt marsh by cycling of elements, both nutrients and pollutants, protects the coastline from erosion, is a keystone species in the salt marsh supporting a large food web, which in turn supports a significant segment of economy, including tourism, has an impact on cloud formation and consequently on global weather, and is thus an ecologically important species relevant for our life-support systems. Embryogenic callus of S. alterniflora was co-inoculated with a pair of Agrobacterium strains LBA4404 carrying the organomercurial lyase (merB) and mercuric reductase (merA) genes, respectively, in order to co-introduce both the merA and the merB genes. Seven stable geneticin resistant lines were recovered. The presence of merA and merB genes was verified by PCR and Southern blotting. All but one transgenic lines contained both the merA and the merB sequences proving that co-introduction into Spartina of two genes from separate Agrobacterium strains is feasible and frequent, although the overall frequency of transformation is low. Northern blotting showed differences in relative expression of the two transgenes among individual transformants. The steady-state RNA levels appeared to correlate with the phenotype. Line #7 showed the highest resistance to HgCl(2) (up to 500 microM), whereas line #3 was the most resistant to phenylmercuric acetate (PMA). Wild-type (WT) callus is sensitive to PMA at 50 microM and to HgCl(2) at 225 microM.

  12. Two Distinct Determinants of Ligand Specificity in T1R1/T1R3 (the Umami Taste Receptor)*

    PubMed Central

    Toda, Yasuka; Nakagita, Tomoya; Hayakawa, Takashi; Okada, Shinji; Narukawa, Masataka; Imai, Hiroo; Ishimaru, Yoshiro; Misaka, Takumi

    2013-01-01

    Umami taste perception in mammals is mediated by a heteromeric complex of two G-protein-coupled receptors, T1R1 and T1R3. T1R1/T1R3 exhibits species-dependent differences in ligand specificity; human T1R1/T1R3 specifically responds to l-Glu, whereas mouse T1R1/T1R3 responds more strongly to other l-amino acids than to l-Glu. The mechanism underlying this species difference remains unknown. In this study we analyzed chimeric human-mouse receptors and point mutants of T1R1/T1R3 and identified 12 key residues that modulate amino acid recognition in the human- and mouse-type responses in the extracellular Venus flytrap domain of T1R1. Molecular modeling revealed that the residues critical for human-type acidic amino acid recognition were located at the orthosteric ligand binding site. In contrast, all of the key residues for the mouse-type broad response were located at regions outside of both the orthosteric ligand binding site and the allosteric binding site for inosine-5′-monophosphate (IMP), a known natural umami taste enhancer. Site-directed mutagenesis demonstrated that the newly identified key residues for the mouse-type responses modulated receptor activity in a manner distinct from that of the allosteric modulation via IMP. Analyses of multiple point mutants suggested that the combination of two distinct determinants, amino acid selectivity at the orthosteric site and receptor activity modulation at the non-orthosteric sites, may mediate the ligand specificity of T1R1/T1R3. This hypothesis was supported by the results of studies using nonhuman primate T1R1 receptors. A complex molecular mechanism involving changes in the properties of both the orthosteric and non-orthosteric sites of T1R1 underlies the determination of ligand specificity in mammalian T1R1/T1R3. PMID:24214976

  13. Myocardial Native T1 Time in Patients With Hypertrophic Cardiomyopathy.

    PubMed

    Kato, Shingo; Nakamori, Shiro; Bellm, Steven; Jang, Jihye; Basha, Tamer; Maron, Martin; Manning, Warren J; Nezafat, Reza

    2016-10-01

    In hypertrophic cardiomyopathy (HC), there are significant variations in left ventricular (LV) wall thickness and fibrosis, which necessitates a volumetric coverage. Slice-interleaved T1 (STONE) mapping sequence allows for the assessment of native T1 time with complete coverage of LV myocardium. The aims of this study were to evaluate spatial heterogeneity of native T1 time in patients with HC. Twenty-nine patients with HC (55 ± 16 years) and 15 healthy adult control subjects (46 ± 19 years) were studied. Native T1 mapping was performed using STONE sequence which enables acquisition of 5 slices in the short-axis plane within a 90 seconds free-breathing scan. We measured LV native T1 time and maximum LV wall thickness in each 16 segments from 3 slices (basal, midventricular and apical slice). Late gadolinium enhanced (LGE) magnetic resonance imaging was acquired to assess the presence of myocardial enhancement. In patients with HC, LV native T1 time was significantly elevated compared with healthy controls, regardless of the presence or absence of LGE (mean native T1 time; LGE positive segments from HC, 1,141 ± 46 ms; LGE negative segments from HC, 1,114 ± 56 ms; segments from healthy controls, 1,065 ± 35 ms, p <0.001). Elevation of native T1 time was defined as >1,135 ms, which was +2SD of native T1 time by STONE sequence in healthy controls. A total of 120 of 405 (30%) LGE negative segments from patients with HC showed elevated native T1 time. Prevalence of segments with elevated native T1 time for basal, midventricular, and apical slice was 29%, 25%, 38%, respectively. Significant correlation was found between LV wall thickness and LV native T1 time (y = 0.029 × -22.6, p <0.001 by Spearman's correlation coefficient). In conclusion, substantial number of segments without LGE showed elevation of native T1 time, and whole-heart T1 mapping revealed heterogeneity of myocardial native T1 time in patients with HC. PMID:27567135

  14. T1 Relaxation Time in Lungs of Asymptomatic Smokers

    PubMed Central

    Alamidi, Daniel F.; Kindvall, Simon S. I.; Hubbard Cristinacce, Penny L.; McGrath, Deirdre M.; Young, Simon S.; Naish, Josephine H.; Waterton, John C.; Wollmer, Per; Diaz, Sandra; Olsson, Marita; Hockings, Paul D.; Lagerstrand, Kerstin M.; Parker, Geoffrey J. M.; Olsson, Lars E.

    2016-01-01

    Purpose Interest in using T1 as a potential MRI biomarker of chronic obstructive pulmonary disease (COPD) has recently increased. Since tobacco smoking is the major risk factor for development of COPD, the aim for this study was to examine whether tobacco smoking, pack-years (PY), influenced T1 of the lung parenchyma in asymptomatic current smokers. Materials and Methods Lung T1 measurements from 35 subjects, 23 never smokers and 12 current smokers were retrospectively analyzed from an institutional review board approved study. All 35 subjects underwent pulmonary function test (PFT) measurements and lung T1, with similar T1 measurement protocols. A backward linear model of T1 as a function of FEV1, FVC, weight, height, age and PY was tested. Results A significant correlation between lung T1 and PY was found with a negative slope of -3.2 ms/year (95% confidence interval [CI] [-5.8, -0.6], p = 0.02), when adjusted for age and height. Lung T1 shortens with ageing among all subjects, -4.0 ms/year (95%CI [-6.3, -1.7], p = 0.001), and among the never smokers, -3.7 ms/year (95%CI [-6.0, -1.3], p = 0.003). Conclusions A correlation between lung T1 and PY when adjusted for both age and height was found, and T1 of the lung shortens with ageing. Accordingly, PY and age can be significant confounding factors when T1 is used as a biomarker in lung MRI studies that must be taken into account to detect underlying patterns of disease. PMID:26958856

  15. Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro

    2008-09-24

    A novel analytical procedure based on the combination of multiplex PCR, restriction analysis, and CGE-LIF to unambiguosly and simultaneously confirm the presence of multiple lines of genetically modified corn is proposed. This methodology is based on the amplification of event-specific DNA regions by multiplex PCR using 6-FAM-labeled primers. Subsequently, PCR products are digested by a mixture containing specific restriction endonucleases. Thus, restriction endonucleases selectively recognize DNA target sequences contained in the PCR products and cleave the double-stranded DNA at a given cleavage site. Next, the restriction digest is analyzed by CGE-LIF corroborating the length of the expected restriction fragments, confirming (or not) the existence of GMOs. For accurate size determination of the DNA fragments by CGE-LIF a special standard DNA mixture was produced in this laboratory for calibration. The suitability of this mixture for size determination of labeled DNA fragments is also demonstrated. The usefulness of the proposed methodology is demonstrated through the simultaneous detection and confirmatory analysis of samples containing 0.5% of GA21 and MON863 maize plus an endogenous gene of maize as control.

  16. The distribution of cotransformed transgenes in particle bombardment-mediated transformed wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although particle bombardment is the predominant method of foreign DNA direct transfer, whether transgene is integrated randomly into the genome has not been determined. In this study, we identified the distribution of transgene loci in 45 transgenic wheat (Triticum aestivum L.) lines containing c...

  17. Over-expression of snakin-2 and extensin-like protein genes restricts pathogen invasiveness and enhances tolerance to Clavibacter michiganensis subsp. michiganensis in transgenic tomato (Solanum lycopersicum).

    PubMed

    Balaji, Vasudevan; Smart, Christine D

    2012-02-01

    Two tomato proteins were evaluated by over-expression in transgenic tomato for their ability to confer resistance to Clavibacter michiganensis subsp. michiganensis (Cmm). Snakin-2 (SN2) is a cysteine-rich peptide with broad-spectrum antimicrobial activity in vitro while extensin-like protein (ELP) is a major cell-wall hydroxyproline-rich glycoprotein linked with plant response to pathogen attack and wounding. Tomato plants, cultivar Mountain Fresh, were transformed via Agrobacterium tumefaciens harboring a binary vector for expression of the full-length SN2 gene or ELP cDNA under the regulation of the CaMV 35S promoter. Molecular characterization of PCR-positive putative T(0) transgenic plants by Northern analysis revealed constitutive over-expression of SN2 and ELP mRNA. Junction fragment analysis by Southern blot showed that three of the four SN2 over-expressing T(0) lines had single copies of complete T-DNAs while the other line had two complete T-DNA copies. All four ELP over-expressing T(0) lines had a single copy T-DNA insertion. Semi-quantitative RT-PCR analysis of T(1) plants revealed constitutive over-expression of SN2 and ELP. Transgenic lines that accumulated high levels of SN2 or ELP mRNA showed enhanced tolerance to Cmm resulting in a significant delay in the development of wilt symptoms and a reduction in the size of canker lesions compared to non-transformed control plants. Furthermore, in transgenic lines over-expressing SN2 or ELP bacterial populations were significantly lower (100-10,000-fold) than in non-transformed control plants. These results demonstrate that SN2 and ELP over-expression limits Cmm invasiveness suggesting potential in vivo antibacterial activity and possible biotechnological application for these two defense proteins.

  18. Stable CoT-1 repeat RNA is abundant and associated with euchromatic interphase chromosomes

    PubMed Central

    Hall, Lisa L.; Carone, Dawn M.; Gomez, Alvin; Kolpa, Heather J.; Byron, Meg; Mehta, Nitish; Fackelmayer, Frank O.; Lawrence, Jeanne B.

    2014-01-01

    SUMMARY Recent studies recognize a vast diversity of non-coding RNAs with largely unknown functions, but few have examined interspersed repeat sequences, which constitute almost half our genome. RNA hybridization in situ using CoT-1 (highly repeated) DNA probes detects surprisingly abundant euchromatin-associated RNA comprised predominantly of repeat sequences (“CoT-1 RNA”), including LINE-1. CoT-1-hybridizing RNA strictly localizes to the interphase chromosome territory in cis, and remains stably associated with the chromosome territory following prolonged transcriptional inhibition. The CoT-1 RNA territory resists mechanical disruption and fractionates with the non-chromatin scaffold, but can be experimentally released. Loss of repeat-rich, stable nuclear RNAs from euchromatin corresponds to aberrant chromatin distribution and condensation. CoT-1 RNA has several properties similar to XIST chromosomal RNA, but is excluded from chromatin condensed by XIST. These findings impact two “black boxes” of genome science: the poorly understood diversity of non-coding RNA and the unexplained abundance of repetitive elements. PMID:24581492

  19. Evaluating the fitness of human lysozyme transgenic dairy goats: growth and reproductive traits.

    PubMed

    Jackson, Kathryn A; Berg, Jolene M; Murray, James D; Maga, Elizabeth A

    2010-12-01

    While there are many reports in the literature describing the attributes of specific applications of transgenic animals for agriculture, there are relatively few studies focusing on the fitness of the transgenic animals themselves. This work was designed to gather information on genetically modified food animals to determine if the presence of a transgene can impact general animal production traits. More specifically, we used a line of transgenic dairy goats expressing human lysozyme in their mammary gland to evaluate the reproductive fitness and growth and development of these animals compared to their non-transgenic counterparts and the impact of consuming a transgenic food product, lysozyme-containing milk. In males, none of the parameters of semen quality, including semen volume and concentration, total sperm per ejaculate, sperm morphology, viability and motility, were significantly different between transgenic bucks and non-transgenic full-sib controls. Likewise, transgenic females of this line did not significantly differ in the reproductive traits of gestation length and litter size compared to their non-transgenic counterparts. To evaluate growth, transgenic and non-transgenic kid goats received colostrum and milk from either transgenic or non-transgenic does from birth until weaning. Neither the presence of the transgene nor the consumption of milk from transgenic animals significantly affected birth weight, weaning weight, overall gain and post-wean gain. These results indicate that the analyzed reproductive and growth traits were not regularly or substantially impacted by the presence or expression of the transgene. The evaluation of these general parameters is an important aspect of defining the safety of applying transgenic technology to animal agriculture.

  20. Up-regulation of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase enhances production of essential oils and sterols in transgenic Lavandula latifolia.

    PubMed

    Muñoz-Bertomeu, Jesús; Sales, Ester; Ros, Roc; Arrillaga, Isabel; Segura, Juan

    2007-11-01

    Spike lavender (Lavandula latifolia) essential oil is widely used in the perfume, cosmetic, flavouring and pharmaceutical industries. Thus, modifications of yield and composition of this essential oil by genetic engineering should have important scientific and commercial applications. We generated transgenic spike lavender plants expressing the Arabidopsis thaliana HMG1 cDNA, encoding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the mevalonic acid (MVA) pathway. Transgenic T0 plants accumulated significantly more essential oil constituents as compared to controls (up to 2.1- and 1.8-fold in leaves and flowers, respectively). Enhanced expression of HMGR1S also increased the amount of the end-product sterols, beta-sitosterol and stigmasterol (average differences of 1.8- and 1.9-fold, respectively), but did not affect the accumulation of carotenoids or chlorophylls. We also analysed T1 plants derived from self-pollinated seeds of T0 lines that flowered after growing for 2 years in the greenhouse. The increased levels of essential oil and sterols observed in the transgenic T0 plants were maintained in the progeny that inherited the HMG1 transgene. Our results demonstrate that genetic manipulation of the MVA pathway increases essential oil yield in spike lavender, suggesting a contribution for this cytosolic pathway to monoterpene and sesquiterpene biosynthesis in leaves and flowers of the species.

  1. Heterologous expression of taro cystatin protects transgenic tomato against Meloidogyne incognita infection by means of interfering sex determination and suppressing gall formation.

    PubMed

    Chan, Yuan-Li; Yang, Ai-Hwa; Chen, Jen-Tzu; Yeh, Kai-Wun; Chan, Ming-Tsair

    2010-03-01

    Plant-parasitic nematodes are a major pest of many plant species and cause global economic loss. A phytocystatin gene, Colocasia esculenta cysteine proteinase inhibitor (CeCPI), isolated from a local taro Kaosiang No. 1, and driven by a CaMV35S promoter was delivered into CLN2468D, a heat-tolerant cultivar of tomato (Solanum lycopersicum). When infected with Meloidogyne incognita, one of root-knot nematode (RKN) species, transgenic T1 lines overexpressing CeCPI suppressed gall formation as evidenced by a pronounced reduction in gall numbers. In comparison with wild-type plants, a much lower proportion of female nematodes without growth retardation was observed in transgenic plants. A decrease of RKN egg mass in transgenic plants indicated seriously impaired fecundity. Overexpression of CeCPI in transgenic tomato has inhibitory functions not only in the early RKN infection stage but also in the production of offspring, which may result from intervention in sex determination. PMID:20054551

  2. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    PubMed

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

    2015-01-01

    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice. PMID:26172549

  3. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision

    PubMed Central

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

    2015-01-01

    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice. PMID:26172549

  4. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    PubMed

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

    2015-01-01

    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

  5. Irreversible change in the T1 temperature dependence with thermal dose using the proton resonance frequency-T1 technique.

    PubMed

    Diakite, Mahamadou; Payne, Allison; Todd, Nick; Parker, Dennis L

    2013-04-01

    Denaturation of macromolecules within the tissues is believed to be the major factor contributing to the damage of tissues upon hyperthermia. As a result, the value of the spin-lattice relaxation time T1 of the tissue water, which is related to the translational and rotational rates of water, represents an intrinsic probe for investigating structural changes in tissues at high temperature. Therefore, the goal of this work is to investigate whether the simultaneous measurement of temperature and T1 using a hybrid proton resonance frequency (PRF)-T1 measurement technique can be used to detect irreversible changes in T1 that might be indicative of tissue damage. A new hybrid PRF-T1 sequence was implemented based on the variable flip angle driven-equilibrium single-pulse observation (DESPOT)1 method from a standard three dimensional segmented echo-planar imaging sequence by alternating two flip angles from measurement to measurement. The structural changes of the heated tissue volumes were analyzed based on the derived T1 values and the corresponding PRF temperatures. Using the hybrid PRF-T1 technique, we demonstrate that the change of spin lattice relaxation time T1 is reversible with temperature for low thermal dose (thermal dose ≤ 240 cumulative equivalent minutes [CEM] 43°C) and irreversible with temperature after significant accumulation of thermal dose in ex vivo chicken breast tissue. These results suggest that the hybrid PRF-T1 method may be a potentially powerful tool to investigate the extent and mechanism of heat damage of biological tissues.

  6. A thermoalkaliphilic lipase of Geobacillus sp. T1.

    PubMed

    Leow, Thean Chor; Rahman, Raja Noor Zaliha Raja Abd; Basri, Mahiran; Salleh, Abu Bakar

    2007-05-01

    A thermoalkaliphilic T1 lipase gene of Geobacillus sp. strain T1 was overexpressed in pGEX vector in the prokaryotic system. Removal of the signal peptide improved protein solubility and promoted the binding of GST moiety to the glutathione-Sepharose column. High-yield purification of T1 lipase was achieved through two-step affinity chromatography with a final specific activity and yield of 958.2 U/mg and 51.5%, respectively. The molecular mass of T1 lipase was determined to be approximately 43 kDa by gel filtration chromatography. T1 lipase had an optimum temperature and pH of 70 degrees C and pH 9, respectively. It was stable up to 65 degrees C with a half-life of 5 h 15 min at pH 9. It was stable in the presence of 1 mM metal ions Na(+), Ca(2+), Mn(2+), K(+) and Mg(2+ ), but inhibited by Cu(2+), Fe(3+) and Zn(2+). Tween 80 significantly enhanced T1 lipase activity. T1 lipase was active towards medium to long chain triacylglycerols (C10-C14) and various natural oils with a marked preference for trilaurin (C12) (triacylglycerol) and sunflower oil (natural oil). Serine and aspartate residues were involved in catalysis, as its activity was strongly inhibited by 5 mM PMSF and 1 mM Pepstatin. The T(m) for T1 lipase was around 72.2 degrees C, as revealed by denatured protein analysis of CD spectra.

  7. Secretion of N- and O-linked Glycoproteins from 4T1 Murine Mammary Carcinoma Cells.

    PubMed

    Phang, Wai-Mei; Tan, Aik-Aun; Gopinath, Subash C B; Hashim, Onn H; Kiew, Lik Voon; Chen, Yeng

    2016-01-01

    Breast cancer is one of the most common cancers that affect women globally and accounts for ~23% of all cancers diagnosed in women. Breast cancer is also one of the leading causes of death primarily due to late stage diagnoses and a lack of effective treatments. Therefore, discovering protein expression biomarkers is mandatory for early detection and thus, critical for successful therapy. Two-dimensional electrophoresis (2D-E) coupled with lectin-based analysis followed by mass spectrometry were applied to identify potential biomarkers in the secretions of a murine mammary carcinoma cell line. Comparisons of the protein profiles of the murine 4T1 mammary carcinoma cell line and a normal murine MM3MG mammary cell line indicated that cadherin-1 (CDH), collagenase 3 (MMP-13), Viral envelope protein G7e (VEP), Gag protein (GAG) and Hypothetical protein LOC433182 (LOC) were uniquely expressed by the 4T1 cells, and pigment epithelium-derived factor (PEDF) was exclusively secreted by the MM3MG cells. Further analysis by a lectin-based study revealed that aberrant O-glycosylated CDH, N-glycosylated MMP-13 and LOC were present in the 4T1 medium. These differentially expressed N- and O-linked glycoprotein candidates, which were identified by combining lectin-based analysis with 2D-E, could serve as potential diagnostic and prognostic markers for breast cancer. PMID:27226773

  8. Secretion of N- and O-linked Glycoproteins from 4T1 Murine Mammary Carcinoma Cells

    PubMed Central

    Phang, Wai-Mei; Tan, Aik-Aun; Gopinath, Subash C.B.; Hashim, Onn H.; Kiew, Lik Voon; Chen, Yeng

    2016-01-01

    Breast cancer is one of the most common cancers that affect women globally and accounts for ~23% of all cancers diagnosed in women. Breast cancer is also one of the leading causes of death primarily due to late stage diagnoses and a lack of effective treatments. Therefore, discovering protein expression biomarkers is mandatory for early detection and thus, critical for successful therapy. Two-dimensional electrophoresis (2D-E) coupled with lectin-based analysis followed by mass spectrometry were applied to identify potential biomarkers in the secretions of a murine mammary carcinoma cell line. Comparisons of the protein profiles of the murine 4T1 mammary carcinoma cell line and a normal murine MM3MG mammary cell line indicated that cadherin-1 (CDH), collagenase 3 (MMP-13), Viral envelope protein G7e (VEP), Gag protein (GAG) and Hypothetical protein LOC433182 (LOC) were uniquely expressed by the 4T1 cells, and pigment epithelium-derived factor (PEDF) was exclusively secreted by the MM3MG cells. Further analysis by a lectin-based study revealed that aberrant O-glycosylated CDH, N-glycosylated MMP-13 and LOC were present in the 4T1 medium. These differentially expressed N- and O-linked glycoprotein candidates, which were identified by combining lectin-based analysis with 2D-E, could serve as potential diagnostic and prognostic markers for breast cancer. PMID:27226773

  9. Hyperpolarized (129)Xe T (1) in oxygenated and deoxygenated blood

    NASA Technical Reports Server (NTRS)

    Albert, M. S.; Balamore, D.; Kacher, D. F.; Venkatesh, A. K.; Jolesz, F. A.

    2000-01-01

    The viability of the new technique of hyperpolarized (129)Xe MRI (HypX-MRI) for imaging organs other than the lungs depends on whether the spin-lattice relaxation time, T(1), of (129)Xe is sufficiently long in the blood. In previous experiments by the authors, the T(1) was found to be strongly dependent upon the oxygenation of the blood, with T(1) increasing from about 3 s in deoxygenated samples to about 10 s in oxygenated samples. Contrarily, Tseng et al. (J. Magn. Reson. 1997; 126: 79-86) reported extremely long T(1) values deduced from an indirect experiment in which hyperpolarized (129)Xe was used to create a 'blood-foam'. They found that oxygenation decreased T(1). Pivotal to their experiment is the continual and rapid exchange of hyperpolarized (129)Xe between the gas phase (within blood-foam bubbles) and the dissolved phase (in the skin of the bubbles); this necessitated a complicated analysis to extract the T(1) of (129)Xe in blood. In the present study, the experimental design minimizes gas exchange after the initial bolus of hyperpolarized (129)Xe has been bubbled through the sample. This study confirms that oxygenation increases the T(1) of (129)Xe in blood, from about 4 s in freshly drawn venous blood, to about 13 s in blood oxygenated to arterial levels, and also shifts the red blood cell resonance to higher frequency. Copyright 2000 John Wiley & Sons, Ltd. Abbreviations used BOLD blood oxygen level dependent NOE nuclear overhouses effect PO(2) oxygen partial pressure RBC red blood cells RF radio frequency SNR signal-to-noise ratio.

  10. Proteomic analysis of imatinib-resistant CML-T1 cells reveals calcium homeostasis as a potential therapeutic target

    PubMed Central

    Toman, O.; Kabickova, T.; Vit, O.; Fiser, R.; Polakova, K. Machova; Zach, J.; Linhartova, J.; Vyoral, D.; Petrak, J.

    2016-01-01

    Chronic myeloid leukemia (CML) therapy has markedly improved patient prognosis after introduction of imatinib mesylate for clinical use. However, a subset of patients develops resistance to imatinib and other tyrosine kinase inhibitors (TKIs), mainly due to point mutations in the region encoding the kinase domain of the fused BCR-ABL oncogene. To identify potential therapeutic targets in imatinib-resistant CML cells, we derived imatinib-resistant CML-T1 human cell line clone (CML-T1/IR) by prolonged exposure to imatinib in growth media. Mutational analysis revealed that the Y235H mutation in BCR-ABL is probably the main cause of CML-T1/IR resistance to imatinib. To identify alternative therapeutic targets for selective elimination of imatinib-resistant cells, we compared the proteome profiles of CML-T1 and CML-T1/IR cells using 2-DE-MS. We identified eight differentially expressed proteins, with strongly upregulated Na+/H+ exchanger regulatory factor 1 (NHERF1) in the resistant cells, suggesting that this protein may influence cytosolic pH, Ca2+ concentration or signaling pathways such as Wnt in CML-T1/IR cells. We tested several compounds including drugs in clinical use that interfere with the aforementioned processes and tested their relative toxicity to CML-T1 and CML-T1/IR cells. Calcium channel blockers, calcium signaling antagonists and modulators of calcium homeostasis, namely thapsigargin, ionomycin, verapamil, carboxyamidotriazole and immunosuppressive drugs cyclosporine A and tacrolimus (FK-506) were selectively toxic to CML-T1/IR cells. The putative cellular targets of these compounds in CML-T1/IR cells are postulated in this study. We propose that Ca2+ homeostasis can be a potential therapeutic target in CML cells resistant to TKIs. We demonstrate that a proteomic approach may be used to characterize a TKI-resistant population of CML cells enabling future individualized treatment options for patients. PMID:27430982

  11. Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants

    PubMed Central

    Udawat, Pushpika; Jha, Rajesh K.; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath

    2016-01-01

    The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and O2− radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

  12. Myocardial T1 mapping: modalities and clinical applications

    PubMed Central

    Jellis, Christine L.

    2014-01-01

    Myocardial fibrosis appears to be linked to myocardial dysfunction in a multitude of non-ischemic cardiomyopathies. Accurate non-invasive quantitation of this extra-cellular matrix has the potential for widespread clinical benefit in both diagnosis and guiding therapeutic intervention. T1 mapping is a cardiac magnetic resonance (CMR) imaging technique, which shows early clinical promise particularly in the setting of diffuse fibrosis. This review will outline the evolution of T1 mapping and the various techniques available with their inherent advantages and limitations. Histological validation of this technique remains somewhat limited, however clinical application in a range of pathologies suggests strong potential for future development. PMID:24834410

  13. Wettability and fluid saturations determined from NMR T1 distributions.

    PubMed

    Howard, J J

    1994-01-01

    The abundance and distribution of brine and decane are determined from T1 distributions at different stages of a water-flood test in water-wet and oil-wet chalks. The T1 distributions generated from multi-exponential decomposition of inversion-recovery data provide more information than obtained from stretched and bi-exponential fits. Chalk samples because of their uniform pore size and ideal sedimentary rocks for NMR investigations of wettability since water and decane interactions with pore walls of differing wettability are easily distinguished.

  14. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  15. Transgenic mouse model of cutaneous adnexal tumors

    PubMed Central

    Kito, Yusuke; Saigo, Chiemi; Atsushi, Kurabayashi; Mutsuo, Furihata; Tamotsu, Takeuchi

    2014-01-01

    TMEM207 was first characterized as being an important molecule for the invasion activity of gastric signet-ring cell carcinoma cells. In order to unravel the pathological properties of TMEM207, we generated several transgenic mouse lines, designated C57BL/6-Tg (ITF-TMEM207), in which murine TMEM207 was ectopically expressed under a truncated (by ~200 bp) proximal promoter of the murine intestinal trefoil factor (ITF) gene (also known as Tff3). Unexpectedly, a C57BL/6-Tg (ITF-TMEM207) mouse line exhibited a high incidence of spontaneous intradermal tumors with histopathological features that resembled those of various human cutaneous adnexal tumors. These tumors were found in ~14% female and 13% of male 6- to 12-month-old mice. TMEM207 immunoreactivity was found in hair follicle bulge cells in non-tumorous skin, as well as in cutaneous adnexal tumors of the transgenic mouse. The ITF-TMEM207 construct in this line appeared to be inserted to a major satellite repeat sequence at chromosome 2, in which no definite coding molecule was found. In addition, we also observed cutaneous adnexal tumors in three other C57BL/6-Tg (ITF-TMEM207) transgenic mouse lines. We believe that the C57BL/6-Tg (ITF-TMEM207) mouse might be a useful model to understand human cutaneous adnexal tumors. PMID:25305140

  16. A novel enterocin T1 with anti-Pseudomonas activity produced by Enterococcus faecium T1 from Chinese Tibet cheese.

    PubMed

    Liu, Hui; Zhang, Lanwei; Yi, Huaxi; Han, Xue; Gao, Wei; Chi, Chunliang; Song, Wei; Li, Haiying; Liu, Chunguang

    2016-02-01

    An enterocin-producing Enterococcus faecium T1 was isolated from Chinese Tibet cheese. The enterocin was purified by SP-Sepharose and reversed phase HPLC. It was identified as unique from other reported bacteriocins based on molecular weight (4629 Da) and amino acid compositions; therefore it was subsequently named enterocin T1. Enterocin T1 was stable at 80-100 °C and over a wide pH range, pH 3.0-10.0. Protease sensitivity was observed to trypsin, pepsin, papain, proteinase K, and pronase E. Importantly, enterocin T1 was observed to inhibit the growth of numerous Gram-negative and Gram-positive bacteria including Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas fluorescens, Escherichia coli, Salmonella typhimurium, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Listeria monocytogenes. Take together, these results suggest that enterocin T1 is a novel bacteriocin with the potential to be used as a bio-preservative to control Pseudomonas spp. in food. PMID:26745981

  17. Hybridization and backcrossing between transgenic oilseed rape and two related weed species under field conditions.

    PubMed

    Halfhill, Matthew D; Zhu, Bin; Warwick, Suzanne I; Raymer, Paul L; Millwood, Reginald J; Weissinger, Arthur K; Stewart, C Neal

    2004-01-01

    Determining the frequency of crop-wild transgene flow under field conditions is a necessity for the development of regulatory strategies to manage transgenic hybrids. Gene flow of green fluorescent protein (GFP) and Bacillus thuringiensis (Bt) transgenes was quantified in three field experiments using eleven independent transformed Brassica napus L. lines and the wild relatives, B. rapa L. and Raphanus raphanistrum L. Under a high crop to wild relative ratio (600:1), hybridization frequency with B. rapa differed among the individual transformed B. napus lines (ranging from ca. 4% to 22%), however, this difference could be caused by the insertion events or other factors, e.g., differences in the hybridization frequencies among the B. rapa plants. The average hybridization frequency over all transformed lines was close to 10%. No hybridization with R. raphanistrum was detected. Under a lower crop to wild relative ratio (180:1), hybridization frequency with B. rapa was consistent among the transformed B. napus lines at ca. 2%. Interspecific hybridization was higher when B. rapa occurred within the B. napus plot (ca. 37.2%) compared with plot margins (ca. 5.2%). No significant differences were detected among marginal plants grown at 1, 2, and 3 m from the field plot. Transgene backcrossing frequency between B. rapa and transgenic hybrids was determined in two field experiments in which the wild relative to transgenic hybrid ratio was 5-15 plants of B. rapa to 1 transgenic hybrid. As expected, ca. 50% of the seeds produced were transgenic backcrosses when the transgenic hybrid plants served as the maternal parent. When B. rapa plants served as the maternal parent, transgene backcrossing frequencies were 0.088% and 0.060%. Results show that transgene flow from many independent transformed lines of B. napus to B. rapa can occur under a range of field conditions, and that transgenic hybrids have a high potential to produce transgenic seeds in backcrosses. PMID:15612504

  18. Hybridization and backcrossing between transgenic oilseed rape and two related weed species under field conditions.

    PubMed

    Halfhill, Matthew D; Zhu, Bin; Warwick, Suzanne I; Raymer, Paul L; Millwood, Reginald J; Weissinger, Arthur K; Stewart, C Neal

    2004-01-01

    Determining the frequency of crop-wild transgene flow under field conditions is a necessity for the development of regulatory strategies to manage transgenic hybrids. Gene flow of green fluorescent protein (GFP) and Bacillus thuringiensis (Bt) transgenes was quantified in three field experiments using eleven independent transformed Brassica napus L. lines and the wild relatives, B. rapa L. and Raphanus raphanistrum L. Under a high crop to wild relative ratio (600:1), hybridization frequency with B. rapa differed among the individual transformed B. napus lines (ranging from ca. 4% to 22%), however, this difference could be caused by the insertion events or other factors, e.g., differences in the hybridization frequencies among the B. rapa plants. The average hybridization frequency over all transformed lines was close to 10%. No hybridization with R. raphanistrum was detected. Under a lower crop to wild relative ratio (180:1), hybridization frequency with B. rapa was consistent among the transformed B. napus lines at ca. 2%. Interspecific hybridization was higher when B. rapa occurred within the B. napus plot (ca. 37.2%) compared with plot margins (ca. 5.2%). No significant differences were detected among marginal plants grown at 1, 2, and 3 m from the field plot. Transgene backcrossing frequency between B. rapa and transgenic hybrids was determined in two field experiments in which the wild relative to transgenic hybrid ratio was 5-15 plants of B. rapa to 1 transgenic hybrid. As expected, ca. 50% of the seeds produced were transgenic backcrosses when the transgenic hybrid plants served as the maternal parent. When B. rapa plants served as the maternal parent, transgene backcrossing frequencies were 0.088% and 0.060%. Results show that transgene flow from many independent transformed lines of B. napus to B. rapa can occur under a range of field conditions, and that transgenic hybrids have a high potential to produce transgenic seeds in backcrosses.

  19. Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

    PubMed Central

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2015-01-01

    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  20. Introgression of the SbASR-1 gene cloned from a halophyte Salicornia brachiate enhances salinity and drought endurance in transgenic groundnut (arachis hypogaea)and acts as a transcription factor [corrected].

    PubMed

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2015-01-01

    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  1. Transfer of hyperpolarization from long T 1 storage nuclei to short T 1 neighbors using FLOPSY-8

    NASA Astrophysics Data System (ADS)

    Moreno, Karlos X.; Harrison, Crystal; Dean Sherry, A.; Malloy, Craig R.; Merritt, Matthew E.

    2011-12-01

    Nuclei with long T 1s are optimal targets for dynamic nuclear polarization (DNP). Therefore, most of the agents used in metabolic imaging and spectroscopy studies are based on carboxylic acid moieties that lack protons, a strong source of dipolar relaxation. Metabolic flux information encoded into spectra of small molecule metabolites in the form of the 13C isotopomer data cannot be accessed using standard 13C hyperpolarization methods because protonated carbons relax too quickly through T 1 dipolar relaxation. It is shown here that the longitudinal mixing sequence FLOPSY-8 can be used to transfer polarization from a long T 1 storage nucleus to adjacent protonated carbons so that they may be detected with high sensitivity. We demonstrate that FLOPSY-8 allows a direct readout of isotopomer populations in butyrate and glutamate in vitro.

  2. Gene flow from transgenic common beans expressing the bar gene.

    PubMed

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium. PMID:21865877

  3. Design and Management of Field Trials of Transgenic Cereals

    NASA Astrophysics Data System (ADS)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  4. Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP).

    PubMed

    Huber, Reinhard C; Remuge, Liliana; Carlisle, Ailsa; Lillico, Simon; Sandøe, Peter; Sørensen, Dorte B; Whitelaw, C Bruce A; Olsson, I Anna S

    2012-08-01

    Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology--animal welfare--has not been approached through systematic assessment and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals along various stages of post natal development. The protocol used covered reproductory performance and behaviour in GFP and wildtype sows and general health and development, social behaviour, exploratory behaviour and emotionality in GFP and wildtype littermates from birth until an age of roughly 4 months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs expressing GFP as healthy. Although the results are not surprising in the light of previous experience, they give a more solid fundament to the evaluation of GFP expression as being relatively non-invasive in pigs. The present study may furthermore serve as starting point for researchers aiming at a systematic characterization of welfare relevant effects in the line of transgenic pigs they are working with.

  5. Loss of sense transgene-induced post-transcriptional gene silencing by sequential introduction of the same transgene sequences in tobacco.

    PubMed

    Hirai, Sayaka; Takahashi, Kouta; Abiko, Tomomi; Kodama, Hiroaki

    2010-04-01

    RNA silencing is an epigenetic inhibition of gene expression and is guided by small interfering RNAs. Sense transgene-induced post-transcriptional gene silencing (S-PTGS) occurs in a portion of a transgenic plant population. When a sense transgene encoding a tobacco endoplasmic reticulum omega-3 fatty acid desaturase (NtFAD3) was introduced into tobacco plants, an S-PTGS line, S44, was obtained. Introduction of another copy of the NtFAD3 transgene into S44 plants caused a phenotypic change from S-PTGS to overexpression. Because this change was associated with the methylation of the promoter sequences of the transgene, reduced transcriptional activity may abolish S-PTGS and residual transcription of the sense transgene may account for the overexpression. To clarify whether RNA-directed DNA methylation (RdDM) can repress the transcriptional activity of the S44 transgene locus, we introduced several RdDM constructs targeting the transgene promoter. An RdDM construct harboring a 200-bp-long fragment of promoter sequences efficiently abrogated the generation of NtFAD3 small interfering RNAs in S44 plants. Transcription of the transgene was partially repressed, but the resulting NtFAD3 mRNAs successfully accumulated and an overexpressed phenotype was established. Our results indicate an example in which overexpression of the transgene is established by complex epigenetic interactions among the transgenic loci. PMID:20180844

  6. Regulation of endothelial-specific transgene expression by the LacI repressor protein in vivo.

    PubMed

    Morton, Susan K; Chaston, Daniel J; Baillie, Brett K; Hill, Caryl E; Matthaei, Klaus I

    2014-01-01

    Genetically modified mice have played an important part in elucidating gene function in vivo. However, conclusions from transgenic studies may be compromised by complications arising from the site of transgene integration into the genome and, in inducible systems, the non-innocuous nature of inducer molecules. The aim of the present study was to use the vascular system to validate a technique based on the bacterial lac operon system, in which transgene expression can be repressed and de-repressed by an innocuous lactose analogue, IPTG. We have modified an endothelium specific promoter (TIE2) with synthetic LacO sequences and made transgenic mouse lines with this modified promoter driving expression of mutant forms of connexin40 and an independently translated reporter, EGFP. We show that tissue specificity of this modified promoter is retained in the vasculature of transgenic mice in spite of the presence of LacO sequences, and that transgene expression is uniform throughout the endothelium of a range of adult systemic and cerebral arteries and arterioles. Moreover, transgene expression can be consistently down-regulated by crossing the transgenic mice with mice expressing an inhibitor protein LacI(R), and in one transgenic line, transgene expression could be de-repressed rapidly by the innocuous inducer, IPTG. We conclude that the modified bacterial lac operon system can be used successfully to validate transgenic phenotypes through a simple breeding schedule with mice homozygous for the LacI(R) protein. PMID:24755679

  7. 2012 North Dakota Transgenic Barley FHB Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2012 North Dakota transgenic field trials consisted of 23 barley lines, tested in three misted and three non-misted replicates. Plots were sown on May 9, 2012 in hill plots with 10 seed per hill spaced at 30 cm, and all plots were inoculated using the grain spawn method at heading. Lines include...

  8. Obesity-related abnormalities couple environmental triggers with genetic susceptibility in adult-onset T1D.

    PubMed

    Nguyen, K Hoa; Ande, Sudharsana R; Mishra, Suresh

    2016-01-29

    The incidence of adult-onset T1D in low-risk non-HLA type has increased several folds, whereas the contemporaneous incidence in high-risk HLA-type remains stable. Various factors behind this selective increase in T1D in young adults remain unclear. Obesity and its associated abnormalities appear to be an important determinant; however, the underlying mechanism involved is not understood. Recently, we have developed two novel transgenic obese mice models, Mito-Ob and m-Mito-Ob, by expressing a pleiotropic protein prohibitin (PHB) and a phospho mutant form of PHB (Y114F-PHB or m-PHB) from the aP2 gene promoter, respectively. Both mice models develop obesity in a sex-neutral manner, independent of diet; but obesity associated chronic low-grade inflammation and insulin resistance in a male sex-specific manner. Interestingly, on a high fat diet (HFD) only male m-Mito-Ob mice displayed marked mononuclear cell infiltration in pancreas and developed insulitis that mimic adult-onset T1D. Male Mito-Ob mice that share the metabolic phenotype of male m-Mito-Ob mice, and female m-Mito-Ob that harbor m-PHB similar to male m-Mito-Ob mice, did not develop insulitis. Thus, insulitis development in male m-Mito-Ob in response to HFD requires both, obesity-related abnormalities and m-PHB. Collectively, this data provides a proof-of-concept that obesity-associated abnormalities couple environmental triggers with genetic susceptibility in adult-onset T1D and reveals PHB as a potential susceptibility gene for T1D.

  9. Transgenic Crops for Herbicide Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since their introduction in 1995, crops made resistant to the broad-spectrum herbicides glyphosate and glufosinate with transgenes are widely available and used in much of the world. As of 2008, over 80% of the transgenic crops grown world-wide have this transgenic trait. This technology has had m...

  10. Stability of transgene methylation patterns in mice: position effects, strain specificity and cellular mosaicism.

    PubMed

    Koetsier, P A; Mangel, L; Schmitz, B; Doerfler, W

    1996-07-01

    The methylation status of a transgene, which carried the adenovirus type 2 E2A late promoter linked to the chloramphenicol acetyltransferase gene, was studied in three transgenic mouse lines (5-8, 7-1 and 8-1). These lines were analysed over a large number of offspring generations beyond the founder animal. In mating experiments, the influence of the parent-of-origin and strain-specific backgrounds on the transgene methylation patterns were assessed and found to have no effect on the pre-established methylation patterns in mouse lines 5-8 and 8-1. The founder animal 7-1 carried two groups of a total of ten transgenes, which were located on two different chromosomes. These arrays of transgenes could be segregated into separate mouse lines 7-1A and 7-1B. The transgenes of 7-1A animals exhibited cellular mosaic methylation patterns that were demethylated in approximately 10% of the offspring in a mixed genetic background. Upon further transmission of these transgenes in a mixed genetic background, the grandparental methylation patterns were reestablished in most progeny. Mating to inbred DBA/2 mice resulted in maintenance of the demethylated pattern or in further demethylation of the transgenes in approximately 50% of the offspring. In contrast, an equal number of transgenic siblings from matings to C57BL/6 mice showed a return to the original methylation pattern. The mosaic methylation status of this locus was apparently controlled by mouse-strain-specific factors. The methylation patterns of the 7-1B transgenes were not cellular mosaic and remained stable in all offspring, as with lines 5-8 and 8-1. Hence, the strain-dependent and cellular mosaic transgene methylation patterns of 7-1A animals were probably a consequence of the chromosomal integration site of the transgenes (position effect).

  11. Viable transgenic goats derived from skin cells.

    PubMed

    Behboodi, Esmail; Memili, Erdogan; Melican, David T; Destrempes, Margaret M; Overton, Susan A; Williams, Jennifer L; Flanagan, Peter A; Butler, Robin E; Liem, Hetty; Chen, Li How; Meade, Harry M; Gavin, William G; Echelard, Yann

    2004-06-01

    The current study was undertaken to evaluate the possibility of expanding transgenic goat herds by means of somatic cell nuclear transfer (NT) using transgenic goat cells as nucleus donors. Skin cells from adult, transgenic goats were first synchronized at quiescent stage (G0) by serum starvation and then induced to exit G0 and proceed into G1. Oocytes collected from superovulated donors were enucleated, karyoplast-cytoplast couplets were constructed, and then fused and activated simultaneously by a single electrical pulse. Fused couplets were either co-cultured with oviductal cells in TCM-199 medium (in vitro culture) or transferred to intermediate recipient goat oviducts (in vivo culture) until final transfer. The resulting morulae and blastocysts were transferred to the final recipients. Pregnancies were confirmed by ultrasonography 25-30 days after embryo transfer. In vitro cultured NT embryos developed to morulae and blastocyst stages but did not produce any pregnancies while 30% (6/20) of the in vivo derived morulae and blastocysts produced pregnancies. Two of these pregnancies were resorbed early in gestation. Of the four recipients that maintained pregnancies to term, two delivered dead fetuses 2-3 days after their due dates, and two recipients gave birth to healthy kids at term. Fluorescence in situ hybridization (FISH) analysis confirmed that both kids were transgenic and had integration sites consistent with those observed in the adult cell line.

  12. Recent Results of IRAN-T1 Tokamak

    SciTech Connect

    Dorranian, D.; Ghoranneviss, M.; Salem, M. K.; Mahmoodi D, M.; Arvin, R.; Talebitaher, Alireza; Abhari, Ali; Khorshid, P.; Hojabri, A.

    2006-12-04

    In this article after introducing the IR-T1 tokamak and its diagnostic systems a brief discussion on the range of grossly stable operating conditions of its plasma by Hugill diagram is presented. Hard disruption instability is studied experimentally in the next part, which confirms that MHD behavior in small tokamaks can be characterized by a single parameter q(a), safety factor at plasma edge. Finally the characteristics of the new regime of IR-T1 are reported. By our new model of triggering different fields (toroidal, ohmic and vertical), the plasma duration time is increased up to 35 ms with Ip of about 25 kA. By modifying capacitance and charging voltage of ohmic and vertical fields the spike oscillations which was appeared in the plasma behavior is taken out. The role of cleaning the vacuum chamber and using heavier gas for glow discharge and the effect of base pressure is described in detail.

  13. ACTS T1-VSAT - The intelligent earth station

    NASA Technical Reports Server (NTRS)

    Manning, John R.; Spiegler, Jeffrey D.; Lowry, Peter A.

    1992-01-01

    The functional design of the software for NASA's Advanced Communication Technology Satellite (ACTS) T1-VSAT (Very Small Aperture Terminal) is described. The design provides a flexible interface to allow customized control of a satellite network and to provide external processes with access to network capabilities without requiring modification to the network hardware or software. Some of the envisioned features are: automatic number location; dynamic reconfiguration of the number plan tables; security features of call priority, call preemption, and remote verification; automatic reconfiguration of least cost routing tables; circuit availability verification prior to call setup; audio and video conferencing; on demand broadband dial-up service; on demand dial-up broadband broadcast service; and ISDN. A brief review is also given of the ACTS satellite and network, the network management, and the ACTS T1-VSAT earth station.

  14. Tunneling at νT=1 in quantum Hall bilayers

    NASA Astrophysics Data System (ADS)

    Nandi, D.; Khaire, T.; Finck, A. D. K.; Eisenstein, J. P.; Pfeiffer, L. N.; West, K. W.

    2013-10-01

    Interlayer tunneling measurements in the strongly correlated bilayer quantized Hall phase at νT=1 are reported. The maximum, or critical, current for tunneling at νT=1 is shown to be a well-defined global property of the coherent phase, insensitive to extrinsic circuit effects and the precise configuration used to measure it, but also exhibiting a surprising scaling behavior with temperature. Comparisons between the experimentally observed tunneling characteristics and a recent theory are favorable at high temperatures, but not at low temperatures where the tunneling closely resembles the dc Josephson effect. The zero-bias tunneling resistance becomes extremely small at low temperatures, vastly less than that observed at zero magnetic field, but nonetheless remains finite. The temperature dependence of this tunneling resistance is similar to that of the ordinary in-plane resistivity of the quantum Hall phase.

  15. Transgenic animal bioreactors.

    PubMed

    Houdebine, L M

    2000-01-01

    The production of recombinant proteins is one of the major successes of biotechnology. Animal cells are required to synthesize proteins with the appropriate post-translational modifications. Transgenic animals are being used for this purpose. Milk, egg white, blood, urine, seminal plasma and silk worm cocoon from transgenic animals are candidates to be the source of recombinant proteins at an industrial scale. Although the first recombinant protein produced by transgenic animals is expected to be in the market in 2000, a certain number of technical problems remain to be solved before the various systems are optimized. Although the generation of transgenic farm animals has become recently easier mainly with the technique of animal cloning using transfected somatic cells as nuclear donor, this point remains a limitation as far as cost is concerned. Numerous experiments carried out for the last 15 years have shown that the expression of the transgene is predictable only to a limited extent. This is clearly due to the fact that the expression vectors are not constructed in an appropriate manner. This undoubtedly comes from the fact that all the signals contained in genes have not yet been identified. Gene constructions thus result sometime in poorly functional expression vectors. One possibility consists in using long genomic DNA fragments contained in YAC or BAC vectors. The other relies on the identification of the major important elements required to obtain a satisfactory transgene expression. These elements include essentially gene insulators, chromatin openers, matrix attached regions, enhancers and introns. A certain number of proteins having complex structures (formed by several subunits, being glycosylated, cleaved, carboxylated...) have been obtained at levels sufficient for an industrial exploitation. In other cases, the mammary cellular machinery seems insufficient to promote all the post-translational modifications. The addition of genes coding for enzymes

  16. Constitutive overexpression of the TaNF-YB4 gene in transgenic wheat significantly improves grain yield

    PubMed Central

    Yadav, Dinesh; Shavrukov, Yuri; Bazanova, Natalia; Chirkova, Larissa; Borisjuk, Nikolai; Kovalchuk, Nataliya; Ismagul, Ainur; Parent, Boris; Langridge, Peter; Hrmova, Maria; Lopato, Sergiy

    2015-01-01

    Heterotrimeric nuclear factors Y (NF-Ys) are involved in regulation of various vital functions in all eukaryotic organisms. Although a number of NF-Y subunits have been characterized in model plants, only a few have been functionally evaluated in crops. In this work, a number of genes encoding NF-YB and NF-YC subunits were isolated from drought-tolerant wheat (Triticum aestivum L. cv. RAC875), and the impact of the overexpression of TaNF-YB4 in the Australian wheat cultivar Gladius was investigated. TaNF-YB4 was isolated as a result of two consecutive yeast two-hybrid (Y2H) screens, where ZmNF-YB2a was used as a starting bait. A new NF-YC subunit, designated TaNF-YC15, was isolated in the first Y2H screen and used as bait in a second screen, which identified two wheat NF-YB subunits, TaNF-YB2 and TaNF-YB4. Three-dimensional modelling of a TaNF-YB2/TaNF-YC15 dimer revealed structural determinants that may underlie interaction selectivity. The TaNF-YB4 gene was placed under the control of the strong constitutive polyubiquitin promoter from maize and introduced into wheat by biolistic bombardment. The growth and yield components of several independent transgenic lines with up-regulated levels of TaNF-YB4 were evaluated under well-watered conditions (T1–T3 generations) and under mild drought (T2 generation). Analysis of T2 plants was performed in large deep containers in conditions close to field trials. Under optimal watering conditions, transgenic wheat plants produced significantly more spikes but other yield components did not change. This resulted in a 20–30% increased grain yield compared with untransformed control plants. Under water-limited conditions transgenic lines maintained parity in yield performance. PMID:26220082

  17. Towards T 1-limited magnetic resonance imaging using Rabi beats

    NASA Astrophysics Data System (ADS)

    Fedder, H.; Dolde, F.; Rempp, F.; Wolf, T.; Hemmer, P.; Jelezko, F.; Wrachtrup, J.

    2011-03-01

    Two proof-of-principle experiments toward T 1-limited magnetic resonance imaging with NV centers in diamond are demonstrated. First, a large number of Rabi oscillations is measured and it is demonstrated that the hyperfine interaction due to the NV's 14N can be extracted from the beating oscillations. Second, the Rabi beats under V-type microwave excitation of the three hyperfine manifolds is studied experimentally and described theoretically.

  18. T1 relaxometry of crossing fibres in the human brain.

    PubMed

    De Santis, Silvia; Assaf, Yaniv; Jeurissen, Ben; Jones, Derek K; Roebroeck, Alard

    2016-11-01

    A comprehensive tract-based characterisation of white matter should include the ability to quantify myelin and axonal attributes irrespective of the complexity of fibre organisation within the voxel. Recently, a new experimental framework that combines inversion recovery and diffusion MRI, called inversion recovery diffusion tensor imaging (IR-DTI), was introduced and applied in an animal study. IR-DTI provides the ability to assign to each unique fibre population within a voxel a specific value of the longitudinal relaxation time, T1, which is a proxy for myelin content. Here, we apply the IR-DTI approach to the human brain in vivo on 7 healthy subjects for the first time. We demonstrate that the approach is able to measure differential tract properties in crossing fibre areas, reflecting the different myelination of tracts. We also show that tract-specific T1 has less inter-subject variability compared to conventional T1 in areas of crossing fibres, suggesting increased specificity to distinct fibre populations. Finally we show in simulations that changes in myelination selectively affecting one fibre bundle in crossing fibre areas can potentially be detected earlier using IR-DTI.

  19. T1 relaxometry of crossing fibres in the human brain.

    PubMed

    De Santis, Silvia; Assaf, Yaniv; Jeurissen, Ben; Jones, Derek K; Roebroeck, Alard

    2016-11-01

    A comprehensive tract-based characterisation of white matter should include the ability to quantify myelin and axonal attributes irrespective of the complexity of fibre organisation within the voxel. Recently, a new experimental framework that combines inversion recovery and diffusion MRI, called inversion recovery diffusion tensor imaging (IR-DTI), was introduced and applied in an animal study. IR-DTI provides the ability to assign to each unique fibre population within a voxel a specific value of the longitudinal relaxation time, T1, which is a proxy for myelin content. Here, we apply the IR-DTI approach to the human brain in vivo on 7 healthy subjects for the first time. We demonstrate that the approach is able to measure differential tract properties in crossing fibre areas, reflecting the different myelination of tracts. We also show that tract-specific T1 has less inter-subject variability compared to conventional T1 in areas of crossing fibres, suggesting increased specificity to distinct fibre populations. Finally we show in simulations that changes in myelination selectively affecting one fibre bundle in crossing fibre areas can potentially be detected earlier using IR-DTI. PMID:27444568

  20. Conditional overexpression of transgenes in megakaryocytes and platelets in vivo

    PubMed Central

    Nguyen, Hao G.; Yu, Guangyao; Makitalo, Maria; Yang, Dan; Xie, Hou-Xiang; Jones, Matthew R.; Ravid, Katya

    2005-01-01

    Megakaryocyte (MK)–specific transgene expression has proved valuable in studying thrombotic and hemostatic processes. Constitutive expression of genes, however, could result in altered phenotypes due to compensatory mechanisms or lethality. To circumvent these limitations, we used the tetracycline/doxycycline (Tet)–off system to conditionally over-express genes in megakaryocytes and platelets in vivo. We generated 3 transactivator transgenic lines expressing the Tet transactivator element (tTA), under the control of the MK-specific platelet factor 4 promoter (PF4-tTA-VP16). Responder lines were simultaneously generated, each with a bidirectional minimal cytomegalovirus (CMV)–tTA responsive promoter driving prokaryotic β-galactosidase gene, as a cellular reporter, and a gene of interest (in this case, the mitotic regulator Aurora-B). A transactivator founder line that strongly expressed PF4-driven tTA–viral protein 16 (VP16) was crossbred to a responder line. The homozygous double-transgenic mouse line exhibited doxycycline-dependent transgene overexpression in MKs and platelets. Using this line, platelets were conveniently indicated at sites of induced stress by β-galactosidase staining. In addition, we confirmed our earlier report on effects of constitutive expression of Aurora-B, indicating a tight regulation at protein level and a modest effect on MK ploidy. Hence, we generated a new line, PF4-tTA-VP16, that is available for conditionally overexpressing genes of interest in the MK/platelet lineage in vivo. PMID:15890684

  1. T1 and susceptibility contrast at high fields

    NASA Astrophysics Data System (ADS)

    Neelavalli, Jaladhar

    Clinical imaging at high magnetic field strengths (≥ 3Tesla) is sought after primarily due to the increased signal strength available at these fields. This increased SNR can be used to perform: (a) high resolution imaging in the same time as at lower field strengths; (b) the same resolution imaging with much faster acquisition; and (c) functional MR imaging (fMRI), dynamic perfusion and diffusion imaging with increased sensitivity. However they are also associated with increased power deposition (SAR) due to increase in imaging frequency and longer T1 relaxation times. Longer T1s mean longer imaging times for generating good T1 contrast images. On the other hand for faster imaging, at high fields fast spin echo or magnetization prepared sequences are conventionally proposed which are, however, associated with high SAR values. Imaging with low SAR is more and more important as we move towards high fields and particularly for patients with metallic implants like pacemakers or deep brain stimulator. The SAR limit acceptable for these patients is much less than the limit acceptable for normal subjects. A new method is proposed for imaging at high fields with good contrast with simultaneous reduction in power deposition. Further, T1 based contrast optimization problem in FLASH imaging is considered for tissues with different T1s but same spin densities. The solution providing optimal imaging parameters is simplified for quick and easy computation in a clinical setting. The efficacy of the simplification is evaluated and practical limits under which the simplification can be applied are worked out. The phase difference due to variation in magnetic susceptibility property among biological tissues is another unique source of contrast which is different from the conventional T1, T2 and T2* contrast. This susceptibility based phase contrast has become more and more important at high fields, partly due to contrast generation issues due to longer T 1s and shorter T2s and

  2. Transgenes for tea?

    PubMed

    Heritage, John

    2005-01-01

    So far, no compelling scientific evidence has been found to suggest that the consumption of transgenic or genetically modified (GM) plants by animals or humans is more likely to cause harm than is the consumption of their conventional counterparts. Despite this lack of scientific evidence, the economic prospects for GM plants are probably limited in the short term and there is public opposition to the technology. Now is a good time to address several issues concerning GM plants, including the potential for transgenes to migrate from GM plants to gut microbes or to animal or human tissues, the consequences of consuming GM crops, either as fresh plants or as silage, and the problems caused by current legislation on GM labelling and beyond.

  3. [Features of development and reproduction of transgenic flax].

    PubMed

    Lemesh, V A; Samatadze, T E; Guzenko, E V; Zhelezniakova, E V; Amosova, A V; Zelenin, A V; Muravenko, O V

    2014-01-01

    Primary transformants carrying a genetic construct with the chimeric gfp-tua6 gene were obtained using biolistic transformation of hypocotyl explants of flax variety Vasilek. Viable modified plants were used as a basis for the production of inbred lines with confirmed inheritance of introduced genetic construct in three generations. The characteristics of phenological growth stages, plant height, number of bolls and meiosis were studied for transgenic plants. A comparison of transformed lines based on reproduction years revealed a significant decrease of seed production in one line. Meiotic analysis of this line at metaphase I and anaphase I stages was conducted. The percentage of cells with impaired meiosis was highest in transgenic plants of the line with the lowest seed production. Thus, the nonspecific incorporation of genetic construct into the flax genome using biolistic transformation impairs meiosis to a different extent and it is the main reason for unequal reproducibility of transgenic flax. The production of stably reproducing transgenic lines requires systematic analysis of meiosis.

  4. Transgenics in crops

    NASA Technical Reports Server (NTRS)

    Li, Y.; Wu, Y. H.; McAvoy, R.; Duan, H.

    2001-01-01

    With rapid world population growth and declining availability of fresh water and arable land, a new technology is urgently needed to enhance agricultural productivity. Recent discoveries in the field of crop transgenics clearly demonstrate the great potential of this technology for increasing food production and improving food quality while preserving the environment for future generations. In this review, we briefly discuss some of the recent achievements in crop improvement that have been made using gene transfer technology.

  5. [Prospective factors of T1 and T2 glottic carcinoma].

    PubMed

    Mackiewicz-Nartowicz, Hanna; Sinkiewicz, Anna; Piwczyński, Dariusz; Betlejewski, Stanisław; Owczarek, Arkadiusz

    2007-01-01

    The aim of our study was to estimate the probability of the neoplasm recurrence in patients with T1 and T2 glottic carcinoma operated with CO2 laser microsurgery. We analyzed the material of 171 patients treated in the Otolaryngology Department of the Collegium Medicum Nicolaus Copernicus University between 1991 and 2003. The statistical method of logistic regression was used to estimate factors disposing the local recurrence of laryngeal cancer. We studied: age, sex, extent and location of the lesion, time up to recurrence, carbon granuloma, smoking cigarettes before and after the operation. We confirmed statistically significant correlation between the local recurrence and anterior commissure involvement.

  6. T-1 Test Program Ver. 6.0.1

    2004-05-21

    The software allows for easy setup and testing of a variety of RF Electronic Sensor Platforms (ESPs). The software interprets RF messages from the ESP and displays the information in a graphical user interface. This program is used primarily for testing of the T-1 Electronic Sensor Platform. The software imports Electronic Tag Data files which are created from the Electronic Sensor Platform Programmer (ESPP). The software will automatically add sensors to its database when amore » RF message s received that the program recognizes. Any data that is generated can be stored to a file for later analysis.« less

  7. The TOTEM T1 read out card motherboard

    NASA Astrophysics Data System (ADS)

    Minutoli, S.; Lo Vetere, M.; Robutti, E.

    2010-12-01

    This article describes the Read Out Card (ROC) motherboard, which is the main component of the T1 forward telescope front-end electronic system. The ROC main objectives are to acquire tracking data and trigger information from the detector. It performs data conversion from electrical to optical format and transfers the data streams to the next level of the system and it implements Slow Control modules which are able to receive, decode and distribute the LHC machine low jitter clock and fast command. The ROC also provides a spy mezzanine connection based on programmable FPGA and USB2.0 for laboratory and portable DAQ debugging system.

  8. Comparative analysis of nutritional compositions of transgenic RNAi-mediated virus-resistant bean (event EMB-PV051-1) with its non-transgenic counterpart.

    PubMed

    Carvalho, José L V; de Oliveira Santos, Juliana; Conte, Carmine; Pacheco, Sidney; Nogueira, Elsa O P L; Souza, Thiago L P O; Faria, Josias C; Aragão, Francisco J L

    2015-10-01

    Golden mosaic is among the most economically important diseases that severely reduce bean production in Latin America. In 2011, a transgenic bean event named Embrapa 5.1 (EMB-PV051-1), resistant to bean golden mosaic virus, was approved for commercial release in Brazil. The aim of this study was to measure and evaluate the nutritional components of the beans, as well as the anti-nutrient levels in the primary transgenic line and its derived near-isogenic lines after crosses and backcrosses with two commercial cultivars. Nutritional assessment of transgenic crops used for human consumption is an important aspect of safety evaluations. Results demonstrated that the transgenic bean event, cultivated under field conditions, was substantially equivalent to that of the non-transgenic bean plants. In addition, the amounts of the nutritional components are within the range of values observed for several bean commercial varieties grown across a range of environments and seasons.

  9. Transgenic fish systems and their application in ecotoxicology.

    PubMed

    Lee, Okhyun; Green, Jon M; Tyler, Charles R

    2015-02-01

    The use of transgenics in fish is a relatively recent development for advancing understanding of genetic mechanisms and developmental processes, improving aquaculture, and for pharmaceutical discovery. Transgenic fish have also been applied in ecotoxicology where they have the potential to provide more advanced and integrated systems for assessing health impacts of chemicals. The zebrafish (Daniorerio) is the most popular fish for transgenic models, for reasons including their high fecundity, transparency of their embryos, rapid organogenesis and availability of extensive genetic resources. The most commonly used technique for producing transgenic zebrafish is via microinjection of transgenes into fertilized eggs. Transposon and meganuclease have become the most reliable methods for insertion of the genetic construct in the production of stable transgenic fish lines. The GAL4-UAS system, where GAL4 is placed under the control of a desired promoter and UAS is fused with a fluorescent marker, has greatly enhanced model development for studies in ecotoxicology. Transgenic fish have been developed to study for the effects of heavy metal toxicity (via heat-shock protein genes), oxidative stress (via an electrophile-responsive element), for various organic chemicals acting through the aryl hydrocarbon receptor, thyroid and glucocorticoid response pathways, and estrogenicity. These models vary in their sensitivity with only very few able to detect responses for environmentally relevant exposures. Nevertheless, the potential of these systems for analyses of chemical effects in real time and across multiple targets in intact organisms is considerable. Here we illustrate the techniques used for generating transgenic zebrafish and assess progress in the development and application of transgenic fish (principally zebrafish) for studies in environmental toxicology. We further provide a viewpoint on future development opportunities.

  10. [Effects of phytase transgenic corn planting on soil nematode community].

    PubMed

    Zhao, Zong-Chao; Su, Ying; Mou, Wen-Ya; Liu, Man-Qiang; Chen, Xiao-Yun; Chen, Fa-Jun

    2014-04-01

    A healthy soil ecosystem is essential for nutrient cycling and energy conversion, and the impact of exogenous genes from genetically modified crops had aroused wide concerns. Phytase transgenic corn (i. e., the inbred line BVLA430101) was issued a bio-safety certificate on 27 September 2009 in China, which could improve the efficiency of feed utilization, reduce environmental pollution caused by animal manure. In this study, the abundance of trophic groups, community structure and ecological indices of soil nematodes were studied over the growing cycle of phytase transgenic corn (ab. transgenic corn) and control conventional parental corn (ab. control corn) in the field. Totally 29 and 26 nematode genera were isolated from transgenic corn and control corn fields, respectively. The abundances of bacterivores and omnivores-predators, the total number of soil nematodes, and the Shannon index (H) were significantly greater under transgenic corn than under control corn, while the opposite trend was found for the relative abundance of herbivores and the maturity index (Sigma MI) of soil nematodes. Repeated-measures analysis of variance (ANOVA) did not detect any significant effects of transgenic corn on the composition and abundance of nematode trophic groups and ecological indices of soil nematodes. Furthermore, the Student-T test showed that the abundances of bacterivores and omnivores-predators and the total number of soil nematodes during the milk-ripe stage were significant higher in the transgenic corn field than in the control corn field. The effects of transgenic corn planting on soil nematodes might be related to the increase in the nitrogen content of field soil under transgenic corn compared to control corn.

  11. [Effects of phytase transgenic corn planting on soil nematode community].

    PubMed

    Zhao, Zong-Chao; Su, Ying; Mou, Wen-Ya; Liu, Man-Qiang; Chen, Xiao-Yun; Chen, Fa-Jun

    2014-04-01

    A healthy soil ecosystem is essential for nutrient cycling and energy conversion, and the impact of exogenous genes from genetically modified crops had aroused wide concerns. Phytase transgenic corn (i. e., the inbred line BVLA430101) was issued a bio-safety certificate on 27 September 2009 in China, which could improve the efficiency of feed utilization, reduce environmental pollution caused by animal manure. In this study, the abundance of trophic groups, community structure and ecological indices of soil nematodes were studied over the growing cycle of phytase transgenic corn (ab. transgenic corn) and control conventional parental corn (ab. control corn) in the field. Totally 29 and 26 nematode genera were isolated from transgenic corn and control corn fields, respectively. The abundances of bacterivores and omnivores-predators, the total number of soil nematodes, and the Shannon index (H) were significantly greater under transgenic corn than under control corn, while the opposite trend was found for the relative abundance of herbivores and the maturity index (Sigma MI) of soil nematodes. Repeated-measures analysis of variance (ANOVA) did not detect any significant effects of transgenic corn on the composition and abundance of nematode trophic groups and ecological indices of soil nematodes. Furthermore, the Student-T test showed that the abundances of bacterivores and omnivores-predators and the total number of soil nematodes during the milk-ripe stage were significant higher in the transgenic corn field than in the control corn field. The effects of transgenic corn planting on soil nematodes might be related to the increase in the nitrogen content of field soil under transgenic corn compared to control corn. PMID:25011306

  12. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

    PubMed

    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

    2001-02-01

    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus.

  13. Extended ISIS sequences insensitive to T(1) smearing.

    PubMed

    Ljungberg, M; Starck, G; Vikhoff-Baaz, B; Alpsten, M; Ekholm, S; Forssell-Aronsson, E

    2000-10-01

    Image selected in vivo spectroscopy (ISIS) is a volume selection method often used for in vivo (31)P MRS, since it is suitable for measurements of substances with short T(2). However, ISIS can suffer from significant signal contributions caused by T(1) smearing from regions outside the VOI. A computer model was developed to simulate this contamination. The simulation results for the ISIS experiment order implemented in our MR system (ISIS-0) were in agreement with results obtained from phantom measurements. A new extended ISIS experiment order (E-ISIS) was developed, consisting of four "optimal" ISIS experiment orders (ISIS-1 to ISIS-4) performed consecutively with dummy ISIS experiments in between. The simulation results show that contamination due to T(1) smearing is, effectively, eliminated with E-ISIS and is significantly lower than for ISIS-0 and ISIS-1. E-ISIS offers increased accuracy for quantitative and qualitative determination of substances studied using in vivo MRS. Hence, E-ISIS can be valuable for both clinical and research applications.

  14. The seeds of Lotus japonicus lines transformed with sense, antisense, and sense/antisense galactomannan galactosyltransferase constructs have structurally altered galactomannans in their endosperm cell walls.

    PubMed

    Edwards, Mary E; Choo, Tze-Siang; Dickson, Cathryn A; Scott, Catherine; Gidley, Michael J; Reid, J S Grant

    2004-03-01

    Galactomannan biosynthesis in legume seed endosperms involves two Golgi membrane-bound glycosyltransferases, mannan synthase and galactomannan galactosyltransferase (GMGT). GMGT specificity is an important factor regulating the distribution and amount of (1-->6)-alpha-galactose (Gal) substitution of the (1-->4)-beta-linked mannan backbone. The model legume Lotus japonicus is shown now to have endospermic seeds with endosperm cell walls that contain a high-Gal galactomannan (mannose [Man]/Gal = 1.2-1.3). Galactomannan biosynthesis in developing L. japonicus endosperms has been mapped, and a cDNA encoding a functional GMGT has been obtained from L. japonicus endosperms during galactomannan deposition. L. japonicus has been transformed with sense, antisense, and sense/antisense ("hairpin loop") constructs of the GMGT cDNA. Some of the sense, antisense, and sense/antisense transgenic lines exhibited galactomannans with altered (higher) Man/Gal values in their (T(1) generation) seeds, at frequencies that were consistent with posttranscriptional silencing of GMGT. For T(1) generation individuals, transgene inheritance was correlated with galactomannan composition and amount in the endosperm. All the azygous individuals had unchanged galactomannans, whereas those that had inherited a GMGT transgene exhibited a range of Man/Gal values, up to about 6 in some lines. For Man/Gal values up to 4, the results were consistent with lowered Gal substitution of a constant amount of mannan backbone. Further lowering of Gal substitution was accompanied by a slight decrease in the amount of mannan backbone. Microsomal membranes prepared from the developing T(2) generation endosperms of transgenic lines showed reduced GMGT activity relative to mannan synthase. The results demonstrate structural modification of a plant cell wall polysaccharide by designed regulation of a Golgi-bound glycosyltransferase.

  15. Assessment of the diversity and dynamics of Plum pox virus and aphid populations in transgenic European plums under Mediterranean conditions.

    PubMed

    Capote, Nieves; Pérez-Panadés, Jordi; Monzó, César; Carbonell, Emilio; Urbaneja, Alberto; Scorza, Ralph; Ravelonandro, Michel; Cambra, Mariano

    2008-06-01

    The molecular variability of Plum pox virus (PPV) populations was compared in transgenic European plums (Prunus domestica L.) carrying the coat protein (CP) gene of PPV and non-transgenic plums in an experimental orchard in Valencia, Spain. A major objective of this study was to detect recombination between PPV CP transgene transcripts and infecting PPV RNA. Additionally, we assessed the number and species of PPV aphid vectors that visited transgenic and non-transgenic plum trees. Test trees consisted of five different P. domestica transgenic lines, i.e. the PPV-resistant C5 'HoneySweet' line and the PPV-susceptible C4, C6, PT6 and PT23 lines, and non-transgenic P. domestica and P. salicina Lind trees. No significant difference in the genetic diversity of PPV populations infecting transgenic and conventional plums was detected, in particular no recombinant between transgene transcripts and incoming viral RNA was found at detectable levels. Also, no significant difference was detected in aphid populations, including viruliferous individuals, that visited transgenic and conventional plums. Our data indicate that PPV-CP transgenic European plums exposed to natural PPV infection over an 8 year period caused limited, if any, risk beyond the cultivation of conventional plums under Mediterranean conditions in terms of the emergence of recombinant PPV and diversity of PPV and aphid populations.

  16. TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L.)

    PubMed Central

    Lloyd, Andrew H; Milligan, Andrew S; Langridge, Peter; Able, Jason A

    2007-01-01

    Background Chromosome pairing, recombination and DNA repair are essential processes during meiosis in sexually reproducing organisms. Investigating the bread wheat (Triticum aestivum L.) Ph2 (Pairing homoeologous) locus has identified numerous candidate genes that may have a role in controlling such processes, including TaMSH7, a plant specific member of the DNA mismatch repair family. Results Sequencing of the three MSH7 genes, located on the short arms of wheat chromosomes 3A, 3B and 3D, has revealed no significant sequence divergence at the amino acid level suggesting conservation of function across the homoeogroups. Functional analysis of MSH7 through the use of RNAi loss-of-function transgenics was undertaken in diploid barley (Hordeum vulgare L.). Quantitative real-time PCR revealed several T0 lines with reduced MSH7 expression. Positive segregants from two T1 lines studied in detail showed reduced MSH7 expression when compared to transformed controls and null segregants. Expression of MSH6, another member of the mismatch repair family which is most closely related to the MSH7 gene, was not significantly reduced in these lines. In both T1 lines, reduced seed set in positive segregants was observed. Conclusion Results presented here indicate, for the first time, a distinct functional role for MSH7 in vivo and show that expression of this gene is necessary for wild-type levels of fertility. These observations suggest that MSH7 has an important function during meiosis and as such remains a candidate for Ph2. PMID:18096080

  17. HLA class II susceptibility pattern for type 1 diabetes (T1D) in an Iranian population.

    PubMed

    Kiani, J; Hajilooi, M; Furst, D; Rezaei, H; Shahryari-Hesami, S; Kowsarifard, S; Zamani, A; Solgi, G

    2015-08-01

    This study aimed to determine the HLA-DRB1/HLA-DQB1 susceptibility and protection pattern for type 1 diabetes (T1D) in a population from Hamadan, north-west of Iran. A total of 133 patients with T1D were tested for HLA-DRB1 and HLA-DQB1 alleles using PCR-SSP compared to 100 ethnic-matched healthy controls. Alleles and haplotypes frequencies were compared between both groups. The most susceptible alleles for disease were HLA-DRB1*03:01, DRB1*04:02, DQB1*02:01 and DQB1*03:02, and protective alleles were HLA-DRB1*07:01, *11:01, *13:01, *14:01 and DRB1*15 and HLA-DQB1*06:01, *06:02 and *06:03. Haplotype analysis revealed that patients with T1D had higher frequencies of DRB1*03:01-DQB1*02:01 (OR = 4.86, P < 10(-7) ) and DRB1*04:02-DQB1*03:02 (OR = 9.93, P < 10(-7) ) and lower frequencies of DRB1*07:01-DQB1*02:01 (P = 0.0005), DRB1*11:01-DQB1*03:01 (P = 0.001), DRB1*13:01-DQB1*06:03 (P = 0.002) and DRB1*15-DQB1*06:01 (P = 0.001) haplotypes compared to healthy controls. Heterozygote combination of both susceptible haplotypes (DR3/DR4) confers the highest risk for T1D (RR = 18.80, P = 4 × 10(-5) ). Additionally, patients with homozygote diplotype, DR3/DR3 and DR4/DR4, showed a similar risk with less extent to heterozygote combination (P = 0.0004 and P = 0.01, respectively). Our findings not only confirm earlier reports from Iranians but also are in line with Caucasians and partly with Asians and some African patients with T1D. Remarkable differences were the identification of DRB1*04:01-DQB1*03:02, DRB1*07:01-DQB1*03:03 and DRB1*16-DQB1*05:02 as neutral and DRB1*13:01-DQB1*06:03 as the most protective haplotypes in this study.

  18. Transgenic algae engineered for higher performance

    SciTech Connect

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  19. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    PubMed

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  20. Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease.

    PubMed

    Namukwaya, B; Tripathi, L; Tripathi, J N; Arinaitwe, G; Mukasa, S B; Tushemereirwe, W K

    2012-08-01

    Banana Xanthomonas wilt (BXW), caused by Xanthomonas campestris pv. musacearum, is one of the most important diseases of banana (Musa sp.) and currently considered as the biggest threat to banana production in Great Lakes region of East and Central Africa. The pathogen is highly contagious and its spread has endangered the livelihood of millions of farmers who rely on banana for food and income. The development of disease resistant banana cultivars remains a high priority since farmers are reluctant to employ labor-intensive disease control measures and there is no host plant resistance among banana cultivars. In this study, we demonstrate that BXW can be efficiently controlled using transgenic technology. Transgenic bananas expressing the plant ferredoxin-like protein (Pflp) gene under the regulation of the constitutive CaMV35S promoter were generated using embryogenic cell suspensions of banana. These transgenic lines were characterized by molecular analysis. After challenge with X. campestris pv. musacearum transgenic lines showed high resistance. About 67% of transgenic lines evaluated were completely resistant to BXW. These transgenic lines did not show any disease symptoms after artificial inoculation of in vitro plants under laboratory conditions as well as potted plants in the screen-house, whereas non-transgenic control plants showed severe symptoms resulting in complete wilting. This study confirms that expression of the Pflp gene in banana results in enhanced resistance to BXW. This transgenic technology can provide a timely solution to the BXW pandemic.

  1. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus

    PubMed Central

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    ABSTRACT Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV. PMID:25984767

  2. Pyramiding transgenes for multiple resistance in rice against bacterial blight, yellow stem borer and sheath blight.

    PubMed

    Datta, K; Baisakh, N; Thet, K Maung; Tu, J; Datta, S K

    2002-12-01

    Here we describe the development of transgene-pyramided stable elite rice lines resistant to disease and insect pests by conventional crossing of two transgenic parental lines transformed independently with different genes. The Xa21 gene (resistance to bacterial blight), the Bt fusion gene (for insect resistance) and the chitinase gene (for tolerance of sheath blight) were combined in a single rice line by reciprocal crossing of two transgenic homozygous IR72 lines. F4 plant lines carrying all the genes of interest stably were identified using molecular methods. The identified lines, when exposed to infection caused by Xanthomonas oryzae pv oryzae, showed resistance to bacterial blight. Neonate larval mortality rates of yellow stem borer ( Scirpophaga incertulas) in an insect bioassay of the same identified lines were 100%. The identified line pyramided with different genes to protect against yield loss showed high tolerance of sheath blight disease caused by Rhizoctonia solani.

  3. Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).

    PubMed

    Singh, Natwar; Mishra, Avinash; Jha, Bhavanath

    2014-08-15

    Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture.

  4. A 90-Day Dietary Toxicity Study of Genetically Modified Rice T1C-1 Expressing Cry1C Protein in Sprague Dawley Rats

    PubMed Central

    Tang, Xueming; Han, Fangting; Zhao, Kai; Xu, Yan; Wu, Xiao; Wang, Jinbin; Jiang, Lingxi; Shi, Wei

    2012-01-01

    In a 90-day study, Sprague Dawley rats were fed transgenic T1C-1 rice expressing Cry1C protein and were compared with rats fed non-transgenic parental rice Minghui 63 and rats fed a basal diet. No adverse effects on animal behavior or weight gain were observed during the study. Blood samples were collected and analyzed, and standard hematological and biochemical parameters were compared. A few of these parameters were found to be significantly different, but were within the normal reference intervals for rats of this breed and age, and were thus not considered to be treatment-related. Following sacrifice, a large number of organs were weighed, and macroscopic and histopathological examinations were performed with no changes reported. The aim of this study was to use a known animal model to determine the safety of the genetically modified (GM) rice T1C-1. The results showed no adverse or toxic effects due to T1C-1 rice when tested in this 90-day study. PMID:23300690

  5. A 90-day dietary toxicity study of genetically modified rice T1C-1 expressing Cry1C protein in Sprague Dawley rats.

    PubMed

    Tang, Xueming; Han, Fangting; Zhao, Kai; Xu, Yan; Wu, Xiao; Wang, Jinbin; Jiang, Lingxi; Shi, Wei

    2012-01-01

    In a 90-day study, Sprague Dawley rats were fed transgenic T1C-1 rice expressing Cry1C protein and were compared with rats fed non-transgenic parental rice Minghui 63 and rats fed a basal diet. No adverse effects on animal behavior or weight gain were observed during the study. Blood samples were collected and analyzed, and standard hematological and biochemical parameters were compared. A few of these parameters were found to be significantly different, but were within the normal reference intervals for rats of this breed and age, and were thus not considered to be treatment-related. Following sacrifice, a large number of organs were weighed, and macroscopic and histopathological examinations were performed with no changes reported. The aim of this study was to use a known animal model to determine the safety of the genetically modified (GM) rice T1C-1. The results showed no adverse or toxic effects due to T1C-1 rice when tested in this 90-day study.

  6. Cassette vectors directing expression of T cell receptor genes in transgenic mice.

    PubMed

    Kouskoff, V; Signorelli, K; Benoist, C; Mathis, D

    1995-03-27

    We describe a pair of cassette vectors that can be used to express rearranged T cell receptor genes in transgenic mice. Short DNA fragments containing rearranged V alpha and V beta segments are readily amplified from T cells and introduced between artificial cloning sites. Transgene-derived mRNAs are transcribed under the control of the natural TCR alpha and -beta promoter/enhancer elements. Using this vector, we have obtained transgenic mouse lines which display transgene-encoded TCR alpha and beta chains on a majority of T cells. PMID:7714342

  7. SupT-1: a cell system suitable for an efficient propagation of both HHV-7 and HHV-6 variants A and B.

    PubMed

    Cermelli, C; Pietrosemoli, P; Meacci, M; Pecorari, M; Sabbatini, A M; Colombari, B; Portolani, M

    1997-07-01

    HHV-7 growth on Sup-T1, an immature T-cell line, was studied using different HHV-7 isolates obtained in our laboratory. Titration of viral yields showed that all the virus isolates propagate on this cell line more efficiently than in cord blood lymphocytes, the cells usually recommended for HHV-7 growth. The permissivity of Sup-T1 to HHV-6, whose ability to replicate in these cells was still unknown, was also investigated using two virus isolates representative of variants A and B respectively. Both isolates were able to propagate on Sup-T1 and viral titres were similar to those obtained in cord blood lymphocytes. As the efficient propagation of both HHV-7 and HHV-6 isolates in Sup-T1 cultures, these cells may replace more time consuming and expensive cord blood lymphocyte preparations for the propagation of both the viruses.

  8. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    PubMed

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  9. Immunity to tomato yellow leaf curl virus in transgenic tomato is associated with accumulation of transgene small RNA.

    PubMed

    Leibman, Diana; Prakash, Shanmugam; Wolf, Dalia; Zelcer, Aaron; Anfoka, Ghandi; Haviv, Sabrina; Brumin, Marina; Gaba, Victor; Arazi, Tzahi; Lapidot, Moshe; Gal-On, Amit

    2015-11-01

    Gene silencing is a natural defense response of plants against invading RNA and DNA viruses. The RNA post-transcriptional silencing system has been commonly utilized to generate transgenic crop plants that are "immune" to plant virus infection. Here, we applied this approach against the devastating DNA virus tomato yellow leaf curl virus (TYLCV) in its host tomato (Solanum lycopersicum L.). To generate broad resistance to a number of different TYLCV viruses, three conserved sequences (the intergenic region [NCR], V1-V2 and C1-C2 genes) from the genome of the severe virus (TYLCV) were synthesized as a single insert and cloned into a hairpin configuration in a binary vector, which was used to transform TYLCV-susceptible tomato plants. Eight of 28 independent transgenic tomato lines exhibited immunity to TYLCV-Is and to TYLCV-Mld, but not to tomato yellow leaf curl Sardinia virus, which shares relatively low sequence homology with the transgene. In addition, a marker-free (nptII-deleted) transgenic tomato line was generated for the first time by Agrobacterium-mediated transformation without antibiotic selection, followed by screening of 1180 regenerated shoots by whitefly-mediated TYLCV inoculation. Resistant lines showed a high level of transgene-siRNA (t-siRNA) accumulation (22% of total small RNA) with dominant sizes of 21 nt (73%) and 22 nt (22%). The t-siRNA displayed hot-spot distribution ("peaks") along the transgene, with different distribution patterns than the viral-siRNA peaks observed in TYLCV-infected tomato. A grafting experiment demonstrated the mobility of 0.04% of the t-siRNA from transgenic rootstock to non-transformed scion, even though scion resistance against TYLCV was not achieved. PMID:26255053

  10. Tandem constructs to mitigate transgene persistence: tobacco as a model.

    PubMed

    Al-Ahmad, Hani; Galili, Shmuel; Gressel, Jonathan

    2004-03-01

    Some transgenic crops can introgress genes into other varieties of the crop, to related weeds or themselves remain as 'volunteer' weeds, potentially enhancing the invasiveness or weediness of the resulting offspring. The presently suggested mechanisms for transgene containment allow low frequency of gene release (leakage), requiring the mitigation of continued spread. Transgenic mitigation (TM), where a desired primary gene is tandemly coupled with mitigating genes that are positive or neutral to the crop but deleterious to hybrids and their progeny, was tested as a mechanism to mitigate transgene introgression. Dwarfism, which typically increases crop yield while decreasing the ability to compete, was used as a mitigator. A construct of a dominant ahasR (acetohydroxy acid synthase) gene conferring herbicide resistance in tandem with the semidominant mitigator dwarfing Delta gai (gibberellic acid-insensitive) gene was transformed into tobacco (Nicotiana tabacum). The integration and the phenotypic stability of the tandemly linked ahasR and Delta gai genomic inserts in later generations were confirmed by polymerase chain reaction. The hemizygous semidwarf imazapyr-resistant TM T1 (= BC1) transgenic plants were weak competitors when cocultivated with wild type segregants under greenhouse conditions and without using the herbicide. The competition was most intense at close spacings typical of weed offspring. Most dwarf plants interspersed with wild type died at 1-cm, > 70% at 2.5-cm and 45% at 5-cm spacing, and the dwarf survivors formed no flowers. At 10-cm spacing, where few TM plants died, only those TM plants growing at the periphery of the large cultivation containers formed flowers, after the wild type plants terminated growth. The highest reproductive TM fitness relative to the wild type was 17%. The results demonstrate the suppression of crop-weed hybrids when competing with wild type weeds, or such crops as volunteer weeds, in seasons when the selector

  11. Effect of Air Ions on Submicron T1 Bacteriophage Aerosols

    PubMed Central

    Happ, John W.; Harstad, J. Bruce; Buchanan, Lee M.

    1966-01-01

    The effect of a high concentration of ionized air molecules on sampling T1 phage aerosols of submicron particle size was evaluated by comparing the phage recoveries of all-glass impingers (AGI-4) and type 6 filter papers. Sampler recoveries of all ionized aerosols were less than the recoveries of nonionized control aerosols. These reductions in recovery were greater with positive ions than with negative ions or ions of mixed polarity. The AGI-4 allowed considerable slippage, which was not affected by the air ions. Type 6 filter paper recoveries were less than AGI-4 recoveries. The air ions did not appear to affect the aerosol particle size as determined by an electron microscope. Images Fig. 1 Fig. 3 PMID:16349691

  12. Internal disruptions and RHF in IR-T1 tokamak

    SciTech Connect

    Ghoranneviss, M.; Masnavi, M.; Khademian, A.

    1996-12-31

    Sawtooth oscillations are observed on IR-T1 Tokamak during low ql discharge with a disruption time of about 30--60 {micro}s. The q = 1 singular surface occurs at radius 3--3.5 cm and inverted Sawtooth from chords outside this radius. The superimposed (m = 1) oscillation with a frequency of about 19 kHz {approx} 25 kHz, according to the tokamak discharges parameters, preceding the Sawtooth oscillation. One major effect the Sawtooth oscillation is to flatten the temperature and density profiles approximately out to a mixing radius rm = {radical}2 rs,. Furthermore, by applying RHFs (L = 2 and L = 3), the Sawtooth behavior is modified. The magnitude of the weak RHFs used in the experiments did not exceed 1% of Bp. Results showed that the weak RHFs magnetic perturbation would change the MHD instabilities and the Sawtooth behavior, as well as plasma, confinement.

  13. MAIN-BELT COMET P/2012 T1 (PANSTARRS)

    SciTech Connect

    Hsieh, Henry H.; Kaluna, Heather M.; Yang Bin; Haghighipour, Nader; Micheli, Marco; Denneau, Larry; Jedicke, Robert; Kleyna, Jan; Veres, Peter; Wainscoat, Richard J.; Ansdell, Megan; Elliott, Garrett T.; Keane, Jacqueline V.; Meech, Karen J.; Riesen, Timm E.; Sonnett, Sarah; Novakovic, Bojan; Fitzsimmons, Alan; Moskovitz, Nicholas A.; Sheppard, Scott S.; and others

    2013-07-01

    We present initial results from observations and numerical analyses aimed at characterizing the main-belt comet P/2012 T1 (PANSTARRS). Optical monitoring observations were made between 2012 October and 2013 February using the University of Hawaii 2.2 m telescope, the Keck I telescope, the Baade and Clay Magellan telescopes, Faulkes Telescope South, the Perkins Telescope at Lowell Observatory, and the Southern Astrophysical Research Telescope. The object's intrinsic brightness approximately doubles from the time of its discovery in early October until mid-November and then decreases by {approx}60% between late December and early February, similar to photometric behavior exhibited by several other main-belt comets and unlike that exhibited by disrupted asteroid (596) Scheila. We also used Keck to conduct spectroscopic searches for CN emission as well as absorption at 0.7 {mu}m that could indicate the presence of hydrated minerals, finding an upper limit CN production rate of Q{sub CN} < 1.5 Multiplication-Sign 10{sup 23} mol s{sup -1}, from which we infer a water production rate of Q{sub H{sub 2O}}<5 Multiplication-Sign 10{sup 25} mol s{sup -1}, and no evidence of the presence of hydrated minerals. Numerical simulations indicate that P/2012 T1 is largely dynamically stable for >100 Myr and is unlikely to be a recently implanted interloper from the outer solar system, while a search for potential asteroid family associations reveals that it is dynamically linked to the {approx}155 Myr old Lixiaohua asteroid family.

  14. Ethical issues in transgenics.

    PubMed

    Sherlock, R; Morrey, J D

    2000-01-01

    The arguments of critics and concerns of the public on generating transgenic cloned animals are analyzed for the absence or presence of logical structure. Critics' arguments are symbolically compared with "genetic trespassing," "genetic speeding," or "going the wrong way," and responses are provided to these arguments. Scientists will be empowered to participate in the public discussion and to engage the critics on these issues as they consider thoughtful, plausible responses to their concerns. Temporary moratoriums are recognized as a plausible approach to dealing with possible concerns of new scientific advancements.

  15. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond

    PubMed Central

    Ting, Jonathan T.; Feng, Guoping

    2014-01-01

    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more “extra” genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines. PMID:24772073

  16. Transgenic horticultural crops in Asia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Modern biotechnology applications, including genetic engineering, are a powerful tool to complement the conventional methods of crop improvement. Asia currently has three countries cultivating biotech/transgenic crops – China, India, and the Philippines, but only China commercially grows a transgen...

  17. A globin enhancer acts by increasing the proportion of erythrocytes expressing a linked transgene.

    PubMed Central

    Sutherland, H G; Martin, D I; Whitelaw, E

    1997-01-01

    Enhancer elements have been shown to affect the probability of a gene establishing an active transcriptional state and suppress the silencing of reporter genes in cell lines, but their effect in transgenic mice has been obscured by the use of assays that do not assess expression on a cell-by-cell basis. We have examined the effect of a globin enhancer on the variegation of lacZ expression in erythrocytes of transgenic mice. Mice carrying lacZ driven by the alpha-globin promoter exhibit beta-galactosidase (beta-Gal) expression in only a very small proportion of embryonic erythrocytes. When the transgenic construct also contains the (alphaHS-40 enhancer, which controls expression of the alpha-globin gene, expression is seen in a high proportion of embryonic erythrocytes, although there are variations between transgenic lines which can be attributed to different sites of integration. Analysis of beta-Gal expression levels suggests that expressing cells in lines carrying only the alpha-globin promoter express as much beta-Gal as those in which the transgene also contains alphaHS-40. A marked decline in transgene expression occurs as mice age, which is mainly due to a decrease in the proportion of cells expressing the transgene. Thus, a globin enhancer can act to suppress variegation of a linked transgene; this result is consistent with a model in which enhancers act to establish and maintain an active domain without directly affecting the transcriptional rate. PMID:9032288

  18. An inducible transgene reports activation of macrophages in live zebrafish larvae.

    PubMed

    Sanderson, Leslie E; Chien, An-Tzu; Astin, Jonathan W; Crosier, Kathryn E; Crosier, Philip S; Hall, Christopher J

    2015-11-01

    Macrophages are the most functionally heterogenous cells of the hematopoietic system. Given many diseases are underpinned by inappropriate macrophage activation, macrophages have emerged as a therapeutic target to treat disease. A thorough understanding of what controls macrophage activation will likely reveal new pathways that can be manipulated for therapeutic benefit. Live imaging fluorescent macrophages within transgenic zebrafish larvae has provided a valuable window to investigate macrophage behavior in vivo. Here we describe the first transgenic zebrafish line that reports macrophage activation, as evidenced by induced expression of an immunoresponsive gene 1(irg1):EGFP transgene. When combined with existing reporter lines that constitutively mark macrophages, we reveal this unique transgenic line can be used to live image macrophage activation in response to the bacterial endotoxin lipopolysaccharide and xenografted human cancer cells. We anticipate the Tg(irg1:EGFP) line will provide a valuable tool to explore macrophage activation and plasticity in the context of different disease models.

  19. Retinoic acid-mediated gene expression in transgenic reporter zebrafish.

    PubMed

    Perz-Edwards, A; Hardison, N L; Linney, E

    2001-01-01

    Retinoic acid-mediated gene activation is important for normal vertebrate development. The size and nature of retinoic acid make it difficult to identify the precise cellular location of this signaling molecule throughout an embryo. Additionally, retinoic acid (RA) signaling is regulated by a complex combination of receptors, coactivators, and antagonizing proteins. Thus, in order to integrate these signals and identify regions within a whole developing embryo where cells can respond transcriptionally to retinoic acid, we have used a reporter transgenic approach. We have generated several stable lines of transgenic zebrafish which use retinoic acid response elements to drive fluorescent protein expression. In these zebrafish lines, transgene expression is localized to regions of the neural tube, retina, notochord, somites, heart, pronephric ducts, branchial arches, and jaw muscles in embryos and larvae. Transgene expression can be induced in additional regions of the neural tube and retina as well as the immature notochord, hatching gland, enveloping cell layer, and fin by exposing embryos to retinoic acid. Treatment with retinoic acid synthase inhibitors, citral and diethylaminobenzaldehyde (DEAB), during neurulation, greatly reduces transgene expression. DEAB treatment of embryos at gastrulation phenocopies the embryonic effects of vitamin A deprivation or targeted disruption of the RA synthase retinaldehyde dehydrogenase-2 in other vertebrates. Together these data suggest that the reporter expression we see in zebrafish is dependent upon conserved vertebrate pathways of RA synthesis.

  20. Main-belt Comet P/2012 T1 (PANSTARRS)

    NASA Astrophysics Data System (ADS)

    Hsieh, Henry H.; Kaluna, Heather M.; Novaković, Bojan; Yang, Bin; Haghighipour, Nader; Micheli, Marco; Denneau, Larry; Fitzsimmons, Alan; Jedicke, Robert; Kleyna, Jan; Vereš, Peter; Wainscoat, Richard J.; Ansdell, Megan; Elliott, Garrett T.; Keane, Jacqueline V.; Meech, Karen J.; Moskovitz, Nicholas A.; Riesen, Timm E.; Sheppard, Scott S.; Sonnett, Sarah; Tholen, David J.; Urban, Laurie; Kaiser, Nick; Chambers, K. C.; Burgett, William S.; Magnier, Eugene A.; Morgan, Jeffrey S.; Price, Paul A.

    2013-07-01

    We present initial results from observations and numerical analyses aimed at characterizing the main-belt comet P/2012 T1 (PANSTARRS). Optical monitoring observations were made between 2012 October and 2013 February using the University of Hawaii 2.2 m telescope, the Keck I telescope, the Baade and Clay Magellan telescopes, Faulkes Telescope South, the Perkins Telescope at Lowell Observatory, and the Southern Astrophysical Research Telescope. The object's intrinsic brightness approximately doubles from the time of its discovery in early October until mid-November and then decreases by ~60% between late December and early February, similar to photometric behavior exhibited by several other main-belt comets and unlike that exhibited by disrupted asteroid (596) Scheila. We also used Keck to conduct spectroscopic searches for CN emission as well as absorption at 0.7 μm that could indicate the presence of hydrated minerals, finding an upper limit CN production rate of Q CN < 1.5 × 1023 mol s-1, from which we infer a water production rate of Q_H_2O<5\\times 10^{25} mol s-1, and no evidence of the presence of hydrated minerals. Numerical simulations indicate that P/2012 T1 is largely dynamically stable for >100 Myr and is unlikely to be a recently implanted interloper from the outer solar system, while a search for potential asteroid family associations reveals that it is dynamically linked to the ~155 Myr old Lixiaohua asteroid family. Some of the data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration, and made possible by the generous financial support of the W. M. Keck Foundation, the Magellan Telescopes located at Las Campanas Observatory, Chile, and the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inova

  1. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    PubMed Central

    Schäfer, Tina; Hanke, Magda-Viola; Flachowsky, Henryk; König, Stephan; Peil, Andreas; Kaldorf, Michael; Polle, Andrea; Buscot, François

    2012-01-01

    This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF). We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova) and transgenic lines (M9/T386 and M9/T389) were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass. PMID:22888297

  2. Inheritance of GFP-Bt transgenes from Brassica napus in backcrosses with three wild B. rapa accessions.

    PubMed

    Zhu, Bin; Lawrence, John R; Warwick, Suzanne I; Mason, Peter; Braun, Lorraine; Halfhill, Matthew D; Stewart, C Neal

    2004-01-01

    Transgenes from transgenic oilseed rape, Brassica napus (AACC genome), can introgress into populations of wild B. rapa (AA genome), but little is known about the long-term persistence of transgenes from different transformation events. For example, transgenes that are located on the crop's C chromosomes may be lost during the process of introgression. We investigated the genetic behavior of transgenes in backcross generations of wild B. rapa after nine GFP (green fluorescent protein)-Bt (Bacillus thuringiensis) B. napus lines, named GT lines, were hybridized with three wild B. rapa accessions, respectively. Each backcross generation involved crosses between hemizygous GT plants and non-GT B. rapa pollen recipients. In some cases, sample sizes were too small to allow the detection of major deviations from Mendelian segregation ratios, but the segregation of GT:non-GT was consistent with an expected ratio of 1:1 in all crosses in the BC1 generation. Starting with the BC2 generation, significantly different genetic behavior of the transgenes was observed among the nine GT B. napus lines. In some lines, the segregation of GT:non-GT showed a ratio of 1:1 in the BC2, BC3, and BC4 generations. However, in other GT B. napus lines the segregation ratio of GT:non-GT significantly deviated from 1:1 in the BC2 and BC3 generations, which had fewer transgenic progeny than expected, but not in the BC4 generation. Most importantly, in two GT B. napus lines the segregation of GT:non-GT did not fit into a ratio of 1:1 in the BC2, BC3 or BC4 generations due to a deficiency of transgenic progeny. For these lines, a strong reduction of transgene introgression was observed in all three B. rapa accessions. These findings imply that the genomic location of transgenes in B. napus may affect the long-term persistence of transgenes in B. rapa after hybridization has occurred.

  3. Role of nutrient-sensing taste 1 receptor (T1R) family members in gastrointestinal chemosensing.

    PubMed

    Shirazi-Beechey, Soraya P; Daly, Kristian; Al-Rammahi, Miran; Moran, Andrew W; Bravo, David

    2014-06-01

    Luminal nutrient sensing by G-protein-coupled receptors (GPCR) expressed on the apical domain of enteroendocrine cells activates intracellular pathways leading to secretion of gut hormones that control vital physiological processes such as digestion, absorption, food intake and glucose homeostasis. The taste 1 receptor (T1R) family of GPCR consists of three members: T1R1; T1R2; T1R3. Expression of T1R1, T1R2 and T1R3 at mRNA and protein levels has been demonstrated in the intestinal tissue of various species. It has been shown that T1R2-T1R3, in association with G-protein gustducin, is expressed in intestinal K and L endocrine cells, where it acts as the intestinal glucose (sweet) sensor. A number of studies have demonstrated that activation of T1R2-T1R3 by natural sugars and artificial sweeteners leads to secretion of glucagon-like peptides 1&2 (GLP-1 and GLP-2) and glucose dependent insulinotropic peptide (GIP). GLP-1 and GIP enhance insulin secretion; GLP-2 increases intestinal growth and glucose absorption. T1R1-T1R3 combination co-expressed on the apical domain of cholecystokinin (CCK) expressing cells is a luminal sensor for a number of L-amino acids; with amino acid-activation of the receptor eliciting CCK secretion. This article focuses on the role of the gut-expressed T1R1, T1R2 and T1R3 in intestinal sweet and L-amino acid sensing. The impact of exploiting T1R2-T1R3 as a nutritional target for enhancing intestinal glucose absorption and gut structural maturity in young animals is also highlighted.

  4. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    SciTech Connect

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-08-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expression supports that cells utilize the PiT1 levels to control proliferation, with non-proliferating cells showing the lowest PiT1 mRNA levels. The mechanism behind the role of PiT1 in increased cell proliferation is not known. We, however, found that compared to control cells, cultures of NIH3T3 cells overexpressing PiT1 upon seeding showed increased cell number after 24 h and had shifted more cells from G0/G1 to S+G2/M within 12 h, suggesting that an early event may play a role. We here show that expression of human PiT1 in NIH3T3 cells led to faster cell adhesion; this effect was not cell type specific in that it was also observed when expressing human PiT1 in MC3T3-E1 cells. We also show for NIH3T3 that PiT1 overexpression led to faster cell spreading. The final total numbers of attached cells did, however, not differ between cultures of PiT1 overexpressing cells and control cells of neither cell type. We suggest that the PiT1-mediated fast adhesion potentials allow the cells to go faster out of G0/G1 and thereby contribute to their proliferative advantage within the first 24 h after seeding. - Highlights: • Effects of elevated levels of the inorganic phosphate transporter PiT1 were studied. • The density-inhibited murine cell lines NIH3T3 and MC3T3-E1 showed faster adhesion. • NIH3T3 cells showed faster spreading. • We suggest that the faster adhesion/spreading contributes to faster proliferation.

  5. Resolution enhanced T1-insensitive steady-state imaging.

    PubMed

    Derakhshan, Jamal J; Nour, Sherif G; Sunshine, Jeffrey L; Griswold, Mark A; Duerk, Jeffrey L

    2012-08-01

    Resolution enhanced T(1)-insensitive steady-state imaging (RE-TOSSI) is a new MRI pulse sequence for the generation of rapid T(2) contrast with high spatial resolution. TOSSI provides T(2) contrast by using nonequally spaced inversion pulses throughout a balanced steady-state free precession (SSFP) acquisition. In RE-TOSSI, these energy and time intensive adiabatic inversion pulses and associated magnetization preparation are removed from TOSSI after acquisition of the data around the center of k-space. Magnetization evolution simulations demonstrate T(2) contrast in TOSSI as well as reduction in the widening of the point spread function width (by up to a factor of 4) to a near ideal case for RE-TOSSI. Phantom experimentation is used to characterize and compare the contrast and spatial resolution properties of TOSSI, RE-TOSSI, balanced SSFP, Half-Fourier Acquisition Single-Shot Turbo Spin Echo (HASTE), and turbo spin echo and to optimize the fraction of k-space acquired using TOSSI. Comparison images in the abdomen and brain demonstrate similar contrast and improved spatial resolution in RE-TOSSI compared with TOSSI; comparison balanced SSFP, HASTE, and turbo spin echo images are provided. RE-TOSSI is capable of providing high spatial resolution T(2)-weighted images in 1 s or less per image.

  6. YpT1-2N0 rectal cancer after neoadjuvant chemoradiation has lower survival compared with pT1-2N0 rectal cancer

    PubMed Central

    Wan, Jue-feng; Zhu, Ji; Li, Gui-chao; Sun, Wen-jie; Zhang, Zhen

    2015-01-01

    Pathologic T1-2N0 rectal cancer shows an excellent prognosis without preoperative or postoperative chemoradiation. However, oncologic outcome of ypT1-2N0 remains unclear and undetermined. Thus, the aim of this study was to compare the survival of ypT1-2 and pT1-2 rectal cancer patients after radical resection and identify risk factors of ypT1-2 rectal cancer in Surveillance, Epidemiology, and End Results Program (SEER)-registered rectal cancer patients. The results showed that ypT1-2N0 rectal cancer after neoadjuvant chemoradiation has lower survival compared with pT1-2N0 rectal cancer and mucinous/signet-ring cancer and less than 12 lymph nodes retrieval were two risk factors in ypT1-2 patients. These results suggest that ypT1-2 patients with one or two risk factors may benefit from postoperative adjuvant chemotherapy. PMID:26517674

  7. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    PubMed

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  8. [Transgenics without Manichaeism].

    PubMed

    Valle, S

    2000-01-01

    We live in an era characterized by the hegemony of science and technology, an era fraught with questions awaiting answers which would enable a safe and sustainable future for humankind. The development of agro-industrial processes - food products in particular - through recombinant DNA technology has enhanced the profit prospects of the few big biotechnology companies and of large-scale farmers who have access to the latest technological developments. We thus oppose a moratorium on recombinant DNA technology. Moreover, hasty statements about risk-free transgenics may be misleading in the absence of extensive safety tests. There is a pressing need for the establishment of biosafety policy in this country involving the organized civil society and every government agency responsible for monitoring such matters. There is also the need to put in place a bio-surveillance and a code of ethics regarding genetic manipulation.

  9. Development of transgenic animals for optogenetic manipulation of mammalian nervous system function: Progress and prospects for behavioral neuroscience

    PubMed Central

    Ting, Jonathan T.; Feng, Guoping

    2014-01-01

    Here we review the rapidly growing toolbox of transgenic mice and rats that exhibit functional expression of engineered opsins for neuronal activation and silencing with light. Collectively, these transgenic animals are enabling neuroscientists to access and manipulate the many diverse cell types in the mammalian nervous system in order to probe synaptic and circuitry connectivity, function, and dysfunction. The availability of transgenic lines affords important advantages such as stable and heritable transgene expression patterns across experimental cohorts. As such, the use of transgenic lines precludes the need for other costly and labor-intensive procedures to achieve functional transgene expression in each individual experimental animal. This represents an important consideration when large cohorts of experimental animals are desirable as in many common behavioral assays. We describe the diverse strategies that have been implemented for developing transgenic mouse and rat lines and highlight recent advances that have led to dramatic improvements in achieving functional transgene expression of engineered opsins. Furthermore, we discuss considerations and caveats associated with implementing recently developed transgenic lines for optogenetics-based experimentation. Lastly, we propose strategies that can be implemented to develop and refine the next generation of genetically modified animals for behaviorally-focused optogenetics-based applications. PMID:23473879

  10. Different functional roles of T1R subunits in the heteromeric taste receptors.

    PubMed

    Xu, Hong; Staszewski, Lena; Tang, Huixian; Adler, Elliot; Zoller, Mark; Li, Xiaodong

    2004-09-28

    The T1R receptors, a family of taste-specific class C G protein-coupled receptors, mediate mammalian sweet and umami tastes. The structure-function relationships of T1R receptors remain largely unknown. In this study, we demonstrate the different functional roles of T1R extracellular and transmembrane domains in ligand recognition and G protein coupling. Similar to other family C G protein-coupled receptors, the N-terminal Venus flytrap domain of T1R2 is required for recognizing sweeteners, such as aspartame and neotame. The G protein coupling requires the transmembrane domain of T1R2. Surprisingly, the C-terminal transmembrane domain of T1R3 is required for recognizing sweetener cyclamate and sweet taste inhibitor lactisole. Because T1R3 is the common subunit in the sweet taste receptor and the umami taste receptor, we tested the interaction of lactisole and cyclamate with the umami taste receptor. Lactisole inhibits the activity of the human T1R1/T1R3 receptor, and, as predicted, blocked the umami taste of l-glutamate in human taste tests. Cyclamate does not activate the T1R1/T1R3 receptor by itself, but potentiates the receptor's response to l-glutamate. Taken together, these findings demonstrate the different functional roles of T1R3 and T1R2 and the presence of multiple ligand binding sites on the sweet taste receptor. PMID:15353592

  11. Different functional roles of T1R subunits in the heteromeric taste receptors.

    PubMed

    Xu, Hong; Staszewski, Lena; Tang, Huixian; Adler, Elliot; Zoller, Mark; Li, Xiaodong

    2004-09-28

    The T1R receptors, a family of taste-specific class C G protein-coupled receptors, mediate mammalian sweet and umami tastes. The structure-function relationships of T1R receptors remain largely unknown. In this study, we demonstrate the different functional roles of T1R extracellular and transmembrane domains in ligand recognition and G protein coupling. Similar to other family C G protein-coupled receptors, the N-terminal Venus flytrap domain of T1R2 is required for recognizing sweeteners, such as aspartame and neotame. The G protein coupling requires the transmembrane domain of T1R2. Surprisingly, the C-terminal transmembrane domain of T1R3 is required for recognizing sweetener cyclamate and sweet taste inhibitor lactisole. Because T1R3 is the common subunit in the sweet taste receptor and the umami taste receptor, we tested the interaction of lactisole and cyclamate with the umami taste receptor. Lactisole inhibits the activity of the human T1R1/T1R3 receptor, and, as predicted, blocked the umami taste of l-glutamate in human taste tests. Cyclamate does not activate the T1R1/T1R3 receptor by itself, but potentiates the receptor's response to l-glutamate. Taken together, these findings demonstrate the different functional roles of T1R3 and T1R2 and the presence of multiple ligand binding sites on the sweet taste receptor.

  12. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.

    PubMed

    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants.

  13. The interplay of T1- and T2-relaxation on T1-weighted MRI of hMSCs induced by Gd-DOTA-peptides.

    PubMed

    Cao, Limin; Li, Binbin; Yi, Peiwei; Zhang, Hailu; Dai, Jianwu; Tan, Bo; Deng, Zongwu

    2014-04-01

    Three Gd-DOTA-peptide complexes with different peptide sequence are synthesized and used as T1 contrast agent to label human mesenchymal stem cells (hMSCs) for magnetic resonance imaging study. The peptides include a universal cell penetrating peptide TAT, a linear MSC-specific peptide EM7, and a cyclic MSC-specific peptide CC9. A significant difference in labeling efficacy is observed between the Gd-DOTA-peptides as well as a control Dotarem. All Gd-DOTA-peptides as well as Dotarem induce significant increase in T1 relaxation rate which is in favor of T1-weighted MR imaging. Gd-DOTA-CC9 yields the maximum labeling efficacy but poor T1 contrast enhancement. Gd-DOTA-EM7 yields the minimum labeling efficacy but better T1 contrast enhancement. Gd-DOTA-TAT yields a similar labeling efficacy as Gd-DOTA-CC9 and similar T1 contrast enhancement as Gd-DOTA-EM7. The underlying mechanism that governs T1 contrast enhancement effect is discussed. Our results suggest that T1 contrast enhancement induced by Gd-DOTA-peptides depends not only on the introduced cellular Gd content, but more importantly on the effect that Gd-DOTA-peptides exert on the T1-relaxation and T2-relaxation processes/rates. Both T1 and particularly T2 relaxation rate have to be taken into account to interpret T1 contrast enhancement. In addition, the interpretation has to be based on cellular instead of aqueous longitudinal and transverse relaxivities of Gd-DOTA-peptides.

  14. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  15. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon

    PubMed Central

    Kendig, Derek M.; Hurst, Norman R.; Bradley, Zachary L.; Mahavadi, Sunila; Kuemmerle, John F.; Lyall, Vijay; DeSimone, John; Murthy, Karnam S.

    2014-01-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5′-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1−/− mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  16. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion.

  17. PbWoxT1 mRNA from pear (Pyrus betulaefolia) undergoes long-distance transport assisted by a polypyrimidine tract binding protein.

    PubMed

    Duan, Xuwei; Zhang, Wenna; Huang, Jing; Hao, Li; Wang, Shengnan; Wang, Aide; Meng, Dong; Zhang, Qiulei; Chen, Qiuju; Li, Tianzhong

    2016-04-01

    Little is known about the mechanisms by which mRNAs are transported over long distances in the phloem between the rootstock and the scion in grafted woody plants. We identified an mRNA in the pear variety 'Du Li' (Pyrus betulaefolia) that was shown to be transportable in the phloem. It contains a WUSCHEL-RELATED HOMEOBOX (WOX) domain and was therefore named Wox Transport 1 (PbWoxT1). A 548-bp fragment of PbWoxT1 is critical in long-distance transport. PbWoxT1 is rich in CUCU polypyrimidine domains and its mRNAs interact with a polypyrimidine tract binding protein, PbPTB3. Furthermore, the expression of PbWoxT1 significantly increased in the stems of wild-type (WT) tobacco grafted onto the rootstocks of PbWoxT1 or PbPTB3 co-overexpressing lines, but this was not the case in WT plants grafted onto PbWoxT1 overexpressing rootstocks, suggesting that PbPTB3 mediates PbWoxT1 mRNA long-distance transport. We provide novel information that adds a new mechanism with which to explain the noncell-autonomous manner of WOX gene function, which enriches our understanding of how WOX genes work in fruit trees and other species.

  18. Consistent transcriptional silencing of 35S-driven transgenes in gentian.

    PubMed

    Mishiba, Kei-ichiro; Nishihara, Masahiro; Nakatsuka, Takashi; Abe, Yoshiko; Hirano, Hiroshi; Yokoi, Takahide; Kikuchi, Akiko; Yamamura, Saburo

    2005-11-01

    In this study, no transgenic gentian (Gentiana triflora x Gentiana scabra) plants produced via Agrobacterium-mediated transformation exhibited transgene (GtMADS, gentian-derived MADS-box genes or sGFP, green fluorescent protein) expression in their leaf tissues, despite the use of constitutive Cauliflower mosaic virus (CaMV) 35S promoter. Strikingly, no expression of the selectable marker gene (bar) used for bialaphos selection was observed. To investigate the possible cause of this drastic transgene silencing, methylation-specific sequences were analysed by bisulfite genomic sequencing using tobacco transformants as a control. Highly methylated cytosine residues of CpG and CpWpG (W contains A or T) sites were distinctively detected in the promoter and 5' coding regions of the transgenes 35S-bar and 35S-GtMADS in all gentian lines analysed. These lines also exhibited various degrees of cytosine methylation in asymmetrical sequences. The methylation frequencies in the other transgene, nopaline synthase (NOS) promoter-driven nptII, and the endogenous GtMADS gene coding region, were much lower and were variable compared with those in the 35S promoter regions. Transgene methylation was observed in the bialaphos-selected transgenic calluses expressing the transgenes, and methylation sequences were distributed preferentially around the as-1 element in the 35S promoter. Calluses derived from leaf tissues of silenced transgenic gentian also exhibited transgene suppression, but expression was recovered by treatment with the methylation inhibitor 5-aza-2'-deoxycytidine (aza-dC). These results indicated that cytosine methylation occurs exclusively in the 35S promoter regions of the expressed transgenes during selection of gentian transformants, causing transcriptional gene silencing. PMID:16262705

  19. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

    PubMed Central

    2014-01-01

    Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred

  20. Taste information derived from T1R-expressing taste cells in mice.

    PubMed

    Yoshida, Ryusuke; Ninomiya, Yuzo

    2016-03-01

    The taste system of animals is used to detect valuable nutrients and harmful compounds in foods. In humans and mice, sweet, bitter, salty, sour and umami tastes are considered the five basic taste qualities. Sweet and umami tastes are mediated by G-protein-coupled receptors, belonging to the T1R (taste receptor type 1) family. This family consists of three members (T1R1, T1R2 and T1R3). They function as sweet or umami taste receptors by forming heterodimeric complexes, T1R1+T1R3 (umami) or T1R2+T1R3 (sweet). Receptors for each of the basic tastes are thought to be expressed exclusively in taste bud cells. Sweet (T1R2+T1R3-expressing) taste cells were thought to be segregated from umami (T1R1+T1R3-expressing) taste cells in taste buds. However, recent studies have revealed that a significant portion of taste cells in mice expressed all T1R subunits and responded to both sweet and umami compounds. This suggests that sweet and umami taste cells may not be segregated. Mice are able to discriminate between sweet and umami tastes, and both tastes contribute to behavioural preferences for sweet or umami compounds. There is growing evidence that T1R3 is also involved in behavioural avoidance of calcium tastes in mice, which implies that there may be a further population of T1R-expressing taste cells that mediate aversion to calcium taste. Therefore the simple view of detection and segregation of sweet and umami tastes by T1R-expressing taste cells, in mice, is now open to re-examination.

  1. Taste information derived from T1R-expressing taste cells in mice.

    PubMed

    Yoshida, Ryusuke; Ninomiya, Yuzo

    2016-03-01

    The taste system of animals is used to detect valuable nutrients and harmful compounds in foods. In humans and mice, sweet, bitter, salty, sour and umami tastes are considered the five basic taste qualities. Sweet and umami tastes are mediated by G-protein-coupled receptors, belonging to the T1R (taste receptor type 1) family. This family consists of three members (T1R1, T1R2 and T1R3). They function as sweet or umami taste receptors by forming heterodimeric complexes, T1R1+T1R3 (umami) or T1R2+T1R3 (sweet). Receptors for each of the basic tastes are thought to be expressed exclusively in taste bud cells. Sweet (T1R2+T1R3-expressing) taste cells were thought to be segregated from umami (T1R1+T1R3-expressing) taste cells in taste buds. However, recent studies have revealed that a significant portion of taste cells in mice expressed all T1R subunits and responded to both sweet and umami compounds. This suggests that sweet and umami taste cells may not be segregated. Mice are able to discriminate between sweet and umami tastes, and both tastes contribute to behavioural preferences for sweet or umami compounds. There is growing evidence that T1R3 is also involved in behavioural avoidance of calcium tastes in mice, which implies that there may be a further population of T1R-expressing taste cells that mediate aversion to calcium taste. Therefore the simple view of detection and segregation of sweet and umami tastes by T1R-expressing taste cells, in mice, is now open to re-examination. PMID:26912569

  2. Accelerated and Navigator-Gated Look-Locker Imaging for Cardiac T1 Estimation (ANGIE): Development and Application to T1 Mapping of the Right Ventricle

    PubMed Central

    Mehta, Bhairav B.; Chen, Xiao; Bilchick, Kenneth C.; Salerno, Michael; Epstein, Frederick H.

    2014-01-01

    Purpose: To develop a method for high-resolution cardiac T1 mapping. Methods: A new method, accelerated and navigator-gated look-locker imaging for cardiac T1 estimation (ANGIE), was developed. An adaptive acquisition algorithm that accounts for the interplay between navigator gating and undersampling patterns well-suited for compressed sensing was used to minimize scan time. Computer simulations, phantom experiments, and imaging of the left ventricle (LV) were used to optimize and evaluate ANGIE. ANGIE’s high spatial resolution was demonstrated by T1 mapping of the right ventricle (RV). Comparisons were made to modified Look-Locker imaging (MOLLI). Results: Retrospective reconstruction of fully sampled datasets demonstrated the advantages of the adaptive algorithm. For the LV, ANGIE measurements of T1 were in good agreement with MOLLI. For the RV, ANGIE achieved a spatial resolution of 1.2 × 1.2 mm2 with a scan time of 157±53 s per slice, and measured RV T1 values of 980±96 ms versus 1076±157 ms for lower-resolution MOLLI. ANGIE provided lower intrascan variation in the RV T1 estimate compared with MOLLI (P<0.05). Conclusion: ANGIE enables high-resolution cardiac T1 mapping in clinically reasonable scan times. ANGIE opens the prospect of quantitative T1 mapping of thin cardiovascular structures such as the RV wall. PMID:24515952

  3. Interactions between Equine Cyclin T1, Tat, and TAR Are Disrupted by a Leucine-to-Valine Substitution Found in Human Cyclin T1

    PubMed Central

    Taube, Ran; Fujinaga, Koh; Irwin, Dan; Wimmer, Jörg; Geyer, Matthias; Peterlin, B. Matija

    2000-01-01

    Transcriptional transactivators (Tat) from human immunodeficiency and equine infectious anemia viruses (HIV and EIAV) interact with their transactivation response elements (TAR) to increase the rates of viral transcription. Whereas the human cyclin T1 is required for the binding of Tat to TAR from HIV, it is unknown how Tat from EIAV interacts with its TAR. Furthermore, Tat from EIAV functions in equine and canine cells but not in human cells. In this study, we present sequences of cyclins T1 from horse and dog and demonstrate that their N-terminal 300 residues rescue the transactivation of Tat from EIAV in human cells. Although human and equine cyclins T1 bind to this Tat, only the equine cyclin T1 supports the binding of Tat to TAR from EIAV. Finally, a reciprocal exchange of the valine for the leucine at position 29 in human and equine cyclins T1, respectively, renders the human cyclin T1 active and the equine cyclin T1 inactive for Tat transactivation from EIAV. Thus, the collaboration between a specific cyclin T1 and Tat for their high-affinity interaction with TAR is a common theme of lentiviral transactivation. PMID:10623752

  4. T1R2 and T1R3 subunits are individually unnecessary for normal affective licking responses to Polycose: implications for saccharide taste receptors in mice.

    PubMed

    Treesukosol, Yada; Blonde, Ginger D; Spector, Alan C

    2009-04-01

    The T1R2 and T1R3 proteins are expressed in taste receptor cells and form a heterodimer binding with compounds described as sweet by humans. We examined whether Polycose taste might be mediated through this heterodimer by testing T1R2 knockout (KO) and T1R3 KO mice and their wild-type (WT) littermate controls in a series of brief-access taste tests (25-min sessions with 5-s trials). Sucrose, Na-saccharin, and Polycose were each tested for three consecutive sessions with order of presentation varied among subgroups in a Latin-Square manner. Both KO groups displayed blunted licking responses and initiated significantly fewer trials of sucrose and Na-saccharin across a range of concentrations. KO mice tested after Polycose exposure demonstrated some degree of concentration-dependent licking of sucrose, likely attributable to learning related to prior postingestive experience. These results are consistent with prior findings in the literature, implicating the T1R2+3 heterodimer as the principal taste receptor for sweet-tasting ligands, and also provide support for the potential of postingestive experience to influence responding in the KO mice. In contrast, T1R2 KO and T1R3 KO mice displayed concentration-dependent licking responses to Polycose that tracked those of their WT controls and in some cases licked midrange concentrations more; the number of Polycose trials initiated overall did not differ between KO and WT mice. Thus, the T1R2 and T1R3 proteins are individually unnecessary for normal concentration-dependent licking of Polycose to be expressed in a brief-access test. Whether at least one of these T1R protein subunits is necessary for normal Polycose responsiveness remains untested. Alternatively, there may be a novel taste receptor(s) that mediates polysaccharide taste. PMID:19158407

  5. Adjuvant chemotherapy of pT1a and pT1b breast carcinoma: results from the NEMESI study

    PubMed Central

    2012-01-01

    Background The prognosis of pT1a-pT1b breast cancer (BC) used to be considered very good, with a 10-y RFS of 90%. However, some retrospective studies reported a 10-y RFS of 81%–86% and suggested benefit from adjuvant systemic therapy. Methods To evaluate the variables that determined the choice of adjuvant chemotherapy and the type of chemotherapy delivered in pT1a-pT1b BC, we analysed the small tumours enrolled in the NEMESI study. Results Out of 1,894 patients with pathological stage I-II BC enrolled in NEMESI, 402 (21.2%) were pT1a-pT1b. Adjuvant chemotherapy was delivered in 127/402 (31.59%). Younger age, grading G3, high proliferative index, ER-negative and HER2-positive status were significantly associated with the decision to administer adjuvant chemotherapy. An anthracycline without taxane regimen was administered in 59.1% of patients, anthracycline with taxane in 24.4%, a CMF-like regimen in 14.2% and taxane in 2.4%. Adjuvant chemotherapy was administered in 88.4% triple-negative and 73.46% HER2-positive pT1a-pT1b BC. Adjuvant trastuzumab was delivered in 30/49 HER2-positive BC (61.2%). Conclusions Adjuvant chemotherapy was delivered in 31.59% T1a-pT1b BC treated at 63 Italian oncological centres from January 2008 to June 2008. The choice to deliver chemotherapy was based on biological prognostic factors. Anthracycline-based chemotherapy was administered in 83.5% patients. PMID:22545982

  6. Transgenic wheat expressing a barley class II chitinase gene has enhanced resistance against Fusarium graminearum

    PubMed Central

    Shin, Sanghyun; Mackintosh, Caroline A.; Lewis, Janet; Heinen, Shane J.; Radmer, Lorien; Dill-Macky, Ruth; Baldridge, Gerald D.; Zeyen, Richard J.; Muehlbauer, Gary J.

    2008-01-01

    Fusarium head blight (FHB; scab), primarily caused by Fusarium graminearum, is a devastating disease of wheat worldwide. FHB causes yield reductions and contamination of grains with trichothecene mycotoxins such as deoxynivalenol (DON). The genetic variation in existing wheat germplasm pools for FHB resistance is low and may not provide sufficient resistance to develop cultivars through traditional breeding approaches. Thus, genetic engineering provides an additional approach to enhance FHB resistance. The objectives of this study were to develop transgenic wheat expressing a barley class II chitinase and to test the transgenic lines against F. graminearum infection under greenhouse and field conditions. A barley class II chitinase gene was introduced into the spring wheat cultivar, Bobwhite, by biolistic bombardment. Seven transgenic lines were identified that expressed the chitinase transgene and exhibited enhanced Type II resistance in the greenhouse evaluations. These seven transgenic lines were tested under field conditions for percentage FHB severity, percentage visually scabby kernels (VSK), and DON accumulation. Two lines (C8 and C17) that exhibited high chitinase protein levels also showed reduced FHB severity and VSK compared to Bobwhite. One of the lines (C8) also exhibited reduced DON concentration compared with Bobwhite. These results showed that transgenic wheat expressing a barley class II chitinase exhibited enhanced resistance against F. graminearum in greenhouse and field conditions. PMID:18467324

  7. High-throughput assessment of transgene copy number in sugarcane using real-time quantitative PCR.

    PubMed

    Casu, Rosanne E; Selivanova, Alexandra; Perroux, Jai M

    2012-01-01

    Accurate and timely detection of transgene copy number in sugarcane is currently hampered by the requirement to use Southern blotting, needing relatively large amounts of genomic DNA and, therefore, the continued growth and maintenance of bulky plants in containment glasshouses. In addition, the sugarcane genome is both polyploid and aneuploid, complicating the identification of appropriate genes for use as references in the development of a high-throughput method. Using bioinformatic techniques followed by in vitro testing, two genes that appear to occur once per base genome of sugarcane were identified. Using these genes as reference genes, a high-throughput assay employing RT-qPCR was developed and tested using a group of sugarcane plants that contained unknown numbers of copies of the nptII gene encoding kanamycin resistance. Using this assay, transgene copy numbers from 3 to more than 50 were identified. In comparison, Southern blotting accurately identified the number of transgene copies for one line and by inference for another, but was not able to provide an accurate estimation for transgenic lines containing numerous copies of the nptII gene. Using the reference genes identified in this study, a high-throughput assay for the determination of transgene copy number was developed and tested for sugarcane. This method requires much less input DNA, can be performed much earlier in the production of transgenic sugarcane plants and allows much more efficient assessment of numerous potentially transgenic lines than Southern blotting.

  8. Muscle regulatory factors regulate T1R3 taste receptor expression.

    PubMed

    Kokabu, Shoichiro; Lowery, Jonathan W; Toyono, Takashi; Seta, Yuji; Hitomi, Suzuro; Sato, Tsuyoshi; Enoki, Yuichiro; Okubo, Masahiko; Fukushima, Yosuke; Yoda, Tetsuya

    2015-12-25

    T1R3 is a T1R class of G protein-coupled receptors, composing subunit of the umami taste receptor when complexed with T1R1. T1R3 was originally discovered in gustatory tissue but is now known to be expressed in a wide variety of tissues and cell types such the intestine, pancreatic β-cells, skeletal muscle, and heart. In addition to taste recognition, the T1R1/T1R3 complex functions as an amino acid sensor and has been proposed to be a control mechanism for the secretion of hormones, such as cholecystokinin, insulin, and duodenal HCO3(-) and activates the mammalian rapamycin complex 1 (MTORC1) to inhibit autophagy. T1R3 knockout mice have increased rate of autophagy in the heart, skeletal muscle and liver. Thus, T1R3 has multiple physiological functions and is widely expressed in vivo. However, the exact mechanisms regulating T1R3 expression are largely unknown. Here, we used comparative genomics and functional analyses to characterize the genomic region upstream of the annotated transcriptional start of human T1R3. This revealed that the T1R3 promoter in human and mouse resides in an evolutionary conserved region (ECR). We also identified a repressive element located upstream of the human T1R3 promoter that has relatively high degree of conservation with rhesus macaque. Additionally, the muscle regulatory factors MyoD and Myogenin regulate T1R3 expression and T1R3 expression increases with skeletal muscle differentiation of murine myoblast C2C12 cells. Taken together, our study raises the possibility that MyoD and Myogenin might control skeletal muscle metabolism and homeostasis through the regulation of T1R3 promoter activity. PMID:26545778

  9. Pharming and transgenic plants.

    PubMed

    Liénard, David; Sourrouille, Christophe; Gomord, Véronique; Faye, Loïc

    2007-01-01

    Plant represented the essence of pharmacopoeia until the beginning of the 19th century when plant-derived pharmaceuticals were partly supplanted by drugs produced by the industrial methods of chemical synthesis. In the last decades, genetic engineering has offered an alternative to chemical synthesis, using bacteria, yeasts and animal cells as factories for the production of therapeutic proteins. More recently, molecular farming has rapidly pushed towards plants among the major players in recombinant protein production systems. Indeed, therapeutic protein production is safe and extremely cost-effective in plants. Unlike microbial fermentation, plants are capable of carrying out post-translational modifications and, unlike production systems based on mammalian cell cultures, plants are devoid of human infective viruses and prions. Furthermore, a large panel of strategies and new plant expression systems are currently developed to improve the plant-made pharmaceutical's yields and quality. Recent advances in the control of post-translational maturations in transgenic plants will allow them, in the near future, to perform human-like maturations on recombinant proteins and, hence, make plant expression systems suitable alternatives to animal cell factories.

  10. Pharming and transgenic plants.

    PubMed

    Liénard, David; Sourrouille, Christophe; Gomord, Véronique; Faye, Loïc

    2007-01-01

    Plant represented the essence of pharmacopoeia until the beginning of the 19th century when plant-derived pharmaceuticals were partly supplanted by drugs produced by the industrial methods of chemical synthesis. In the last decades, genetic engineering has offered an alternative to chemical synthesis, using bacteria, yeasts and animal cells as factories for the production of therapeutic proteins. More recently, molecular farming has rapidly pushed towards plants among the major players in recombinant protein production systems. Indeed, therapeutic protein production is safe and extremely cost-effective in plants. Unlike microbial fermentation, plants are capable of carrying out post-translational modifications and, unlike production systems based on mammalian cell cultures, plants are devoid of human infective viruses and prions. Furthermore, a large panel of strategies and new plant expression systems are currently developed to improve the plant-made pharmaceutical's yields and quality. Recent advances in the control of post-translational maturations in transgenic plants will allow them, in the near future, to perform human-like maturations on recombinant proteins and, hence, make plant expression systems suitable alternatives to animal cell factories. PMID:17875476

  11. Expression pattern in retinal photoreceptors of POMGnT1, a protein involved in muscle-eye-brain disease

    PubMed Central

    Uribe, Mary Luz; Haro, Carmen; Campello, Laura; Cruces, Jesús; Martín-Nieto, José

    2016-01-01

    Purpose The POMGNT1 gene, encoding protein O-linked-mannose β-1,2-N-acetylglucosaminyltransferase 1, is associated with muscle-eye-brain disease (MEB) and other dystroglycanopathies. This gene’s lack of function or expression causes hypoglycosylation of α-dystroglycan (α-DG) in the muscle and the central nervous system, including the brain and the retina. The ocular symptoms of patients with MEB include retinal degeneration and detachment, glaucoma, and abnormal electroretinogram. Nevertheless, the POMGnT1 expression pattern in the healthy mammalian retina has not yet been investigated. In this work, we address the expression of the POMGNT1 gene in the healthy retina of a variety of mammals and characterize the distribution pattern of this gene in the adult mouse retina and the 661W photoreceptor cell line. Methods Using reverse transcription (RT)–PCR and immunoblotting, we studied POMGNT1 expression at the mRNA and protein levels in various mammalian species, from rodents to humans. Immunofluorescence confocal microscopy analyses were performed to characterize the distribution profile of its protein product in mouse retinal sections and in 661W cultured cells. The intranuclear distribution of POMT1 and POMT2, the two enzymes preceding POMGnT1 in the α-DG O-mannosyl glycosylation pathway, was also analyzed. Results POMGNT1 mRNA and its encoded protein were expressed in the neural retina of all mammals studied. POMGnT1 was located in the cytoplasmic fraction in the mouse retina and concentrated in the myoid portion of the photoreceptor inner segments, where the protein colocalized with GM130, a Golgi complex marker. The presence of POMGnT1 in the Golgi complex was also evident in 661W cells. However, and in contrast to retinal tissue, POMGnT1 additionally accumulated in the nucleus of the 661W photoreceptors. Colocalization was found within this organelle between POMGnT1 and POMT1/2, the latter associated with euchromatic regions of the nucleus. Conclusions

  12. T1ρ magnetic resonance: basic physics principles and applications in knee and intervertebral disc imaging.

    PubMed

    Wáng, Yì-Xiáng J; Zhang, Qinwei; Li, Xiaojuan; Chen, Weitian; Ahuja, Anil; Yuan, Jing

    2015-12-01

    T1ρ relaxation time provides a new contrast mechanism that differs from T1- and T2-weighted contrast, and is useful to study low-frequency motional processes and chemical exchange in biological tissues. T1ρ imaging can be performed in the forms of T1ρ-weighted image, T1ρ mapping and T1ρ dispersion. T1ρ imaging, particularly at low spin-lock frequency, is sensitive to B0 and B1 inhomogeneity. Various composite spin-lock pulses have been proposed to alleviate the influence of field inhomogeneity so as to reduce the banding-like spin-lock artifacts. T1ρ imaging could be specific absorption rate (SAR) intensive and time consuming. Efforts to address these issues and speed-up data acquisition are being explored to facilitate wider clinical applications. This paper reviews the T1ρ imaging's basic physic principles, as well as its application for cartilage imaging and intervertebral disc imaging. Compared to more established T2 relaxation time, it has been shown that T1ρ provides more sensitive detection of proteoglycan (PG) loss at early stages of cartilage degeneration. T1ρ has also been shown to provide more sensitive evaluation of annulus fibrosis (AF) degeneration of the discs.

  13. T1ρ magnetic resonance: basic physics principles and applications in knee and intervertebral disc imaging

    PubMed Central

    Zhang, Qinwei; Li, Xiaojuan; Chen, Weitian; Ahuja, Anil; Yuan, Jing

    2015-01-01

    T1ρ relaxation time provides a new contrast mechanism that differs from T1- and T2-weighted contrast, and is useful to study low-frequency motional processes and chemical exchange in biological tissues. T1ρ imaging can be performed in the forms of T1ρ-weighted image, T1ρ mapping and T1ρ dispersion. T1ρ imaging, particularly at low spin-lock frequency, is sensitive to B0 and B1 inhomogeneity. Various composite spin-lock pulses have been proposed to alleviate the influence of field inhomogeneity so as to reduce the banding-like spin-lock artifacts. T1ρ imaging could be specific absorption rate (SAR) intensive and time consuming. Efforts to address these issues and speed-up data acquisition are being explored to facilitate wider clinical applications. This paper reviews the T1ρ imaging’s basic physic principles, as well as its application for cartilage imaging and intervertebral disc imaging. Compared to more established T2 relaxation time, it has been shown that T1ρ provides more sensitive detection of proteoglycan (PG) loss at early stages of cartilage degeneration. T1ρ has also been shown to provide more sensitive evaluation of annulus fibrosis (AF) degeneration of the discs. PMID:26807369

  14. Comparisons of EPR imaging and T1-weighted MRI for efficient imaging of nitroxyl contrast agents.

    PubMed

    Matsumoto, Ken-ichiro; Narazaki, Michiko; Ikehira, Hiroo; Anzai, Kazunori; Ikota, Nobuo

    2007-07-01

    The resolution and signal to noise ratio of EPR imaging and T(1)-weighted MRI were compared using an identical phantom. Several solutions of nitroxyl contrast agents with different EPR spectral shapes were tested. The feasibility of T(1)-weighted MRI to detect nitroxyl contrast agents was described. T(1)-weighted MRI can detect nitroxyl contrast agents with a complicated EPR spectrum easier and quicker; however, T(1)-weighted MRI has less quantitative ability especially for lipophilic nitroxyl contrast agents, because T(1)-relaxivity, i.e. accessibility to water, is affected by the hydrophilic/hydrophobic micro-environment of a nitroxyl contrast agent. The less quantitative ability of T(1)-weighted MRI may not be a disadvantage of redox imaging, which obtains reduction rate of a nitroxyl contrast. Therefore, T(1)-weighted MRI has a great advantage to check the pharmacokinetics of newly modified and/or designed nitroxyl contrast agents. PMID:17433743

  15. Obtaining T1-T2 distribution functions from 1-dimensional T1 and T2 measurements: The pseudo 2-D relaxation model

    NASA Astrophysics Data System (ADS)

    Williamson, Nathan H.; Röding, Magnus; Galvosas, Petrik; Miklavcic, Stanley J.; Nydén, Magnus

    2016-08-01

    We present the pseudo 2-D relaxation model (P2DRM), a method to estimate multidimensional probability distributions of material parameters from independent 1-D measurements. We illustrate its use on 1-D T1 and T2 relaxation measurements of saturated rock and evaluate it on both simulated and experimental T1-T2 correlation measurement data sets. Results were in excellent agreement with the actual, known 2-D distribution in the case of the simulated data set. In both the simulated and experimental case, the functional relationships between T1 and T2 were in good agreement with the T1-T2 correlation maps from the 2-D inverse Laplace transform of the full 2-D data sets. When a 1-D CPMG experiment is combined with a rapid T1 measurement, the P2DRM provides a double-shot method for obtaining a T1-T2 relationship, with significantly decreased experimental time in comparison to the full T1-T2 correlation measurement.

  16. Ultra-low field T1 vs. T1rho at 3T and 7T: study of rotationally immobilized protein gels and animal brain tissues

    NASA Astrophysics Data System (ADS)

    Dong, Hui; Inglis, Ben; Barr, Ian; Clarke, John

    2015-03-01

    Clinical magnetic resonance imaging (MRI) machines operating in static fields of typically 1.5 T or 3 T can capture information on slow molecular dynamics utilizing the so-called T1rho technique. This technique, in which a radiofrequency (RF) spin-lock field is applied with microtesla amplitude, has been used, for example, to determine the onset time of stroke in studies on rats. The long RF pulse, however, may exceed the specific absorption rate (SAR) limit, putting subjects at risk. Ultra-low-field (ULF) MRI, based on Superconducting Quantum Interference Devices (SQUIDs), directly detects proton signals at a static magnetic field of typically 50-250 μT. Using our ULF MRI system with adjustable static field of typically 55 to 240 μT, we systematically measured the T1 and T2 dispersion profiles of rotationally immobilized protein gels (bovine serum albumin), ex vivo pig brains, and ex vivo rat brains with induced stroke. Comparing the ULF results with T1rho dispersion obtained at 3 T and 7 T, we find that the degree of protein immobilization determines the frequency-dependence of both T1 and T1rho. Furthermore, T1rho and ULF T1 show similar results for stroke, suggesting that ULF MRI may be used to image traumatic brain injury with negligible SAR. This research was supported by the Henry H. Wheeler, Jr. Brain Imaging Center and the Donaldson Trust.

  17. Orosensory detection of sucrose, maltose, and glucose is severely impaired in mice lacking T1R2 or T1R3, but Polycose sensitivity remains relatively normal

    PubMed Central

    Treesukosol, Yada

    2012-01-01

    Evidence in the literature supports the hypothesis that the T1R2+3 heterodimer binds to compounds that humans describe as sweet. Here, we assessed the necessity of the T1R2 and T1R3 subunits in the maintenance of normal taste sensitivity to carbohydrate stimuli. We trained and tested water-restricted T1R2 knockout (KO), T1R3 KO and their wild-type (WT) same-sex littermate controls in a two-response operant procedure to sample a fluid and differentially respond on the basis of whether the stimulus was water or a tastant. Correct responses were reinforced with water and incorrect responses were punished with a time-out. Testing was conducted with a modified descending method of limits procedure across daily 25-min sessions. Both KO groups displayed severely impaired performance and markedly decreased sensitivity when required to discriminate water from sucrose, glucose, or maltose. In contrast, when Polycose was tested, KO mice had normal EC50 values for their psychometric functions, with some slight, but significant, impairment in performance. Sensitivity to NaCl did not differ between these mice and their WT controls. Our findings support the view that the T1R2+3 heterodimer is the principal receptor that mediates taste detection of natural sweeteners, but not of all carbohydrate stimuli. The combined presence of T1R2 and T1R3 appears unnecessary for the maintenance of relatively normal sensitivity to Polycose, at least in this task. Some detectability of sugars at high concentrations might be mediated by the putative polysaccharide taste receptor, the remaining T1R subunit forming either a homodimer or heteromer with another protein(s), or nontaste orosensory cues. PMID:22621968

  18. The Functional Role of the T1R Family of Receptors in Sweet Taste and Feeding

    PubMed Central

    Treesukosol, Yada; Smith, Kimberly R.; Spector, Alan C.

    2011-01-01

    The discovery of the T1R family of Class C G protein-coupled receptors in the peripheral gustatory system a decade ago has been a tremendous advance for taste research, and its conceptual reach has extended to other organ systems. There are three proteins in the family, T1R1, T1R2, and T1R3, encoded by their respective genes, Tas1r1, Tas1r2, and Tas1r3. T1R2 combines with T1R3 to form a heterodimer that binds with sugars and other sweeteners. T1R3 also combines with T1R1 to form a heterodimer that binds with L-amino acids. These proteins are expressed not only in taste bud cells, but one or more of these T1Rs have also been identified in the nasal epithelium, gut, pancreas, liver, kidney, testes and brain in various mammalian species. Here we review current perspectives regarding the functional role of these receptors, concentrating on sweet taste and feeding. We also discuss behavioral findings suggesting that a glucose polymer mixture, Polycose, which rodents avidly prefer, appears to activate a receptor that does not depend on the combined expression of T1R2 and T1R3. In addition, although the T1Rs have been implicated as playing a role in glucose sensing, T1R2 knock-out (KO) and T1R3 KO mice display normal chow and fluid intake as well as normal body weight compared with same-sex littermate wild type (WT) controls. Moreover, regardless of whether they are fasted or not, these KO mice do not differ from their WT counterparts in their Polycose intake across a broad range of concentrations in 30-min intake tests. The functional implications of these results and those in the literature are considered. PMID:21376068

  19. Characterization of oligopeptide transporter (PepT1) in grass carp (Ctenopharyngodon idella).

    PubMed

    Liu, Zhen; Zhou, Yi; Feng, Junchang; Lu, Shuangqing; Zhao, Qiong; Zhang, Jianshe

    2013-03-01

    The oligopeptide transporter (PepT1) is located on the brush-border membrane of the intestinal epithelium, and plays an important role in dipeptide and tripeptide absorptions from protein digestion. In this study, we cloned the PepT1 cDNA from grass carp and characterized its expression profile in response to dietary protein and feed additives (sodium butyrate) treatments. The PepT1 gene encodes a protein of 714 amino acids with high sequence similarity with other vertebrate homologues. Expression analysis revealed highest levels of PepT1 mRNA expression in the foregut of grass carp. In addition, PepT1 mRNA expression exhibited diurnal variation in all three bowel segments of intestine with lower levels of expression in daytime than nighttime. During embryonic development, PepT1 showed a dynamic pattern of expression reaching maximal levels of expression in the gastrula stage and minimal levels in the organ stage. The PepT1 expression showed constant levels from 14 to 34 day post-hatch. To determine whether fish diet of different protein contents may have any effect on PepT1 expression, we extended our research to dietary regulation of PepT1 expression. We found that dietary protein levels had a significant effect on PepT1 gene expression. In addition, PepT1 mRNA levels were higher after feeding with fish meal than with soybean meal. Moreover, in vitro and in vivo sodium butyrate treatments increased PepT1 expression in the intestine of grass carp. The results demonstrate for the first time that PepT1 mRNA expression is regulated in a temporal and spatial pattern during development, and dietary protein and feed additives had a significant effects on PepT1 gene expression in grass carp.

  20. Suppression of intestinal immunity through silencing of TCTP by RNAi in transgenic silkworm, Bombyx mori.

    PubMed

    Hu, Cuimei; Wang, Fei; Ma, Sanyuan; Li, Xianyang; Song, Liang; Hua, Xiaoting; Xia, Qingyou

    2015-12-10

    Intestinal immune response is a front line of host defense. The host factors that participate in intestinal immunity response remain largely unknown. We recently reported that Translationally Controlled Tumor Protein (BmTCTP) was obtained by constructing a phage display cDNA library of the silkworm midgut and carrying out high throughput screening of pathogen binding molecules. To further address the function of BmTCTP in silkworm intestinal immunity, transgenic RNAi silkworms were constructed by microinjection piggBac plasmid to Dazao embryos. The antimicrobial capacity of transgenic silkworm decreased since the expression of gut antimicrobial peptide from transgenic silkworm was not sufficiently induced during oral microbial challenge. Moreover, dynamic ERK phosphorylation from transgenic silkworm midgut was disrupted. Taken together, the innate immunity of intestinal was suppressed through disruption of dynamic ERK phosphorylation after oral microbial infection as a result of RNAi-mediated knockdown of midgut TCTP in transgenic silkworm.

  1. Generation and characterization of a transgenic mouse with a functional human TSPY.

    PubMed

    Schubert, S; Skawran, B; Dechend, F; Nayernia, K; Meinhardt, A; Nanda, I; Schmid, M; Engel, W; Schmidtke, J

    2003-09-01

    To generate an animal model that is suitable for the analysis of regulation and expression of human testis-specific protein, Y-encoded TSPY, a transgenic mouse line, TgTSPY9, harboring a complete structural human TSPY gene was generated. Fluorescence in situ hybridization and Southern analyses show that approximately 50 copies of the human TSPY transgene are integrated at a single chromosomal site that maps to the distal long arm of the Y chromosome. The transgene is correctly transcribed and spliced according to the human pattern and is mainly expressed in testicular tissue, with spermatogonia and early primary spermatocytes (leptotene and zygotene) as expressing germ cells. TSPY transgenic mice are phenotypically normal, and spermatogenesis is neither impaired nor enhanced by the human transgene. The present study shows that a human TSPY gene integrated into the mouse genome follows the human expression pattern although murine tspy had lost its function in rodent evolution millions of years ago. PMID:12773407

  2. Transgenic mouse model of malignant skin melanoma.

    PubMed Central

    Mintz, B; Silvers, W K

    1993-01-01

    Tyr-SV40E transgenic mice are specifically susceptible to melanoma due to expression of the oncogene in pigment cells. Mice of the more susceptible lines die young of early-onset eye melanomas, when skin melanomas are still infrequent and benign. To surmount this obstacle, skin from donors of two high-susceptibility lines was grafted to Tyr-SV40E hosts of a low-susceptibility line of the same inbred strain, thereby enabling the skin to outlive the donors and continue to grow in immunocompetent but tolerant hosts. Unexpectedly, donor pigment cells in all the grafts soon selectively proliferated close to areas of greatest wound healing, forming a dense black tracery, especially at the outer rim of the grafts. These lesions slowly grew radially within the grafts, producing irregular greyish patches. Local vertical thickenings then appeared and developed into small melanomas, which soon ulcerated through the epidermis. The tumors rapidly enlarged and became deeply invasive. Discrete black nevi also arose, with many becoming larger and distinctly blue, but those not near areas of pronounced wound healing did not progress to malignancy. In this first series, malignant melanoma resulted in all the grafts from the more susceptible of two donor lines and in some grafts from the other line. Distant metastases occurred in some cases from each line. Most tumors were hypomelanotic and heterogeneous, with lobes or areas differing in melanization. The results strongly suggest that growth factors and cytokines--known to be produced in wound repair--are triggering the growth and malignant conversion of these genetically susceptible melanocytes and that in the graft situation we are merely witnessing a caricature--a usefully exaggerated manifestation of the true events underlying the genesis of melanomas. The striking resemblance to the human malignancy, the genetic uniformity and different susceptibilities of the transgenic lines, and the experimental possibilities in the grafted

  3. Detection of Leptomeningeal Metastasis by Contrast-Enhanced 3D T1-SPACE: Comparison with 2D FLAIR and Contrast-Enhanced 2D T1-Weighted Images

    PubMed Central

    Gil, Bomi; Hwang, Eo-Jin; Lee, Song; Jang, Jinhee; Jung, So-Lyung; Ahn, Kook-Jin; Kim, Bum-soo

    2016-01-01

    Introduction To compare the diagnostic accuracy of contrast-enhanced 3D(dimensional) T1-weighted sampling perfection with application-optimized contrasts by using different flip angle evolutions (T1-SPACE), 2D fluid attenuated inversion recovery (FLAIR) images and 2D contrast-enhanced T1-weighted image in detection of leptomeningeal metastasis except for invasive procedures such as a CSF tapping. Materials and Methods Three groups of patients were included retrospectively for 9 months (from 2013-04-01 to 2013-12-31). Group 1 patients with positive malignant cells in CSF cytology (n = 22); group 2, stroke patients with steno-occlusion in ICA or MCA (n = 16); and group 3, patients with negative results on MRI, whose symptom were dizziness or headache (n = 25). A total of 63 sets of MR images are separately collected and randomly arranged: (1) CE 3D T1-SPACE; (2) 2D FLAIR; and (3) CE T1-GRE using a 3-Tesla MR system. A faculty neuroradiologist with 8-year-experience and another 2nd grade trainee in radiology reviewed each MR image- blinded by the results of CSF cytology and coded their observations as positives or negatives of leptomeningeal metastasis. The CSF cytology result was considered as a gold standard. Sensitivity and specificity of each MR images were calculated. Diagnostic accuracy was compared using a McNemar’s test. A Cohen's kappa analysis was performed to assess inter-observer agreements. Results Diagnostic accuracy was not different between 3D T1-SPACE and CSF cytology by both raters. However, the accuracy test of 2D FLAIR and 2D contrast-enhanced T1-weighted GRE was inconsistent by the two raters. The Kappa statistic results were 0.657 (3D T1-SPACE), 0.420 (2D FLAIR), and 0.160 (2D contrast-enhanced T1-weighted GRE). The 3D T1-SPACE images showed the highest inter-observer agreements between the raters. Conclusions Compared to 2D FLAIR and 2D contrast-enhanced T1-weighted GRE, contrast-enhanced 3D T1 SPACE showed a better detection rate of

  4. Generation of transgenic energy cane plants with integration of minimal transgene expression cassette.

    PubMed

    Fouad, Walid M; Hao, Wu; Xiong, Yuan; Steeves, Cody; Sandhu, Surinder K; Altpeter, Fredy

    2015-01-01

    Lignocellulosic biomass has the potential to serve as feedstock and direct replacement for petrochemicals in the fuel, chemical, pharmaceutical and material industries. Energy cane has been identified by the U.S. Department of Energy (DOE) as prime lignocellulosic feedstock as it produces record biomass yields and is able to grow on low-value land with reduced inputs. Molecular improvement of energy cane is an essential step toward the development of a high-value crop and may contribute to improved biomass conversion to value added products. Such improvements require a development of an efficient regeneration and transformation system for the vegetatively propagated energy cane varieties. In this report, an efficient biolistic gene delivery protocol for energy canes (genotype L 79-1002 and Ho 00-961) has been established with immature leaf rolls as explants. Embryonic calli, developed approximately 6 weeks after culture initiation and was used as target for biolistic transfer of a minimum expression cassette of P-ubi::nptII::35S polyA derived from plasmid pJFNPTII. Putative transgenic clones of callus were obtained after selection on callus induction medium supplemented with 30 mg l(-1) geneticin. Regeneration was carried out on NB medium, which is modified from MS supplemented with 1.86 mg l(-1) naphthaleneacetic acid (NAA) and 0.1mg l(-1), 6- benzylaminopurine (BAP) and 20mg l(-1) paromomycin. Shoots growing on selection media were transferred to hormone free medium with 20 mg l(-1) paromomycin. Putative transgenic lines were first analyzed by PCR. Transgene integration was confirmed by Southern blot analysis. ELISA (Enzyme-Linked Immunosorbent Assay) and Immunochromathography assays confirmed transgene expression.

  5. High-efficiency Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) and regeneration of insect-resistant transgenic plants.

    PubMed

    Mehrotra, Meenakshi; Sanyal, Indraneel; Amla, D V

    2011-09-01

    To develop an efficient genetic transformation system of chickpea (Cicer arietinum L.), callus derived from mature embryonic axes of variety P-362 was transformed with Agrobacterium tumefaciens strain LBA4404 harboring p35SGUS-INT plasmid containing the uidA gene encoding β-glucuronidase (GUS) and the nptII gene for kanamycin selection. Various factors affecting transformation efficiency were optimized; as Agrobacterium suspension at OD(600) 0.3 with 48 h of co-cultivation period at 20°C was found optimal for transforming 10-day-old MEA-derived callus. Inclusion of 200 μM acetosyringone, sonication for 4 s with vacuum infiltration for 6 min improved the number of GUS foci per responding explant from 1.0 to 38.6, as determined by histochemical GUS assay. For introducing the insect-resistant trait into chickpea, binary vector pRD400-cry1Ac was also transformed under optimized conditions and 18 T(0) transgenic plants were generated, representing 3.6% transformation frequency. T(0) transgenic plants reflected Mendelian inheritance pattern of transgene segregation in T(1) progeny. PCR, RT-PCR, and Southern hybridization analysis of T(0) and T(1) transgenic plants confirmed stable integration of transgenes into the chickpea genome. The expression level of Bt-Cry protein in T(0) and T(1) transgenic chickpea plants was achieved maximum up to 116 ng mg(-1) of soluble protein, which efficiently causes 100% mortality to second instar larvae of Helicoverpa armigera as analyzed by an insect mortality bioassay. Our results demonstrate an efficient and rapid transformation system of chickpea for producing non-chimeric transgenic plants with high frequency. These findings will certainly accelerate the development of chickpea plants with novel traits.

  6. Inducible Gene Manipulations in Brain Serotonergic Neurons of Transgenic Rats

    PubMed Central

    Tews, Björn; Bartsch, Dusan

    2011-01-01

    The serotonergic (5-HT) system has been implicated in various physiological processes and neuropsychiatric disorders, but in many aspects its role in normal and pathologic brain function is still unclear. One reason for this might be the lack of appropriate animal models which can address the complexity of physiological and pathophysiological 5-HT functioning. In this respect, rats offer many advantages over mice as they have been the animal of choice for sophisticated neurophysiological and behavioral studies. However, only recently technologies for the targeted and tissue specific modification of rat genes - a prerequisite for a detailed study of the 5-HT system - have been successfully developed. Here, we describe a rat transgenic system for inducible gene manipulations in 5-HT neurons. We generated a Cre driver line consisting of a tamoxifen-inducible CreERT2 recombinase under the control of mouse Tph2 regulatory sequences. Tissue-specific serotonergic Cre recombinase expression was detected in four transgenic TPH2-CreERT2 rat founder lines. For functional analysis of Cre-mediated recombination, we used a rat Cre reporter line (CAG-loxP.EGFP), in which EGFP is expressed after Cre-mediated removal of a loxP-flanked lacZ STOP cassette. We show an in-depth characterisation of this rat Cre reporter line and demonstrate its applicability for monitoring Cre-mediated recombination in all major neuronal subpopulations of the rat brain. Upon tamoxifen induction, double transgenic TPH2-CreERT2/CAG-loxP.EGFP rats show selective and efficient EGFP expression in 5-HT neurons. Without tamoxifen administration, EGFP is only expressed in few 5-HT neurons which confirms minimal background recombination. This 5-HT neuron specific CreERT2 line allows Cre-mediated, inducible gene deletion or gene overexpression in transgenic rats which provides new opportunities to decipher the complex functions of the mammalian serotonergic system. PMID:22140568

  7. Multiplicative or t1 Noise in NMR Spectroscopy

    SciTech Connect

    Granwehr, Josef

    2005-01-25

    The signal in an NMR experiment is highly sensitive to fluctuations of the environment of the sample. If, for example, the static magnetic field B{sub 0}, the amplitude and phase of radio frequency (rf) pulses, or the resonant frequency of the detection circuit are not perfectly stable and reproducible, the magnetic moment of the spins is altered and becomes a noisy quantity itself. This kind of noise not only depends on the presence of a signal, it is in fact proportional to it. Since all the spins at a particular location in a sample experience the same environment at any given time, this noise primarily affects the reproducibility of an experiment, which is mainly of importance in the indirect dimensions of a multidimensional experiment, when intense lines are suppressed with a phase cycle, or for difference spectroscopy techniques. Equivalently, experiments which are known to be problematic with regard to their reproducibility, like flow experiments or experiments with a mobile target, tend to be affected stronger by multiplicative noise. In this article it is demonstrated how multiplicative noise can be identified and characterized using very simple, repetitive experiments. An error estimation approach is developed to give an intuitive, yet quantitative understanding of its properties. The consequences for multidimensional NMR experiments are outlined, implications for data analysis are shown, and strategies for the optimization of experiments are summarized.

  8. Fully automatic detection of deep white matter T1 hypointense lesions in multiple sclerosis

    NASA Astrophysics Data System (ADS)

    Spies, Lothar; Tewes, Anja; Suppa, Per; Opfer, Roland; Buchert, Ralph; Winkler, Gerhard; Raji, Alaleh

    2013-12-01

    A novel method is presented for fully automatic detection of candidate white matter (WM) T1 hypointense lesions in three-dimensional high-resolution T1-weighted magnetic resonance (MR) images. By definition, T1 hypointense lesions have similar intensity as gray matter (GM) and thus appear darker than surrounding normal WM in T1-weighted images. The novel method uses a standard classification algorithm to partition T1-weighted images into GM, WM and cerebrospinal fluid (CSF). As a consequence, T1 hypointense lesions are assigned an increased GM probability by the standard classification algorithm. The GM component image of a patient is then tested voxel-by-voxel against GM component images of a normative database of healthy individuals. Clusters (≥0.1 ml) of significantly increased GM density within a predefined mask of deep WM are defined as lesions. The performance of the algorithm was assessed on voxel level by a simulation study. A maximum dice similarity coefficient of 60% was found for a typical T1 lesion pattern with contrasts ranging from WM to cortical GM, indicating substantial agreement between ground truth and automatic detection. Retrospective application to 10 patients with multiple sclerosis demonstrated that 93 out of 96 T1 hypointense lesions were detected. On average 3.6 false positive T1 hypointense lesions per patient were found. The novel method is promising to support the detection of hypointense lesions in T1-weighted images which warrants further evaluation in larger patient samples.

  9. Multi-voxel algorithm for quantitative bi-exponential MRI T1 estimation

    NASA Astrophysics Data System (ADS)

    Bladt, P.; Van Steenkiste, G.; Ramos-Llordén, G.; den Dekker, A. J.; Sijbers, J.

    2016-03-01

    Quantification of the spin-lattice relaxation time, T1, of tissues is important for characterization of tissues in clinical magnetic resonance imaging (MRI). In T1 mapping, T1 values are estimated from a set of T1-weighted MRI images. Due to the limited spatial resolution of the T1-weighted images, one voxel might consist of two tissues, causing partial volume effects (PVE). In conventional mono-exponential T1 estimation, these PVE result in systematic errors in the T1 map. To account for PVE, single-voxel bi-exponential estimators have been suggested. Unfortunately, in general, they suffer from low accuracy and precision. In this work, we propose a joint multi-voxel bi-exponential T1 estimator (JMBE) and compare its performance to a single-voxel bi-exponential T1 estimator (SBE). Results show that, in contrast to the SBE, and for clinically achievable single-voxel SNRs, the JMBE is accurate and efficient if four or more neighboring voxels are used in the joint estimation framework. This illustrates that, for clinically realistic SNRs, accurate results for quantitative biexponential T1 estimation are only achievable if information of neighboring voxels is incorporated.

  10. Distinct Contributions of T1R2 and T1R3 Taste Receptor Subunits to the Detection of Sweet Stimuli

    SciTech Connect

    Nie,Y.; Vigues, S.; Hobbs, J.; Conn, G.; Munger, S.

    2005-01-01

    The molecular mechanisms by which G protein-coupled receptor (GPCR)-type chemosensory receptors of animals selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. This study showed that each of the two subunits in the mammalian heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli, though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in mice. Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.

  11. Can transgenic mosquitoes afford the fitness cost?

    PubMed

    Lambrechts, Louis; Koella, Jacob C; Boëte, Christophe

    2008-01-01

    In a recent study, SM1-transgenic Anopheles stephensi, which are resistant partially to Plasmodium berghei, had higher fitness than non-transgenic mosquitoes when they were maintained on Plasmodium-infected blood. This result should be interpreted cautiously with respect to malaria control using transgenic mosquitoes because, despite the evolutionary advantage conferred by the transgene, a concomitant cost prevents it from invading the entire population. Indeed, for the spread of a resistance transgene in a natural situation, the transgene's fitness cost and the efficacy of the gene drive will be more crucial than any evolutionary advantage.

  12. [Biofuels, food security and transgenic crops].

    PubMed

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  13. [Biofuels, food security and transgenic crops].

    PubMed

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology. PMID:19722000

  14. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

    2015-01-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  15. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

    PubMed

    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

    2015-09-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar.

  16. Hypoxia-induced in vivo sickling of transgenic mouse red cells.

    PubMed Central

    Rubin, E M; Witkowska, H E; Spangler, E; Curtin, P; Lubin, B H; Mohandas, N; Clift, S M

    1991-01-01

    To develop an animal model for sickle cell anemia, we have created transgenic mice that express a severe naturally occurring human sickling hemoglobin, Hb S Antilles. Due to its low solubility and oxygen affinity, Hb S Antilles has a greater propensity to cause red cell sickling than Hb S. To make transgenic animals that express a high level of Hb S Antilles, the erythroid-specific DNAse I hypersensitive site II from the human beta-globin cluster was linked independently to the human alpha 2-globin gene and to the beta S Antilles gene. Embryos were injected with both constructs simultaneously and seven transgenic mice were obtained, three of which contained both the human alpha and the human beta S Antilles transgene. After crossing the human transgenes into the mouse beta-thalassemic background a transgenic mouse line was derived in which approximately half the beta-globin chains in the murine red cells were human beta S Antilles. Deoxygenation of the transgenic red cells in vitro resulted in extensive sickling. An increase of in vivo sickling was achieved by placing these transgenic mice in a low oxygen environment. This murine model for red cell sickling should help to advance our understanding of sickle cell disease and may provide a model to test therapeutic interventions. Images PMID:1991848

  17. The Construction and Expression of Lysine-Rich Gene in the Mammary Gland of Transgenic Mice

    PubMed Central

    Ma, Xin; Zhang, Peng; Song, Guangqi; Chen, Yue; Wang, Zhongwei; Yin, Yupeng; Kong, Delong; Zhang, Sheng; Zhao, Zhihui; Ouyang, Hongsheng

    2012-01-01

    Lysine is the limiting amino acid in cereal grains, which represent a major source of human food and animal feed worldwide, and is considered the most important of the essential amino acids. In this study, β-casein, αS2-casein, and lactotransferrin cDNA clone fragments encoding lysine-rich peptides were fused together to generate a lysine-rich (LR) gene and the mammary gland-specific expression vector pBC1-LR-NEOr was constructed. Transgenic mice were generated by pronuclear microinjection of the linearized expression vectors harboring the LR transgene. The transgenic mice and their offspring were examined using multiplex polymerase chain reaction (PCR), Southern blotting, reverse transcriptase–PCR, in situ hybridization, and Western blotting techniques. Our results showed that the LR gene was successfully integrated into the mouse genome and was transmitted stably. The specific LR gene expression was restricted to the mammary gland, active alveoli of the transgenic female mice during lactation. The lysine level of the two transgenic lines was significantly higher than that of nontransgenic controls (p<0.05). In addition, the growth performance of transgenic pups was enhanced by directly feeding them the LR protein-enriched transgenic milk. Our results demonstrated that lysine-rich gene was successfully constructed and expressed in mammary gland of transgenic mice. This study will provide a better understanding of how mammary gland expression systems that increase the lysine content of milk can be applied to other mammals, such as cows. PMID:22577831

  18. Taste responses in mice lacking taste receptor subunit T1R1

    PubMed Central

    Kusuhara, Yoko; Yoshida, Ryusuke; Ohkuri, Tadahiro; Yasumatsu, Keiko; Voigt, Anja; Hübner, Sandra; Maeda, Katsumasa; Boehm, Ulrich; Meyerhof, Wolfgang; Ninomiya, Yuzo

    2013-01-01

    The T1R1 receptor subunit acts as an umami taste receptor in combination with its partner, T1R3. In addition, metabotropic glutamate receptors (brain and taste variants of mGluR1 and mGluR4) are thought to function as umami taste receptors. To elucidate the function of T1R1 and the contribution of mGluRs to umami taste detection in vivo, we used newly developed knock-out (T1R1−/−) mice, which lack the entire coding region of the Tas1r1 gene and express mCherry in T1R1-expressing cells. Gustatory nerve recordings demonstrated that T1R1−/− mice exhibited a serious deficit in inosine monophosphate-elicited synergy but substantial residual responses to glutamate alone in both chorda tympani and glossopharyngeal nerves. Interestingly, chorda tympani nerve responses to sweeteners were smaller in T1R1−/− mice. Taste cell recordings demonstrated that many mCherry-expressing taste cells in T1R1+/− mice responded to sweet and umami compounds, whereas those in T1R1−/− mice responded to sweet stimuli. The proportion of sweet-responsive cells was smaller in T1R1−/− than in T1R1+/− mice. Single-cell RT-PCR demonstrated that some single mCherry-expressing cells expressed all three T1R subunits. Chorda tympani and glossopharyngeal nerve responses to glutamate were significantly inhibited by addition of mGluR antagonists in both T1R1−/− and T1R1+/− mice. Conditioned taste aversion tests demonstrated that both T1R1−/− and T1R1+/− mice were equally capable of discriminating glutamate from other basic taste stimuli. Avoidance conditioned to glutamate was significantly reduced by addition of mGluR antagonists. These results suggest that T1R1-expressing cells mainly contribute to umami taste synergism and partly to sweet sensitivity and that mGluRs are involved in the detection of umami compounds. PMID:23339178

  19. Transgenic American elm shows reduced Dutch elm disease symptoms and normal mycorrhizal colonization.

    PubMed

    Newhouse, Andrew E; Schrodt, Franziska; Liang, Haiying; Maynard, Charles A; Powell, William A

    2007-07-01

    The American elm (Ulmus americana L.) was once one of the most common urban trees in eastern North America until Dutch-elm disease (DED), caused by the fungus Ophiostoma novo-ulmi, eliminated most of the mature trees. To enhance DED resistance, Agrobacterium was used to transform American elm with a transgene encoding the synthetic antimicrobial peptide ESF39A, driven by a vascular promoter from American chestnut. Four unique, single-copy transgenic lines were produced and regenerated into whole plants. These lines showed less wilting and significantly less sapwood staining than non-transformed controls after O. novo-ulmi inoculation. Preliminary observations indicated that mycorrhizal colonization was not significantly different between transgenic and wild-type trees. Although the trees tested were too young to ensure stable resistance was achieved, these results indicate that transgenes encoding antimicrobial peptides reduce DED symptoms and therefore hold promise for enhancing pathogen resistance in American elm.

  20. Transgene expression and fitness of hybrids between GM oilseed rape and Brassica rapa.

    PubMed

    Ammitzbøll, Henriette; Mikkelsen, Teis Nørgaard; Jørgensen, Rikke Bagger

    2005-01-01

    Oilseed rape (Brassica napus) is sexually compatible with its wild and weedy relative B. rapa, and introgression of genes from B. napus has been found to occur over a few generations. We simulated the early stages of transgene escape by producing F1 hybrids and the first backcross generation between two lines of transgenic B. napus and two populations of weedy B. rapa. Transgene expression and the fitness of the hybrids were examined under different environmental conditions. Expression of the transgenes was analyzed at the mRNA level by quantitative PCR and found to be stable in the hybrids, regardless of the genetic background and the environment, and equal to the level of transcription in the parental B. napus lines. Vigor of the hybrids was measured as the photosynthetic capability; pollen viability and seed set per silique. Photosynthetic capability of first generation hybrids was found to be at the same level, or higher, than that of the parental species, whereas the reproductive fitness was significantly lower. The first backcross generation had a significantly lower photosynthetic capability and reproductive fitness compared to the parental species. This is the first study that examines transgene expression at the mRNA level in transgenic hybrids of B. napus of different genetic background exposed to different environmental conditions. The data presented clarify important details of the overall risk assessment of growing transgenic oilseed rape.

  1. Transgenic resistance to Bamboo mosaic virus by expression of interfering satellite RNA.

    PubMed

    Lin, Kuan-Yu; Hsu, Yau-Heiu; Chen, Hsin-Chuan; Lin, Na-Sheng

    2013-09-01

    Plant genetic engineering has broadened the options for plant virus resistance and is mostly based on pathogen-derived resistance. Previously, we have shown that interfering satellite RNA (satRNA) of Bamboo mosaic virus (satBaMV) greatly reduces Bamboo mosaic virus (BaMV) accumulation and BaMV-induced symptoms in co-inoculated plants. Here, we generated a nonviral source of virus-resistant transgenic Nicotiana benthamiana and Arabidopsis thaliana by introducing interfering satBaMV. Asymptomatic transgenic N. benthamiana lines were highly resistant to BaMV virion and viral RNA infection, and the expression of the transgene BSL6 was higher in asymptomatic than mildly symptomatic lines. In addition, BaMV- and satBaMV-specific small RNAs were detectable only after BaMV challenge, and their levels were associated with genomic viral RNA or satRNA levels. By transcriptomic analysis, the salicylic acid (SA) signalling pathway was not induced in satBaMV transgenic A. thaliana in mock conditions, suggesting that two major antiviral mechanisms, RNA silencing and SA-mediated resistance, are not involved directly in transgenic satBaMV-mediated BaMV interference. In contrast, resistance is associated with the level of the interfering satBaMV transgene. We propose satBaMV-mediated BaMV interference in transgenic plants by competition for replicase with BaMV. PMID:23675895

  2. Diabetes-Associated Dry Eye Syndrome in a New Humanized Transgenic Model of Type 1 Diabetes

    PubMed Central

    Imam, Shahnawaz; Elagin, Raya B.

    2013-01-01

    Purpose Patients with Type 1 Diabetes (T1D) are at high risk of developing lacrimal gland dysfunction. We have developed a new model of human T1D using double-transgenic mice carrying HLA-DQ8 diabetes-susceptibility haplotype instead of mouse MHC-class II and expressing the human beta cell autoantigen Glutamic Acid Decarboxylase in pancreatic beta cells. We report here the development of dry eye syndrome (DES) after diabetes induction in our humanized transgenic model. Methods Double-transgenic mice were immunized with DNA encoding human GAD65, either naked or in adenoviral vectors, to induce T1D. Mice monitored for development of diabetes developed lacrimal gland dysfunction. Results Animals developed lacrimal gland disease (classically associated with diabetes in Non Obese Diabetic [NOD] mice and with T1D in humans) as they developed glucose intolerance and diabetes. Animals manifested obvious clinical signs of dry eye syndrome (DES), from corneal erosions to severe keratitis. Histological studies of peri-bulbar areas revealed lymphocytic infiltration of glandular structures. Indeed, infiltrative lesions were observed in lacrimal/Harderian glands within weeks following development of glucose intolerance. Lesions ranged from focal lymphocytic infiltration to complete acinar destruction. We observed a correlation between the severity of the pancreatic infiltration and the severity of the ocular disease. Conclusions Our results demonstrate development of DES in association with antigen-specific insulitis and diabetes following immunization with clinically relevant human autoantigen concomitantly expressed in pancreatic beta cells of diabetes-susceptible mice. As in the NOD mouse model and as in human T1D, our animals developed diabetes-associated DES. This specific finding stresses the relevance of our model for studying these human diseases. We believe our model will facilitate studies to prevent/treat diabetes-associated DES as well as human diabetes. PMID

  3. Anticancer Activity of Saponins from Allium chinense against the B16 Melanoma and 4T1 Breast Carcinoma Cell

    PubMed Central

    Yu, Zhihui; Zhang, Tong; Zhou, Fengjuan; Xiao, Xiuqing; Ding, Xuezhi; He, Hao; Rang, Jie; Quan, Meifang; Wang, Ting; Zuo, Mingxing; Xia, Liqiu

    2015-01-01

    The cytotoxic substance of A. chinense saponins (ACSs) was isolated using ethanol extraction and purified with the D101 macroporous adsorption resin approach. We investigated the anticancer activity of ACSs in the B16 melanoma and 4T1 breast carcinoma cell lines. Methylthioninium chloride and hematoxylin-eosin staining with Giemsa dyestuff were used when the cells were treated with ACSs. The results showed that the cells morphologies changed significantly; ACSs induced cell death in B16 and 4T1 cells based on acridine orange/ethidium bromide double fluorescence staining, with the number and degree of apoptotic tumor cells increasing as ACS concentration increased. ACSs inhibited the proliferation of B16 and 4T1 cells in a dose-dependent manner. They also inhibited cell migration and colony formation and exhibited a concentration-dependent effect. In addition, ACSs apparently inhibited the growth of melanoma in vivo. The preliminary antitumor in vivo assay revealed that early medication positively affected tumor inhibition action and effectively protected the liver and spleen of C57 BL/6 mice from injury. This study provides evidence for the cytotoxicity of ACSs and a strong foundation for further research to establish the theoretical basis for cell death and help in the design and development of new anticancer drugs. PMID:26146506

  4. Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.

    PubMed

    Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min

    2015-09-01

    The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis. PMID:25604637

  5. Comprehensive assessment of milk composition in transgenic cloned cattle.

    PubMed

    Zhang, Ran; Guo, Chengdong; Sui, Shunchao; Yu, Tian; Wang, Jianwu; Li, Ning

    2012-01-01

    The development of transgenic cloned animals offers new opportunities for agriculture, biomedicine and environmental science. Expressing recombinant proteins in dairy animals to alter their milk composition is considered beneficial for human health. However, relatively little is known about the expression profile of the proteins in milk derived from transgenic cloned animals. In this study, we compared the proteome and nutrient composition of the colostrum and mature milk from three lines of transgenic cloned (TC) cattle that specifically express human α-lactalbumin (TC-LA), lactoferrin (TC-LF) or lysozyme (TC-LZ) in the mammary gland with those from cloned non-transgenic (C) and conventionally bred normal animals (N). Protein expression profile identification was performed, 37 proteins were specifically expressed in the TC animals and 70 protein spots that were classified as 22 proteins with significantly altered expression levels in the TC and C groups compared to N group. Assessment of the relationship of the transgene effect and normal variability in the milk protein profiles in each group indicated that the variation in the endogenous protein profiles of the three TC groups was within the limit of natural variability. More than 50 parameters for the colostrum and mature milk were compared between each TC group and the N controls. The data revealed essentially similar profiles for all groups. This comprehensive study demonstrated that in TC cattle the mean values for the measured milk parameters were all within the normal range, suggesting that the expression of a transgene does not affect the composition of milk.

  6. Transgenic Sugarcane with a cry1Ac Gene Exhibited Better Phenotypic Traits and Enhanced Resistance against Sugarcane Borer

    PubMed Central

    Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping

    2016-01-01

    We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines. PMID:27093437

  7. Transgenic Sugarcane with a cry1Ac Gene Exhibited Better Phenotypic Traits and Enhanced Resistance against Sugarcane Borer.

    PubMed

    Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping; Que, Youxiong

    2016-01-01

    We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines.

  8. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    PubMed

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. PMID:26025753

  9. Construction and long term preservation of clonal transgenic silkworms using a parthenogenetic strain.

    PubMed

    Zabelina, Valeriya; Uchino, Keiro; Mochida, Yuji; Yonemura, Naoyuki; Klymenko, Vyacheslav; Sezutsu, Hideki; Tamura, Toshiki; Sehnal, František

    2015-10-01

    For the functional analysis of insect genes as well as for the production of recombinant proteins for biomedical use, clonal transgenic silkworms are very useful. We examined if they could be produced in the parthenogenetic strain that had been maintained for more than 40years as a female line in which embryogenesis is induced with nearly 100% efficiency by a heat shock treatment of unfertilized eggs. All individuals have identical female genotype. Silkworm transgenesis requires injection of the DNA constructs into the non-diapausing eggs at the preblastodermal stage of embryogenesis. Since our parthenogenetic silkworms produce diapausing eggs, diapause programing was eliminated by incubating ovaries of the parthenogenetic strain in standard male larvae. Chorionated eggs were dissected from the implants, activated by the heat shock treatment and injected with the transgene construct. Several transgenic individuals occurred in the daughter generation. Southern blotting analysis of two randomly chosen transgenic lines VTG1 and VTG14 revealed multiple transgene insertions. Insertions found in the parental females were transferred to the next generation without any changes in their sites and copy numbers, suggesting that transgenic silkworms can be maintained as clonal strains with homozygous transgenes. Cryopreservation was developed for the storage of precious genotypes. As shown for the VTG1 and VTG14 lines, larval ovaries can be stored in DMSO at the temperature of liquid nitrogen, transferred to Grace's medium during defrosting, and then implanted into larvae of either sex of the standard silkworm strains C146 and w1-pnd. Chorionated eggs, which developed in the implants, were dissected and activated by the heat shock to obtain females (nearly 100% efficiency) or by a cold shock to induce development to both sexes in 4% of the eggs. It was then possible to establish bisexual lines homozygous for the transgene. PMID:26112978

  10. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    PubMed

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China.

  11. WP1: transgenic opto-animals

    NASA Astrophysics Data System (ADS)

    UŻarowska, E.; Czajkowski, Rafał; Konopka, W.

    2014-11-01

    We aim to create a set of genetic tools where permanent opsin expression (ChR or NpHR) is precisely limited to the population of neurons that express immediate early gene c-fos during a specific temporal window of behavioral training. Since the c-fos gene is only expressed in neurons that form experience-dependent ensemble, this approach will result in specific labeling of a small subset of cells that create memory trace for the learned behavior. To this end we employ two alternative inducible gene expression systems: Tet Expression System and Cre/lox System. In both cases, the temporal window for opsin induction is controlled pharmacologically, by doxycycline or tamoxifen, respectively. Both systems will be used for creating lines of transgenic animals.

  12. Phase-sensitive inversion recovery for myocardial T1 mapping with motion correction and parametric fitting.

    PubMed

    Xue, Hui; Greiser, Andreas; Zuehlsdorff, Sven; Jolly, Marie-Pierre; Guehring, Jens; Arai, Andrew E; Kellman, Peter

    2013-05-01

    The assessment of myocardial fibrosis and extracellular volume requires accurate estimation of myocardial T1 s. While image acquisition using the modified Look-Locker inversion recovery technique is clinically feasible for myocardial T1 mapping, respiratory motion can limit its applicability. Moreover, the conventional T1 fitting approach using the magnitude inversion recovery images can lead to less stable T1 estimates and increased computational cost. In this article, we propose a novel T1 mapping scheme that is based on phase-sensitive image reconstruction and the restoration of polarity of the MR signal after inversion. The motion correction is achieved by registering the reconstructed images after background phase removal. The restored signal polarity of the inversion recovery signal helps the T1 fitting resulting in improved quality of the T1 map and reducing the computational cost. Quantitative validation on a data cohort of 45 patients proves the robustness of the proposed method against varying image contrast. Compared to the magnitude T1 fitting, the proposed phase-sensitive method leads to less fluctuation in T1 estimates.

  13. Taste substance binding elicits conformational change of taste receptor T1r heterodimer extracellular domains

    PubMed Central

    Nango, Eriko; Akiyama, Shuji; Maki-Yonekura, Saori; Ashikawa, Yuji; Kusakabe, Yuko; Krayukhina, Elena; Maruno, Takahiro; Uchiyama, Susumu; Nuemket, Nipawan; Yonekura, Koji; Shimizu, Madoka; Atsumi, Nanako; Yasui, Norihisa; Hikima, Takaaki; Yamamoto, Masaki; Kobayashi, Yuji; Yamashita, Atsuko

    2016-01-01

    Sweet and umami tastes are perceived by T1r taste receptors in oral cavity. T1rs are class C G-protein coupled receptors (GPCRs), and the extracellular ligand binding domains (LBDs) of T1r1/T1r3 and T1r2/T1r3 heterodimers are responsible for binding of chemical substances eliciting umami or sweet taste. However, molecular analyses of T1r have been hampered due to the difficulties in recombinant expression and protein purification, and thus little is known about mechanisms for taste perception. Here we show the first molecular view of reception of a taste substance by a taste receptor, where the binding of the taste substance elicits a different conformational state of T1r2/T1r3 LBD heterodimer. Electron microscopy has showed a characteristic dimeric structure. Förster resonance energy transfer and X-ray solution scattering have revealed the transition of the dimerization manner of the ligand binding domains, from a widely spread to compactly organized state upon taste substance binding, which may correspond to distinct receptor functional states. PMID:27160511

  14. Measurement of T1 of human arterial and venous blood at 7T

    PubMed Central

    Rane, S.; Gore, J.C.

    2012-01-01

    Techniques for measuring cerebral perfusion require accurate longitudinal relaxation (T1) of blood, a MRI parameter that is field dependent. T1 of arterial and venous human blood was measured at 7T using three different sources – pathology laboratory, blood bank and in vivo. The T1 of venous blood was measured from sealed samples from a pathology lab and in vivo. Samples from a blood bank were oxygenated and mixed to obtain different physiological concentrations of hematocrit and oxygenation. T1 relaxation times were estimated using a three-point fit to a simple inversion recovery equation. At 37° C, the T1 of blood at arterial pO2was 2.29 ± 0.1 s and 2.07 ± 0.12 at venous pO2. The in vivo T1 of venous blood, in three subjects, was slightly longer at 2.45 ± 0.11s. T1 of arterial and venous blood at 7T was measured and found to be significantly different. The T1 values were longer in vivo than in vitro. While the exact cause for the discrepancy is unknown, the additives in the blood samples, degradation during experiment, oxygenation differences, and the non-stagnant nature of blood in vivo could be potential contributors to the lower values of T1 in the venous samples. PMID:23102945

  15. Taste substance binding elicits conformational change of taste receptor T1r heterodimer extracellular domains.

    PubMed

    Nango, Eriko; Akiyama, Shuji; Maki-Yonekura, Saori; Ashikawa, Yuji; Kusakabe, Yuko; Krayukhina, Elena; Maruno, Takahiro; Uchiyama, Susumu; Nuemket, Nipawan; Yonekura, Koji; Shimizu, Madoka; Atsumi, Nanako; Yasui, Norihisa; Hikima, Takaaki; Yamamoto, Masaki; Kobayashi, Yuji; Yamashita, Atsuko

    2016-01-01

    Sweet and umami tastes are perceived by T1r taste receptors in oral cavity. T1rs are class C G-protein coupled receptors (GPCRs), and the extracellular ligand binding domains (LBDs) of T1r1/T1r3 and T1r2/T1r3 heterodimers are responsible for binding of chemical substances eliciting umami or sweet taste. However, molecular analyses of T1r have been hampered due to the difficulties in recombinant expression and protein purification, and thus little is known about mechanisms for taste perception. Here we show the first molecular view of reception of a taste substance by a taste receptor, where the binding of the taste substance elicits a different conformational state of T1r2/T1r3 LBD heterodimer. Electron microscopy has showed a characteristic dimeric structure. Förster resonance energy transfer and X-ray solution scattering have revealed the transition of the dimerization manner of the ligand binding domains, from a widely spread to compactly organized state upon taste substance binding, which may correspond to distinct receptor functional states. PMID:27160511

  16. How To Produce and Characterize Transgenic Plants.

    ERIC Educational Resources Information Center

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  17. [Current status and industrialization of transgenic tomatoes].

    PubMed

    Wang, Ao-Xue; Chen, Xiu-Ling

    2011-09-01

    In this review, the progress in transgenic tomato research, including disease and insect resistance, herbicide resistance, stress tolerance, long-term storage, quality improvement, and male sterility, were described. The recent researches on producing heterologous proteins using transgenic tomatoes were also reviewed. Furthermore, the industrialization status and problems of transgenic tomatoes were analyzed and the prospects of both research and industrialization in transgenic tomatoes were discussed.

  18. [Effects of transgenic Bt rice on soil dissolved organic carbon and nitrogen contents and microbiological properties].

    PubMed

    Li, Xiu-Qiang; Chen, Fa-Jun; Liu, Man-Qiang; Hu, Feng

    2012-01-01

    A two-year field experiment (2009 and 2010) was conducted to evaluate the effects of three transgenic Bt rice lines (KMD, HH1, and BtSY63) and their non-Bt lines (XSD, MH63, and SY63) on soil dissolved organic carbon (DOC) and nitrogen (DON) and microbiological properties. All the measured indices changed significantly with sampling time. Comparing with their corresponding non-Bt lines, the test transgenic Bt lines had little effects on the soil DOC, DON, and microbial biomass nitrogen (MBN). The transgenic Bt lines had significant effects on the soil microbial biomass carbon (MBC), basal respiration (BR), and microbial metabolic quotient (qCO2) in certain periods of time in the first year, but no effects in the second year. Among the soils planted with the three non-Bt rice lines, no difference was observed in the DOC, DON, and microbiological properties, whereas in the soil planted with BtSY63, the MBC and BR were significantly higher, but the qCO2 was significantly lower, as compared with those in the soils planted with KMD and HH1. In sum, two years' planting transgenic Bt rice had little effects on the soil DOC, DON, and microbiological properties, but the differences of soil microbiological properties induced by the planting of different transgenic Bt rice lines were larger than those induced by the planting of different non-Bt lines, implying that long term monitoring would help to reveal the effects of transgenic Bt rice on the structure and function of soil ecosystem. PMID:22489485

  19. Field performance of transgenic citrus trees: Assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics

    PubMed Central

    2012-01-01

    Background The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. Results The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Conclusions Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the

  20. ZFIN, the Zebrafish Model Organism Database: increased support for mutants and transgenics.

    PubMed

    Howe, Douglas G; Bradford, Yvonne M; Conlin, Tom; Eagle, Anne E; Fashena, David; Frazer, Ken; Knight, Jonathan; Mani, Prita; Martin, Ryan; Moxon, Sierra A Taylor; Paddock, Holly; Pich, Christian; Ramachandran, Sridhar; Ruef, Barbara J; Ruzicka, Leyla; Schaper, Kevin; Shao, Xiang; Singer, Amy; Sprunger, Brock; Van Slyke, Ceri E; Westerfield, Monte

    2013-01-01

    ZFIN, the Zebrafish Model Organism Database (http://zfin.org), is the central resource for zebrafish genetic, genomic, phenotypic and developmental data. ZFIN curators manually curate and integrate comprehensive data involving zebrafish genes, mutants, transgenics, phenotypes, genotypes, gene expressions, morpholinos, antibodies, anatomical structures and publications. Integrated views of these data, as well as data gathered through collaborations and data exchanges, are provided through a wide selection of web-based search forms. Among the vertebrate model organisms, zebrafish are uniquely well suited for rapid and targeted generation of mutant lines. The recent rapid production of mutants and transgenic zebrafish is making management of data associated with these resources particularly important to the research community. Here, we describe recent enhancements to ZFIN aimed at improving our support for mutant and transgenic lines, including (i) enhanced mutant/transgenic search functionality; (ii) more expressive phenotype curation methods; (iii) new downloads files and archival data access; (iv) incorporation of new data loads from laboratories undertaking large-scale generation of mutant or transgenic lines and (v) new GBrowse tracks for transgenic insertions, genes with antibodies and morpholinos.

  1. ZFIN, the Zebrafish Model Organism Database: increased support for mutants and transgenics.

    PubMed

    Howe, Douglas G; Bradford, Yvonne M; Conlin, Tom; Eagle, Anne E; Fashena, David; Frazer, Ken; Knight, Jonathan; Mani, Prita; Martin, Ryan; Moxon, Sierra A Taylor; Paddock, Holly; Pich, Christian; Ramachandran, Sridhar; Ruef, Barbara J; Ruzicka, Leyla; Schaper, Kevin; Shao, Xiang; Singer, Amy; Sprunger, Brock; Van Slyke, Ceri E; Westerfield, Monte

    2013-01-01

    ZFIN, the Zebrafish Model Organism Database (http://zfin.org), is the central resource for zebrafish genetic, genomic, phenotypic and developmental data. ZFIN curators manually curate and integrate comprehensive data involving zebrafish genes, mutants, transgenics, phenotypes, genotypes, gene expressions, morpholinos, antibodies, anatomical structures and publications. Integrated views of these data, as well as data gathered through collaborations and data exchanges, are provided through a wide selection of web-based search forms. Among the vertebrate model organisms, zebrafish are uniquely well suited for rapid and targeted generation of mutant lines. The recent rapid production of mutants and transgenic zebrafish is making management of data associated with these resources particularly important to the research community. Here, we describe recent enhancements to ZFIN aimed at improving our support for mutant and transgenic lines, including (i) enhanced mutant/transgenic search functionality; (ii) more expressive phenotype curation methods; (iii) new downloads files and archival data access; (iv) incorporation of new data loads from laboratories undertaking large-scale generation of mutant or transgenic lines and (v) new GBrowse tracks for transgenic insertions, genes with antibodies and morpholinos. PMID:23074187

  2. Transgenic Manipulation of the Metabolism of Polyamines in Poplar Cells1

    PubMed Central

    Bhatnagar, Pratiksha; Glasheen, Bernadette M.; Bains, Suneet K.; Long, Stephanie L.; Minocha, Rakesh; Walter, Christian; Minocha, Subhash C.

    2001-01-01

    The metabolism of polyamines (putrescine, spermidine, and spermine) has become the target of genetic manipulation because of their significance in plant development and possibly stress tolerance. We studied the polyamine metabolism in non-transgenic (NT) and transgenic cells of poplar (Populus nigra × maximowiczii) expressing a mouse Orn decarboxylase (odc) cDNA. The transgenic cells showed elevated levels of mouse ODC enzyme activity, severalfold higher amounts of putrescine, a small increase in spermidine, and a small reduction in spermine as compared with NT cells. The conversion of labeled ornithine (Orn) into putrescine was significantly higher in the transgenic than the NT cells. Whereas exogenously supplied Orn caused an increase in cellular putrescine in both cell lines, arginine at high concentrations was inhibitory to putrescine accumulation. The addition of urea and glutamine had no effect on polyamines in either of the cell lines. Inhibition of glutamine synthetase by methionine sulfoximine led to a substantial reduction in putrescine and spermidine in both cell lines. The results show that: (a) Transgenic expression of a heterologous odc gene can be used to modulate putrescine metabolism in plant cells, (b) accumulation of putrescine in high amounts does not affect the native arginine decarboxylase activity, (c) Orn biosynthesis occurs primarily from glutamine/glutamate and not from catabolic breakdown of arginine, (d) Orn biosynthesis may become a limiting factor for putrescine production in the odc transgenic cells, and (e) assimilation of nitrogen into glutamine keeps pace with an increased demand for its use for putrescine production. PMID:11299393

  3. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    PubMed

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity. PMID:27437143

  4. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    PubMed

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  5. Tissue-specific expression of human CD4 in transgenic mice.

    PubMed

    Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C

    1993-05-01

    The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. PMID:8474453

  6. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions

    PubMed Central

    Lebedev, V. G.; Faskhiev, V. N.; Kovalenko, N. P.; Shestibratov, K. A.; Miroshnikov, A. I.

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014–2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity. PMID:27437143

  7. Transcriptional regulation using the Q system in transgenic zebrafish.

    PubMed

    Ghosh, A; Halpern, M E

    2016-01-01

    Methods to label cell populations selectively or to modify their gene expression are critical tools in the study of developmental or physiological processes in vivo. A variety of approaches have been applied to the zebrafish model, capitalizing on Tol2 transposition to generate transgenic lines with high efficiency. Here we describe the adoption of the Q system of Neurospora crassa, which includes the QF transcription factor and the upstream activating sequence (QUAS) to which it binds. These components function as a bipartite regulatory system similar to that of yeast Gal4/UAS, producing robust expression in transient assays of zebrafish embryos injected with plasmids and in stable transgenic lines. An important advantage, however, is that QUAS-regulated transgenes appear far less susceptible to transcriptional silencing even after seven generations. This chapter describes some of the Q system reagents that have been developed for zebrafish, as well as the use of the QF transcription factor for isolation of tissue-specific driver lines from gene/enhancer trap screens. Additional strategies successfully implemented in invertebrate models, such as a truncated QF transcription factor (QF2) or the reassembly of a split QF, are also discussed. The provided information, and available Gateway-based vectors, should enable those working with the zebrafish model to implement the Q system with minimal effort or to use it in combination with Gal4, Cre, or other regulatory systems for further refinement of transcriptional control. PMID:27443927

  8. Serial changes in the T1 magnetic relaxation parameter after myocardial infarction in man.

    PubMed Central

    Been, M; Smith, M A; Ridgway, J P; Douglas, R H; de Bono, D P; Best, J J; Muir, A L

    1988-01-01

    A low field resistive nuclear magnetic resonance imaging system (0.08 Tesla) was used to study the in vivo changes in the relaxation parameter T1 of the left ventricular myocardium from the first day to six months after acute myocardial infarction in 41 consecutive patients admitted to a coronary care unit. T1 maps were constructed from transverse and coronal images at various times after infarction. Thrombolytic treatment had been successful in 28 patients. Thirty three of the 34 patients studied within two weeks of infarction had a significantly increased T1 value but this developed only after the third day in four. At day 1-3 the mean (1 SD) maximum T1 was 413 (29) ms (n = 23) compared with 430 (41) ms (n = 22) at day 4-7, 433 (35) ms (n = 24) at day 8-14, 420 (34) at one month (n = 22), 388 (39) (n = 20) at three months, and 361 (24) (n = 14) at six months. The number of regions of interest with an increased T1 followed a similar time course. Although the increase in T1 measured at three months correlated with the initial maximum creatine kinase and with the left ventricular ejection fraction measured at one month, the number of regions with abnormal T1 from day 4 through to one month correlated best with left ventricular ejection fraction. There was no significant difference in T1 between patients with or without reperfusion. The rise in T1 over the first few days together with the prolonged time course of T1 increase suggests that the increase in T1 may reflect cellular infiltration as much or more than tissue oedema. Images Fig 3 PMID:3342143

  9. Role of glycosyltransferase PomGnT1 in glioblastoma progression

    PubMed Central

    Lan, Jin; Guo, Pin; Lin, Yingying; Mao, Qing; Guo, Liemei; Ge, Jianwei; Li, Xiaoxiong; Jiang, Jiyao; Lin, Xinjian; Qiu, Yongming

    2015-01-01

    Background Glioblastoma multiforme (GBM) is the most aggressive and invasive brain tumor, for which novel prognostic markers and predictors of therapeutic response are urgently needed. We reported previously that levels of peptide-O-linked mannose β-1,2-N-acetylglucosaminyltransferase 1 (PomGnT1) in glioma specimens correlated with tumor grade. However, the prognostic significance of PomGnT1 in glioma patients and its function in GBM progression remain unknown. Methods Clinical relevance of PomGnT1 in GBM patients' prognosis was analyzed both in a clinically annotated expression dataset of 446 GBM tumor specimens and in 82 GBM tumor samples collected at our institution. The function of PomGnT1 in glioma growth and invasion, and the underlying mechanisms of PomGnT1 regulation were explored in vitro and in vivo. Results PomGnT1 expression in GBM tissues was closely associated with poor prognosis in GBM patients. Forced overexpression of PomGnT1 in glioblastoma cells impaired cell adhesion and increased their proliferation and invasion in vitro. Subsequent in vivo experiments showed that overexpression of PomGnT1 promoted tumor growth and shortened the survival time of tumor-bearing mice in an orthotopic model. Conversely, stable short hairpin RNA–mediated knockdown of PomGnT1 expression produced opposite effects both in vitro and in vivo. Mechanistic studies revealed that activation of epidermal growth factor receptor (EGFR) resulted in EGFR/extracellular signal-regulated kinase–dependent upregulation of PomGnT1, downregulation of receptor-type protein tyrosine phosphatase β, and activation of β-catenin pathway signaling. Conclusion These findings suggest that PomGnT1 promotes GBM progression via activation of β-catenin and may serve as a prognostic factor for glioma patient survival as well as a novel molecular target for anticancer therapy in malignant glioma. PMID:25085363

  10. DNA methylation in 5-aza-2'-deoxycytidine-resistant variants of C3H 10T1/2 C18 cells.

    PubMed Central

    Flatau, E; Gonzales, F A; Michalowsky, L A; Jones, P A

    1984-01-01

    A cell line (T17) was derived from C3H 10T1/2 C18 cells after 17 treatments with increasing concentrations of 5-aza-2'-deoxycytidine. The T17 cell line was very resistant to the cytotoxic effects of 5-aza-2'-deoxycytidine, and the 50% lethal dose for 5-aza-2'-deoxycytidine was ca. 3 microM, which was 30-fold greater than that of the parental C3H 10T1/2 C18 cells. Increased drug resistance was not due to a failure of the T17 cell line to incorporate 5-aza-2'-deoxycytidine into DNA. The cells were also slightly cross-resistant to 5-azacytidine. The percentage of cytosines modified to 5-methylcytosine in T17 cells was 0.7%, a 78% decrease from the level of 3.22% in C3H 10T1/2 C18 cells. The DNA cytosine methylation levels in several clones isolated from the treated lines were on the order of 0.7%, and clones with methylation levels lower than 0.45% were not obtained even after further drug treatments. These highly decreased methylation levels appeared to be unstable, and DNA modification increased as the cells divided in the absence of further drug treatment. The results suggest that it may not be possible to derive mouse cells with vanishingly low levels of 5-methylcytosine and that considerable de novo methylation can occur in cultured lines. PMID:6209556

  11. Human health and transgenic crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Under the joint auspices of the Agrochemical and the Agricultural and Food Chemistry Divisions of the American Chemical Society, we organized a short symposium on “Human Health and Transgenic Crops” at the 244th ACS national meeting, held August 19-23, 2012 in Philadelphia, PA, to examine an array o...

  12. Transgene-like animal models using intronic microRNAs.

    PubMed

    Lin, Shi-Lung; Chang, Shin-Ju E; Ying, Shao-Yao

    2013-01-01

    Transgenic animal models are valuable tools for testing gene functions and drug mechanisms in vivo. They are also the best similitude for a human body for etiological and pathological research of diseases. All pharmaceutically developed drugs must be proven to be safe and effective in animals before approval by the Food and Drug Administration to be used in clinical trials. To this end, the transgenic animal models of diseases serve as the front line of drug evaluation. However, there is currently no transgenic animal model for microRNA (miRNA) research. miRNAs, small single-stranded regulatory RNAs capable of silencing intracellular gene transcripts (mRNAs) that contain either complete or partial complementarity to the miRNA, are useful for the design of new therapies against cancer polymorphism and viral mutation. Recently, varieties of natural miRNAs have been found to derived from hairpin-like RNA precursors in almost all eukaryotes, including yeast (Schizosaccharomyces pombe), plant (Arabidopsis spp.), nematode (Caenorhabditis elegans), fly (Drosophila melanogaster), fish, mouse, and human, involving intracellular defense against viral infections and regulation of certain gene expressions during development. To facilitate the miRNA research in vivo, we have developed a state-of-the-art transgenic strategy for silencing specific genes in zebrafish, chicken, and mouse, using intronic miRNAs. By insertion of a hairpin-like pre-miRNA structure into the intron region of a gene, we have found that mature miRNAs were successfully transcribed by RNA polymerases type II (Pol II), coexpressed with the encoding gene transcript, and excised out of the encoding gene transcript by natural RNA splicing and processing mechanisms. In conjunction with retroviral transfection systems, the designed hairpin-like pre-miRNA construct was further tested to insert into the intron regions of a cellular gene for tissue-specific expression regulated by the gene promoter. Because the

  13. Spi-1/PU.1 transgenic mice develop multistep erythroleukemias.

    PubMed Central

    Moreau-Gachelin, F; Wendling, F; Molina, T; Denis, N; Titeux, M; Grimber, G; Briand, P; Vainchenker, W; Tavitian, A

    1996-01-01

    Insertional mutagenesis of the spi-1 gene is associated with the emergence of malignant proerythroblasts during Friend virus-induced acute erythroleukemia. To determine the role of spi-1/PU.1 in the genesis of leukemia, we generated spi-1 transgenic mice. In one founder line the transgene was overexpressed as an unexpected-size transcript in various mouse tissues. Homozygous transgenic animals gave rise to live-born offspring, but 50% of the animals developed a multistep erythroleukemia within 1.5 to 6 months of birth whereas the remainder survived without evidence of disease. At the onset of the disease, mice became severely anemic. Their hematopoietic tissues were massively invaded with nontumorigenic proerythroblasts that express a high level of Spi-1 protein. These transgenic proerythroblasts are partially blocked in differentiation and strictly dependent on erythropoietin for their proliferation both in vivo and in vitro. A complete but transient regression of the disease was observed after erythrocyte transfusion, suggesting that the constitutive expression of spi-1 is related to the block of the differentiation of erythroid precursors. At relapse, erythropoietin-independent malignant proerythroblasts arose. Growth factor autonomy could be partially explained by the autocrine secretion of erythropoietin; however, other genetic events appear to be necessary to confer the full malignant phenotype. These results reveal that overexpression of spi-1 is essential for malignant erythropoiesis and does not alter other hematopoietic lineages. PMID:8628313

  14. DETERMINATION OF AN UPPER LIMIT FOR THE WATER OUTGASSING RATE OF MAIN-BELT COMET P/2012 T1 (PANSTARRS)

    SciTech Connect

    O'Rourke, L.; Teyssier, D.; Kueppers, M.; Snodgrass, C.; De Val-Borro, M.; Hartogh, P.; Biver, N.; Bockelee-Morvan, D.; Hsieh, H.; Micheli, M.; Fernandez, Y.

    2013-09-01

    A new Main-Belt Comet (MBC) P/2012 T1 (PANSTARRS) was discovered on 2012 October 6, approximately one month after its perihelion, by the Pan-STARRS1 survey based in Hawaii. It displayed cometary activity upon its discovery with one hypothesis being that the activity was driven by sublimation of ices; as a result, we searched for emission assumed to be driven by the sublimation of subsurface ices. Our search was of the H{sub 2}O 1{sub 10}-1{sub 01} ground state rotational line at 557 GHz from P/2012 T1 (PANSTARRS) with the Heterodyne Instrument for the Far Infrared on board the Herschel Space Observatory on 2013 January 16, when the object was at a heliocentric distance of 2.504 AU and a geocentric distance of 2.064 AU. Perihelion was in early 2012 September at a distance of 2.411 AU. While no H{sub 2}O line emission was detected in our observations, we were able to derive sensitive 3{sigma} upper limits for the water production rate and column density of <7.63 Multiplication-Sign 10{sup 25} molecules s{sup -1} and of <1.61 Multiplication-Sign 10{sup 11} cm{sup -2}, respectively. An observation taken on 2013 January 15 using the Very Large Telescope found the MBC to be active during the Herschel observation, suggesting that any ongoing sublimation due to subsurface ice was lower than our upper limit.

  15. Loss of PiT-1 results in abnormal endocytosis in the yolk sac visceral endoderm.

    PubMed

    Wallingford, Mary C; Giachelli, Cecilia M

    2014-08-01

    PiT-1 protein is a transmembrane sodium-dependent phosphate (Pi) transporter. PiT-1 knock out (KO) embryos die from largely unknown causes by embryonic day (E) 12.5. We tested the hypothesis that PiT-1 is required for endocytosis in the embryonic yolk sac (YS) visceral endoderm (VE). Here we present data supporting that PiT-1 KO results in a YS remodeling defect and decreased endocytosis in the YS VE. The remodeling defect is not due to an upstream cardiomyocyte requirement for PiT-1, as SM22αCre-specific KO of PiT-1 in the developing heart and the YS mesodermal layer (ME) does not recapitulate the PiT-1 global KO phenotype. Furthermore, we find that high levels of PiT-1 protein localize to the YS VE apical membrane. Together these data support that PiT-1 is likely required in YS VE. During normal development maternal immunoglobulin (IgG) is endocytosed into YS VE and accumulates in the apical side of the VE in a specialized lysosome termed the apical vacuole (AV). We have identified a reduction in PiT-1 KO VE cell height and a striking loss of IgG accumulation in the PiT-1 KO VE. The endocytosis genes Tfeb, Lamtor2 and Snx2 are increased at the RNA level. Lysotracker Red staining reveals a loss of distinct AVs, and yolk sacs incubated ex vivo with phRODO Green Dextran for Endocytosis demonstrate a functional loss of endocytosis. As yolk sac endocytosis is controlled in part by microautophagy, but expression of LC3 had not been examined, we investigated LC3 expression during yolk sac development and found stage-specific LC3 RNA expression that is predominantly from the YS VE layer at E9.5. Normalized LC3-II protein levels are decreased in the PiT-1 KO YS, supporting a requirement for PiT-1 in autophagy in the YS. Therefore, we propose the novel idea that PiT-1 is central to the regulation of endocytosis and autophagy in the YS VE.

  16. Promoting scopolamine biosynthesis in transgenic Atropa belladonna plants with pmt and h6h overexpression under field conditions.

    PubMed

    Xia, Ke; Liu, Xiaoqiang; Zhang, Qiaozhuo; Qiang, Wei; Guo, Jianjun; Lan, Xiaozhong; Chen, Min; Liao, Zhihua

    2016-09-01

    Atropa belladonna is one of the most important plant sources for producing pharmaceutical tropane alkaloids (TAs). T1 progeny of transgenic A. belladonna, in which putrescine N-methyltransferase (EC. 2.1.1.53) from Nicotiana tabacum (NtPMT) and hyoscyamine 6β-hydroxylase (EC. 1.14.11.14) from Hyoscyamus niger (HnH6H) were overexpressed, were established to investigate TA biosynthesis and distribution in ripe fruits, leaves, stems, primary roots and secondary roots under field conditions. Both NtPMT and HnH6H were detected at the transcriptional level in transgenic plants, whereas they were not detected in wild-type plants. The transgenes did not influence the root-specific expression patterns of endogenous TA biosynthetic genes in A. belladonna. All four endogenous TA biosynthetic genes (AbPMT, AbTRI, AbCYP80F1 and AbH6H) had the highest/exclusive expression levels in secondary roots, suggesting that TAs were mainly synthesized in secondary roots. T1 progeny of transgenic A. belladonna showed an impressive scopolamine-rich chemotype that greatly improved the pharmaceutical value of A. belladonna. The higher efficiency of hyoscyamine conversion was found in aerial than in underground parts. In aerial parts of transgenic plants, hyoscyamine was totally converted to downstream alkaloids, especially scopolamine. Hyoscyamine, anisodamine and scopolamine were detected in underground parts, but scopolamine and anisodamine were more abundant than hyoscyamine. The exclusively higher levels of anisodamine in roots suggested that it might be difficult for its translocation from root to aerial organs. T1 progeny of transgenic A. belladonna, which produces scopolamine at very high levels (2.94-5.13 mg g(-1)) in field conditions, can provide more valuable plant materials for scopolamine production. PMID:27135818

  17. T 1 Relaxation Measurement of Ex-Vivo Breast Cancer Tissues at Ultralow Magnetic Fields

    PubMed Central

    Lee, Seong-Joo; Shim, Jeong Hyun; Kim, Kiwoong; Hwang, Seong-min; Yu, Kwon Kyu; Lim, Sanghyun; Han, Jae Ho; Yim, Hyunee; Kim, Jang-Hee; Jung, Yong Sik; Kim, Ku Sang

    2015-01-01

    We investigated T1 relaxations of ex-vivo cancer tissues at low magnetic fields in order to check the possibility of achieving a T1 contrast higher than those obtained at high fields. The T1 relaxations of fifteen pairs (normal and cancerous) of breast tissue samples were measured at three magnetic fields, 37, 62, and 122 μT, using our superconducting quantum interference device-based ultralow field nuclear magnetic resonance setup, optimally developed for ex-vivo tissue studies. A signal reconstruction based on Bayesian statistics for noise reduction was exploited to overcome the low signal-to-noise ratio. The ductal and lobular-type tissues did not exhibit meaningful T1 contrast values between normal and cancerous tissues at the three different fields. On the other hand, an enhanced T1 contrast was obtained for the mucinous cancer tissue. PMID:25705658

  18. T1BT* structural study of an anti-plasmodial peptide through NMR and molecular dynamics

    PubMed Central

    2013-01-01

    Background T1BT* is a peptide construct containing the T1 and B epitopes located in the 5’ minor repeat and the 3’ major repeat of the central repeat region of the Plasmodium falciparum circumsporozoite protein (CSP), respectively, and the universal T* epitope located in the C-terminus of the same protein. This peptide construct, with B = (NANP)3, has been found to elicit antisporozoite antibodies and gamma-interferon-screening T-cell responses in inbred strains of mice and in outbred nonhuman primates. On the other hand, NMR and CD spectroscopies have identified the peptide B’ = (NPNA)3 as the structural unit of the major repeat in the CSP, rather than the more commonly quoted NANP. With the goal of assessing the structural impact of the NPNA cadence on a proven anti-plasmodial peptide, the solution structures of T1BT* and T1B’T* were determined in this work. Methods NMR spectroscopy and molecular dynamics calculations were used to determine the solution structures of T1BT* and T1B’T*. These structures were compared to determine the main differences and similarities between them. Results Both peptides exhibit radically different structures, with the T1B’T* showing strong helical tendencies. NMR and CD data, in conjunction with molecular modelling, provide additional information about the topologies of T1BT* and T1B’T*. Knowing the peptide structures required to elicit the proper immunogenic response can help in the design of more effective, conformationally defined malaria vaccine candidates. If peptides derived from the CSP are required to have helical structures to interact efficiently with their corresponding antibodies, a vaccine based on the T1B’T* construct should show higher efficiency as a pre-erythrocyte vaccine that would prevent infection of hepatocytes by sporozoites. PMID:23506240

  19. Aspirin Breaks the Crosstalk between 3T3-L1 Adipocytes and 4T1 Breast Cancer Cells by Regulating Cytokine Production.

    PubMed

    Hsieh, Chia-Chien; Huang, Yu-Shan

    2016-01-01

    Breast cancer is one of the most common cancers in women worldwide. The obesity process is normally accompanied by chronic, low-grade inflammation. Infiltration by inflammatory cytokines and immune cells provides a favorable microenvironment for tumor growth, migration, and metastasis. Epidemiological evidence has shown that aspirin is an effective agent against several types of cancer. The aim of this study is to investigate the anti-inflammatory and anti-cancer effects of aspirin on 3T3-L1 adipocytes, 4T1 murine breast cancer cells, and their crosstalk. The results showed that aspirin treatment inhibited differentiation and lipid accumulation by 3T3-L1 preadipocytes, and decreased the secretion of the inflammatory adipokine MCP-1 after stimulation with tumor necrosis factor (TNF)-α or conditioned medium from RAW264.7 cells. In 4T1 cells, treatment with aspirin decreased cell viability and migration, possibly by suppressing MCP-1 and VEGF secretion. Subsequently, culture of 4T1 cells in 3T3-L1 adipocyte-conditioned medium (Ad-CM) and co-culture of 3T3-L1 and 4T1 cells using a transwell plate were performed to clarify the relationship between these two cell lines. Aspirin exerted its inhibitory effects in the transwell co-culture system, as well as the conditioned-medium model. Aspirin treatment significantly inhibited the proliferation of 4T1 cells, and decreased the production of MCP-1 and PAI-1 in both the Ad-CM model and co-culture system. Aspirin inhibited inflammatory MCP-1 adipokine production by 3T3-L1 adipocytes and the cell growth and migration of 4T1 cells. It also broke the crosstalk between these two cell lines, possibly contributing to its chemopreventive properties in breast cancer. This is the first report that aspirin's chemopreventive activity supports the potential application in auxiliary therapy against obesity-related breast cancer development. PMID:26794215

  20. Aspirin Breaks the Crosstalk between 3T3-L1 Adipocytes and 4T1 Breast Cancer Cells by Regulating Cytokine Production.

    PubMed

    Hsieh, Chia-Chien; Huang, Yu-Shan

    2016-01-01

    Breast cancer is one of the most common cancers in women worldwide. The obesity process is normally accompanied by chronic, low-grade inflammation. Infiltration by inflammatory cytokines and immune cells provides a favorable microenvironment for tumor growth, migration, and metastasis. Epidemiological evidence has shown that aspirin is an effective agent against several types of cancer. The aim of this study is to investigate the anti-inflammatory and anti-cancer effects of aspirin on 3T3-L1 adipocytes, 4T1 murine breast cancer cells, and their crosstalk. The results showed that aspirin treatment inhibited differentiation and lipid accumulation by 3T3-L1 preadipocytes, and decreased the secretion of the inflammatory adipokine MCP-1 after stimulation with tumor necrosis factor (TNF)-α or conditioned medium from RAW264.7 cells. In 4T1 cells, treatment with aspirin decreased cell viability and migration, possibly by suppressing MCP-1 and VEGF secretion. Subsequently, culture of 4T1 cells in 3T3-L1 adipocyte-conditioned medium (Ad-CM) and co-culture of 3T3-L1 and 4T1 cells using a transwell plate were performed to clarify the relationship between these two cell lines. Aspirin exerted its inhibitory effects in the transwell co-culture system, as well as the conditioned-medium model. Aspirin treatment significantly inhibited the proliferation of 4T1 cells, and decreased the production of MCP-1 and PAI-1 in both the Ad-CM model and co-culture system. Aspirin inhibited inflammatory MCP-1 adipokine production by 3T3-L1 adipocytes and the cell growth and migration of 4T1 cells. It also broke the crosstalk between these two cell lines, possibly contributing to its chemopreventive properties in breast cancer. This is the first report that aspirin's chemopreventive activity supports the potential application in auxiliary therapy against obesity-related breast cancer development.

  1. Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

    PubMed

    Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

    2000-02-01

    ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance. PMID:18944602

  2. Enhanced Virus Resistance in Transgenic Maize Expressing a dsRNA-Specific Endoribonuclease Gene from E. coli

    PubMed Central

    Liu, He; Tian, Lanzhi; Zhang, Aihong; Zhang, Yanjing; Shi, Lindan; Guo, Bihong; Xu, Jin; Duan, Xifei; Wang, Xianbing; Han, Chenggui; Miao, Hongqin; Yu, Jialin; Li, Dawei

    2013-01-01

    Maize rough dwarf disease (MRDD), caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV), the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection. PMID:23593318

  3. Osmotin-expressing transgenic tea plants have improved stress tolerance and are of higher quality.

    PubMed

    Bhattacharya, Amita; Saini, Uksha; Joshi, Robin; Kaur, Devinder; Pal, Awadhesh Kumar; Kumar, Nitish; Gulati, Ashu; Mohanpuria, Prashant; Yadav, Sudesh Kumar; Kumar, Sanjay; Ahuja, Paramvir Singh

    2014-04-01

    Drought is a major stress that affects the yield and quality of tea, a widely consumed beverage crop grown in more than 20 countries of the world. Therefore, osmotin gene-expressing transgenic tea plants produced using earlier optimized conditions were evaluated for their tolerance of drought stress and their quality. Improved tolerance of polyethylene glycol-induced water stress and faster recovery from stress were evident in transgenic lines compared with the normal phenotype. Significant improvements in growth under in-vitro conditions were also observed. Besides enhanced reactive oxygen species-scavenging enzyme activity, the transgenic lines contained significantly higher levels of flavan-3-ols and caffeine, key compounds that govern quality and commercial yield of the beverage. The selected transgenic lines have the potential to meet the demands of the tea industry for stress-tolerant plants with higher yield and quality. These traits of the transgenic lines can be effectively maintained for generations because tea is commercially cultivated through vegetative propagation only.

  4. Targeting gene expression to the female larval fat body of transgenic Aedes aegypti mosquitoes.

    PubMed

    Totten, D C; Vuong, M; Litvinova, O V; Jinwal, U K; Gulia-Nuss, M; Harrell, R A; Beneš, H

    2013-02-01

    As the fat body is a critical tissue for mosquito development, metamorphosis, immune and reproductive system function, the characterization of regulatory modules targeting gene expression to the female mosquito fat body at distinct life stages is much needed for multiple, varied strategies for controlling vector-borne diseases such as dengue and malaria. The hexameric storage protein, Hexamerin-1.2, of the mosquito Aedes atropalpus is female-specific and uniquely expressed in the fat body of fourth instar larvae and young adults. We have identified in the Hex-1.2 gene, a short regulatory module that directs female-, tissue-, and stage-specific lacZ reporter gene expression using a heterologous promoter in transgenic lines of the dengue vector Aedes aegypti. Male transgenic larvae and pupae of one line expressed no Escherichia coli β-galactosidase or transgene product; in two other lines reporter gene activity was highly female-biased. All transgenic lines expressed the reporter only in the fat body; however, lacZ mRNA levels were no different in males and females at any stage examined, suggesting that the gene regulatory module drives female-specific expression by post-transcriptional regulation in the heterologous mosquito. This regulatory element from the Hex-1.2 gene thus provides a new molecular tool for transgenic mosquito control as well as functional genetic analysis in aedine mosquitoes.

  5. Diversity of Transgenic Mouse Models for Selective Targeting of Midbrain Dopamine Neurons

    PubMed Central

    Lammel, Stephan; Steinberg, Elizabeth E.; Földy, Csaba; Wall, Nicholas R.; Beier, Kevin; Luo, Liqun; Malenka, Robert C.

    2015-01-01

    Ventral tegmental area (VTA) dopamine (DA) neurons have been implicated in reward, aversion, salience, cognition, and several neuropsychiatric disorders. Optogenetic approaches involving transgenic Cre-driver mouse lines provide powerful tools for dissecting DA-specific functions. However, the emerging complexity of VTA circuits requires Cre-driver mouse lines that restrict transgene expression to a precisely defined cell population. Because of recent work reporting that VTA DA neurons projecting to the lateral habenula release GABA, but not DA, we performed an extensive anatomical, molecular, and functional characterization of prominent DA transgenic mouse driver lines. We find that transgenes under control of the tyrosine hydroxylase, but not the dopamine transporter, promoter exhibit dramatic non-DA cell-specific expression patterns within and around VTA nuclei. Our results demonstrate how Cre expression in unintentionally targeted cells in transgenic mouse lines can confound the interpretation of supposedly cell-type-specific experiments. This Matters Arising paper is in response to Stamatakis et al. (2013), published in Neuron. See also the Matters Arising Response paper by Stuber et al. (2015), published concurrently with this Matters Arising in Neuron. PMID:25611513

  6. Expression of the whey acidic protein in transgenic pigs impairs mammary development.

    PubMed

    Shamay, A; Pursel, V G; Wilkinson, E; Wall, R J; Hennighausen, L

    1992-05-01

    The whey acidic protein has been found in milk of mice, rats, rabbits and camels, and its gene is expressed specifically in mammary tissue at late pregnancy and throughout lactation. A characteristic of whey acidic protein is the 'four-disulfide-core' signature which is also present in proteins involved in organ development. We have generated six lines of transgenic pigs which carry a mouse whey acidic protein transgene and express it at high levels in their mammary glands. Transgenic sows from three lines could not produce sufficient quantities of milk to support normal development of healthy offspring. This phenotype appears to be similar, if not identical, to the milchlos phenotype exhibited by mice expressing whey acidic protein transgenes. Mammary tissue from post-partum milchlos sows had an immature histological appearance, which was distinct from that observed during normal development or involution. Expression of the whey acidic protein transgene was found in mammary tissue from sexually immature pigs from milchlos lines, but not in sows from lines that appeared to lactate normally. We suggest that precocious synthesis of whey acidic protein impairs mammary development and function. Impaired mammary development due to inappropriate timing of whey acidic protein expression is consistent with the notion that proteins with the 'four-disulfide-core' signature participate in tissue formation. PMID:1284481

  7. Stacking of antimicrobial genes in potato transgenic plants confers increased resistance to bacterial and fungal pathogens.

    PubMed

    Rivero, Mercedes; Furman, Nicolás; Mencacci, Nicolás; Picca, Pablo; Toum, Laila; Lentz, Ezequiel; Bravo-Almonacid, Fernando; Mentaberry, Alejandro

    2012-01-20

    Solanum tuberosum plants were transformed with three genetic constructions expressing the Nicotiana tabacum AP24 osmotine, Phyllomedusa sauvagii dermaseptin and Gallus gallus lysozyme, and with a double-transgene construction expressing the AP24 and lysozyme sequences. Re-transformation of dermaseptin-transformed plants with the AP24/lysozyme construction allowed selection of plants simultaneously expressing the three transgenes. Potato lines expressing individual transgenes or double- and triple-transgene combinations were assayed for resistance to Erwinia carotovora using whole-plant and tuber infection assays. Resistance levels for both infection tests compared consistently for most potato lines and allowed selection of highly resistant phenotypes. Higher resistance levels were found in lines carrying the dermaseptin and lysozyme sequences, indicating that theses proteins are the major contributors to antibacterial activity. Similar results were obtained in tuber infection tests conducted with Streptomyces scabies. Plant lines showing the higher resistance to bacterial infections were challenged with Phytophthora infestans, Rhizoctonia solani and Fusarium solani. Considerable levels of resistance to each of these pathogens were evidenced employing semi-quantitative tests based in detached-leaf inoculation, fungal growth inhibition and in vitro plant inoculation. On the basis of these results, we propose that stacking of these transgenes is a promising approach to achieve resistance to both bacterial and fungal pathogens.

  8. Origin and Spread of Bos taurus: New Clues from Mitochondrial Genomes Belonging to Haplogroup T1

    PubMed Central

    Bonfiglio, Silvia; Ginja, Catarina; De Gaetano, Anna; Achilli, Alessandro; Olivieri, Anna; Colli, Licia; Tesfaye, Kassahun; Agha, Saif Hassan; Gama, Luis T.; Cattonaro, Federica; Penedo, M. Cecilia T; Ajmone-Marsan, Paolo; Torroni, Antonio; Ferretti, Luca

    2012-01-01

    Background Most genetic studies on modern cattle have established a common origin for all taurine breeds in the Near East, during the Neolithic transition about 10 thousand years (ka) ago. Yet, the possibility of independent and/or secondary domestication events is still debated and is fostered by the finding of rare mitochondrial DNA (mtDNA) haplogroups like P, Q and R. Haplogroup T1, because of its geographic distribution, has been the subject of several investigations pointing to a possible independent domestication event in Africa and suggesting a genetic contribution of African cattle to the formation of Iberian and Creole cattle. Whole mitochondrial genome sequence analysis, with its proven effectiveness in improving the resolution of phylogeographic studies, is the most appropriate tool to investigate the origin and structure of haplogroup T1. Methodology A survey of >2200 bovine mtDNA control regions representing 28 breeds (15 European, 10 African, 3 American) identified 281 subjects belonging to haplogroup T1. Fifty-four were selected for whole mtDNA genome sequencing, and combined with ten T1 complete sequences from previous studies into the most detailed T1 phylogenetic tree available to date. Conclusions Phylogenetic analysis of the 64 T1 mitochondrial complete genomes revealed six distinct sub-haplogroups (T1a–T1f). Our data support the overall scenario of a Near Eastern origin of the T1 sub-haplogroups from as much as eight founding T1 haplotypes. However, the possibility that one sub-haplogroup (T1d) arose in North Africa, in domesticated stocks, shortly after their arrival from the Near East, can not be ruled out. Finally, the previously identified “African-derived American" (AA) haplotype turned out to be a sub-clade of T1c (T1c1a1). This haplotype was found here for the first time in Africa (Egypt), indicating that it probably originated in North Africa, reached the Iberian Peninsula and sailed to America, with the first European settlers

  9. Generating Transgenic Mice by Lentiviral Transduction of Spermatozoa Followed by In Vitro Fertilization and Embryo Transfer.

    PubMed

    Chandrashekran, Anil; Casimir, Colin; Dibb, Nick; Readhead, Carol; Winston, Robert

    2016-01-01

    Most transgenic technologies rely on the oocyte as a substrate for genetic modification. Transgenics animals are usually generated by the injection of the gene constructs (including lentiviruses encoding gene constructs or modified embryonic stem cells) into the pronucleus of a fertilized egg followed by the transfer of the injected embryos into the uterus of a foster mother. Male germ cells also have potential as templates for transgenic development. We have previously shown that mature sperm can be utilized as template for lentiviral transduction and as such used to generate transgenic mice efficiently with germ line capabilities. We provide here a detailed protocol that is relatively simple, to establish transgenic mice using lentivirally transduced spermatozoa. This protocol employs a well-established lentiviral gene delivery system (usual for somatic cells) delivering a variety of transgenes to be directly used with sperm, and the subsequent use of these modified sperm in in vitro fertilization studies and embryo transfer into foster female mice, for the establishment of transgenic mice. PMID:27317176

  10. Strain-specific regulation of striatal phenotype in Drd2-eGFP BAC transgenic mice.

    PubMed

    Chan, C Savio; Peterson, Jayms D; Gertler, Tracy S; Glajch, Kelly E; Quintana, Ruth E; Cui, Qiaoling; Sebel, Luke E; Plotkin, Joshua L; Shen, Weixing; Heiman, Myriam; Heintz, Nathaniel; Greengard, Paul; Surmeier, D James

    2012-07-01

    Mice carrying bacterial artificial chromosome (BAC) transgenes have become important tools for neuroscientists, providing a powerful means of dissecting complex neural circuits in the brain. Recently, it was reported that one popular line of these mice--mice possessing a BAC transgene with a D(2) dopamine receptor (Drd2) promoter construct coupled to an enhanced green fluorescent protein (eGFP) reporter--had abnormal striatal gene expression, physiology, and motor behavior. Unlike most of the work using BAC mice, this interesting study relied upon mice backcrossed on the outbred Swiss Webster (SW) strain that were homozygous for the Drd2-eGFP BAC transgene. The experiments reported here were conducted to determine whether mouse strain or zygosity was a factor in the reported abnormalities. As reported, SW mice were very sensitive to transgene expression. However, in more commonly used inbred strains of mice (C57BL/6, FVB/N) that were hemizygous for the transgene, the Drd2-eGFP BAC transgene did not alter striatal gene expression, physiology, or motor behavior. Thus, the use of inbred strains of mice that are hemizygous for the Drd2 BAC transgene provides a reliable tool for studying basal ganglia function.

  11. Expression of human protamine P1 in sperm of transgenic mice

    SciTech Connect

    Wyrobek, A.J.; Keith, C.; Stilwell, J.; Lowe, X.; Anderson, G.

    1994-12-31

    Transgenic mice were produced by pronuclear injection with DNA constructs containing human protamine P1 cDNA recombined with a murine protamine P1 promoter, and were identified by PCR. Expression of human P1 was investigated using huplm, a monoclonal antibody specific for human P1, applied to murine testicular cells, smears of epididymal sperm, and smears of detergent-isolated sperm nuclei. Various antibodies and nontransgenic littermates were used as controls. Two male founders (T3 and T7) sired more than five generations of transgenic offspring each with continued expression of human P1 in their sperm. Transgenic animals appear of normal fertility with sperm of typical nuclear morphology. The human P1 transgene was expressed postmeioticly in both lines, as expected. Nearly 100% of sperm of T3 and T7 hemizygotes labeled with huplm, consistent with complete diffusion of human P1 protein through the intercellular bridge of spermatogenic cells. Human P1 labeling of sperm nuclei was not visibly affected by sonication or by treatment with the detergent MATAB or the reducing agent DTT. A third founder female (T5) showed a transmission pattern consistent with insertion of the transgene into an X chromosome; her transgenic offspring expressed human P1 in only a small fraction of sperm. Human P1 transgenes may serve as efficient targets for germinal mutations and transgenicmice may provide promising models for investigating the DNA complexes.

  12. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

    PubMed

    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E

    2016-01-01

    The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants. PMID:26771455

  13. Hyperplasia and tumours in lung, breast and other tissues in mice carrying a RAR beta 4-like transgene.

    PubMed

    Bérard, J; Gaboury, L; Landers, M; De Repentigny, Y; Houle, B; Kothary, R; Bradley, W E

    1994-12-01

    Transgenic mice were generated which express a truncated nuclear retinoic acid receptor beta (RAR beta), closely resembling the natural isoform RAR beta 4, under the control of the MMTV promoter. The transgene was expressed in salivary gland, testis, lung and mammary tissue in two different lines. At approximately 11-14 months virtually all the transgenic mice showed hyperplasia of the lung alveolar epithelium with an excess of type II pneumocytes. Hyperplasia of the mammary alveoli and terminal ducts was also seen in some females. Salivary glands and some sebaceous glands were hyperplastic in most male transgenic mice, but only rarely in females or in non-transgenics. Primary benign and malignant tumours were more numerous in transgenic mice than in controls, with a total of 23 in 43 mice versus two in 33 non-transgenic animals. Treatment with dexamethasone to increase transgene expression resulted in exaggerated versions of the above phenotypes. Overexpression of RAR beta 4 therefore appears to predispose various tissues to hyperplasia and neoplasia, and this by contrast to the RAR beta 2 isoform, which has tumour suppressor activity. A survey of ratios of RAR beta 4:RAR beta 2 expression in human lung tumour cell lines showed an increase compared with normal lung tissue, suggesting that RAR beta 4 may play a similar role in human tumorigenesis.

  14. BMP treatment of C3H10T1/2 mesenchymal stem cells induces both chondrogenesis and osteogenesis.

    PubMed

    Shea, Colleen M; Edgar, Cory M; Einhorn, Thomas A; Gerstenfeld, Louis C

    2003-12-15

    The molecular mechanisms by which bone morphogenetic proteins (BMPs) promote skeletal cell differentiation were investigated in the murine mesenchymal stem cell line C3H10T1/2. Both BMP-7 and BMP-2 induced C3H10T1/2 cells to undergo a sequential pattern of chondrogenic followed by osteogenic differentiation that was dependent on both the concentration and the continuous presence of BMP in the growth media. Differentiation was determined by the expression of chondrogenesis and osteogenesis associated matrix genes. Subsequent experiments using BMP-7 demonstrated that withdrawal of BMP from the growth media led to a complete loss of skeletal cell differentiation accompanied by adipogenic differentiation of these cells. Continuous treatment with BMP-7 increased the expression of Sox9, Msx 2, and c-fos during the periods of chondrogenic differentiation after which point their expression decreased. In contrast, Dlx 5 expression was induced by BMP-7 treatment and remained elevated throughout the time-course of skeletal cell differentiation. Runx2/Cbfa1 was not detected by ribonuclease protection assay (RPA) and did not appear to be induced by BMP-7. The sequential nature of differentiation of chondrocytic and osteoblastic cells and the necessity for continuous BMP treatment to maintain skeletal cell differentiation suggests that the maintenance of selective differentiation of the two skeletal cell lineages might be dependent on BMP-7-regulated expression of other morphogenetic factors. An examination of the expression of Wnt, transforming growth factor-beta (TGF-beta), and the hedgehog family of morphogens showed that Wnt 5b, Wnt 11, BMP-4, growth and differentiation factor-1 (GDF-1), Sonic hedgehog (Shh), and Indian hedgehog (Ihh) were endogenously expressed by C3H10T1/2 cells. Wnt 11, BMP-4, and GDF-1 expression were inhibited by BMP-7 treatment in a dose-dependent manner while Wnt 5b and Shh were selectively induced by BMP-7 during the period of chondrogenic

  15. Response of transgenic poplar overexpressing cytosolic glutamine synthetase to phosphinothricin.

    PubMed

    Pascual, María Belén; Jing, Zhong Ping; Kirby, Edward G; Cánovas, Francisco M; Gallardo, Fernando

    2008-01-01

    of GS transgenic poplar plantlets was 5-fold greater than controls. The response of young leaves to PPT treatment depends on physiological state as indicated by GS and Rubisco (LSU) levels. Young leaves from control plants, typically in a low differentiation state, respond to the herbicide showing up-regulation of GS and LSU. In contrast, young leaves from transgenic lines, with higher initial GS and LSU levels compared to control, display up-regulation of NADP(+)-isocitrate dehydrogenase. Differences between control and GS transgenics in their response to PPT are discussed in relation to their differences in photosynthetic and photorespiratory capacities (El-Khatib et al., 2004).

  16. Matrix-attachment regions can impart position-independent regulation of a tissue-specific gene in transgenic mice.

    PubMed

    McKnight, R A; Shamay, A; Sankaran, L; Wall, R J; Hennighausen, L

    1992-08-01

    Matrix-attachment regions (MARs) may function as domain boundaries and partition chromosomes into independently regulated units. We have tested whether MAR sequences from the chicken lysozyme locus, the so-called A-elements, can confer position-independent regulation to a whey acidic protein (WAP) transgene in mammary tissue of mice. In the absence of MARs, expression of WAP transgenes was observed in 50% of the lines, and regulation during pregnancy, during lactation, and upon hormonal induction did not mimic that of the endogenous WAP gene and varied with the integration site. In contrast, all 11 lines in which WAP transgenes were juxtaposed to MAR elements showed expression. Accurate position-independent hormonal and developmental regulation was seen in four out of the five lines analyzed. These results indicate that MARs can establish independent genetic domains in transgenic mice. PMID:1495984

  17. Comparative analysis of transgenic tall fescue (Festuca arundinacea Schreb.) plants obtained by Agrobacterium-mediated transformation and particle bombardment.