Sample records for t1 transgenic lines

  1. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A two-year field trial was conducted to assess the impacts of two transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. The arthropods were classified into five guilds, including herbivores, parasitoids, predators...

  2. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.


    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y


    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields. PMID:25203669

  3. Cryopreservation of Xenopus transgenic lines.


    Buchholz, Daniel R; Fu, Liezhen; Shi, Yun-Bo


    Xenopus laevis has been widely used for molecular, cellular, and developmental studies. With the development of the sperm-mediated transgenic method, it is now possible to study gene function during vertebrate development by using this popular model. On the other hand, like other animal species, it is labor intensive, and the maintenance of transgenic lines is expensive. In this article, we investigated the possibility of using sperm-cryopreservation as a means to preserve transgenic frog lines. We demonstrated that cryopreserved sperms are viable but not fertile under our in vitro fertilization (IVF) conditions. However, by microinjecting cryopreserved sperm nuclei, we successfully regenerated a transgenic line carrying a double promoter transgene construct, where the marker gene encoding the green fluorescent protein (GFP) is driven by the gamma-crystallin gene promoter and a gene of interest, encoding a fusion protein of GFP with the matrix metalloproteinase stromelysin-3 (ST3-GFP), is driven by a heat shock-inducible promoter. We demonstrated the functional transmission of the ST3-GFP transgene by analyzing the phenotype of the F1 animals after heat-shock to induce its expression. Our method thus provides an inexpensive means to preserve transgenic frog lines and a convenient way for distribution of transgenic lines. Furthermore, the ease with which to microinject nuclei compared to the technically demanding transgenesis procedure with variable outcome should facilitate more laboratories to use transgenic Xenopus laevis for functional studies in vivo. Mol. Reprod. Dev. 67: 65-69, 2004. PMID:14648875

  4. Cryopreservation of transgenic mouse lines.


    Pomeroy, K O


    A transgenic animal represents an enormous investment in time and money. Animals can be destroyed through disease, fire, malfuncnons in the control of the environment, negligence, sabotage, or accidental disposal. Researchers can protect valuable transgenic lines from accrdental destruction by "banking" them in liquid nitrogen. Cryopreservation can also reduce animal costs by decreasing the number of live animals investigators must maintain. Often, when one is trying to produce a transgenic animal, some lines will be derived that may not initially appear interesting. These animals can be stored in liquid nitrogen for future recovery and study. The maintenance of just one line of mice, say 25 mice at 15 cents/d, can cost over $1000 (US) in a single year. PMID:21390665

  5. Transgenic cry1C(⁎) gene rough rice line T1C-19 does not change the host preferences of the non-target stored product pest, Rhyzopertha dominica (Fabricius) (Coleoptera: Bostrichidae), and its parasitoid wasp, Anisopteromalus calandrae (Howard) (Hymenoptera: Pteromalidae).


    Sun, Xiao; Yan, Miao-Jun; Zhang, Aijun; Wang, Man-Qun


    Rough rice grains are often stored for extended periods before they are used or consumed. However, during storage, the rough rice is vulnerable to insect infestation, resulting in significant economic loss. Previous studies have shown that volatiles cues, physical characteristics, and taste chemicals on the grains could be the important key behavior factors for storage insect pests to locate the hosts and select oviposition sites. It is also well known that the transgenic Bt rough rice line T1C-19, which expresses a cry1C(⁎) gene has a high resistance to Lepidoptera pests. However, there were no evidences to show the consequences of host preference for non-target insect pests after growing Bt transgenic rice. In this study, the potential key factors of Bt rough rice were investigated for their impacts on the behaviors of non-target pest lesser grain borer Rhyzopertha dominica, the main weevil pest of grain and its parasitic wasps Anisopteromalus calandrae, the natural enemy of the beetle. Both electronic nose and electronic tongue analyses showed that the parameters of Bt rough rice were analogous to those of the non-Bt rough rice. The volatile profiles of Bt and non-Bt rough rice examined by gas chromatographic mass spectrometry (GC-MS) were similar. For most volatile compounds, there were no significantly quantitative differences in compound quantities between Bt and non-Bt rough rice. The densities of sclereids and trichomes on the rough rice husk surface were statistically equal in Bt and non-Bt rough rice. The non-target pest, R. dominica, and its parasitoid wasp, A. calandrae, were attracted to both rough rice and could not distinguish the transgenic T1C-19 from the isogenic rough rice. These results demonstrated that Bt rough rice has no negative impacts on the host preference behaviors of non-target stored product pest R. dominica and its parasitoid A. calandrae. PMID:26150137

  6. Interhospital CT image communication: T-1 line versus courier service

    NASA Astrophysics Data System (ADS)

    Lou, Shyhliang A.; Huang, H. K.; Bazzill, Todd M.; Gould, Robert G.; Dillon, William P.; Schomer, Barbara G.


    The Mount Zion Hospital (MZH) in San Francisco, Calif. is associated with the University of California at San Francisco (UCSF) medical center. These hospitals are approximately two miles apart. The UCSF radiology department supports specialty image reading for MZH daily. The major issue involved with this service is the access of patient images. Currently, the patient image access is through two ways: (1) inter-hospital travel, and (2) image delivery. Both methods are neither efficient nor economic. If patient images can be transferred from MZH to UCSF to be viewed in digital form in a reasonable time period, the issue of patient image accession can be resolved. This study attempts to use an available digital communication technology, a T-1 line, to verify this hypothesis. The study is centered on the comparison between the T-1 line and courier service with respect to cost and image delivery performance. This comparison study focuses on CT images with an emphasis on neuroradiology application.

  7. 2008 FHB Analysis of Transgenic Barley Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenic lines have been developed with the goal of reducing FHB and DON in barley. Replicated field trials for FHB reaction of 48 Conlon transgenic lines were conducted in 2008 in Langdon, ND and Rosemount, MN. The Langdon trials consisted of three replicates in hill plots in an inoculated misted...

  8. Transgenic American chestnuts show enhanced blight resistance and transmit the trait to T1 progeny.


    Newhouse, Andrew E; Polin-McGuigan, Linda D; Baier, Kathleen A; Valletta, Kristia E R; Rottmann, William H; Tschaplinski, Timothy J; Maynard, Charles A; Powell, William A


    American chestnut (Castanea dentata) is a classic example of a native keystone species that was nearly eradicated by an introduced fungal pathogen. This report describes progress made toward producing a fully American chestnut tree with enhanced resistance to the blight fungus (Cryphonectria parasitica). The transgenic American chestnut 'Darling4,' produced through an Agrobacterium co-transformation procedure to express a wheat oxalate oxidase gene driven by the VspB vascular promoter, shows enhanced blight resistance at a level intermediate between susceptible American chestnut and resistant Chinese chestnut (Castanea mollissima). Enhanced resistance was identified first with a leaf-inoculation assay using young chestnuts grown indoors, and confirmed with traditional stem inoculations on 3- and 4-year-old field-grown trees. Pollen from 'Darling4' and other events was used to produce transgenic T1 seedlings, which also expressed the enhanced resistance trait in leaf assays. Outcrossed transgenic seedlings have several advantages over tissue-cultured plantlets, including increased genetic diversity and faster initial growth. This represents a major step toward the restoration of the majestic American chestnut. PMID:25438789

  9. Expression of an endochitinase gene from Trichoderma virens confers enhanced tolerance to Alternaria blight in transgenic Brassica juncea (L.) czern and coss lines.


    Kamble, Suchita; Mukherjee, Prasun K; Eapen, Susan


    An endochitinase gene 'ech42' from the biocontrol fungus 'Trichoderma virens' was introduced to Brassica juncea (L). Czern and Coss via Agrobaterium tumefaciens mediated genetic transformation method. Integration and expression of the 'ech42' gene in transgenic lines were confirmed by PCR, RT-PCR and Southern hybridization. Transgenic lines (T1) showed expected 3:1 Mendelian segregation ratio when segregation analysis for inheritance of transgene 'hpt' was carried out. Fluorimetric analysis of transgenic lines (T0 and T1) showed 7 fold higher endochitinase activity than the non-transformed plant. Fluorimetric zymogram showed presence of endochitinase (42 kDa) in crude protein extract of transgenic lines. In detached leaf bioassay with fungi Alternaria brassicae and Alternaria brassicicola, transgenic lines (T0 and T1) showed delayed onset of lesions as well as 30-73 % reduction in infected leaf area compared to non-transformed plant. PMID:27186020

  10. Field tests of transgenic barley lines in North Dakota

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Testing transgenic barley lines for FHB in the greenhouse does not necessarily give the same results as field tests. The objective of this project was to test 18 transgenic lines in replicated trials in an inoculated FHB nursery. Several programs have developed barley lines expressing anti-fungal a...

  11. Response of sensitive human ataxia and resistant T-1 cell lines to accelerated heavy ions

    SciTech Connect

    Tobias, C.A.; Blakely, E.A.; Chang, P.Y.; Lommel, L.; Roots, R.


    The radiation dose responses of fibroblast from a patient with Ataxia telangiectasis (AT-2SF) and an established line of human T-1 cells were studied. Nearly monoenergetic accelerated neon and argon ions were used at the Berkeley Bevalac with various residual range values. The LET of the particles varied from 30 keV/ to over 1000 keV/ All Ataxia survival curves were exponential functions of the dose. Their radiosensitivity reached peak values at 100 to 200 keV/ Human T-1 cells have effective sublethal damage repair as has been evidenced by split dose experiments, and they are much more resistant to low LET than to high LET radiation. The repair-misrepair model has been used to interpret these results. We have obtained mathematical expressions that describe the cross sections and inactivation coefficients for both human cell lines as a function of the LET and the type of particle used. The results suggest either that high-LET particles induce a greater number of radiolesions per track or that heavy-ions at high LET induce lesions that kill cells more effectively and that are different from those produced at low LET. We assume that the lesions induced in T-1 and Ataxia cells are qualitatively similar and that each cell line attempts to repair these lesions. The result in most irradiated Ataxia cells, however, is either lethal misrepair or incomplete repair leading to cell death. 63 references, 10 figures, 1 table.

  12. Calcium signaling properties of a thyrotroph cell line, mouse TαT1 cells.


    Tomić, Melanija; Bargi-Souza, Paula; Leiva-Salcedo, Elias; Nunes, Maria Tereza; Stojilkovic, Stanko S


    T1 cells are mouse thyrotroph cell line frequently used for studies on thyroid-stimulating hormone beta subunit gene expression and other cellular functions. Here we have characterized calcium-signaling pathways in TαT1 cells, an issue not previously addressed in these cells and incompletely described in native thyrotrophs. TαT1 cells are excitable and fire action potentials spontaneously and in response to application of thyrotropin-releasing hormone (TRH), the native hypothalamic agonist for thyrotrophs. Spontaneous electrical activity is coupled to small amplitude fluctuations in intracellular calcium, whereas TRH stimulates both calcium mobilization from intracellular pools and calcium influx. Non-receptor-mediated depletion of intracellular pool also leads to a prominent facilitation of calcium influx. Both receptor and non-receptor stimulated calcium influx is substantially attenuated but not completely abolished by inhibition of voltage-gated calcium channels, suggesting that depletion of intracellular calcium pool in these cells provides a signal for both voltage-independent and -dependent calcium influx, the latter by facilitating the pacemaking activity. These cells also express purinergic P2Y1 receptors and their activation by extracellular ATP mimics TRH action on calcium mobilization and influx. The thyroid hormone triiodothyronine prolongs duration of TRH-induced calcium spikes during 30-min exposure. These data indicate that TαT1 cells are capable of responding to natively feed-forward TRH signaling and intrapituitary ATP signaling with acute calcium mobilization and sustained calcium influx. Amplification of TRH-induced calcium signaling by triiodothyronine further suggests the existence of a pathway for positive feedback effects of thyroid hormones probably in a non-genomic manner. PMID:26453278

  13. Making BAC transgene constructs with lambda-red recombineering system for transgenic animals or cell lines.


    Holmes, Scott; Lyman, Suzanne; Hsu, Jen-Kang; Cheng, JrGang


    The genomic DNA libraries based on Bacteria Artificial Chromosomes (BAC) are the foundation of whole genomic mapping, sequencing, and annotation for many species like mice and humans. With their large insert size, BACs harbor the gene-of-interest and nearby transcriptional regulatory elements necessary to direct the expression of the gene-of-interest in a temporal and cell-type specific manner. When replacing a gene-of-interest with a transgene in vivo, the transgene can be expressed with the same patterns and machinery as that of the endogenous gene. This chapter describes in detail a method of using lambda-red recombineering to make BAC transgene constructs with the integration of a transgene into a designated location within a BAC. As the final BAC construct will be used for transfection in cell lines or making transgenic animals, specific considerations with BAC transgenes such as genotyping, BAC coverage and integrity as well as quality of BAC DNA will be addressed. Not only does this approach provide a practical and effective way to modify large DNA constructs, the same recombineering principles can apply to smaller high copy plasmids as well as to chromosome engineering. PMID:25239742

  14. Host status of three transgenic plum lines to Mesocriconema xenoplax

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gastrodianin anti-fungal protein (GAFP) increases tolerance against Phytophthora root rot and root knot nematode (Meloidogyne incognita) in transgenic plum lines. However, nothing is known about the potential of GAFP lectin to confer resistance to the ring nematode Mesocriconema xenoplax. Three t...

  15. Accumulation of nickel in transgenic tobacco

    NASA Astrophysics Data System (ADS)

    Sidik, Nik Marzuki; Othman, Noor Farhan


    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TF<1) at all levels of metal treatment. Among the 4 transgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  16. Case Study: Polycystic Livers in a Transgenic Mouse Line

    SciTech Connect

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.


    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  17. Generation and characterization of transgenic plum lines expressing gafp-1 with the bul409 promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Gastrodia anti fungal protein (GAFP-1) is a mannose-binding lectin that can confer increased disease resistance in transgenic tobacco and plum. In all previously-generated transgenic lines, the gene was under the control of the 35SCaMV promoter. In this study, transgenic plum lines were create...

  18. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer.


    Silva, Vera L; Ferreira, Debora; Nobrega, Franklin L; Martins, Ivone M; Kluskens, Leon D; Rodrigues, Ligia R


    The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line- 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 -CPTASNTSC and 4T1pep2-EVQSSKFPAHVS) were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy. PMID:27548261

  19. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer

    PubMed Central

    Nobrega, Franklin L.; Martins, Ivone M.


    The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line– 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 –CPTASNTSC and 4T1pep2—EVQSSKFPAHVS) were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy. PMID:27548261

  20. Transgenic Arabidopsis tester lines with dominant marker genes.


    Van Lijsebettens, M; Wang, X; Cnops, G; Boerjan, W; Desnos, T; Höfte, H; Van Montagu, M


    The map positions of a set of eight T-DNA insertions in the Arabidopsis genome have been determined by using closely linked visible markers. The insertions are dispersed over four of the five chromosomes. Each T-DNA insert contains one or more of the chimeric marker genes neomycin phosphotransferase (neo), hygromycin phosphotransferase (hpt), phosphinothricin acetyltransferase (bar), beta-glucuronidase (gusA) and indole-3-acetamide hydrolase (iaaH). The neo, hpt and bar marker genes are dominant in a selective germination assay or when used as DNA markers in a polymerase chain reaction. These dominant markers will allow recombinants to be discerned in a germinating F2 population, one generation earlier than with a conventional recessive marker. The transgenic marker lines will speed up and simplify the isolation of recombinants in small genetic intervals, a rate-limiting step in positional cloning strategies. The transgenic lines containing the hpt marker will also be of interest for the isolation of deletion mutants at the T-DNA integration sites. PMID:8676880

  1. Case Study: Polycystic Livers in a Transgenic Mouse Line

    PubMed Central

    Lovaglio, Jamie; Artwohl, James E; Ward, Christopher J; Diekwisch, Thomas GH; Ito, Yoshihiro; Fortman, Jeffrey D


    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with polycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site. PMID:24674586

  2. Transgenic cell lines for detection of animal viruses.

    PubMed Central

    Olivo, P D


    Rapid diagnostic assays based on direct detection of viral antigen or nucleic acid are being used with increasing frequency in clinical virology laboratories. Virus culture, however, remains the only way to detect infectious virus and to analyze clinically relevant viral phenotypes, such as drug resistance. Growth of viruses in cell culture is labor intensive and time-consuming and requires the use of many different cell lines. Transgenic technology, together with increasing knowledge of the molecular pathways of virus replication, offers the possibility of using genetically modified cell lines to improve virus growth in cell culture and to facilitate detection of virus-infected cells. Genetically modifying cells so that they express a reporter gene only after infection with a specific virus can allow the detection of infectious virus by rapid and simple enzyme assays such as beta-galactosidase assays without the need for antibodies. Although transgenic cells have recently been successfully used for herpes simplex virus detection, much more work needs to be done to adapt this technology to other human viral pathogens such as cytomegalovirus and respiratory viruses. This review offers some strategies for applying this technology to a wide spectrum of animal viruses. PMID:8809463

  3. Generation of Doubled Haploid Transgenic Wheat Lines by Microspore Transformation

    PubMed Central

    Liu, Weiguo; Konzak, Calvin F.; von Wettstein, Diter; Rustgi, Sachin


    Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i) pretreatment of immature spikes with CuSO4 solution (500 mg/L) at 4°C for 10 days; (ii) electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii) induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv) co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v) elimination of AGL-1 cells after co-cultivation with timentin (200–400 mg/L). PMID:24260351

  4. Ectopic transgene expression in the retina of four transgenic mouse lines.


    Gábriel, Robert; Erdélyi, Ferenc; Szabó, Gábor; Lawrence, J Josh; Wilhelm, Márta


    Retinal expression of transgenes was examined in four mouse lines. Two constructs were driven by the choline acetyltransferase (ChAT) promoter: green fluorescent protein conjugated to tau protein (tau-GFP) or cytosolic yellow fluorescent protein (YFP) generated through CRE recombinase-induced expression of Rosa26 (ChAT-CRE/Rosa26YFP). Two other constructs targeted inhibitory interneurons: GABAergic horizontal and amacrine cells identified by glutamic acid decarboxylase (GAD65-GFP) or parvalbumin (PV) cells (PV-CRE/Rosa26YFP). Animals were transcardially perfused and retinal sections prepared. Antibodies against PV, calretinin (CALR), calbindin (CALB), and tyrosine hydroxylase (TH) were used to counterstain transgene-expressing cells. In PVxRosa and ChAT-tauGFP constructs, staining appeared in vertically oriented row of processes resembling Müller cells. In the ChATxRosa construct, populations of amacrine cells and neurons in the ganglion cell layer were labeled. Some cones also exhibited GFP fluorescence. CALR, PV and TH were found in none of these cells. Occasionally, we found GFP/CALR and GFP/PV double-stained cells in the ganglion cell layer (GCL). In the GAD65-GFP construct, all layers of the neuroretina were labeled, except photoreceptors. Not all horizontal cells expressed GFP. We did not find GFP/TH double-labeled cells and GFP was rarely present in CALR- and CALB-containing cells. Many PV-positive neurons were also labeled for GFP, including small diameter amacrines. In the GCL, single labeling for GFP and PV was ascertained, as well as several CALR/PV double-stained neurons. In the GCL, cells triple labeled with GFP/CALR/CALB were sparse. In conclusion, only one of the four transgenic constructs exhibited an expression pattern consistent with endogenous retinal protein expression, while the others strongly suggested ectopic gene expression. PMID:26563404

  5. In vivo immunomodulatory effects of Antrodia camphorata polysaccharides in a T1/T2 doubly transgenic mouse model for inhibiting infection of Schistosoma mansoni

    SciTech Connect

    Cheng, P.-C.; Hsu, C.-Y.; Chen, C.-C.; Lee, K.-M.


    Antrodia camphorata (A. camphorata) is a fungus commonly used for treatment of viral hepatitis and cancer in Chinese folk medicine. Extract of A. camphorate is reported to possess anti-inflammatory, antihepatitis B virus and anticancer activities. In this study, we tested the in vivo effects of polysaccharides derived from A. camphorata (AC-PS) on immune function by detection of cytokine expression and evaluation of the immune phenotype in a T1/T2 doubly transgenic mouse model. The protective effect of AC-PS in mice was tested by infection with Schistosoma mansoni. The induction of large amounts of IFN-{gamma}, IL-2 and TNF-a mRNA were detected after 2 and 4 weeks of oral AC-PS administration in BALB/c and C57BL/6 mice. In transgenic mice, 3 to 6 weeks of oral AC-PS administration increased the proportion of CD4{sup +} T cells and B cells within the spleen. More specifically, there was an increase of Th1 CD4{sup +} T cells and Be1 cells among spleen cells as observed by detection the of Type1/Type2 marker molecules. By using a disease model of parasitic infection, we found that AC-PS treatment inhibited infection with S. mansoni in BALB/C and C57BL/6 mice. AC-PS appears to influence the immune system of mice into developing Th1 responses and have potential for preventing infection with S. mansoni.

  6. Metal mutagenesis in transgenic Chinese hamster cell lines.

    PubMed Central

    Klein, C B; Kargacin, B; Su, L; Cosentino, S; Snow, E T; Costa, M


    Metals are toxic agents for which genotoxic effects are often difficult to demonstrate. To study metal mutagenesis, we have used two stable hprt/gpt+ transgenic cell lines that were derived from Chinese hamster V79 cells. Both the G12 and G10 cell lines are known to be very sensitive to clastogens such as X-rays and bleomycin, with the mutagenic response of the integrated xanthine guanine phosphoribosyl transferase (gpt) gene in G10 usually exceeding that of the same gene in the transgenic G12 cells. In studies with carcinogenic insoluble nickel compounds, a high level of mutagenesis was found at the gpt locus of G12 cells but not at the endogenous hypoxanthine phosphoribosyl transferase (hprt) locus of V79 cells. We have since demonstrated the similar recovery of a high frequency of viable G12 mutants with other insoluble nickel salts including nickel oxides (black and green). The relative mutant yield for the insoluble nickel compounds (G12 > G10) is the opposite of that obtained with nonmetal clastogens (G10 > G12). In the G12 cells, nickel mutagenesis may be related to the integration of the gpt sequence into a heterochromatic region of the genome. For some of the insoluble nickel compounds, significant inhibition of both cytotoxicity and mutant yield resulted when the G12 cells were pretreated with vitamin E. In comparison with the nickel studies, the mutagenic responses to chromium compounds in these cell lines were not as dramatic. Mutagenesis of the gpt target could not be demonstrated with other metals such as mercury or vanadium. PMID:7843139

  7. Development of Transgenic Cotton Lines Expressing Allium sativum Agglutinin (ASAL) for Enhanced Resistance against Major Sap-Sucking Pests

    PubMed Central

    Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao


    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1–2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects. PMID:24023750

  8. Detection of hepatocellular carcinoma in transgenic mice by Gd-DTPA- and rhodamine 123-conjugated human serum albumin nanoparticles in T1 magnetic resonance imaging.


    Watcharin, Waralee; Schmithals, Christian; Pleli, Thomas; Köberle, Verena; Korkusuz, Hüdayi; Hübner, Frank; Waidmann, Oliver; Zeuzem, Stefan; Korf, Horst-Werner; Terfort, Andreas; Gelperina, Svetlana; Vogl, Thomas J; Kreuter, Jörg; Piiper, Albrecht


    Nanoparticle (NP)-based contrast agents that enable high resolution anatomic T1-weighted magnetic resonance imaging (MRI) offer the prospect of improving differential diagnosis of liver tumors such as hepatocellular carcinoma (HCC). In the present study, we investigated the possibility of employing novel non-toxic human serum albumin nanoparticles conjugated with Gd-DTPA and rhodamine 123 (Gd-Rho-HSA-NPs) for the detection of HCC by T1-weighted MRI. In addition, the influence of surface coating of the NPs with poloxamine 908, which alters the absorptive behavior of NPs and changes their distribution between the liver and tumor was examined. MRI of transgenic mice with endogenously formed HCCs following intravenous injection of Gd-Rho-HSA-NPs revealed a strong negative contrast of the tumors. Contrasting of the HCCs by NP-enhanced MRI required less Gd as compared to gadolinium-ethoxybenzyl-diethylenetriaminepentaacetic acid-enhanced MRI, which currently provides the most sensitive detection of HCC in patients. Immunohistochemical analyses revealed that the Gd-Rho-HSA-NPs were localized to macrophages, which were - similar to HCC in patients - fewer in number in HCC as compared to the liver tissue, which is in agreement with the negative contrasting of HCC in Gd-Rho-HSA-NP-enhanced MRI. Poloxamine-coated NPs showed lower accumulation in the tumor macrophages and caused a longer lasting enhancement of the MRI signal. These data indicate that Gd-Rho-HSA-NPs enable sensitive detection of HCC by T1-weighted MRI in mice with endogenous HCC through their uptake by macrophages. Poloxamine coating of the NPs delayed the tumor localization of the NPs. PMID:25499552

  9. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  10. Stripe rust resistance and dough quality of new wheat - Dasypyrum villosum translocation lines T1DL•1V#3S and T1DS•1V#3L and the location of HMW-GS genes.


    Zhao, W C; Gao, X; Dong, J; Zhao, Z J; Chen, Q G; Chen, L G; Shi, Y G; Li, X Y


    The transfer of agronomically useful genes from wild wheat species into cultivated wheat is one of the most effective approaches to improvement of wheat varieties. To evaluate the transfer of genes from Dasypyrum villosum into Triticum aestivum, wheat quality and disease resistance was evaluated in two new translocation lines, T1DL•1V#3S and T1DS•1V#3L. We examined the levels of stripe rust resistance and dough quality in the two lines, and identified and located the stripe rust resistant genes and high molecular weight glutenin subunit (HMW-GS) genes Glu-V1 of D. villosum. Compared to the Chinese Spring (CS) variety, T1DL•1V#3S plants showed moderate resistance to moderate susceptibility to the stripe rust races CYR33 and Su11-4. However, T1DS•1V#3L plants showed high resistance or immunity to these stripe rusts. The genes for resistance to stripe rust were located on 1VL of D. villosum. In comparison to CS, the dough from T1DS•1V#3L had a significantly shorter developing time (1.45 min) and stable time (1.0 min), a higher weakness in gluten strength (208.5 FU), and a lower farinograph quality index (18). T1DL•1V#3S had a significantly longer developing time (4.2 min) and stable time (5.25 min), a lower weakness in gluten strength (53 FU) and a higher farinograph quality index (78.5). We also found that T1DS•1V#3L had reduced gluten strength and dough quality compared to CS, but T1DL•1V#3S had increased gluten strength and dough quality. The results of SDS-PAGE analysis indicated that Glu-V1 of D. villosum was located on short arm 1VS and long arm 1VL. These results prove that the new translocation lines, T1DS•1V#3L and T1DS•1V#3L, have valuable stripe rust resistance and dough quality traits that will be important for improving wheat quality and resistance in future wheat breeding programs. PMID:26214490

  11. Changes in the protein expression profiles of the Hepa-T1 cell line when exposed to Cu2+.


    Chen, Dong-Shi; Chan, King Ming


    Copper is an essential element in a variety of biological processes, but it can be toxic when present in excessive amounts. The central regulators of cellular copper metabolism include copper-binding proteins, copper transporters, metal membrane active transporters and copper-dependent enzymes. However, the way in which cupric ions (Cu(2+)) cause cellular changes in proteins and lead to toxic effects is less well-known. The aim of this study is to identify the proteins related to Cu(2+) toxicity or detoxification mechanisms in tilapia (Oreochromis niloticus) using a proteomic approach. A cell line derived from the liver of tilapia, Hepa-T1, was used as a model and exposed to two sub-lethal concentrations of waterborne copper for 96 h. The proteins expressed in Hepa-T1 were investigated by differential protein profiling using two-dimensional gel electrophoresis (2DE). It was found that Cu(2+) (120 and 300 microM) caused the differential expression of 93 different proteins, 18 of which were further verified by real-time quantitative polymerase chain reaction (PCR) analysis. Following analysis with ingenuity pathway software, several proteins were found to be involved in lipid metabolism, tissue connective development and cell cycle control, thus indicating that copper toxicity affects these cellular functions. PMID:19616320

  12. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans.

    PubMed Central

    Praitis, V; Casey, E; Collar, D; Austin, J


    In Caenorhabditis elegans, transgenic lines are typically created by injecting DNA into the hermaphrodite germline to form multicopy extrachromosomal DNA arrays. This technique is a reliable means of expressing transgenes in C. elegans, but its use has limitations. Because extrachromosomal arrays are semistable, only a fraction of the animals in a transgenic extrachromosomal array line are transformed. In addition, because extrachromosomal arrays can contain hundreds of copies of the transforming DNA, transgenes may be overexpressed, misexpressed, or silenced. We have developed an alternative method for C. elegans transformation, using microparticle bombardment, that produces single- and low-copy chromosomal insertions. Using this method, we find that it is possible to create integrated transgenic lines that reproducibly express GFP reporter constructs without the variations in expression level and pattern frequently exhibited by extrachromosomal array lines. In addition, we find that low-copy integrated lines can also be used to express transgenes in the C. elegans germline, where conventional extrachromosomal arrays typically fail to express due to germline silencing. PMID:11238406

  13. Heat treatment results in a loss of transgene-encoded activities in several tobacco lines.

    PubMed Central

    Neumann, K; Dröge-Laser, W; Köhne, S; Broer, I


    Heat treatment (37 degrees C) of transgenic tobacco (Nicotiana tabacum) plants led to a reversible reduction or complete loss of transgene-encoded activities in about 40% of 10 independent transformants carrying the luciferase-coding region fused to the 355 cauliflower mosaic virus or the soybean small subunit promoter and the nopaline synthase promoter driving the neomycin phosphotransferase gene, whereas the other lines had temperature-tolerant activities. Temperature sensitivity or tolerance of transgene-encoded activities was heritable. In some of the lines, temperature sensitivity of the transgene-encoded activities depended on the stage of development, occurring in either seedlings (40% luciferase and 50% neomycin phosphotransferase) or adult plants (both 40%). The phenomenon did not correlate with copy numbers or the homo- or hemizygous state of the transgenes. In lines harboring a temperature-sensitive luciferase activity, reduction of bioluminescence was observed after 2 to 3 h at 37 degrees C. Activity was regained after 2 h of subsequent cultivation at 25 degrees C. Irrespective of the reaction to the heat treatment, the level of luciferase RNA was slightly increased at 37 degrees C. Only in lines showing temperature sensitivity of transgene-encoded activities was the amount of luciferase and neomycin phosphotransferase strongly reduced. In sterile culture, heat treatment for 15 d did not cause visible damage or changes in plant morphology. In all plants tested a slight induction of the heat-shock response was observed at 37 degrees C. PMID:9390430

  14. Generation of Transgenic Porcine Fibroblast Cell Lines Using Nanomagnetic Gene Delivery Vectors.


    Grześkowiak, Bartosz F; Hryhorowicz, Magdalena; Tuśnio, Karol; Grzeszkowiak, Mikołaj; Załęski, Karol; Lipiński, Daniel; Zeyland, Joanna; Mykhaylyk, Olga; Słomski, Ryszard; Jurga, Stefan; Woźniak, Anna


    The transgenic process allows for obtaining genetically modified animals for divers biomedical applications. A number of transgenic animals for xenotransplantation have been generated with the somatic cell nuclear transfer (SCNT) method. Thereby, efficient nucleic acid delivery to donor cells such as fibroblasts is of particular importance. The objective of this study was to establish stable transgene expressing porcine fetal fibroblast cell lines using magnetic nanoparticle-based gene delivery vectors under a gradient magnetic field. Magnetic transfection complexes prepared by self-assembly of suitable magnetic nanoparticles, plasmid DNA, and an enhancer under an inhomogeneous magnetic field enabled the rapid and efficient delivery of a gene construct (pCD59-GFPBsd) into porcine fetal fibroblasts. The applied vector dose was magnetically sedimented on the cell surface within 30 min as visualized by fluorescence microscopy. The PCR and RT-PCR analysis confirmed not only the presence but also the expression of transgene in all magnetofected transgenic fibroblast cell lines which survived antibiotic selection. The cells were characterized by high survival rates and proliferative activities as well as correct chromosome number. The developed nanomagnetic gene delivery formulation proved to be an effective tool for the production of genetically engineered fibroblasts and may be used in future in SCNT techniques for breeding new transgenic animals for the purpose of xenotransplantation. PMID:27048425

  15. Establishment of oct4:egfp transgenic and oct4:egfp /β-actin:DsRed double transgenic medaka lines.


    Yokota, Shinpei; Matsuno, Rinta; Kato, Hiroyuki; Hashimoto, Hisashi; Kinoshita, Masato; Yokoi, Hayato; Suzuki, Tohru


    As a model to examine cellular multipotency in fish, we established a medaka transgenic (Tg) Tru.oct4:egfp line carrying the green fluorescence protein (GFP) cDNA under control of the Takifugu rubripes oct4 promoter. In this Tg line, GFP could be used to examine both maternal and zygotic oct4 expression during embryogenesis. In addition, while adult Tg fish did not express GFP in any somatic cells, activation of GFP expression was initiated in regenerating fins after amputation. In vitro, some of the cell populations that migrated from fin explants expressed GFP, implying that GFP could be used to monitor oct4 expression in both embryos and in regenerating tissues in the Tru.oct4:egfp Tg line. Next, crossing with β-actin:DsRed Tg line in which all cells emit red fluorescence by expression of red fluorescent protein (RFP) under the β-actin promoter, we prepared a Tru.oct4:egfp /β-actin:DsRed double Tg line. In the double Tg line, early embryonic cells were +GFP/+RFP double positive. In vitro fin cell culture, a small number of +GFP/+RFP double positive cells could be discriminated from other -GFP/+RFP cells. Thus, when transplanted into wild-type medaka, this double Tg line can be used to trace the fate of the transplanted cells using RFP fluorescence after the loss of GFP expression. PMID:27067442

  16. Transgenic soybean overexpressing GmSamT1 exhibits resistance to multiple-HG types of soybean cysts nematode heterodera glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean (Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyzes the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heter...

  17. Biosafety Assessment of Site-directed Transgene Integration in Human Umbilical Cord–lining Cells

    PubMed Central

    Sivalingam, Jaichandran; Krishnan, Shruti; Ng, Wai Har; Lee, Sze Sing; Phan, Toan Thang; Kon, Oi Lian


    Biosafety and efficacy considerations that impede clinical application of gene therapy could be addressed by nonviral ex vivo cell therapy, utilizing transgenic cells that have been comprehensively pre-evaluated for genotoxic potential and transgene expression. We evaluated the genotoxic potential of phiC31 bacteriophage integrase-mediated transgene integration in cord-lining epithelial cells (CLECs) readily cultured from the outer membrane of human umbilical cords, by sequencing and mapping integration sites, spectral karyotyping, high-resolution genome copy number, transcriptome, and transgene copy number analyses and in vivo tumorigenicity. Of 44 independent integration events, <5% were exonic and 85% of modified cells had integrated ≤2 transgene(s). Expression of 95.6% of genes was unaltered in modified cells. Only three small regions showed genome copy number changes that did not correlate with altered gene expression or integration sites. Spectral karyotyping revealed rare nonrecurrent occurrence of three different translocations. Integrase-modified cells were not tumorigenic in immunocompromised mice for at least 4 months. Stable integration of a human factor VIII (FVIII) construct conferred durable FVIII secretion in vitro. Xenoimplantation of FVIII-secreting CLECs in immunocompetent hemophilic mice achieved significant phenotypic correction. Pre-evaluated clonal populations of phiC31 integrase–modified CLECs could be useful as bioimplants for monogenic diseases such as hemophilia. PMID:20424600

  18. A Transgenic Durum Wheat Line that is Free of Marker Genes and Expresses 1dy10

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We used a combination of “clean gene” technology and positive selection to generate transgenic durum wheat lines free of herbicide and antibiotic resistance marker genes. Biolistic transformation experiments were carried out using three “minimal gene cassettes” consisting of linear DNA fragments exc...

  19. Assessment of Fecundity and Germ Line Transmission in Two Transgenic Pig Lines Produced by Sleeping Beauty Transposition

    PubMed Central

    Garrels, Wiebke; Holler, Stephanie; Cleve, Nicole; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A.


    Recently, we described a simplified injection method for producing transgenic pigs using a non-autonomous Sleeping Beauty transposon system. The founder animals showed ubiquitous expression of the Venus fluorophore in almost all cell types. To assess, whether expression of the reporter fluorophore affects animal welfare or fecundity, we analyzed reproductive parameters of two founder boars, germ line transmission, and organ and cell specific transgene expression in animals of the F1 and F2 generation. Molecular analysis of ejaculated sperm cells suggested three monomeric integrations of the Venus transposon in both founders. To test germ line transmission of the three monomeric transposon integrations, wild-type sows were artificially inseminated. The offspring were nursed to sexual maturity and hemizygous lines were established. A clear segregation of the monomeric transposons following the Mendelian rules was observed in the F1 and F2 offspring. Apparently, almost all somatic cells, as well as oocytes and spermatozoa, expressed the Venus fluorophore at cell-type specific levels. No detrimental effects of Venus expression on animal health or fecundity were found. Importantly, all hemizygous lines expressed the fluorophore in comparable levels, and no case of transgene silencing or variegated expression was found after germ line transmission, suggesting that the insertions occurred at transcriptionally permissive loci. The results show that Sleeping Beauty transposase-catalyzed transposition is a promising approach for stable genetic modification of the pig genome. PMID:24705079

  20. Production of fat-1 transgenic rats using a post-natal female germline stem cell line.


    Zhou, Li; Wang, Lei; Kang, Jing X; Xie, Wenhai; Li, Xiaoyong; Wu, Changqing; Xu, Bo; Wu, Ji


    Germline stem cell lines possess the abilities of self-renewal and differentiation, and have been established from both mouse and human ovaries. Here, we established a new female germline stem cell (FGSC) line from post-natal rats by immunomagnetic sorting for Fragilis, which showed a normal karyotype, high telomerase activity, and a consistent gene expression pattern of primordial germ cells after 1 year of culture. Using an in vitro differentiation system, the FGSC line could differentiate into oocytes. After liposome-based transfection with green fluorescent protein (GFP) or fat-1 vectors, the FGSCs were transplanted into the ovaries of infertile rats. The transplanted FGSCs underwent oogenesis, and the rats produced offspring carrying the GFP or fat-1 transgene after mating with wild-type male rats. The efficiency of gene transfer was 27.86-28.00%, and 2 months was needed to produce transgenic rats. These findings have implications in biomedical research and potential applications in biotechnology. PMID:24258451

  1. Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.


    Kowarz, Eric; Löscher, Denise; Marschalek, Rolf


    Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. PMID:25650551

  2. Transcriptional signature of accessory cells in the lateral line, using the Tnk1bp1:EGFP transgenic zebrafish line

    PubMed Central


    Background Because of the structural and molecular similarities between the two systems, the lateral line, a fish and amphibian specific sensory organ, has been widely used in zebrafish as a model to study the development/biology of neuroepithelia of the inner ear. Both organs have hair cells, which are the mechanoreceptor cells, and supporting cells providing other functions to the epithelium. In most vertebrates (excluding mammals), supporting cells comprise a pool of progenitors that replace damaged or dead hair cells. However, the lack of regenerative capacity in mammals is the single leading cause for acquired hearing disorders in humans. Results In an effort to understand the regenerative process of hair cells in fish, we characterized and cloned an egfp transgenic stable fish line that trapped tnks1bp1, a highly conserved gene that has been implicated in the maintenance of telomeres' length. We then used this Tg(tnks1bp1:EGFP) line in a FACsorting strategy combined with microarrays to identify new molecular markers for supporting cells. Conclusions We present a Tg(tnks1bp1:EGFP) stable transgenic line, which we used to establish a transcriptional profile of supporting cells in the zebrafish lateral line. Therefore we are providing a new set of markers specific for supporting cells as well as candidates for functional analysis of this important cell type. This will prove to be a valuable tool for the study of regeneration in the lateral line of zebrafish in particular and for regeneration of neuroepithelia in general. PMID:22273551

  3. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    NASA Astrophysics Data System (ADS)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen


    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  4. Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes.


    Yang, R L; Wang, A X; Zhang, J; Dong, Y; Yang, M S; Wang, J M


    We characterized new transgenic varieties of poplar with multiple insect-resistant and salt stress tolerant genes. Two insect-resistant Bacillus thuringiensis (Bt) genes, Cry1Ac and Cry3A, and a salt-tolerant gene, Betaine aldehyde dehydrogenase (BADH) were inserted into a vector, p209-Cry1Ac-Cry3A-BADH. The clone of Populus x euramericana was transformed by the vector using the Agrobacterium-mediated method. Three transgenic lines were assessed using genetic detection and resistance expression analysis. PCR revealed that exogenous genes Cry1Ac, Cry3A, BADH and selective marker gene NPTII were present in three transgenic lines. Quantitative real-time PCR (qPCR) showed significant differences in the transcriptional abundance of three exogenous genes in different lines. Results of assays for Bt toxic proteins showed that the Cry1Ac and Cry3A toxic protein content of each line was 12.83-26.32 and 2108.91-2724.79 ng/g, respectively. The Cry1Ac toxic protein content of different lines was significantly different; the Cry3A toxic protein content was about 100 times higher than that of the Cry1Ac toxic protein. The insect-resistance test revealed the mortality rate of transgenic lines to Hyphantria cunea L1 larvae varied by 42.2-66.7%, which was significantly higher than non-transgenic lines. The mortality rate of L1 and L2 Plagiodera versicolora larvae was 100%. The insecticidal effect of transgenic lines to P. versicolora larvae was higher than that to H. cunea larvae. NaCl stress tolerance of three transgenic lines under 3-6% NaCl concentration was significantly higher than that of non-transgenic lines. PMID:27173305

  5. Evaluation of the Agronomic Performance of Atrazine-Tolerant Transgenic japonica Rice Parental Lines for Utilization in Hybrid Seed Production

    PubMed Central

    Li, Yanlan; Li, Yanan; Wang, Shengjun; Su, Jinping; Liu, Xuejun; Chen, Defu; Chen, Xiwen


    Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.). To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA) from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer), and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9–7.0% or 0.8–8.7% respectively, for transgenic lines, and 44.0–59.2% or 28.1–30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production. PMID:25275554

  6. (E)-β-farnesene gene reduces Lipaphis erysimi colonization in transgenic Brassica juncea lines

    PubMed Central

    Verma, Shiv Shankar; Sinha, Rakesh Kumar; Jajoo, Anajna


    Aphids are the major concern that significantly reduces the yield of crops. (E)-β-farnesene (Eβf) is the principal component of the alarm pheromone of many aphids. The results of current research support the direct defense response of (E)-β-farnesene (Eβf) against aphid Lipaphis erysimi (L.) Kaltenbach in Brassica juncea. Eβf gene was isolated from Mentha arvensis and transformed into B. juncea, showed direct repellent against aphid colonization. The seasonal mean population (SMP) recorded under field condition showed significantly higher aphid colonization in wild type in comparison to most of the transgenic lines, and shows positive correlation with the repellency of transgenic plant expressing (E)-β-farnesene. The current research investigation provides direct evidence for aphid control in B. juncea using Eβf, a non-toxic mode of action. PMID:26251882

  7. Characterization of transgenic zebrafish lines that express GFP in the retina, pineal gland, olfactory bulb, hatching gland, and optic tectum.


    Fang, Wei; Bonaffini, Sarah; Zou, Jian; Wang, Xiaolei; Zhang, Cen; Tsujimura, Taro; Kawamura, Shoji; Wei, Xiangyun


    Transgenic animals are powerful tools to study gene function invivo. Here we characterize several transgenic zebrafish lines that express green fluorescent protein (GFP) under the control of the LCR(RH2)-RH2-1 or LCR(RH2)-RH2-2 green opsin regulatory elements. Using confocal immunomicroscopy, stereo-fluorescence microscopy, and Western blotting, we show that the Tg(LCR(RH2)-RH2-1:GFP)(pt112) and Tg(LCR(RH2)-RH2-2:GFP)(pt115) transgenic zebrafish lines express GFP in the pineal gland and certain types of photoreceptors. In addition, some of these lines also express GFP in the hatching gland, optic tectum, or olfactory bulb. Some of the expression patterns differ significantly from previously published similar transgenic fish lines, making them useful tools for studying the development of the corresponding tissues and organs. In addition, the variations of GFP expression among different lines corroborate the notion that transgenic expression is often subjected to position effect, thus emphasizing the need for careful verification of expression patterns when transgenic animal models are utilized for research. PMID:23499733

  8. Characterization of transgenic zebrafish lines that express GFP in the retina, pineal gland, olfactory bulb, hatching gland, and optic tectum

    PubMed Central

    Fang, Wei; Bonaffini, Sarah; Zou, Jian; Wang, Xiaolei; Zhang, Cen; Tsujimura, Taro; Kawamura, Shoji; Wei, Xiangyun


    Transgenic animals are powerful tools to study gene function in vivo. Here we characterize several transgenic zebrafish lines that express green fluorescent protein (GFP) under the control of the LCRRH2-RH2-1 or LCRRH2-RH2-2 green opsin regulatory elements. Using confocal immunomicroscopy, stereo-fluorescence microscopy, and Western blotting, we show that the Tg(LCRRH2-RH2-1:GFP)pt112 and Tg(LCRRH2-RH2-2:GFP)pt115 transgenic zebrafish lines express GFP in the pineal gland and certain types of photoreceptors. In addition, some of these lines also express GFP in the hatching gland, optic tectum, or olfactory bulb. Some of the expression patterns differ significantly from previously published similar transgenic fish lines, making them useful tools for studying the development of the corresponding tissues and organs. In addition, the variations of GFP expression among different lines corroborate the notion that transgenic expression is often subjected to position effect, thus emphasizing the need for careful verification of expression patterns when transgenic animal models are utilized for research. PMID:23499733

  9. Generation and characterization of transgenic zebrafish lines using different ubiquitous promoters

    PubMed Central

    Burket, Christopher T.; Montgomery, Jacob E.; Thummel, Ryan; Kassen, Sean C.; LaFave, Matthew C.; Langenau, David M.; Zon, Leonard I.


    Two commonly used promoters to ubiquitously express transgenes in zebrafish are the Xenopus laevis elongation factor 1 α promoter (XlEef1a1) and the zebrafish histone variant H2A.F/Z (h2afv) promoter. Recently, transgenes utilizing these promoters were shown to be silenced in certain adult tissues, particularly the central nervous system. To overcome this limitation, we cloned the promoters of four zebrafish genes that likely are transcribed ubiquitously throughout development and into the adult. These four genes are the TATA box binding protein gene, the taube nuss-like gene, the eukaryotic elongation factor 1-gamma gene, and the beta-actin-1 gene. We PCR amplified approximately 2.5 kb upstream of the putative translational start site of each gene and cloned each into a Tol2 expression vector that contains the EGFP reporter transgene. We used these four Tol2 vectors to independently generate stable transgenic fish lines for analysis of transgene expression during development and in the adult. We demonstrated that all four promoters drive a very broad pattern of EGFP expression throughout development and the adult. Using the retina as a well-characterized component of the CNS, all four promoters appeared to drive EGFP expression in all neuronal and non-neuronal cells of the adult retina. In contrast, the h2afv promoter failed to express EGFP in the adult retina. When we examined EGFP expression in the various cells of the blood cell lineage, we observed that all four promoters exhibited a more heterogenous expression pattern than either the XlEef1a1 or h2afv promoters. While these four ubiquitous promoters did not express EGFP in all the adult blood cells, they did express EGFP throughout the CNS and in broader expression patterns in the adult than either the XlEef1a1 or h2afv promoters. For these reasons, these four promoters will be valuable tools for expressing transgenes in adult zebrafish. PMID:17968670

  10. Evaluating Tissue-Specific Recombination in a Pdgfrα-CreERT2 Transgenic Mouse Line.


    O'Rourke, Megan; Cullen, Carlie L; Auderset, Loic; Pitman, Kimberley A; Achatz, Daniela; Gasperini, Robert; Young, Kaylene M


    In the central nervous system (CNS) platelet derived growth factor receptor alpha (PDGFRα) is expressed exclusively by oligodendrocyte progenitor cells (OPCs), making the Pdgfrα promoter an ideal tool for directing transgene expression in this cell type. Two Pdgfrα-CreERT2 mouse lines have been generated for this purpose which, when crossed with cre-sensitive reporter mice, allow the temporally restricted labelling of OPCs for lineage-tracing studies. These mice have also been used to achieve the deletion of CNS-specific genes from OPCs. However the ability of Pdgfrα-CreERT2 mice to induce cre-mediated recombination in PDGFRα+ cell populations located outside of the CNS has not been examined. Herein we quantify the proportion of PDGFRα+ cells that become YFP-labelled following Tamoxifen administration to adult Pdgfrα-CreERT2::Rosa26-YFP transgenic mice. We report that the vast majority (>90%) of PDGFRα+ OPCs in the CNS, and a significant proportion of PDGFRα+ stromal cells within the bone marrow (~38%) undergo recombination and become YFP-labelled. However, only a small proportion of the PDGFRα+ cell populations found in the sciatic nerve, adrenal gland, pituitary gland, heart, gastrocnemius muscle, kidney, lung, liver or intestine become YFP-labelled. These data suggest that Pdgfrα-CreERT2 transgenic mice can be used to achieve robust recombination in OPCs, while having a minimal effect on most PDGFRα+ cell populations outside of the CNS. PMID:27626928

  11. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies.


    Marquart, Gregory D; Tabor, Kathryn M; Brown, Mary; Strykowski, Jennifer L; Varshney, Gaurav K; LaFave, Matthew C; Mueller, Thomas; Burgess, Shawn M; Higashijima, Shin-Ichi; Burgess, Harold A


    Transgenic methods enable the selective manipulation of neurons for functional mapping of neuronal circuits. Using confocal microscopy, we have imaged the cellular-level expression of 109 transgenic lines in live 6 day post fertilization larvae, including 80 Gal4 enhancer trap lines, 9 Cre enhancer trap lines and 20 transgenic lines that express fluorescent proteins in defined gene-specific patterns. Image stacks were acquired at single micron resolution, together with a broadly expressed neural marker, which we used to align enhancer trap reporter patterns into a common 3-dimensional reference space. To facilitate use of this resource, we have written software that enables searching for transgenic lines that label cells within a selectable 3-dimensional region of interest (ROI) or neuroanatomical area. This software also enables the intersectional expression of transgenes to be predicted, a feature which we validated by detecting cells with co-expression of Cre and Gal4. Many of the imaged enhancer trap lines show intrinsic brain-specific expression. However, to increase the utility of lines that also drive expression in non-neuronal tissue we have designed a novel UAS reporter, that suppresses expression in heart, muscle, and skin through the incorporation of microRNA binding sites in a synthetic 3' untranslated region. Finally, we mapped the site of transgene integration, thus providing molecular identification of the expression pattern for most lines. Cumulatively, this library of enhancer trap lines provides genetic access to 70% of the larval brain and is therefore a powerful and broadly accessible tool for the dissection of neural circuits in larval zebrafish. PMID:26635538

  12. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies

    PubMed Central

    Marquart, Gregory D.; Tabor, Kathryn M.; Brown, Mary; Strykowski, Jennifer L.; Varshney, Gaurav K.; LaFave, Matthew C.; Mueller, Thomas; Burgess, Shawn M.; Higashijima, Shin-ichi; Burgess, Harold A.


    Transgenic methods enable the selective manipulation of neurons for functional mapping of neuronal circuits. Using confocal microscopy, we have imaged the cellular-level expression of 109 transgenic lines in live 6 day post fertilization larvae, including 80 Gal4 enhancer trap lines, 9 Cre enhancer trap lines and 20 transgenic lines that express fluorescent proteins in defined gene-specific patterns. Image stacks were acquired at single micron resolution, together with a broadly expressed neural marker, which we used to align enhancer trap reporter patterns into a common 3-dimensional reference space. To facilitate use of this resource, we have written software that enables searching for transgenic lines that label cells within a selectable 3-dimensional region of interest (ROI) or neuroanatomical area. This software also enables the intersectional expression of transgenes to be predicted, a feature which we validated by detecting cells with co-expression of Cre and Gal4. Many of the imaged enhancer trap lines show intrinsic brain-specific expression. However, to increase the utility of lines that also drive expression in non-neuronal tissue we have designed a novel UAS reporter, that suppresses expression in heart, muscle, and skin through the incorporation of microRNA binding sites in a synthetic 3′ untranslated region. Finally, we mapped the site of transgene integration, thus providing molecular identification of the expression pattern for most lines. Cumulatively, this library of enhancer trap lines provides genetic access to 70% of the larval brain and is therefore a powerful and broadly accessible tool for the dissection of neural circuits in larval zebrafish. PMID:26635538

  13. A Transgenic Mouse Line Expressing the Red Fluorescent Protein tdTomato in GABAergic Neurons.


    Besser, Stefanie; Sicker, Marit; Marx, Grit; Winkler, Ulrike; Eulenburg, Volker; Hülsmann, Swen; Hirrlinger, Johannes


    GABAergic inhibitory neurons are a large population of neurons in the central nervous system (CNS) of mammals and crucially contribute to the function of the circuitry of the brain. To identify specific cell types and investigate their functions labelling of cell populations by transgenic expression of fluorescent proteins is a powerful approach. While a number of mouse lines expressing the green fluorescent protein (GFP) in different subpopulations of GABAergic cells are available, GFP expressing mouse lines are not suitable for either crossbreeding to other mouse lines expressing GFP in other cell types or for Ca2+-imaging using the superior green Ca2+-indicator dyes. Therefore, we have generated a novel transgenic mouse line expressing the red fluorescent protein tdTomato in GABAergic neurons using a bacterial artificial chromosome based strategy and inserting the tdTomato open reading frame at the start codon within exon 1 of the GAD2 gene encoding glutamic acid decarboxylase 65 (GAD65). TdTomato expression was observed in all expected brain regions; however, the fluorescence intensity was highest in the olfactory bulb and the striatum. Robust expression was also observed in cortical and hippocampal neurons, Purkinje cells in the cerebellum, amacrine cells in the retina as well as in cells migrating along the rostral migratory stream. In cortex, hippocampus, olfactory bulb and brainstem, 80% to 90% of neurons expressing endogenous GAD65 also expressed the fluorescent protein. Moreover, almost all tdTomato-expressing cells coexpressed GAD65, indicating that indeed only GABAergic neurons are labelled by tdTomato expression. This mouse line with its unique spectral properties for labelling GABAergic neurons will therefore be a valuable new tool for research addressing this fascinating cell type. PMID:26076353

  14. A human beta cell line with drug inducible excision of immortalizing transgenes

    PubMed Central

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe


    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  15. A Transgenic Mouse Line Expressing the Red Fluorescent Protein tdTomato in GABAergic Neurons

    PubMed Central

    Besser, Stefanie; Sicker, Marit; Marx, Grit; Winkler, Ulrike; Eulenburg, Volker; Hülsmann, Swen; Hirrlinger, Johannes


    GABAergic inhibitory neurons are a large population of neurons in the central nervous system (CNS) of mammals and crucially contribute to the function of the circuitry of the brain. To identify specific cell types and investigate their functions labelling of cell populations by transgenic expression of fluorescent proteins is a powerful approach. While a number of mouse lines expressing the green fluorescent protein (GFP) in different subpopulations of GABAergic cells are available, GFP expressing mouse lines are not suitable for either crossbreeding to other mouse lines expressing GFP in other cell types or for Ca2+-imaging using the superior green Ca2+-indicator dyes. Therefore, we have generated a novel transgenic mouse line expressing the red fluorescent protein tdTomato in GABAergic neurons using a bacterial artificial chromosome based strategy and inserting the tdTomato open reading frame at the start codon within exon 1 of the GAD2 gene encoding glutamic acid decarboxylase 65 (GAD65). TdTomato expression was observed in all expected brain regions; however, the fluorescence intensity was highest in the olfactory bulb and the striatum. Robust expression was also observed in cortical and hippocampal neurons, Purkinje cells in the cerebellum, amacrine cells in the retina as well as in cells migrating along the rostral migratory stream. In cortex, hippocampus, olfactory bulb and brainstem, 80% to 90% of neurons expressing endogenous GAD65 also expressed the fluorescent protein. Moreover, almost all tdTomato-expressing cells coexpressed GAD65, indicating that indeed only GABAergic neurons are labelled by tdTomato expression. This mouse line with its unique spectral properties for labelling GABAergic neurons will therefore be a valuable new tool for research addressing this fascinating cell type. PMID:26076353

  16. Transgenic mouse lines for non-invasive ratiometric monitoring of intracellular chloride

    PubMed Central

    Batti, Laura; Mukhtarov, Marat; Audero, Enrica; Ivanov, Anton; Paolicelli, Rosa Chiara; Zurborg, Sandra; Gross, Cornelius; Bregestovski, Piotr; Heppenstall, Paul A.


    Chloride is the most abundant physiological anion and participates in a variety of cellular processes including trans-epithelial transport, cell volume regulation, and regulation of electrical excitability. The development of tools to monitor intracellular chloride concentration ([Cli]) is therefore important for the evaluation of cellular function in normal and pathological conditions. Recently, several Cl-sensitive genetically encoded probes have been described which allow for non-invasive monitoring of [Cli]. Here we describe two mouse lines expressing a CFP-YFP-based Cl probe called Cl-Sensor. First, we generated transgenic mice expressing Cl-Sensor under the control of the mouse Thy1 mini promoter. Cl-Sensor exhibited good expression from postnatal day two (P2) in neurons of the hippocampus and cortex, and its level increased strongly during development. Using simultaneous whole-cell monitoring of ionic currents and Cl-dependent fluorescence, we determined that the apparent EC50 for Cli was 46 mM, indicating that this line is appropriate for measuring neuronal [Cli] in postnatal mice. We also describe a transgenic mouse reporter line for Cre-dependent conditional expression of Cl-Sensor, which was targeted to the Rosa26 locus and by incorporating a strong exogenous promoter induced robust expression upon Cre-mediated recombination. We demonstrate high levels of tissue-specific expression in two different Cre-driver lines targeting cells of the myeloid lineage and peripheral sensory neurons. Using these mice the apparent EC50 for Cli was estimated to be 61 and 54 mM in macrophages and DRG, respectively. Our data suggest that these mouse lines will be useful models for ratiometric monitoring of Cli in specific cell types in vivo. PMID:23734096

  17. The histone deacetylase inhibitor Entinostat enhances polymer-mediated transgene expression in cancer cell lines.


    Elmer, Jacob J; Christensen, Matthew D; Barua, Sutapa; Lehrman, Jennifer; Haynes, Karmella A; Rege, Kaushal


    Eukaryotic cells maintain an immense amount of genetic information by tightly wrapping their DNA around positively charged histones. While this strategy allows human cells to maintain more than 25,000 genes, histone binding can also block gene expression. Consequently, cells express histone acetyl transferases (HATs) to acetylate histone lysines and release DNA for transcription. Conversely, histone deacetylases (HDACs) are employed for restoring the positive charge on the histones, thereby silencing gene expression by increasing histone-DNA binding. It has previously been shown that histones bind and silence viral DNA, while hyperacetylation of histones via HDAC inhibition restores viral gene expression. In this study, we demonstrate that treatment with Entinostat, an HDAC inhibitor, enhances transgene (luciferase) expression by up to 25-fold in human prostate and murine bladder cancer cell lines when used with cationic polymers for plasmid DNA delivery. Entinostat treatment altered cell cycle progression, resulting in a significant increase in the fraction of cells present in the G0/G1 phase at low micromolar concentrations. While this moderate G0/G1 arrest disappeared at higher concentrations, a modest increase in the fraction of apoptotic cells and a decrease in cell proliferation were observed, consistent with the known anticancer effects of the drug. DNase accessibility studies revealed no significant change in plasmid transcriptional availability with Entinostat treatment. However, quantitative PCR studies indicated that Entinostat treatment, at the optimal dose for enhancing transgene expression, led to an increase in the amount of plasmid present in the nucleus in two cancer cell lines. Taken together, our results show that Entinostat enhances polymer- mediated transgene expression and can be useful in applications related to transient protein expression in mammalian cells. Biotechnol. Bioeng. 2016;113: 1345-1356. © 2015 Wiley Periodicals, Inc. PMID

  18. Quantitative proteomic analysis of wheat grain proteins reveals differential effects of silencing of omega-5 gliadin genes in transgenic lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel wheat lines with altered flour compositions can be used to decipher the roles of specific gluten proteins in flour quality. Grain proteins from transgenic wheat lines in which genes encoding the omega-5 gliadins were silenced by RNA interference (RNAi) were analyzed in detail by quantitative 2...

  19. Construction and characterization of a sox9b transgenic reporter line

    PubMed Central

    Plavicki, Jessica S.; Baker, Tracie. R.; Burns, Felipe R.; Xiong, Kong M.; Gooding, Alex J.; Hofsteen, Peter; Peterson, Richard E.; Heideman, Warren


    The transcription factor SOX9 is a member of the SRY-related high-mobility-group box (SOX) superfamily of genes. In mammals, Sox9 plays important roles in many developmental processes including craniofacial, skeletal and heart morphogenesis, retinal and brain development, and gonad differentiation. Human mutations in SOX9 or the SOX9 promoter result in campomelic dysplasia, a severe genetic disorder, which disrupts skeletal, craniofacial, cardiac, neural and reproductive development. Due to the duplication of the teleost fish genome, zebrafish (Danio rerio) have two Sox9 genes: sox9a and sox9b. Loss of sox9b in zebrafish results in loss of function phenotypes that are similar to those observed in humans and mice. In order to generate a transgenic sox9b:EGFP reporter line, we cloned a 2450 bp fragment of the sox9b promoter and fused it to an EGFP reporter. Consistent with reported sox9b expression and function, we observed sox9b:EGFP in the developing heart, skeletal and craniofacial structures, brain, retina, and ovaries. Our resulting transgenic line is a useful tool for identifying and studying sox9b function in development and visualizing a number of zebrafish organs and tissues in which sox9b is normally expressed. PMID:25896205

  20. Mobility properties of the Hermes transposable element in transgenic lines of Aedes aegypti.


    Smith, Ryan C; Atkinson, Peter W


    The Hermes transposable element has been used to genetically transform a wide range of insect species, including the mosquito, Aedes aegypti, a vector of several important human pathogens. Hermes integrations into the mosquito germline are characterized by the non-canonical integration of the transposon and flanking plasmid and, once integrated, Hermes is stable in the presence of its transposase. In an effort to improve the post-integration mobility of Hermes in the germline of Ae. aegypti, a transgenic helper Mos1 construct expressing Hermes transposase under the control of a testis-specific promoter was crossed to a separate transgenic strain containing a target Hermes transposon. In less than 1% of the approximately 1,500 progeny from jumpstarter lines analyzed, evidence of putative Hermes germline remobilizations were detected. These recovered transposition events occur through an aberrant mechanism and provide insight into the non-canonical cut-and-paste transposition of Hermes in the germ line of Ae. aegypti. PMID:20596755

  1. Mobility properties of the Hermes transposable element in transgenic lines of Aedes aegypti

    PubMed Central

    Smith, Ryan C.


    The Hermes transposable element has been used to genetically transform a wide range of insect species, including the mosquito, Aedes aegypti, a vector of several important human pathogens. Hermes integrations into the mosquito germline are characterized by the non-canonical integration of the transposon and flanking plasmid and, once integrated, Hermes is stable in the presence of its transposase. In an effort to improve the post-integration mobility of Hermes in the germline of Ae. aegypti, a transgenic helper Mos1 construct expressing Hermes transposase under the control of a testis-specific promoter was crossed to a separate transgenic strain containing a target Hermes transposon. In less than 1% of the approximately 1,500 progeny from jumpstarter lines analyzed, evidence of putative Hermes germline remobilizations were detected. These recovered transposition events occur through an aberrant mechanism and provide insight into the non-canonical cut-and-paste transposition of Hermes in the germ line of Ae. aegypti. PMID:20596755

  2. Construction and characterization of a sox9b transgenic reporter line.


    Plavicki, Jessica S; Baker, Tracie R; Burns, Felipe R; Xiong, Kong M; Gooding, Alex J; Hofsteen, Peter; Peterson, Richard E; Heideman, Warren


    The transcription factor SOX9 is a member of the SRY-related high-mobility-group box (SOX) superfamily of genes. In mammals, Sox9 plays important roles in many developmental processes including craniofacial, skeletal and heart morphogenesis, retinal and brain development, and gonad differentiation. Human mutations in SOX9 or the SOX9 promoter result in campomelic dysplasia, a severe genetic disorder, which disrupts skeletal, craniofacial, cardiac, neural and reproductive development. Due to the duplication of the teleost fish genome, zebrafish (Danio rerio) have two Sox9 genes: sox9a and sox9b. Loss of sox9b in zebrafish results in loss of function phenotypes that are similar to those observed in humans and mice. In order to generate a transgenic sox9b:EGFP reporter line, we cloned a 2450 bp fragment of the sox9b promoter and fused it to an EGFP reporter. Consistent with reported sox9b expression and function, we observed sox9b:EGFP in the developing heart, skeletal and craniofacial structures, brain, retina, and ovaries. Our resulting transgenic line is a useful tool for identifying and studying sox9b function in development and visualizing a number of zebrafish organs and tissues in which sox9b is normally expressed. PMID:25896205

  3. The transposition frequency of Tag1 elements is increased in transgenic Arabidopsis lines.

    PubMed Central

    Bhatt, A M; Lister, C; Crawford, N; Dean, C


    Tag1 was identified as a highly active endogenous transposable element in transgenic Arabidopsis thaliana Landsberg erecta plants carrying the maize transposable element Activator (Ac). Here, we describe experiments designed to determine the basis for the high activity of Tag1. The frequency of transposition of Tag1 elements was compared in lines containing or lacking Ac transposase to assess the effect of Ac transposase on Tag1 activity. Three populations of nontransgenic plants, including nontransformed regenerants, were also analyzed. The high level of activity of Tag1 did not correlate with the presence or absence of Ac transposase but was significantly higher in transgenic lines. This result was maintained through at least six generations after transformation. These data suggest that Tag1 transposition is stimulated by processes that occur during the Agrobacterium transformation and that thereafter remain active. Two Tag1 elements are tightly linked in the Landsberg erecta genome and map to the lower arm of chromosome 1. Tag1 elements were found in only a few A. thaliana ecotypes but were present in four other Arabidopsis species. PMID:9501115

  4. Molecular analysis, cytogenetics and fertility of introgression lines from transgenic wheat to Aegilops cylindrica host.


    Schoenenberger, Nicola; Guadagnuolo, Roberto; Savova-Bianchi, Dessislava; Küpfer, Philippe; Felber, François


    Natural hybridization and backcrossing between Aegilops cylindrica and Triticum aestivum can lead to introgression of wheat DNA into the wild species. Hybrids between Ae. cylindrica and wheat lines bearing herbicide resistance (bar), reporter (gus), fungal disease resistance (kp4), and increased insect tolerance (gna) transgenes were produced by pollination of emasculated Ae. cylindrica plants. F1 hybrids were backcrossed to Ae. cylindrica under open-pollination conditions, and first backcrosses were selfed using pollen bags. Female fertility of F1 ranged from 0.03 to 0.6%. Eighteen percent of the sown BC1s germinated and flowered. Chromosome numbers ranged from 30 to 84 and several of the plants bore wheat-specific sequence-characterized amplified regions (SCARs) and the bar gene. Self fertility in two BC1 plants was 0.16 and 5.21%, and the others were completely self-sterile. Among 19 BC1S1 individuals one plant was transgenic, had 43 chromosomes, contained the bar gene, and survived glufosinate treatments. The other BC1S1 plants had between 28 and 31 chromosomes, and several of them carried SCARs specific to wheat A and D genomes. Fertility of these plants was higher under open-pollination conditions than by selfing and did not necessarily correlate with even or euploid chromosome number. Some individuals having supernumerary wheat chromosomes recovered full fertility. PMID:17028347

  5. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    SciTech Connect

    Klein, C.B.; Rossman, T.G. )


    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT{sup {minus}} Chinese hamster V79 cells. Several gpt{sup {minus}} cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt{sup {minus}} occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N{prime}-nitro-N-nitrosoguanidine (MNNG) and {beta}-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus.

  6. zebraflash transgenic lines for in vivo bioluminescence imaging of stem cells and regeneration in adult zebrafish

    PubMed Central

    Chen, Chen-Hui; Durand, Ellen; Wang, Jinhu; Zon, Leonard I.; Poss, Kenneth D.


    The zebrafish has become a standard model system for stem cell and tissue regeneration research, based on powerful genetics, high tissue regenerative capacity and low maintenance costs. Yet, these studies can be challenged by current limitations of tissue visualization techniques in adult animals. Here we describe new imaging methodology and present several ubiquitous and tissue-specific luciferase-based transgenic lines, which we have termed zebraflash, that facilitate the assessment of regeneration and engraftment in freely moving adult zebrafish. We show that luciferase-based live imaging reliably estimates muscle quantity in an internal organ, the heart, and can longitudinally follow cardiac regeneration in individual animals after major injury. Furthermore, luciferase-based detection enables visualization and quantification of engraftment in live recipients of transplanted hematopoietic stem cell progeny, with advantages in sensitivity and gross spatial resolution over fluorescence detection. Our findings present a versatile resource for monitoring and dissecting vertebrate stem cell and regeneration biology. PMID:24198277

  7. Establishment of oct4:gfp transgenic zebrafish line for monitoring cellular multipotency by GFP fluorescence.


    Kato, Hiroyuki; Abe, Kota; Yokota, Shinpei; Matsuno, Rinta; Mikekado, Tsuyoshi; Yokoi, Hayato; Suzuki, Tohru


    The establishment of induced pluripotent stem (iPS) cell technology in fish could facilitate the establishment of novel cryopreservation techniques for storing selected aquaculture strains as frozen cells. In order to apply iPS cell technology to fish, we established a transgenic zebrafish line, Tg(Tru.oct4:EGFP), using green fluorescent protein (GFP) expression under the control of the oct4 gene promoter as a marker to evaluate multipotency in iPS cell preparations. We used the oct4 promoter from fugu (Takifugu rubripes) due to the compact nature of the fugu genome and to facilitate future applications of this technology in marine fishes. During embryogenesis, maternal GFP fluorescence was observed at the cleavage stage and zygotic GFP expression was observed from the start of the shield stage until approximately 24 h after fertilization. gfp messenger RNA (mRNA) was expressed by whole embryonic cells at the shield stage, and then restricted to the caudal neural tube in the latter stages of embryogenesis. These observations showed that GFP fluorescence and the regulation of gfp mRNA expression by the exogenous fugu oct4 promoter are well suited for monitoring endogenous oct4 mRNA expression in embryos. Bisulfite sequencing revealed that the rate of CpG methylation in the transgenic oct4 promoter was high in adult cells (98%) and low in embryonic cells (37%). These findings suggest that, as with the endogenous oct4 promoter, demethylation and methylation both take place normally in the transgenic oct4 promoter during embryogenesis. The embryonic cells harvested at the shield stage formed embryonic body-like cellular aggregates and maintained GFP fluorescence for 6 d when cultured on Transwell-COL Permeable Supports or a feeder layer of adult fin cells. Loss of GFP fluorescence by cultured cells was correlated with cellular differentiation. We consider that the Tg(Tru.oct4:EGFP) zebrafish line established here is well suited for monitoring multipotency in

  8. Influence of Precursor Availability on Alkaloid Accumulation by Transgenic Cell Line of Catharanthus roseus1

    PubMed Central

    Whitmer, Serap; Canel, Camilo; Hallard, Didier; Gonçalves, Cecilia; Verpoorte, Robert


    We have used a transgenic cell line of Catharanthus roseus (L.) G. Don to study the relative importance of the supply of biosynthetic precursors for the synthesis of terpenoid indole alkaloids. Line S10 carries a recombinant, constitutively overexpressed version of the endogenous strictosidine synthase (Str) gene. Various concentrations and combinations of the substrate tryptamine and of loganin, the immediate precursor of secologanin, were added to suspension cultures of S10. Our results indicate that high rates of tryptamine synthesis can take place under conditions of low tryptophan decarboxylase activity, and that high rates of strictosidine synthesis are possible in the presence of a small tryptamine pool. It appears that the utilization of tryptamine for alkaloid biosynthesis enhances metabolic flux through the indole pathway. However, a deficiency in the supply of either the iridoid or the indole precursor can limit flux through the step catalyzed by strictosidine synthase. Precursor utilization for the synthesis of strictosidine depends on the availability of the cosubstrate; the relative abundance of these precursors is a cell-line-specific trait that reflects the metabolic status of the cultures. PMID:9490777

  9. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    PubMed Central

    Bartlett, Joanne G.; Smedley, Mark A.; Harwood, Wendy A.


    Sequencing across the junction between an integrated transfer DNA (T-DNA) and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression. PMID:24833334

  10. Developing a Triple Transgenic Cell Line for High-Efficiency Porcine Reproductive and Respiratory Syndrome Virus Infection

    PubMed Central

    Zhang, Linlin; Cui, Zhengzhi; Zhou, Lei; Kang, Youmin; Li, Li; Li, Jinxiu; Dai, Yunping; Yu, Shuyang; Li, Ning


    Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating pathogens in the swine industry worldwide. Due to the lack of robust cell lines and small animal models, the pathogenesis of PRRSV infection and mechanism for protective vaccination are still not yet well understood. To obtain useful cell lines, several groups have attempted to construct different transgenic cell lines with three PRRSV receptors: CD163, CD169, and CD151. The results showed that CD163 is essential for PRRSV entry into target cells and replication, and both CD169 and CD151 play key roles during PRRSV infection. However, their interplay and combined effect remains unclear. In this study, we generated transgenic BHK-21 derived cell lines co-expressing different combinations of the three receptors, which were transfected with CD163 alone, or the combination of CD163 and CD169, or the combination of CD163 and CD151, or the combination of CD163, CD169, and CD151 using the PiggyBac transposon system. Our results showed that the synergistic interaction among the three receptors was important to improve the susceptibility of cells during PRRSV infection. Through a series of comparable analyses, we confirmed that the cell line co-expressing triple receptors sustained viral infection and replication, and was superior to the current cell platform used for the PRRSV study, MARC-145 cells. Moreover, we found that PRRSV infection of the transgenic cell lines could trigger IFN-stimulated gene responses similar to those of porcine alveolar macrophages and MARC-145 cells. In summary, we developed a stable transgenic cell line susceptible to PRRSV, which may not only provide a useful tool for virus propagation, vaccine development, and pathogenesis studies, but also establish the foundation for small animal model development. PMID:27182980

  11. Fasudil hydrochloride induces osteoblastic differentiation of stromal cell lines, C3H10T1/2 and ST2, via bone morphogenetic protein-2 expression.


    Kanazawa, Ippei; Yamaguchi, Toru; Yano, Shozo; Yamauchi, Mika; Sugimoto, Toshitsugu


    Rho-kinase (ROK), downstream of the mevalonate pathway, is detrimental to vessels, and suppressing its activity is a target for the treatment of human disease such as coronary artery disease and pulmonary hypertension. Recent studies have shown that ROK has a crucial role in bone metabolism. However, the role of ROK in stromal cells is still unclear. The present study was undertaken to investigate the effect of a ROK inhibitor, fasudil hydrochloride, on stromal cell lines, C3H10T1/2 and ST2. In both cells, Fasudil significantly stimulated alkaline phosphatase activity and enhanced cell mineralization. Moreover, fasudil significantly increased the mRNA expression of collagen-I, osteocalcin, and bone morphogenetic protein-2 (BMP-2). Supplementation of noggin, a BMP-2 antagonist, significantly reversed the fasudil-induced collagen-I and osteocalcin mRNA expression in both cells. These findings suggest that fasudil induces the osteoblastic differentiation of stromal cells via enhancing BMP-2 expression, and that this drug might be beneficial for not only atherosclerosis but also osteoporosis by promoting bone formation. PMID:20154408

  12. Transgene expression of green fluorescent protein and germ line transmission in cloned pigs derived from in vitro transfected adult fibroblasts.


    Brunetti, Dario; Perota, Andrea; Lagutina, Irina; Colleoni, Silvia; Duchi, Roberto; Calabrese, Fiorella; Seveso, Michela; Cozzi, Emanuele; Lazzari, Giovanna; Lucchini, Franco; Galli, Cesare


    The pig represents the xenogeneic donor of choice for future organ transplantation in humans for anatomical and physiological reasons. However, to bypass several immunological barriers, strong and stable human genes expression must occur in the pig's organs. In this study we created transgenic pigs using in vitro transfection of cultured cells combined with somatic cell nuclear transfer (SCNT) to evaluate the ubiquitous transgene expression driven by pCAGGS vector in presence of different selectors. pCAGGS confirmed to be a very effective vector for ubiquitous transgene expression, irrespective of the selector that was used. Green fluorescent protein (GFP) expression observed in transfected fibroblasts was also maintained after nuclear transfer, through pre- and postimplantation development, at birth and during adulthood. Germ line transmission without silencing of the transgene was demonstrated. The ubiquitous expression of GFP was clearly confirmed in several tissues including endothelial cells, thus making it a suitable vector for the expression of multiple genes relevant to xenotransplantation where tissue specificity is not required. Finally cotransfection of green and red fluorescence protein transgenes was performed in fibroblasts and after nuclear transfer blastocysts expressing both fluorescent proteins were obtained. PMID:18823265

  13. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    PubMed Central

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen


    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  14. Germline recombination in a novel Cre transgenic line, Prl3b1-Cre mouse.


    Al-Soudy, Al-Sayed; Nakanishi, Tsuyoshi; Mizuno, Seiya; Hasegawa, Yoshikazu; Shawki, Hossam H; Katoh, Megumi C; Basha, Walaa A; Ibrahim, Abdelaziz E; El-Shemy, Hany A; Iseki, Hiroyoshi; Yoshiki, Atsushi; Hiromori, Youhei; Nagase, Hisamitsu; Takahashi, Satoru; Oishi, Hisashi; Sugiyama, Fumihiro


    Spermatogenesis is a complex and highly regulated process by which spermatogonial stem cells differentiate into spermatozoa. To better understand the molecular mechanisms of the process, the Cre/loxP system has been widely utilized for conditional gene knockout in mice. In this study, we generated a transgenic mouse line that expresses Cre recombinase under the control of the 2.5 kbp of the Prolactin family 3, subfamily b, member 1 (Prl3b1) gene promoter (Prl3b1-cre). Prl3b1 was initially reported to code for placental lactogen 2 (PL-2) protein in placenta along with increased expression toward the end of pregnancy. PL-2 was found to be expressed in germ cells in the testis, especially in spermatocytes. To analyze the specificity and efficiency of Cre recombinase activity in Prl3b1-cre mice, the mice were mated with reporter R26GRR mice, which express GFP ubiquitously before and tdsRed exclusively after Cre recombination. The systemic examination of Prl3b1-cre;R26GRR mice revealed that tdsRed-positive cells were detected only in the testis and epididymis. Fluorescence imaging of Prl3b1-cre;R26GRR testes suggested that Cre-mediated recombination took place in the germ cells with approximately 74% efficiency determined by in vitro fertilization. In conclusion, our results suggest that the Prl3b1-cre mice line provides a unique resource to understand testicular germ-cell development. genesis 54:389-397, 2016. © 2016 Wiley Periodicals, Inc. PMID:27124574

  15. Recombineering-Based Procedure for Creating BAC Transgene Constructs for Animals and Cell Lines

    PubMed Central

    Hollenback, Steven M.; Lyman, Suzanne; Cheng, JrGang


    The use of BAC/P1 as a vector for the generation of a transgene has gained popularity after the genomic annotation of many organisms was completed (often based on the respective BAC library). Large-scale generation of BAC transgenic mice has proven that BAC transgene approaches have less integration position effects and dosage artifacts when compared with traditional transgenic approaches. Also, a BAC can achieve the same tissue-specific expression as a Knock-in of the same gene with less effort and shorter time of establishment. The λ-RED recombinogenic system has been used to manipulate DNA constructs with site-directed mutagenesis, truncation, and tagging with an epitope tag or as a fusion protein by homologous recombination, as well as used here to modify many BACs with various transgenes. The recombineering plasmid, pKD46, is used to fabricate BAC transgenic constructs that can be used in generating transgenic organisms as well as used in mammalian cell culture. PMID:21732318

  16. Comparison of the physiological characteristics of transgenic insect-resistant cotton and conventional lines

    PubMed Central

    Li, Xiaogang; Ding, Changfeng; Wang, Xingxiang; Liu, Biao


    The introduction of transgenic insect-resistant cotton into agricultural ecosystems has raised concerns regarding its ecological effects. Many studies have been conducted to compare the differences in characteristics between transgenic cotton and conventional counterparts. However, few studies have focused on the different responses of transgenic cotton to stress conditions, especially to the challenges of pathogens. The aim of this work is to determine the extent of variation in physiological characteristics between transgenic insect-resistant cotton and the conventional counterpart infected by cotton soil-borne pathogens. The results showed that the difference in genetic backgrounds is the main factor responsible for the effects on biochemical characteristics of transgenic cotton when incubating with cotton Fusarium oxysporum. However, genetic modification had a significantly greater influence on the stomatal structure of transgenic cotton than the effects of cotton genotypes. Our results highlight that the differences in genetic background and/or genetic modifications may introduce variations in physiological characteristics and should be considered to explore the potential unexpected ecological effects of transgenic cotton. PMID:25737015

  17. Developing Fiber Specific Promoter-Reporter Transgenic Lines to Study the Effect of Abiotic Stresses on Fiber Development in Cotton

    PubMed Central

    Chen, Junping; Burke, John J.


    Cotton is one of the most important cash crops in US agricultural industry. Environmental stresses, such as drought, high temperature and combination of both, not only reduce the overall growth of cotton plants, but also greatly decrease cotton lint yield and fiber quality. The impact of environmental stresses on fiber development is poorly understood due to technical difficulties associated with the study of developing fiber tissues and lack of genetic materials to study fiber development. To address this important question and provide the need for scientific community, we have generated transgenic cotton lines harboring cotton fiber specific promoter (CFSP)-reporter constructs from six cotton fiber specific genes (Expansin, E6, Rac13, CelA1, LTP, and Fb late), representing genes that are expressed at different stages of fiber development. Individual CFSP::GUS or CFSP::GFP construct was introduced into Coker 312 via Agrobacterium mediated transformation. Transgenic cotton lines were evaluated phenotypically and screened for the presence of selectable marker, reporter gene expression, and insertion numbers. Quantitative analysis showed that the patterns of GUS reporter gene activity during fiber development in transgenic cotton lines were similar to those of the native genes. Greenhouse drought and heat stress study showed a correlation between the decrease in promoter activities and decrease in fiber length, increase in micronaire and changes in other fiber quality traits in transgenic lines grown under stressed condition. These newly developed materials provide new molecular tools for studying the effects of abiotic stresses on fiber development and may be used in study of cotton fiber development genes and eventually in the genetic manipulation of fiber quality. PMID:26030401

  18. Two step male release strategy using transgenic mosquito lines to control transmission of vector-borne diseases.


    Carvalho, Danilo Oliveira; Costa-da-Silva, André Luis; Lees, Rosemary Susan; Capurro, Margareth Lara


    Mosquitoes are responsible for the transmission of pathogens that cause devastating human diseases such as malaria and dengue. The current increase in mean global temperature and changing sea level interfere with precipitation frequency and some other climatic conditions which, in general, influence the rate of development of insects and etiologic agents causing acceleration as the temperature rises. The most common strategy employed to combat target mosquito species is the Integrated Vector Management (IVM), which comprises the use of multiple activities and various approaches to preventing the spread of a vector in infested areas. IVM programmes are becoming ineffective; and the global scenario is threatening, requiring new interventions for vector control and surveillance. Not surprisingly, there is a growing need to find alternative methods to combat the mosquito vectors. The possibility of using transgenic mosquitoes to fight against those diseases has been discussed over the last two decades and this use of transgenic lines to suppress populations or to replace them is still under investigation through field and laboratory trials. As an alternative, the available transgenic strategies could be improved by coupling suppression and substitution strategies. The idea is to first release a suppression line to significantly reduce the wild population, and once the first objective is reached a second release using a substitution line could be then performed. Examples of targeting this approach against vectors of malaria and dengue are discussed. PMID:24513036

  19. c-MycERTAM transgene silencing in a genetically modified human neural stem cell line implanted into MCAo rodent brain

    PubMed Central

    Stevanato, Lara; Corteling, Randolph L; Stroemer, Paul; Hope, Andrew; Heward, Julie; Miljan, Erik A; Sinden, John D


    Background The human neural stem cell line CTX0E03 was developed for the cell based treatment of chronic stroke disability. Derived from fetal cortical brain tissue, CTX0E03 is a clonal cell line that contains a single copy of the c-mycERTAM transgene delivered by retroviral infection. Under the conditional regulation by 4-hydroxytamoxifen (4-OHT), c-mycERTAM enabled large-scale stable banking of the CTX0E03 cells. In this study, we investigated the fate of this transgene following growth arrest (EGF, bFGF and 4-OHT withdrawal) in vitro and following intracerebral implantation into a mid-cerebral artery occluded (MCAo) rat brain. In vitro, 4-weeks after removing growth factors and 4-OHT from the culture medium, c-mycERTAM transgene transcription is reduced by ~75%. Furthermore, immunocytochemistry and western blotting demonstrated a concurrent decrease in the c-MycERTAM protein. To examine the transcription of the transgene in vivo, CTX0E03 cells (450,000) were implanted 4-weeks post MCAo lesion and analysed for human cell survival and c-mycERTAM transcription by qPCR and qRT-PCR, respectively. Results The results show that CTX0E03 cells were present in all grafted animal brains ranging from 6.3% to 39.8% of the total cells injected. Prior to implantation, the CTX0E03 cell suspension contained 215.7 (SEM = 13.2) copies of the c-mycERTAM transcript per cell. After implantation the c-mycERTAM transcript copy number per CTX0E03 cell had reduced to 6.9 (SEM = 3.4) at 1-week and 7.7 (SEM = 2.5) at 4-weeks. Bisulfite genomic DNA sequencing of the in vivo samples confirmed c-mycERTAM silencing occurred through methylation of the transgene promoter sequence. Conclusion In conclusion the results confirm that CTX0E03 cells downregulated c-mycERTAM transgene expression both in vitro following EGF, bFGF and 4-OHT withdrawal and in vivo following implantation in MCAo rat brain. The silencing of the c-mycERTAM transgene in vivo provides an additional safety feature of CTX0E03

  20. Impact of six transgenic Bacillus thuringiensis rice lines on four nontarget thrips species attacking rice panicles in the paddy field.


    Akhtar, Z R; Tian, J C; Chen, Y; Fang, Q; Hu, C; Peng, Y F; Ye, G Y


    As a key component of ecological risk assessments, nontarget effects of Bacillus thuringiensis (Bt) rice have been tested under laboratory and field conditions for various organisms. A 2-yr field experiment was conducted to observe the nontarget effects of six transgenic rice lines (expressing the Cry1Ab or fused protein of Cry1Ab and Cry1Ac) on four nontarget thrips species including Frankliniella intonsa (Trybom), F. tenuicornis (Uzel), Haplothrips aculeatus (F.), and H. tritici (Kurd), as compared with their rice parental control lines. Two sampling methods including the beat plate and plastic bag method were used to monitor the population densities of the four thrips species for 2 yr. The results showed that the seasonal average densities of four tested thrips species in Bt rice plots were significantly lower than or very similar to those in the non-Bt rice plots depending on rice genotypes, sampling methods, and years. Among all six tested Bt rice lines, transgenic B1 and KMD2 lines suppressed the population of these tested thrips species the most. Our results indicate that the tested Bt rice lines are unlikely to result in high population pressure of thrips species in comparison with non-Bt rice. In some cases, Bt rice lines could significantly suppress thrips populations in the rice ecosystem. In addition, compatibility of Bt rice, with rice host plant resistance to nontarget sucking pests is also discussed within an overall integrated pest management program for rice. PMID:23339799

  1. Cre recombinase-regulated Endothelin1 transgenic mouse lines: novel tools for analysis of embryonic and adult disorders

    PubMed Central

    Tavares, Andre L.P.; Clouthier, David E.


    Endothelin-1 (EDN1) influences both craniofacial and cardiovascular development and a number of adult physiological conditions by binding to one or both of the known endothelin receptors, thus initiating multiple signaling cascades. Animal models containing both conventional and conditional loss of the Edn1 gene have been used to dissect EDN1 function in both embryos and adults. However, while transgenic Edn1 over-expression or targeted genomic insertion of Edn1 has been performed to understand how elevated levels of Edn1 result in or exacerbate disease states, an animal model in which Edn1 over-expression can be achieved in a spatiotemporal-specific manner has not been reported. Here we describe the creation of Edn1 conditional over-expression transgenic mouse lines in which the chicken β-actin promoter and an Edn1 cDNA are separated by a strong stop sequence flanked by loxP sites. In the presence of Cre, the stop cassette is removed, leading to Edn1 expression. Using the Wnt1-Cre strain, in which Cre expression is targeted to the Wnt1-expressing domain of the central nervous system (CNS) from which neural crest cells (NCCs) arise, we show that stable CBA-Edn1 transgenic lines with varying EDN1 protein levels develop defects in NCC-derived tissues of the face, though the severity differs between lines. We also show that Edn1 expression can be achieved in other embryonic tissues utilizing other Cre strains, with this expression also resulting in developmental defects. CBA-Edn1 transgenic mice will be useful in investigating diverse aspects of EDN1-mediated-development and disease, including understanding how NCCs achieve and maintain a positional and functional identity and how aberrant EDN1 levels can lead to multiple physiological changes and diseases. PMID:25725491

  2. Role of the durum wheat dehydrin in the function of proteases conferring salinity tolerance in Arabidopsis thaliana transgenic lines.


    Saibi, Walid; Zouari, Nabil; Masmoudi, Khaled; Brini, Faiçal


    Dehydrins are claimed to stabilize macromolecules against freezing damage, dehydration, ionic or osmotic stresses, thermal stress and re-folding yield. However, their precise function remains unknown. In this context, we report the behavior of protease activities in dehydrin transgenic Arabidopsis lines against the wild type plant under salt stress (100mM NaCl). Indeed, proteases play key roles in plants, maintaining strict protein quality control and degrading specific sets of proteins in response to diverse environmental and developmental stimuli. We proved that durum wheat DHN-5 modulates the activity of some proteases, summarized on the promotion of the Cysteinyl protease and the decrease of the Aspartyl protease activity. This fact is also upgraded in salt stress conditions. We conclude that the dehydrin transgenic context encodes salinity tolerance in transgenic lines through the modulation of the interaction not only at transcriptional level but also at protein level and also with the impact of salt stress as an endogenous and exogenous effector on some biocatalysts like proteases. PMID:26751399

  3. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    SciTech Connect

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros


    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  4. Assessment of fetal cell chimerism in transgenic pig lines generated by Sleeping beauty transposition.


    Garrels, Wiebke; Holler, Stephanie; Taylor, Ulrike; Herrmann, Doris; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A


    Human cells migrate between mother and fetus during pregnancy and persist in the respective host for long-term after birth. Fetal microchimerism occurs also in twins sharing a common placenta or chorion. Whether microchimerism occurs in multiparous mammals such as the domestic pig, where fetuses have separate placentas and chorions, is not well understood. Here, we assessed cell chimerism in litters of wild-type sows inseminated with semen of transposon transgenic boars. Segregation of three independent monomeric transposons ensured an excess of transgenic over non-transgenic offspring in every litter. Transgenic siblings (n = 35) showed robust ubiquitous expression of the reporter transposon encoding a fluorescent protein, and provided an unique resource to assess a potential cell trafficking to non-transgenic littermates (n = 7) or mothers (n = 4). Sensitive flow cytometry, fluorescence microscopy, and real-time PCR provided no evidence for microchimerism in porcine littermates, or piglets and their mothers in both blood and solid organs. These data indicate that the epitheliochorial structure of the porcine placenta effectively prevents cellular exchange during gestation. PMID:24811124

  5. Assessment of Fetal Cell Chimerism in Transgenic Pig Lines Generated by Sleeping Beauty Transposition

    PubMed Central

    Garrels, Wiebke; Holler, Stephanie; Taylor, Ulrike; Herrmann, Doris; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A.


    Human cells migrate between mother and fetus during pregnancy and persist in the respective host for long-term after birth. Fetal microchimerism occurs also in twins sharing a common placenta or chorion. Whether microchimerism occurs in multiparous mammals such as the domestic pig, where fetuses have separate placentas and chorions, is not well understood. Here, we assessed cell chimerism in litters of wild-type sows inseminated with semen of transposon transgenic boars. Segregation of three independent monomeric transposons ensured an excess of transgenic over non-transgenic offspring in every litter. Transgenic siblings (n = 35) showed robust ubiquitous expression of the reporter transposon encoding a fluorescent protein, and provided an unique resource to assess a potential cell trafficking to non-transgenic littermates (n = 7) or mothers (n = 4). Sensitive flow cytometry, fluorescence microscopy, and real-time PCR provided no evidence for microchimerism in porcine littermates, or piglets and their mothers in both blood and solid organs. These data indicate that the epitheliochorial structure of the porcine placenta effectively prevents cellular exchange during gestation. PMID:24811124

  6. [Creation of transgenic sugar beet lines expressing insect pest resistance genes cry1C and cry2A].


    Litvin, D I; Sivura, V V; Kurilo, V V; Oleneva, V D; Emets, A I; Blium, Ia B


    Impact of insect pests makes a significant limitation of the sugar beet crop yield. Integration of cry-genes of Bacillus thuringiensis into plant genome is one of the promising strategies to ensure plant resistance. The aim of this work was to obtain sugar beet lines (based on the MM 1/2 line) transformed with cry2A and cry1Cgenes. We have optimized transformation protocol and direct plant let regeneration protocol from leaf explants using 1 mg/l benzylaminopurine as well as 0,25 mg/l benzylaminopurine and 0,1 mg/l indole-butyric acid. Consequently, transgenic sugar beet lines transformed with vector constructs pRD400-cry1C and pRD400-cry2A have been obtained. PCR analysis revealed integration of cry2A and cry1C into genome of transgenic lines and expression of these genes in leaf tissues was shown by reverse transcription PCR. PMID:24818505

  7. Assessment of genome integrity in cattle transgenic cell lines using array CGH

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenic cattle carrying multiple genomic modifications have been produced by serial rounds of somatic cell chromatin transfer (cloning) of sequentially genetically targeted somatic cells. However, cloning efficiency tends to decline with the increase of rounds of cloning. It is possible that mult...

  8. Generation and characterization of transgenic plum lines expressing the Gastrodia anti-fungal protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Gastrodia anti-fungal protein (GAFP) is a monocot mannose-binding plant lectin isolated from the Asiatic orchid Gastrodia elata. This lectin has provided documented disease resistance in transgenic tobacco and cotton against several root diseases, but it's potential to confer disease resistance...

  9. Study of heat and radiation response of a malignant, melanin-producing cell line derived from C3H 10T1/2 cells transformed in culture by radiation

    SciTech Connect

    Raaphorst, G.P.; Vadasz, J.; Azzam, E.I.


    The mouse C3H 10T1/2 cell line was transformed to the malignant state using ionizing radiation. One of the transformed lines (R25) that was isolated, displayed some properties similar to malignant melanoma cells. The cells became dark and pigmented after prolonged time in culture and this cell line produced tumors in C3H mice. The radiation survival curve of R25 had a large shoulder which was also observed for human melanoma cell lines. R25 was more resistant to heating at 45.0 degrees C than the normal cell line. Heating at 45.0 degrees C before irradiation resulted in a reduction of the survival curve shoulder. The heat and radiation sensitivity of R25 did not appear to be related to the melanin content of these cells.

  10. Activation of the black seabream (Acanthopagrus schlegeli) somatolactin-alpha gene promoter by Pit-1c in the Hepa-T1 cell-line.


    Tian, Jing; Chan, King Ming


    Somatolactin (SL) is a pituitary hormone of the growth hormone (GH) gene family found only in fish. To understand the regulation of this hormone at the level of gene transcription, we obtained a SLalpha gene from black seabream (bsb), with its 5' flanking promoter region carrying several putative transcription factors including seven binding sites for pituitary-specific transcription factor 1 (Pit-1). To study the actions of Pit-1 on this gene promoter, we cloned three variants of bsbPit-1 (Pit-1a, Pit-1b and Pit-1c) derived from alternative splicing of mRNA or differential transcription start sites from black seabream pituitary. The deduced amino acid sequences of these Pit-1s contained 371 amino acids (aa), 333 and 311aa for the three Pit-1 variants, Pit-1a, Pit-1b and Pit-1c, respectively, with diverse regions of Pit-1 located at the transactivation domain. The actions of bsbPit-1 variants on the bsbSL gene promoter were investigated using a co-transfection assay, with a reporter gene using a transient expression assay in Hepa-T1 cells. The N-terminus truncated isoform bsbPit-1c showed the highest level of activity on SLalpha gene promoter activation in Hepa-T1 cells; however, neither Pit-1a nor Pit-1b activated the bsbSL gene promoter in the same study. PMID:19766121

  11. Comparison of the Rhizosphere Bacterial Communities of Zigongdongdou Soybean and a High-Methionine Transgenic Line of This Cultivar

    PubMed Central

    Ji, Jun; Wu, Haiying; Meng, Fang; Zhang, Mingrong; Zheng, Xiaobo; Wu, Cunxiang; Zhang, Zhengguang


    Previous studies have shown that methionine from root exudates affects the rhizosphere bacterial population involved in soil nitrogen fixation. A transgenic line of Zigongdongdou soybean cultivar (ZD91) that expresses Arabidopsis cystathionine γ-synthase resulting in an increased methionine production was examined for its influence to the rhizosphere bacterial population. Using 16S rRNA gene-based pyrosequencing analysis of the V4 region and DNA extracted from bacterial consortia collected from the rhizosphere of soybean plants grown in an agricultural field at the pod-setting stage, we characterized the populational structure of the bacterial community involved. In total, 87,267 sequences (approximately 10,908 per sample) were analyzed. We found that Acidobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Chloroflexi, Planctomycetes, Gemmatimonadetes, Firmicutes, and Verrucomicrobia constitute the dominant taxonomic groups in either the ZD91 transgenic line or parental cultivar ZD, and that there was no statistically significant difference in the rhizosphere bacterial community structure between the two cultivars. PMID:25079947

  12. Finite change analysis of glycolytic intermediates in tuber tissue of lines of transgenic potato (Solanum tuberosum) overexpressing phosphofructokinase.

    PubMed Central

    Thomas, S; Mooney, P J; Burrell, M M; Fell, D A


    Genetically engineered organisms overexpressing phosphofructokinase (PFK), a supposed 'regulatory' step of glycolysis, often show little or no measurable change in glycolytic or respiratory flux, although the concentrations of glycolytic intermediates may change. We have used the finite change theory of Metabolic Control Analysis (MCA) to analyse the concentrations of glycolytic metabolites in aged disks of tuber tissue from four lines of transgenic potatoes expressing different amounts of PFK that, under aerobic conditions, showed statistically indistinguishable rates of respiration. The constancy of the metabolites' concentration deviation indices for different increases in PFK expression indicated that the metabolite changes from a graded series, excluding the possibility of anomalous behaviour that might be observed in a single transgenic line. Consequently we were able to use the finite change method to validate the results of an MCA model of tuber glycolysis [Thomas, Mooney, Burrell and Fell (1997) Biochem. J. 322, 119-127]. Furthermore the metabolite changes with PFK activity are evidence that near-equilibrium steps do not transmit increased substrate concentrations down the pathway without attenuation. Our results support the view that flux increase by activation of a single enzyme early in the pathway will, contrary to expectations, be of limited effectiveness in achieving flux increases. PMID:9078250

  13. A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis.


    Marquès-Bueno, Maria Mar; Morao, Ana K; Cayrel, Anne; Platre, Matthieu P; Barberon, Marie; Caillieux, Erwann; Colot, Vincent; Jaillais, Yvon; Roudier, François; Vert, Grégory


    Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936

  14. Enteric plexuses of two choline-acetyltransferase transgenic mouse lines: chemical neuroanatomy of the fluorescent protein-expressing nerve cells.


    Wilhelm, Márta; Lawrence, J Josh; Gábriel, Robert


    We studied cholinergic circuit elements in the enteric nervous system (ENS) of two distinct transgenic mouse lines in which fluorescent protein expression was driven by the choline-acetyltransferase (ChAT) promoter. In the first mouse line, green fluorescent protein was fused to the tau gene. This construct allowed the visualization of the fiber tracts and ganglia, however the nerve cells were poorly resolved. In the second mouse line (ChATcre-YFP), CRE/loxP recombination yielded cytosolic expression of yellow fluorescent protein (YFP). In these preparations the morphology of enteric neurons could be well studied. We also determined the neurochemical identity of ENS neurons in muscular and submucous layers using antibodies against YFP, calretinin (CALR), calbindin (CALB), and vasoactive intestinal peptide (VIP). Confocal microscopic imaging was used to visualize fluorescently-conjugated secondary antibodies. In ChATcre-YFP preparations, YFP was readily apparent in somatodendritic regions of ENS neurons. In the myenteric plexus, YFP/CALR/VIP staining revealed that 34% of cholinergic cells co-labeled with CALR. Few single-stained CR-positive cells were observed. Neither YFP nor CALR co-localized with VIP. In GFP/CALB/CALR staining, all co-localization combinations were represented. In the submucosal plexus, YFP/CALR/VIP staining revealed discrete neuronal populations. However, in separate preparations, double labeling was observed for YFP/CALR and CALR/VIP. In YFP/CALR/CALB staining, all combinations of double staining and triple labeling were verified. In conclusion, the neurochemical coding of ENS neurons in these mouse lines is consistent with many observations in non-transgenic animals. Thus, they provide useful tools for physiological and pharmacological studies on distinct neurochemical subtypes of ENS neurons. PMID:25592616

  15. Establishment of transgenic lines for jumpstarter method using a composite transposon vector in the ladybird beetle, Harmonia axyridis.


    Kuwayama, Hisashi; Gotoh, Hiroki; Konishi, Yusuke; Nishikawa, Hideto; Yaginuma, Toshinobu; Niimi, Teruyuki


    In this post-genomic era, genome-wide functional analysis is indispensable. The recent development of RNA interference techniques has enabled researchers to easily analyze gene function even in non-model organisms. On the other hand, little progress has been made in the identification and functional analyses of cis-regulatory elements in non-model organisms. In order to develop experimental platform for identification and analyses of cis-regulatory elements in a non-model organism, in this case, the ladybird beetle, Harmonia axyridis, we established transgenic transposon-tagged lines using a novel composite vector. This vector enables the generation of two types of insertion products (jumpstarter and mutator). The jumpstarter portion carries a transposase gene, while the mutator segment carries a reporter gene for detecting enhancers. The full-composite element is flanked by functional termini (required for movement); however, the mutator region has an extra terminus making it possible for the mutator to remobilize on its own, thus leaving an immobile jumpstarter element behind. Each insertion type is stable on its own, but once crossed, jumpstarters can remobilize mutators. After crossing a jumpstarter and mutator line, all tested G2 females gave rise to at least one new insertion line in the next generation. This jumping rate is equivalent to the P-element-mediated jumpstarter method in Drosophila. These established transgenic lines will offer us the ideal experimental materials for the effective screening and identification of enhancers in this species. In addition, this jumpstarter method has the potential to be as effective in other non-model insect species and thus applicable to any organism. PMID:24959904

  16. Establishment of a human cell line (SKI-DLCL-1) with a t(1;14)(q21;q32) translocation from the ascites of a patient with diffuse large cell lymphoma.


    Goy, A; Gilles, F; Remache, Y; Filippa, D; Portlock, C S; Jhanwar, S C; Zelenetz, A D


    Cytogenetic abnormalities at chromosome 1q21 are among the most common second genetic events observed in Non-Hodgkin's Lymphomas and have prognostic significance. Recently, BCL9 has been cloned from a pre-B-cell lymphoblastic leukemia cell line, which carried a t(1:14)(q21;q32). However, among a panel of 39 B-cell malignancies with 1q21 translocation, only two cases showed rearrangement for the BCL9 gene. We report the establishment of a new lymphoma cell line from a patient with relapsed diffuse large cell lymphoma. This cell line SKI-DLCL-1 showed cell surface antigens identical to the original tumor and demonstrated the profile of a mature B-cell phenotype: CD19 and CD20 positive, CD5 and C10 negative. It carried a t(1;14)(q21;q32) translocation identical to the original tumor. Although the clinical presentation was an isolated effusion lymphoma, studies for HIV-1, HHV8 and EBV were all negative. Southern blot analysis demonstrated that BCL9 was not rearranged in the SKI-DLCL-1 cell line. In addition, the BCL9 gene was not over-expressed in SKI-DLCL-1 cell line. The identification of a new locus at 1q21 will help clarify the pathogenesis of B-cell malignancies with a translocation involving this locus. PMID:11426565

  17. Establishment of a Transgenic Zebrafish Line for Superficial Skin Ablation and Functional Validation of Apoptosis Modulators In Vivo

    PubMed Central

    Chen, Chi-Fang; Chu, Che-Yu; Chen, Te-Hao; Lee, Shyh-Jye; Shen, Chia-Ning; Hsiao, Chung-Der


    Background Zebrafish skin is composed of enveloping and basal layers which form a first-line defense system against pathogens. Zebrafish epidermis contains ionocytes and mucous cells that aid secretion of acid/ions or mucous through skin. Previous studies demonstrated that fish skin is extremely sensitive to external stimuli. However, little is known about the molecular mechanisms that modulate skin cell apoptosis in zebrafish. Methodology/Principal Findings This study aimed to create a platform to conduct conditional skin ablation and determine if it is possible to attenuate apoptotic stimuli by overexpressing potential apoptosis modulating genes in the skin of live animals. A transgenic zebrafish line of Tg(krt4:NTR-hKikGR)cy17 (killer line), which can conditionally trigger apoptosis in superficial skin cells, was first established. When the killer line was incubated with the prodrug metrodinazole, the superficial skin displayed extensive apoptosis as judged by detection of massive TUNEL- and active caspase 3-positive signals. Great reductions in NTR-hKikGR+ fluorescent signals accompanied epidermal cell apoptosis. This indicated that NTR-hKikGR+ signal fluorescence can be utilized to evaluate apoptotic events in vivo. After removal of metrodinazole, the skin integrity progressively recovered and NTR-hKikGR+ fluorescent signals gradually restored. In contrast, either crossing the killer line with testing lines or transiently injecting the killer line with testing vectors that expressed human constitutive active Akt1, mouse constitutive active Stat3, or HPV16 E6 element displayed apoptosis-resistant phenotypes to cytotoxic metrodinazole as judged by the loss of reduction in NTR-hKikGR+ fluorescent signaling. Conclusion/Significance The killer/testing line binary system established in the current study demonstrates a nitroreductase/metrodinazole system that can be utilized to conditionally perform skin ablation in a real-time manner, and provides a valuable tool to

  18. Megaesophagus in a Line of Transgenic Rats: A Model of Achalasia

    PubMed Central

    Pang, J.; Borjeson, T. M.; Muthupalani, S.; Ducore, R. M.; Carr, C. A.; Feng, Y.; Sullivan, M. P.; Cristofaro, V.; Luo, J.; Lindstrom, J. M.; Fox, J. G.


    Megaesophagus is defined as the abnormal enlargement or dilatation of the esophagus, characterized by a lack of normal contraction of the esophageal walls. This is called achalasia when associated with reduced or no relaxation of the lower esophageal sphincter (LES). To date, there are few naturally occurring models for this disease. A colony of transgenic (Pvrl3-Cre) rats presented with megaesophagus at 3 to 4 months of age; further breeding studies revealed a prevalence of 90% of transgene-positive animals having megaesophagus. Affected rats could be maintained on a total liquid diet long term and were shown to display the classic features of dilated esophagus, closed lower esophageal sphincter, and abnormal contractions on contrast radiography and fluoroscopy. Histologically, the findings of muscle degeneration, inflammation, and a reduced number of myenteric ganglia in the esophagus combined with ultrastructural lesions of muscle fiber disarray and mitochondrial changes in the striated muscle of these animals closely mimic that seen in the human condition. Muscle contractile studies looking at the response of the lower esophageal sphincter and fundus to electrical field stimulation, sodium nitroprusside, and L-nitro-L-arginine methyl ester also demonstrate the similarity between megaesophagus in the transgenic rats and patients with achalasia. No primary cause for megaesophagus was found, but the close parallel to the human form of the disease, as well as ease of care and manipulation of these rats, makes this a suitable model to better understand the etiology of achalasia as well as study new management and treatment options for this incurable condition. PMID:24457157

  19. Megaesophagus in a line of transgenic rats: a model of achalasia.


    Pang, J; Borjeson, T M; Muthupalani, S; Ducore, R M; Carr, C A; Feng, Y; Sullivan, M P; Cristofaro, V; Luo, J; Lindstrom, J M; Fox, J G


    Megaesophagus is defined as the abnormal enlargement or dilatation of the esophagus, characterized by a lack of normal contraction of the esophageal walls. This is called achalasia when associated with reduced or no relaxation of the lower esophageal sphincter (LES). To date, there are few naturally occurring models for this disease. A colony of transgenic (Pvrl3-Cre) rats presented with megaesophagus at 3 to 4 months of age; further breeding studies revealed a prevalence of 90% of transgene-positive animals having megaesophagus. Affected rats could be maintained on a total liquid diet long term and were shown to display the classic features of dilated esophagus, closed lower esophageal sphincter, and abnormal contractions on contrast radiography and fluoroscopy. Histologically, the findings of muscle degeneration, inflammation, and a reduced number of myenteric ganglia in the esophagus combined with ultrastructural lesions of muscle fiber disarray and mitochondrial changes in the striated muscle of these animals closely mimic that seen in the human condition. Muscle contractile studies looking at the response of the lower esophageal sphincter and fundus to electrical field stimulation, sodium nitroprusside, and L-nitro-L-arginine methyl ester also demonstrate the similarity between megaesophagus in the transgenic rats and patients with achalasia. No primary cause for megaesophagus was found, but the close parallel to the human form of the disease, as well as ease of care and manipulation of these rats, makes this a suitable model to better understand the etiology of achalasia as well as study new management and treatment options for this incurable condition. PMID:24457157

  20. Molecular cytogenetic analyses of HIG, a novel human cell line carrying t(1;3)(p36.3;q25.3) established from a patient with chronic myelogenous leukemia in blastic crisis.


    Hosoya, Noriko; Ogawa, Seishi; Motokura, Tohru; Hangaishi, Akira; Wang, Lili; Qiao, Ying; Nannya, Yasuhito; Kogi, Mieko; Hirai, Hisamaru


    Chromosomal abnormalities involving 1p36, 3q21, and/or 3q26 have been reported in a subset of myeloid neoplasms having characteristic dysmegakaryopoiesis, and the overexpression of EVI1 on 3q26 or of MEL1 on 1p36 has been implicated in their pathogenesis. We describe molecular cytogenetic analyses of a novel human cell line, HIG, established from a unique case in which a novel translocation t(1;3)(p36;q26) appeared as the sole additional chromosomal abnormality at the time of blastic transformation of chronic myelogenous leukemia. The patient displayed clinical features resembling those of the 3q21q26 syndrome. The HIG cell line retained der(1)t(1;3)(p36;q26) but lost t(9;22)(q34;q11). To identify the relevant gene that would be deregulated by this translocation, we molecularly cloned the translocation's breakpoints. They were distant from the breakpoint cluster regions of the 3q21q26 syndrome or t(1;3)(p36;q21), and neither the EVI1 nor the MEL1 transcript was detected in the HIG cell line. None of the genes located within 150 kilobase pairs of the breakpoints were aberrantly expressed, suggesting that in this case other gene(s) more distant from the breakpoints are deregulated by possible remote effects. Further analyses of the deregulated genes in the HIG cell line should provide important insight into the mechanisms involved in these types of leukemias. PMID:14704036

  1. Comparative transcriptional and proteomic profiling of bread wheat cultivar and its derived transgenic line over-expressing a low molecular weight glutenin subunit gene in the endosperm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have carried out a parallel transcriptional and proteomic comparison of seeds from a transformed bread wheat line that over-expresses a transgenic low molecular weight glutenin subunit gene relative to the corresponding non-transformed genotype. Proteomic analyses showed that, during seed develop...

  2. Transgenic maize lines with cell-type specific expression of fluorescent proteins in plastids.


    Sattarzadeh, Amir; Fuller, Jonathan; Moguel, Salvador; Wostrikoff, Katia; Sato, Shirley; Covshoff, Sarah; Clemente, Tom; Hanson, Maureen; Stern, David B


    Plastid number and morphology vary dramatically between cell types and at different developmental stages. Furthermore, in C4 plants such as maize, chloroplast ultrastructure and biochemical functions are specialized in mesophyll and bundle sheath cells, which differentiate acropetally from the proplastid form in the leaf base. To develop visible markers for maize plastids, we have created a series of stable transgenics expressing fluorescent proteins fused to either the maize ubiquitin promoter, the mesophyll-specific phosphoenolpyruvate carboxylase (PepC) promoter, or the bundle sheath-specific Rubisco small subunit 1 (RbcS) promoter. Multiple independent events were examined and revealed that maize codon-optimized versions of YFP and GFP were particularly well expressed, and that expression was stably inherited. Plants carrying PepC promoter constructs exhibit YFP expression in mesophyll plastids and the RbcS promoter mediated expression in bundle sheath plastids. The PepC and RbcS promoter fusions also proved useful for identifying plastids in organs such as epidermis, silks, roots and trichomes. These tools will inform future plastid-related studies of wild-type and mutant maize plants and provide material from which different plastid types may be isolated. PMID:20051034

  3. T-1 Training Area

    SciTech Connect


    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  4. T-1 Training Area




    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  5. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry

    PubMed Central

    Ikeda, Keiko; Takahashi, Masanori; Sato, Shigeru; Igarashi, Hiroyuki; Ishizuka, Toru; Yawo, Hiromu; Arata, Satoru; Southard-Smith, E. Michelle; Kawakami, Kiyoshi; Onimaru, Hiroshi


    The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG) and the pre-Bötzinger complex group (preBötC). The pFRG partially overlaps in the retrotrapezoid nucleus (RTN), which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I) neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg) rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems. PMID:26147470

  6. A novel Amh-Treck transgenic mouse line allows toxin-dependent loss of supporting cells in gonads.


    Shinomura, Mai; Kishi, Kasane; Tomita, Ayako; Kawasumi, Miyuri; Kanezashi, Hiromi; Kuroda, Yoshiko; Tsunekawa, Naoki; Ozawa, Aisa; Aiyama, Yoshimi; Yoneda, Asuka; Suzuki, Hitomi; Saito, Michiko; Picard, Jean-Yves; Kohno, Kenji; Kurohmaru, Masamichi; Kanai-Azuma, Masami; Kanai, Yoshiakira


    Cell ablation technology is useful for studying specific cell lineages in a developing organ in vivo. Herein, we established a novel anti-Müllerian hormone (AMH)-toxin receptor-mediated cell knockout (Treck) mouse line, in which the diphtheria toxin (DT) receptor was specifically activated in Sertoli and granulosa cells in postnatal testes and ovaries respectively. In the postnatal testes of Amh-Treck transgenic (Tg) male mice, DT injection induced a specific loss of the Sertoli cells in a dose-dependent manner, as well as the specific degeneration of granulosa cells in the primary and secondary follicles caused by DT injection in Tg females. In the testes with depletion of Sertoli cell, germ cells appeared to survive for only several days after DT treatment and rapidly underwent cell degeneration, which led to the accumulation of a large amount of cell debris within the seminiferous tubules by day 10 after DT treatment. Transplantation of exogenous healthy Sertoli cells following DT treatment rescued the germ cell loss in the transplantation sites of the seminiferous epithelia, leading to a partial recovery of the spermatogenesis. These results provide not only in vivo evidence of the crucial role of Sertoli cells in the maintenance of germ cells, but also show that the Amh-Treck Tg line is a useful in vivo model of the function of the supporting cell lineage in developing mammalian gonads. PMID:25212783

  7. Effect of vegetation of transgenic Bt rice lines and their straw amendment on soil enzymes, respiration, functional diversity and community structure of soil microorganisms under field conditions.


    Fang, Hua; Dong, Bin; Yan, Hu; Tang, Feifan; Wang, Baichuan; Yu, Yunlong


    With the development of transgenic crops, there is an increasing concern about the possible adverse effects of their vegetation and residues on soil environmental quality. This study was carried out to evaluate the possible effects of the vegetation of transgenic Bt rice lines Huachi B6 (HC) and TT51 (TT) followed by the return of their straw to the soil on soil enzymes (catalase, urease, neutral phosphatase and invertase), anaerobic respiration activity, microbial utilization of carbon substrates and community structure, under field conditions. The results indicated that the vegetation of the two transgenic rice lines (HC and TT) and return of their straw had few adverse effects on soil enzymes and anaerobic respiration activity compared to their parent and distant parent, although some transient differences were observed. The vegetation and subsequent straw amendment of Bt rice HC and TT did not appear to have a harmful effect on the richness, evenness and community structure of soil microorganisms. No different pattern of impact due to plant species was found between HC and TT. It could be concluded that the vegetation of transgenic Bt rice lines and the return of their straw as organic fertilizer may not alter soil microbe-mediated functions. PMID:23513447

  8. Transgenic indica rice lines, expressing Brassica juncea Nonexpressor of pathogenesis-related genes 1 (BjNPR1), exhibit enhanced resistance to major pathogens.


    Sadumpati, Vijayakumar; Kalambur, Muralidharan; Vudem, Dashavantha Reddy; Kirti, Pulugurtha Bharadwaja; Khareedu, Venkateswara Rao


    Brassica juncea Nonexpressor of pathogenesis-related genes 1 (BjNPR1) has been introduced into commercial indica rice varieties by Agrobacterium-mediated genetic transformation. Transgenic rice plants were regenerated from the phosphinothricin-resistant calli obtained after co-cultivation with Agrobacterium strain LBA4404 harbouring Ti plasmid pSB111-bar-BjNPR1. Molecular analyses confirmed the stable integration and expression of BjNPR1 in various transgenic rice lines. Transgenes NPR1 and bar were stably inherited and disclosed co-segregation in subsequent generations in a Mendelian fashion. Homozygous transgenic rice lines expressing BjNPR1 protein displayed enhanced resistance to rice blast, sheath blight and bacterial leaf blight diseases. Rice transformants with higher levels of NPR1 revealed notable increases in plant height, panicle length, flag-leaf length, number of seeds/panicle and seed yield/plant as compared to the untransformed plants. The overall results amply demonstrate the profound impact of BjNPR1 in imparting resistance against major pathogens of rice. The multipotent BjNPR1, as such, seems promising as a prime candidate gene to fortify crop plants with durable resistance against various pathogens. PMID:23664883

  9. Detection of feral GT73 transgenic oilseed rape (Brassica napus) along railway lines on entry routes to oilseed factories in Switzerland.


    Hecht, Mirco; Oehen, Bernadette; Schulze, Jürg; Brodmann, Peter; Bagutti, Claudia


    To obtain a reference status prior to cultivation of genetically modified oilseed rape (OSR, Brassica napus L.) in Switzerland, the occurrence of feral OSR was monitored along transportation routes and at processing sites. The focus was set on the detection of (transgenic) OSR along railway lines from the Swiss borders with Italy and France to the respective oilseed processing factories in Southern and Northern Switzerland (Ticino and region of Basel). A monitoring concept was developed to identify sites of largest risk of escape of genetically modified plants into the environment in Switzerland. Transport spillage of OSR seeds from railway goods cars particularly at risk hot spots such as switch yards and (un)loading points but also incidental and continuous spillage were considered. All OSR plants, including their hybridization partners which were collected at the respective monitoring sites were analyzed for the presence of transgenes by real-time PCR. On sampling lengths each of 4.2 and 5.7 km, respectively, 461 and 1,574 plants were sampled in Ticino and the region of Basel. OSR plants were found most frequently along the routes to the oilseed facilities, and in larger amounts on risk hot spots compared to sites of random sampling. At three locations in both monitored regions, transgenic B. napus line GT73 carrying the glyphosate resistance transgenes gox and CP4 epsps were detected (Ticino, 22 plants; in the region of Basel, 159). PMID:23917737

  10. Inducible mutagenesis in TEPC 2372, a mouse plasmacytoma cell line that harbors the transgenic shuttle vector lambdaLIZ.


    Felix, K; Kovalchuk, A L; Park, S S; Coleman, A E; Ramsay, E S; Qian, M; Kelliher, K A; Jones, G M; Ried, T; Bornkamm, G W; Janz, S


    The plasmacytoma cell line, TEPC 2372, was derived from a malignant plasma cell tumor that developed in the peritoneal cavity of a BALB/c mouse that harbored the transgenic shuttle vector for the assessment of mutagenesis in vivo, lambdaLIZ. TEPC 2372 was found to display the typical features of a BALB/c plasmacytoma. It consisted of pleomorphic plasma cells that secreted a monoclonal immunoglobulin (IgG2b/lambda), was initially dependent on the presence of IL-6 to grow in cell culture, contained a hyperdiploid chromosome complement with a tendency to undergo tetraploidization, and harbored a constitutively active c-myc gene by virtue of a T(6;15) chromosomal translocation. TEPC 2372 was further characterized by the ability to respond to in vitro exposure with 4-NQO (4-nitroquinoline-1-oxide), an oxidative model mutagen, with a vigorous dose-dependent increase in mutagenesis that peaked at a 7.85-fold elevation of mutant rates in lambdaLIZ when compared to background mutant rates in untreated controls. Cotreatment with 4-NQO and BSO (buthionine sulfoximine), a glutathione-depleting compound that causes endogenous oxidative stress, resulted in a 9.03-fold increase in the mutant frequency in lambdaLIZ. These results demonstrated that TEPC 2372, the malignant plasma cell counterpart of the lambdaLIZ-based in vivo mutagenesis assay, may be useful as an in vitro reference point for the further elucidation of oxidative mutagenesis in lymphoid tissues. PMID:11166031

  11. Chemically induced skin carcinogenesis in a transgenic mouse line (TG.AC) carrying a v-Ha-ras gene.


    Spalding, J W; Momma, J; Elwell, M R; Tennant, R W


    A transgenic mouse line (TG.AC) created in the FVB/N strain, carries a v-Ha-ras gene fused to a zeta-globin promoter gene. These trangenic mice have the properties of genetically initiated skin and have been shown to be sensitive to 12-O-tetradecanoylphorbol-13-acetate (TPA), a well-described promoter of skin papillomas in the two-stage mouse skin tumorigenesis model. It was of interest to determine whether the TG.AC mouse strain was also responsive to other known promoters. Groups of heterozygous or homozygous TG.AC mice were treated topically, 2x/week, for up to 20 weeks with benzoyl peroxide (BPO), 2-butanol peroxide (2-BUP), phenol (PH), acetic acid (AA), TPA and acetone (ACN), the vehicle control. Skin papillomas were induced in all groups treated with TPA, BPO and 2-BUP. Papillomas were observed in some treatment groups as early as 3 weeks. The relative activity of the promoters was TPA > 2-BUP > BPO > PH = AA = ACN. No papillomas were observed in any of the uninitiated FVB/N mice treated in a similar manner and which served as treatment control groups. Studies to determine the sensitivity of TG.AC mice to TPA, indicated that a total dose of 25-30 micrograms of TPA administered in 3 or 10 applications, was sufficient to induce an average incidence of 11-15 papillomas per mouse. The papilloma incidence continued to increase and was maintained up to 15 weeks after TPA treatment was terminated. The short latency period and high incidence of papilloma induction indicate that TG.AC mice have a high sensitivity to known skin promoters. The TG.AC line should prove to be a sensitive model for identifying putative tumor promoters or complete carcinogens. PMID:8330346

  12. Opposing effects of APP/PS1 and TrkB.T1 genotypes on midbrain dopamine neurons and stimulated dopamine release in vivo.


    Kärkkäinen, E; Yavich, L; Miettinen, P O; Tanila, H


    Brain derived neurotrophic factor (BDNF) signaling disturbances in Alzheimer׳s disease (AD) have been demonstrated. BDNF levels fall in AD, but the ratio between truncated and full-length BDNF receptors TrkB.T1 and TrkB.TK, respectively, increases in brains of AD patients and APPswe/PS1dE9 (APP/PS1) AD model mice. Dopaminergic (DAergic) system disturbances in AD and detrimental effects of BDNF signaling deficits on DAergic system functions have also been indicated. Against this, we investigated changes in nigrostriatal dopamine (DA) system in mice carrying APP/PS1 and/or TrkB.T1 transgenes, the latter line modeling the TrkB.T1/TK ratio change in AD. Employing in vivo voltammetry, we found normal short-term DA release in caudate-putamen of mice carrying APP/PS1 or TrkB.T1 transgenes but impaired capacity to recruit more DA upon prolonged stimulation. However, mice carrying both transgenes did not differ from wild-type controls. Immunohistochemistry revealed normal density of tyrosine hydroxylase positive axon terminals in caudate-putamen in all genotypes and intact presynaptic machinery for DA release and reuptake, as shown by unchanged levels of SNAP-25, α-synuclein and DA transporter. However, we observed increased DAergic neurons in substantia nigra of TrkB.T1 mice resulting in decreased tyrosine hydroxylase per neuron in TrkB.T1 mice. The finding of unchanged nigral DAergic neurons in APP/PS1 mice largely confirms earlier reports, but the unexpected increase in midbrain DA neurons in TrkB.T1 mice is a novel finding. We suggest that both APP/PS1 and TrkB.T1 genotypes disrupt DAergic signaling, but via separate mechanisms. PMID:26168899

  13. Analysis of Different Promoter Systems for Efficient Transgene Expression in Mouse Embryonic Stem Cell Lines

    PubMed Central

    Chung, Sangmi; Andersson, Therese; Sonntag, Kai-C.; Björklund, Lars; Isacson, Ole; Kim, Kwang-Soo


    Mouse embryonic stem (ES) cells are derived from the inner cell mass of the preimplantation embryo and have the developmental capacity to generate all cell types of the body. Combined with efficient genetic manipulation and in vitro differentiation procedures, ES cells are a useful system for the molecular analysis of developmental pathways. We analyzed and compared the transcriptional activities of a cellular polypeptide chain elongation factor 1 alpha (EF), a cellular-virus hybrid (cytomegalo-virus [CMV] immediate early enhancer fused to chicken β-actin [CBA]), and a viral CMV promoter system in two ES cell lines. When transiently transfected, the EF and CBA promoters robustly drove reporter gene expression, while the CMV promoter was inactive. We also demonstrated that the EF and CBA promoters effectively drove gene expression in different stages of cell development: naïve ES cells, embryoid bodies (EBs), and neuronal precursor cells. In contrast, the CMV promoter did not have transcriptional activity in either ES cells or EB but had significant activity once ES cells differentiated into neuronal precursors. Our data show that individual promoters have different abilities to express reporter gene expression in the ES and other cell types tested. PMID:11897870

  14. Production of mRNA from the cry1Ac transgene differs among Bollgard lines which correlates to the level of subsequent protein.


    Adamczyk, John J; Perera, Omaththage; Meredith, William R


    Commercial cultivars of Bollgard cotton, Gossypium hirsutum L., differ in the amount of expressed Cry1Ac protein. However, the plant-mechanism for which this occurs is still unknown. Using quantitative real-time polymerase chain reaction (qPCR), we developed a method to determine if differences in the overall level of Cry1Ac among Bollgard lines could be correlated to the mRNA transcripts. Our data shows that the cry1Ac mRNA transcript differs among Bollgard lines and are correlated with corresponding Cry1Ac protein levels. In addition, qPCR based methods can efficiently be employed to quantify Cry1Ac protein expression levels in transgenic cotton cultivars. We postulate that qPCR based methods could be successfully employed for quantifying expression levels of transgenes in plants carrying different Bt toxins. PMID:18594999

  15. Transgene-free human induced pluripotent stem cell line (HS5-SV.hiPS) generated from cesarean scar-derived fibroblasts.


    Rungsiwiwut, Ruttachuk; Pavarajarn, Wipawee; Numchaisrika, Pranee; Virutamasen, Pramuan; Pruksananonda, Kamthorn


    Transgene-free human HS5-SV.hiPS line was generated from human cesarean scar-derived fibroblasts using temperature-sensitive Sendai virus vectors carrying Oct4, Sox2, cMyc and Klf4 exogenous transcriptional factors. The viral constructs were eliminated from HS5-SV.hiPS line through heat treatment. Transgene-free HS5-SV.hiPS cells expressed pluripotent associated transcription factors Oct4, Nanog, Sox2, Rex1 and surface markers SSEA-4, TRA-1-60 and OCT4. HS5-SV.hiPS cells formed embryoid bodies and differentiated into three embryonic germ layers in vivo. HS5-SV.hiPS cells maintained their normal karyotype (46, XX) after culture for extended period. HS5-SV.hiPS displayed the similar pattern of DNA fingerprinting to the parenteral scar-derived fibroblasts. PMID:27345776

  16. Generation of transgenic watermelon resistant to Zucchini yellow mosaic virus and Papaya ringspot virus type W.


    Yu, Tsong-Ann; Chiang, Chu-Hui; Wu, Hui-Wen; Li, Chin-Mei; Yang, Ching-Fu; Chen, Jun-Han; Chen, Yu-Wen; Yeh, Shyi-Dong


    Zucchini yellow mosaic virus (ZYMV) and Papaya ringspot virus type W (PRSV W) are major limiting factors for production of watermelon worldwide. For the effective control of these two viruses by transgenic resistance, an untranslatable chimeric construct containing truncated ZYMV coat protein (CP) and PRSV W CP genes was transferred to commercial watermelon cultivars by Agrobacterium-mediated transformation. Using our protocol, a total of 27 putative transgenic lines were obtained from three cultivars of 'Feeling' (23 lines), 'China baby' (3 lines), and 'Quality' (1 line). PCR and Southern blot analyses confirmed that the chimeric construct was incorporated into the genomic DNA of the transformants. Greenhouse evaluation of the selected ten transgenic lines of 'Feeling' cultivar revealed that two immune lines conferred complete resistance to ZYMV and PRSV W, from which virus accumulation were not detected by Western blotting 4 weeks after inoculation. The transgenic transcript was not detected, but small interfering RNA (siRNA) was readily detected from the two immune lines and T(1) progeny of line ZW 10 before inoculation, indicating that RNA-mediated post-transcriptional gene silencing (PTGS) is the underlying mechanism for the double-virus resistance. The segregation ratio of T(1) progeny of the immune line ZW10 indicated that the single inserted transgene is nuclearly inherited and associated with the phenotype of double-virus resistance as a dominant trait. The transgenic lines derived from the commercial watermelon cultivars have great potential for control of the two important viruses and can be implemented directly without further breeding. PMID:21079966

  17. Activation of transgenic estrogen receptor-beta by selected phytoestrogens in a stably transduced rat serotonergic cell line.


    Amer, Dena A M; Kretzschmar, Georg; Müller, Nicole; Stanke, Nicole; Lindemann, Dirk; Vollmer, Günter


    Many flavonoids, a major group of phenolic plant-derived secondary metabolites, are known to possess estrogen-like bioactivities. However, little is known about their estrogenic properties in the central nervous system due to the lack of suitable cellular models expressing sufficient amounts of functional estrogen receptor beta (ERbeta). To overcome this deficit, we have created a cellular model, which is serotonergic in origin, to study properties of estrogenic substances by stably transducing RN46A-B14 cells derived from raphe nuclei region of the rat brain with a lentiviral vector encoding a human ERbeta. We clearly showed that the transgenic human ERbeta is a spontaneously expressed and a functional receptor. We have further assessed the estrogenicity of three different isoflavones and four different naringenin-type flavanones in this cell line utilizing a luciferase reporter gene assay. Genistein (GEN), Daidzein (DAI), Equol (EQ), Naringenin (NAR) and 8-prenylnaringenin (8-PN) showed strong estrogenic activity in a concentration-dependent manner as compared to 7-(O-prenyl)naringenin-4'-acetate (7-O-PN) which was only slightly estrogenic and 6-(1,1-dimethylallyl)naringenin (6-DMAN) that neither showed estrogenic nor anti-estrogenic activity in our model. All observed effects could be antagonized by the anti-estrogen fulvestrant. Moreover, co-treatment of cells with 17beta-estradiol (E2) and either GEN or DAI showed a slight additive effect as compared to EQ. On the other hand, 8-PN in addition to 7-O-PN, but not NAR and 6-DMAN, were able to slightly antagonize the responses triggered by E2. Our newly established cellular model may prove to be a useful tool in explicating basic physiological properties of ERbeta in the brain and may help unravel molecular and cellular mechanisms involved in serotonergic mood regulation by estrogen or potential plant-derived secondary metabolites. PMID:20433925

  18. Phenotype and Hierarchy of Two Transgenic T Cell Lines Targeting the Respiratory Syncytial Virus KdM282-90 Epitope Is Transfer Dose-Dependent.


    Morabito, Kaitlyn M; Erez, Noam; Graham, Barney S; Ruckwardt, Tracy J


    In this study, we compared two lines of transgenic CD8+ T cells specific for the same KdM282-90 epitope of respiratory syncytial virus in the CB6F1 hybrid mouse model. Here we found that these two transgenic lines had similar in vivo abilities to control viral load after respiratory syncytial virus infection using adoptive transfer. Transfer of the TRBV13-2 line resulted in higher levels of IL-6 and MIP1-α in the lung than TRBV13-1 transfer. Interestingly, when large numbers of cells were co-transferred, the lines formed a hierarchy, with TRBV13-2 being immunodominant over TRBV13-1 in the mediastinal lymph node despite no identifiable difference in proliferation or apoptosis between the lines. This hierarchy was not established when lower cell numbers were transferred. The phenotype and frequency of proliferating cells were also cell transfer dose-dependent with higher percentages of CD127loCD62LloKLRG1lo and proliferating cells present when lower numbers of cells were transferred. These results illustrate the importance of cell number in adoptive transfer experiments and its influence on the phenotype and hierarchy of the subsequent T cell response. PMID:26752171

  19. Agronomic performance and transcriptional analysis of carotenoid biosynthesis in fruits of transgenic HighCaro and control tomato lines under field conditions.


    Giorio, Giovanni; Stigliani, Adriana Lucia; D'Ambrosio, Caterina


    Genetic manipulation of carotenoid biosynthesis in higher plants has been the objective of a number of biotechnology programs, e.g. the Golden Rice Program. However, tomato (Solanum lycopersicum L.), which naturally accumulates lycopene in fruits, has attracted the attention of many groups who have manipulated it to increase or diversify carotenoid accumulation. One of the most significant achievements was "HighCaro (HC)," a transgenic tomato plant constitutively expressing the tomato lycopene beta-cyclase (tLcy-b), that produces orange fruits due to the complete conversion of lycopene to beta-carotene. In this article we report the results of a field trial conducted in Metaponto (Italy) on HC and on two control genotypes to evaluate the stability of the transgenic trait and their yield performances. Transcriptional regulation of eight genes involved in carotenogenesis was assayed by quantitative real-time PCR (qRT-PCR) analysis on fruits collected at four distinct development stages. Statistical analysis results demonstrated that in field conditions the transgene maintained its ability to induce the conversion of lycopene to beta-carotene. Moreover, agronomic performances and fruit quality in the transgenic line were not impaired by this metabolic disturbance. Results of qRT-PCR analysis suggested that transcription of PSY-1, PDS and ZDS genes were developmentally regulated in both genotypes. Unexpectedly, Lcy-b expression in transgenic fruits was also developmentally regulated, despite the fact that the gene was driven by a constitutive promoter. Our data provide evidence that in photosynthetic cells a strict and aspecific mechanism controls the level of transcripts until the onset of chromoplasts differentiation, at which point a gene-specific control on transcription takes place. PMID:17096211

  20. The HSP terminator of Arabidopsis thaliana induces a high level of miraculin accumulation in transgenic tomatoes.


    Hirai, Tadayoshi; Kurokawa, Natsuko; Duhita, Narendra; Hiwasa-Tanase, Kyoko; Kato, Kazuhisa; Kato, Ko; Ezura, Hiroshi


    High-level accumulation of the target recombinant protein is a significant issue in heterologous protein expression using transgenic plants. Miraculin, a taste-modifying protein, was accumulated in transgenic tomatoes using an expression cassette in which the miraculin gene was expressed by the cauliflower mosaic virus (CaMV) 35S promoter and the heat shock protein (HSP) terminator (MIR-HSP). The HSP terminator was derived from heat shock protein 18.2 in Arabidopsis thaliana . Using this HSP-containing cassette, the miraculin concentration in T0 transgenic tomato lines was 1.4-13.9% of the total soluble protein (TSP), and that in the T1 transgenic tomato line homozygous for the miraculin gene reached 17.1% of the TSP. The accumulation level of the target protein was comparable to levels observed with chloroplast transformation. The high-level accumulation of miraculin in T0 transgenic tomato lines achieved by the HSP terminator was maintained in the successive T1 generation, demonstrating the genetic stability of this accumulation system. PMID:21861502

  1. T24 HRAS transformed NIH/3T3 mouse cells (GhrasT-NIH/3T3) in serial tumorigenic in vitro/in vivo passages give rise to increasingly aggressive tumorigenic cell lines T1-A and T2-A and metastatic cell lines T3-HA and T4-PA.


    Ray, Durwood B; Merrill, Gerald A; Brenner, Frederic J; Lytle, Laurie S; Lam, Tan; McElhinney, Aaron; Anders, Joel; Rock, Tara Tauber; Lyker, Jennifer Kier; Barcus, Scott; Leslie, Kara Hust; Kramer, Jill M; Rubenstein, Eric M; Pryor Schanz, Karen; Parkhurst, Amy J; Peck, Michelle; Good, Kimberly; Granath, Kristi Lemke; Cifra, Nicole; Detweiler, Jessalee Wantz; Stevens, Laura; Albertson, Richard; Deir, Rachael; Stewart, Elisabeth; Wingard, Katherine; Richardson, Micah Rose; Blizard, Sarah B; Gillespie, Lauren E; Kriley, Charles E; Rzewnicki, Daniel I; Jones, David H


    Cancer cells often arise progressively from "normal" to "pre-cancer" to "transformed" to "local metastasis" to "metastatic disease" to "aggressive metastatic disease". Recent whole genome sequencing (WGS) and spectral karyotyping (SKY) of cancer cells and tumorigenic models have shown this progression involves three major types of genome rearrangements: ordered small step-wise changes, more dramatic "punctuated evolution" (chromoplexy), and large catastrophic steps (chromothripsis) which all occur in random combinations to generate near infinite numbers of stochastically rearranged metastatic cancer cell genomes. This paper describes a series of mouse cell lines developed sequentially to mimic this type of progression. This starts with the new GhrasT-NIH/Swiss cell line that was produced from the NIH/3T3 cell line that had been transformed by transfection with HRAS oncogene DNA from the T24 human bladder carcinoma. These GhrasT-NIH/Swiss cells were injected s.c. into NIH/Swiss mice to produce primary tumors from which one was used to establish the T1-A cell line. T1-A cells injected i.v. into the tail vein of a NIH/Swiss mouse produced a local metastatic tumor near the base of the tail from which the T2-A cell line was established. T2-A cells injected i.v. into the tail vein of a nude NIH/Swiss mouse produced metastases in the liver and one lung from which the T3-HA (H=hepatic) and T3-PA (P=pulmonary) cell lines were developed, respectively. T3-HA cells injected i.v. into a nude mouse produced a metastasis in the lung from which the T4-PA cell line was established. PCR analysis indicated the human T24 HRAS oncogene was carried along with each in vitro/in vivo transfer step and found in the T2-A and T4-PA cell lines. Light photomicrographs indicate that all transformed cells are morphologically similar. GhrasT-NIH/Swiss cells injected s.c. produced tumors in 4% of NIH/Swiss mice in 6-10 weeks; T1-A cells injected s.c. produced tumors in 100% of NIH/Swiss mice in 7



    Chen, Hsin Liang; Li, Si Shen; Huang, Rang; Tsai, Huai-Jen


    Plasmid phr-YPGHc, containing the fish growth hormone (GH) cDNA driven by a heat shock protein 70A promoter and a RUBISCO SSU 2 promoter, was transferred into the protoplast of marine microalga Nannochloropsis oculata (Droop) D. J. Hibberd by electroporation. Four transgenic clones were obtained in which the transferred phr-YPGHc was integrated into the genome and existed stably at least until the 50th generation. When we treated these transgenic microalgae by heat shock, the heterologous fish GH was produced in the amount of 0.42 to 0.27 μg · mL(-1) from the 50 mL of medium. We incubated artemia with the wildtype and transgenic N. oculata for 6 h and then fed these microalgae-treated artemia to red-tilapia larvae. After feeding, the growth of larvae that were fed artemia incubated with transgenic microalgae was greater (i.e., statistically significant: P < 0.05) than that of larvae that were fed artemia incubated with nontransgenic microalgae: 316% versus 104% in weight gain, and 217% versus 146% in body length increase, respectively. Therefore, the N. oculata enables production of functional GH, and we propose that it might be an excellent bioreactor material. PMID:27041435

  3. Testing Transgenic Spring Wheat and Barley Lines for Reaction to Fusarium Head Blight: 2008 Field Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2008 field screening nursery, with 64 wheat and 208 barley plots was located at UMore Park, Rosemount MN. Trial entries were submitted by Rutgers University (5 wheat), University of North Texas (2 wheat) and USDA (48 barley). In addition to the submitted transgenic entries, untransformed contr...

  4. Effects of Defoliating Insect Resistance QTLs and a crylAc Transgene in Soybean Near-Isogenic Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Additional sources of resistance would be desirable to manage defoliating insect resistance to crystal proteins coded by transgenes from Bacillus thuringiensis (Bt) and to sustain the deployment of Bt crops. The objective of this study was to evaluate the effects and interactions of three soybean (G...

  5. Learning abilities, NGF and BDNF brain levels in two lines of TNF-alpha transgenic mice, one characterized by neurological disorders, the other phenotypically normal.


    Aloe, L; Properzi, F; Probert, L; Akassoglou, K; Kassiotis, G; Micera, A; Fiore, M


    In this study we used two lines of transgenic mice overexpressing tumor necrosis factor alpha (TNF-alpha) in the central nervous system (CNS), one characterized by reactive gliosis, inflammatory demyelination and neurological deficits (Tg6074) the other showing no neurological or phenotypical alterations (TgK3) to investigate the effect of TNF-alpha on brain nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) levels and learning abilities. The results showed that the amount of NGF in the brain of Tg6074 and TgK3 transgenic mice is low in the hippocampus and in the spinal cord, increases in the hypothalamus of Tg6074 and showed no significant changes in the cortex. BDNF levels were low in the hippocampus and spinal cord of TgK3. BDNF increased in the hypothalamus of TgK3 and Tg6074 while in the cortex, BDNF increased only in Tg6074 mice. Transgenic mice also had memory impairments as revealed by the Morris Water Maze test. These findings indicate that TNF-alpha significantly influences BDNF and NGF synthesis, most probably in a dose-dependent manner. Learning abilities were also differently affected by overexpression of TNF-alpha, but were not associated with inflammatory activity. The possible functional implications of our findings are discussed. PMID:10517960

  6. Transgenic mouse lines expressing rat AH receptor variants - A new animal model for research on AH receptor function and dioxin toxicity mechanisms

    SciTech Connect

    Pohjanvirta, Raimo


    Han/Wistar (Kuopio; H/W) rats are exceptionally resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) toxicity mainly because of their mutated aryl hydrocarbon receptor (AHR) gene. In H/W rats, altered splicing of the AHR mRNA generates two AHR proteins: deletion (DEL) and insertion (INS) variants, with the INS isoform being predominantly expressed. To gain further insight into their functional properties, cDNAs of these and rat wild-type (rWT) isoform were transferred into C57BL/6J-derived mice by microinjection. The endogenous mouse AHR was eliminated by selective crossing with Ahr-null mice. A single mouse line was obtained for each of the three constructs. The AHR mRNA levels in tissues were generally close to those of C57BL/6 mice in INS and DEL mice and somewhat higher in rWT mice; in testis, however, all 3 constructs exhibited marked overexpression. The transgenic mouse lines were phenotypically normal except for increased testis weight. Induction of drug-metabolizing enzymes by TCDD occurred similarly to that in C57BL/6 mice, but there tended to be a correlation with AHR concentrations, especially in testis. In contrast to C57BL/6 mice, the transgenics did not display any major gender difference in susceptibility to the acute lethality and hepatotoxicity of TCDD; rWT mice were highly sensitive, DEL mice moderately resistant and INS mice highly resistant. Co-expression of mouse AHR and rWT resulted in augmented sensitivity to TCDD and abolished the natural resistance of female C57BL/6 mice, whereas mice co-expressing mouse AHR and INS were resistant. Thus, these transgenic mouse lines provide a novel promising tool for molecular studies on dioxin toxicity and AHR function.

  7. Transgenic Pearl Millet Male Fertility Restorer Line (ICMP451) and Hybrid (ICMH451) Expressing Brassica juncea Nonexpressor of Pathogenesis Related Genes 1 (BjNPR1) Exhibit Resistance to Downy Mildew Disease

    PubMed Central

    Khareedu, Venkateswara Rao; Vudem, Dashavantha Reddy


    Brassica juncea Nonexpressor of pathogenesis-related genes 1 (BjNPR1) has been introduced into pearl millet male fertility restorer line ICMP451 by Agrobacterium tumefaciens-mediated genetic transformation. Transgenic pearl millet plants were regenerated from the phosphinothricin-resistant calli obtained after co-cultivation with A. tumefaciens strain LBA4404 harbouring Ti plasmid pSB111-bar-BjNPR1. Molecular analyses confirmed the stable integration and expression of BjNPR1 in transgenic pearl millet lines. Transgenes BjNPR1 and bar were stably inherited and disclosed co-segregation in subsequent generations in a Mendelian fashion. Transgenic pearl millet hybrid ICMH451-BjNPR1 was developed by crossing male-sterile line 81A X homozygous transgenic line ICMP451-BjNPR1. T3 and T4 homozygous lines of ICMP451-BjNPR1 and hybrid ICMH451-BjNPR1 exhibited resistance to three strains of downy mildew pathogen, while the untransformed ICMP451 and the isogenic hybrid ICMH451 plants were found susceptible. Following infection with S. graminicola, differential expression of systemic acquired resistance pathway genes, UDP-glucose salicylic acid glucosyl transferase and pathogenesis related gene 1 was observed in transgenic ICMP451-BjNPR1 and untransformed plants indicating the activation of systemic acquired resistance pathway contributing to the transgene-mediated resistance against downy mildew. The transgenic pearl millet expressing BjNPR1 showed resistance to multiple strains of S. graminicola and, as such, seems promising for the development of durable downy mildew resistant hybrids. PMID:24603762

  8. Enhancement of Recombinant Adeno-Associated Virus Type 2-Mediated Transgene Expression in a Lung Epithelial Cell Line by Inhibition of the Epidermal Growth Factor Receptor

    PubMed Central

    Smith, Andrew D.; Collaco, Roy F.; Trempe, James P.


    Recombinant adeno-associated viruses (rAAVs) have attracted considerable interest as gene delivery systems because they show long-term expression in vivo and transduce numerous cell types. Limitations to successful gene transduction from rAAVs have prompted investigations of a variety of treatments to enhance transgene expression from rAAV vectors. Tyrphostin-1, an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, dramatically enhances rAAV transgene expression. Elegant studies have demonstrated that a single-strand D-sequence-binding protein (ssDBP) is phosphorylated by EGFR and binds to the D sequence element in the AAV terminal repeat (TR). Binding of the Tyr-phosphorylated ssDBP prevents conversion of single-stranded vector DNA to a double-strand conformation. We observed dramatic increases in transgene expression in lung epithelial cells (IB3) with tyrphostin treatment. Gel shift analysis of ssDBP revealed that its DNA binding characteristics were unchanged after tyrphostin treatment or adenovirus infection. Tyrphostin stimulated rAAV transgene expression to a greater extent than adenovirus coinfection. Southern hybridizations revealed that the vector DNA remained in the single-strand conformation in tyrphostin-treated cells but double-stranded replicative form monomer DNA was most abundant in adenovirus-infected cells. Northern analyses revealed that tyrphostin treatment enhanced mRNA accumulation more than in adenovirus-infected cultures even though replicative form DNA was undetectable. Analysis of the JNK, ERK, and p38K mitogen-activated protein kinase pathways revealed that tyrphostin treatment stimulated the activity of JNK and p38K. Our data suggest that tyrphostin-induced alteration of stress response pathways results in dramatic enhancement of transcription on linear vector DNA templates in the IB3 cell line. These results expand the downstream targets of the EGFR in regulating rAAV transduction. PMID:12743297

  9. Biochemical and physiological studies of Arabidopsis thaliana transgenic lines with repressed expression of the mitochondrial pyruvate dehydrogenase kinase.


    Marillia, Elizabeth-France; Micallef, Barry J; Micallef, Malgre; Weninger, Alan; Pedersen, Kalie K; Zou, Jitao; Taylor, David C


    Pyruvate dehydrogenase kinase (PDHK), a negative regulator of the mitochondrial pyruvate dehydrogenase complex (mtPDC), plays a pivotal role in controlling mtPDC activity, and hence, the TCA cycle and cell respiration. Previously, the cloning of a PDHK cDNA from Arabidopsis thaliana and the effects of constitutively down-regulating its expression on plant growth and development has been reported. The first detailed analyses of the biochemical and physiological effects of partial silencing of the mtPDHK in A. thaliana using antisense constructs driven by both constitutive and seed-specific promoters are reported here. The studies revealed an increased level of respiration in leaves of the constitutive antisense PDHK transgenics; an increase in respiration was also found in developing seeds of the seed-specific antisense transgenics. Both constitutive and seed-specific partial silencing of the mtPDHK resulted in increased seed oil content and seed weight at maturity. Feeding 3-(14)C pyruvate to bolted stems containing siliques (constitutive transgenics), or to isolated siliques or immature seeds (seed-specific transgenics) confirmed a higher rate of incorporation of radiolabel into all seed lipid species, particularly triacylglycerols. Neither constitutive nor seed-specific partial silencing of PDHK negatively affected overall silique and seed development. Instead, oil and seed yield, and overall plant productivity were improved. These findings suggest that a partial reduction of the repression of the mtPDC by antisense PDHK expression can alter carbon flux and, in particular, the contribution of carbon moieties from pyruvate to fatty acid biosynthesis and storage lipid accumulation in developing seeds, implicating a role for mtPDC in fatty acid biosynthesis in seeds. PMID:12493853

  10. Efficient generation of marker-free transgenic rice plants using an improved transposon-mediated transgene reintegration strategy.


    Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong; Qu, Shaohong


    Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops. PMID:25371551

  11. Efficient Generation of Marker-Free Transgenic Rice Plants Using an Improved Transposon-Mediated Transgene Reintegration Strategy1

    PubMed Central

    Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong


    Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops. PMID:25371551

  12. The cellulase-mediated saccharification on wood derived from transgenic low-lignin lines of black cottonwood (Populus trichocarpa).


    Min, Douyong; Li, Quanzi; Jameel, Hasan; Chiang, Vincent; Chang, Hou-min


    Downregulated lignin transgenic black cottonwood (Populus trichocarpa) was used to elucidate the effect of lignin and xylan content on enzymatic saccharification. The lignin contents of three transgenic samples (4CL1-1, 4CL1-4, and CH8-1-4) were 19.3, 16.7, and 15.0 %, respectively, as compared with the wild type (21.3 %). The four pretreatments were dilute acid (0.1 % sulfuric acid, 185 °C, 30 min), green liquor (6 % total titratable alkali, 25 % sulfidity based on TTA, 185 °C, and 15 min.), autohydrolysis (185 °C, 30 min), and ozone delignification (25 °C, 30 min). Following the pretreatment, enzymatic saccharification was carried out using an enzyme charge of 5 FPU/g of substrates. The removal of lignin and hemicellulose varies with both the types of pretreatments and the lignin content of the transgenic trees. Due to the greatest removal of lignin, green liquor induced the highest sugar production and saccharification efficiency, followed by acid, ozone, and autohydrolysis in descending order. The results indicated that lignin is the main recalcitrance of biomass degradation. At a given lignin content, pretreatment with ozone delignification had lower saccharification efficiency than the other pretreatment methods due to higher xylan content. PMID:22903324

  13. Transgenic Fish

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fish into which foreign DNA is artificially introduced and integrated into their genome are called transgenic fish. Since the development of the first transgenic fish in 1985, techniques to produce transgenic fish have improved tremendously, resulting in the production of genetically modified (GM) ...

  14. Generation of Pet1210-Cre Transgenic Mouse Line Reveals Non-Serotonergic Expression Domains of Pet1 Both in CNS and Periphery

    PubMed Central

    Pelosi, Barbara; Migliarini, Sara; Pacini, Giulia; Pratelli, Marta; Pasqualetti, Massimo


    Neurons producing serotonin (5-hydroxytryptamine, 5-HT) constitute one of the most widely distributed neuronal networks in the mammalian central nervous system (CNS) and exhibit a profuse innervation throughout the CNS already at early stages of development. Serotonergic neuron specification is controlled by a combination of secreted molecules and transcription factors such as Shh, Fgf4/8, Nkx2.2, Lmx1b and Pet1. In the mouse, Pet1 mRNA expression appears between 10 and 11 days post coitum (dpc) in serotonergic post-mitotic precursors and persists in serotonergic neurons up to adulthood, where it promotes the expression of genes defining the mature serotonergic phenotype such as tryptophan hydroxylase 2 (Tph2) and serotonin transporter (SERT). Hence, the generation of genetic tools based on Pet1 specific expression represents a valuable approach to study the development and function of the serotonergic system. Here, we report the generation of a Pet1210-Cre transgenic mouse line in which the Cre recombinase is expressed under the control of a 210 kb fragment from the Pet1 genetic locus to ensure a reliable and faithful control of somatic recombination in Pet1 cell lineage. Besides Cre-mediated recombination accurately occurred in the serotonergic system as expected and according to previous studies, Pet1210-Cre transgenic mouse line allowed us to identify novel, so far uncharacterized, Pet1 expression domains. Indeed, we showed that in the raphe Pet1 is expressed also in a non-serotonergic neuronal population intermingled with Tph2-expressing cells and mostly localized in the B8 and B9 nuclei. Moreover, we detected Cre-mediated recombination also in the developing pancreas and in the ureteric bud derivatives of the kidney, where it reflected a specific Pet1 expression. Thus, Pet1210-Cre transgenic mouse line faithfully drives Cre-mediated recombination in all Pet1 expression domains representing a valuable tool to genetically manipulate serotonergic and non

  15. Comparative analysis of osteogenic/chondrogenic differentiation potential in primary limb bud-derived and C3H10T1/2 cell line-based mouse micromass cultures.


    Takács, Roland; Matta, Csaba; Somogyi, Csilla; Juhász, Tamás; Zákány, Róza


    Murine micromass models have been extensively applied to study chondrogenesis and osteogenesis to elucidate pathways of endochondral bone formation. Here we provide a detailed comparative analysis of the differentiation potential of micromass cultures established from either BMP-2 overexpressing C3H10T1/2 cells or mouse embryonic limb bud-derived chondroprogenitor cells, using micromass cultures from untransfected C3H10T1/2 cells as controls. Although the BMP-2 overexpressing C3H10T1/2 cells failed to form chondrogenic nodules, cells of both models expressed mRNA transcripts for major cartilage-specific marker genes including Sox9, Acan, Col2a1, Snorc, and Hapln1 at similar temporal sequence, while notable lubricin expression was only detected in primary cultures. Furthermore, mRNA transcripts for markers of osteogenic differentiation including Runx2, Osterix, alkaline phosphatase, osteopontin and osteocalcin were detected in both models, along with matrix calcification. Although the adipogenic lineage-specific marker gene FABP4 was also expressed in micromass cultures, Oil Red O-positive cells along with PPARγ2 transcripts were only detected in C3H10T1/2-derived micromass cultures. Apart from lineage-specific marker genes, pluripotency factors (Nanog and Sox2) were also expressed in these models, reflecting on the presence of various mesenchymal lineages as well as undifferentiated cells. This cellular heterogeneity has to be taken into consideration for the interpretation of data obtained by using these models. PMID:23921684

  16. Comparative Analysis of Osteogenic/Chondrogenic Differentiation Potential in Primary Limb Bud-Derived and C3H10T1/2 Cell Line-Based Mouse Micromass Cultures

    PubMed Central

    Takács, Roland; Matta, Csaba; Somogyi, Csilla; Juhász, Tamás; Zákány, Róza


    Murine micromass models have been extensively applied to study chondrogenesis and osteogenesis to elucidate pathways of endochondral bone formation. Here we provide a detailed comparative analysis of the differentiation potential of micromass cultures established from either BMP-2 overexpressing C3H10T1/2 cells or mouse embryonic limb bud-derived chondroprogenitor cells, using micromass cultures from untransfected C3H10T1/2 cells as controls. Although the BMP-2 overexpressing C3H10T1/2 cells failed to form chondrogenic nodules, cells of both models expressed mRNA transcripts for major cartilage-specific marker genes including Sox9, Acan, Col2a1, Snorc, and Hapln1 at similar temporal sequence, while notable lubricin expression was only detected in primary cultures. Furthermore, mRNA transcripts for markers of osteogenic differentiation including Runx2, Osterix, alkaline phosphatase, osteopontin and osteocalcin were detected in both models, along with matrix calcification. Although the adipogenic lineage-specific marker gene FABP4 was also expressed in micromass cultures, Oil Red O-positive cells along with PPARγ2 transcripts were only detected in C3H10T1/2-derived micromass cultures. Apart from lineage-specific marker genes, pluripotency factors (Nanog and Sox2) were also expressed in these models, reflecting on the presence of various mesenchymal lineages as well as undifferentiated cells. This cellular heterogeneity has to be taken into consideration for the interpretation of data obtained by using these models. PMID:23921684

  17. A transgenic Bm cell line of piggyBac transposon-derived targeting expression of humanized glycoproteins through N-glycosylation.


    Hu, Jia-Biao; Zhang, Peng; Wang, Mei-Xian; Zhou, Fang; Niu, Yan-Shan; Miao, Yun-Gen


    Glycoproteins have been implicated in a wide variety of important biochemical and biological functions, including protein stability, immune function, enzymatic function, cellular adhesion and others. Unfortunately, there is no therapeutic protein produced in insect system to date, due to the expressed glycoproteins are paucimannosidic N-glycans, rather than the complex, terminally sialylated N-glycans in mammalian cells. In this paper, we cloned the necessary genes in glycosylation of mammalian cells, such as N-acetylglucosaminyltransferase II (Gn-TII), galactosyltransferases (Gal-Ts), 2,6-Sial-T (ST6 GalII)and 2,3-Sial-T (ST3GalIII), and transformed them to silkworm genome of BmN cell line through transgenesis to establish a transgenic Bm cell line of piggyBac transposon-derived targeting expression of humanized glycoproteins. The study supplied a new insect cell line which is practically to produce "bisected" complex N-glycans like in mammalian cells. PMID:22699878

  18. Identification of a Bipotential Precursor Cell in Hepatic Cell Lines Derived from Transgenic Mice Expressing Cyto-Met in the Liver

    PubMed Central

    Spagnoli, Francesca M.; Amicone, Laura; Tripodi, Marco; Weiss, Mary C.


    Met murine hepatocyte (MMH) lines were established from livers of transgenic mice expressing constitutively active human Met. These lines harbor two cell types: epithelial cells resembling the parental populations and flattened cells with multiple projections and a dispersed growth habit that are designated palmate. Epithelial cells express the liver-enriched transcription factors HNF4 and HNF1α, and proteins associated with epithelial cell differentiation. Treatments that modulate their differentiation state, including acidic FGF, induce hepatic functions. Palmate cells show none of these properties. However, they can differentiate along the hepatic cell lineage, giving rise to: (a) epithelial cells that express hepatic transcription factors and are competent to express hepatic functions; (b) bile duct-like structures in three-dimensional Matrigel cultures. Derivation of epithelial from palmate cells is confirmed by characterization of the progeny of individually fished cells. Furthermore, karyotype analysis confirms the direction of the phenotypic transition: palmate cells are diploid and the epithelial cells are hypotetraploid. The clonal isolation of the palmate cell, an immortalized nontransformed bipotential cell that does not yet express the liver-enriched transcription factors and is a precursor of the epithelial-hepatocyte in MMH lines, provides a new tool for the study of mechanisms controlling liver development. PMID:9817765

  19. Identification of a bipotential precursor cell in hepatic cell lines derived from transgenic mice expressing cyto-Met in the liver.


    Spagnoli, F M; Amicone, L; Tripodi, M; Weiss, M C


    Met murine hepatocyte (MMH) lines were established from livers of transgenic mice expressing constitutively active human Met. These lines harbor two cell types: epithelial cells resembling the parental populations and flattened cells with multiple projections and a dispersed growth habit that are designated palmate. Epithelial cells express the liver-enriched transcription factors HNF4 and HNF1alpha, and proteins associated with epithelial cell differentiation. Treatments that modulate their differentiation state, including acidic FGF, induce hepatic functions. Palmate cells show none of these properties. However, they can differentiate along the hepatic cell lineage, giving rise to: (a) epithelial cells that express hepatic transcription factors and are competent to express hepatic functions; (b) bile duct-like structures in three-dimensional Matrigel cultures. Derivation of epithelial from palmate cells is confirmed by characterization of the progeny of individually fished cells. Furthermore, karyotype analysis confirms the direction of the phenotypic transition: palmate cells are diploid and the epithelial cells are hypotetraploid. The clonal isolation of the palmate cell, an immortalized nontransformed bipotential cell that does not yet express the liver-enriched transcription factors and is a precursor of the epithelial-hepatocyte in MMH lines, provides a new tool for the study of mechanisms controlling liver development. PMID:9817765

  20. Localization of mutant ubiquitin in the brain of a transgenic mouse line with proteasomal inhibition and its validation at specific sites in Alzheimer's disease

    PubMed Central

    Gentier, Romina J. G.; Verheijen, Bert M.; Zamboni, Margherita; Stroeken, Maartje M. A.; Hermes, Denise J. H. P.; Küsters, Benno; Steinbusch, Harry W. M.; Hopkins, David A.; Van Leeuwen, Fred W.


    Loss of protein quality control by the ubiquitin-proteasome system (UPS) during aging is one of the processes putatively contributing to cellular stress and Alzheimer's disease (AD) pathogenesis. Recently, pooled Genome Wide Association Studies (GWAS), pathway analysis and proteomics identified protein ubiquitination as one of the key modulators of AD. Mutations in ubiquitin B mRNA that result in UBB+1 dose-dependently cause an impaired UPS, subsequent accumulation of UBB+1 and most probably depositions of other aberrant proteins present in plaques and neurofibrillary tangles. We used specific immunohistochemical probes for a comprehensive topographic mapping of the UBB+1 distribution in the brains of transgenic mouse line 3413 overexpressing UBB+1. We also mapped the expression of UBB+1 in brain areas of AD patients selected based upon the distribution of UBB+1 in line 3413. Therefore, we focused on the olfactory bulb, basal ganglia, nucleus basalis of Meynert, inferior colliculus and raphe nuclei. UBB+1 distribution was compared with established probes for pre-tangles and tangles and Aβ plaques. UBB+1 distribution found in line 3413 is partly mirrored in the AD brain. Specifically, nuclei with substantial accumulations of tangle-bearing neurons, such as the nucleus basalis of Meynert and raphe nuclei also present high densities of UBB+1 positive tangles. Line 3413 is useful for studying the contribution of proteasomal dysfunction in AD. The findings are consistent with evidence that areas outside the forebrain are also affected in AD. Line 3413 may also be predictive for other conformational diseases, including related tauopathies and polyglutamine diseases, in which UBB+1 accumulates in their cellular hallmarks. PMID:25852488

  1. Flowering responses to altered expression of phytochrome in mutants and transgenic lines of Arabidopsis thaliana (L.) Heynh.

    PubMed Central

    Bagnall, D J; King, R W; Whitelam, G C; Boylan, M T; Wagner, D; Quail, P H


    The long-day plant Arabidopsis thaliana (L.) Heynh. flowers early in response to brief end-of-day (EOD) exposures to far-red light (FR) following a fluorescent short day of 8 h. FR promotion of flowering was nullified by subsequent brief red light (R) EOD exposure, indicating phytochrome involvement. The EOD response to R or FR is a robust measure of phytochrome action. Along with their wild-type (WT) parents, mutants deficient in either phytochrome A or B responded similarly to the EOD treatments. Thus, neither phytochrome A nor B exclusively regulated flowering, although phytochrome B controlled hypocotyl elongation. Perhaps a third phytochrome species is important for the EOD responses of the mutants and/or their flowering is regulated by the amount of the FR-absorbing form of phytochrome, irrespective of the phytochrome species. Overexpression of phytochrome A or phytochrome B resulted in differing photoperiod and EOD responses among the genotypes. The day-neutral overexpressor of phytochrome A had an EOD response similar to all of the mutants and WTs, whereas R EOD exposure promoted flowering in the overexpressor of phytochrome B and FR EOD exposure inhibited this promotion. The comparisons between relative flowering times and leaf numbers at flowering of the over-expressors and their WTs were not consistent across photoperiods and light treatments, although both phytochromes A and B contributed to regulating flowering of the transgenic plants. PMID:7659750

  2. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.


    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong


    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow. PMID:26975052

  3. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor

    PubMed Central

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong


    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow. PMID:26975052

  4. Additive transgene expression and genetic introgression in multiple green-fluorescent protein transgenic crop x weed hybrid generations.


    Halfhill, M D; Millwood, R J; Weissinger, A K; Warwick, S I; Stewart, C N


    The level of transgene expression in crop x weed hybrids and the degree to which crop-specific genes are integrated into hybrid populations are important factors in assessing the potential ecological and agricultural risks of gene flow associated with genetic engineering. The average transgene zygosity and genetic structure of transgenic hybrid populations change with the progression of generations, and the green fluorescent protein (GFP) transgene is an ideal marker to quantify transgene expression in advancing populations. The homozygous T(1) single-locus insert GFP/ Bacillus thuringiensis (Bt) transgenic canola ( Brassica napus, cv Westar) with two copies of the transgene fluoresced twice as much as hemizygous individuals with only one copy of the transgene. These data indicate that the expression of the GFP gene was additive, and fluorescence could be used to determine zygosity status. Several hybrid generations (BC(1)F(1), BC(2)F(1)) were produced by backcrossing various GFP/Bt transgenic canola ( B. napus, cv Westar) and birdseed rape ( Brassica rapa) hybrid generations onto B. rapa. Intercrossed generations (BC(2)F(2) Bulk) were generated by crossing BC(2)F(1) individuals in the presence of a pollinating insect ( Musca domestica L.). The ploidy of plants in the BC(2)F(2) Bulk hybrid generation was identical to the weedy parental species, B. rapa. AFLP analysis was used to quantify the degree of B. napus introgression into multiple backcross hybrid generations with B. rapa. The F(1) hybrid generations contained 95-97% of the B. napus-specific AFLP markers, and each successive backcross generation demonstrated a reduction of markers resulting in the 15-29% presence in the BC(2)F(2) Bulk population. Average fluorescence of each successive hybrid generation was analyzed, and homozygous canola lines and hybrid populations that contained individuals homozygous for GFP (BC(2)F(2) Bulk) demonstrated significantly higher fluorescence than hemizygous hybrid

  5. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.


    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan


    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  6. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    PubMed Central

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan


    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  7. Testing Transgenic Spring Wheat and Barley Lines for Reaction to Fusarium Head Blight: 2010 Field Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2010 field screening nursery, with 88 barley plots was located at UMore Park, Rosemount MN. Trial entries (n=18) and an the untransformed 2-row control Conlon (susceptible) were submitted by USDA-ARS, RRVARC Fargo. Barley lines with known reactions to Fusarium head blight (FHB) were also incl...

  8. Testing Transgenic Spring Wheat and Barley Lines for Reaction to Fusarium Head Blight: 2009 Field Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2009 field screening nursery, with 128 wheat and 208 barley plots was located at UMore Park, Rosemount MN. Trial entries and untransformed controls were submitted by the University of Minnesota (19+1 wheat), the Donald Danforth Plant Science Center (4+2 wheat) and USDA (48+1 barley). Lines wit...

  9. Testing transgenic spring wheat and barley lines for reaction to Fusarium head blight: 2011 field nursery report.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2011 field screening nursery, with 56 wheat and 88 barley plots was located at UMore Park, Rosemount MN. Trial entries and untransformed controls were submitted by the University of North Texas (9+1 wheat), and USDA (17+2 barley). Lines with known reactions to Fusarium head blight (FHB) were a...

  10. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack)

    PubMed Central


    Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT) and a synthetic green fluorescent protein gene (gfp). Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants. PMID:23006412

  11. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons.


    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua


    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  12. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons

    PubMed Central

    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua


    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  13. Generation and Characterisation of a Pax8-CreERT2 Transgenic Line and a Slc22a6-CreERT2 Knock-In Line for Inducible and Specific Genetic Manipulation of Renal Tubular Epithelial Cells

    PubMed Central

    Espana-Agusti, Judit; Zou, Xiangang; Wong, Kim; Fu, Beiyuan; Yang, Fengtang; Tuveson, David A.; Adams, David J.; Matakidou, Athena


    Genetically relevant mouse models need to recapitulate the hallmarks of human disease by permitting spatiotemporal gene targeting. This is especially important for replicating the biology of complex diseases like cancer, where genetic events occur in a sporadic fashion within developed somatic tissues. Though a number of renal tubule targeting mouse lines have been developed their utility for the study of renal disease is limited by lack of inducibility and specificity. In this study we describe the generation and characterisation of two novel mouse lines directing CreERT2 expression to renal tubular epithelia. The Pax8-CreERT2 transgenic line uses the mouse Pax8 promoter to direct expression of CreERT2 to all renal tubular compartments (proximal and distal tubules as well as collecting ducts) whilst the Slc22a6-CreERT2 knock-in line utilises the endogenous mouse Slc22a6 locus to specifically target the epithelium of proximal renal tubules. Both lines show high organ and tissue specificity with no extrarenal activity detected. To establish the utility of these lines for the study of renal cancer biology, Pax8-CreERT2 and Slc22a6-CreERT2 mice were crossed to conditional Vhl knockout mice to induce long-term renal tubule specific Vhl deletion. These models exhibited renal specific activation of the hypoxia inducible factor pathway (a VHL target). Our results establish Pax8-CreERT2 and Slc22a6-CreERT2 mice as valuable tools for the investigation and modelling of complex renal biology and disease. PMID:26866916

  14. Generation and Characterisation of a Pax8-CreERT2 Transgenic Line and a Slc22a6-CreERT2 Knock-In Line for Inducible and Specific Genetic Manipulation of Renal Tubular Epithelial Cells.


    Espana-Agusti, Judit; Zou, Xiangang; Wong, Kim; Fu, Beiyuan; Yang, Fengtang; Tuveson, David A; Adams, David J; Matakidou, Athena


    Genetically relevant mouse models need to recapitulate the hallmarks of human disease by permitting spatiotemporal gene targeting. This is especially important for replicating the biology of complex diseases like cancer, where genetic events occur in a sporadic fashion within developed somatic tissues. Though a number of renal tubule targeting mouse lines have been developed their utility for the study of renal disease is limited by lack of inducibility and specificity. In this study we describe the generation and characterisation of two novel mouse lines directing CreERT2 expression to renal tubular epithelia. The Pax8-CreERT2 transgenic line uses the mouse Pax8 promoter to direct expression of CreERT2 to all renal tubular compartments (proximal and distal tubules as well as collecting ducts) whilst the Slc22a6-CreERT2 knock-in line utilises the endogenous mouse Slc22a6 locus to specifically target the epithelium of proximal renal tubules. Both lines show high organ and tissue specificity with no extrarenal activity detected. To establish the utility of these lines for the study of renal cancer biology, Pax8-CreERT2 and Slc22a6-CreERT2 mice were crossed to conditional Vhl knockout mice to induce long-term renal tubule specific Vhl deletion. These models exhibited renal specific activation of the hypoxia inducible factor pathway (a VHL target). Our results establish Pax8-CreERT2 and Slc22a6-CreERT2 mice as valuable tools for the investigation and modelling of complex renal biology and disease. PMID:26866916

  15. Cell Suspension Culture-Mediated Incorporation of the Rice Bel Gene into Transgenic Cotton

    PubMed Central

    Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang


    Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops. PMID:22768325

  16. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.


    Ke, Liping; Liu, RuiE; Chu, Bijue; Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang


    Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops. PMID:22768325

  17. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na+/H+ Antiporter Gene Compared to 1.9 kb Coding Region with 5′ UTR in Transgenic Lines of Rice

    PubMed Central

    Amin, U. S. M.; Biswas, Sudip; Elias, Sabrina M.; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I.


    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na+/H+ antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5′ UTR with CDS and the other of 2.3 kb, including 5′ UTR, CDS, and the 3′ UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5′ and 3′ UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3′ UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P < 0.05) and the electrolyte leakage significantly lower (P < 0.05) in the order 2.3 kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P < 0.01) compared, respectively, to the best 1.9 kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance. PMID:26834778

  18. [Treatment options of T1 glottic carcinoma].


    Wang, Qi; Fan, Guokang


    T1 glottic carcinoma is part of early laryngeal carcinoma which involves the vocal cords, including anterior commissure or posterior commissure. We analyzed the treatment options of T1 glottic carcinoma by reviewing the related literatures about T1 glottic carcinoma treated by conservative surgery (open surgery and laser microsurgery), radiotherapy, robot surgery, photodynamic treatment. PMID:27192922

  19. Human papillomavirus type 16 E7 oncoprotein upregulates the retinoic acid receptor-beta expression in cervical cancer cell lines and K14E7 transgenic mice.


    Gutiérrez, Jorge; García-Villa, Enrique; Ocadiz-Delgado, Rodolfo; Cortés-Malagón, Enoc M; Vázquez, Juan; Roman-Rosales, Alejandra; Alvarez-Rios, Elizabeth; Celik, Haydar; Romano, Marta C; Üren, Aykut; Lambert, Paul F; Gariglio, Patricio


    Persistent infection with high-risk human papillomaviruses is the main etiological factor in cervical cancer (CC). The human papillomavirus type 16 (HPV16) E7 oncoprotein alters several cellular processes, regulating the expression of many genes in order to avoid cell cycle control. Retinoic acid receptor beta (RARB) blocks cell growth, inducing differentiation and apoptosis. This tumor suppressor gene is gradually silenced in late passages of foreskin keratinocytes immortalized with HPV16 and in various tumors, including CC, mainly by epigenetic modifications. We investigated the effect of E7 oncoprotein on RARB gene expression. We found that HPV16 E7 increases RARB mRNA and RAR-beta protein expression both in vitro and in the cervix of young K14E7 transgenic mice. In E7-expressing cells, RARB overexpression is further increased in the presence of the tumor suppressor p53 (TP53) R273C mutant. This effect does not change when either C33-A or E7-expressing C33-A cell line is treated with Trichostatin A, suggesting that E7 enhances RARB expression independently of histone deacetylases inhibition. These findings indicate that RARB overexpression is part of the early molecular events induced by the E7 oncoprotein. PMID:26173416

  20. Transgene expression in the striatum following intracerebral injections of DNA nanoparticles encoding for human glial cell line-derived neurotrophic factor.


    Fletcher, A M; Kowalczyk, T H; Padegimas, L; Cooper, M J; Yurek, D M


    A goal of our studies is to develop a potential therapeutic for Parkinson's disease (PD) by a human glial cell line-derived neurotrophic factor (hGDNF) expression plasmid administered to the rat striatum as a compacted DNA nanoparticle (DNP) and which will generate long-term hGDNF expression at biologically active levels. In the present study, we used a DNA plasmid encoding for hGDNF and a polyubiquitin C (UbC) promoter that was previously shown to have activity in both neurons and glia, but primarily in glia. A two-fold improvement was observed at the highest plasmid dose when using hGDNF DNA incorporating sequences found in RNA splice variant 1 compared with splice variant 2; of note, the splice variant 2 sequence is used in most preclinical studies. This optimized expression cassette design includes flanking scaffold matrix attachment elements (S/MARs) as well as a CpG-depleted prokaryotic domain and, where possible, eukaryotic elements. Stable long-term GDNF activity at levels 300-400% higher than baseline was observed following a single intracerebral injection. In a previous study, DNP plasmids encoding for reporter genes had been successful in generating long-term reporter transgene activity in the striatum (>365 days) and in this study produced sustained GDNF activity at the longest assessed time point (6 months). PMID:21839809

  1. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing


    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  2. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.


    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing


    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  3. Molecular breeding of transgenic white clover (Trifolium repens L.) with field resistance to Alfalfa mosaic virus through the expression of its coat protein gene.


    Panter, S; Chu, P G; Ludlow, E; Garrett, R; Kalla, R; Jahufer, M Z Z; de Lucas Arbiza, A; Rochfort, S; Mouradov, A; Smith, K F; Spangenberg, G


    Viral diseases, such as Alfalfa mosaic virus (AMV), cause significant reductions in the productivity and vegetative persistence of white clover plants in the field. Transgenic white clover plants ectopically expressing the viral coat protein gene encoded by the sub-genomic RNA4 of AMV were generated. Lines carrying a single copy of the transgene were analysed at the molecular, biochemical and phenotypic level under glasshouse and field conditions. Field resistance to AMV infection, as well as mitotic and meiotic stability of the transgene, were confirmed by phenotypic evaluation of the transgenic plants at two sites within Australia. The T(0) and T(1) generations of transgenic plants showed immunity to infection by AMV under glasshouse and field conditions, while the T(4) generation in an agronomically elite 'Grasslands Sustain' genetic background, showed a very high level of resistance to AMV in the field. An extensive biochemical study of the T(4) generation of transgenic plants, aiming to evaluate the level and composition of natural toxicants and key nutritional parameters, showed that the composition of the transgenic plants was within the range of variation seen in non-transgenic populations. PMID:21947755

  4. Transcription Activator-Like Effector Nuclease (TALEN)-Mediated CLYBL Targeting Enables Enhanced Transgene Expression and One-Step Generation of Dual Reporter Human Induced Pluripotent Stem Cell (iPSC) and Neural Stem Cell (NSC) Lines

    PubMed Central

    Cerbini, Trevor; Funahashi, Ray; Luo, Yongquan; Liu, Chengyu; Park, Kyeyoon; Rao, Mahendra; Malik, Nasir; Zou, Jizhong


    Targeted genome engineering to robustly express transgenes is an essential methodology for stem cell-based research and therapy. Although designer nucleases have been used to drastically enhance gene editing efficiency, targeted addition and stable expression of transgenes to date is limited at single gene/locus and mostly PPP1R12C/AAVS1 in human stem cells. Here we constructed transcription activator-like effector nucleases (TALENs) targeting the safe-harbor like gene CLYBL to mediate reporter gene integration at 38%–58% efficiency, and used both AAVS1-TALENs and CLYBL-TALENs to simultaneously knock-in multiple reporter genes at dual safe-harbor loci in human induced pluripotent stem cells (iPSCs) and neural stem cells (NSCs). The CLYBL-TALEN engineered cell lines maintained robust reporter expression during self-renewal and differentiation, and revealed that CLYBL targeting resulted in stronger transgene expression and less perturbation on local gene expression than PPP1R12C/AAVS1. TALEN-mediated CLYBL engineering provides improved transgene expression and options for multiple genetic modification in human stem cells. PMID:25587899

  5. Transgenic Animals.

    ERIC Educational Resources Information Center

    Jaenisch, Rudolf


    Describes three methods and their advantages and disadvantages for introducing genes into animals. Discusses the predictability and tissue-specificity of the injected genes. Outlines the applications of transgenic technology for studying gene expression, the early stages of mammalian development, mutations, and the molecular nature of chromosomes.…

  6. Morphological analysis of the early development of telencephalic and diencephalic gonadotropin-releasing hormone neuronal systems in enhanced green fluorescent protein-expressing transgenic medaka lines.


    Takahashi, Akiko; Islam, M Sadiqul; Abe, Hideki; Okubo, Kataaki; Akazome, Yasuhisa; Kaneko, Takeshi; Hioki, Hiroyuki; Oka, Yoshitaka


    Teleosts possess two or three paralogs of gonadotropin-releasing hormone (GnRH) genes: gnrh1, gnrh2, and gnrh3. Some species have lost the gnrh1 and/or gnrh3 genes, whereas gnrh2 has been completely conserved in the teleost species analyzed to date. In most teleosts that possess gnrh1, GnRH1 peptide is the authentic GnRH that stimulates gonadotropin release, whereas GnRH2 and GnRH3, if present, are neuromodulatory. Progenitors of GnRH1 and GnRH3 neurons originate from olfactory placodes and migrate to their destination during early development. However, because of the relatively low affinity/specificity of generally available antibodies that recognize GnRH1 or GnRH3, labeling of these neurons has only been possible using genetic manipulation. We used a model teleost, medaka, which possesses all three paralogous gnrh genes, to analyze development of forebrain GnRH neurons composed of GnRH1 and GnRH3 neurons. Here, we newly generated transgenic medaka lines that express enhanced green fluorescent protein under the control of promoters for gnrh1 or gnrh3, to detect GnRH neurons and facilitate immunohistochemical analysis of the neuronal morphology. We used a combination of immunohistochemistry and three-dimensional confocal microscopy image reconstructions to improve identification of neurites from GnRH1 or GnRH3 neuronal populations with greater precision. This led us to clearly identify the hypophysiotropic innervation of GnRH1 neurons residing in the ventral preoptic area (vPOA) from as early as 10 days post hatching. Furthermore, these analyses also revealed retinopetal projections of nonhypophysiotropic GnRH1 neurons in vPOA, prominent during early developmental stages, and multiple populations of GnRH3 neurons with different origins and migratory pathways. PMID:26287569

  7. Enhanced cadmium-induced testicular necrosis and renal proximal tubule damage caused by gene-dose increase in a Slc39a8-transgenic mouse line.


    Wang, Bin; Schneider, Scott N; Dragin, Nadine; Girijashanker, Kuppuswami; Dalton, Timothy P; He, Lei; Miller, Marian L; Stringer, Keith F; Soleimani, Manoocher; Richardson, Douglas D; Nebert, Daniel W


    Resistance to cadmium (Cd)-induced testicular necrosis is an autosomal recessive trait defined as the Cdm locus. Using positional cloning, we previously identified the Slc39a8 (encoding an apical-surface ZIP8 transporter protein) as the gene most likely responsible for the phenotype. In situ hybridization revealed that endothelial cells of the testis vasculature express high ZIP8 levels in two sensitive inbred mouse strains and negligible amounts in two resistant strains. In the present study, we isolated a 168.7-kb bacterial artificial chromosome (BAC), carrying only the Slc39a8 gene, from a Cd-sensitive 129/SvJ BAC library and generated BAC-transgenic mice. The BTZIP8-3 line, having three copies of the 129/SvJ Slc39a8 gene inserted into the Cd-resistant C57BL/6J genome (having its normal two copies of the Slc39a8 gene), showed tissue-specific ZIP8 mRNA expression similar to wild-type mice, mainly in lung, testis, and kidney. The approximately 2.5-fold greater expression paralleled the fact that the BTZIP8-3 line has five copies, whereas wild-type mice have two copies, of the Slc39a8 gene. The ZIP8 mRNA and protein localized especially to endothelial cells of the testis vasculature in BTZIP8-3 mice. Cd treatment reversed Cd resistance (seen in nontransgenic littermates) to Cd sensitivity in BTZIP8-3 mice; reversal of the testicular necrosis phenotype confirms that Slc39a8 is unequivocally the Cdm locus. ZIP8 also localized specifically to the apical surface of proximal tubule cells in the BTZIP8-3 kidney. Cd treatment caused acute renal failure and signs of proximal tubular damage in the BTZIP8-3 but not nontransgenic littermates. BTZIP8-3 mice should be a useful model for studying Cd-induced disease in kidney. PMID:17108009

  8. PVX-Cre-mediated marker gene elimination from transgenic plants.


    Kopertekh, L; Jüttner, G; Schiemann, J


    Cre recombinase gene from bacteriophage P1 was transiently expressed by a Potato Virus X (PVX)-based vector in transgenic lox -target Nicotiana benthamiana plants to remove the selectable marker gene. The target construct consisted of two directly oriented lox sites flanking a bar gene located between a gfp coding region and an upstream CaMV 35S promoter. The Cre-mediated excision of intervening sequence placed the gfp coding region under the transcriptional control of the CaMV 35S promoter. GFP activity was observed in PVX-Cre systemically infected leaves, regenerants from PVX-Cre infected explants and T1 progeny of these regenerants. PVX-Cre was removed efficiently from the regenerants by adding the nucleoside analogue ribavirin to the culture medium. Molecular data proved a correlation between gfp expression and precise site-specific excision of the bar gene in all examined transgenic lines. The frequency of recombination expressed as a percentage of regenerated plants exhibiting marker gene excision varied from 48% to 82%. These results demonstrate that a plant virus vector can be used efficiently to express cre recombinase in vivo providing an alternative method for the production of transgenic plants without marker genes. PMID:15604695

  9. Transgenic Resistance to Citrus tristeza virus in Grapefruit

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Grapefruit (Citrus paradisi) transgenic plants transformed with a variety of constructs derived from the Citrus tristeza virus (CTV) genome were tested for their resistance to the virus. Most transgenic lines were susceptible (27 lines), a few were partially resistant (6 lines) and only one line, tr...

  10. High levan accumulation in transgenic tobacco plants expressing the Gluconacetobacter diazotrophicus levansucrase gene.


    Banguela, Alexander; Arrieta, Juan G; Rodríguez, Raisa; Trujillo, Luis E; Menéndez, Carmen; Hernández, Lázaro


    Bacterial levansucrase (EC converts sucrose into non-linear levan consisting of long β(2,6)-linked fructosyl chains with β(2,1) branches. Bacterial levan has wide food and non-food applications, but its production in industrial reactors is costly and low yielding. Here, we report the constitutive expression of Gluconacetobacter diazotrophicus levansucrase (LsdA) fused to the vacuolar targeting pre-pro-peptide of onion sucrose:sucrose 1-fructosyltransferase (1-SST) in tobacco, a crop that does not naturally produce fructans. In the transgenic plants, levan with degree of polymerization above 10(4) fructosyl units was detected in leaves, stem, root, and flowers, but not in seeds. High levan accumulation in leaves led to gradual phenotypic alterations that increased with plant age through the flowering stage. In the transgenic lines, the fructan content in mature leaves varied from 10 to 70% of total dry weight. No oligofructans were stored in the plant organs, although the in vitro reaction of transgenic LsdA with sucrose yielded β(2,1)-linked FOS and levan. Transgenic lines with levan representing up to 30mgg(-1) of fresh leaf weight produced viable seeds and the polymer accumulation remained stable in the tested T1 and T2 progenies. The lsdA-expressing tobacco represents an alternative source of highly polymerized levan. PMID:21540065

  11. Improved Nutritive Quality and Salt Resistance in Transgenic Maize by Simultaneously Overexpression of a Natural Lysine-Rich Protein Gene, SBgLR, and an ERF Transcription Factor Gene, TSRF1

    PubMed Central

    Wang, Meizhen; Liu, Chen; Li, Shixue; Zhu, Dengyun; Zhao, Qian; Yu, Jingjuan


    Maize (Zea mays L.), as one of the most important crops in the world, is deficient in lysine and tryptophan. Environmental conditions greatly impact plant growth, development and productivity. In this study, we used particle bombardment mediated co-transformation to obtain marker-free transgenic maize inbred X178 lines harboring a lysine-rich protein gene SBgLR from potato and an ethylene responsive factor (ERF) transcription factor gene, TSRF1, from tomato. Both of the target genes were successfully expressed and showed various expression levels in different transgenic lines. Analysis showed that the protein and lysine content in T1 transgenic maize seeds increased significantly. Compared to non-transformed maize, the protein and lysine content increased by 7.7% to 24.38% and 8.70% to 30.43%, respectively. Moreover, transgenic maize exhibited more tolerance to salt stress. When treated with 200 mM NaCl for 48 h, both non-transformed and transgenic plant leaves displayed wilting and losing green symptoms and dramatic increase of the free proline contents. However, the degree of control seedlings was much more serious than that of transgenic lines and much more increases of the free proline contents in the transgenic lines than that in the control seedlings were observed. Meanwhile, lower extent decreases of the chlorophyll contents were detected in the transgenic seedlings. Quantitative RT-PCR was performed to analyze the expression of ten stress-related genes, including stress responsive transcription factor genes, ZmMYB59 and ZmMYC1, proline synthesis related genes, ZmP5CS1 and ZmP5CS2, photosynthesis-related genes, ZmELIP, ZmPSI-N, ZmOEE, Zmrbcs and ZmPLAS, and one ABA biosynthesis related gene, ZmSDR. The results showed that with the exception of ZmP5CS1 and ZmP5CS2 in line 9–10 and 19–11, ZmMYC1 in line 19–11 and ZmSDR in line 19–11, the expression of other stress-related genes were inhibited in transgenic lines under normal conditions. After salt

  12. A field-grown transgenic tomato line expressing higher levels of polyamines reveals legume cover crop mulch-specific perturbations in fruit phenotype at the levels of metabolite profiles, gene expression, and agronomic characteristics

    PubMed Central

    Neelam, Anil; Cassol, Tatiana; Mehta, Roshni A.; Abdul-Baki, Aref A.; Sobolev, Anatoli P.; Goyal, Ravinder K.; Abbott, Judith; Segre, Anna L.; Handa, Avtar K.; Mattoo, Autar K.


    Genetic modification of crop plants to introduce desirable traits such as nutritional enhancement, disease and pest resistance, and enhanced crop productivity is increasingly seen as a promising technology for sustainable agriculture and boosting food production in the world. Independently, cultural practices that utilize alternative agriculture strategies including organic cultivation subscribe to sustainable agriculture by limiting chemical usage and reduced tillage. How the two together affect fruit metabolism or plant growth in the field or whether they are compatible has not yet been tested. Fruit-specific yeast S-adenosylmethionine decarboxylase (ySAMdc) line 579HO, and a control line 556AZ were grown in leguminous hairy vetch (Vicia villosa Roth) (HV) mulch and conventional black polyethylene (BP) mulch, and their fruit analysed. Significant genotype×mulch-dependent interactions on fruit phenotype were exemplified by differential profiles of 20 fruit metabolites such as amino acids, sugars, and organic acids. Expression patterns of the ySAMdc transgene, and tomato SAMdc, E8, PEPC, and ICDHc genes were compared between the two lines as a function of growth on either BP or HV mulch. HV mulch significantly stimulated the accumulation of asparagine, glutamate, glutamine, choline, and citrate concomitant with a decrease in glucose in the 556AZ fruits during ripening as compared to BP. It enables a metabolic system in tomato somewhat akin to the one in higher polyamine-accumulating transgenic fruit that have higher phytonutrient content. Finally, synergism was found between HV mulch and transgenic tomato in up-regulating N:C indicator genes PEPC and ICDHc in the fruit. PMID:18469323

  13. A field-grown transgenic tomato line expressing higher levels of polyamines reveals legume cover crop mulch-specific perturbations in fruit phenotype at the levels of metabolite profiles, gene expression, and agronomic characteristics.


    Neelam, Anil; Cassol, Tatiana; Mehta, Roshni A; Abdul-Baki, Aref A; Sobolev, Anatoli P; Goyal, Ravinder K; Abbott, Judith; Segre, Anna L; Handa, Avtar K; Mattoo, Autar K


    Genetic modification of crop plants to introduce desirable traits such as nutritional enhancement, disease and pest resistance, and enhanced crop productivity is increasingly seen as a promising technology for sustainable agriculture and boosting food production in the world. Independently, cultural practices that utilize alternative agriculture strategies including organic cultivation subscribe to sustainable agriculture by limiting chemical usage and reduced tillage. How the two together affect fruit metabolism or plant growth in the field or whether they are compatible has not yet been tested. Fruit-specific yeast S-adenosylmethionine decarboxylase (ySAMdc) line 579HO, and a control line 556AZ were grown in leguminous hairy vetch (Vicia villosa Roth) (HV) mulch and conventional black polyethylene (BP) mulch, and their fruit analysed. Significant genotypexmulch-dependent interactions on fruit phenotype were exemplified by differential profiles of 20 fruit metabolites such as amino acids, sugars, and organic acids. Expression patterns of the ySAMdc transgene, and tomato SAMdc, E8, PEPC, and ICDHc genes were compared between the two lines as a function of growth on either BP or HV mulch. HV mulch significantly stimulated the accumulation of asparagine, glutamate, glutamine, choline, and citrate concomitant with a decrease in glucose in the 556AZ fruits during ripening as compared to BP. It enables a metabolic system in tomato somewhat akin to the one in higher polyamine-accumulating transgenic fruit that have higher phytonutrient content. Finally, synergism was found between HV mulch and transgenic tomato in up-regulating N:C indicator genes PEPC and ICDHc in the fruit. PMID:18469323

  14. SirT1 in muscle physiology and disease: lessons from mouse models

    PubMed Central

    Vinciguerra, Manlio; Fulco, Marcella; Ladurner, Andreas; Sartorelli, Vittorio; Rosenthal, Nadia


    Sirtuin 1 (SirT1) is the largest of the seven members of the sirtuin family of class III nicotinamide adenine dinucleotide (NAD+)-dependent protein deacetylases, whose activation is beneficial for metabolic, neurodegenerative, inflammatory and neoplastic diseases, and augments life span in model organisms (Finkel et al., 2009; Lavu et al., 2008). In vitro studies show that SirT1 protects genome integrity and is involved in circadian physiological rhythms (Asher et al., 2008; Nakahata et al., 2008; Oberdoerffer et al., 2008). In the last few years, a fundamental role for SirT1 in the metabolism and differentiation of skeletal muscle cells has been uncovered (Fulco et al., 2003), and the use of specific transgenic or knockout SirT1 mouse models implicates it in the protection of heart muscle from oxidative and hypertrophic stresses (Alcendor et al., 2007). In this Perspective, we review the recent exciting findings that have established a key role for the ’longevity’ protein SirT1 in skeletal and heart muscle physiology and disease. Furthermore, given the multiple biological functions of SirT1, we discuss the unique opportunities that SirT1 mouse models can offer to improve our integrated understanding of the metabolism, as well as the regeneration and aging-associated changes in the circadian function, of skeletal and heart muscle. PMID:20354108

  15. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  16. Transgenic mouse offspring generated by ROSI.


    Moreira, Pedro; Pérez-Cerezales, Serafín; Laguna, Ricardo; Fernández-Gonzalez, Raúl; Sanjuanbenito, Belén Pintado; Gutiérrez-Adán, Alfonso


    The production of transgenic animals is an important tool for experimental and applied biology. Over the years, many approaches for the production of transgenic animals have been tried, including pronuclear microinjection, sperm-mediated gene transfer, transfection of male germ cells, somatic cell nuclear transfer and the use of lentiviral vectors. In the present study, we developed a new transgene delivery approach, and we report for the first time the production of transgenic animals by co-injection of DNA and round spermatid nuclei into non-fertilized mouse oocytes (ROSI). The transgene used was a construct containing the human CMV immediate early promoter and the enhanced GFP gene. With this procedure, 12% of the live offspring we obtained carried the transgene. This efficiency of transgenic production by ROSI was similar to the efficiency by pronuclear injection or intracytoplasmic injection of male gamete nuclei (ICSI). However, ICSI required fewer embryos to produce the same number of transgenic animals. The expression of Egfp mRNA and fluorescence of EGFP were found in the majority of the organs examined in 4 transgenic lines generated by ROSI. Tissue morphology and transgene expression were not distinguishable between transgenic animals produced by ROSI or pronuclear injection. Furthermore, our results are of particular interest because they indicate that the transgene incorporation mediated by intracytoplasmic injection of male gamete nuclei is not an exclusive property of mature sperm cell nuclei with compact chromatin but it can be accomplished with immature sperm cell nuclei with decondensed chromatin as well. The present study also provides alternative procedures for transgene delivery into embryos or reconstituted oocytes. PMID:26498042

  17. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    PubMed Central

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.


    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  18. New pulse sequences for T1- and T1/T2-contrast enhancing in NMR imaging.


    Andreev, N K; Hakimov, A M; Idiyatullin, D S


    Improved pulse sequences DIFN (abbreviation of the words: DIFferentiation by N pulses), 90 degrees - tau1 - 180 degrees tau1 - . . . 180 degrees - tau1 with optimised time intervals tau1- for T1 measurement and contrast enhancing in NMR imaging are presented. The pulse sequences DIFN have a better sensitivity to T1 than the well-known pulse sequence SR. In contrast to the IR pulse sequence, the information given by the DIFN pulse sequence is more reliable, because the NMR signal does not change its sign. For a given time interval tau0 < or = (0.1 - 0.3) T(1) the DIFN pulse sequences serve as T1-filters. They pass the signal components with relatively short T1 < T(1) and suppress the components with relatively long T1 < T(1). The effects of the radiofrequency field inhomogeneity and inaccurate adjusting of pulse lengths are also considered. It is also proposed in this work to use the joint T1T2-contrast in NMR imaging obtained as a result of applying the DIFN pulse sequences in combination with the well-known Carr-Purcell-Meiboom-Gill (CPMG) pulse sequence. The region of interest, where the contrast should be especially enhanced, is specified by the two times at which measurements are performed, which allow the amplitudes of pixels to reach some defined levels by spin-lattice and spin-spin relaxation. PMID:9814781

  19. A transgenic line with Gal4 insertion useful to study morphogenesis of craniofacial perichondrium, vascular endothelium-associated cells, floor plate, and dorsal midline radial glia during zebrafish development

    PubMed Central

    Nakayama, Sohei; Ikenaga, Takanori; Kawakami, Koichi; Ono, Fumihito; Hatta, Kohei


    Zebrafish is a good model for studying vertebrate development because of the availability of powerful genetic tools. We are interested in the study of the craniofacial skeletal structure of the zebrafish. For this purpose, we performed a gene trap screen and identified a Gal4 gene trap line, SAGFF(LF)134A. We then analyzed the expression pattern of SAGFF(LF)134A;Tg(UAS:GFP) and found that GFP was expressed not only in craniofacial skeletal elements but also in the vascular system, as well as in the nervous system. In craniofacial skeletal elements, strong GFP expression was detected not only in chondrocytes but also in the perichondrium. In the vascular system, GFP was expressed in endothelium-associated cells. In the spinal cord, strong GFP expression was found in the floor plate, and later in the dorsal radial glia located on the midline. Taking advantage of this transgenic line, which drives Gal4 expression in specific tissues, we crossed SAGFF(LF)134A with several UAS reporter lines. In particular, time-lapse imaging of photoconverted floor-plate cells of SAGFF(LF)134A;Tg(UAS:KikGR) revealed that the floor-plate cells changed their shape within 36 hours from cuboidal/trapezoidal to wine glass shaped. Moreover, we identified a novel mode of association between axons and glia. The putative paths for the commissural axons, including pax8-positive CoBL interneurons, were identified as small openings in the basal endfoot of each floor plate. Our results indicate that the transgenic line would be useful for studying the morphogenesis of less-well-characterized tissues of interest, including the perichondrium, dorsal midline radial glia, late-stage floor plate, and vascular endothelium-associated cells. PMID:22348745

  20. Advanced Colloids Experiment (ACE-T1)

    NASA Technical Reports Server (NTRS)

    Meyer, William V.; Sicker, Ron; Brown, Dan; Eustace, John


    Increment 45 - 46 Science Symposium presentation of Advanced Colloids Experiment (ACE-T1) to RPO. The purpose of this event is for Principal Investigators to present their science objectives, testing approach, and measurement methods to agency scientists, managers, and other investigators.

  1. Transgenic hepatocarcinogenesis in the rat.

    PubMed Central

    Hully, J. R.; Su, Y.; Lohse, J. K.; Griep, A. E.; Sattler, C. A.; Haas, M. J.; Dragan, Y.; Peterson, J.; Neveu, M.; Pitot, H. C.


    Although transgenic hepatocarcinogenesis has been accomplished in the mouse with a number of genetic constructs targeting the oncogene to expression primarily in the liver, no example of this process has yet been developed in the rat. Because our understanding of the multistage nature of hepatocarcinogenesis is most advanced in the rat, we have developed a strain of transgenic rats carrying the promoter-enhancer sequences of the mouse albumin gene linked 5' to the simian virus-40 T antigen gene. A line of transgenic rats bearing this transgene has been developed from a single founder female. Five to six copies of the transgene, possibly in tandem, occur within the genome of the transgenic animals, which are maintained by heterozygous matings. Livers of transgenic animals are histologically normal after weaning; at 2 months of age, small foci of vacuolated cells appear in this organ. By 4 months of age, all animals exhibit focal lesions and nodules consisting primarily of small basophilic cells, many of which exhibit considerable cytoplasmic vacuolization. Mating of animals each bearing the transgene results in rats with a demyelinating condition that develops acutely in pregnant females and more chronically in males. Ultrastructural studies of these cells indicate that the vacuoles contain substantial amounts of glycogen, with the cells resembling hepatoblasts. Malignant neoplasms with both a glandular and a hepatoblastoma/hepatocellular carcinoma pattern arise from the nodules. Enzyme and immunohistochemical studies of all lesions reveal many similarities in gene expression to comparable lesions in rats subjected to chemically induced hepatocarcinogenesis, with certain exceptions. The placental form of glutathione-S-transferase is absent from all lesions in the transgenic animal, as is the expression of connexin 32. A significant number of lesions express serum albumin, and many, but not all, exhibit the T antigen. Lesions expressing the T antigen also contain

  2. Efficient production of germline transgenic chickens using lentiviral vectors.


    McGrew, Michael J; Sherman, Adrian; Ellard, Fiona M; Lillico, Simon G; Gilhooley, Hazel J; Kingsman, Alan J; Mitrophanous, Kyriacos A; Sang, Helen


    An effective method for genetic modification of chickens has yet to be developed. An efficient technology, enabling production of transgenic birds at high frequency and with reliable expression of transgenes, will have many applications, both in basic research and in biotechnology. We investigated the efficiency with which lentiviral vectors could transduce the chicken germ line and examined the expression of introduced reporter transgenes. Ten founder cockerels transmitted the vector to between 4% and 45% of their offspring and stable transmission to the G2 generation was demonstrated. Analysis of expression of reporter gene constructs in several transgenic lines showed a conserved expression profile between individuals that was maintained after transmission through the germ line. These data demonstrate that lentiviral vectors can be used to generate transgenic lines with an efficiency in the order of 100-fold higher than any previously published method, with no detectable silencing of transgene expression between generations. PMID:15192698

  3. Efficient production of germline transgenic chickens using lentiviral vectors

    PubMed Central

    McGrew, Michael J; Sherman, Adrian; Ellard, Fiona M; Lillico, Simon G; Gilhooley, Hazel J; Kingsman, Alan J; Mitrophanous, Kyriacos A; Sang, Helen


    An effective method for genetic modification of chickens has yet to be developed. An efficient technology, enabling production of transgenic birds at high frequency and with reliable expression of transgenes, will have many applications, both in basic research and in biotechnology. We investigated the efficiency with which lentiviral vectors could transduce the chicken germ line and examined the expression of introduced reporter transgenes. Ten founder cockerels transmitted the vector to between 4% and 45% of their offspring and stable transmission to the G2 generation was demonstrated. Analysis of expression of reporter gene constructs in several transgenic lines showed a conserved expression profile between individuals that was maintained after transmission through the germ line. These data demonstrate that lentiviral vectors can be used to generate transgenic lines with an efficiency in the order of 100-fold higher than any previously published method, with no detectable silencing of transgene expression between generations. PMID:15192698

  4. Tet-Transgenic Rodents: a comprehensive, up-to date database.


    Schönig, Kai; Freundlieb, Sabine; Gossen, Manfred


    Here we introduce the "Tet-Transgenic Rodents" database, documenting most of the published Tet-transgenic mouse lines generated in the past 2 decades. Aside from the >500 mouse lines listed, it also includes the first of the recently reported Tet-transgenic rat models. Since the Tet technology comprises two essential components, a cis-acting promoter (Ptet) and a trans-acting transactivator, the database has been organized accordingly. One section of the database summarizes the different transgenic mouse lines carrying mostly tissue specific promoters driving the Tet transactivator. Another section covers transgenic mouse lines carrying responder transgenes under Ptet control. The few existing rat transgenic lines are listed correspondingly. It is the purpose of this database to facilitate the repeated use of preexisting, validated transgenic lines as a shortcut for further research. PMID:23180363

  5. Transgenic apple (Malus x domestica) shoot showing low browning potential.


    Murata, M; Haruta, M; Murai, N; Tanikawa, N; Nishimura, M; Homma, S; Itoh, Y


    Transgenic apple shoots were prepared from leaf disks by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistance gene and antisense polyphenol oxidase (PPO) DNA. Four transgenic apple lines that grew on the medium containing 50 microgram/mL KM were obtained. They contained the KM resistance gene and grew stably on the medium for >3 years. Two transgenic shoot lines containing antisense PPO DNA in which PPO activity was repressed showed a lower browning potential than a control shoot. PMID:11087467

  6. {open_quotes}Horizontal{close_quotes} gene transfer from a transgenic potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs - if at all - at an extremely low frequency

    SciTech Connect

    Schlueter, K.; Fuetterer, J.; Potrykus, I.


    The frequency of possible {open_quotes}horizontal{close_quotes} gene transfer between a plant and a tightly associated bacterial pathogen was studied in a model system consisting of transgenic Solanum tuberosum, containing a {beta}-lactamase gene linked to a pBR322 origin of replication, and Erwinia chrysanthemi. This experimental system offers optimal conditions for the detection of possible horizontal gene transfer events, even when they occur at very low frequency. Horizontal gene transfer was not detected under conditions mimicking a {open_quotes}natural{close_quotes} infection. The gradual, stepwise alteration of artificial, positive control conditions to idealized natural conditions, however, allowed the characterization of factors that affected gene transfer, and revealed a gradual decrease of the gene transfer frequency from 6.3 x 10{sup -2} under optimal control conditions to a calculated 2.0 x 10{sub -17} under idealized natural conditions. These data, in combination with other published studies, argue that horizontal gene transfer is so rare as to be essentially irrelevant to any realistic assessment of the risk involved in release experiments involving transgenic plants. 22 refs., 3 figs., 2 tabs.

  7. Dose correction for post-contrast T1 mapping of the heart: the MESA study.


    Gai, Neville D; Sandfort, Veit; Liu, Songtao; Lima, João A C; Bluemke, David A


    value normalized myocardium). Weight-based contrast dosing administered in mmol/kg results in a bias in T1 values which can lead to erroneous conclusions. After adjustment for lean muscle mass based on plasma volume, results from T1(myo,c) were in line with ECV derived results. Furthermore, the use of a modified equivalent dose adjusted for BMI, age, sex and hematocrit can be adopted for quantitative imaging. PMID:26362875

  8. The distribution of transgene insertion sites in barley determined by physical and genetic mapping.

    PubMed Central

    Salvo-Garrido, Haroldo; Travella, Silvia; Bilham, Lorelei J; Harwood, Wendy A; Snape, John W


    The exact site of transgene insertion into a plant host genome is one feature of the genetic transformation process that cannot, at present, be controlled and is often poorly understood. The site of transgene insertion may have implications for transgene stability and for potential unintended effects of the transgene on plant metabolism. To increase our understanding of transgene insertion sites in barley, a detailed analysis of transgene integration in independently derived transgenic barley lines was carried out. Fluorescence in situ hybridization (FISH) was used to physically map 23 transgene integration sites from 19 independent barley lines. Genetic mapping further confirmed the location of the transgenes in 11 of these lines. Transgene integration sites were present only on five of the seven barley chromosomes. The pattern of transgene integration appeared to be nonrandom and there was evidence of clustering of independent transgene insertion events within the barley genome. In addition, barley genomic regions flanking the transgene insertion site were isolated for seven independent lines. The data from the transgene flanking regions indicated that transgene insertions were preferentially located in gene-rich areas of the genome. These results are discussed in relation to the structure of the barley genome. PMID:15280249

  9. T1 Mapping in Characterizing Myocardial Disease: A Comprehensive Review.


    Puntmann, Valentina O; Peker, Elif; Chandrashekhar, Y; Nagel, Eike


    Cardiovascular magnetic resonance provides insights into myocardial structure and function noninvasively, with high diagnostic accuracy and without ionizing radiation. Myocardial tissue characterization in particular gives cardiovascular magnetic resonance a prime role among all the noninvasive cardiovascular investigations. Late gadolinium enhancement imaging is an established method for visualizing replacement scar, providing diagnostic and prognostic information in a variety of cardiac conditions. Late gadolinium enhancement, however, relies on the regional segregation of tissue characteristics to generate the imaging contrast. Thus, myocardial pathology that is diffuse in nature and affecting the myocardium in a rather uniform and global distribution is not well visualized with late gadolinium enhancement. Examples include diffuse myocardial inflammation, fibrosis, hypertrophy, and infiltration. T1 mapping is a novel technique allowing to diagnose these diffuse conditions by measurement of T1 values, which directly correspond to variation in intrinsic myocardial tissue properties. In addition to providing clinically meaningful indices, T1-mapping measurements also allow for an estimation of extracellular space by calculation of extracellular volume fraction. Multiple lines of evidence suggest a central role for T1 mapping in detection of diffuse myocardial disease in early disease stages and complements late gadolinium enhancement in visualization of the regional changes in common advanced myocardial disease. As a quantifiable measure, it may allow grading of disease activity, monitoring progress, and guiding treatment, potentially as a fast contrast-free clinical application. We present an overview of clinically relevant technical aspects of acquisition and processing, and the current state of art and evidence, supporting its clinical use. PMID:27390332

  10. Comparison of Trifecta and Pentafecta Outcomes between T1a and T1b Renal Masses following Robot-Assisted Partial Nephrectomy (RAPN) with Minimum One Year Follow Up: Can RAPN for T1b Renal Masses Be Feasible?

    PubMed Central

    Kim, Dae Keun; Kim, Lawrence H. C.; Raheem, Ali Abdel; Shin, Tae Young; Alabdulaali, Ibrahim; Yoon, Young Eun; Han, Woong Kyu; Rha, Koon Ho


    Purpose/Objectives To investigate the feasibility of RAPN on T1b renal mass by assessment of Trifecta and Pentafecta rate between T1a and T1b renal mass. Materials/Methods We retrospectively reviewed the medical records of 277 cases of RPN performed from 2006 to 2015. Sixty patients with clinically T1b renal masses (> 4cm and ≤ 7 cm) were identified, and from 180 patients with clinically T1a renal mass, 60 patients were matched with T1b renal mass by propensity score. Tumor complexity was investigated according to R.E.N.A.L nephrometry score. “Pentafecta” was defined as achievement of Trifecta (negative surgical margin, no postoperative complications and warm ischemia time of ≤ 25 minutes) with addition of over 90% estimated GFR preservation and no chronic kidney disease stage upgrading at 1 year postoperative period. Propensity score matching was performed by OneToManyMTCH. Logistic regression models were used to identify the variables which predict the Trifecta, and Pentafecta ac. Results Preoperative variables (age, sex, body mass index, ASA score) were similar between T1a and T1b after propensity score matching. The median R.E.N.A.L. nephrometry score was 8 vs 9 for T1a and T1b respectively (p<0.001). The median warm ischemia time was 20.1 min vs 26.2 min (p<0.001). Positive surgical margin rate was 5% vs 6.6% (p = 0.729) and overall complication rate of 13.3%. vs 15% (p = 0.793). The rate of achievement of Trifecta rate were 65.3% vs 43.3% (p = 0.017) and Pentafecta rate were 38.3% vs 26.7% (p = 0.172). For achievement of Pentafecta, R.E.N.A.L nephrometry score (HR 0.80; 95% CI (0.67–0.97); p = 0.031) was significant predictor of achieving Pentafecta. Subanalyis to assess the component of R.E.N.A.L nephrometry score, L component (location relative to the polar lines, HR 0.63; 95% CI (0.38–1.03); P = 0.064) was relatively important component for Pentafecta achievement. Conclusions The rate of Pentafecta after RAPN was comparable between T1a and T1b

  11. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko


    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  12. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress.


    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P; Dobaria, Jentilal R


    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163

  13. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress

    PubMed Central

    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P.; Dobaria, Jentilal R.


    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163

  14. [Evaluation of Salt Tolerance of Transgenic Tobacco Plants Bearing with P5CS1 Gene of Arabidopsis thaliana].


    Ibragimova, S M; Trifonova, E A; Filipenko, E A; Shymny, V K


    Arabidopsis thaliana delta1-pyrroline-5-carhoxylate synthase 1 gene (P5CS1) cDNA was cloned under the control of the potent constitutive 35S RNA promoter of the cauliflower mosaic virus and transferred into genome of tobacco cv. Petit Havana SR-1 (Nicotiana tabacum L.) plants. It is shown that the constitutive level of proline in the transgenic plants T0 exceeds that of the SR1 reference line by 1.5 to 4 times. Under conditions of salt stress (200, 300 mM NaCl) T1-generation transgenic plants in early stages of development formed a large biomass, developed more quickly, and had a higher rate of root growth compared to the control, which confirms the involvement of the P5CS1 gene in molecular mechanisms of stress resistance in plants. PMID:27055296

  15. Refinement of the Citrus tristeza virus resistance gene (Ctv) positional map in Poncirus trifoliata and generation of transgenic grapefruit (Citrus paradisi) plant lines with candidate resistance genes in this region.


    Rai, Mamta


    Citrus tristeza virus (CTV) is a major pathogen of Citrus. A single dominant gene Ctv present in the trifoliate relative of Citrus, Poncirus trifoliata confers broad spectrum resistance against CTV. Refinement of genetic maps has delimited this gene to a 121 kb region, comprising of ten candidate Ctv resistance genes. The ten candidate genes were individually cloned in Agrobacterium based binary vector and transformed into three CTV susceptible grapefruit varieties. Two of the candidate R-genes, R-2 and R-3 are exclusively expressed in transgenic plants and in Poncirus trifoliata, while five other genes are also expressed in non-transformed Citrus controls. Northern blotting with a CTV derived probe for assessment of infection in virus inoculated plants over a span of three growth periods, each comprising of six to eight weeks, indicates either an absence of initiation of infection or it's slow spread in R-2 plant lines or an initial appearance of infection and it's subsequent obliteration in some R-1 and R-4 plant lines. Limited genome walk up- and downstream form R-1 gene, based on it's 100% sequence identity between Poncirus and Citrus, indicates promoter identity of 92% between the two varieties. Further upstream and downstream sequencing indicates the presence of an O-methyl transferase and a Copia like gene respectively in Citrus instead of the amino acid transporter like gene upstream and a sugar transporter like gene downstream in Poncirus. The possibility of recombinations in the resistance locus of Citrus and the need for consistent monitoring for virus infection and gene expression in the transgenic Citrus trees is discussed. PMID:16830176

  16. Neuroanatomy and transgenic technologies

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  17. Efficient Generation of Mice with Consistent Transgene Expression by FEEST.


    Gao, Lei; Jiang, Yonghua; Mu, Libing; Liu, Yanbin; Wang, Fengchao; Wang, Peng; Zhang, Aiqun; Tang, Nan; Chen, Ting; Luo, Minmin; Yu, Lei; Gao, Shaorong; Chen, Liang


    Transgenic mouse models are widely used in biomedical research; however, current techniques for producing transgenic mice are limited due to the unpredictable nature of transgene expression. Here, we report a novel, highly efficient technique for the generation of transgenic mice with single-copy integration of the transgene and guaranteed expression of the gene-of-interest (GOI). We refer to this technique as functionally enriched ES cell transgenics, or FEEST. ES cells harboring an inducible Cre gene enabled the efficient selection of transgenic ES cell clones using hygromycin before Cre-mediated recombination. Expression of the GOI was confirmed by assaying for the GFP after Cre recombination. As a proof-of-principle, we produced a transgenic mouse line containing Cre-activatable tTA (cl-tTA6). This tTA mouse model was able to induce tumor formation when crossed with a transgenic mouse line containing a doxycycline-inducible oncogene. We also showed that the cl-tTA6 mouse is a valuable tool for faithfully recapitulating the clinical course of tumor development. We showed that FEEST can be easily adapted for other genes by preparing a transgenic mouse model of conditionally activatable EGFR L858R. Thus, FEEST is a technique with the potential to generate transgenic mouse models at a genome-wide scale. PMID:26573149

  18. SirT1 gain-of-function increases energy efficiency and prevents diabetes in mice

    PubMed Central

    Banks, Alexander S.; Kon, Ning; Knight, Colette; Matsumoto, Michihiro; Gutiérrez-Juárez, Roger; Rossetti, Luciano; Gu, Wei; Accili, Domenico


    Summary In yeast, worms and flies, an extra copy of the gene encoding the Sirtuin Sir2 increases metabolic efficiency, as does administration of polyphenols like resveratrol, thought to act through Sirtuins. But evidence that Sirtuin gain-of-function results in increased metabolic efficiency in mammals is limited. We generated transgenic mice with moderate overexpression of SirT1, designed to mimic the Sirtuin gain-of-function that improves metabolism in C.elegans. These mice exhibit normal insulin sensitivity, but decreased food intake and locomotor activity, resulting in decreased energy expenditure. However, in various models of insulin resistance and diabetes, SirT1 transgenics display improved glucose tolerance due to decreased hepatic glucose production and increased adiponectin levels, without changes in body weight or composition. We conclude that SirT1 gain-of-function primes the organism for metabolic adaptation to insulin resistance, increasing hepatic insulin sensitivity and decreasing whole-body energy requirements. These findings have important implications for Sirtuin-based therapies in humans. PMID:18840364

  19. Generation and Characterization of an Nse-CreERT2 Transgenic Line Suitable for Inducible Gene Manipulation in Cerebellar Granule Cells

    PubMed Central

    Pohlkamp, Theresa; Steller, Laura; May, Petra; Günther, Thomas; Schüle, Roland; Frotscher, Michael


    We created an Nse-CreERT2 mouse line expressing the tamoxifen-inducible CreERT2 recombinase under the control of the neuron-specific enolase (Nse) promoter. By using Cre reporter lines we could show that this Nse-CreERT2 line has recombination activity in the granule cells of all cerebellar lobules as well as in postmitotic granule cell precursors in the external granular layer of the developing cerebellum. A few hippocampal dentate gyrus granule cells showed Cre-mediated recombination as well. Cre activity could be induced in both the developing and adult mouse brain. The established mouse line constitutes a valuable tool to study the function of genes expressed by cerebellar granule cells in the developing and adult brain. In combination with reporter lines it is a useful model to analyze the development and maintenance of the cerebellar architecture including granule cell distribution, migration, and the extension of granule cell fibers in vivo. PMID:24950299

  20. An evaluation of new and established methods to determine T-DNA copy number and homozygosity in transgenic plants.


    Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K; Clemente, Tom E; Long, Stephen P


    Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL-)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T-DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL-PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T-DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T-DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided. PMID:26670088

  1. Lines

    ERIC Educational Resources Information Center

    Mires, Peter B.


    National Geography Standards for the middle school years generally stress the teaching of latitude and longitude. There are many creative ways to explain the great grid that encircles our planet, but the author has found that students in his college-level geography courses especially enjoy human-interest stories associated with lines of latitude…

  2. Controlling transgene expression in subcutaneous implants using a skin lotion containing the apple metabolite phloretin

    PubMed Central

    Gitzinger, Marc; Kemmer, Christian; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin


    Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida–mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies. PMID:19549857

  3. Generation of transgenic Hydra by embryo microinjection.


    Juliano, Celina E; Lin, Haifan; Steele, Robert E


    As a member of the phylum Cnidaria, the sister group to all bilaterians, Hydra can shed light on fundamental biological processes shared among multicellular animals. Hydra is used as a model for the study of regeneration, pattern formation, and stem cells. However, research efforts have been hampered by lack of a reliable method for gene perturbations to study molecular function. The development of transgenic methods has revitalized the study of Hydra biology(1). Transgenic Hydra allow for the tracking of live cells, sorting to yield pure cell populations for biochemical analysis, manipulation of gene function by knockdown and over-expression, and analysis of promoter function. Plasmid DNA injected into early stage embryos randomly integrates into the genome early in development. This results in hatchlings that express transgenes in patches of tissue in one or more of the three lineages (ectodermal epithelial, endodermal epithelial, or interstitial). The success rate of obtaining a hatchling with transgenic tissue is between 10% and 20%. Asexual propagation of the transgenic hatchling is used to establish a uniformly transgenic line in a particular lineage. Generating transgenic Hydra is surprisingly simple and robust, and here we describe a protocol that can be easily implemented at low cost. PMID:25285460

  4. Establishment of mesenchymal stem cell lines derived from the bone marrow of green fluorescent protein-transgenic mice exhibiting a diversity in intracellular transforming growth factor-β and bone morphogenetic protein signaling.


    Sawada, Shunsuke; Chosa, Naoyuki; Takizawa, Naoki; Yokota, Jun; Igarashi, Yasuyuki; Tomoda, Koichi; Kondo, Hisatomo; Yaegashi, Takashi; Ishisaki, Akira


    Cytokines and their intercellular signals regulate the multipotency of mesenchymal stem cells (MSCs). The present study established the MSC lines SG‑2, ‑3, and ‑5 from the bone marrow of green fluorescent protein (GFP)‑transgenic mice. These cell lines clearly expressed mouse MSC markers Sca‑1 and CD44, and SG‑2 and ‑5 cells retained the potential for osteogenic and adipogenic differentiation in the absence of members of the transforming growth factor (TGF)‑β superfamily. By contrast, SG‑3 cells only retained adipogenic differentiation potential. Analysis of cytokine and cytokine receptor expression in these SG cell lines showed that bone morphogenetic protein (BMP) receptor 1B was most highly expressed in the SG‑3 cells, which underwent osteogenesis in response to BMP, while TGF‑β receptor II was most highly expressed in SG‑3 and ‑5 cells. However, it was unexpectedly noted that phosphorylation of Smad 2, a major transcription factor, was induced by TGF‑β1 in SG‑2 cells but not in SG‑3 or ‑5 cells. Furthermore, TGF‑β1 clearly induced the expression of Smad‑interacting transcription factor CCAAT/enhancer binding protein‑β in SG‑2 but not in SG‑3 or ‑5 cells. These results demonstrated the establishment of TGF‑β‑responsive SG‑2 MSCs, BMP‑responsive SG‑3 MSCs and TGF‑β/BMP‑unresponsive SG‑5 MSCs, each of which was able to be traced by GFP fluorescence after transplantation into in vivo experimental models. In conclusion, the present study suggested that these cell lines may be used to explore how the TGF‑β superfamily affects the proliferation and differentiation status of MSCs in vivo. PMID:26781600

  5. Molecular Analyses of Transgenic Plants.


    Trijatmiko, Kurniawan Rudi; Arines, Felichi Mae; Oliva, Norman; Slamet-Loedin, Inez Hortense; Kohli, Ajay


    One of the major challenges in plant molecular biology is to generate transgenic plants that express transgenes stably over generations. Here, we describe some routine methods to study transgene locus structure and to analyze transgene expression in plants: Southern hybridization using DIG chemiluminescent technology for characterization of transgenic locus, SYBR Green-based real-time RT-PCR to measure transgene transcript level, and protein immunoblot analysis to evaluate accumulation and stability of transgenic protein product in the target tissue. PMID:26614292

  6. Studies of an expanded trinucleotide repeat in transgenic mice

    SciTech Connect

    Bingham, P.; Wang, S.; Merry, D.


    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  7. Overview: Engineering transgenic constructs and mice

    PubMed Central

    Haruyama, Naoto; Cho, Andrew; Kulkarni, Ashok B


    Cell biology research encompasses everything from single cells to whole animals. Recent discoveries concerning particular gene functions can be applied to the whole animal for understanding genotype-phenotype relationships underlying disease mechanisms. For this reason, genetically manipulated mouse models are now considered essential to correctly understand disease processes in whole animals. This unit provides the basic mouse technologies used to generate conventional transgenic mice, which represents gain-of-function approach. First, an overview of the transgenic construct design is presented. This unit then explains basic strategies for the identification and establishment of independent transgenic mouse lines, followed by comments on historical and emerging techniques, and then on typical problems that are encountered when researchers start to generate transgenic mice. PMID:19283728

  8. Transgenic plants with enhanced growth characteristics


    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.


    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  9. Editor's Highlight: Identification and Characterization of Teratogenic Chemicals Using Embryonic Stem Cells Isolated From a Wnt/β-Catenin-Reporter Transgenic Mouse Line.


    Kugler, Josephine; Kemler, Rolf; Luch, Andreas; Oelgeschläger, Michael


    Embryonic stem cells (ESCs) are commonly used for the analysis of gene function in embryonic development and provide valuable models for human diseases. In recent years, ESCs have also become an attractive tool for toxicological testing, in particular for the identification of teratogenic compounds. We have recently described a Bmp-reporter ESC line as a new tool to identify teratogenic compounds and to characterize the molecular mechanisms mediating embryonic toxicity. Here we describe the use of a Wnt/β-Catenin-reporter ESC line isolated from a previously described mouse line that carries the LacZ reporter gene under the control of a β-Catenin responsive promoter. The reporter ESC line stably differentiates into cardiomyocytes within 12 days. The reporter was endogenously induced between day 3-5 of differentiation reminiscent of its expression in vivo, in which strong LacZ activity is detected around gastrulation. Subsequently its expression becomes restricted to mesodermal cells and cells undergoing an epithelial to mesenchymal transition. The Wnt/β-Catenin-dependent expression of the reporter protein allowed quantification of dose- and time-dependent effects of teratogenic chemicals. In particular, valproic acid reduced reporter activity on day 7 whereas retinoic acid induced reporter activity on day 5 at concentrations comparable to the ones inhibiting the formation of functional cardiomyocytes, the classical read-out of the embryonic stem cell test (EST). In addition, we were also able to show distinct effects of teratogenic chemicals on the Wnt/β-Catenin-reporter compared with the previously described Bmp-reporter ESCs. Thus, different reporter cell lines provide complementary tools for the identification and analysis of potentially teratogenic compounds. PMID:27208078

  10. Sampling submicron T1 bacteriophage aerosols.


    Harstad, J B


    Liquid impingers, filter papers, and fritted bubblers were partial viable collectors of radioactive submicron T1 bacteriophage aerosols at 30, 55, and 85% relative humidity. Sampler differences for viable collection were due to incomplete physical collection (slippage) and killing of phage by the samplers. Dynamic aerosols of a mass median diameter of 0.2 mu were produced with a Dautrebande generator from concentrated aqueous purified phage suspensions containing extracellular soluble radioactive phosphate as a physical tracer. There was considerable destruction of phage by the Dautrebande generator; phage titers of the Dautrebande suspension decreased exponentially, but there was a progressive (linear) increase in tracer titers. Liquid impingers recovered the most viable phage but allowed considerable (30 to 48%) slippage, which varies inversely with the aerosol relative humidity. Filter papers were virtually complete physical collectors of submicron particles but were the most destructive. Fritted bubbler slippage was more than 80%. With all samplers, phage kill was highest at 85% relative humidity and lowest at 55% relative humidity. An electrostatic precipitator was used to collect aerosol samples for particle sizing with an electron microscope. The particle size was slightly larger at 85% relative humidity than at 30 or 55% relative humidity. PMID:5866038

  11. Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

    SciTech Connect

    Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul . E-mail:; Lee, Dong-Seok . E-mail:


    It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway.

  12. Marker-free transgenic (MFT) near-isogenic introgression lines (NIILs) of 'golden' indica rice (cv. IR64) with accumulation of provitamin A in the endosperm tissue.


    Baisakh, Niranjan; Rehana, Sayda; Rai, Mayank; Oliva, Norman; Tan, Jing; Mackill, David J; Khush, Gurdev S; Datta, Karabi; Datta, Swapan K


    We have developed near-isogenic introgression lines (NIILs) of an elite indica rice cultivar (IR64) with the genes for beta-carotene biosynthesis from dihaploid (DH) derivatives of golden japonica rice (cv. T309). A careful analysis of the DH lines indicated the integration of the genes of interest [phytoene synthase (psy) and phytoene desaturase (crtI)] and the selectable marker gene (hygromycin phosphotransferase, hph) in two unlinked loci. During subsequent crossing, progenies could be obtained carrying only the locus with psy and crtI, which was segregated independently from the locus containing the hph gene during meiotic segregation. The NIILs (BC(2)F(2)) showed maximum similarity with the recurrent parent cultivar IR64. Further, progenies of two NIILs were devoid of any fragments beyond the left or right border, including the chloramphenicol acetyltransferase (cat) antibiotic resistance gene of the transformation vector. Spectrophotometric readings showed the accumulation of up to 1.06 microg total carotenoids, including beta-carotene, in 1 g of the endosperm. The accumulation of beta-carotene was also evident from the clearly visible yellow colour of the polished seeds. PMID:17177811

  13. Transgenic Mouse Technology: Principles and Methods

    PubMed Central

    Kumar, T. Rajendra; Larson, Melissa; Wang, Huizhen; McDermott, Jeff; Bronshteyn, Illya


    Introduction of foreign DNA into the mouse germ line is considered a major technical advancement in the fields of developmental biology and genetics. This technology now referred to as transgenic mouse technology has revolutionized virtually all fields of biology and provided new genetic approaches to model many human diseases in a whole animal context. Several hundreds of transgenic lines with expression of foreign genes specifically targeted to desired organelles/cells/tissues have been characterized. Further, the ability to spatio-temporally inactivate or activate gene expression in vivo using the “Cre-lox” technology has recently emerged as a powerful approach to understand various developmental processes including those relevant to molecular endocrinology. In this chapter, we will discuss the principles of transgenic mouse technology, and describe detailed methodology standardized at our Institute. PMID:19763515

  14. The distribution of cotransformed transgenes in particle bombardment-mediated transformed wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although particle bombardment is the predominant method of foreign DNA direct transfer, whether transgene is integrated randomly into the genome has not been determined. In this study, we identified the distribution of transgene loci in 45 transgenic wheat (Triticum aestivum L.) lines containing c...

  15. Generation of Transgenic Mice

    PubMed Central

    Cho, Andrew; Haruyama, Naoto; Kulkarni, Ashok B.


    This unit describes detailed step-by-step protocols, reagents, and equipment required for successful generation of transgenic mice using pronuclear injection. The experimental methods and practical tips given here will help guide beginners in understanding what is required and what to avoid in these standard protocols for efficiently generating transgenic mice. PMID:19283729


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenes promise to reduce insecticide and fungicide use, but relatively little has been done to significantly reduce herbicide use through genetic engineering. Three strategies for transgene utilization are discussed which have the potential to change this: 1) improvement of weed-specific biocon...

  17. Enhanced Transgene Expression from Recombinant Single-Stranded D-Sequence-Substituted Adeno-Associated Virus Vectors in Human Cell Lines In Vitro and in Murine Hepatocytes In Vivo

    PubMed Central

    Wang, Yuan; Lu, Yuan; Wang, Lina; Jayandharan, Giridhara R.; Aslanidi, George V.; Li, Baozheng; Cheng, Binbin; Ma, Wenqin; Lentz, Thomas; Ling, Changquan; Xiao, Xiao; Samulski, R. Jude; Muzyczka, Nicholas


    ABSTRACT We have previously reported that the removal of a 20-nucleotide sequence, termed the D sequence, from both ends of the inverted terminal repeats (ITRs) in the adeno-associated virus serotype 2 (AAV2) genome significantly impairs rescue, replication, and encapsidation of the viral genomes (X. S. Wang, S. Ponnazhagan, and A. Srivastava, J Mol Biol 250:573–580, 1995; X. S. Wang, S. Ponnazhagan, and A. Srivastava, J Virol 70:1668–1677, 1996). Here we describe that replacement of only one D sequence in either ITR restores each of these functions, but DNA strands of only single polarity are encapsidated in mature progeny virions. Since most commonly used recombinant AAV vectors contain a single-stranded DNA (ssDNA), which is transcriptionally inactive, efficient transgene expression from AAV vectors is dependent upon viral second-strand DNA synthesis. We have also identified a transcription suppressor sequence in one of the D sequences, which shares homology with the binding site for the cellular NF-κB-repressing factor (NRF). The removal of this D sequence from, and replacement with a sequence containing putative binding sites for transcription factors in, single-stranded AAV (ssAAV) vectors significantly augments transgene expression both in human cell lines in vitro and in murine hepatocytes in vivo. The development of these genome-modified ssAAV vectors has implications not only for the basic biology of AAV but also for the optimal use of these vectors in human gene therapy. IMPORTANCE The results of the studies described here not only have provided novel insights into some of the critical steps in the life cycle of a human virus, the adeno-associated virus (AAV), that causes no known disease but have also led to the development of novel recombinant AAV vectors which are more efficient in allowing increased levels of gene expression. Thus, these studies have significant implications for the potential use of these novel AAV vectors in human gene therapy

  18. Evaluating the fitness of human lysozyme transgenic dairy goats: growth and reproductive traits

    PubMed Central

    Jackson, Kathryn A.; Berg, Jolene M.; Murray, James D.


    While there are many reports in the literature describing the attributes of specific applications of transgenic animals for agriculture, there are relatively few studies focusing on the fitness of the transgenic animals themselves. This work was designed to gather information on genetically modified food animals to determine if the presence of a transgene can impact general animal production traits. More specifically, we used a line of transgenic dairy goats expressing human lysozyme in their mammary gland to evaluate the reproductive fitness and growth and development of these animals compared to their non-transgenic counterparts and the impact of consuming a transgenic food product, lysozyme-containing milk. In males, none of the parameters of semen quality, including semen volume and concentration, total sperm per ejaculate, sperm morphology, viability and motility, were significantly different between transgenic bucks and non-transgenic full-sib controls. Likewise, transgenic females of this line did not significantly differ in the reproductive traits of gestation length and litter size compared to their non-transgenic counterparts. To evaluate growth, transgenic and non-transgenic kid goats received colostrum and milk from either transgenic or non-transgenic does from birth until weaning. Neither the presence of the transgene nor the consumption of milk from transgenic animals significantly affected birth weight, weaning weight, overall gain and post-wean gain. These results indicate that the analyzed reproductive and growth traits were not regularly or substantially impacted by the presence or expression of the transgene. The evaluation of these general parameters is an important aspect of defining the safety of applying transgenic technology to animal agriculture. PMID:20135222

  19. Over-expression of snakin-2 and extensin-like protein genes restricts pathogen invasiveness and enhances tolerance to Clavibacter michiganensis subsp. michiganensis in transgenic tomato (Solanum lycopersicum).


    Balaji, Vasudevan; Smart, Christine D


    Two tomato proteins were evaluated by over-expression in transgenic tomato for their ability to confer resistance to Clavibacter michiganensis subsp. michiganensis (Cmm). Snakin-2 (SN2) is a cysteine-rich peptide with broad-spectrum antimicrobial activity in vitro while extensin-like protein (ELP) is a major cell-wall hydroxyproline-rich glycoprotein linked with plant response to pathogen attack and wounding. Tomato plants, cultivar Mountain Fresh, were transformed via Agrobacterium tumefaciens harboring a binary vector for expression of the full-length SN2 gene or ELP cDNA under the regulation of the CaMV 35S promoter. Molecular characterization of PCR-positive putative T(0) transgenic plants by Northern analysis revealed constitutive over-expression of SN2 and ELP mRNA. Junction fragment analysis by Southern blot showed that three of the four SN2 over-expressing T(0) lines had single copies of complete T-DNAs while the other line had two complete T-DNA copies. All four ELP over-expressing T(0) lines had a single copy T-DNA insertion. Semi-quantitative RT-PCR analysis of T(1) plants revealed constitutive over-expression of SN2 and ELP. Transgenic lines that accumulated high levels of SN2 or ELP mRNA showed enhanced tolerance to Cmm resulting in a significant delay in the development of wilt symptoms and a reduction in the size of canker lesions compared to non-transformed control plants. Furthermore, in transgenic lines over-expressing SN2 or ELP bacterial populations were significantly lower (100-10,000-fold) than in non-transformed control plants. These results demonstrate that SN2 and ELP over-expression limits Cmm invasiveness suggesting potential in vivo antibacterial activity and possible biotechnological application for these two defense proteins. PMID:21479554

  20. L-Theanine elicits umami taste via the T1R1 + T1R3 umami taste receptor.


    Narukawa, Masataka; Toda, Yasuka; Nakagita, Tomoya; Hayashi, Yukako; Misaka, Takumi


    L-Theanine is a unique amino acid present in green tea. It elicits umami taste and has a considerable effect on tea taste and quality. We investigated L-theanine activity on the T1R1 + T1R3 umami taste receptor. L-Theanine activated T1R1 + T1R3-expressing cells and showed a synergistic response with inosine 5'-monophosphate. The site-directed mutagenesis analysis revealed that L-theanine binds to L-amino acid binding site in the Venus flytrap domain of T1R1. This study shows that L-theanine elicits an umami taste via T1R1 + T1R3. PMID:24633359

  1. Up-regulation of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase enhances production of essential oils and sterols in transgenic Lavandula latifolia.


    Muñoz-Bertomeu, Jesús; Sales, Ester; Ros, Roc; Arrillaga, Isabel; Segura, Juan


    Spike lavender (Lavandula latifolia) essential oil is widely used in the perfume, cosmetic, flavouring and pharmaceutical industries. Thus, modifications of yield and composition of this essential oil by genetic engineering should have important scientific and commercial applications. We generated transgenic spike lavender plants expressing the Arabidopsis thaliana HMG1 cDNA, encoding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the mevalonic acid (MVA) pathway. Transgenic T0 plants accumulated significantly more essential oil constituents as compared to controls (up to 2.1- and 1.8-fold in leaves and flowers, respectively). Enhanced expression of HMGR1S also increased the amount of the end-product sterols, beta-sitosterol and stigmasterol (average differences of 1.8- and 1.9-fold, respectively), but did not affect the accumulation of carotenoids or chlorophylls. We also analysed T1 plants derived from self-pollinated seeds of T0 lines that flowered after growing for 2 years in the greenhouse. The increased levels of essential oil and sterols observed in the transgenic T0 plants were maintained in the progeny that inherited the HMG1 transgene. Our results demonstrate that genetic manipulation of the MVA pathway increases essential oil yield in spike lavender, suggesting a contribution for this cytosolic pathway to monoterpene and sesquiterpene biosynthesis in leaves and flowers of the species. PMID:17714440

  2. Variation in GUS activity in vegetatively propagated Hevea brasiliensis transgenic plants.


    Lardet, Ludovic; Leclercq, Julie; Bénistan, Elise; Dessailly, Florence; Oliver, Gérald; Martin, Florence; Montoro, Pascal


    Hevea brasiliensis transgenic plants are regenerated from transgenic callus lines by somatic embryogenesis. Somatic embryogenesis is not yet available for commercial propagation of Hevea clones, which requires conventional grafting of buds on rootstock seedlings (budding). The stability of transgene expression in budded plants is therefore necessary for further development of genetic engineering in rubber trees. Transgene expression was assessed by fluorimetric beta-glucuronidase (GUS) activity in fully developed leaves of in vitro plants from transgenic lines and their sub-lines obtained by budding. A large variation in GUS activity was found in self-rooted in vitro plants of five transgenic lines, and the absence of activity in one line suggested transgene silencing. Beyond confirming transmissibility of the reporter gene by budding and long-term expression, a quantification of GUS activity revealed that greater variability existed in budded plants compared to self-rooted mother in vitro plants for three transgenic lines. Although somatic embryogenesis provided more stable GUS activity, budding remained an efficient way of propagating transgenic plants but transgene expression in budded plants should be verified for functional analysis and further development. PMID:21643815

  3. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.


    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk


    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice. PMID:26172549

  4. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision

    PubMed Central

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk


    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice. PMID:26172549

  5. The natural degeneration course in the T1rho values of normal knee cartilage.


    Goto, Hajimu; Iwama, Yuki; Fujii, Masahiko; Aoyama, Nobukazu; Kubo, Seiji; Kuroda, Ryosuke; Ohno, Yoshiharu; Sugimura, Kazuro


    The purpose of our study is to investigate whether there is an age-related change in T1 rho values and to evaluate the effects of weight bearing on age-related increase in T1 rho values of normal cartilage. Thirty-two asymptomatic patients were examined using a 3.0T MRI to determine knee cartilage T1 rho values. Femorotibial and patella cartilage was defined as weight-bearing cartilage (WB-C) and non-weight-bearing cartilage (NWB-C), respectively. The femoral cartilage was divided into weight-bearing (WB-P) and less-weight-bearing (LWB-P) portions. Pearson's correlation coefficient and single regression analysis were used to assess the relationship between cartilage T1 rho values and age. The slopes of the regression lines of cartilage T1 rho values and age were compared between WB-C and NWB-C and between WB-P and LWB-P. Cartilage T1 rho values correlated positively with aging for all cartilage regions and all age groups (p<0.001). In the medial femoral cartilage, the age-related increase in T1 rho values was significantly greater for WB-P than for NWB-P (p<0.05). For several cartilage regions, this increase was greater for WB-C than for LWB-C (p<0.05). The T1 rho value is very sensitive to age-related cartilage degeneration and weight bearing-related degeneration, and hence may be a very sensitive and useful measure for the early diagnosis of osteoarthritis. PMID:22971986

  6. Transgene silencing and transgene-derived siRNA production in tobacco plants homozygous for an introduced AtMYB90 construct

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenic tobacco (Nicotiana tabacum) lines were engineered to ectopically over-express AtMYB90 (PAP2), an R2-R3 Myb gene associated with regulation of anthocyanin production in Arabidopsis thaliana. Independently transformed transgenic lines Myb27 and Myb237 accumulated large quantities of anthoc...

  7. Uncertainty estimations for quantitative in vivo MRI T1 mapping

    NASA Astrophysics Data System (ADS)

    Polders, Daniel L.; Leemans, Alexander; Luijten, Peter R.; Hoogduin, Hans


    Mapping the longitudinal relaxation time (T1) of brain tissue is of great interest for both clinical research and MRI sequence development. For an unambiguous interpretation of in vivo variations in T1 images, it is important to understand the degree of variability that is associated with the quantitative T1 parameter. This paper presents a general framework for estimating the uncertainty in quantitative T1 mapping by combining a slice-shifted multi-slice inversion recovery EPI technique with the statistical wild-bootstrap approach. Both simulations and experimental analyses were performed to validate this novel approach and to evaluate the estimated T1 uncertainty in several brain regions across four healthy volunteers. By estimating the T1 uncertainty, it is shown that the variation in T1 within anatomic regions for similar tissue types is larger than the uncertainty in the measurement. This indicates that heterogeneity of the inspected tissue and/or partial volume effects can be the main determinants for the observed variability in the estimated T1 values. The proposed approach to estimate T1 and its uncertainty without the need for repeated measurements may also prove to be useful for calculating effect sizes that are deemed significant when comparing group differences.

  8. Uncertainty estimations for quantitative in vivo MRI T1 mapping.


    Polders, Daniel L; Leemans, Alexander; Luijten, Peter R; Hoogduin, Hans


    Mapping the longitudinal relaxation time (T(1)) of brain tissue is of great interest for both clinical research and MRI sequence development. For an unambiguous interpretation of in vivo variations in T(1) images, it is important to understand the degree of variability that is associated with the quantitative T(1) parameter. This paper presents a general framework for estimating the uncertainty in quantitative T(1) mapping by combining a slice-shifted multi-slice inversion recovery EPI technique with the statistical wild-bootstrap approach. Both simulations and experimental analyses were performed to validate this novel approach and to evaluate the estimated T(1) uncertainty in several brain regions across four healthy volunteers. By estimating the T(1) uncertainty, it is shown that the variation in T(1) within anatomic regions for similar tissue types is larger than the uncertainty in the measurement. This indicates that heterogeneity of the inspected tissue and/or partial volume effects can be the main determinants for the observed variability in the estimated T(1) values. The proposed approach to estimate T(1) and its uncertainty without the need for repeated measurements may also prove to be useful for calculating effect sizes that are deemed significant when comparing group differences. PMID:23041796

  9. Screening for transgenic Japanese quail offspring.


    Poynter, Greg; Huss, David; Lansford, Rusty


    After mosaic founder breeding pairs of Japanese quail start to produce fertile eggs, the hatchlings must be screened for germ-line transmission to the subsequent G1 generation. This article describes how to isolate hatchling genomic DNA from the chorioallantoic membrane (CAM), which remains inside the egg after hatching. Collecting genomic DNA from the CAM decreases the hatchling's stress during handling and eliminates the need for a blood draw. By following this protocol, the CAM of a single egg will provide 50 microg or more of high-quality genomic DNA. The article also describes how to screen the genomic DNA samples for the transgene by the polymerase chain reaction (PCR). PCR genotyping should be used for screening hatchlings with a nonfluorescent transgene or with a fluorescently labeled transgene that does not lend itself well to phenotypic screening. PMID:20147014

  10. Transgenic approach to improve wheat (Triticum aestivum L.) nutritional quality.


    Tamás, Cecília; Kisgyörgy, Boglárka N; Rakszegi, Mariann; Wilkinson, Mark D; Yang, Moon-Sik; Láng, László; Tamás, László; Bedo, Zoltán


    An amaranth (Amaranthus hypochondriacus) albumin gene, encoding the 35-kDa AmA1 protein of the seed, with a high content of essential amino acids, was used in the biolistic transformation of bread wheat (Triticum aestivum L.) variety Cadenza. The transformation cassette carried the ama1 gene under the control of a powerful wheat endosperm-specific promoter (1Bx17 HMW-GS). Southern-blot analysis of T(1) lines confirmed the integration of the foreign gene, while RT-PCR and Western-blot analyses of the samples confirmed the transcription and translation of the transgene. The effects of the extra albumin protein on the properties of flour, produced from bulked T(2) seeds, were calculated using total protein and essential amino acid content analysis, polymeric/monomeric protein and HMW/LMW glutenin subunit ratio measurements. The results indicated that not only can essential amino acid content be increased, but some parameters associated with functional quality may also be improved because of the expression of the AmA1 protein. PMID:19466426

  11. Two Distinct Determinants of Ligand Specificity in T1R1/T1R3 (the Umami Taste Receptor)*

    PubMed Central

    Toda, Yasuka; Nakagita, Tomoya; Hayakawa, Takashi; Okada, Shinji; Narukawa, Masataka; Imai, Hiroo; Ishimaru, Yoshiro; Misaka, Takumi


    Umami taste perception in mammals is mediated by a heteromeric complex of two G-protein-coupled receptors, T1R1 and T1R3. T1R1/T1R3 exhibits species-dependent differences in ligand specificity; human T1R1/T1R3 specifically responds to l-Glu, whereas mouse T1R1/T1R3 responds more strongly to other l-amino acids than to l-Glu. The mechanism underlying this species difference remains unknown. In this study we analyzed chimeric human-mouse receptors and point mutants of T1R1/T1R3 and identified 12 key residues that modulate amino acid recognition in the human- and mouse-type responses in the extracellular Venus flytrap domain of T1R1. Molecular modeling revealed that the residues critical for human-type acidic amino acid recognition were located at the orthosteric ligand binding site. In contrast, all of the key residues for the mouse-type broad response were located at regions outside of both the orthosteric ligand binding site and the allosteric binding site for inosine-5′-monophosphate (IMP), a known natural umami taste enhancer. Site-directed mutagenesis demonstrated that the newly identified key residues for the mouse-type responses modulated receptor activity in a manner distinct from that of the allosteric modulation via IMP. Analyses of multiple point mutants suggested that the combination of two distinct determinants, amino acid selectivity at the orthosteric site and receptor activity modulation at the non-orthosteric sites, may mediate the ligand specificity of T1R1/T1R3. This hypothesis was supported by the results of studies using nonhuman primate T1R1 receptors. A complex molecular mechanism involving changes in the properties of both the orthosteric and non-orthosteric sites of T1R1 underlies the determination of ligand specificity in mammalian T1R1/T1R3. PMID:24214976

  12. T1-mapping in the heart: accuracy and precision

    PubMed Central


    The longitudinal relaxation time constant (T1) of the myocardium is altered in various disease states due to increased water content or other changes to the local molecular environment. Changes in both native T1 and T1 following administration of gadolinium (Gd) based contrast agents are considered important biomarkers and multiple methods have been suggested for quantifying myocardial T1 in vivo. Characterization of the native T1 of myocardial tissue may be used to detect and assess various cardiomyopathies while measurement of T1 with extracellular Gd based contrast agents provides additional information about the extracellular volume (ECV) fraction. The latter is particularly valuable for more diffuse diseases that are more challenging to detect using conventional late gadolinium enhancement (LGE). Both T1 and ECV measures have been shown to have important prognostic significance. T1-mapping has the potential to detect and quantify diffuse fibrosis at an early stage provided that the measurements have adequate reproducibility. Inversion recovery methods such as MOLLI have excellent precision and are highly reproducible when using tightly controlled protocols. The MOLLI method is widely available and is relatively mature. The accuracy of inversion recovery techniques is affected significantly by magnetization transfer (MT). Despite this, the estimate of apparent T1 using inversion recovery is a sensitive measure, which has been demonstrated to be a useful tool in characterizing tissue and discriminating disease. Saturation recovery methods have the potential to provide a more accurate measurement of T1 that is less sensitive to MT as well as other factors. Saturation recovery techniques are, however, noisier and somewhat more artifact prone and have not demonstrated the same level of reproducibility at this point in time. This review article focuses on the technical aspects of key T1-mapping methods and imaging protocols and describes their limitations including

  13. T1 Relaxation Time in Lungs of Asymptomatic Smokers

    PubMed Central

    Alamidi, Daniel F.; Kindvall, Simon S. I.; Hubbard Cristinacce, Penny L.; McGrath, Deirdre M.; Young, Simon S.; Naish, Josephine H.; Waterton, John C.; Wollmer, Per; Diaz, Sandra; Olsson, Marita; Hockings, Paul D.; Lagerstrand, Kerstin M.; Parker, Geoffrey J. M.; Olsson, Lars E.


    Purpose Interest in using T1 as a potential MRI biomarker of chronic obstructive pulmonary disease (COPD) has recently increased. Since tobacco smoking is the major risk factor for development of COPD, the aim for this study was to examine whether tobacco smoking, pack-years (PY), influenced T1 of the lung parenchyma in asymptomatic current smokers. Materials and Methods Lung T1 measurements from 35 subjects, 23 never smokers and 12 current smokers were retrospectively analyzed from an institutional review board approved study. All 35 subjects underwent pulmonary function test (PFT) measurements and lung T1, with similar T1 measurement protocols. A backward linear model of T1 as a function of FEV1, FVC, weight, height, age and PY was tested. Results A significant correlation between lung T1 and PY was found with a negative slope of -3.2 ms/year (95% confidence interval [CI] [-5.8, -0.6], p = 0.02), when adjusted for age and height. Lung T1 shortens with ageing among all subjects, -4.0 ms/year (95%CI [-6.3, -1.7], p = 0.001), and among the never smokers, -3.7 ms/year (95%CI [-6.0, -1.3], p = 0.003). Conclusions A correlation between lung T1 and PY when adjusted for both age and height was found, and T1 of the lung shortens with ageing. Accordingly, PY and age can be significant confounding factors when T1 is used as a biomarker in lung MRI studies that must be taken into account to detect underlying patterns of disease. PMID:26958856

  14. Efficient production of transgenic cassava using negative and positive selection.


    Zhang, P; Potrykus, I; Puonti-Kaerlas, J


    In order to improve the efficiency of cassava (Manihot esculenta Crantz) transformation, two different selection systems were assessed, a positive one based on the use of mannose as the selective agent, and a negative one based on hygromycin resistance encoded by an intron-containing hph gene. Transgenic plants selected on mannose or hygromycin were regenerated for the first time from embryogenic suspensions cocultivated with Agrobacterium. After the initial selection using mannose and hygromycin, 82.6% and 100% of the respective developing embryogenic callus lines were transgenic. A system allowing plant regeneration from only transgenic lines was designed by combining chemical selection with histochemical GUS assays. In total, 12 morphologically normal transgenic plant lines were produced, five using mannose and seven using hygromycin. The stable integration of the transgenes into the nuclear genome was verified using PCR and Southern analysis. RT-PCR and northern analyses confirmed the transgene expression in the regenerated plants. A rooting test on mannose containing medium was developed as an alternative to GUS assays in order to eliminate escapes from the positive selection system. Our results show that transgenic cassava plants can be obtained by using either antibiotic resistance genes that are not expressed in the micro-organisms or an antibiotic-free positive selection system. PMID:11206969

  15. Non-invasive instant genotyping of fluorescently labelled transgenic mice.


    Fink, Dieter; Yau, Tien Yin; Kolbe, Thomas; Rülicke, Thomas


    Fluorescence proteins have been useful as genetic reporters for a wide range of applications in biomedical research and are frequently used for the analysis of transgene activity. Here, we show that expression levels of the ubiquitously expressed fluorescent proteins eGFP, mCherry, and tdTomato can be measured in transgenic mouse lines with random or targeted integrations. We identified the tail of the mouse as the tissue best suited for quantifying fluorescence intensity and show that expression levels in the tail correlate with gene dose. This allows for instant non-invasive determination of the genetic condition at the transgenic locus (hemizygous/heterozygous and homozygous), while simultaneously providing an objective comparison for transgene expression levels among different mouse lines. In summary, we demonstrate for the first time that the gene dose of a ubiquitously expressed fluorescence reporter can be reliably quantified and directly linked to the genotype of transgenic mice. Based on this information, animals with the appropriate genotype can be instantly selected without laborious analysis for establishing and breeding of new transgenic lines, reducing the number of "waste" animals. Furthermore, no tissue sampling is necessary, which is a significant refinement of genotyping procedures. Both aspects are important improvements for the genotyping of transgenic mice that follow the principles of the 3 Rs (reduction and refinement). PMID:25981046

  16. Ultrashort TE T1ρ magic angle imaging.


    Du, Jiang; Statum, Sheronda; Znamirowski, Richard; Bydder, Graeme M; Chung, Christine B


    An ultrashort TE T(1)ρ sequence was used to measure T(1) ρ of the goat posterior cruciate ligament (n = 1) and human Achilles tendon specimens (n = 6) at a series of angles relative to the B(0) field and spin-lock field strengths to investigate the contribution of dipole-dipole interaction to T(1)ρ relaxation. Preliminary results showed a significant magic angle effect. T(1)ρ of the posterior cruciate ligament increased from 6.9 ± 1.3 ms at 0° to 36 ± 5 ms at 55° and then gradually reduced to 12 ± 3 ms at 90°. Mean T(1)ρ of the Achilles tendon increased from 5.5 ± 2.2 ms at 0° to 40 ± 5 ms at 55°. T(1)ρ dispersion study showed a significant T(1)ρ increase from 2.3 ± 0.9 ms to 11 ± 3 ms at 0° as the spin-lock field strength increased from 150 Hz to 1 kHz, and from 30 ± 3 ms to 42 ± 4 ms at 55° as the spin-lock field strength increased from 100 to 500 Hz. These results suggest that dipolar interaction is the dominant T(1)ρ relaxation mechanism in tendons and ligaments. PMID:22539354

  17. Expression of spearmint limonene synthase in transgenic spike lavender results in an altered monoterpene composition in developing leaves.


    Muñoz-Bertomeu, Jesús; Ros, Roc; Arrillaga, Isabel; Segura, Juan


    We generated transgenic spike lavender (Lavandula latifolia) plants constitutively expressing the limonene synthase (LS) gene from spearmint (Mentha spicata), encoding the LS enzyme that catalyzes the synthesis of limonene from geranyl diphosphate. Overexpression of the LS transgene did not consistently affect monoterpene profile in pooled leaves or flowers from transgenic T(0) plants. Analyses from cohorts of leaves sampled at different developmental stages showed that essential oil accumulation in transgenic and control plants was higher in developing than in mature leaves. Furthermore, developing leaves of transgenic plants contained increased limonene contents (more than 450% increase compared to controls) that correlated with the highest transcript accumulation of the LS gene. The levels of other monoterpene pathway components were also significantly altered. T(0) transgenic plants were grown for 2 years, self-pollinated, and the T(1) seeds obtained. The increased limonene phenotype was maintained in the progenies that inherited the LS transgene. PMID:18514005

  18. Voltage-dependent Gating Rearrangements in the Intracellular T1T1 Interface of a K+ Channel

    PubMed Central

    Wang, Guangyu; Covarrubias, Manuel


    The intracellular tetramerization domain (T1) of most eukaryotic voltage-gated potassium channels (Kv channels) exists as a “hanging gondola” below the transmembrane regions that directly control activation gating via the electromechanical coupling between the S4 voltage sensor and the main S6 gate. However, much less is known about the putative contribution of the T1 domain to Kv channel gating. This possibility is mechanistically intriguing because the T1–S1 linker connects the T1 domain to the voltage-sensing domain. Previously, we demonstrated that thiol-specific reagents inhibit Kv4.1 channels by reacting in a state-dependent manner with native Zn2+ site thiolate groups in the T1T1 interface; therefore, we concluded that the T1T1 interface is functionally active and not protected by Zn2+ (Wang, G., M. Shahidullah, C.A. Rocha, C. Strang, P.J. Pfaffinger, and M. Covarrubias. 2005. J. Gen. Physiol. 126:55–69). Here, we co-expressed Kv4.1 channels and auxiliary subunits (KChIP-1 and DPPX-S) to investigate the state and voltage dependence of the accessibility of MTSET to the three interfacial cysteines in the T1 domain. The results showed that the average MTSET modification rate constant (kMTSET) is dramatically enhanced in the activated state relative to the resting and inactivated states (∼260- and ∼47-fold, respectively). Crucially, under three separate conditions that produce distinct activation profiles, kMTSET is steeply voltage dependent in a manner that is precisely correlated with the peak conductance–voltage relations. These observations strongly suggest that Kv4 channel gating is tightly coupled to voltage-dependent accessibility changes of native T1 cysteines in the intersubunit Zn2+ site. Furthermore, cross-linking of cysteine pairs across the T1T1 interface induced substantial inhibition of the channel, which supports the functionally dynamic role of T1 in channel gating. Therefore, we conclude that the complex voltage

  19. Breaking-off tissue specific activity of the oil palm metallothionein-like gene promoter in T(1) seedlings of tomato exposed to metal ions.


    Kamaladini, Hossein; Nor Akmar Abdullah, Siti; Aziz, Maheran Abdul; Ismail, Ismanizan Bin; Haddadi, Fatemeh


    Metallothioneins (MTs) are cysteine-rich metal-binding proteins that are involved in cell growth regulation, transportation of metal ions and detoxification of heavy metals. A mesocarp-specific metallothionein-like gene (MT3-A) promoter was isolated from the oil palm (Elaeis guineensis Jacq). A vector construct containing the MT3-A promoter fused to the β-glucuronidase (GUS) gene in the pCAMBIA 1304 vector was produced and used in Agrobacterium-mediated transformation of tomato. Histochemical GUS assay of different tissues of transgenic tomato showed that the MT3-A promoter only drove GUS expression in the reproductive tissues and organs, including the anther, fruit and seed coat. Competitive RT-PCR and GUS fluorometric assay showed changes in the level of GUS mRNA and enzyme activity in the transgenic tomato (T(0)). No GUS mRNA was found in roots and leaves of transgenic tomato. In contrast, the leaves of transgenic tomato seedlings (T(1)) produced the highest GUS activity when treated with 150 μM Cu(2+) compared to the control (without Cu(2+)). However, Zn(2+) and Fe(2+) treatments did not show GUS expression in the leaves of the transgenic tomato seedlings. Interestingly, the results showed a breaking-off tissue-specific activity of the oil palm MT3-A promoter in T(1) seedlings of tomato when subjected to Cu(2+) ions. PMID:23290536

  20. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.


    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N


    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  1. Overexpression of mouse follistatin causes reproductive defects in transgenic mice.


    Guo, Q; Kumar, T R; Woodruff, T; Hadsell, L A; DeMayo, F J; Matzuk, M M


    Follistatin is an activin-binding protein that can act as an activin antagonist in vitro. Follistatin also binds heparin sulfate proteoglycans and may function as a reservoir for activins in vivo. In the mouse, follistatin mRNA is first detected in the deciduum on embryonic day 5.5 and later in the developing hindbrain, somites, vibrissae, teeth, epidermis, and muscle. We have previously shown that follistatin-deficient mice have numerous embryonic defects including shiny, taut skin, growth retardation, and cleft palate leading to death within hours of birth. To further define the roles of follistatin during mammalian reproduction and development, we created gain-of-function mutant mice in which mouse follistatin is overexpressed. The mouse metallothionein (MT)-I promoter was placed upstream of the six-exon mouse follistatin (FS) gene. To distinguish wild-type and transgenic follistatin mRNA, the 3'-untranslated region of the mouse follistatin gene was replaced with the SV40 untranslated and polyA sequences. Three male and two female founder transgenic mice were produced, were fertile, and transmitted the transgene to offspring. Northern blot analysis demonstrated that the transgene mRNA was expressed at varying levels in the livers of offspring from four of five of the transgenic lines and was expressed in the testes in all five lines. In MT-FS line 4, which had the highest expression of the transgene mRNA in the liver, the transgene transcripts were also present in multiple other tissues. Phenotypically, the MT-FS transgenic lines had defects in the testis, ovary, and hair. Mice from MT-FS lines 7 and 10 had slightly decreased testis size, whereas mice from lines 4, 5, and 9 had much smaller testes and shiny, somewhat irregular, fur. Histological analysis of the adult testes from line 5 and 9 males showed variable degrees of Leydig cell hyperplasia, an arrest of spermatogenesis, and seminiferous tubular degeneration leading to infertility. Female transgenic mice

  2. Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants

    PubMed Central

    Udawat, Pushpika; Jha, Rajesh K.; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath


    The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and O2− radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

  3. Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants.


    Udawat, Pushpika; Jha, Rajesh K; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath


    The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and [Formula: see text] radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

  4. Hybridization and backcrossing between transgenic oilseed rape and two related weed species under field conditions.


    Halfhill, Matthew D; Zhu, Bin; Warwick, Suzanne I; Raymer, Paul L; Millwood, Reginald J; Weissinger, Arthur K; Stewart, C Neal


    Determining the frequency of crop-wild transgene flow under field conditions is a necessity for the development of regulatory strategies to manage transgenic hybrids. Gene flow of green fluorescent protein (GFP) and Bacillus thuringiensis (Bt) transgenes was quantified in three field experiments using eleven independent transformed Brassica napus L. lines and the wild relatives, B. rapa L. and Raphanus raphanistrum L. Under a high crop to wild relative ratio (600:1), hybridization frequency with B. rapa differed among the individual transformed B. napus lines (ranging from ca. 4% to 22%), however, this difference could be caused by the insertion events or other factors, e.g., differences in the hybridization frequencies among the B. rapa plants. The average hybridization frequency over all transformed lines was close to 10%. No hybridization with R. raphanistrum was detected. Under a lower crop to wild relative ratio (180:1), hybridization frequency with B. rapa was consistent among the transformed B. napus lines at ca. 2%. Interspecific hybridization was higher when B. rapa occurred within the B. napus plot (ca. 37.2%) compared with plot margins (ca. 5.2%). No significant differences were detected among marginal plants grown at 1, 2, and 3 m from the field plot. Transgene backcrossing frequency between B. rapa and transgenic hybrids was determined in two field experiments in which the wild relative to transgenic hybrid ratio was 5-15 plants of B. rapa to 1 transgenic hybrid. As expected, ca. 50% of the seeds produced were transgenic backcrosses when the transgenic hybrid plants served as the maternal parent. When B. rapa plants served as the maternal parent, transgene backcrossing frequencies were 0.088% and 0.060%. Results show that transgene flow from many independent transformed lines of B. napus to B. rapa can occur under a range of field conditions, and that transgenic hybrids have a high potential to produce transgenic seeds in backcrosses. PMID:15612504

  5. Cardiac magnetic resonance T1 mapping of left atrial myocardium

    PubMed Central

    Beinart, Roy; Khurram, Irfan M.; Liu, Songtao; Yarmohammadi, Hirad; Halperin, Henry R.; Bluemke, David A.; Gai, Neville; van der Geest, Rob J.; Lima, Joao A.C.; Calkins, Hugh; Zimmerman, Stefan L.; Nazarian, Saman


    BACKGROUND Cardiac magnetic resonance (CMR) T1 mapping is an emerging tool for objective quantification of myocardial fibrosis. OBJECTIVES To (a) establish the feasibility of left atrial (LA) T1 measurements, (b) determine the range of LA T1 values in patients with atrial fibrillation (AF) vs healthy volunteers, and (c) validate T1 mapping vs LA intracardiac electrogram voltage amplitude measures. METHODS CMR imaging at 1.5 T was performed in 51 consecutive patients before AF ablation and in 16 healthy volunteers. T1 measurements were obtained from the posterior LA myocardium by using the modified Look-Locker inversion-recovery sequence. Given the established association of reduced electrogram amplitude with fibrosis, intracardiac point-by-point bipolar LA voltage measures were recorded for the validation of T1 measurements. RESULTS The median LA T1 relaxation time was shorter in patients with AF (387 [interquartile range 364–428] ms) compared to healthy volunteers (459 [interquartile range 418–532] ms; P < .001) and was shorter in patients with AF with prior ablation compared to patients without prior ablation (P = .035). In a generalized estimating equations model, adjusting for data clusters per participant, age, rhythm during CMR, prior ablation, AF type, hypertension, and diabetes, each 100-ms increase in T1 relaxation time was associated with 0.1 mV increase in intracardiac bipolar LA voltage (P = .025). CONCLUSIONS Measurement of the LA myocardium T1 relaxation time is feasible and strongly associated with invasive voltage measures. This methodology may improve the quantification of fibrotic changes in thin-walled myocardial tissues. PMID:23643513

  6. Design and Management of Field Trials of Transgenic Cereals

    NASA Astrophysics Data System (ADS)

    Bedő, Zoltán; Rakszegi, Mariann; Láng, László

    The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

  7. Gene flow from transgenic common beans expressing the bar gene.


    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L


    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium. PMID:21865877

  8. BAC TransgeneOmics

    PubMed Central

    Poser, Ina; Sarov, Mihail; Hutchins, James R A; Hériché, Jean-Karim; Toyoda, Yusuke; Pozniakovsky, Andrei; Weigl, Daniela; Nitzsche, Anja; Hegemann, Björn; Bird, Alexander W; Pelletier, Laurence; Kittler, Ralf; Hua, Sujun; Naumann, Ronald; Augsburg, Martina; Sykora, Martina M; Hofemeister, Helmut; Zhang, Youming; Nasmyth, Kim; White, Kevin P; Dietzel, Steffen; Mechtler, Karl; Durbin, Richard; Stewart, A Francis; Peters, Jan-Michael; Buchholz, Frank; Hyman, Anthony A


    The interpretation of genome sequences requires reliable and standardized methods to assess protein function at high throughput. Here we describe a fast and reliable pipeline to study protein function in mammalian cells based on protein tagging in bacterial artificial chromosomes (BACs). The large size of the BAC transgenes ensures the presence of most, if not all, regulatory elements and results in expression that closely matches that of the endogenous gene. We show that BAC transgenes can be rapidly and reliably generated using 96-well-format recombineering. After stable transfection of these transgenes into human tissue culture cells or mouse embryonic stem cells, the localization, protein-protein and/or protein-DNA interactions of the tagged protein are studied using generic, tag-based assays. The same high-throughput approach will be generally applicable to other model systems. PMID:18391959

  9. A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...

  10. [Oncogenesis in transgenic mice].


    Shvemberger, I N; Ermilov, A N


    Oncogenesis in transgenic mice is at present a model, most adequately reflecting the natural conditions of tumor development. One of more important traits of this model is that it allows to study malignant growth simultaneously at all the structure-function levels in the context of the whole organism. This paper is a review of results of a series of experiments in which the localization of tumors was dependent or independent on the tissue specificity of a promoter, as well as development of multiple tumors with the use of viral regulatory sequences in genetic constructions. It has been shown that although a transgene is expressed in most of the tissues, tumors develop in some particular tissues only. These observations are interpreted by some authors in favour of the concept of multistep cancerogenesis. In this view, of primary importance are the results of studies on oncogenesis in transgenic mice, which contradict this concept and are regarded by their authors as an evidence of the possibility of a one-step transformation of normal cell into malignant one. The analysis of the obtained material enabled us to put forward an assumption that the key role in oncogenesis is played not only by certain genetic disturbances, but also by multi-level homeostatic mechanisms. Apparently, it is just the transgenic mice with cellular or viral oncogenes in their genome that represent a more adequate model for the detection of certain molecular-biological mechanisms underlying these disturbances. Also, of much importance is abundant material accumulated by now on oncogenesis of transgenic mice which shows a possibility of the effective use of various genetic constructions with prokaryotic and eukaryotic regulatory sequences, a possibility to induce not only tumors of some particular tissues, but also multiple hyperplastic and neoplastic changes in one and the same mouse. Development of tumors in such transgenic mice can be regarded as a model of different types of cancer disease

  11. hPepT1 mediates bacterial tripeptide fMLP uptake in human monocytes.


    Charrier, Laetitia; Driss, Adel; Yan, Yutao; Nduati, Vivienne; Klapproth, Jan-Michael; Sitaraman, Shanthi V; Merlin, Didier


    Here, we examined hPepT1 expression in the monocytic cell line, KG-1. Reverse transcription polymerase chain reaction (RT-PCR) analysis revealed that hPepT1 is expressed in KG-1 cells, while cDNA cloning and direct sequencing confirmed the sequence of KG-1 hPepT1 (accession number, AY634368). Immunoblotting of cell lysates from KG-1 cells or macrophages isolated from human peripheral blood revealed a approximately 100 kDa immunoreactive band mainly present in the membrane fraction. Uptake experiments showed that the transport of 20 microM radiolabeled Gly-Sarcosine ([14C]Gly-Sar) in KG-1 cells was Na+, Cl- dependent and disodium 4,4'-diisothiocyanatostilbene-2,2'-disulfonate (DIDS)-sensitive. In addition, hPepT1 activity was likely to be coupled to a Na+/H+ exchanger, as evidenced by the fact that [14C]Gly-Sar uptake was not affected by the absence of Na+ when cells were incubated at low pH (5.2). Interestingly, hPepT1-mediated transport was reduced in KG-1 cells incubated at low pH as it was also observed in nonpolarized Caco2-BBE cells. This pattern of pH-dependence is due to a disruption of the driving force of hPepT1-mediated transport events. This was supported by our finding that nonpolarized cells, Caco2-BBE cells and KG-1 cells, have an increased permeability to H+ when compared to polarized Caco2-BBE cells. Finally, we showed that hPepT1 is responsible for transporting fMLP into undifferentiated and differentiated (macrophage-like) KG-1 cells. Together, these results show that hPepT1 is expressed in nonpolarized immune cells, such as macrophages, where the transporter functions best at the physiological pH 7.2. Furthermore, we provide evidence for hPepT1-mediated fMLP transport, which might constitute a novel immune cell activation pathway during intestinal inflammation. PMID:16568107

  12. Introgression of the SbASR-1 gene cloned from a halophyte Salicornia brachiate enhances salinity and drought endurance in transgenic groundnut (arachis hypogaea)and acts as a transcription factor [corrected].


    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath


    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  13. Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

    PubMed Central

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath


    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  14. Loss of sense transgene-induced post-transcriptional gene silencing by sequential introduction of the same transgene sequences in tobacco.


    Hirai, Sayaka; Takahashi, Kouta; Abiko, Tomomi; Kodama, Hiroaki


    RNA silencing is an epigenetic inhibition of gene expression and is guided by small interfering RNAs. Sense transgene-induced post-transcriptional gene silencing (S-PTGS) occurs in a portion of a transgenic plant population. When a sense transgene encoding a tobacco endoplasmic reticulum omega-3 fatty acid desaturase (NtFAD3) was introduced into tobacco plants, an S-PTGS line, S44, was obtained. Introduction of another copy of the NtFAD3 transgene into S44 plants caused a phenotypic change from S-PTGS to overexpression. Because this change was associated with the methylation of the promoter sequences of the transgene, reduced transcriptional activity may abolish S-PTGS and residual transcription of the sense transgene may account for the overexpression. To clarify whether RNA-directed DNA methylation (RdDM) can repress the transcriptional activity of the S44 transgene locus, we introduced several RdDM constructs targeting the transgene promoter. An RdDM construct harboring a 200-bp-long fragment of promoter sequences efficiently abrogated the generation of NtFAD3 small interfering RNAs in S44 plants. Transcription of the transgene was partially repressed, but the resulting NtFAD3 mRNAs successfully accumulated and an overexpressed phenotype was established. Our results indicate an example in which overexpression of the transgene is established by complex epigenetic interactions among the transgenic loci. PMID:20180844

  15. Regulation of endothelial-specific transgene expression by the LacI repressor protein in vivo.


    Morton, Susan K; Chaston, Daniel J; Baillie, Brett K; Hill, Caryl E; Matthaei, Klaus I


    Genetically modified mice have played an important part in elucidating gene function in vivo. However, conclusions from transgenic studies may be compromised by complications arising from the site of transgene integration into the genome and, in inducible systems, the non-innocuous nature of inducer molecules. The aim of the present study was to use the vascular system to validate a technique based on the bacterial lac operon system, in which transgene expression can be repressed and de-repressed by an innocuous lactose analogue, IPTG. We have modified an endothelium specific promoter (TIE2) with synthetic LacO sequences and made transgenic mouse lines with this modified promoter driving expression of mutant forms of connexin40 and an independently translated reporter, EGFP. We show that tissue specificity of this modified promoter is retained in the vasculature of transgenic mice in spite of the presence of LacO sequences, and that transgene expression is uniform throughout the endothelium of a range of adult systemic and cerebral arteries and arterioles. Moreover, transgene expression can be consistently down-regulated by crossing the transgenic mice with mice expressing an inhibitor protein LacI(R), and in one transgenic line, transgene expression could be de-repressed rapidly by the innocuous inducer, IPTG. We conclude that the modified bacterial lac operon system can be used successfully to validate transgenic phenotypes through a simple breeding schedule with mice homozygous for the LacI(R) protein. PMID:24755679

  16. A thermoalkaliphilic lipase of Geobacillus sp. T1.


    Leow, Thean Chor; Rahman, Raja Noor Zaliha Raja Abd; Basri, Mahiran; Salleh, Abu Bakar


    A thermoalkaliphilic T1 lipase gene of Geobacillus sp. strain T1 was overexpressed in pGEX vector in the prokaryotic system. Removal of the signal peptide improved protein solubility and promoted the binding of GST moiety to the glutathione-Sepharose column. High-yield purification of T1 lipase was achieved through two-step affinity chromatography with a final specific activity and yield of 958.2 U/mg and 51.5%, respectively. The molecular mass of T1 lipase was determined to be approximately 43 kDa by gel filtration chromatography. T1 lipase had an optimum temperature and pH of 70 degrees C and pH 9, respectively. It was stable up to 65 degrees C with a half-life of 5 h 15 min at pH 9. It was stable in the presence of 1 mM metal ions Na(+), Ca(2+), Mn(2+), K(+) and Mg(2+ ), but inhibited by Cu(2+), Fe(3+) and Zn(2+). Tween 80 significantly enhanced T1 lipase activity. T1 lipase was active towards medium to long chain triacylglycerols (C10-C14) and various natural oils with a marked preference for trilaurin (C12) (triacylglycerol) and sunflower oil (natural oil). Serine and aspartate residues were involved in catalysis, as its activity was strongly inhibited by 5 mM PMSF and 1 mM Pepstatin. The T(m) for T1 lipase was around 72.2 degrees C, as revealed by denatured protein analysis of CD spectra. PMID:17426920

  17. Multiple effects of genetic background on variegated transgene expression in mice.

    PubMed Central

    Opsahl, Margaret L; McClenaghan, Margaret; Springbett, Anthea; Reid, Sarah; Lathe, Richard; Colman, Alan; Whitelaw, C Bruce A


    BLG/7 transgenic mice express an ovine beta-lactoglobulin transgene during lactation. Unusually, transgene expression levels in milk differ between siblings. This variable expression is due to variegated transgene expression in the mammary gland and is reminiscent of position-effect variegation. The BLG/7 line was created and maintained on a mixed CBA x C57BL/6 background. We have investigated the effect on transgene expression of backcrossing for 13 generations into these backgrounds. Variable transgene expression was observed in all populations examined, confirming that it is an inherent property of the transgene array at its site of integration. There were also strain-specific effects on transgene expression that appear to be independent of the inherent variegation. The transgene, compared to endogenous milk protein genes, is specifically susceptible to inbreeding depression. Outcrossing restored transgene expression levels to that of the parental population; thus suppression was not inherited. Finally, no generation-dependent decrease in mean expression levels was observed in the parental population. Thus, although the BLG/7 transgene is expressed in a variegated manner, there was no generation-associated accumulated silencing of transgene expression. PMID:11901126

  18. Secretion of N- and O-linked Glycoproteins from 4T1 Murine Mammary Carcinoma Cells

    PubMed Central

    Phang, Wai-Mei; Tan, Aik-Aun; Gopinath, Subash C.B.; Hashim, Onn H.; Kiew, Lik Voon; Chen, Yeng


    Breast cancer is one of the most common cancers that affect women globally and accounts for ~23% of all cancers diagnosed in women. Breast cancer is also one of the leading causes of death primarily due to late stage diagnoses and a lack of effective treatments. Therefore, discovering protein expression biomarkers is mandatory for early detection and thus, critical for successful therapy. Two-dimensional electrophoresis (2D-E) coupled with lectin-based analysis followed by mass spectrometry were applied to identify potential biomarkers in the secretions of a murine mammary carcinoma cell line. Comparisons of the protein profiles of the murine 4T1 mammary carcinoma cell line and a normal murine MM3MG mammary cell line indicated that cadherin-1 (CDH), collagenase 3 (MMP-13), Viral envelope protein G7e (VEP), Gag protein (GAG) and Hypothetical protein LOC433182 (LOC) were uniquely expressed by the 4T1 cells, and pigment epithelium-derived factor (PEDF) was exclusively secreted by the MM3MG cells. Further analysis by a lectin-based study revealed that aberrant O-glycosylated CDH, N-glycosylated MMP-13 and LOC were present in the 4T1 medium. These differentially expressed N- and O-linked glycoprotein candidates, which were identified by combining lectin-based analysis with 2D-E, could serve as potential diagnostic and prognostic markers for breast cancer. PMID:27226773

  19. Secretion of N- and O-linked Glycoproteins from 4T1 Murine Mammary Carcinoma Cells.


    Phang, Wai-Mei; Tan, Aik-Aun; Gopinath, Subash C B; Hashim, Onn H; Kiew, Lik Voon; Chen, Yeng


    Breast cancer is one of the most common cancers that affect women globally and accounts for ~23% of all cancers diagnosed in women. Breast cancer is also one of the leading causes of death primarily due to late stage diagnoses and a lack of effective treatments. Therefore, discovering protein expression biomarkers is mandatory for early detection and thus, critical for successful therapy. Two-dimensional electrophoresis (2D-E) coupled with lectin-based analysis followed by mass spectrometry were applied to identify potential biomarkers in the secretions of a murine mammary carcinoma cell line. Comparisons of the protein profiles of the murine 4T1 mammary carcinoma cell line and a normal murine MM3MG mammary cell line indicated that cadherin-1 (CDH), collagenase 3 (MMP-13), Viral envelope protein G7e (VEP), Gag protein (GAG) and Hypothetical protein LOC433182 (LOC) were uniquely expressed by the 4T1 cells, and pigment epithelium-derived factor (PEDF) was exclusively secreted by the MM3MG cells. Further analysis by a lectin-based study revealed that aberrant O-glycosylated CDH, N-glycosylated MMP-13 and LOC were present in the 4T1 medium. These differentially expressed N- and O-linked glycoprotein candidates, which were identified by combining lectin-based analysis with 2D-E, could serve as potential diagnostic and prognostic markers for breast cancer. PMID:27226773

  20. Transgenic Crops for Herbicide Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since their introduction in 1995, crops made resistant to the broad-spectrum herbicides glyphosate and glufosinate with transgenes are widely available and used in much of the world. As of 2008, over 80% of the transgenic crops grown world-wide have this transgenic trait. This technology has had m...

  1. Transgenic Hydra allow in vivo tracking of individual stem cells during morphogenesis

    PubMed Central

    Wittlieb, Jörg; Khalturin, Konstantin; Lohmann, Jan U.; Anton-Erxleben, Friederike; Bosch, Thomas C. G.


    Understanding the evolution of development in large part relies on the study of phylogenetically old organisms. Cnidarians, such as Hydra, have become attractive model organisms for these studies. However, despite long-term efforts, stably transgenic animals could not be generated, severely limiting the functional analysis of genes. Here we report the efficient generation of transgenic Hydra lines by embryo microinjection. One of these transgenic lines expressing EGFP revealed remarkably high motility of individual endodermal epithelial cells during morphogenesis. We expect that transgenic Hydra will become important tools to dissect the molecular mechanisms of development at the base of the Metazoan tree. PMID:16556723

  2. 2012 North Dakota Transgenic Barley FHB Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 2012 North Dakota transgenic field trials consisted of 23 barley lines, tested in three misted and three non-misted replicates. Plots were sown on May 9, 2012 in hill plots with 10 seed per hill spaced at 30 cm, and all plots were inoculated using the grain spawn method at heading. Lines include...

  3. Transgenic Farm Animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The development of recombinant DNA technology has enabled scientists to isolate single genes, analyze and modify their nucleotide structure(s), make copies of these isolated genes, and insert copies of these genes into the genome of plants and animals. The transgenic technology of adding genes to li...

  4. In vivo quantification of hyperoxic arterial blood water T1.


    Siero, Jeroen C W; Strother, Megan K; Faraco, Carlos C; Hoogduin, Hans; Hendrikse, Jeroen; Donahue, Manus J


    Normocapnic hyperoxic and hypercapnic hyperoxic gas challenges are increasingly being used in cerebrovascular reactivity (CVR) and calibrated functional MRI experiments. The longitudinal arterial blood water relaxation time (T1a) change with hyperoxia will influence signal quantification through mechanisms relating to elevated partial pressure of plasma-dissolved O2 (pO2) and increased oxygen bound to hemoglobin in arteries (Ya) and veins (Yv). The dependence of T1a on Ya and Yv has been elegantly characterized ex vivo; however, the combined influence of pO2, Ya and Yv on T1a in vivo under normal ventilation has not been reported. Here, T1a is calculated during hyperoxia in vivo by a heuristic approach that evaluates T1 -dependent arterial spin labeling (ASL) signal changes to varying gas stimuli. Healthy volunteers (n = 14; age, 31.5 ± 7.2 years) were scanned using pseudo-continuous ASL in combination with room air (RA; 21% O2/79% N2), hypercapnic normoxic (HN; 5% CO2/21% O2/74% N2) and hypercapnic hyperoxic (HH; 5% CO2/95% O2) gas administration. HH T1a was calculated by requiring that the HN and HH cerebral blood flow (CBF) change be identical. The HH protocol was then repeated in patients (n = 10; age, 61.4 ± 13.3 years) with intracranial stenosis to assess whether an HH T1a decrease prohibited ASL from being performed in subjects with known delayed blood arrival times. Arterial blood T1a decreased from 1.65 s at baseline to 1.49 ± 0.07 s during HH. In patients, CBF values in the affected flow territory for the HH condition were increased relative to baseline CBF values and were within the physiological range (RA CBF = 36.6 ± 8.2 mL/100 g/min; HH CBF = 45.2 ± 13.9 mL/100 g/min). It can be concluded that hyperoxic (95% O2) 3-T arterial blood T1aHH = 1.49 ± 0.07 s relative to a normoxic T1a of 1.65 s. PMID:26419505

  5. Proteomic analysis of imatinib-resistant CML-T1 cells reveals calcium homeostasis as a potential therapeutic target

    PubMed Central

    Toman, O.; Kabickova, T.; Vit, O.; Fiser, R.; Polakova, K. Machova; Zach, J.; Linhartova, J.; Vyoral, D.; Petrak, J.


    Chronic myeloid leukemia (CML) therapy has markedly improved patient prognosis after introduction of imatinib mesylate for clinical use. However, a subset of patients develops resistance to imatinib and other tyrosine kinase inhibitors (TKIs), mainly due to point mutations in the region encoding the kinase domain of the fused BCR-ABL oncogene. To identify potential therapeutic targets in imatinib-resistant CML cells, we derived imatinib-resistant CML-T1 human cell line clone (CML-T1/IR) by prolonged exposure to imatinib in growth media. Mutational analysis revealed that the Y235H mutation in BCR-ABL is probably the main cause of CML-T1/IR resistance to imatinib. To identify alternative therapeutic targets for selective elimination of imatinib-resistant cells, we compared the proteome profiles of CML-T1 and CML-T1/IR cells using 2-DE-MS. We identified eight differentially expressed proteins, with strongly upregulated Na+/H+ exchanger regulatory factor 1 (NHERF1) in the resistant cells, suggesting that this protein may influence cytosolic pH, Ca2+ concentration or signaling pathways such as Wnt in CML-T1/IR cells. We tested several compounds including drugs in clinical use that interfere with the aforementioned processes and tested their relative toxicity to CML-T1 and CML-T1/IR cells. Calcium channel blockers, calcium signaling antagonists and modulators of calcium homeostasis, namely thapsigargin, ionomycin, verapamil, carboxyamidotriazole and immunosuppressive drugs cyclosporine A and tacrolimus (FK-506) were selectively toxic to CML-T1/IR cells. The putative cellular targets of these compounds in CML-T1/IR cells are postulated in this study. We propose that Ca2+ homeostasis can be a potential therapeutic target in CML cells resistant to TKIs. We demonstrate that a proteomic approach may be used to characterize a TKI-resistant population of CML cells enabling future individualized treatment options for patients. PMID:27430982

  6. Assessment of myocardial fibrosis with T1 mapping MRI.


    Everett, R J; Stirrat, C G; Semple, S I R; Newby, D E; Dweck, M R; Mirsadraee, S


    Myocardial fibrosis can arise from a range of pathological processes and its presence correlates with adverse clinical outcomes. Cardiac magnetic resonance (CMR) can provide a non-invasive assessment of cardiac structure, function, and tissue characteristics, which includes late gadolinium enhancement (LGE) techniques to identify focal irreversible replacement fibrosis with a high degree of accuracy and reproducibility. Importantly the presence of LGE is consistently associated with adverse outcomes in a range of common cardiac conditions; however, LGE techniques are qualitative and unable to detect diffuse myocardial fibrosis, which is an earlier form of fibrosis preceding replacement fibrosis that may be reversible. Novel T1 mapping techniques allow quantitative CMR assessment of diffuse myocardial fibrosis with the two most common measures being native T1 and extracellular volume (ECV) fraction. Native T1 differentiates normal from infarcted myocardium, is abnormal in hypertrophic cardiomyopathy, and may be particularly useful in the diagnosis of Anderson-Fabry disease and amyloidosis. ECV is a surrogate measure of the extracellular space and is equivalent to the myocardial volume of distribution of the gadolinium-based contrast medium. It is reproducible and correlates well with fibrosis on histology. ECV is abnormal in patients with cardiac failure and aortic stenosis, and is associated with functional impairment in these groups. T1 mapping techniques promise to allow earlier detection of disease, monitor disease progression, and inform prognosis; however, limitations remain. In particular, reference ranges are lacking for T1 mapping values as these are influenced by specific CMR techniques and magnetic field strength. In addition, there is significant overlap between T1 mapping values in healthy controls and most disease states, particularly using native T1, limiting the clinical application of these techniques at present. PMID:27005015

  7. Hyperpolarized (129)Xe T (1) in oxygenated and deoxygenated blood

    NASA Technical Reports Server (NTRS)

    Albert, M. S.; Balamore, D.; Kacher, D. F.; Venkatesh, A. K.; Jolesz, F. A.


    The viability of the new technique of hyperpolarized (129)Xe MRI (HypX-MRI) for imaging organs other than the lungs depends on whether the spin-lattice relaxation time, T(1), of (129)Xe is sufficiently long in the blood. In previous experiments by the authors, the T(1) was found to be strongly dependent upon the oxygenation of the blood, with T(1) increasing from about 3 s in deoxygenated samples to about 10 s in oxygenated samples. Contrarily, Tseng et al. (J. Magn. Reson. 1997; 126: 79-86) reported extremely long T(1) values deduced from an indirect experiment in which hyperpolarized (129)Xe was used to create a 'blood-foam'. They found that oxygenation decreased T(1). Pivotal to their experiment is the continual and rapid exchange of hyperpolarized (129)Xe between the gas phase (within blood-foam bubbles) and the dissolved phase (in the skin of the bubbles); this necessitated a complicated analysis to extract the T(1) of (129)Xe in blood. In the present study, the experimental design minimizes gas exchange after the initial bolus of hyperpolarized (129)Xe has been bubbled through the sample. This study confirms that oxygenation increases the T(1) of (129)Xe in blood, from about 4 s in freshly drawn venous blood, to about 13 s in blood oxygenated to arterial levels, and also shifts the red blood cell resonance to higher frequency. Copyright 2000 John Wiley & Sons, Ltd. Abbreviations used BOLD blood oxygen level dependent NOE nuclear overhouses effect PO(2) oxygen partial pressure RBC red blood cells RF radio frequency SNR signal-to-noise ratio.

  8. The distribution of cotransformed transgenes in particle bombardment-mediated transformed wheat.


    Han, Yonghua; Blechl, Ann; Wang, Daowen


    Although particle bombardment is the predominant method of foreign DNA direct transfer, whether transgene is integrated randomly into the genome has not been determined. In this study, we identified the distribution of transgene loci in 45 transgenic wheat (Triticum aestivum L.) lines containing co-transformed high molecular weight glutenin subunit genes and the selectable marker bar using fluorescence in situ hybridization. Transgene loci were shown to distribute unevenly throughout the genome and incorporate into different locations along individual chromosomes. There was only a slight tendency towards the localization of transgenes in distal chromosome regions. High proportions of transgenes in separate plasmids integrated at the same site and only 7 lines had 2 or 3 loci. Such loci may not segregate frequently in subsequent generations so it is difficult to remove selectable markers from transgenic lines after regeneration. We also found that three transgene lines were associated with rearranged chromosomes, suggesting a the close relationship between particle bombardment-mediated transgene integration and chromosomal rearrangements. PMID:26405007

  9. Limited Fitness Advantages of Crop-Weed Hybrid Progeny Containing Insect-Resistant Transgenes (Bt/CpTI) in Transgenic Rice Field

    PubMed Central

    Yang, Xiao; Wang, Feng; Su, Jun; Lu, Bao-Rong


    Background The spread of insect-resistance transgenes from genetically engineered (GE) rice to its coexisting weedy rice (O. sativa f. spontanea) populations via gene flow creates a major concern for commercial GE rice cultivation. Transgene flow to weedy rice seems unavoidable. Therefore, characterization of potential fitness effect brought by the transgenes is essential to assess environmental consequences caused by crop-weed transgene flow. Methodology/Principal Findings Field performance of fitness-related traits was assessed in advanced hybrid progeny of F4 generation derived from a cross between an insect-resistant transgenic (Bt/CpTI) rice line and a weedy strain. The performance of transgene-positive hybrid progeny was compared with the transgene-negative progeny and weedy parent in pure and mixed planting of transgenic and nontransgenic plants under environmental conditions with natural vs. low insect pressure. Results showed that under natural insect pressure the insect-resistant transgenes could effectively suppress target insects and bring significantly increased fitness to transgenic plants in pure planting, compared with nontransgenic plants (including weedy parent). In contrast, no significant differences in fitness were detected under low insect pressure. However, such increase in fitness was not detected in the mixed planting of transgenic and nontransgenic plants due to significantly reduced insect pressure. Conclusions/Significance Insect-resistance transgenes may have limited fitness advantages to hybrid progeny resulted from crop-weed transgene flow owning to the significantly reduced ambient target insect pressure when an insect-resistant GE crop is grown. Given that the extensive cultivation of an insect-resistant GE crop will ultimately reduce the target insect pressure, the rapid spread of insect-resistance transgenes in weedy populations in commercial GE crop fields may be not likely to happen. PMID:22815975

  10. Constitutive overexpression of the TaNF-YB4 gene in transgenic wheat significantly improves grain yield.


    Yadav, Dinesh; Shavrukov, Yuri; Bazanova, Natalia; Chirkova, Larissa; Borisjuk, Nikolai; Kovalchuk, Nataliya; Ismagul, Ainur; Parent, Boris; Langridge, Peter; Hrmova, Maria; Lopato, Sergiy


    Heterotrimeric nuclear factors Y (NF-Ys) are involved in regulation of various vital functions in all eukaryotic organisms. Although a number of NF-Y subunits have been characterized in model plants, only a few have been functionally evaluated in crops. In this work, a number of genes encoding NF-YB and NF-YC subunits were isolated from drought-tolerant wheat (Triticum aestivum L. cv. RAC875), and the impact of the overexpression of TaNF-YB4 in the Australian wheat cultivar Gladius was investigated. TaNF-YB4 was isolated as a result of two consecutive yeast two-hybrid (Y2H) screens, where ZmNF-YB2a was used as a starting bait. A new NF-YC subunit, designated TaNF-YC15, was isolated in the first Y2H screen and used as bait in a second screen, which identified two wheat NF-YB subunits, TaNF-YB2 and TaNF-YB4. Three-dimensional modelling of a TaNF-YB2/TaNF-YC15 dimer revealed structural determinants that may underlie interaction selectivity. The TaNF-YB4 gene was placed under the control of the strong constitutive polyubiquitin promoter from maize and introduced into wheat by biolistic bombardment. The growth and yield components of several independent transgenic lines with up-regulated levels of TaNF-YB4 were evaluated under well-watered conditions (T1-T3 generations) and under mild drought (T2 generation). Analysis of T2 plants was performed in large deep containers in conditions close to field trials. Under optimal watering conditions, transgenic wheat plants produced significantly more spikes but other yield components did not change. This resulted in a 20-30% increased grain yield compared with untransformed control plants. Under water-limited conditions transgenic lines maintained parity in yield performance. PMID:26220082

  11. Constitutive overexpression of the TaNF-YB4 gene in transgenic wheat significantly improves grain yield

    PubMed Central

    Yadav, Dinesh; Shavrukov, Yuri; Bazanova, Natalia; Chirkova, Larissa; Borisjuk, Nikolai; Kovalchuk, Nataliya; Ismagul, Ainur; Parent, Boris; Langridge, Peter; Hrmova, Maria; Lopato, Sergiy


    Heterotrimeric nuclear factors Y (NF-Ys) are involved in regulation of various vital functions in all eukaryotic organisms. Although a number of NF-Y subunits have been characterized in model plants, only a few have been functionally evaluated in crops. In this work, a number of genes encoding NF-YB and NF-YC subunits were isolated from drought-tolerant wheat (Triticum aestivum L. cv. RAC875), and the impact of the overexpression of TaNF-YB4 in the Australian wheat cultivar Gladius was investigated. TaNF-YB4 was isolated as a result of two consecutive yeast two-hybrid (Y2H) screens, where ZmNF-YB2a was used as a starting bait. A new NF-YC subunit, designated TaNF-YC15, was isolated in the first Y2H screen and used as bait in a second screen, which identified two wheat NF-YB subunits, TaNF-YB2 and TaNF-YB4. Three-dimensional modelling of a TaNF-YB2/TaNF-YC15 dimer revealed structural determinants that may underlie interaction selectivity. The TaNF-YB4 gene was placed under the control of the strong constitutive polyubiquitin promoter from maize and introduced into wheat by biolistic bombardment. The growth and yield components of several independent transgenic lines with up-regulated levels of TaNF-YB4 were evaluated under well-watered conditions (T1–T3 generations) and under mild drought (T2 generation). Analysis of T2 plants was performed in large deep containers in conditions close to field trials. Under optimal watering conditions, transgenic wheat plants produced significantly more spikes but other yield components did not change. This resulted in a 20–30% increased grain yield compared with untransformed control plants. Under water-limited conditions transgenic lines maintained parity in yield performance. PMID:26220082

  12. T1ρ MR Imaging of Human Musculoskeletal System

    PubMed Central

    Wang, Ligong; Regatte, Ravinder R.


    Magnetic resonance imaging (MRI) offers the direct visualization of human musculoskeletal (MSK) system, especially all diarthrodial tissues including cartilage, bone, menisci, ligaments, tendon, hip, synovium etc. Conventional MR imaging techniques based on T1- and T2-weighted, proton density (PD) contrast are inconclusive in quantifying early biochemically degenerative changes in MSK system in general and articular cartilage in particular. In recent years, quantitative MR parameter mapping techniques have been used to quantify the biochemical changes in articular cartilage with a special emphasis on evaluating joint injury, cartilage degeneration, and soft tissue repair. In this article, we will focus on cartilage biochemical composition, basic principles of T1ρ MR imaging, implementation of T1ρ pulse sequences, biochemical validation, and summarize the potential applications of T1ρ MR imaging technique in MSK diseases including osteoarthritis (OA), anterior cruciate ligament (ACL) injury, and knee joint repair. Finally, we will also review the potential advantages, challenges, and future prospects of T1ρ MR imaging for widespread clinical translation. PMID:24935818

  13. Analysis of rice Act1 5' region activity in transgenic rice plants.

    PubMed Central

    Zhang, W; McElroy, D; Wu, R


    The 5' region of the rice actin 1 gene (Act1) has been developed as an efficient regulator of foreign gene expression in transgenic rice plants. To determine the pattern and level of rice Act1 5' region activity, transgenic rice plants containing the Act1 5' region fused to a bacterial beta-glucuronidase (Gus) coding sequence were generated. Two independent clonal lines of transgenic rice plants were analyzed in detail. Quantitative analysis showed that tissue from these transgenic rice plants have a level of GUS protein that represents as much as 3% of total soluble protein. We were able to demonstrate that Act1-Gus gene expression is constitutive throughout the sporophytic and gametophytic tissues of these transgenic rice plants. Plants from one transgenic line were analyzed for the segregation of GUS activity in pollen by in situ histochemical staining, and the inheritance and stability of Act1-Gus expression were assayed in subsequently derived progeny plants. PMID:1821763

  14. Population-scale laboratory studies of the effect of transgenic plants on nontarget insects.


    Schuler, T H; Denholm, I; Jouanin, L; Clark, S J; Clark, A J; Poppy, G M


    Studies of the effects of insect-resistant transgenic plants on beneficial insects have, to date, concentrated mainly on either small-scale "worst case scenario" laboratory experiments or on field trials. We present a laboratory method using large population cages that represent an intermediate experimental scale, allowing the study of ecological and behavioural interactions between transgenic plants, pests and their natural enemies under more controlled conditions than is possible in the field. Previous studies have also concentrated on natural enemies of lepidopteran and coleopteran target pests. However, natural enemies of other pests, which are not controlled by the transgenic plants, are also potentially exposed to the transgene product when feeding on hosts. The reduction in the use of insecticides on transgenic crops could lead to increasing problems with such nontarget pests, normally controlled by sprays, especially if there are any negative effects of the transgenic plant on their natural enemies. This study tested two lines of insect-resistant transgenic oilseed rape (Brassica napus) for side-effects on the hymenopteran parasitoid Diaeretiella rapae and its aphid host, Myzus persicae. One transgenic line expressed the delta-endotoxin Cry1Ac from Bacillus thuringiensis (Bt) and a second expressed the proteinase inhibitor oryzacystatin I (OC-I) from rice. These transgenic plant lines were developed to provide resistance to lepidopteran and coleopteran pests, respectively. No detrimental effects of the transgenic oilseed rape lines on the ability of the parasitoid to control aphid populations were observed. Adult parasitoid emergence and sex ratio were also not consistently altered on the transgenic oilseed rape lines compared with the wild-type lines. PMID:11472551

  15. Estimating T1 from multichannel variable flip angle SPGR sequences.


    Trzasko, Joshua D; Mostardi, Petrice M; Riederer, Stephen J; Manduca, Armando


    Quantitative estimation of T1 is a challenging but important task inherent to many clinical applications. The most commonly used paradigm for estimating T1 in vivo involves performing a sequence of spoiled gradient-recalled echo acquisitions at different flip angles, followed by fitting of an exponential model to the data. Although there has been substantial work comparing different fitting methods, there has been little discussion on how these methods should be applied for data acquired using multichannel receivers. In this note, we demonstrate that the manner in which multichannel data is handled can have a substantial impact on T1 estimation performance and should be considered equally as important as choice of flip angles or fitting strategy. PMID:22807160

  16. Estimating T1 from Multichannel Variable Flip Angle SPGR Sequences

    PubMed Central

    Trzasko, Joshua D.; Mostardi, Petrice M.; Riederer, Stephen J.; Manduca, Armando


    Quantitative estimation of T1 is a challenging but important task inherent to many clinical applications. The most commonly used paradigm for estimating T1 in vivo involves performing a sequence of spoiled gradient-recalled echo acquisitions at different flip angles, followed by fitting of an exponential model to the data. Although there has been substantial work comparing different fitting methods, there has been little discussion on how these methods should be applied for data acquired using multichannel receivers. In this note, we demonstrate that the manner in which multichannel data is handled can have a substantial impact on T1 estimation performance and should be considered equally as important as choice of flip angles or fitting strategy. PMID:22807160

  17. Visualization and genetic manipulation of adult neurogenesis using transgenic mice.


    Dhaliwal, Jagroop; Lagace, Diane C


    Many laboratories have focused efforts on the creation of transgenic mouse models to study adult neurogenesis. In the last decade several constitutive reporter, as well as inducible transgenic lines have been published that allowed for visualization, tracking and alteration of specific neurogenic cell populations in the adult brain. Given the popularity of this approach, multiple mouse lines are available, and this review summarizes the differences in the basic techniques that have been used to create these mice, highlighting the different constructs and reporter proteins used, as well as the strengths and limitations of each of these models. Representative examples from the literature demonstrate some of the diverse and seminal findings that have come to fruition through the laborious, yet highly rewarding work of creating transgenic mouse lines for adult neurogenesis research. PMID:21395845

  18. Management of colorectal T1 carcinoma treated by endoscopic resection.


    Saitoh, Yusuke; Inaba, Yuhei; Sasaki, Takahiro; Sugiyama, Ryuji; Sukegawa, Ryuji; Fujiya, Mikihiro


    As a result of recent advances in endoscopic therapeutic technology, the number of endoscopic resections carried out in the treatment of early colorectal carcinomas with little risk of lymph node metastasis has increased. There are no reports of lymph node metastasis in intramucosal (Tis) carcinomas, whereas lymph node metastasis occurs in 6.8-17.8% of submucosal (T1) carcinomas. Three clinical guidelines have been published in Japan and the management strategy for early colorectal tumors has been demonstrated. According to the 2014 Japanese Society for Cancer of the Colon and Rectum (JSCCR) Guidelines for the Treatment of Colorectal Cancer, additional surgery should be done in cases of endoscopically resected T1 carcinoma with a histologically diagnosed positive vertical margin. Additional surgery may also be considered when one of the following histological findings is detected: (i) SM invasion depth ≥1000 µm; (ii) histological type por., sig., or muc.; (iii) grade 2-3 tumor budding; and (iv) positive vascular permeation. A resected lesion that is histologically diagnosed as a T1 carcinoma without any of the above-mentioned findings can be followed up without additional surgery. As for the prognosis of endoscopically resected T1 carcinomas, the relapse ratio of approximately 3.4% (44/1312) is relatively low. However, relapse is associated with a poor prognosis, with 72 cancer-related deaths reported out of 134 relapsed cases (54%). A more detailed stratification of the lymph node metastasis risk after endoscopic resection for T1 carcinomas and the prognosis of relapsed cases will be elucidated through prospective studies. Thereafter, the appropriate indications and safe and secure endoscopic resection for T1 carcinomas will be established. PMID:26076802

  19. Gene expression profile in liver of hB1F transgenic mice

    PubMed Central

    Wang, Shui-Liang; Yang, Hua; Xie, You-Hua; Wang, Yuan; Li, Jian-Zhong; Wang, Long; Wang, Zhu-Gang; Fu, Ji-Liang


    AIM: To analyze the tissue morphologic phenotype and liver gene expression profile of hB1F transgenic mice. METHODS: Transgene expression was analyzed with RT-PCR and Western blotting. For one of the transgenic mouse lines, tissue expression pattern of the transgene was also examined with immunochemical methods. Pathological analysis was used to examine the tissue morphologic phenotype of established transgenic mice. The liver gene expression profile of transgenic mice was analyzed with microchip, and some of the differentially expressed genes were verified with RT-PCR. RESULTS: The expressions of hB1F were shown in livers from 6 of 7 transgenic mouse lines. The overexpression of hB1F transgene did not cause pathological changes. Expressions of three genes were up-regulated, while down-regulation was observed for 25 genes. CONCLUSION: The overexpression of hB1F transgene may cause changes of gene expression profiles in the liver of transgenic mice. PMID:15378783

  20. A novel enterocin T1 with anti-Pseudomonas activity produced by Enterococcus faecium T1 from Chinese Tibet cheese.


    Liu, Hui; Zhang, Lanwei; Yi, Huaxi; Han, Xue; Gao, Wei; Chi, Chunliang; Song, Wei; Li, Haiying; Liu, Chunguang


    An enterocin-producing Enterococcus faecium T1 was isolated from Chinese Tibet cheese. The enterocin was purified by SP-Sepharose and reversed phase HPLC. It was identified as unique from other reported bacteriocins based on molecular weight (4629 Da) and amino acid compositions; therefore it was subsequently named enterocin T1. Enterocin T1 was stable at 80-100 °C and over a wide pH range, pH 3.0-10.0. Protease sensitivity was observed to trypsin, pepsin, papain, proteinase K, and pronase E. Importantly, enterocin T1 was observed to inhibit the growth of numerous Gram-negative and Gram-positive bacteria including Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas fluorescens, Escherichia coli, Salmonella typhimurium, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Listeria monocytogenes. Take together, these results suggest that enterocin T1 is a novel bacteriocin with the potential to be used as a bio-preservative to control Pseudomonas spp. in food. PMID:26745981

  1. Transgenics in crops

    NASA Technical Reports Server (NTRS)

    Li, Y.; Wu, Y. H.; McAvoy, R.; Duan, H.


    With rapid world population growth and declining availability of fresh water and arable land, a new technology is urgently needed to enhance agricultural productivity. Recent discoveries in the field of crop transgenics clearly demonstrate the great potential of this technology for increasing food production and improving food quality while preserving the environment for future generations. In this review, we briefly discuss some of the recent achievements in crop improvement that have been made using gene transfer technology.

  2. Disproportionate growth in mice with Igf-2 transgenes.

    PubMed Central

    Ward, A; Bates, P; Fisher, R; Richardson, L; Graham, C F


    Injection transgenesis was used to study the long-term effects of excess insulin-like growth factor II on mouse growth and differentiation. By using a construct in which the coding region of the mouse insulin like growth factor II gene (Igf-2) was placed under the control of a keratin gene promoter, four transgenic lines were established, all of which displayed overgrowth of the skin as judged by wrinkling. In addition to high levels of expression in the skin, transgene transcripts were also present in the alimentary canal and uterus. At most of the sites of transgene expression the cell number (DNA content) was greatly increased, indicating a local action of the excess insulin-like growth factor II on cell multiplication. Adult total live weight was slightly increased and there was no macroscopic evidence of tumor formation. The characteristics of these transgenic mice indicate distinct local and systemic actions for insulin-like growth factor II. Images PMID:7524092

  3. A novel method for simultaneous 3D B(1) and T(1) mapping: the method of slopes (MoS).


    Chavez, Sofia; Stanisz, Greg J


    A novel three-dimensional simultaneous B(1) and T(1) mapping method is introduced: the method of slopes (MoS). The linearity of the spoiled gradient recalled echo (SPGR) signal vs flip angle relation is exploited: B(1) mapping is achieved by a two-point extrapolation to signal null with a correction scheme while T(1) mapping uses the slopes of the SPGR signal vs flip angle curves near the origin and near the signal null. This new method improves upon the existing variable flip angle (VFA) T(1)-mapping method in that (i) consistency between B(1) and T(1) maps is ensured (ii) the sampling scheme is T(1)-independent (iii) the noise bias and singularity, associated with using a linear form for the SPGR signal equation, is eliminated by using the full equation. The method is shown to yield accurate and robust results via simulations. Initial estimates of B(1) and T(1) values are obtained from three data points via simple computations and straight line approximations. Initial estimates of B(1) values, for a range of values, are shown to be accurate due to the proposed B(1) correction scheme. The accuracy and robustness of T(1) values is achieved via a non-linear fitting algorithm which includes a fourth data point sampled at high SNR. The MoS was validated by comparing resulting B(1) and T(1) maps with those obtained using other standard methods. Finally, the ability to obtain brain B(1) and T(1) maps using the MoS was demonstrated by in vivo experiments. The MoS is expected to perform well on other motion-free anatomical regions as well. PMID:22368092

  4. Transgenic control of perforin gene expression

    SciTech Connect

    Lichtenheld, M.G.; Podack, E.R.; Levy, R.B.


    Perforin is a pore-forming effector molecule of CTL and NK cells. To characterize perforin gene expression and its transcriptional control mechanisms in vivo, expression of a cell surface tag, i.e., human CD4, was driven by 5.1 kb of the murin perforin 5{prime} flanking and promoter region in transgenic mice. Six out of seven transgenic lines expressed the perforin-tag hybrid gene at low to intermediate levels, depending on the integration site. Transgene expression occurred in all cells that physiologically are able to express perforin. At the whole organ level, significant amounts of transgenic mRNA and endogenous perforin mRNA were co-expressed in the lymphoid organs, as well as in the lung, the ileum, the oviduct/uterus, and the bone marrow. At the single cell level, the perforin tag was present on NK cells and on CD8{sup +}, as well as on CD4{sup +} cells. Also targeted were Thy-1.2{sup +} {gamma}{delta} T cells, but not Thy-1.2{sup -} {gamma}{delta} T cells, B cells, nor monocytes. During thymic T cell development, transgene expression occurred in double negative (CD4{sup -}CD8{sup -}) thymocytes and was detected at all subsequent stages, but exceeded the expression levels of the endogenous gene in the thymus. In conclusion, the analyzed perforin 5{prime} flanking and promoter region contains important cis-acting sequences that restrict perforin expression to T cells and NK cells, and therefore provides a unique tool for manipulating T cell and/or Nk cell-mediated immune responses in transgenic mice. On the other hand, the normal control of perforin gene expression involves at least one additional negative control mechanism that was not mediated by the transgenic promoter and upstream region. This control restricts perforin gene expression in thymically developing T cells and in most resting peripheral T cells, but can be released upon T cell activation. 43 refs., 7 figs., 1 tab.

  5. Transgenic fish systems and their application in ecotoxicology.


    Lee, Okhyun; Green, Jon M; Tyler, Charles R


    The use of transgenics in fish is a relatively recent development for advancing understanding of genetic mechanisms and developmental processes, improving aquaculture, and for pharmaceutical discovery. Transgenic fish have also been applied in ecotoxicology where they have the potential to provide more advanced and integrated systems for assessing health impacts of chemicals. The zebrafish (Daniorerio) is the most popular fish for transgenic models, for reasons including their high fecundity, transparency of their embryos, rapid organogenesis and availability of extensive genetic resources. The most commonly used technique for producing transgenic zebrafish is via microinjection of transgenes into fertilized eggs. Transposon and meganuclease have become the most reliable methods for insertion of the genetic construct in the production of stable transgenic fish lines. The GAL4-UAS system, where GAL4 is placed under the control of a desired promoter and UAS is fused with a fluorescent marker, has greatly enhanced model development for studies in ecotoxicology. Transgenic fish have been developed to study for the effects of heavy metal toxicity (via heat-shock protein genes), oxidative stress (via an electrophile-responsive element), for various organic chemicals acting through the aryl hydrocarbon receptor, thyroid and glucocorticoid response pathways, and estrogenicity. These models vary in their sensitivity with only very few able to detect responses for environmentally relevant exposures. Nevertheless, the potential of these systems for analyses of chemical effects in real time and across multiple targets in intact organisms is considerable. Here we illustrate the techniques used for generating transgenic zebrafish and assess progress in the development and application of transgenic fish (principally zebrafish) for studies in environmental toxicology. We further provide a viewpoint on future development opportunities. PMID:25394772

  6. [Effects of phytase transgenic corn planting on soil nematode community].


    Zhao, Zong-Chao; Su, Ying; Mou, Wen-Ya; Liu, Man-Qiang; Chen, Xiao-Yun; Chen, Fa-Jun


    A healthy soil ecosystem is essential for nutrient cycling and energy conversion, and the impact of exogenous genes from genetically modified crops had aroused wide concerns. Phytase transgenic corn (i. e., the inbred line BVLA430101) was issued a bio-safety certificate on 27 September 2009 in China, which could improve the efficiency of feed utilization, reduce environmental pollution caused by animal manure. In this study, the abundance of trophic groups, community structure and ecological indices of soil nematodes were studied over the growing cycle of phytase transgenic corn (ab. transgenic corn) and control conventional parental corn (ab. control corn) in the field. Totally 29 and 26 nematode genera were isolated from transgenic corn and control corn fields, respectively. The abundances of bacterivores and omnivores-predators, the total number of soil nematodes, and the Shannon index (H) were significantly greater under transgenic corn than under control corn, while the opposite trend was found for the relative abundance of herbivores and the maturity index (Sigma MI) of soil nematodes. Repeated-measures analysis of variance (ANOVA) did not detect any significant effects of transgenic corn on the composition and abundance of nematode trophic groups and ecological indices of soil nematodes. Furthermore, the Student-T test showed that the abundances of bacterivores and omnivores-predators and the total number of soil nematodes during the milk-ripe stage were significant higher in the transgenic corn field than in the control corn field. The effects of transgenic corn planting on soil nematodes might be related to the increase in the nitrogen content of field soil under transgenic corn compared to control corn. PMID:25011306

  7. Comparative analysis of nutritional compositions of transgenic RNAi-mediated virus-resistant bean (event EMB-PV051-1) with its non-transgenic counterpart.


    Carvalho, José L V; de Oliveira Santos, Juliana; Conte, Carmine; Pacheco, Sidney; Nogueira, Elsa O P L; Souza, Thiago L P O; Faria, Josias C; Aragão, Francisco J L


    Golden mosaic is among the most economically important diseases that severely reduce bean production in Latin America. In 2011, a transgenic bean event named Embrapa 5.1 (EMB-PV051-1), resistant to bean golden mosaic virus, was approved for commercial release in Brazil. The aim of this study was to measure and evaluate the nutritional components of the beans, as well as the anti-nutrient levels in the primary transgenic line and its derived near-isogenic lines after crosses and backcrosses with two commercial cultivars. Nutritional assessment of transgenic crops used for human consumption is an important aspect of safety evaluations. Results demonstrated that the transgenic bean event, cultivated under field conditions, was substantially equivalent to that of the non-transgenic bean plants. In addition, the amounts of the nutritional components are within the range of values observed for several bean commercial varieties grown across a range of environments and seasons. PMID:25894661

  8. T2 can be greater than 2T1

    NASA Astrophysics Data System (ADS)

    Sevian, H. M.; Skinner, J. L.


    We consider a quantum-mechanical two-level system under the influence of both diagonal and off-diagonal stochastic perturbations, and focus on the decay times T1 and T2, which refer to the relaxation to equilibrium of the populations and relative phase of the two levels, respectively. From both theoretical and experimental viewpoints one traditionally expects that T2≤2T1. On the other hand, from a fourth-order cumulant expansion calculation of the asymptotic time dependence of the density matrix elements, Budimir and Skinner [J. Stat. Phys. 49, 1029 (1987)] showed that, in fact, in some instances T2>2T1. In this paper we solve the stochastic model numerically, which leads to the exact time dependence of the density matrix at all times. We find that the analytic prediction that T2>2T1 is not only correct, but also meaningful, in the sense that the density matrix elements decay exponentially after only a short transient time.

  9. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.


    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y


    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus. PMID:11302173

  10. Obesity-related abnormalities couple environmental triggers with genetic susceptibility in adult-onset T1D.


    Nguyen, K Hoa; Ande, Sudharsana R; Mishra, Suresh


    The incidence of adult-onset T1D in low-risk non-HLA type has increased several folds, whereas the contemporaneous incidence in high-risk HLA-type remains stable. Various factors behind this selective increase in T1D in young adults remain unclear. Obesity and its associated abnormalities appear to be an important determinant; however, the underlying mechanism involved is not understood. Recently, we have developed two novel transgenic obese mice models, Mito-Ob and m-Mito-Ob, by expressing a pleiotropic protein prohibitin (PHB) and a phospho mutant form of PHB (Y114F-PHB or m-PHB) from the aP2 gene promoter, respectively. Both mice models develop obesity in a sex-neutral manner, independent of diet; but obesity associated chronic low-grade inflammation and insulin resistance in a male sex-specific manner. Interestingly, on a high fat diet (HFD) only male m-Mito-Ob mice displayed marked mononuclear cell infiltration in pancreas and developed insulitis that mimic adult-onset T1D. Male Mito-Ob mice that share the metabolic phenotype of male m-Mito-Ob mice, and female m-Mito-Ob that harbor m-PHB similar to male m-Mito-Ob mice, did not develop insulitis. Thus, insulitis development in male m-Mito-Ob in response to HFD requires both, obesity-related abnormalities and m-PHB. Collectively, this data provides a proof-of-concept that obesity-associated abnormalities couple environmental triggers with genetic susceptibility in adult-onset T1D and reveals PHB as a potential susceptibility gene for T1D. PMID:26766792

  11. Transgenic algae engineered for higher performance


    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J


    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  12. Overexpression of host plant urease in transgenic silkworms.


    Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou


    Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms. PMID:25549597

  13. Imagable 4T1 model for the study of late stage breast cancer

    PubMed Central

    Tao, Kai; Fang, Min; Alroy, Joseph; Sahagian, G Gary


    Background The 4T1 mouse mammary tumor cell line is one of only a few breast cancer models with the capacity to metastasize efficiently to sites affected in human breast cancer. Here we describe two 4T1 cell lines modified to facilitate analysis of tumor growth and metastasis and evaluation of gene function in vivo. New information regarding the involvement of innate and acquired immunity in metastasis and other characteristics of the model relevant to its use in the study of late stage breast cancer are reported. Methods The lines were engineered for stable expression of firefly luciferase to allow tracking and quantitation of the cells in vivo. Biophotonic imaging was used to characterize growth and metastasis of the lines in vivo and an improved gene expression approach was used to characterize the basis for the metastatic phenotype that was observed. Results Growth of cells at the primary site was biphasic with metastasis detected during the second growth phase 5–6 weeks after introduction of the cells. Regression of growth, which occurred in weeks 3–4, was associated with extensive necrosis and infiltration of leukocytes. Biphasic tumor growth did not occur in BALB/c SCID mice indicating involvement of an acquired immune response in the effect. Hematopoiesis in spleen and liver and elevated levels of circulating leukocytes were observed at week 2 and increased progressively until death at week 6–8. Gene expression analysis revealed an association of several secreted factors including colony stimulatory factors, cytokines and chemokines, acute phase proteins, angiogenesis factors and ECM modifying proteins with the 4T1 metastatic phenotype. Signaling pathways likely to be responsible for production of these factors were also identified. Conclusion The production of factors that stimulate angiogenesis and ECM modification and induce hematopoiesis, recruitment and activation of leukocytes suggest that 4T1 tumor cells play a more direct role than previously

  14. Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease.


    Namukwaya, B; Tripathi, L; Tripathi, J N; Arinaitwe, G; Mukasa, S B; Tushemereirwe, W K


    Banana Xanthomonas wilt (BXW), caused by Xanthomonas campestris pv. musacearum, is one of the most important diseases of banana (Musa sp.) and currently considered as the biggest threat to banana production in Great Lakes region of East and Central Africa. The pathogen is highly contagious and its spread has endangered the livelihood of millions of farmers who rely on banana for food and income. The development of disease resistant banana cultivars remains a high priority since farmers are reluctant to employ labor-intensive disease control measures and there is no host plant resistance among banana cultivars. In this study, we demonstrate that BXW can be efficiently controlled using transgenic technology. Transgenic bananas expressing the plant ferredoxin-like protein (Pflp) gene under the regulation of the constitutive CaMV35S promoter were generated using embryogenic cell suspensions of banana. These transgenic lines were characterized by molecular analysis. After challenge with X. campestris pv. musacearum transgenic lines showed high resistance. About 67% of transgenic lines evaluated were completely resistant to BXW. These transgenic lines did not show any disease symptoms after artificial inoculation of in vitro plants under laboratory conditions as well as potted plants in the screen-house, whereas non-transgenic control plants showed severe symptoms resulting in complete wilting. This study confirms that expression of the Pflp gene in banana results in enhanced resistance to BXW. This transgenic technology can provide a timely solution to the BXW pandemic. PMID:22101927

  15. Allergenicity assessment of the Papaya ringspot virus coat protein expressed in transgenic Rainbow papaya

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The virus-resistant, transgenic commercial papaya cultivars Rainbow and SunUp (Carica papaya L.) have been consumed locally in Hawaii and elsewhere in the mainland US and Canada since their release to planters in Hawaii in 1998. These cultivars are derived from transgenic papaya line 55-1 and carry ...

  16. Removal of Reprogramming Transgenes Improves the Tissue Reconstitution Potential of Keratinocytes Generated From Human Induced Pluripotent Stem Cells

    PubMed Central

    Kokubu, Chikara; Yusa, Kosuke; Horie, Kyoji; Yoshimura, Yasuhide; Yamauchi, Kaori; Suemori, Hirofumi; Yokozeki, Hiroo; Toyoda, Masashi; Kiyokawa, Nobutaka; Okita, Hajime; Miyagawa, Yoshitaka; Akutsu, Hidenori; Umezawa, Akihiro; Katayama, Ichiro


    Human induced pluripotent stem cell (hiPSC) lines have a great potential for therapeutics because customized cells and organs can be induced from such cells. Assessment of the residual reprogramming factors after the generation of hiPSC lines is required, but an ideal system has been lacking. Here, we generated hiPSC lines from normal human dermal fibroblasts with piggyBac transposon bearing reprogramming transgenes followed by removal of the transposon by the transposase. Under this condition, we compared the phenotypes of transgene-residual and -free hiPSCs of the same genetic background. The transgene-residual hiPSCs, in which the transcription levels of the reprogramming transgenes were eventually suppressed, were quite similar to the transgene-free hiPSCs in a pluripotent state. However, after differentiation into keratinocytes, clear differences were observed. Morphological, functional, and molecular analyses including single-cell gene expression profiling revealed that keratinocytes from transgene-free hiPSC lines were more similar to normal human keratinocytes than those from transgene-residual hiPSC lines, which may be partly explained by reactivation of residual transgenes upon induction of keratinocyte differentiation. These results suggest that transgene-free hiPSC lines should be chosen for therapeutic purposes. PMID:25024429

  17. Transgene expression after rep-mediated site-specific integration into chromosome 19.


    Philpott, Nicola J; Gomos, Janette; Falck-Pedersen, Erik


    We have used a plasmid-based transfection model of the adeno-associated virus (AAV) Rep-mediated site-specific integration (RMSSI) pathway to characterize the stability and expression of a site-specifically integrated transgene (either green fluorescent protein [GFP] or chloramphenicol acetyltransferase [CAT]). Three plasmids containing the AAV p5 integration efficiency element (p5IEE) have been used to study integration and transgene expression in HeLa cells: (1) pRepGFP(itr+) contains both AAV ITRs, rep, and p5IEE and can be used as either a plasmid or rAAV vehicle for integration; (2) pRepGFP(itr-) contains the AAV rep gene and the p5IEE; (3) pAd-p5CAT contains only the 138-bp p5IEE of AAV. The data presented demonstrate that in the absence of drug selection, all three constructs undergo site-specific integration (efficiencies of between 10 and 40% of transduced cell lines). At 6 weeks posttransfection most cell lines that underwent RMSSI also expressed the appropriate transgene product. By 18 weeks posttransfection cell lines that were established with rep in cis to the transgene showed a decline in transgene expression as well as a loss of transgene DNA. In many cell lines, there appears to be transgene-containing DNA that does not contribute to gene expression. Data support a model of gene expression and transgene instability through a Rep-mediated pathway. In contrast to rep-containing cell lines, clonal cell lines containing p5IEECAT (with Rep provided in trans) maintained both the integrated transgene and transgene expression throughout the entire experimental time course (18 weeks). PMID:14965377

  18. Functionally Active T1-T1 Interfaces Revealed by the Accessibility of Intracellular Thiolate Groups in Kv4 Channels

    PubMed Central

    Wang, Guangyu; Shahidullah, Mohammad; Rocha, Carmen A.; Strang, Candace; Pfaffinger, Paul J.; Covarrubias, Manuel


    Gating of voltage-dependent K+ channels involves movements of membrane-spanning regions that control the opening of the pore. Much less is known, however, about the contributions of large intracellular channel domains to the conformational changes that underlie gating. Here, we investigated the functional role of intracellular regions in Kv4 channels by probing relevant cysteines with thiol-specific reagents. We find that reagent application to the intracellular side of inside-out patches results in time-dependent irreversible inhibition of Kv4.1 and Kv4.3 currents. In the absence or presence of Kv4-specific auxiliary subunits, mutational and electrophysiological analyses showed that none of the 14 intracellular cysteines is essential for channel gating. C110, C131, and C132 in the intersubunit interface of the tetramerization domain (T1) are targets responsible for the irreversible inhibition by a methanethiosulfonate derivative (MTSET). This result is surprising because structural studies of Kv4-T1 crystals predicted protection of the targeted thiolate groups by constitutive high-affinity Zn2+ coordination. Also, added Zn2+ or a potent Zn2+ chelator (TPEN) does not significantly modulate the accessibility of MTSET to C110, C131, or C132; and furthermore, when the three critical cysteines remained as possible targets, the MTSET modification rate of the activated state is ∼200-fold faster than that of the resting state. Biochemical experiments confirmed the chemical modification of the intact α-subunit and the purified tetrameric T1 domain by MTS reagents. These results conclusively demonstrate that the T1T1 interface of Kv4 channels is functionally active and dynamic, and that critical reactive thiolate groups in this interface may not be protected by Zn2+ binding. PMID:15955876

  19. Immunity to tomato yellow leaf curl virus in transgenic tomato is associated with accumulation of transgene small RNA.


    Leibman, Diana; Prakash, Shanmugam; Wolf, Dalia; Zelcer, Aaron; Anfoka, Ghandi; Haviv, Sabrina; Brumin, Marina; Gaba, Victor; Arazi, Tzahi; Lapidot, Moshe; Gal-On, Amit


    Gene silencing is a natural defense response of plants against invading RNA and DNA viruses. The RNA post-transcriptional silencing system has been commonly utilized to generate transgenic crop plants that are "immune" to plant virus infection. Here, we applied this approach against the devastating DNA virus tomato yellow leaf curl virus (TYLCV) in its host tomato (Solanum lycopersicum L.). To generate broad resistance to a number of different TYLCV viruses, three conserved sequences (the intergenic region [NCR], V1-V2 and C1-C2 genes) from the genome of the severe virus (TYLCV) were synthesized as a single insert and cloned into a hairpin configuration in a binary vector, which was used to transform TYLCV-susceptible tomato plants. Eight of 28 independent transgenic tomato lines exhibited immunity to TYLCV-Is and to TYLCV-Mld, but not to tomato yellow leaf curl Sardinia virus, which shares relatively low sequence homology with the transgene. In addition, a marker-free (nptII-deleted) transgenic tomato line was generated for the first time by Agrobacterium-mediated transformation without antibiotic selection, followed by screening of 1180 regenerated shoots by whitefly-mediated TYLCV inoculation. Resistant lines showed a high level of transgene-siRNA (t-siRNA) accumulation (22% of total small RNA) with dominant sizes of 21 nt (73%) and 22 nt (22%). The t-siRNA displayed hot-spot distribution ("peaks") along the transgene, with different distribution patterns than the viral-siRNA peaks observed in TYLCV-infected tomato. A grafting experiment demonstrated the mobility of 0.04% of the t-siRNA from transgenic rootstock to non-transformed scion, even though scion resistance against TYLCV was not achieved. PMID:26255053

  20. Tandem constructs to mitigate transgene persistence: tobacco as a model.


    Al-Ahmad, Hani; Galili, Shmuel; Gressel, Jonathan


    Some transgenic crops can introgress genes into other varieties of the crop, to related weeds or themselves remain as 'volunteer' weeds, potentially enhancing the invasiveness or weediness of the resulting offspring. The presently suggested mechanisms for transgene containment allow low frequency of gene release (leakage), requiring the mitigation of continued spread. Transgenic mitigation (TM), where a desired primary gene is tandemly coupled with mitigating genes that are positive or neutral to the crop but deleterious to hybrids and their progeny, was tested as a mechanism to mitigate transgene introgression. Dwarfism, which typically increases crop yield while decreasing the ability to compete, was used as a mitigator. A construct of a dominant ahasR (acetohydroxy acid synthase) gene conferring herbicide resistance in tandem with the semidominant mitigator dwarfing Delta gai (gibberellic acid-insensitive) gene was transformed into tobacco (Nicotiana tabacum). The integration and the phenotypic stability of the tandemly linked ahasR and Delta gai genomic inserts in later generations were confirmed by polymerase chain reaction. The hemizygous semidwarf imazapyr-resistant TM T1 (= BC1) transgenic plants were weak competitors when cocultivated with wild type segregants under greenhouse conditions and without using the herbicide. The competition was most intense at close spacings typical of weed offspring. Most dwarf plants interspersed with wild type died at 1-cm, > 70% at 2.5-cm and 45% at 5-cm spacing, and the dwarf survivors formed no flowers. At 10-cm spacing, where few TM plants died, only those TM plants growing at the periphery of the large cultivation containers formed flowers, after the wild type plants terminated growth. The highest reproductive TM fitness relative to the wild type was 17%. The results demonstrate the suppression of crop-weed hybrids when competing with wild type weeds, or such crops as volunteer weeds, in seasons when the selector

  1. Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).


    Singh, Natwar; Mishra, Avinash; Jha, Bhavanath


    Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture. PMID:24954532

  2. [Management of T1a vocal fold carcinoma].


    Reiter, R; Brosch, S; Smith, E; Pickhard, A


    About 2/3 of the larynx carcinomas affect the vocal chords. The main risk factor is smoking. Carcinomas in this localisation often arise from leukoplakias with dysplasia. A typical symptom is dysphonia. Arrest of vibration in microlaryngostroboscopy is a hint that a carcinoma could be present. Transoral laser cordectomy or radiotherapy show equivalent oncological results and results in quality of voice in the treatment of vocal fold carcinoma (T1a). As lymph node and distant metastasis are very rare, follow-up can concentrate on microlaryngoscopy. In case of a suspicious area on the vocal fold, biopsy of the affected tissue is needed to plan correct treatment. The prognosis of the T1 vocal chord carcinoma is quite good with a 5-year survival rate of almost 100%. PMID:23929210

  3. Assessing Myocardial Disease Using T1ρ MRI.


    Han, Yuchi; Liimatainen, Timo; Gorman, Robert C; Witschey, Walter R T


    There is great interest to use magnetic resonance imaging (MRI) for non-invasive assessment of myocardial disease in ischemic and non-ischemic cardiomyopathies. Recently, there has been a renewed interest to use a magnetic resonance imaging (MRI) technique utilizing spin locking radiofrequency (RF) pulses, called T1ρ MRI. The spin locking RF pulse creates sensitivity to some mechanisms of nuclear relaxation such as (1)H exchange between water and amide, amine and hydroxyl functional groups in molecules; consequently, there is the potential to non-invasively, and without exogenous contrast agents, obtain important molecular information from diseased myocardial tissue. The purpose of this article is to review and critically examine the recent published literature in the field related to T1ρ MRI of myocardial disease. PMID:24688628

  4. Assessing Myocardial Disease Using T1ρ MRI

    PubMed Central

    Han, Yuchi; Liimatainen, Timo; Gorman, Robert C.


    There is great interest to use magnetic resonance imaging (MRI) for non-invasive assessment of myocardial disease in ischemic and non-ischemic cardiomyopathies. Recently, there has been a renewed interest to use a magnetic resonance imaging (MRI) technique utilizing spin locking radiofrequency (RF) pulses, called T1ρ MRI. The spin locking RF pulse creates sensitivity to some mechanisms of nuclear relaxation such as 1H exchange between water and amide, amine and hydroxyl functional groups in molecules; consequently, there is the potential to non-invasively, and without exogenous contrast agents, obtain important molecular information from diseased myocardial tissue. The purpose of this article is to review and critically examine the recent published literature in the field related to T1ρ MRI of myocardial disease. PMID:24688628

  5. Recombination technologies for enhanced transgene stability in bioengineered insects

    PubMed Central

    Schetelig, Marc F.; Götschel, Frank; Viktorinová, Ivana; Handler, Alfred M.


    Transposon-based vectors currently provide the most suitable gene transfer systems for insect germ-line transformation and are used for molecular improvement of the Sterile Insect Technique. However, the long time stability of genome-integrated transposon constructs depends on the absence of transposase activity that could remobilize the transposon-embedded transgenes. To achieve transgene stability transposon vectors are usually non-autonomous, lacking a functional transposase gene, and chosen so that endogenous or related transposon activities are not present in the host. Nevertheless, the non-autonomous transposon-embedded transgenes could become unstable by the unintended presence of a mobilizing transposase that may have been undetected or subsequently entered the host species by horizontal gene transfer. Since the field release of transgenic insects will present environmental concerns relating to large populations and high mobility, it will be important to ensure that transgene constructs are stably integrated for maintaining strain integrity and eliminating the possibility for unintentional transfer into the genome of another organism. Here we review efficient methods to delete or rearrange terminal repeat sequences of transposons necessary for their mobility, subsequent to their initial genomic integration. These procedures should prevent transposase-mediated remobilization of the transgenes, ensuring their genomic stability. PMID:20844938

  6. Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect.


    Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa


    A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view. PMID:18663453

  7. Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond

    PubMed Central

    Ting, Jonathan T.; Feng, Guoping


    The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more “extra” genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines. PMID:24772073

  8. Transgenic horticultural crops in Asia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Modern biotechnology applications, including genetic engineering, are a powerful tool to complement the conventional methods of crop improvement. Asia currently has three countries cultivating biotech/transgenic crops – China, India, and the Philippines, but only China commercially grows a transgen...

  9. Epigenetic silencing in transgenic plants

    PubMed Central

    Rajeevkumar, Sarma; Anunanthini, Pushpanathan; Sathishkumar, Ramalingam


    Epigenetic silencing is a natural phenomenon in which the expression of genes is regulated through modifications of DNA, RNA, or histone proteins. It is a mechanism for defending host genomes against the effects of transposable elements and viral infection, and acts as a modulator of expression of duplicated gene family members and as a silencer of transgenes. A major breakthrough in understanding the mechanism of epigenetic silencing was the discovery of silencing in transgenic tobacco plants due to the interaction between two homologous promoters. The molecular mechanism of epigenetic mechanism is highly complicated and it is not completely understood yet. Two different molecular routes have been proposed for this, that is, transcriptional gene silencing, which is associated with heavy methylation of promoter regions and blocks the transcription of transgenes, and post-transcriptional gene silencing (PTGS), the basic mechanism is degradation of the cytosolic mRNA of transgenes or endogenous genes. Undesired transgene silencing is of major concern in the transgenic technologies used in crop improvement. A complete understanding of this phenomenon will be very useful for transgenic applications, where silencing of specific genes is required. The current status of epigenetic silencing in transgenic technology is discussed and summarized in this mini-review. PMID:26442010

  10. Identification and quantification of anthocyanins in transgenic purple tomato.


    Su, Xiaoyu; Xu, Jianteng; Rhodes, Davina; Shen, Yanting; Song, Weixing; Katz, Benjamin; Tomich, John; Wang, Weiqun


    Anthocyanins are natural pigments derived from the phenylpropanoid pathway. Most tomatoes produce little anthocyanins, but the transgenic purple tomato biosynthesizes a high level of anthocyanins due to expression of two transcription factors (Del and Ros1). This study was to identify and quantify anthocyanins in this transgenic tomato line. Seven anthocyanins, including two new anthocyanins [malvidin-3-(p-coumaroyl)-rutinoside-5-glucoside and malvidin-3-(feruloyl)-rutinoside-5-glucoside], were identified by LC-MS/MS. Petunidin-3-(trans-coumaroyl)-rutinoside-5-glucoside and delphinidin-3-(trans-coumaroyl)-rutinoside-5-glucoside were the most abundant anthocyanins, making up 86% of the total anthocyanins. Compared to undetectable anthocyanins in the wild type, the contents of anthocyanins in the whole fruit, peel, and flesh of the Del/Ros1-transgenic tomato were 5.2±0.5, 5.1±0.5, and 5.8±0.3g/kg dry matter, respectively. Anthocyanins were undetectable in the seeds of both wide-type and transgenic tomato lines. Such novel and high levels of anthocyanins obtained in this transgenic tomato may provide unique functional products with potential health benefits. PMID:26920283

  11. Zn2+-dependent Redox Switch in the Intracellular T1-T1 Interface of a Kv Channel*†

    PubMed Central

    Wang, Guangyu; Strang, Candace; Pfaffinger, Paul J.; Covarrubias, Manuel


    The thiol-based redox regulation of proteins plays a central role in cellular signaling. Here, we investigated the redox regulation at the Zn2+ binding site (HX5CX20CC) in the intracellular T1-T1 inter-subunit interface of a Kv4 channel. This site undergoes conformational changes coupled to voltage-dependent gating, which may be sensitive to oxidative stress. The main results show that internally applied nitric oxide (NO) inhibits channel activity profoundly. This inhibition is reversed by reduced glutathione and suppressed by intracellular Zn2+, and at least two Zn2+ site cysteines are required to observe the NO-induced inhibition (Cys-110 from one subunit and Cys-132 from the neighboring subunit). Biochemical evidence suggests strongly that NO induces a disulfide bridge between Cys-110 and Cys-132 in intact cells. Finally, further mutational studies suggest that intra-subunit Zn2+ coordination involving His-104, Cys-131, and Cys-132 protects against the formation of the inhibitory disulfide bond. We propose that the interfacial T1 Zn2+ site of Kv4 channels acts as a Zn2+-dependent redox switch that may regulate the activity of neuronal and cardiac A-type K+ currents under physiological and pathological conditions. PMID:17331952

  12. Dissection of a Synthesized Quantitative Trait to Characterize Transgene Interactions

    PubMed Central

    Nap, J. P.; Conner, A. J.; Mlynarova, L.; Stiekema, W. J.; Jansen, R. C.


    Six transgenic tobacco lines, each homozygous for the β-glucuronidase (GUS) gene at a different locus, and wild type were selfed and intercrossed to evaluate GUS activity in all possible hemizygous, homozygous and dihybrid combinations of GUS alleles. The transgenic lines are characterized by their GUS activity (two low, three intermediate, one high), T-DNA complexity (four single-copy, two more complex single-locus) and the presence of the chicken lysozyme matrix-associated region (MAR) around the full T-DNA (two lines). Gene action and interaction was analyzed by weighted linear regression with parameters for additivity, dominance and epistasis. The analysis showed that each of the four single-copy lines acted fully additively. In contrast, the two complex single-locus lines showed classical single-locus overdominance and were epistatic dominant over all other GUS alleles. The latter is manifested in severe suppression of GUS activity in dihybrid lines, irrespective of the presence of MAR elements around the GUS gene. Such elements apparently do not protect against epistatic dominance. The quantitative data suggested that the epistatic dominance and overdominance are based on the same molecular mechanism. Our approach of a genetic analysis of quantitative variation in well-characterized transgenic lines provides a powerful tool to gain insight into complex plant traits. PMID:9286691

  13. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    PubMed Central

    Schäfer, Tina; Hanke, Magda-Viola; Flachowsky, Henryk; König, Stephan; Peil, Andreas; Kaldorf, Michael; Polle, Andrea; Buscot, François


    This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF). We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova) and transgenic lines (M9/T386 and M9/T389) were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass. PMID:22888297

  14. Carotid dosimetry for T1 glottic cancer radiotherapy

    PubMed Central

    Lim, C C; Whitehurst, P; Thomson, D; Ho, K F; Lowe, M; Sykes, A; Lee, LW; Yap, B; Slevin, N


    Objective: Radiotherapy for T1 glottic cancer is commonly delivered using a lateral parallel opposed pair of megavoltage photon fields. There is increasing reported evidence of cerebrovascular events due to radiation-induced carotid stenosis. An alternative field arrangement is to use an anterior oblique technique. This study compares the carotid dosimetry between the two techniques and reviews the evidence for the risk of radiation-induced vascular events. Methods: The radiotherapy plans of 10 patients with T1 glottic cancer treated with an anterior oblique technique were examined for carotid dose. Alternative plans were then created using a parallel opposed pair of fields and the dose to the carotids compared. All patients received 50 Gy in 16 fractions treating once daily, for 5 days in a week. Results: The average of the mean dose to the carotids with the anterior oblique technique was 21 Gy compared with 37 Gy using the lateral parallel opposed pair arrangement (p < 0.0001). Conclusion: An anterior oblique field arrangement for the treatment of T1 glottic cancer results in a significantly lower radiation dose to the carotid arteries, which may be clinically important in terms of reducing the risk of cerebrovascular events in long-term survivors. Advances in knowledge: Although the anterior oblique technique for treating early glottic cancers is well described, and it is predictable that the dose received by the carotid arteries should be lower with this technique, to our knowledge this is the first study to quantify that reduction in dose with a series of patients. PMID:24628251

  15. T-1 Test Program Ver. 6.0.1

    SciTech Connect

    Perlinski, Anthony W.


    The software allows for easy setup and testing of a variety of RF Electronic Sensor Platforms (ESPs). The software interprets RF messages from the ESP and displays the information in a graphical user interface. This program is used primarily for testing of the T-1 Electronic Sensor Platform. The software imports Electronic Tag Data files which are created from the Electronic Sensor Platform Programmer (ESPP). The software will automatically add sensors to its database when a RF message s received that the program recognizes. Any data that is generated can be stored to a file for later analysis.

  16. The electronics system of the TOTEM T1 telescope

    NASA Astrophysics Data System (ADS)

    Minutoli, S.; Bozzo, M.; Ferro, F.; Lo Vetere, M.; Robutti, E.


    The T1 detector of the TOTEM experiment is devoted to the measurement of the inelastic rate of proton-proton interactions at the LHC. It is made of Cathode Strip Chambers. The complete electronic chains of front-end, readout and trigger are presented here. The electronics system has been developed keeping into account the hostile environment from the point of view of both radiation and magnetic field. Dedicated VLSI circuits have been extensively used in order to optimize space and power consumption.

  17. The TOTEM T1 read out card motherboard

    NASA Astrophysics Data System (ADS)

    Minutoli, S.; Lo Vetere, M.; Robutti, E.


    This article describes the Read Out Card (ROC) motherboard, which is the main component of the T1 forward telescope front-end electronic system. The ROC main objectives are to acquire tracking data and trigger information from the detector. It performs data conversion from electrical to optical format and transfers the data streams to the next level of the system and it implements Slow Control modules which are able to receive, decode and distribute the LHC machine low jitter clock and fast command. The ROC also provides a spy mezzanine connection based on programmable FPGA and USB2.0 for laboratory and portable DAQ debugging system.

  18. T-1 Test Program Ver. 6.0.1


    The software allows for easy setup and testing of a variety of RF Electronic Sensor Platforms (ESPs). The software interprets RF messages from the ESP and displays the information in a graphical user interface. This program is used primarily for testing of the T-1 Electronic Sensor Platform. The software imports Electronic Tag Data files which are created from the Electronic Sensor Platform Programmer (ESPP). The software will automatically add sensors to its database when amore » RF message s received that the program recognizes. Any data that is generated can be stored to a file for later analysis.« less

  19. [Transgenics without Manichaeism].


    Valle, S


    We live in an era characterized by the hegemony of science and technology, an era fraught with questions awaiting answers which would enable a safe and sustainable future for humankind. The development of agro-industrial processes - food products in particular - through recombinant DNA technology has enhanced the profit prospects of the few big biotechnology companies and of large-scale farmers who have access to the latest technological developments. We thus oppose a moratorium on recombinant DNA technology. Moreover, hasty statements about risk-free transgenics may be misleading in the absence of extensive safety tests. There is a pressing need for the establishment of biosafety policy in this country involving the organized civil society and every government agency responsible for monitoring such matters. There is also the need to put in place a bio-surveillance and a code of ethics regarding genetic manipulation. PMID:16680900

  20. An increase in melatonin in transgenic rice causes pleiotropic phenotypes, including enhanced seedling growth, delayed flowering, and low grain yield.


    Byeon, Yeong; Back, Kyoungwhan


    No previous reports have described the effects of an increase in endogenous melatonin levels on plant yield and reproduction. Here, the phenotypes of melatonin-rich transgenic rice plants overexpressing sheep serotonin N-acetyltransferase were investigated under field conditions. Early seedling growth of melatonin-rich transgenic rice was greatly accelerated, with enhanced biomass relative to the wild type (WT). However, flowering was delayed by 1 wk in the transgenic lines compared with the WT. Grain yields of the melatonin-rich transgenic lines were reduced by 33% on average. Other phenotypes also varied among the transgenic lines. For example, the transgenic line S1 exhibited greater height and biomass than the WT, while the S10 transgenic line showed diminished height and an increase in panicle numbers per plant. The expression levels of Oryza sativa homeobox1 (OSH1) and TEOSINTE BRANCHED1 (TB1) genes, two key regulators of meristem initiation and maintenance, were not altered in the transgenic lines. These data demonstrate that an alteration of endogenous melatonin levels leads to pleiotropic effects such as height, biomass, panicle number, flowering time, and grain yield, indicating that melatonin behaves as a signaling molecule in plant growth and reproduction. PMID:24571270

  1. Post-mortem re-cloning of a transgenic red fluorescent protein dog

    PubMed Central

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo


    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification. PMID:22122908

  2. A 90-Day Dietary Toxicity Study of Genetically Modified Rice T1C-1 Expressing Cry1C Protein in Sprague Dawley Rats

    PubMed Central

    Tang, Xueming; Han, Fangting; Zhao, Kai; Xu, Yan; Wu, Xiao; Wang, Jinbin; Jiang, Lingxi; Shi, Wei


    In a 90-day study, Sprague Dawley rats were fed transgenic T1C-1 rice expressing Cry1C protein and were compared with rats fed non-transgenic parental rice Minghui 63 and rats fed a basal diet. No adverse effects on animal behavior or weight gain were observed during the study. Blood samples were collected and analyzed, and standard hematological and biochemical parameters were compared. A few of these parameters were found to be significantly different, but were within the normal reference intervals for rats of this breed and age, and were thus not considered to be treatment-related. Following sacrifice, a large number of organs were weighed, and macroscopic and histopathological examinations were performed with no changes reported. The aim of this study was to use a known animal model to determine the safety of the genetically modified (GM) rice T1C-1. The results showed no adverse or toxic effects due to T1C-1 rice when tested in this 90-day study. PMID:23300690

  3. Proteomic analysis of imatinib-resistant CML-T1 cells reveals calcium homeostasis as a potential therapeutic target.


    Toman, O; Kabickova, T; Vit, O; Fiser, R; Polakova, K Machova; Zach, J; Linhartova, J; Vyoral, D; Petrak, J


    Chronic myeloid leukemia (CML) therapy has markedly improved patient prognosis after introduction of imatinib mesylate for clinical use. However, a subset of patients develops resistance to imatinib and other tyrosine kinase inhibitors (TKIs), mainly due to point mutations in the region encoding the kinase domain of the fused BCR-ABL oncogene. To identify potential therapeutic targets in imatinib‑resistant CML cells, we derived imatinib-resistant CML-T1 human cell line clone (CML-T1/IR) by prolonged exposure to imatinib in growth media. Mutational analysis revealed that the Y235H mutation in BCR-ABL is probably the main cause of CML-T1/IR resistance to imatinib. To identify alternative therapeutic targets for selective elimination of imatinib-resistant cells, we compared the proteome profiles of CML-T1 and CML-T1/IR cells using 2-DE-MS. We identified eight differentially expressed proteins, with strongly upregulated Na+/H+ exchanger regulatory factor 1 (NHERF1) in the resistant cells, suggesting that this protein may influence cytosolic pH, Ca2+ concentration or signaling pathways such as Wnt in CML-T1/IR cells. We tested several compounds including drugs in clinical use that interfere with the aforementioned processes and tested their relative toxicity to CML-T1 and CML-T1/IR cells. Calcium channel blockers, calcium signaling antagonists and modulators of calcium homeostasis, namely thapsigargin, ionomycin, verapamil, carboxyamidotriazole and immunosuppressive drugs cyclosporine A and tacrolimus (FK-506) were selectively toxic to CML-T1/IR cells. The putative cellular targets of these compounds in CML-T1/IR cells are postulated in this study. We propose that Ca2+ homeostasis can be a potential therapeutic target in CML cells resistant to TKIs. We demonstrate that a proteomic approach may be used to characterize a TKI-resistant population of CML cells enabling future individualized treatment options for patients. PMID:27430982

  4. Investigations of the νT=1 exciton condensate

    NASA Astrophysics Data System (ADS)

    Wiersma, R. D.; Lok, J. G. S.; Tiemann, L.; Dietsche, W.; von Klitzing, K.; Schuh, D.; Wegscheider, W.


    Recent experiments on quantum Hall bilayers in the vicinity of total filling factor 1 ( νT=1) have revealed many exciting observations characteristic of a superfluidic exciton condensate. We report on our experimental work involving the νT=1 exciton condensate in independently contacted bilayer two-dimensional electron systems. We observe previously reported phenomena as a zero-bias resonant tunneling peak, a quantized Hall drag resistivity, and in counter-flow configuration, the near vanishing of both ρxx and ρxy resistivity components. At balanced electron densities in the layers, we find for both drag and counter-flow current configurations, thermally activated transport with a monotonic increase of the activation energy for d/ℓB<1.65 with activation energies up to 0.4 K. In the imbalanced system the activation energies show a striking asymmetry around the balance point, implying that the gap to charge excitations is considerably different in the separate layers that form the bilayer condensate. This indicates that the measured activation energy is neither the binding energy of the excitons, nor their condensation energy.

  5. Investigations of the νT=1 Exciton Condensate

    NASA Astrophysics Data System (ADS)

    Wiersma, R. D.; Lok, J. G. S.; Tiemann, L.; Dietsche, W.; von Klitzing, K.; Wegscheider, W.; Schuh, D.

    Recent experiments on quantum Hall bilayers in the vicinity of total filling factor 1 (νT=1) have revealed the possibility of a superfluidic exciton condensate. We report on our experimental work involving the νT=1 exciton condensate in independently contacted bilayer two-dimensional electron systems. We reproduce the previously reported zero bias resonant tunneling peak, a quantized Hall drag resistivity, and in counter-flow configuration, the near vanishing of both ρxx and ρxy resistivity components. At balanced electron densities in the layers, we find for both drag and counter-flow current configurations, thermally activated transport with a monotonic increase of the activation energy for d/ℓB < 1.65 with activation energies up to 0.4 K. In the imbalanced system the activation energies show a striking asymmetry around the balance point, implying that the gap to charge excitations is considerably different in the separate layers that form the bilayer condensate. This indicates that the measured activation energy is neither the binding energy of the excitons, nor their condensation energy. We establish a phase diagram of the excitonic condensate showing the enhancement of this state at slight imbalances.

  6. Mammalian MagT1 and TUSC3 are required for cellular magnesium uptake and vertebrate embryonic development

    PubMed Central

    Zhou, Hao; Clapham, David E.


    Magnesium (Mg2+) is the second most abundant cation in cells, yet relatively few mechanisms have been identified that regulate cellular levels of this ion. The most clearly identified Mg2+ transporters are in bacteria and yeast. Here, we use a yeast complementary screen to identify two mammalian genes, MagT1 and TUSC3, as major mechanisms of Mg2+ influx. MagT1 is universally expressed in all human tissues and its expression level is up-regulated in low extracellular Mg2+. Knockdown of either MagT1 or TUSC3 protein significantly lowers the total and free intracellular Mg2+ concentrations in mammalian cell lines. Morpholino knockdown of MagT1 and TUSC3 protein expression in zebrafish embryos results in early developmental arrest; excess Mg2+ or supplementation with mammalian mRNAs can rescue the effects. We conclude that MagT1 and TUSC3 are indispensable members of the vertebrate plasma membrane Mg2+ transport system. PMID:19717468

  7. Enhanced UV-Induced Skin Carcinogenesis in Transgenic Mice Overexpressing Proprotein Convertases1

    PubMed Central

    Fu, Jian; Bassi, Daniel E; Zhang, Jirong; Li, Tianyu; Cai, Kathy Q; Testa, Courtney Lyons; Nicolas, Emmanuelle; Klein-Szanto, Andres J


    The proprotein convertases (PCs) furin and PACE4 process numerous substrates involved in tumor growth, invasion, and metastasis. We have previously shown that PCs increase the susceptibility to chemical skin carcinogenesis. Because of the human relevancy of UV radiation in the etiopathogenesis of human skin cancer, we investigated whether or not transgenic mice overexpressing either furin alone or both furin and PACE4 show increased susceptibility to UV carcinogenesis. After backcrossing our previously described furin and PACE4 transgenic lines, targeted to the epidermis, into a SKH-1 background, we exposed both single and double transgenic mice to UV radiation for 34 weeks. The results showed an increase in squamous cell carcinoma (SCC) multiplicity of approximately 70% in the single furin transgenic mouse line SF47 (P < .002) and a 30% increase in the other single transgenic line SF49 when compared to wild-type (WT) SKH-1 mice. Interestingly, there was also an increase in the percentage of high histologic grade SCCs in the transgenic lines compared to the WT mice, i.e., WT = 9%, SF47 = 15%, and SF49 = 26% (P < .02). Targeting both furin and PACE4 to the epidermis in double transgenic mice did not have an additive effect on tumor incidence/multiplicity but did enhance the tumor histopathologic grade, i.e., a significant increase in higher grade SCCs was seen in the bigenic mouse line SPF47 (P < .02). Thus, we observed an increased susceptibility to UV in single furin transgenic mice that was not substantially enhanced in the double furin/PACE4 transgenic mice. PMID:23441131

  8. Consistent transcriptional silencing of 35S-driven transgenes in gentian.


    Mishiba, Kei-ichiro; Nishihara, Masahiro; Nakatsuka, Takashi; Abe, Yoshiko; Hirano, Hiroshi; Yokoi, Takahide; Kikuchi, Akiko; Yamamura, Saburo


    In this study, no transgenic gentian (Gentiana triflora x Gentiana scabra) plants produced via Agrobacterium-mediated transformation exhibited transgene (GtMADS, gentian-derived MADS-box genes or sGFP, green fluorescent protein) expression in their leaf tissues, despite the use of constitutive Cauliflower mosaic virus (CaMV) 35S promoter. Strikingly, no expression of the selectable marker gene (bar) used for bialaphos selection was observed. To investigate the possible cause of this drastic transgene silencing, methylation-specific sequences were analysed by bisulfite genomic sequencing using tobacco transformants as a control. Highly methylated cytosine residues of CpG and CpWpG (W contains A or T) sites were distinctively detected in the promoter and 5' coding regions of the transgenes 35S-bar and 35S-GtMADS in all gentian lines analysed. These lines also exhibited various degrees of cytosine methylation in asymmetrical sequences. The methylation frequencies in the other transgene, nopaline synthase (NOS) promoter-driven nptII, and the endogenous GtMADS gene coding region, were much lower and were variable compared with those in the 35S promoter regions. Transgene methylation was observed in the bialaphos-selected transgenic calluses expressing the transgenes, and methylation sequences were distributed preferentially around the as-1 element in the 35S promoter. Calluses derived from leaf tissues of silenced transgenic gentian also exhibited transgene suppression, but expression was recovered by treatment with the methylation inhibitor 5-aza-2'-deoxycytidine (aza-dC). These results indicated that cytosine methylation occurs exclusively in the 35S promoter regions of the expressed transgenes during selection of gentian transformants, causing transcriptional gene silencing. PMID:16262705

  9. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.


    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K


    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed. PMID:10945344

  10. Hepatic expression of mature transforming growth factor beta 1 in transgenic mice results in multiple tissue lesions.


    Sanderson, N; Factor, V; Nagy, P; Kopp, J; Kondaiah, P; Wakefield, L; Roberts, A B; Sporn, M B; Thorgeirsson, S S


    Aberrant expression of transforming growth factor beta 1 (TGF-beta 1) has been implicated in a number of disease processes, particularly those involving fibrotic and inflammatory lesions. To determine the in vivo effects of overexpression of TGF-beta 1 on the function and structure of hepatic as well as extrahepatic tissues, transgenic mice were generated containing a fusion gene (Alb/TGF-beta 1) consisting of modified porcine TGF-beta 1 cDNA under the control of the regulatory elements of the mouse albumin gene. Five transgenic lines were developed, all of which expressed the Alb/TGF-beta 1 transgene selectively in hepatocytes. The transgenic line 25 expressing the highest level of the transgene in the liver also had high (> 10-fold over control) plasma levels of TGF-beta 1. Hepatic fibrosis and apoptotic death of hepatocytes developed in all the transgenic lines but was more pronounced in line 25. The fibrotic process was characterized by deposition of collagen around individual hepatocytes and within the space of Disse in a radiating linear pattern. Several extrahepatic lesions developed in line 25, including glomerulonephritis and renal failure, arteritis and myocarditis, as well as atrophic changes in pancreas and testis. The results from this transgenic model strongly support the proposed etiological role for TGF-beta 1 in a variety of fibrotic and inflammatory disorders. The transgenic model may also provide an appropriate paradigm for testing therapeutic interventions aimed at neutralizing the detrimental effects of this important cytokine. PMID:7708687

  11. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.


    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane


    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants. PMID:26138548

  12. Differential Regulation of ERK1/2 and mTORC1 Through T1R1/T1R3 in MIN6 Cells

    PubMed Central

    Wauson, Eric M.; Guerra, Marcy L.; Dyachok, Julia; McGlynn, Kathleen; Giles, Jennifer; Ross, Elliott M.


    The MAPKs ERK1/2 respond to nutrients and other insulin secretagogues in pancreatic β-cells and mediate nutrient-dependent insulin gene transcription. Nutrients also stimulate the mechanistic target of rapamycin complex 1 (mTORC1) to regulate protein synthesis. We showed previously that activation of both ERK1/2 and mTORC1 in the MIN6 pancreatic β-cell-derived line by extracellular amino acids (AAs) is at least in part mediated by the heterodimeric T1R1/T1R3, a G protein-coupled receptor. We show here that AAs differentially activate these two signaling pathways in MIN6 cells. Pretreatment with pertussis toxin did not prevent the activation of either ERK1/2 or mTORC1 by AAs, indicating that Gi is not central to either pathway. Although glucagon-like peptide 1, an agonist for a Gs-coupled receptor, activated ERK1/2 well and mTORC1 to a small extent, AAs had no effect on cytosolic cAMP accumulation. Ca2+ entry is required for ERK1/2 activation by AAs but is dispensable for AA activation of mTORC1. Pretreatment with UBO-QIC, a selective Gq inhibitor, reduced the activation of ERK1/2 but had little effect on the activation of mTORC1 by AAs, suggesting a differential requirement for Gq. Inhibition of G12/13 by the overexpression of the regulator of G protein signaling domain of p115 ρ-guanine nucleotide exchange factor had no effect on mTORC1 activation by AAs, suggesting that these G proteins are also not involved. We conclude that AAs regulate ERK1/2 and mTORC1 through distinct signaling pathways. PMID:26168033

  13. Silibinin and Paclitaxel Cotreatment Significantly Suppress the Activity and Lung Metastasis of Triple Negative 4T1 Mammary Tumor Cell in Mice

    PubMed Central

    Ho, Bing-Ying; Lin, Chun-Hung; Apaya, Maria Karmella; Chao, Wen-Wan; Shyur, Lie-Fen


    The in vitro and in vivo bioactivities of silibinin (SB), paclitaxel (PTX) and SB and PTX in combination (SB+PTX) against murine metastatic mammary 4T1 cancer cell line were investigated. Isobologram and combination index (CI) analyses showed that SB and PTX can function synergistically in the inhibition of 4T1 cell proliferation with a CI value < 1. Both SB and PTX alone or SB+PTX treatment inhibited 4T1 cell migration and motility possibly through downregulation of the serpin protease nexin-1 (PN-1) and N-cadherin expression, inhibition of matrix metalloprotease (MMP)-9 activity, and upregulation of E-cadherin. Flow cytometry and Western blot analyses demonstrated that both drugs deregulated cell-cycle mediators and induced apoptosis in 4T1 cells. A real-time in vivo bioluminescence imaging system to monitor the breast cancer cell metastasis in syngeneic BALB/c mice was established using a stable 4T1pGL-COX-2/Luc cell clone carrying a COX-2 promoter driven-luciferase reporter gene. In vivo study using the allograft 4T1pGL-COX-2/Luc metastatic mouse model indicated that SB co-treated with PTX can significantly suppress lung metastasis of 4T1 cells likely through inhibiting cell proliferation and angiogenesis. Together, this study demonstrates that SB could act synergistically with PTX in 4T1 cells, providing a therapeutic option for highly metastatic triple negative breast cancer. PMID:24716145

  14. 14N quadrupole resonance and 1H T1 dispersion in the explosive RDX.


    Smith, John A S; Blanz, Martin; Rayner, Timothy J; Rowe, Michael D; Bedford, Simon; Althoefer, Kaspar


    The explosive hexahydro-1,3,5-trinitro-s-triazine (CH2-N-NO2)3, commonly known as RDX, has been studied by 14N NQR and 1H NMR. NQR frequencies and relaxation times for the three ν+ and ν- lines of the ring 14N nuclei have been measured over the temperature range 230-330 K. The 1H NMR T1 dispersion has been measured for magnetic fields corresponding to the 1H NMR frequency range of 0-5.4 M Hz. The results have been interpreted as due to hindered rotation of the NO2 group about the N-NO2 bond with an activation energy close to 92 kJ mol(-1). Three dips in the 1H NMR dispersion near 120, 390 and 510 kHz are assigned to the ν0, ν- and ν+ transitions of the 14NO2 group. The temperature dependence of the inverse line-width parameters T2∗ of the three ν+ and ν- ring nitrogen transitions between 230 and 320 K can be explained by a distribution in the torsional oscillational amplitudes of the NO2 group about the N-NO2 bond at crystal defects whose values are consistent with the latter being mainly edge dislocations or impurities in the samples studied. Above 310 K, the 14N line widths are dominated by the rapid decrease in the spin-spin relaxation time T2 due to hindered rotation of the NO2 group. A consequence of this is that above this temperature, the 1H T1 values at the quadrupole dips are dominated by the spin mixing time between the 1H Zeeman levels and the combined 1H and 14N spin-spin levels. PMID:21978662


    SciTech Connect

    Hsieh, Henry H.; Kaluna, Heather M.; Yang Bin; Haghighipour, Nader; Micheli, Marco; Denneau, Larry; Jedicke, Robert; Kleyna, Jan; Veres, Peter; Wainscoat, Richard J.; Ansdell, Megan; Elliott, Garrett T.; Keane, Jacqueline V.; Meech, Karen J.; Riesen, Timm E.; Sonnett, Sarah; Novakovic, Bojan; Fitzsimmons, Alan; Moskovitz, Nicholas A.; Sheppard, Scott S.; and others


    We present initial results from observations and numerical analyses aimed at characterizing the main-belt comet P/2012 T1 (PANSTARRS). Optical monitoring observations were made between 2012 October and 2013 February using the University of Hawaii 2.2 m telescope, the Keck I telescope, the Baade and Clay Magellan telescopes, Faulkes Telescope South, the Perkins Telescope at Lowell Observatory, and the Southern Astrophysical Research Telescope. The object's intrinsic brightness approximately doubles from the time of its discovery in early October until mid-November and then decreases by {approx}60% between late December and early February, similar to photometric behavior exhibited by several other main-belt comets and unlike that exhibited by disrupted asteroid (596) Scheila. We also used Keck to conduct spectroscopic searches for CN emission as well as absorption at 0.7 {mu}m that could indicate the presence of hydrated minerals, finding an upper limit CN production rate of Q{sub CN} < 1.5 Multiplication-Sign 10{sup 23} mol s{sup -1}, from which we infer a water production rate of Q{sub H{sub 2O}}<5 Multiplication-Sign 10{sup 25} mol s{sup -1}, and no evidence of the presence of hydrated minerals. Numerical simulations indicate that P/2012 T1 is largely dynamically stable for >100 Myr and is unlikely to be a recently implanted interloper from the outer solar system, while a search for potential asteroid family associations reveals that it is dynamically linked to the {approx}155 Myr old Lixiaohua asteroid family.

  16. Relationships between LDH-A, Lactate and Metastases in 4T1 Breast Tumors

    PubMed Central

    Rizwan, Asif; Serganova, Inna; Khanin, Raya; Karabeber, Hazem; Ni, Xiaohui; Thakur, Sunitha; Zakian, Kristen L.; Blasberg, Ronald; Koutcher, Jason A.


    Purpose To investigate the relationship between LDH-A expression, lactate concentration, cell metabolism and metastases in murine 4T1 breast tumors. Experimental Design Inhibition of LDH-A expression and protein levels were achieved in a metastatic breast cancer cell line (4T1) using shRNA technology. The relationship between tumor LDH-A protein levels and lactate concentration (measured by magnetic resonance spectroscopic imaging-MRSI) and metastases was assessed. Results LDH-A knockdown cells (KD9) showed a significant reduction in LDH-A protein and LDH activity, less acid production, decreased transwell migration and invasion, lower proliferation, reduced glucose utilization and glycolysis and increase in oxygen consumption, ROS and cellular ATP levels, compared to control (NC) cells cultured in 25 mM glucose. In vivo studies showed lower lactate levels in KD9, KD5, KD317 tumors than in NC or 4T1 wild-type tumors (p<0.01), and a linear relationship between tumor LDH-A protein expression and lactate concentration. Metastases were delayed and primary tumor growth rate decreased. Conclusions We show for the first time that LDH-A knockdown inhibited the formation of metastases, and was accompanied by in vivo changes in tumor cell metabolism. Lactate MRSI can be used as a surrogate to monitor targeted inhibition of LDH-A in a pre-clinical setting and provides a non-invasive imaging strategy to monitor LDH-A targeted therapy. This imaging strategy can be translated to the clinic to identify and monitor patients who are at high risk of developing metastatic disease. PMID:23833310

  17. Progress in the preparation and testing of glycine transporter type-1 (GlyT1) inhibitors.


    Lindsley, Craig W; Wolkenberg, Scott E; Kinney, Gene G


    Clinically utilized antipsychotic agents share as a common mechanism the ability to antagonize dopamine D2 receptors and it is widely assumed that this activity contributes to their efficacy against the positive symptoms of schizophrenia. The efficacy of currently marketed antipsychotic agents on the negative and cognitive symptoms of this disease, however, is not optimal. One alternate hypothesis to the "dopamine hypothesis" of schizophrenia derives from the observation that antagonists of NMDA receptor activity better mimic the symptomatology of schizophrenia in its entirety than do dopamine agonists. Findings from this line of research have led to the NMDA receptor hypofunction (or glutamate dysfunction) hypothesis of schizophrenia, which complements existing research implicating dopamine dysfunction in the disease. According to the NMDA receptor hypofunction hypothesis, any treatment that enhances NMDA receptor activity may prove useful for the treatment of the complex symptoms that define schizophrenia. This idea is now supported by numerous clinical studies that have reported an efficacious response following treatment with activators of the NMDA receptor co-agonist glycineB site. One area of study, aimed at potentiating the NMDA receptor via activation of the glycineB site is small molecule blockade of the glycine reuptake transporter type 1 (GlyT1). Broadly, these efforts have focused on derivatives of the substrate inhibitor, sarcosine, and non-sarcosine based GlyT1 inhibitors. Accordingly, the following review discusses the development of both sarcosine and non-sarcosine based GlyT1 inhibitors and their current status as putative treatments for schizophrenia and other disorders associated with NMDA receptor hypoactivity. PMID:17017963

  18. Measurement of T1/T2 relaxation times in overlapped regions from homodecoupled 1H singlet signals

    NASA Astrophysics Data System (ADS)

    Castañar, Laura; Nolis, Pau; Virgili, Albert; Parella, Teodor


    The implementation of the HOmodecoupled Band-Selective (HOBS) technique in the conventional Inversion-Recovery and CPMG-based PROJECT experiments is described. The achievement of fully homodecoupled signals allows the distinction of overlapped 1H resonances with small chemical shift differences. It is shown that the corresponding T1 and T2 relaxation times can be individually measured from the resulting singlet lines using conventional exponential curve-fitting methods.

  19. Generation and characterization of a transgenic mouse with a functional human TSPY.


    Schubert, S; Skawran, B; Dechend, F; Nayernia, K; Meinhardt, A; Nanda, I; Schmid, M; Engel, W; Schmidtke, J


    To generate an animal model that is suitable for the analysis of regulation and expression of human testis-specific protein, Y-encoded TSPY, a transgenic mouse line, TgTSPY9, harboring a complete structural human TSPY gene was generated. Fluorescence in situ hybridization and Southern analyses show that approximately 50 copies of the human TSPY transgene are integrated at a single chromosomal site that maps to the distal long arm of the Y chromosome. The transgene is correctly transcribed and spliced according to the human pattern and is mainly expressed in testicular tissue, with spermatogonia and early primary spermatocytes (leptotene and zygotene) as expressing germ cells. TSPY transgenic mice are phenotypically normal, and spermatogenesis is neither impaired nor enhanced by the human transgene. The present study shows that a human TSPY gene integrated into the mouse genome follows the human expression pattern although murine tspy had lost its function in rodent evolution millions of years ago. PMID:12773407

  20. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    SciTech Connect

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene


    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expression supports that cells utilize the PiT1 levels to control proliferation, with non-proliferating cells showing the lowest PiT1 mRNA levels. The mechanism behind the role of PiT1 in increased cell proliferation is not known. We, however, found that compared to control cells, cultures of NIH3T3 cells overexpressing PiT1 upon seeding showed increased cell number after 24 h and had shifted more cells from G0/G1 to S+G2/M within 12 h, suggesting that an early event may play a role. We here show that expression of human PiT1 in NIH3T3 cells led to faster cell adhesion; this effect was not cell type specific in that it was also observed when expressing human PiT1 in MC3T3-E1 cells. We also show for NIH3T3 that PiT1 overexpression led to faster cell spreading. The final total numbers of attached cells did, however, not differ between cultures of PiT1 overexpressing cells and control cells of neither cell type. We suggest that the PiT1-mediated fast adhesion potentials allow the cells to go faster out of G0/G1 and thereby contribute to their proliferative advantage within the first 24 h after seeding. - Highlights: • Effects of elevated levels of the inorganic phosphate transporter PiT1 were studied. • The density-inhibited murine cell lines NIH3T3 and MC3T3-E1 showed faster adhesion. • NIH3T3 cells showed faster spreading. • We suggest that the faster adhesion/spreading contributes to faster proliferation.

  1. Functional Lung MRI in Chronic Obstructive Pulmonary Disease: Comparison of T1 Mapping, Oxygen-Enhanced T1 Mapping and Dynamic Contrast Enhanced Perfusion

    PubMed Central

    Jobst, Bertram J.; Triphan, Simon M. F.; Sedlaczek, Oliver; Anjorin, Angela; Kauczor, Hans Ulrich; Biederer, Jürgen; Ley-Zaporozhan, Julia; Ley, Sebastian; Wielpütz, Mark O.


    Purpose Monitoring of regional lung function in interventional COPD trials requires alternative endpoints beyond global parameters such as FEV1. T1 relaxation times of the lung might allow to draw conclusions on tissue composition, blood volume and oxygen fraction. The aim of this study was to evaluate the potential value of lung Magnetic resonance imaging (MRI) with native and oxygen-enhanced T1 mapping for the assessment of COPD patients in comparison with contrast enhanced perfusion MRI. Materials and Methods 20 COPD patients (GOLD I-IV) underwent a coronal 2-dimensional inversion recovery snapshot flash sequence (8 slices/lung) at room air and during inhalation of pure oxygen, as well as dynamic contrast-enhanced first-pass perfusion imaging. Regional distribution of T1 at room air (T1), oxygen-induced T1 shortening (ΔT1) and peak enhancement were rated by 2 chest radiologists in consensus using a semi-quantitative 3-point scale in a zone-based approach. Results Abnormal T1 and ΔT1 were highly prevalent in the patient cohort. T1 and ΔT1 correlated positively with perfusion abnormalities (r = 0.81 and r = 0.80; p&0.001), and with each other (r = 0.80; p<0.001). In GOLD stages I and II ΔT1 was normal in 16/29 lung zones with mildly abnormal perfusion (15/16 with abnormal T1). The extent of T1 (r = 0.45; p<0.05), ΔT1 (r = 0.52; p<0.05) and perfusion abnormalities (r = 0.52; p<0.05) showed a moderate correlation with GOLD stage. Conclusion Native and oxygen-enhanced T1 mapping correlated with lung perfusion deficits and severity of COPD. Under the assumption that T1 at room air correlates with the regional pulmonary blood pool and that oxygen-enhanced T1 reflects lung ventilation, both techniques in combination are principally suitable to characterize ventilation-perfusion imbalance. This appears valuable for the assessment of regional lung characteristics in COPD trials without administration of i.v. contrast. PMID:25822195

  2. Quality and agronomic effects of three high-molecular-weight glutenin subunit transgenic events in winter wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quality and agronomic effects of three transgenic high-molecular-weight glutenin subunit (HMWGS) events were characterized in advanced-generation breeding lines of hard winter wheat (Triticum aestivum L.) in three Nebraska (U.S.A.) crop years. Two of the transgenic events studied, Dy10-E and B52a-6...

  3. Flowing Foam: T1 events and solid-liquid transitions.

    NASA Astrophysics Data System (ADS)

    Dennin, Michael


    Flowing aqueous foam is found in many applications ranging from oil recovery, to fire fighting, to spreading shaving cream. Aqueous foam consists of gas bubbles with liquid walls. One of the striking features of foam is that despite being composed entirely of fluids, its mechanical properties are either those of a solid (elastic response) or fluid (viscous flow), depending on the nature of the applied stress and strains. We study the transition between these two regimes using a model foam system: bubble rafts. Bubble rafts are a single layer of bubbles floating on the air-water surface. This allows us to track the motion of all the bubbles during flow. In this talk, we will present two main results. First, we will discuss the observation of the coexistence between a solid-like and fluid-like state during flow. Second, we will discuss the role played by nonlinear, topological rearrangements, known as T1 events, in determining the mechanical response of the system.

  4. Inducible Gene Manipulations in Brain Serotonergic Neurons of Transgenic Rats

    PubMed Central

    Tews, Björn; Bartsch, Dusan


    The serotonergic (5-HT) system has been implicated in various physiological processes and neuropsychiatric disorders, but in many aspects its role in normal and pathologic brain function is still unclear. One reason for this might be the lack of appropriate animal models which can address the complexity of physiological and pathophysiological 5-HT functioning. In this respect, rats offer many advantages over mice as they have been the animal of choice for sophisticated neurophysiological and behavioral studies. However, only recently technologies for the targeted and tissue specific modification of rat genes - a prerequisite for a detailed study of the 5-HT system - have been successfully developed. Here, we describe a rat transgenic system for inducible gene manipulations in 5-HT neurons. We generated a Cre driver line consisting of a tamoxifen-inducible CreERT2 recombinase under the control of mouse Tph2 regulatory sequences. Tissue-specific serotonergic Cre recombinase expression was detected in four transgenic TPH2-CreERT2 rat founder lines. For functional analysis of Cre-mediated recombination, we used a rat Cre reporter line (CAG-loxP.EGFP), in which EGFP is expressed after Cre-mediated removal of a loxP-flanked lacZ STOP cassette. We show an in-depth characterisation of this rat Cre reporter line and demonstrate its applicability for monitoring Cre-mediated recombination in all major neuronal subpopulations of the rat brain. Upon tamoxifen induction, double transgenic TPH2-CreERT2/CAG-loxP.EGFP rats show selective and efficient EGFP expression in 5-HT neurons. Without tamoxifen administration, EGFP is only expressed in few 5-HT neurons which confirms minimal background recombination. This 5-HT neuron specific CreERT2 line allows Cre-mediated, inducible gene deletion or gene overexpression in transgenic rats which provides new opportunities to decipher the complex functions of the mammalian serotonergic system. PMID:22140568

  5. [Biofuels, food security and transgenic crops].


    Acosta, Orlando; Chaparro-Giraldo, Alejandro


    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology. PMID:19722000

  6. Transgenic American elm shows reduced Dutch elm disease symptoms and normal mycorrhizal colonization.


    Newhouse, Andrew E; Schrodt, Franziska; Liang, Haiying; Maynard, Charles A; Powell, William A


    The American elm (Ulmus americana L.) was once one of the most common urban trees in eastern North America until Dutch-elm disease (DED), caused by the fungus Ophiostoma novo-ulmi, eliminated most of the mature trees. To enhance DED resistance, Agrobacterium was used to transform American elm with a transgene encoding the synthetic antimicrobial peptide ESF39A, driven by a vascular promoter from American chestnut. Four unique, single-copy transgenic lines were produced and regenerated into whole plants. These lines showed less wilting and significantly less sapwood staining than non-transformed controls after O. novo-ulmi inoculation. Preliminary observations indicated that mycorrhizal colonization was not significantly different between transgenic and wild-type trees. Although the trees tested were too young to ensure stable resistance was achieved, these results indicate that transgenes encoding antimicrobial peptides reduce DED symptoms and therefore hold promise for enhancing pathogen resistance in American elm. PMID:17310333

  7. [Transgenic animals and animal welfare


    Reinhardt, Christoph


    Under the pressure of a public vote in Switzerland (7 June 1998) on an initiative to ban the production, use and patenting of transgenic animals, their value for biomedical research and development is intensely debated. In addition, the Swiss legislation has adopted (1992) a constitutional obligation to "take into account the dignity of creatures". The term "dignity of creatures", however, can be interpreted in anthropocentric or biocentric ways. The government has now formulated the legal implications of this term for transgenic animals and plants in various laws including the animal and environmental protection laws. This paper gives arguments for a fair evaluation of trangenic animals from an animal welfare point of view where not only the costs of animal suffering must be considered but also the probability of potential benefit for man. A self-confident research community should allow such an evaluation procedure even in view of an outcome which could ban many uses of transgenic animals PMID:11208266

  8. Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.


    Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min


    The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis. PMID:25604637

  9. PbWoxT1 mRNA from pear (Pyrus betulaefolia) undergoes long-distance transport assisted by a polypyrimidine tract binding protein.


    Duan, Xuwei; Zhang, Wenna; Huang, Jing; Hao, Li; Wang, Shengnan; Wang, Aide; Meng, Dong; Zhang, Qiulei; Chen, Qiuju; Li, Tianzhong


    Little is known about the mechanisms by which mRNAs are transported over long distances in the phloem between the rootstock and the scion in grafted woody plants. We identified an mRNA in the pear variety 'Du Li' (Pyrus betulaefolia) that was shown to be transportable in the phloem. It contains a WUSCHEL-RELATED HOMEOBOX (WOX) domain and was therefore named Wox Transport 1 (PbWoxT1). A 548-bp fragment of PbWoxT1 is critical in long-distance transport. PbWoxT1 is rich in CUCU polypyrimidine domains and its mRNAs interact with a polypyrimidine tract binding protein, PbPTB3. Furthermore, the expression of PbWoxT1 significantly increased in the stems of wild-type (WT) tobacco grafted onto the rootstocks of PbWoxT1 or PbPTB3 co-overexpressing lines, but this was not the case in WT plants grafted onto PbWoxT1 overexpressing rootstocks, suggesting that PbPTB3 mediates PbWoxT1 mRNA long-distance transport. We provide novel information that adds a new mechanism with which to explain the noncell-autonomous manner of WOX gene function, which enriches our understanding of how WOX genes work in fruit trees and other species. PMID:26661583

  10. Amino Acids Regulate Transgene Expression in MDCK Cells

    PubMed Central

    Torrente, Marta; Guetg, Adriano; Sass, Jörn Oliver; Arps, Lisa; Ruckstuhl, Lisa; Camargo, Simone M. R.; Verrey, François


    Gene expression and cell growth rely on the intracellular concentration of amino acids, which in metazoans depends on extracellular amino acid availability and transmembrane transport. To investigate the impact of extracellular amino acid concentrations on the expression of a concentrative amino acid transporter, we overexpressed the main kidney proximal tubule luminal neutral amino acid transporter B0AT1-collectrin (SLC6A19-TMEM27) in MDCK cell epithelia. Exogenously expressed proteins co-localized at the luminal membrane and mediated neutral amino acid uptake. However, the transgenes were lost over few cell culture passages. In contrast, the expression of a control transgene remained stable. To test whether this loss was due to inappropriately high amino acid uptake, freshly transduced MDCK cell lines were cultivated either with physiological amounts of amino acids or with the high concentration found in standard cell culture media. Expression of exogenous transporters was unaffected by physiological amino acid concentration in the media. Interestingly, mycoplasma infection resulted in a significant increase in transgene expression and correlated with the rapid metabolism of L-arginine. However, L-arginine metabolites were shown to play no role in transgene expression. In contrast, activation of the GCN2 pathway revealed by an increase in eIF2α phosphorylation may trigger transgene derepression. Taken together, high extracellular amino acid concentration provided by cell culture media appears to inhibit the constitutive expression of concentrative amino acid transporters whereas L-arginine depletion by mycoplasma induces the expression of transgenes possibly via stimulation of the GCN2 pathway. PMID:24797296

  11. Sensing of amino acids by the gut-expressed taste receptor T1R1-T1R3 stimulates CCK secretion.


    Daly, Kristian; Al-Rammahi, Miran; Moran, Andrew; Marcello, Marco; Ninomiya, Yuzo; Shirazi-Beechey, Soraya P


    CCK is secreted by endocrine cells of the proximal intestine in response to dietary components, including amino acids. CCK plays a variety of roles in digestive processes, including inhibition of food intake, consistent with a role in satiety. In the lingual epithelium, the sensing of a broad spectrum of L-amino acids is accomplished by the heteromeric amino acid (umami) taste receptor (T1R1-T1R3). T1R1 and T1R3 subunits are also expressed in the intestine. A defining characteristic of umami sensing by T1R1-T1R3 is its potentiation by IMP or GMP. Furthermore, T1R1-T1R3 is not activated by Trp. We show here that, in response to L-amino acids (Phe, Leu, Glu, and Trp), but not D-amino acids, STC-1 enteroendocrine cells and mouse proximal small intestinal tissue explants secrete CCK and that IMP enhances Phe-, Leu-, and Glu-induced, but not Trp-induced, CCK secretion. Furthermore, small interfering RNA inhibition of T1R1 expression in STC-1 cells results in significant diminution of Phe-, Leu-, and Glu-stimulated, but not Trp-stimulated, CCK release. In STC-1 cells and mouse intestine, gurmarin inhibits Phe-, Leu-, and Glu-induced, but not Trp-stimulated, CCK secretion. In contrast, the Ca(2+)-sensing receptor antagonist NPS2143 inhibits Phe-stimulated CCK release partially and Trp-induced CCK secretion totally in mouse intestine. However, NPS2143 has no effect on Leu- or Glu-induced CCK secretion. Collectively, our data demonstrate that functional characteristics and cellular location of the gut-expressed T1R1-T1R3 support its role as a luminal sensor for Phe-, Leu-, and Glu-induced CCK secretion. PMID:23203156

  12. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon

    PubMed Central

    Kendig, Derek M.; Hurst, Norman R.; Bradley, Zachary L.; Mahavadi, Sunila; Kuemmerle, John F.; Lyall, Vijay; DeSimone, John; Murthy, Karnam S.


    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5′-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1−/− mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  13. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.


    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R


    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  14. How To Produce and Characterize Transgenic Plants.

    ERIC Educational Resources Information Center

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark


    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  15. Taste information derived from T1R-expressing taste cells in mice.


    Yoshida, Ryusuke; Ninomiya, Yuzo


    The taste system of animals is used to detect valuable nutrients and harmful compounds in foods. In humans and mice, sweet, bitter, salty, sour and umami tastes are considered the five basic taste qualities. Sweet and umami tastes are mediated by G-protein-coupled receptors, belonging to the T1R (taste receptor type 1) family. This family consists of three members (T1R1, T1R2 and T1R3). They function as sweet or umami taste receptors by forming heterodimeric complexes, T1R1+T1R3 (umami) or T1R2+T1R3 (sweet). Receptors for each of the basic tastes are thought to be expressed exclusively in taste bud cells. Sweet (T1R2+T1R3-expressing) taste cells were thought to be segregated from umami (T1R1+T1R3-expressing) taste cells in taste buds. However, recent studies have revealed that a significant portion of taste cells in mice expressed all T1R subunits and responded to both sweet and umami compounds. This suggests that sweet and umami taste cells may not be segregated. Mice are able to discriminate between sweet and umami tastes, and both tastes contribute to behavioural preferences for sweet or umami compounds. There is growing evidence that T1R3 is also involved in behavioural avoidance of calcium tastes in mice, which implies that there may be a further population of T1R-expressing taste cells that mediate aversion to calcium taste. Therefore the simple view of detection and segregation of sweet and umami tastes by T1R-expressing taste cells, in mice, is now open to re-examination. PMID:26912569

  16. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.


    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di


    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. PMID:26025753

  17. Construction and long term preservation of clonal transgenic silkworms using a parthenogenetic strain.


    Zabelina, Valeriya; Uchino, Keiro; Mochida, Yuji; Yonemura, Naoyuki; Klymenko, Vyacheslav; Sezutsu, Hideki; Tamura, Toshiki; Sehnal, František


    For the functional analysis of insect genes as well as for the production of recombinant proteins for biomedical use, clonal transgenic silkworms are very useful. We examined if they could be produced in the parthenogenetic strain that had been maintained for more than 40years as a female line in which embryogenesis is induced with nearly 100% efficiency by a heat shock treatment of unfertilized eggs. All individuals have identical female genotype. Silkworm transgenesis requires injection of the DNA constructs into the non-diapausing eggs at the preblastodermal stage of embryogenesis. Since our parthenogenetic silkworms produce diapausing eggs, diapause programing was eliminated by incubating ovaries of the parthenogenetic strain in standard male larvae. Chorionated eggs were dissected from the implants, activated by the heat shock treatment and injected with the transgene construct. Several transgenic individuals occurred in the daughter generation. Southern blotting analysis of two randomly chosen transgenic lines VTG1 and VTG14 revealed multiple transgene insertions. Insertions found in the parental females were transferred to the next generation without any changes in their sites and copy numbers, suggesting that transgenic silkworms can be maintained as clonal strains with homozygous transgenes. Cryopreservation was developed for the storage of precious genotypes. As shown for the VTG1 and VTG14 lines, larval ovaries can be stored in DMSO at the temperature of liquid nitrogen, transferred to Grace's medium during defrosting, and then implanted into larvae of either sex of the standard silkworm strains C146 and w1-pnd. Chorionated eggs, which developed in the implants, were dissected and activated by the heat shock to obtain females (nearly 100% efficiency) or by a cold shock to induce development to both sexes in 4% of the eggs. It was then possible to establish bisexual lines homozygous for the transgene. PMID:26112978

  18. Transgenic Sugarcane with a cry1Ac Gene Exhibited Better Phenotypic Traits and Enhanced Resistance against Sugarcane Borer.


    Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping; Que, Youxiong


    We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines. PMID:27093437

  19. Transgenic Sugarcane with a cry1Ac Gene Exhibited Better Phenotypic Traits and Enhanced Resistance against Sugarcane Borer

    PubMed Central

    Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping


    We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines. PMID:27093437

  20. WP1: transgenic opto-animals

    NASA Astrophysics Data System (ADS)

    UŻarowska, E.; Czajkowski, Rafał; Konopka, W.


    We aim to create a set of genetic tools where permanent opsin expression (ChR or NpHR) is precisely limited to the population of neurons that express immediate early gene c-fos during a specific temporal window of behavioral training. Since the c-fos gene is only expressed in neurons that form experience-dependent ensemble, this approach will result in specific labeling of a small subset of cells that create memory trace for the learned behavior. To this end we employ two alternative inducible gene expression systems: Tet Expression System and Cre/lox System. In both cases, the temporal window for opsin induction is controlled pharmacologically, by doxycycline or tamoxifen, respectively. Both systems will be used for creating lines of transgenic animals.

  1. Zebrafish sp7:EGFP: a transgenic for studying otic vesicle formation, skeletogenesis, and bone regeneration

    PubMed Central

    DeLaurier, April; Eames, B. Frank; Blanco-Sánchez, Bernardo; Peng, Gang; He, Xinjun; Swartz, Mary E.; Ullmann, Bonnie; Westerfield, Monte; Kimmel, Charles B.


    Summary We report the expression pattern and construction of a transgenic zebrafish line for a transcription factor involved in otic vesicle formation and skeletogenesis. The zinc finger transcription factor sp7 (formerly called osterix) is reported as a marker of osteoblasts. Using bacterial artificial chromosome (BAC)-mediated transgenesis, we generated a zebrafish transgenic line for studying skeletal development, Tg(sp7:EGFP)b1212. Using a zebrafish BAC, EGFP was introduced downstream of the regulatory regions of sp7 and injected into 1 cell-stage embryos. In this transgenic line, GFP expression reproduces endogenous sp7 gene expression in the otic placode and vesicle, and in forming skeletal structures. GFP-positive cells were also detected in adult fish, and were found associated with regenerating fin rays post-amputation. This line provides an essential tool for the further study of zebrafish otic vesicle formation and the development and regeneration of the skeleton. PMID:20506187

  2. Interactions between Equine Cyclin T1, Tat, and TAR Are Disrupted by a Leucine-to-Valine Substitution Found in Human Cyclin T1

    PubMed Central

    Taube, Ran; Fujinaga, Koh; Irwin, Dan; Wimmer, Jörg; Geyer, Matthias; Peterlin, B. Matija


    Transcriptional transactivators (Tat) from human immunodeficiency and equine infectious anemia viruses (HIV and EIAV) interact with their transactivation response elements (TAR) to increase the rates of viral transcription. Whereas the human cyclin T1 is required for the binding of Tat to TAR from HIV, it is unknown how Tat from EIAV interacts with its TAR. Furthermore, Tat from EIAV functions in equine and canine cells but not in human cells. In this study, we present sequences of cyclins T1 from horse and dog and demonstrate that their N-terminal 300 residues rescue the transactivation of Tat from EIAV in human cells. Although human and equine cyclins T1 bind to this Tat, only the equine cyclin T1 supports the binding of Tat to TAR from EIAV. Finally, a reciprocal exchange of the valine for the leucine at position 29 in human and equine cyclins T1, respectively, renders the human cyclin T1 active and the equine cyclin T1 inactive for Tat transactivation from EIAV. Thus, the collaboration between a specific cyclin T1 and Tat for their high-affinity interaction with TAR is a common theme of lentiviral transactivation. PMID:10623752

  3. [Current status and industrialization of transgenic tomatoes].


    Wang, Ao-Xue; Chen, Xiu-Ling


    In this review, the progress in transgenic tomato research, including disease and insect resistance, herbicide resistance, stress tolerance, long-term storage, quality improvement, and male sterility, were described. The recent researches on producing heterologous proteins using transgenic tomatoes were also reviewed. Furthermore, the industrialization status and problems of transgenic tomatoes were analyzed and the prospects of both research and industrialization in transgenic tomatoes were discussed. PMID:21951797

  4. Divergent phenotypes in mutant TDP-43 transgenic mice highlight potential confounds in TDP-43 transgenic modeling.


    D'Alton, Simon; Altshuler, Marcelle; Cannon, Ashley; Dickson, Dennis W; Petrucelli, Leonard; Lewis, Jada


    The majority of cases of frontotemporal lobar degeneration and amyotrophic lateral sclerosis are pathologically defined by the cleavage, cytoplasmic redistribution and aggregation of TAR DNA binding protein of 43 kDa (TDP-43). To examine the contribution of these potentially toxic mechanisms in vivo, we generated transgenic mice expressing human TDP-43 containing the familial amyotrophic lateral sclerosis-linked M337V mutation and identified two lines that developed neurological phenotypes of differing severity and progression. The first developed a rapid cortical neurodegenerative phenotype in the early postnatal period, characterized by fragmentation of TDP-43 and loss of endogenous murine Tdp-43, but entirely lacking aggregates of ubiquitin or TDP-43. A second, low expressing line was aged to 25 months without a severe neurodegenerative phenotype, despite a 30% loss of mouse Tdp-43 and accumulation of lower molecular weight TDP-43 species. Furthermore, TDP-43 fragments generated during neurodegeneration were not C-terminal, but rather were derived from a central portion of human TDP-43. Thus we find that aggregation is not required for cell loss, loss of murine Tdp-43 is not necessarily sufficient in order to develop a severe neurodegenerative phenotype and lower molecular weight TDP-43 positive species in mouse models should not be inherently assumed to be representative of human disease. Our findings are significant for the interpretation of other transgenic studies of TDP-43 proteinopathy. PMID:24466128

  5. Field performance of transgenic citrus trees: Assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics

    PubMed Central


    Background The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. Results The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Conclusions Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the

  6. TRANSGENIC FISH: In Genomics and Genetics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fish into which foreign DNA is artificially introduced and integrated into their genome are called transgenic fish. Since the development of the first transgenic fish in 1985, techniques to produce transgenic fish have improved tremendously, resulting in the production of genetically modified (GM)...

  7. ZFIN, the Zebrafish Model Organism Database: increased support for mutants and transgenics.


    Howe, Douglas G; Bradford, Yvonne M; Conlin, Tom; Eagle, Anne E; Fashena, David; Frazer, Ken; Knight, Jonathan; Mani, Prita; Martin, Ryan; Moxon, Sierra A Taylor; Paddock, Holly; Pich, Christian; Ramachandran, Sridhar; Ruef, Barbara J; Ruzicka, Leyla; Schaper, Kevin; Shao, Xiang; Singer, Amy; Sprunger, Brock; Van Slyke, Ceri E; Westerfield, Monte


    ZFIN, the Zebrafish Model Organism Database (, is the central resource for zebrafish genetic, genomic, phenotypic and developmental data. ZFIN curators manually curate and integrate comprehensive data involving zebrafish genes, mutants, transgenics, phenotypes, genotypes, gene expressions, morpholinos, antibodies, anatomical structures and publications. Integrated views of these data, as well as data gathered through collaborations and data exchanges, are provided through a wide selection of web-based search forms. Among the vertebrate model organisms, zebrafish are uniquely well suited for rapid and targeted generation of mutant lines. The recent rapid production of mutants and transgenic zebrafish is making management of data associated with these resources particularly important to the research community. Here, we describe recent enhancements to ZFIN aimed at improving our support for mutant and transgenic lines, including (i) enhanced mutant/transgenic search functionality; (ii) more expressive phenotype curation methods; (iii) new downloads files and archival data access; (iv) incorporation of new data loads from laboratories undertaking large-scale generation of mutant or transgenic lines and (v) new GBrowse tracks for transgenic insertions, genes with antibodies and morpholinos. PMID:23074187

  8. Development and bioassay of transgenic Chinese cabbage expressing potato proteinase inhibitor II gene.


    Zhang, Junjie; Liu, Fan; Yao, Lei; Luo, Chen; Yin, Yue; Wang, Guixiang; Huang, Yubi


    Lepidopteran larvae are the most injurious pests of Chinese cabbage production. We attempted the development of transgenic Chinese cabbage expressing the potato proteinase inhibitor II gene (pinII) and bioassayed the pest-repelling ability of these transgenic plants. Cotyledons with petioles from aseptic seedlings were used as explants for Agrobacterium-mediated in vitro transformation. Agrobacterium tumefaciens C58 contained the binary vector pBBBasta-pinII-bar comprising pinII and bar genes. Plants showing vigorous PPT resistance were obtained by a series concentration selection for PPT resistance and subsequent regeneration of leaf explants dissected from the putative chimera. Transgenic plants were confirmed by PCR and genomic Southern blotting, which showed that the bar and pinII genes were integrated into the plant genome. Double haploid homozygous transgenic plants were obtained by microspore culture. The pinII expression was detected using quantitative real time polymerase chain reaction (qRT-PCR) and detection of PINII protein content in the transgenic homozygous lines. Insect-feeding trials using the larvae of cabbage worm (Pieris rapae) and the larvae of the diamondback moth (Plutella xylostella) showed higher larval mortality, stunted larval development, and lower pupal weights, pupation rates, and eclosion rates in most of the transgenic lines in comparison with the corresponding values in the non-transformed wild-type line. PMID:23136521

  9. Development and bioassay of transgenic Chinese cabbage expressing potato proteinase inhibitor II gene

    PubMed Central

    Zhang, Junjie; Liu, Fan; Yao, Lei; Luo, Chen; Yin, Yue; Wang, Guixiang; Huang, Yubi


    Lepidopteran larvae are the most injurious pests of Chinese cabbage production. We attempted the development of transgenic Chinese cabbage expressing the potato proteinase inhibitor II gene (pinII) and bioassayed the pest-repelling ability of these transgenic plants. Cotyledons with petioles from aseptic seedlings were used as explants for Agrobacterium-mediated in vitro transformation. Agrobacterium tumefaciens C58 contained the binary vector pBBBasta-pinII-bar comprising pinII and bar genes. Plants showing vigorous PPT resistance were obtained by a series concentration selection for PPT resistance and subsequent regeneration of leaf explants dissected from the putative chimera. Transgenic plants were confirmed by PCR and genomic Southern blotting, which showed that the bar and pinII genes were integrated into the plant genome. Double haploid homozygous transgenic plants were obtained by microspore culture. The pinII expression was detected using quantitative real time polymerase chain reaction (qRT-PCR) and detection of PINII protein content in the transgenic homozygous lines. Insect-feeding trials using the larvae of cabbage worm (Pieris rapae) and the larvae of the diamondback moth (Plutella xylostella) showed higher larval mortality, stunted larval development, and lower pupal weights, pupation rates, and eclosion rates in most of the transgenic lines in comparison with the corresponding values in the non-transformed wild-type line. PMID:23136521

  10. Adjuvant chemotherapy of pT1a and pT1b breast carcinoma: results from the NEMESI study

    PubMed Central


    Background The prognosis of pT1a-pT1b breast cancer (BC) used to be considered very good, with a 10-y RFS of 90%. However, some retrospective studies reported a 10-y RFS of 81%–86% and suggested benefit from adjuvant systemic therapy. Methods To evaluate the variables that determined the choice of adjuvant chemotherapy and the type of chemotherapy delivered in pT1a-pT1b BC, we analysed the small tumours enrolled in the NEMESI study. Results Out of 1,894 patients with pathological stage I-II BC enrolled in NEMESI, 402 (21.2%) were pT1a-pT1b. Adjuvant chemotherapy was delivered in 127/402 (31.59%). Younger age, grading G3, high proliferative index, ER-negative and HER2-positive status were significantly associated with the decision to administer adjuvant chemotherapy. An anthracycline without taxane regimen was administered in 59.1% of patients, anthracycline with taxane in 24.4%, a CMF-like regimen in 14.2% and taxane in 2.4%. Adjuvant chemotherapy was administered in 88.4% triple-negative and 73.46% HER2-positive pT1a-pT1b BC. Adjuvant trastuzumab was delivered in 30/49 HER2-positive BC (61.2%). Conclusions Adjuvant chemotherapy was delivered in 31.59% T1a-pT1b BC treated at 63 Italian oncological centres from January 2008 to June 2008. The choice to deliver chemotherapy was based on biological prognostic factors. Anthracycline-based chemotherapy was administered in 83.5% patients. PMID:22545982

  11. T1R2 and T1R3 subunits are individually unnecessary for normal affective licking responses to Polycose: implications for saccharide taste receptors in mice.


    Treesukosol, Yada; Blonde, Ginger D; Spector, Alan C


    The T1R2 and T1R3 proteins are expressed in taste receptor cells and form a heterodimer binding with compounds described as sweet by humans. We examined whether Polycose taste might be mediated through this heterodimer by testing T1R2 knockout (KO) and T1R3 KO mice and their wild-type (WT) littermate controls in a series of brief-access taste tests (25-min sessions with 5-s trials). Sucrose, Na-saccharin, and Polycose were each tested for three consecutive sessions with order of presentation varied among subgroups in a Latin-Square manner. Both KO groups displayed blunted licking responses and initiated significantly fewer trials of sucrose and Na-saccharin across a range of concentrations. KO mice tested after Polycose exposure demonstrated some degree of concentration-dependent licking of sucrose, likely attributable to learning related to prior postingestive experience. These results are consistent with prior findings in the literature, implicating the T1R2+3 heterodimer as the principal taste receptor for sweet-tasting ligands, and also provide support for the potential of postingestive experience to influence responding in the KO mice. In contrast, T1R2 KO and T1R3 KO mice displayed concentration-dependent licking responses to Polycose that tracked those of their WT controls and in some cases licked midrange concentrations more; the number of Polycose trials initiated overall did not differ between KO and WT mice. Thus, the T1R2 and T1R3 proteins are individually unnecessary for normal concentration-dependent licking of Polycose to be expressed in a brief-access test. Whether at least one of these T1R protein subunits is necessary for normal Polycose responsiveness remains untested. Alternatively, there may be a novel taste receptor(s) that mediates polysaccharide taste. PMID:19158407

  12. [Effects of transgenic Bt rice on soil dissolved organic carbon and nitrogen contents and microbiological properties].


    Li, Xiu-Qiang; Chen, Fa-Jun; Liu, Man-Qiang; Hu, Feng


    A two-year field experiment (2009 and 2010) was conducted to evaluate the effects of three transgenic Bt rice lines (KMD, HH1, and BtSY63) and their non-Bt lines (XSD, MH63, and SY63) on soil dissolved organic carbon (DOC) and nitrogen (DON) and microbiological properties. All the measured indices changed significantly with sampling time. Comparing with their corresponding non-Bt lines, the test transgenic Bt lines had little effects on the soil DOC, DON, and microbial biomass nitrogen (MBN). The transgenic Bt lines had significant effects on the soil microbial biomass carbon (MBC), basal respiration (BR), and microbial metabolic quotient (qCO2) in certain periods of time in the first year, but no effects in the second year. Among the soils planted with the three non-Bt rice lines, no difference was observed in the DOC, DON, and microbiological properties, whereas in the soil planted with BtSY63, the MBC and BR were significantly higher, but the qCO2 was significantly lower, as compared with those in the soils planted with KMD and HH1. In sum, two years' planting transgenic Bt rice had little effects on the soil DOC, DON, and microbiological properties, but the differences of soil microbiological properties induced by the planting of different transgenic Bt rice lines were larger than those induced by the planting of different non-Bt lines, implying that long term monitoring would help to reveal the effects of transgenic Bt rice on the structure and function of soil ecosystem. PMID:22489485

  13. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions

    PubMed Central

    Lebedev, V. G.; Faskhiev, V. N.; Kovalenko, N. P.; Shestibratov, K. A.; Miroshnikov, A. I.


    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014–2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity. PMID:27437143

  14. Tissue-specific expression of human CD4 in transgenic mice.


    Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C


    The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. PMID:8474453

  15. The a”MAZE”ing world of lung specific transgenic mice

    PubMed Central

    Rawlins, Emma L.; Perl, Anne-Karina


    The purpose of this review is to give a comprehensive overview of transgenic mouse lines suitable for studying gene function and cellular lineage relationships in lung development, homeostasis, injury and repair. Many of the mouse strains reviewed in this article have been widely shared within the lung research community and new strains are continuously being developed. There are many useful transgenic lines that work to target subsets of lung cells, but it remains a challenge for investigators to select the correct transgenic modules for their experiment. This review covers both the tetracycline and tamoxifen inducible systems and will primarily focus on conditional lines that target the epithelial cells. We point out the limitations of each strain so investigators can choose the system that will work best for their scientific question. Current mesenchymal and endothelial lines are limited by the fact that they are not lung specific. These lines will be summarized in a brief overview. In addition, useful transgenic reporter mice for studying lineage relationships, promoter activity and signaling pathways will complete our lung specific conditional transgenic mouse-shopping list. PMID:22180870

  16. Muscle regulatory factors regulate T1R3 taste receptor expression.


    Kokabu, Shoichiro; Lowery, Jonathan W; Toyono, Takashi; Seta, Yuji; Hitomi, Suzuro; Sato, Tsuyoshi; Enoki, Yuichiro; Okubo, Masahiko; Fukushima, Yosuke; Yoda, Tetsuya


    T1R3 is a T1R class of G protein-coupled receptors, composing subunit of the umami taste receptor when complexed with T1R1. T1R3 was originally discovered in gustatory tissue but is now known to be expressed in a wide variety of tissues and cell types such the intestine, pancreatic β-cells, skeletal muscle, and heart. In addition to taste recognition, the T1R1/T1R3 complex functions as an amino acid sensor and has been proposed to be a control mechanism for the secretion of hormones, such as cholecystokinin, insulin, and duodenal HCO3(-) and activates the mammalian rapamycin complex 1 (MTORC1) to inhibit autophagy. T1R3 knockout mice have increased rate of autophagy in the heart, skeletal muscle and liver. Thus, T1R3 has multiple physiological functions and is widely expressed in vivo. However, the exact mechanisms regulating T1R3 expression are largely unknown. Here, we used comparative genomics and functional analyses to characterize the genomic region upstream of the annotated transcriptional start of human T1R3. This revealed that the T1R3 promoter in human and mouse resides in an evolutionary conserved region (ECR). We also identified a repressive element located upstream of the human T1R3 promoter that has relatively high degree of conservation with rhesus macaque. Additionally, the muscle regulatory factors MyoD and Myogenin regulate T1R3 expression and T1R3 expression increases with skeletal muscle differentiation of murine myoblast C2C12 cells. Taken together, our study raises the possibility that MyoD and Myogenin might control skeletal muscle metabolism and homeostasis through the regulation of T1R3 promoter activity. PMID:26545778

  17. Human health and transgenic crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Under the joint auspices of the Agrochemical and the Agricultural and Food Chemistry Divisions of the American Chemical Society, we organized a short symposium on “Human Health and Transgenic Crops” at the 244th ACS national meeting, held August 19-23, 2012 in Philadelphia, PA, to examine an array o...

  18. Expression pattern in retinal photoreceptors of POMGnT1, a protein involved in muscle-eye-brain disease

    PubMed Central

    Uribe, Mary Luz; Haro, Carmen; Campello, Laura; Cruces, Jesús; Martín-Nieto, José


    Purpose The POMGNT1 gene, encoding protein O-linked-mannose β-1,2-N-acetylglucosaminyltransferase 1, is associated with muscle-eye-brain disease (MEB) and other dystroglycanopathies. This gene’s lack of function or expression causes hypoglycosylation of α-dystroglycan (α-DG) in the muscle and the central nervous system, including the brain and the retina. The ocular symptoms of patients with MEB include retinal degeneration and detachment, glaucoma, and abnormal electroretinogram. Nevertheless, the POMGnT1 expression pattern in the healthy mammalian retina has not yet been investigated. In this work, we address the expression of the POMGNT1 gene in the healthy retina of a variety of mammals and characterize the distribution pattern of this gene in the adult mouse retina and the 661W photoreceptor cell line. Methods Using reverse transcription (RT)–PCR and immunoblotting, we studied POMGNT1 expression at the mRNA and protein levels in various mammalian species, from rodents to humans. Immunofluorescence confocal microscopy analyses were performed to characterize the distribution profile of its protein product in mouse retinal sections and in 661W cultured cells. The intranuclear distribution of POMT1 and POMT2, the two enzymes preceding POMGnT1 in the α-DG O-mannosyl glycosylation pathway, was also analyzed. Results POMGNT1 mRNA and its encoded protein were expressed in the neural retina of all mammals studied. POMGnT1 was located in the cytoplasmic fraction in the mouse retina and concentrated in the myoid portion of the photoreceptor inner segments, where the protein colocalized with GM130, a Golgi complex marker. The presence of POMGnT1 in the Golgi complex was also evident in 661W cells. However, and in contrast to retinal tissue, POMGnT1 additionally accumulated in the nucleus of the 661W photoreceptors. Colocalization was found within this organelle between POMGnT1 and POMT1/2, the latter associated with euchromatic regions of the nucleus. Conclusions

  19. Transgenic plants: from first successes to future applications.


    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc


    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research. PMID:24166429

  20. Spi-1/PU.1 transgenic mice develop multistep erythroleukemias.

    PubMed Central

    Moreau-Gachelin, F; Wendling, F; Molina, T; Denis, N; Titeux, M; Grimber, G; Briand, P; Vainchenker, W; Tavitian, A


    Insertional mutagenesis of the spi-1 gene is associated with the emergence of malignant proerythroblasts during Friend virus-induced acute erythroleukemia. To determine the role of spi-1/PU.1 in the genesis of leukemia, we generated spi-1 transgenic mice. In one founder line the transgene was overexpressed as an unexpected-size transcript in various mouse tissues. Homozygous transgenic animals gave rise to live-born offspring, but 50% of the animals developed a multistep erythroleukemia within 1.5 to 6 months of birth whereas the remainder survived without evidence of disease. At the onset of the disease, mice became severely anemic. Their hematopoietic tissues were massively invaded with nontumorigenic proerythroblasts that express a high level of Spi-1 protein. These transgenic proerythroblasts are partially blocked in differentiation and strictly dependent on erythropoietin for their proliferation both in vivo and in vitro. A complete but transient regression of the disease was observed after erythrocyte transfusion, suggesting that the constitutive expression of spi-1 is related to the block of the differentiation of erythroid precursors. At relapse, erythropoietin-independent malignant proerythroblasts arose. Growth factor autonomy could be partially explained by the autocrine secretion of erythropoietin; however, other genetic events appear to be necessary to confer the full malignant phenotype. These results reveal that overexpression of spi-1 is essential for malignant erythropoiesis and does not alter other hematopoietic lineages. PMID:8628313

  1. Decreased shoot stature and grain alpha-amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat.


    Appleford, Nigel E J; Wilkinson, Mark D; Ma, Qian; Evans, Daniel J; Stone, Marlon C; Pearce, Stephen P; Powers, Stephen J; Thomas, Stephen G; Jones, Huw D; Phillips, Andrew L; Hedden, Peter; Lenton, John R


    Ectopic expression of a gibberellin 2-oxidase gene (PcGA2ox1) decreased the content of bioactive gibberellins (GAs) in transgenic wheat, producing a range of dwarf plants with different degrees of severity. In at least one case, a single transformation event gave rise to T(1) plants with different degrees of dwarfism, the phenotypes being stably inherited over at least four generations. The dwarf phenotype, which included dark-green leaves, increased tillering and, in severe cases, a prostrate growth habit, was replicated by the application of a GA biosynthesis inhibitor to the wild type. Ear rachis length, grain set, and grain size were also decreased in the wheat transformants, compared with an azygous (null) line. The extent of post-germination alpha-amylase production in grains reflected the severity of the shoot phenotype of the transformants and both developmental processes were restored to normal by the application of gibberellic acid (GA(3)). Expression of two GA biosynthesis genes (TaGA20ox1 and TaGA3ox2) was up-regulated, and that of two alpha-amylase gene families (alpha-Amy1 and alpha-Amy2) down regulated, in scutella of semi-dwarf lines, compared with controls. The marked decline in transcript abundance of both alpha-amylase gene families in aleurone was associated with a decreased content of bioactive GAs in grains of the semi-dwarf lines. PMID:17916639

  2. T1ρ magnetic resonance: basic physics principles and applications in knee and intervertebral disc imaging

    PubMed Central

    Zhang, Qinwei; Li, Xiaojuan; Chen, Weitian; Ahuja, Anil; Yuan, Jing


    T1ρ relaxation time provides a new contrast mechanism that differs from T1- and T2-weighted contrast, and is useful to study low-frequency motional processes and chemical exchange in biological tissues. T1ρ imaging can be performed in the forms of T1ρ-weighted image, T1ρ mapping and T1ρ dispersion. T1ρ imaging, particularly at low spin-lock frequency, is sensitive to B0 and B1 inhomogeneity. Various composite spin-lock pulses have been proposed to alleviate the influence of field inhomogeneity so as to reduce the banding-like spin-lock artifacts. T1ρ imaging could be specific absorption rate (SAR) intensive and time consuming. Efforts to address these issues and speed-up data acquisition are being explored to facilitate wider clinical applications. This paper reviews the T1ρ imaging’s basic physic principles, as well as its application for cartilage imaging and intervertebral disc imaging. Compared to more established T2 relaxation time, it has been shown that T1ρ provides more sensitive detection of proteoglycan (PG) loss at early stages of cartilage degeneration. T1ρ has also been shown to provide more sensitive evaluation of annulus fibrosis (AF) degeneration of the discs. PMID:26807369

  3. Magnetic resonance imaging of brain tumors: measurement of T1: work in progress

    SciTech Connect

    Araki, T.; Inouye, T.; Suzuki, H.; Machida, T.; Iio, M.


    Longitudinal relaxation times (T1) of 20 brain tumors were calculated in vivo using a whole-body magnetic resonance unit with a 0.15-T resistive magnet. Images employing standard inversion recovery pulse sequences with different intervals between the 180)2) pulse and selective excitation pulses were compared on every point of the 256 x 256 pixel matrix. Tumor, white matter, and gray matter were sampled from each patient from the computed T1 image for T1 measurement. Astrocytomas, neurinomas, and metastatic tumors showed longer T1 values than did meningiomas. Lipomas had the shortest T1s. It is concluded that it is difficult to predict histological types of brain tumors by the measurement of T1 alone because of the wide variation in relaxation times, but measurement of T1 can be helpful in differentiating brain tumors when additional information about the patient's condition is known.

  4. Clinical implications of proliferation activity in T1 or T2 male gastric cancer patients

    PubMed Central

    Kim, Young-Woo; Eom, Bang Wool; Kook, Myeong-Cherl; Kim, Han-Seong; Kim, Mi-Kyung; Hwang, Hai-Li; Chandra, Vishal; Poojan, Shiv; Song, Yura; Koh, Jae-Soo; Bae, Chang-Dae; Ro, Jungsil; Hong, Kyeong-Man


    Proliferation activity has already been established as a prognostic marker or as a marker for anticancer drug sensitivity. In gastric cancer, however, the prognostic significance of proliferation activity is still being debated. Several studies evaluating proliferation activity using Ki-67 have shown controversial results in terms of the relationship between proliferation activity and overall survival (OS) or drug sensitivity in gastric cancer patients. Because cytoskeleton-associated protein 2 (CKAP2) staining has recently been introduced as a marker of proliferation activity, we analyzed 437 gastric cancer tissues through CKAP2 immunohistochemistry, and we evaluated the chromatin CKAP2-positive cell count (CPCC) for proliferation activity. Although the CPCC did not show any significant correlation with OS in the male, female or total number of cases, it did show a significant correlation in the T1 or T2 male patient subgroup, according to log-rank tests (P=0.001) and univariate analysis (P=0.045). Additionally, multivariate analysis with the Cox proportional hazard regression model showed a significant correlation between the CPCC and OS (P=0.039) for the co-variables of age, gender, T stage, N stage, histology, tumor location, tumor size and adjuvant chemotherapy. In male gastric cancer cell lines, faster-growing cancer cells showed higher sensitivity to cisplatin than slow-growing cells. Thus our study indicates that CPCC-measured proliferation activity demonstrates a significantly worse prognosis in T1 or T2 male gastric cancer patients. The CPCC will help to more precisely classify gastric cancer patients and to select excellent candidates for adjuvant chemotherapy, which in turn will facilitate further clinical chemotherapeutic trials. PMID:26542785

  5. Ultra-low field T1 vs. T1rho at 3T and 7T: study of rotationally immobilized protein gels and animal brain tissues

    NASA Astrophysics Data System (ADS)

    Dong, Hui; Inglis, Ben; Barr, Ian; Clarke, John


    Clinical magnetic resonance imaging (MRI) machines operating in static fields of typically 1.5 T or 3 T can capture information on slow molecular dynamics utilizing the so-called T1rho technique. This technique, in which a radiofrequency (RF) spin-lock field is applied with microtesla amplitude, has been used, for example, to determine the onset time of stroke in studies on rats. The long RF pulse, however, may exceed the specific absorption rate (SAR) limit, putting subjects at risk. Ultra-low-field (ULF) MRI, based on Superconducting Quantum Interference Devices (SQUIDs), directly detects proton signals at a static magnetic field of typically 50-250 μT. Using our ULF MRI system with adjustable static field of typically 55 to 240 μT, we systematically measured the T1 and T2 dispersion profiles of rotationally immobilized protein gels (bovine serum albumin), ex vivo pig brains, and ex vivo rat brains with induced stroke. Comparing the ULF results with T1rho dispersion obtained at 3 T and 7 T, we find that the degree of protein immobilization determines the frequency-dependence of both T1 and T1rho. Furthermore, T1rho and ULF T1 show similar results for stroke, suggesting that ULF MRI may be used to image traumatic brain injury with negligible SAR. This research was supported by the Henry H. Wheeler, Jr. Brain Imaging Center and the Donaldson Trust.

  6. Obtaining T1-T2 distribution functions from 1-dimensional T1 and T2 measurements: The pseudo 2-D relaxation model

    NASA Astrophysics Data System (ADS)

    Williamson, Nathan H.; Röding, Magnus; Galvosas, Petrik; Miklavcic, Stanley J.; Nydén, Magnus


    We present the pseudo 2-D relaxation model (P2DRM), a method to estimate multidimensional probability distributions of material parameters from independent 1-D measurements. We illustrate its use on 1-D T1 and T2 relaxation measurements of saturated rock and evaluate it on both simulated and experimental T1-T2 correlation measurement data sets. Results were in excellent agreement with the actual, known 2-D distribution in the case of the simulated data set. In both the simulated and experimental case, the functional relationships between T1 and T2 were in good agreement with the T1-T2 correlation maps from the 2-D inverse Laplace transform of the full 2-D data sets. When a 1-D CPMG experiment is combined with a rapid T1 measurement, the P2DRM provides a double-shot method for obtaining a T1-T2 relationship, with significantly decreased experimental time in comparison to the full T1-T2 correlation measurement.

  7. Obtaining T1-T2 distribution functions from 1-dimensional T1 and T2 measurements: The pseudo 2-D relaxation model.


    Williamson, Nathan H; Röding, Magnus; Galvosas, Petrik; Miklavcic, Stanley J; Nydén, Magnus


    We present the pseudo 2-D relaxation model (P2DRM), a method to estimate multidimensional probability distributions of material parameters from independent 1-D measurements. We illustrate its use on 1-D T1 and T2 relaxation measurements of saturated rock and evaluate it on both simulated and experimental T1-T2 correlation measurement data sets. Results were in excellent agreement with the actual, known 2-D distribution in the case of the simulated data set. In both the simulated and experimental case, the functional relationships between T1 and T2 were in good agreement with the T1-T2 correlation maps from the 2-D inverse Laplace transform of the full 2-D data sets. When a 1-D CPMG experiment is combined with a rapid T1 measurement, the P2DRM provides a double-shot method for obtaining a T1-T2 relationship, with significantly decreased experimental time in comparison to the full T1-T2 correlation measurement. PMID:27344611

  8. Orosensory detection of sucrose, maltose, and glucose is severely impaired in mice lacking T1R2 or T1R3, but Polycose sensitivity remains relatively normal.


    Treesukosol, Yada; Spector, Alan C


    Evidence in the literature supports the hypothesis that the T1R2+3 heterodimer binds to compounds that humans describe as sweet. Here, we assessed the necessity of the T1R2 and T1R3 subunits in the maintenance of normal taste sensitivity to carbohydrate stimuli. We trained and tested water-restricted T1R2 knockout (KO), T1R3 KO and their wild-type (WT) same-sex littermate controls in a two-response operant procedure to sample a fluid and differentially respond on the basis of whether the stimulus was water or a tastant. Correct responses were reinforced with water and incorrect responses were punished with a time-out. Testing was conducted with a modified descending method of limits procedure across daily 25-min sessions. Both KO groups displayed severely impaired performance and markedly decreased sensitivity when required to discriminate water from sucrose, glucose, or maltose. In contrast, when Polycose was tested, KO mice had normal EC(50) values for their psychometric functions, with some slight, but significant, impairment in performance. Sensitivity to NaCl did not differ between these mice and their WT controls. Our findings support the view that the T1R2+3 heterodimer is the principal receptor that mediates taste detection of natural sweeteners, but not of all carbohydrate stimuli. The combined presence of T1R2 and T1R3 appears unnecessary for the maintenance of relatively normal sensitivity to Polycose, at least in this task. Some detectability of sugars at high concentrations might be mediated by the putative polysaccharide taste receptor, the remaining T1R subunit forming either a homodimer or heteromer with another protein(s), or nontaste orosensory cues. PMID:22621968

  9. Promoting scopolamine biosynthesis in transgenic Atropa belladonna plants with pmt and h6h overexpression under field conditions.


    Xia, Ke; Liu, Xiaoqiang; Zhang, Qiaozhuo; Qiang, Wei; Guo, Jianjun; Lan, Xiaozhong; Chen, Min; Liao, Zhihua


    Atropa belladonna is one of the most important plant sources for producing pharmaceutical tropane alkaloids (TAs). T1 progeny of transgenic A. belladonna, in which putrescine N-methyltransferase (EC. from Nicotiana tabacum (NtPMT) and hyoscyamine 6β-hydroxylase (EC. from Hyoscyamus niger (HnH6H) were overexpressed, were established to investigate TA biosynthesis and distribution in ripe fruits, leaves, stems, primary roots and secondary roots under field conditions. Both NtPMT and HnH6H were detected at the transcriptional level in transgenic plants, whereas they were not detected in wild-type plants. The transgenes did not influence the root-specific expression patterns of endogenous TA biosynthetic genes in A. belladonna. All four endogenous TA biosynthetic genes (AbPMT, AbTRI, AbCYP80F1 and AbH6H) had the highest/exclusive expression levels in secondary roots, suggesting that TAs were mainly synthesized in secondary roots. T1 progeny of transgenic A. belladonna showed an impressive scopolamine-rich chemotype that greatly improved the pharmaceutical value of A. belladonna. The higher efficiency of hyoscyamine conversion was found in aerial than in underground parts. In aerial parts of transgenic plants, hyoscyamine was totally converted to downstream alkaloids, especially scopolamine. Hyoscyamine, anisodamine and scopolamine were detected in underground parts, but scopolamine and anisodamine were more abundant than hyoscyamine. The exclusively higher levels of anisodamine in roots suggested that it might be difficult for its translocation from root to aerial organs. T1 progeny of transgenic A. belladonna, which produces scopolamine at very high levels (2.94-5.13 mg g(-1)) in field conditions, can provide more valuable plant materials for scopolamine production. PMID:27135818

  10. Characterization of FLOWERING LOCUS T1 (FT1) Gene in Brachypodium and Wheat

    PubMed Central

    Han, Xiuli; Wang, Shuyun; Ni, Fei; Li, Kun; Pearce, Stephen; Wu, Jiajie; Dubcovsky, Jorge; Fu, Daolin


    The phase transition from vegetative to reproductive growth is a critical event in the life cycle of flowering plants. FLOWERING LOCUS T (FT) plays a central role in the regulation of this transition by integrating signals from multiple flowering pathways in the leaves and transmitting them to the shoot apical meristem. In this study, we characterized FT homologs in the temperate grasses Brachypodium distachyon and polyploid wheat using transgenic and mutant approaches. Downregulation of FT1 by RNAi was associated with a significant downregulation of the FT-like genes FT2 and FT4 in Brachypodium and FT2 and FT5 in wheat. In a transgenic wheat line carrying a highly-expressed FT1 allele, FT2 and FT3 were upregulated under both long and short days. Overexpression of FT1 caused extremely early flowering during shoot regeneration in both Brachypodium and hexaploid wheat, and resulted in insufficient vegetative tissue to support the production of viable seeds. Downregulation of FT1 transcripts by RNA interference (RNAi) resulted in non-flowering Brachypodium plants and late flowering plants (2–4 weeks delay) in wheat. A similar delay in heading time was observed in tetraploid wheat plants carrying mutations for both FT-A1 and FT-B1. Plants homozygous only for mutations in FT-B1 flowered later than plants homozygous only for mutations in FT-A1, which corresponded with higher transcript levels of FT-B1 relative to FT-A1 in the early stages of development. Taken together, our data indicate that FT1 plays a critical role in the regulation of flowering in Brachypodium and wheat, and that this role is associated with the simultaneous regulation of other FT-like genes. The differential effects of mutations in FT-A1 and FT-B1 on wheat heading time suggest that different allelic combinations of FT1 homoeologs could be used to adjust wheat heading time to improve adaptation to changing environments. PMID:24718312

  11. Enhanced Virus Resistance in Transgenic Maize Expressing a dsRNA-Specific Endoribonuclease Gene from E. coli

    PubMed Central

    Liu, He; Tian, Lanzhi; Zhang, Aihong; Zhang, Yanjing; Shi, Lindan; Guo, Bihong; Xu, Jin; Duan, Xifei; Wang, Xianbing; Han, Chenggui; Miao, Hongqin; Yu, Jialin; Li, Dawei


    Maize rough dwarf disease (MRDD), caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV), the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection. PMID:23593318

  12. Generating Transgenic Mice by Lentiviral Transduction of Spermatozoa Followed by In Vitro Fertilization and Embryo Transfer.


    Chandrashekran, Anil; Casimir, Colin; Dibb, Nick; Readhead, Carol; Winston, Robert


    Most transgenic technologies rely on the oocyte as a substrate for genetic modification. Transgenics animals are usually generated by the injection of the gene constructs (including lentiviruses encoding gene constructs or modified embryonic stem cells) into the pronucleus of a fertilized egg followed by the transfer of the injected embryos into the uterus of a foster mother. Male germ cells also have potential as templates for transgenic development. We have previously shown that mature sperm can be utilized as template for lentiviral transduction and as such used to generate transgenic mice efficiently with germ line capabilities. We provide here a detailed protocol that is relatively simple, to establish transgenic mice using lentivirally transduced spermatozoa. This protocol employs a well-established lentiviral gene delivery system (usual for somatic cells) delivering a variety of transgenes to be directly used with sperm, and the subsequent use of these modified sperm in in vitro fertilization studies and embryo transfer into foster female mice, for the establishment of transgenic mice. PMID:27317176

  13. Strain-Specific Regulation of Striatal Phenotype in Drd2-eGFP BAC Transgenic Mice

    PubMed Central

    Chan, C. Savio; Peterson, Jayms D.; Gertler, Tracy S.; Glajch, Kelly E.; Quintana, Ruth E.; Cui, Qiaoling; Sebel, Luke E.; Plotkin, Joshua L.; Shen, Weixing; Heiman, Myriam; Heintz, Nathaniel; Greengard, Paul; Surmeier, D. James


    Mice carrying bacterial artificial chromosome (BAC) transgenes have become important tools for neuroscientists, providing a powerful means of dissecting complex neural circuits in the brain. Recently, it was reported that one popular line of these mice – mice possessing a BAC transgene with a D2 dopamine receptor (Drd2) promoter construct coupled to an enhanced green fluorescent protein (eGFP) reporter – had abnormal striatal gene expression, physiology and motor behavior. Unlike most of the work using BAC mice, this interesting study relied upon mice backcrossed on the outbred Swiss Webster strain that were homozygous for the Drd2-eGFP BAC transgene.The experiments reported here were conducted to determine whether mouse strain or zygosity was a factor in the reported abnormalities. As reported, SW mice were very sensitive to transgene expression. However, in more commonly used inbred strains of mice (C57BL/6, FVB/N) that were hemizygous for the transgene, the Drd2-eGFP BAC transgene did not alter striatal gene expression, physiology or motor behavior. Thus, the use of inbred strains of mice which are hemizygous for the Drd2 BAC transgene provide a reliable tool for studying basal ganglia function. PMID:22764222

  14. Expression of human protamine P1 in sperm of transgenic mice

    SciTech Connect

    Wyrobek, A.J.; Keith, C.; Stilwell, J.; Lowe, X.; Anderson, G.


    Transgenic mice were produced by pronuclear injection with DNA constructs containing human protamine P1 cDNA recombined with a murine protamine P1 promoter, and were identified by PCR. Expression of human P1 was investigated using huplm, a monoclonal antibody specific for human P1, applied to murine testicular cells, smears of epididymal sperm, and smears of detergent-isolated sperm nuclei. Various antibodies and nontransgenic littermates were used as controls. Two male founders (T3 and T7) sired more than five generations of transgenic offspring each with continued expression of human P1 in their sperm. Transgenic animals appear of normal fertility with sperm of typical nuclear morphology. The human P1 transgene was expressed postmeioticly in both lines, as expected. Nearly 100% of sperm of T3 and T7 hemizygotes labeled with huplm, consistent with complete diffusion of human P1 protein through the intercellular bridge of spermatogenic cells. Human P1 labeling of sperm nuclei was not visibly affected by sonication or by treatment with the detergent MATAB or the reducing agent DTT. A third founder female (T5) showed a transmission pattern consistent with insertion of the transgene into an X chromosome; her transgenic offspring expressed human P1 in only a small fraction of sperm. Human P1 transgenes may serve as efficient targets for germinal mutations and transgenicmice may provide promising models for investigating the DNA complexes.

  15. A novel imprinted transgene located near a repetitive element that exhibits allelic imbalance in DNA methylation during early development.


    Uchiyama, Koji; Watanabe, Daisuke; Hayasaka, Michiko; Hanaoka, Kazunori


    A mouse line carrying a lacZ transgene driven by the human EEF1A1/EF1 alpha promoter was established. Although the promoter is known to show ubiquitous activity, only paternal transgene alleles were expressed, resulting in a transgene imprinting. At mid-gestation, the promoter sequence was differentially methylated, hypomethylated for paternal and hypermethylated for maternal alleles. In germline, the promoter was a typical differentially methylated region. After fertilization, however, both alleles were hypermethylated. Thus, the differential methylation of the promoter required for transgene imprinting was re-established during later embryonic development independently of the germline differential methylation. Furthermore, also a retroelement promoter closely-flanking imprinted transgene and its wild type counterpart displayed similar differential methylation during early development. The retroelement promoter was methylated differentially also in germline, but in an opposite pattern to the embryonic differential methylation. These results suggest that there might be an unknown epigenetic regulation inducing transgene imprinting independently of DNA methylation in the transgene insertion site. Then, besides CpG dinucleotides, non-CpG cytosines of the retroelement promoter were highly methylated especially in the transgene-active mid-gestational embryos, suggesting that an unusual epigenetic regulation might protect the active transgene against de novo methylation occurring generally in mid-gestational embryo. PMID:25389047

  16. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.


    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Mohamed E; Abd Elsalam, Hassan E


    The potential use of human P450-transgenic plants for phytoremediation of pesticide contaminated soils was tested in laboratory and greenhouse experiments. The transgenic P450 CYP1A2 gene Arabidopsis thaliana plants metabolize number of herbicides, insecticides and industrial chemicals. The P450 isozymes CYP1A2 expressed in A. thaliana were examined regarding the herbicide simazine (SIM). Transgenic A. thaliana plants expressing CYP1A2 gene showed significant resistance to SIM supplemented either in plant growth medium or sprayed on foliar parts. The results showed that SIM produces harmful effect on both rosette diameter and primary root length of the wild type (WT) plants. In transgenic A. thaliana lines, the rosette diameter and primary root length were not affected by SIM concentrations used in this experiment. The results indicate that CYP1A2 can be used as a selectable marker for plant transformation, allowing efficient selection of transgenic lines in growth medium and/or in soil-grown plants. The transgenic A. thaliana plants exhibited a healthy growth using doses of up to 250 μmol SIM treatments, while the non-transgenic A. thaliana plants were severely damaged with doses above 50 μmol SIM treatments. The transgenic A. thaliana plants can be used as phytoremediator of environmental SIM contaminants. PMID:26771455

  17. Fully automatic detection of deep white matter T1 hypointense lesions in multiple sclerosis

    NASA Astrophysics Data System (ADS)

    Spies, Lothar; Tewes, Anja; Suppa, Per; Opfer, Roland; Buchert, Ralph; Winkler, Gerhard; Raji, Alaleh


    A novel method is presented for fully automatic detection of candidate white matter (WM) T1 hypointense lesions in three-dimensional high-resolution T1-weighted magnetic resonance (MR) images. By definition, T1 hypointense lesions have similar intensity as gray matter (GM) and thus appear darker than surrounding normal WM in T1-weighted images. The novel method uses a standard classification algorithm to partition T1-weighted images into GM, WM and cerebrospinal fluid (CSF). As a consequence, T1 hypointense lesions are assigned an increased GM probability by the standard classification algorithm. The GM component image of a patient is then tested voxel-by-voxel against GM component images of a normative database of healthy individuals. Clusters (≥0.1 ml) of significantly increased GM density within a predefined mask of deep WM are defined as lesions. The performance of the algorithm was assessed on voxel level by a simulation study. A maximum dice similarity coefficient of 60% was found for a typical T1 lesion pattern with contrasts ranging from WM to cortical GM, indicating substantial agreement between ground truth and automatic detection. Retrospective application to 10 patients with multiple sclerosis demonstrated that 93 out of 96 T1 hypointense lesions were detected. On average 3.6 false positive T1 hypointense lesions per patient were found. The novel method is promising to support the detection of hypointense lesions in T1-weighted images which warrants further evaluation in larger patient samples.

  18. Fully automatic detection of deep white matter T1 hypointense lesions in multiple sclerosis.


    Spies, Lothar; Tewes, Anja; Suppa, Per; Opfer, Roland; Buchert, Ralph; Winkler, Gerhard; Raji, Alaleh


    A novel method is presented for fully automatic detection of candidate white matter (WM) T1 hypointense lesions in three-dimensional high-resolution T1-weighted magnetic resonance (MR) images. By definition, T1 hypointense lesions have similar intensity as gray matter (GM) and thus appear darker than surrounding normal WM in T1-weighted images. The novel method uses a standard classification algorithm to partition T1-weighted images into GM, WM and cerebrospinal fluid (CSF). As a consequence, T1 hypointense lesions are assigned an increased GM probability by the standard classification algorithm. The GM component image of a patient is then tested voxel-by-voxel against GM component images of a normative database of healthy individuals. Clusters (≥0.1 ml) of significantly increased GM density within a predefined mask of deep WM are defined as lesions. The performance of the algorithm was assessed on voxel level by a simulation study. A maximum dice similarity coefficient of 60% was found for a typical T1 lesion pattern with contrasts ranging from WM to cortical GM, indicating substantial agreement between ground truth and automatic detection. Retrospective application to 10 patients with multiple sclerosis demonstrated that 93 out of 96 T1 hypointense lesions were detected. On average 3.6 false positive T1 hypointense lesions per patient were found. The novel method is promising to support the detection of hypointense lesions in T1-weighted images which warrants further evaluation in larger patient samples. PMID:24216694

  19. Response of transgenic poplar overexpressing cytosolic glutamine synthetase to phosphinothricin.


    Pascual, María Belén; Jing, Zhong Ping; Kirby, Edward G; Cánovas, Francisco M; Gallardo, Fernando


    of GS transgenic poplar plantlets was 5-fold greater than controls. The response of young leaves to PPT treatment depends on physiological state as indicated by GS and Rubisco (LSU) levels. Young leaves from control plants, typically in a low differentiation state, respond to the herbicide showing up-regulation of GS and LSU. In contrast, young leaves from transgenic lines, with higher initial GS and LSU levels compared to control, display up-regulation of NADP(+)-isocitrate dehydrogenase. Differences between control and GS transgenics in their response to PPT are discussed in relation to their differences in photosynthetic and photorespiratory capacities (El-Khatib et al., 2004). PMID:17888468

  20. Multiplicative or t1 Noise in NMR Spectroscopy

    SciTech Connect

    Granwehr, Josef


    The signal in an NMR experiment is highly sensitive to fluctuations of the environment of the sample. If, for example, the static magnetic field B{sub 0}, the amplitude and phase of radio frequency (rf) pulses, or the resonant frequency of the detection circuit are not perfectly stable and reproducible, the magnetic moment of the spins is altered and becomes a noisy quantity itself. This kind of noise not only depends on the presence of a signal, it is in fact proportional to it. Since all the spins at a particular location in a sample experience the same environment at any given time, this noise primarily affects the reproducibility of an experiment, which is mainly of importance in the indirect dimensions of a multidimensional experiment, when intense lines are suppressed with a phase cycle, or for difference spectroscopy techniques. Equivalently, experiments which are known to be problematic with regard to their reproducibility, like flow experiments or experiments with a mobile target, tend to be affected stronger by multiplicative noise. In this article it is demonstrated how multiplicative noise can be identified and characterized using very simple, repetitive experiments. An error estimation approach is developed to give an intuitive, yet quantitative understanding of its properties. The consequences for multidimensional NMR experiments are outlined, implications for data analysis are shown, and strategies for the optimization of experiments are summarized.

  1. Transgene integration and organization in cotton (Gossypium hirsutum L.) genome.


    Zhang, Jun; Cai, Lin; Cheng, Jiaqin; Mao, Huizhu; Fan, Xiaoping; Meng, Zhaohong; Chan, Ka Man; Zhang, Huijun; Qi, Jianfei; Ji, Lianghui; Hong, Yan


    While genetically modified upland cotton (Gossypium hirsutum L.) varieties are ranked among the most successful genetically modified organisms (GMO), there is little knowledge on transgene integration in the cotton genome, partly because of the difficulty in obtaining large numbers of transgenic plants. In this study, we analyzed 139 independently derived T0 transgenic cotton plants transformed by Agrobacterium tumefaciens strain AGL1 carrying a binary plasmid pPZP-GFP. It was found by PCR that as many as 31% of the plants had integration of vector backbone sequences. Of the 110 plants with good genomic Southern blot results, 37% had integration of a single T-DNA, 24% had two T-DNA copies and 39% had three or more copies. Multiple copies of the T-DNA existed either as repeats in complex loci or unlinked loci. Our further analysis of two T1 populations showed that segregants with a single T-DNA and no vector sequence could be obtained from T0 plants having multiple T-DNA copies and vector sequence. Out of the 57 T-DNA/T-DNA junctions cloned from complex loci, 27 had canonical T-DNA tandem repeats, the rest (30) had deletions to T-DNAs or had inclusion of vector sequences. Overlapping micro-homology was present for most of the T-DNA/T-DNA junctions (38/57). Right border (RB) ends of the T-DNA were precise while most left border (LB) ends (64%) had truncations to internal border sequences. Sequencing of collinear vector integration outside LB in 33 plants gave evidence that collinear vector sequence was determined in agrobacterium culture. Among the 130 plants with characterized flanking sequences, 12% had the transgene integrated into coding sequences, 12% into repetitive sequences, 7% into rDNAs. Interestingly, 7% had the transgene integrated into chloroplast derived sequences. Nucleotide sequence comparison of target sites in cotton genome before and after T-DNA integration revealed overlapping microhomology between target sites and the T-DNA (8/8), deletions to

  2. A rice chloroplast transit peptide sequence does not alter the cytoplasmic localization of sheep serotonin N-acetyltransferase expressed in transgenic rice plants.


    Byeon, Yeong; Lee, Hyoung Yool; Lee, Kyungjin; Back, Kyoungwhan


    Ectopic overexpression of melatonin biosynthetic genes of animal origin has been used to generate melatonin-rich transgenic plants to examine the functional roles of melatonin in plants. However, the subcellular localization of these proteins expressed in the transgenic plants remains unknown. We studied the localization of sheep (Ovis aries) serotonin N-acetyltransferase (OaSNAT) and a translational fusion of a rice SNAT transit peptide to OaSNAT (TS:OaSNAT) in plants. Laser confocal microscopy analysis revealed that both OaSNAT and TS:OaSNAT proteins were localized to the cytoplasm even with the addition of the transit sequence to OaSNAT. Transgenic rice plants overexpressing the TS:OaSNAT fusion transgene exhibited high SNAT enzyme activity relative to untransformed wild-type plants, but lower activity than transgenic rice plants expressing the wild-type OaSNAT gene. Melatonin levels in both types of transgenic rice plant corresponded well with SNAT enzyme activity levels. The TS:OaSNAT transgenic lines exhibited increased seminal root growth relative to wild-type plants, but less than in the OaSNAT transgenic lines, confirming that melatonin promotes root growth. Seed-specific OaSNAT expression under the control of a rice prolamin promoter did not confer high levels of melatonin production in transgenic rice seeds compared with seeds from transgenic plants expressing OaSNAT under the control of the constitutive maize ubiquitin promoter. PMID:24920304

  3. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.


    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony


    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  4. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony


    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  5. B lineage-restricted rearrangement of a human Ig kappa transgene.


    Cavelier, P; Nato, F; Coquilleau, I; Rolink, A; Rougeon, F; Goodhardt, M


    To study the control of immunoglobulin kappa light chain gene rearrangement, we generated transgenic mice carrying a germ-line human kappa minilocus (HK) containing the J kappa-proximal V gene, V kappa IV, the V-J intergenic region, the five J kappa segments and the C kappa gene. This construct includes the intronic, but not the 3' kappa enhancer. Rearrangement of the HK transgene was found to be lymphoid specific and restricted to the B cell lineage. Quantification of kappa gene rearrangement in pre-B cell lines established from HK transgenic mice showed that, like endogenous kappa genes, rearrangement of the transgene is repressed in mu-negative early B cell precursors. These results indicate that rearrangement of the HK transgene is subjected to the same B/T cell and developmental regulation as V kappa-J kappa rearrangement at the endogenous locus. Comparison with an unrearranged kappa transgenic construct lacking the V-J intergenic region, suggests that this region, or elements associated with the proximal V gene, may act to restrict kappa gene rearrangement to the B cell lineage. PMID:9247570

  6. Arabidopsis DREB1B in transgenic Salvia miltiorrhiza increased tolerance to drought stress without stunting growth.


    Wei, Tao; Deng, Kejun; Gao, Yonghong; Liu, Yu; Yang, Meiling; Zhang, Lipeng; Zheng, Xuelian; Wang, Chunguo; Song, Wenqin; Chen, Chengbin; Zhang, Yong


    Multiple stress response genes are controlled by transcription factors in a coordinated manner; therefore, these factors can be used for molecular plant breeding. CBF1/DREB1B, a known stress-inducible gene, was isolated from Arabidopsis thaliana and introduced into Salvia miltiorrhiza under the control of the CaMV35S or RD29A promoter. Under drought stress, relative water content, chlorophyll content, and the net photosynthetic rate were observed to be higher in the transgenic lines than in the wild type (WT). Moreover, O2(-) and H2O2 accumulation was observed to be lower in the transgenic lines. Additional analyses revealed that the AtDREB1B transgenic plants generally displayed lesser malondialdehyde (MDA) but higher superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) activities than the WT under drought stress. Quantitative real-time polymerase chain reaction of a subset of genes involved in photosynthesis, stress response, carbohydrate metabolism, and cell protection further verified that AtDREB1B could enhance tolerance to drought by activating different downstream DREB/CBF genes in the transgenic plants. Furthermore, no growth inhibition was detected in transgenic S. miltiorrhiza plants that expressed AtDREB1B driven by either the constitutive CaMV35S promoter or the stress-inducible RD29A promoter. Together, these results suggest that AtDREB1B is a good candidate gene for increasing drought tolerance in transgenic S. miltiorrhiza. PMID:27002402

  7. Functional screening of an asthma QTL in YAC transgenic mice

    SciTech Connect

    Symula, Derek J.; Frazer, Kelly A.; Ueda, Yukihiko; Denefle, Patrice; Stevens, Mary E.; Wang, Zhi-En; Locksley, Richard; Rubin, Edward M.


    While large numbers of quantitative trait loci (QTLs) contributing to genetically complex conditions have been discovered, few causative genes have been identified. This is mainly due to the large size of QTLs and the subtle connection between genotype and quantitative phenotype associated with these conditions. While large numbers of quantitative trait loci (QTLs) contributing to genetically complex conditions have been discovered, few causative genes have been identified. This is mainly due to the large size of QTLs and the subtle connection between genotype and quantitative phenotype associated with these conditions. To screen for genes contributing to an asthma QTL mapped to human chromosome 5q33, the authors characterized a panel of large-insert 5q31 transgenics based on studies demonstrating that altering gene dosage frequently affects quantitative phenotypes normally influenced by that gene. This panel of human YAC transgenics, propagating a one megabase interva2048 chromosome 5q31 containing 23 genes, was screened for quantitative changes in several asthma-associated phenotypes. Multiple independent transgenic lines with altered IgE response to antigen treatment shared a 180 kb region containing 5 genes, including human interleukin 4 (IL4) and interleukin 13 (IL13), which induce IgE class switching in B cells5. Further analysis of these mice and mice transgenic for only murine Il4 and Il13 demonstrated that moderate changes in murine Il4 and Il13 expression affect asthma-associated phenotypes in vivo. This functional screen of large-insert transgenics enabled them to sift through multiple genes in the 5q3 asthma QTL without prior consideration of assumed individual gene function and identify genes that influence the QTL phenotype in vivo.

  8. Expression of a rice chitinase gene in transgenic banana ('Gros Michel', AAA genome group) confers resistance to black leaf streak disease.


    Kovács, Gabriella; Sági, László; Jacon, Géraldine; Arinaitwe, Geofrey; Busogoro, Jean-Pierre; Thiry, Els; Strosse, Hannelore; Swennen, Rony; Remy, Serge


    Transgenic banana (Musa acuminata 'Gros Michel') integrating either of two rice chitinase genes was generated and its resistance to Black Leaf Streak disease caused by the fungus Mycosphaerella fijiensis was tested using a leaf disk bioassay. PCR screening indicated the presence of the hpt selectable marker gene in more than 90 % of the lines tested, whereas more than three quarters of the lines contained the linked rice chitinase gene resulting in a co-transformation frequency of at least 71.4 %. Further, a unique stable integration of the transgenes in each line revealed some false negative PCR results and the expected co-transformation frequency of 100 %. The transgene insert number per line ranged from 1 to 5 and single transgene insert lines (25 % of all) were identified. Considerable delay in disease development (up to 63 days post-incoculation) over a monitoring period of 108 days occurred in nine lines with extracellularly targeted chitinase out of 17 transgenic lines tested and their necrotic leaf area decreased by 73-94 % compared to the untransformed susceptible control line. Finally, correlation between symptom development and rice chitinase expression was confirmed in two lines by Western analysis. The potential of rice chitinase genes to enhance resistance against M. fijiensis in banana was demonstrated as well as the usefulness of the leaf disk bioassay for early disease screening in transgenic banana lines. PMID:22791138

  9. Taste responses in mice lacking taste receptor subunit T1R1

    PubMed Central

    Kusuhara, Yoko; Yoshida, Ryusuke; Ohkuri, Tadahiro; Yasumatsu, Keiko; Voigt, Anja; Hübner, Sandra; Maeda, Katsumasa; Boehm, Ulrich; Meyerhof, Wolfgang; Ninomiya, Yuzo


    The T1R1 receptor subunit acts as an umami taste receptor in combination with its partner, T1R3. In addition, metabotropic glutamate receptors (brain and taste variants of mGluR1 and mGluR4) are thought to function as umami taste receptors. To elucidate the function of T1R1 and the contribution of mGluRs to umami taste detection in vivo, we used newly developed knock-out (T1R1−/−) mice, which lack the entire coding region of the Tas1r1 gene and express mCherry in T1R1-expressing cells. Gustatory nerve recordings demonstrated that T1R1−/− mice exhibited a serious deficit in inosine monophosphate-elicited synergy but substantial residual responses to glutamate alone in both chorda tympani and glossopharyngeal nerves. Interestingly, chorda tympani nerve responses to sweeteners were smaller in T1R1−/− mice. Taste cell recordings demonstrated that many mCherry-expressing taste cells in T1R1+/− mice responded to sweet and umami compounds, whereas those in T1R1−/− mice responded to sweet stimuli. The proportion of sweet-responsive cells was smaller in T1R1−/− than in T1R1+/− mice. Single-cell RT-PCR demonstrated that some single mCherry-expressing cells expressed all three T1R subunits. Chorda tympani and glossopharyngeal nerve responses to glutamate were significantly inhibited by addition of mGluR antagonists in both T1R1−/− and T1R1+/− mice. Conditioned taste aversion tests demonstrated that both T1R1−/− and T1R1+/− mice were equally capable of discriminating glutamate from other basic taste stimuli. Avoidance conditioned to glutamate was significantly reduced by addition of mGluR antagonists. These results suggest that T1R1-expressing cells mainly contribute to umami taste synergism and partly to sweet sensitivity and that mGluRs are involved in the detection of umami compounds. PMID:23339178

  10. Stress-inducible expression of AtDREB1A transcription factor greatly improves drought stress tolerance in transgenic indica rice.


    Ravikumar, G; Manimaran, P; Voleti, S R; Subrahmanyam, D; Sundaram, R M; Bansal, K C; Viraktamath, B C; Balachandran, S M


    The cultivation of rice (Oryza sativa L.), a major food crop, requires ample water (30 % of the fresh water available worldwide), and its productivity is greatly affected by drought, the most significant environmental factor. Much research has focussed on identifying quantitative trait loci, stress-regulated genes and transcription factors that will contribute towards the development of climate-resilient/tolerant crop plants in general and rice in particular. The transcription factor DREB1A, identified from the model plant Arabidopsis thaliana, has been reported to enhance stress tolerance against drought stress. We developed transgenic rice plants with AtDREB1A in the background of indica rice cultivar Samba Mahsuri through Agrobacterium-mediated transformation. The AtDREB1A gene was stably inherited and expressed in T1 and T2 plants and in subsequent generations, as indicated by the results of PCR, Southern blot and RT-PCR analyses. Expression of AtDREB1A was induced by drought stress in transgenic rice lines, which were highly tolerant to severe water deficit stress in both the vegetative and reproductive stages without affecting their morphological or agronomic traits. The physiological studies revealed that the expression of AtDREB1A was associated with an increased accumulation of the osmotic substance proline, maintenance of chlorophyll, increased relative water content and decreased ion leakage under drought stress. Most of the homozygous lines were highly tolerant to drought stress and showed significantly a higher grain yield and spikelet fertility relative to the nontransgenic control plants under both stressed and unstressed conditions. The improvement in drought stress tolerance in combination with agronomic traits is very essential in high premium indica rice cultivars, such as Samba Mahsuri, so that farmers can benefit in times of seasonal droughts and water scarcity. PMID:24398893

  11. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa


    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  12. Anticancer Activity of Saponins from Allium chinense against the B16 Melanoma and 4T1 Breast Carcinoma Cell

    PubMed Central

    Yu, Zhihui; Zhang, Tong; Zhou, Fengjuan; Xiao, Xiuqing; Ding, Xuezhi; He, Hao; Rang, Jie; Quan, Meifang; Wang, Ting; Zuo, Mingxing; Xia, Liqiu


    The cytotoxic substance of A. chinense saponins (ACSs) was isolated using ethanol extraction and purified with the D101 macroporous adsorption resin approach. We investigated the anticancer activity of ACSs in the B16 melanoma and 4T1 breast carcinoma cell lines. Methylthioninium chloride and hematoxylin-eosin staining with Giemsa dyestuff were used when the cells were treated with ACSs. The results showed that the cells morphologies changed significantly; ACSs induced cell death in B16 and 4T1 cells based on acridine orange/ethidium bromide double fluorescence staining, with the number and degree of apoptotic tumor cells increasing as ACS concentration increased. ACSs inhibited the proliferation of B16 and 4T1 cells in a dose-dependent manner. They also inhibited cell migration and colony formation and exhibited a concentration-dependent effect. In addition, ACSs apparently inhibited the growth of melanoma in vivo. The preliminary antitumor in vivo assay revealed that early medication positively affected tumor inhibition action and effectively protected the liver and spleen of C57 BL/6 mice from injury. This study provides evidence for the cytotoxicity of ACSs and a strong foundation for further research to establish the theoretical basis for cell death and help in the design and development of new anticancer drugs. PMID:26146506

  13. Human prion strain selection in transgenic mice

    PubMed Central

    Giles, Kurt; Glidden, David V.; Patel, Smita; Korth, Carsten; Groth, Darlene; Lemus, Azucena; DeArmond, Stephen J.; Prusiner, Stanley B.


    Transgenic (Tg) mice expressing chimeras of mouse and human prion proteins (PrP) have shorter incubation periods for Creutzfeldt-Jakob disease (CJD) prions than mice expressing full-length human PrP. Increasing the sequence similarity of the chimeric PrP to mouse PrP, by reverting human residues to mouse, resulted in a Tg line, denoted Tg22372, which was susceptible to sporadic (s) CJD prions in ~110 days 1. Reversion of one additional residue (M111V) resulted in a new Tg line, termed Tg1014, susceptible to sCJD prions in ~75 days. Tg1014 mice also has shorter incubation periods for variant (v) CJD prions, providing a more tractable model for studying this prion strain. Transmission of vCJD prions to Tg1014 mice resulted in two different strains, determined by neuropathology and biochemical analysis, which correlated with the length of the incubation time. One strain had the biochemical, neuropathological, and transmission characteristics including longer incubation times of the inoculated vCJD strain; the second strain produced a phenotype resembling that of sCJD prions including relatively shorter incubation periods. Mice with intermediate incubation periods for vCJD prions had a mixture of the two strains. Both strains were serially transmitted in Tg1014 mice, which led to further reduction in incubation periods. Conversion of vCJD-like to sCJD-like strains was favored in Tg1014 mice more than in the Tg22372 line. The single amino acid difference therefore appears to offer selective pressure for propagation of the sCJD-like strain. These two Tg mouse lines provide relatively rapid models to study human prion diseases as well as the evolution of human prion strains. PMID:20695008

  14. Native T1 Mapping of the Heart – A Pictorial Review

    PubMed Central

    Germain, Philippe; El Ghannudi, Soraya; Jeung, Mi-Young; Ohlmann, Patrick; Epailly, Eric; Roy, Catherine; Gangi, Afshin


    T1 mapping is now a clinically feasible method, providing pixel-wise quantification of the cardiac structure’s T1 values. Beyond focal lesions, well depicted by late gadolinium enhancement sequences, it has become possible to discriminate diffuse myocardial alterations, previously not assessable by noninvasive means. The strength of this method includes the high reproducibility and immediate clinical applicability, even without the use of contrast media injection (native or pre-contrast T1). The two most important determinants of native T1 augmentation are (1) edema related to tissue water increase (recent infarction or inflammation) and (2) interstitial space increase related to fibrosis (infarction scar, cardiomyopathy) or to amyloidosis. Conversely, lipid (Anderson–Fabry) or iron overload diseases are responsible for T1 reduction. In this pictorial review, the main features provided by native T1 mapping are discussed and illustrated, with a special focus on the awaited clinical purpose of this unique, promising new method. PMID:25525401

  15. Focal liver lesions hyperintense on T1-weighted magnetic resonance images.


    Furlan, Alessandro; Marin, Daniele; Bae, Kyongtae T; Lagalla, Roberto; Agnello, Francesco; Bazzocchi, Massimo; Brancatelli, Giuseppe


    This article reviews focal liver lesions hyperintense on T1-weighted magnetic resonance (MR) images and describes the underlying etiologies associated with their T1 signal intensity. Although focal liver lesions are commonly detected because of their iso- or hypointensity on T1-weighted images, lesions (benign or malignant) may present with T1 hyperintensity when they contain T1 shortening elements--such as fat, hemorrhage, copper, melanin, and highly concentrated proteins. Our discussion includes the description of state-of-the-art T1-weighted MR sequences and the imaging features of lesions on pre- and postcontrast MR images that are characteristic for lesion composition and useful for making accurate diagnosis. PMID:19842568

  16. Constitutive expression of McCHIT1-PAT enhances resistance to rice blast and herbicide, but does not affect grain yield in transgenic glutinous rice.


    Zeng, Xiao-Fang; Li, Lei; Li, Jian-Rong; Zhao, De-Gang


    To produce new rice blast- and herbicide-resistant transgenic rice lines, the McCHIT1 gene encoding the class I chitinase from Momordica charantia and the herbicide resistance gene PAT were introduced into Lailong (Oryza sativa L. ssp. Japonica), a glutinous local rice variety from Guizhou Province, People's Republic of China. Transgenic lines were identified by ß-glucuronidase (GUS) histochemical staining, PCR, and Southern blot analyses. Agronomic traits, resistance to rice blast and herbicide, chitinase activities, and transcript levels of McCHIT1 were assessed in the T2 progeny of three transgenic lines (L1, L8, and L10). The results showed that the introduction of McCHIT1-PAT into Lailong significantly enhanced herbicide and blast resistance. After infection with the blast fungus Magnaporthe oryzae, all of the T2 progeny exhibited less severe lesion symptoms than those of wild type. The disease indices were 100% for wild type, 65.66% for T2 transgenic line L1, 59.69% for T2 transgenic line L8, and 79.80% for T2 transgenic line L10. Transgenic lines expressing McCHIT1-PAT did not show a significant difference from wild type in terms of malondialdehyde (MDA) content, polyphenol oxidase (PPO) activity, and superoxide dismutase (SOD) activity in the leaves. However, after inoculation with M. oryzae, transgenic plants showed significantly higher SOD and PPO activities and lower MDA contents in leaves, compared with those in wild-type leaves. The transgenic and the wild-type plants did not show significant differences in grain yield parameters including plant height, panicles per plant, seeds per panicle, and 1000-grain weight. Therefore, the transgenic plants showed increased herbicide and blast resistance, with no yield penalty. PMID:25639923

  17. The TaDREB3 transgene transferred by conventional crossings to different genetic backgrounds of bread wheat improves drought tolerance.


    Shavrukov, Yuri; Baho, Manahil; Lopato, Sergiy; Langridge, Peter


    Drought tolerance of the wheat cultivar Bobwhite was previously enhanced by transformation with a construct containing the wheat DREB3 gene driven by the stress-inducible maize Rab17 promoter. Progeny of a single T2 transgenic line were used as pollinators in crosses with four elite bread wheat cultivars from Western Australia: Bonnie Rock, IGW-2971, Magenta and Wyalkatchem, with the aim of evaluating transgene performance in different genetic backgrounds. The selected pollinator line, BW8-9-10-3, contained multiple transgene copies, had significantly improved drought tolerance compared with wild-type plants and showed no growth and development penalties or abnormalities. A single hybrid plant was selected from each cross-combination for three rounds of backcrossing with the corresponding maternal wheat cultivar. The transgene was detected in all four F1 BC3 combinations, but stress-inducible transgene expression was found in only three of the four combinations. Under well-watered conditions, the phenotypes and grain yield components of the F2 BC3 transgene-expressing lines were similar to those of corresponding recurrent parents and null-segregants. Under severe drought conditions, the backcross lines demonstrated 12-18% higher survival rates than the corresponding control plants. Two from four F3 BC3 transgenic lines showed significantly higher yield (18.9% and 21.5%) than control plants under limited water conditions. There was no induction of transgene expression under cold stress, and therefore, no improvement of frost tolerance observed in the progenies of drought-tolerant F3 BC3 lines. PMID:25940960

  18. Preventing Spontaneous Genetic Rearrangements in the Transgene Cassettes of Adenovirus Vectors

    PubMed Central

    Cottingham, Matthew G.; Carroll, Fionnadh; Morris, Susan J.; Turner, Alison V.; Vaughan, Aisling M.; Kapulu, Melissa C.; Colloca, Stefano; Siani, Loredana; Gilbert, Sarah C.; Hill, Adrian V.S.


    First-generation, E1/E3-deleted adenoviral vectors with diverse transgenes are produced routinely in laboratories worldwide for development of novel prophylactics and therapies for a variety of applications, including candidate vaccines against important infectious diseases, such as HIV/AIDS, tuberculosis, and malaria. Here, we show, for two different transgenes (both encoding malarial antigens) inserted at the E1 locus, that rare viruses containing a transgene-inactivating mutation exhibit a selective growth advantage during propagation in E1-complementing HEK293 cells, such that they rapidly become the major or sole species in the viral population. For one of these transgenes, we demonstrate that viral yield and cytopathic effect are enhanced by repression of transgene expression in the producer cell line, using the tetracycline repressor system. In addition to these transgene-inactivating mutations, one of which occurred during propagation of the pre-viral genomic clone in bacteria, and the other after viral reconstitution in HEK293 cells, we describe two other types of mutation, a small deletion and a gross rearranging duplication, in one of the transgenes studied. These were of uncertain origin, and the effects on transgene expression and viral growth were not fully characterized. We demonstrate that, together with minor protocol modifications, repression of transgene expression in HEK293 cells during viral propagation enables production of a genetically stable chimpanzee adenovirus vector expressing a malarial antigen which had previously been impossible to derive. These results have important implications for basic and pre-clinical studies using adenoviral vectors and for derivation of adenoviral vector products destined for large-scale amplification during biomanufacture. PMID:22252512

  19. Oral immunization of animals with transgenic cherry tomatillo expressing HBsAg

    PubMed Central

    Gao, Yi; Ma, Ying; Li, Mei; Cheng, Tong; Li, Shao-Wei; Zhang, Jun; Xia, Ning-Shao


    AIM: To investigate the expression of recombinant HBsAg (rHBsAg) in transgenic cherry tomatillo in order to explore the feasibility of producing HBV oral vaccine with cherry tomatillo by animal immune tests. METHODS: The recombinant plant expression vector containing HBsAg gene was constructed. Mediated with Agrobacterium tumefaciens, HBsAg gene was transferred into cotyledons of cherry tomatillo. Transformed cherry tomatillos were obtained through hygromycin delay-selection. Integrated DNA in transgenic cherry tomatillo was confirmed by hygromycin resistance selection, Gus detection, polymerase chain reaction (PCR) and dot blotting analysis. Antigenicity of rHBsAg was examined by ELISA and the immunogenicity of rHBsAg derived from transgenic cherry tomatillo tissues was confirmed by oral feed of transformed tissues to BALB/c mice primed with commercial HBV vaccines. Specific antibody titers in mice’s serum were examined by ELISA every week. RESULTS: By far, 10 positive lines of transgenic cherry tomatillos containing HBsAg gene were obtained. Among different organs of the same transgenic cherry tomatillo, level of rHBsAg expressed in leaves was the highest with the yield up to 300 ng/g fresh weight. And the rHBsAg expression level in fruits was about 10 ng/g fresh weight. In animal immune tests, oral delivery with transgenic tissues to mice primed with commercial vaccine instead of naive mice resulted in significant immune response. CONCLUSION: The result of this animal immune test indicated the rHBsAg derived from transgenic cherry tomatillo possessed normal immunogenicity. This work demonstrated the feasibility to generate oral immunogenic rHBsAg in transgenic cherry tomatillo, and would provide some experimental approach for the production of low-cost oral vaccines using transgenic cherry tomatillo in large scale. PMID:12717845

  20. Taste substance binding elicits conformational change of taste receptor T1r heterodimer extracellular domains

    PubMed Central

    Nango, Eriko; Akiyama, Shuji; Maki-Yonekura, Saori; Ashikawa, Yuji; Kusakabe, Yuko; Krayukhina, Elena; Maruno, Takahiro; Uchiyama, Susumu; Nuemket, Nipawan; Yonekura, Koji; Shimizu, Madoka; Atsumi, Nanako; Yasui, Norihisa; Hikima, Takaaki; Yamamoto, Masaki; Kobayashi, Yuji; Yamashita, Atsuko


    Sweet and umami tastes are perceived by T1r taste receptors in oral cavity. T1rs are class C G-protein coupled receptors (GPCRs), and the extracellular ligand binding domains (LBDs) of T1r1/T1r3 and T1r2/T1r3 heterodimers are responsible for binding of chemical substances eliciting umami or sweet taste. However, molecular analyses of T1r have been hampered due to the difficulties in recombinant expression and protein purification, and thus little is known about mechanisms for taste perception. Here we show the first molecular view of reception of a taste substance by a taste receptor, where the binding of the taste substance elicits a different conformational state of T1r2/T1r3 LBD heterodimer. Electron microscopy has showed a characteristic dimeric structure. Förster resonance energy transfer and X-ray solution scattering have revealed the transition of the dimerization manner of the ligand binding domains, from a widely spread to compactly organized state upon taste substance binding, which may correspond to distinct receptor functional states. PMID:27160511

  1. Measurement of T1 of human arterial and venous blood at 7T

    PubMed Central

    Rane, S.; Gore, J.C.


    Techniques for measuring cerebral perfusion require accurate longitudinal relaxation (T1) of blood, a MRI parameter that is field dependent. T1 of arterial and venous human blood was measured at 7T using three different sources – pathology laboratory, blood bank and in vivo. The T1 of venous blood was measured from sealed samples from a pathology lab and in vivo. Samples from a blood bank were oxygenated and mixed to obtain different physiological concentrations of hematocrit and oxygenation. T1 relaxation times were estimated using a three-point fit to a simple inversion recovery equation. At 37° C, the T1 of blood at arterial pO2was 2.29 ± 0.1 s and 2.07 ± 0.12 at venous pO2. The in vivo T1 of venous blood, in three subjects, was slightly longer at 2.45 ± 0.11s. T1 of arterial and venous blood at 7T was measured and found to be significantly different. The T1 values were longer in vivo than in vitro. While the exact cause for the discrepancy is unknown, the additives in the blood samples, degradation during experiment, oxygenation differences, and the non-stagnant nature of blood in vivo could be potential contributors to the lower values of T1 in the venous samples. PMID:23102945

  2. Taste substance binding elicits conformational change of taste receptor T1r heterodimer extracellular domains.


    Nango, Eriko; Akiyama, Shuji; Maki-Yonekura, Saori; Ashikawa, Yuji; Kusakabe, Yuko; Krayukhina, Elena; Maruno, Takahiro; Uchiyama, Susumu; Nuemket, Nipawan; Yonekura, Koji; Shimizu, Madoka; Atsumi, Nanako; Yasui, Norihisa; Hikima, Takaaki; Yamamoto, Masaki; Kobayashi, Yuji; Yamashita, Atsuko


    Sweet and umami tastes are perceived by T1r taste receptors in oral cavity. T1rs are class C G-protein coupled receptors (GPCRs), and the extracellular ligand binding domains (LBDs) of T1r1/T1r3 and T1r2/T1r3 heterodimers are responsible for binding of chemical substances eliciting umami or sweet taste. However, molecular analyses of T1r have been hampered due to the difficulties in recombinant expression and protein purification, and thus little is known about mechanisms for taste perception. Here we show the first molecular view of reception of a taste substance by a taste receptor, where the binding of the taste substance elicits a different conformational state of T1r2/T1r3 LBD heterodimer. Electron microscopy has showed a characteristic dimeric structure. Förster resonance energy transfer and X-ray solution scattering have revealed the transition of the dimerization manner of the ligand binding domains, from a widely spread to compactly organized state upon taste substance binding, which may correspond to distinct receptor functional states. PMID:27160511

  3. Change in the Proton T1 of Fat and Water in Mixture

    PubMed Central

    Hu, Houchun H.; Nayak, Krishna S.


    This work describes observed changes in the proton T1 relaxation time of both water and lipid when they are in relatively homogeneous mixtures. Results obtained from vegetable oil–water emulsions, pork kidney and lard mixtures, and excised samples of white and brown adipose tissues are presented to demonstrate this change in T1 as a function of mixture fat fraction. As an initial proof of concept, a simpler acetone-water experiment was performed to take advantage of complete miscibility between acetone and water and both components’ single chemical shift peaks. Single-voxel MR spectroscopy was used to measure the T1 of predominant methylene spins in fat and the T1 of water spins in each setup. In the vegetable oil–water emulsions, the T1 of fat varied by as much as 3-fold when water was the dominant mixture component. The T1 of pure lard increased by 170 msec (+37%) when it was blended with lean kidney tissue in a 16% fatty mixture. The fat T1 of lipid-rich white adipose tissue was 312 msec. In contrast, the fat T1 of leaner brown adipose tissue (fat fraction 53%) was 460 msec. A change in the water T1 from that of pure water was also observed in the experiments. PMID:19918888

  4. Effects of Transgenic Cry1Ac + CpTI Cotton on Non-Target Mealybug Pest Ferrisia virgata and Its Predator Cryptolaemus montrouzieri

    PubMed Central

    Wu, Hongsheng; Zhang, Yuhong; Liu, Ping; Xie, Jiaqin; He, Yunyu; Deng, Congshuang; De Clercq, Patrick; Pang, Hong


    Recently, several invasive mealybugs (Hemiptera: Pseudococcidae) have rapidly spread to Asia and have become a serious threat to the production of cotton including transgenic cotton. Thus far, studies have mainly focused on the effects of mealybugs on non-transgenic cotton, without fully considering their effects on transgenic cotton and trophic interactions. Therefore, investigating the potential effects of mealybugs on transgenic cotton and their key natural enemies is vitally important. A first study on the effects of transgenic cotton on a non-target mealybug, Ferrisia virgata (Cockerell) (Hemiptera: Pseudococcidae) was performed by comparing its development, survival and body weight on transgenic cotton leaves expressing Cry1Ac (Bt toxin) + CpTI (Cowpea Trypsin Inhibitor) with those on its near-isogenic non-transgenic line. Furthermore, the development, survival, body weight, fecundity, adult longevity and feeding preference of the mealybug predator Cryptolaemus montrouzieri Mulsant (Coleoptera: Coccinellidae) was assessed when fed F. virgata maintained on transgenic cotton. In order to investigate potential transfer of Cry1Ac and CpTI proteins via the food chain, protein levels in cotton leaves, mealybugs and ladybirds were quantified. Experimental results showed that F. virgata could infest this bivalent transgenic cotton. No significant differences were observed in the physiological parameters of the predator C. montrouzieri offered F. virgata reared on transgenic cotton or its near-isogenic line. Cry1Ac and CpTI proteins were detected in transgenic cotton leaves, but no detectable levels of both proteins were present in the mealybug or its predator when reared on transgenic cotton leaves. Our bioassays indicated that transgenic cotton poses a negligible risk to the predatory coccinellid C. montrouzieri via its prey, the mealybug F. virgata. PMID:24751821

  5. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.


    Jung, Sunyo; Back, Kyoungwhan


    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria. PMID:15890521

  6. Effect of the citrus lycopene β-cyclase transgene on carotenoid metabolism in transgenic tomato fruits.


    Guo, Fei; Zhou, Wenjing; Zhang, Jiancheng; Xu, Qiang; Deng, Xiuxin


    Lycopene β-cyclase (LYCB) is the key enzyme for the synthesis of β-carotene, a valuable component of the human diet. In this study, tomato constitutively express Lycb-1 was engineered. The β-carotene level of transformant increased 4.1 fold, and the total carotenoid content increased by 30% in the fruits. In the transgenic line, the downstream α-branch metabolic fluxes were repressed during the three developmental stages while α-carotene content increased in the ripe stage. Microarray analysis in the ripe stage revealed that the constitutive expression of Lycb-1 affected a number of pathways including the synthesis of fatty acids, flavonoids and phenylpropanoids, the degradation of limonene and pinene, starch and sucrose metabolism and photosynthesis. This study provided insight into the regulatory effect of Lycb-1 gene on plant carotenoid metabolism and fruit transcriptome. PMID:22384184

  7. T1- Thresholds in Black Holes Increase Clinical-Radiological Correlation in Multiple Sclerosis Patients

    PubMed Central

    Thaler, Christian; Faizy, Tobias; Sedlacik, Jan; Holst, Brigitte; Stellmann, Jan-Patrick; Young, Kim Lea; Heesen, Christoph; Fiehler, Jens; Siemonsen, Susanne


    Background Magnetic Resonance Imaging (MRI) is an established tool in diagnosing and evaluating disease activity in Multiple Sclerosis (MS). While clinical-radiological correlations are limited in general, hypointense T1 lesions (also known as Black Holes (BH)) have shown some promising results. The definition of BHs is very heterogeneous and depends on subjective visual evaluation. Objective We aimed to improve clinical-radiological correlations by defining BHs using T1 relaxation time (T1-RT) thresholds to achieve best possible correlation between BH lesion volume and clinical disability. Method 40 patients with mainly relapsing-remitting MS underwent MRI including 3-dimensional fluid attenuated inversion recovery (FLAIR), magnetization-prepared rapid gradient echo (MPRAGE) before and after Gadolinium (GD) injection and double inversion-contrast magnetization-prepared rapid gradient echo (MP2RAGE) sequences. BHs (BHvis) were marked by two raters on native T1-weighted (T1w)-MPRAGE, contrast-enhancing lesions (CE lesions) on T1w-MPRAGE after GD and FLAIR lesions (total-FLAIR lesions) were detected separately. BHvis and total-FLAIR lesion maps were registered to MP2RAGE images, and the mean T1-RT were calculated for all lesion ROIs. Mean T1 values of the cortex (CTX) were calculated for each patient. Subsequently, Spearman rank correlations between clinical scores (Expanded Disability Status Scale and Multiple Sclerosis Functional Composite) and lesion volume were determined for different T1-RT thresholds. Results Significant differences in T1-RT were obtained between all different lesion types with highest T1 values in visually marked BHs (BHvis: 1453.3±213.4 ms, total-FLAIR lesions: 1394.33±187.38 ms, CTX: 1305.6±35.8 ms; p<0.05). Significant correlations between BHvis/total-FLAIR lesion volume and clinical disability were obtained for a wide range of T1-RT thresholds. The highest correlation for BHvis and total-FLAIR lesion masks were found at T1-RT>1500 ms

  8. Can T1-rho MRI detect acetabular cartilage degeneration in femoroacetabular impingement?: a pilot study.


    Rakhra, K S; Lattanzio, P-J; Cárdenas-Blanco, A; Cameron, I G; Beaulé, P E


    Advanced MRI cartilage imaging such as T(1)-rho (T1ρ) for the diagnosis of early cartilage degradation prior to morpholgic radiological changes may provide prognostic information in the management of joint disease. This study aimed first to determine the normal T1ρ profile of cartilage within the hip, and secondly to identify any differences in T1ρ profile between the normal and symptomatic femoroacetabular impingement (FAI) hip. Ten patients with cam-type FAI (seven male and three female, mean age 35.9 years (28 to 48)) and ten control patients (four male and six female, mean age 30.6 years (22 to 35)) underwent 1.5T T1ρ MRI of a single hip. Mean T1ρ relaxation times for full thickness and each of the three equal cartilage thickness layers were calculated and compared between the groups. The mean T1ρ relaxation times for full cartilage thickness of control and FAI hips were similar (37.17 ms (SD 9.95) and 36.71 ms (SD 6.72), respectively). The control group demonstrated a T1ρ value trend, increasing from deep to superficial cartilage layers, with the middle third having significantly greater T1ρ relaxation values than the deepest third (p = 0.008). The FAI group demonstrated loss of this trend. The deepest third in the FAI group demonstrated greater T1ρ relaxation values than controls (p = 0.028). These results suggest that 1.5T T1ρ MRI can detect acetabular hyaline cartilage changes in patients with FAI. PMID:22933489

  9. Serial changes in the T1 magnetic relaxation parameter after myocardial infarction in man.

    PubMed Central

    Been, M; Smith, M A; Ridgway, J P; Douglas, R H; de Bono, D P; Best, J J; Muir, A L


    A low field resistive nuclear magnetic resonance imaging system (0.08 Tesla) was used to study the in vivo changes in the relaxation parameter T1 of the left ventricular myocardium from the first day to six months after acute myocardial infarction in 41 consecutive patients admitted to a coronary care unit. T1 maps were constructed from transverse and coronal images at various times after infarction. Thrombolytic treatment had been successful in 28 patients. Thirty three of the 34 patients studied within two weeks of infarction had a significantly increased T1 value but this developed only after the third day in four. At day 1-3 the mean (1 SD) maximum T1 was 413 (29) ms (n = 23) compared with 430 (41) ms (n = 22) at day 4-7, 433 (35) ms (n = 24) at day 8-14, 420 (34) at one month (n = 22), 388 (39) (n = 20) at three months, and 361 (24) (n = 14) at six months. The number of regions of interest with an increased T1 followed a similar time course. Although the increase in T1 measured at three months correlated with the initial maximum creatine kinase and with the left ventricular ejection fraction measured at one month, the number of regions with abnormal T1 from day 4 through to one month correlated best with left ventricular ejection fraction. There was no significant difference in T1 between patients with or without reperfusion. The rise in T1 over the first few days together with the prolonged time course of T1 increase suggests that the increase in T1 may reflect cellular infiltration as much or more than tissue oedema. Images Fig 3 PMID:3342143

  10. COPD Patients Have Short Lung Magnetic Resonance T1 Relaxation Time.


    Alamidi, Daniel F; Morgan, Alexandra R; Hubbard Cristinacce, Penny L; Nordenmark, Lars H; Hockings, Paul D; Lagerstrand, Kerstin M; Young, Simon S; Naish, Josephine H; Waterton, John C; Maguire, Niall C; Olsson, Lars E; Parker, Geoffrey J M


    Magnetic resonance imaging (MRI) may provide attractive biomarkers for assessment of pulmonary disease in clinical trials as it is free from ionizing radiation, minimally invasive and allows regional information. The aim of this study was to characterize lung MRI T1 relaxation time as a biomarker of chronic obstructive pulmonary disease (COPD); and specifically its relationship to smoking history, computed tomography (CT), and pulmonary function test (PFT) measurements in comparison to healthy age-matched controls. Lung T1 and inter-quartile range (IQR) of T1 maps from 24 COPD subjects and 12 healthy age-matched non-smokers were retrospectively analyzed from an institutional review board approved study. The subjects underwent PFTs and two separate MR imaging sessions at 1.5 tesla to test T1 repeatability. CT scans were performed on the COPD subjects. T1 repeatability (intraclass correlation coefficient) was 0.72 for repeated scans acquired on two visits. The lung T1 was significantly shorter (p < 0.0001) and T1 IQR was significantly larger (p = 0.0002) for the COPD subjects compared to healthy controls. Lung T1 significantly (p = 0.001) correlated with lung density assessed with CT. Strong significant correlations (p < 0.0001) between lung T1 and all PFT measurements were observed. Cigarette exposure did not correlate with lung T1 in COPD subjects. In conclusion, lung MRI T1 mapping shows potential as a repeatable, radiation free, non-invasive imaging technique in the evaluation of COPD. PMID:26488310


    Technology Transfer Automated Retrieval System (TEKTRAN)

    In an effort to control the variability of transgene expression in plants, we used Cre-lox mediated recombination to insert a gus reporter gene precisely and reproducibly into different target loci. Each integrant line chosen for analysis harbors a single-copy of the transgene at the designated targ...

  12. Multislice T1 -prepared 2D single-shot EPI: analysis of a clinical T1 mapping method unbiased by B0 or B1 inhomogeneity.


    Lauzon, M Louis; McCreary, Cheryl R; Frayne, Richard


    Quantitative MR imaging is as sensitive in detecting lesions as qualitative imaging, but it is potentially more specific in differentiating disease. T1 mapping in particular might help to assess acute ischemic stroke, multiple sclerosis, epilepsy and Alzheimer's disease better. Thus, a rapid and robust clinical technique is vital. In 1990, Ordidge and colleagues developed the multislice T1 -prepared two-dimensional (2D) single-shot echo planar imaging technique. Subsequent studies demonstrated its clinical viability, but none performed an in-depth analysis of the strengths and advantages of this T1 mapping method. Herein, theoretical and experimental evidence shows that the technique accounts for 2D slice profile effects and is unbiased by B0 or B1 inhomogeneity. This is verified explicitly by varying the linear shims, the T1 preparation flip angle and the excitation flip angle. Furthermore, it is shown that the repetition time (and hence scan time) can be reduced without a loss of T1 accuracy. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27331861

  13. Fertility comparison between wild type and transgenic mice by in vitro fertilization

    PubMed Central

    Vasudevan, Kuzhalini; Raber, James


    Transgenic mice are increasingly used as animal models for studies of gene function and regulation of mammalian genes. Although there has been continuous and remarkable progress in the development of transgenic technology over several decades, many aspects of the resulting transgenic model’s phenotype cannot be completely predicted. For example, it is well known that as a consequence of the random insertion of the injected DNA construct, several founder mice of the new line need to be analyzed for possible differences in phenotype secondary to different insertion sites. The Knock out technique for transgenic production disrupts a specific gene by insertion or homologous recombination creating a null expression or replacement of the gene with a marker to localize it expression. This modification could result in pleiotropic phenotype if the gene is also expressed in tissues other than the target organs. Although the future breeding performance of the newly created model is critical to many studies, it is rarely anticipated that the new integrations could modify the reproductive profile of the new transgenic line. To date, few studies have demonstrated the difference between the parent strain’s reproductive performance and the newly developed transgenic model. This study was designed to determine whether a genetic modification, knock out (KO) or transgenics, not anticipated to affect reproductive performance could affect the resulting reproductive profile of the newly developed transgenic mouse. More specifically, this study is designed to study the impact of the genetic modification on the ability of gametes to be fertilized in vitro. We analyzed the reproductive performance of mice with different background strains: FVB/N, C57BL/6 (129Sv/J × C57Bl/6)F1 and outbred CD1® and compared them to mice of the same strain carrying a transgene or KO which was not anticipated to affect fertility. In vitro Fertilization was used to analyze the fertility of the mice

  14. A built-in strategy for containment of transgenic plants: creation of selectively terminable transgenic rice.


    Lin, Chaoyang; Fang, Jun; Xu, Xiaoli; Zhao, Te; Cheng, Jiaan; Tu, Juming; Ye, Gongyin; Shen, Zhicheng


    Plant transgenic technology has been widely utilized for engineering crops for trait improvements and for production of high value proteins such as pharmaceuticals. However, the unintended spreading of commercial transgenic crops by pollination and seed dispersal is a major concern for environmental and food safety. Simple and reliable containment strategies for transgenes are highly desirable. Here we report a novel method for creating selectively terminable transgenic rice. In this method, the gene(s) of interest is tagged with a RNA interference cassette, which specifically suppresses the expression of the bentazon detoxification enzyme CYP81A6 and thus renders transgenic rice to be sensitive to bentazon, a herbicide used for rice weed control. We generated transgenic rice plants by this method using a new glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene from Pesudomonas putida as the gene of interest, and demonstrated that these transgenic rice plants were highly sensitive to bentazon but tolerant to glyphosate, which is exactly the opposite of conventional rice. Field trial of these transgenic rice plants further confirmed that they can be selectively killed at 100% by one spray of bentazon at a regular dose used for conventional rice weed control. Furthermore, we found that the terminable transgenic rice created in this study shows no difference in growth, development and yield compared to its non-transgenic control. Therefore, this method of creating transgenic rice constitutes a novel strategy of transgene containment, which appears simple, reliable and inexpensive for implementation. PMID:18350155

  15. A Built-In Strategy for Containment of Transgenic Plants: Creation of Selectively Terminable Transgenic Rice

    PubMed Central

    Zhao, Te; Cheng, Jiaan; Tu, Juming; Ye, Gongyin; Shen, Zhicheng


    Plant transgenic technology has been widely utilized for engineering crops for trait improvements and for production of high value proteins such as pharmaceuticals. However, the unintended spreading of commercial transgenic crops by pollination and seed dispersal is a major concern for environmental and food safety. Simple and reliable containment strategies for transgenes are highly desirable. Here we report a novel method for creating selectively terminable transgenic rice. In this method, the gene(s) of interest is tagged with a RNA interference cassette, which specifically suppresses the expression of the bentazon detoxification enzyme CYP81A6 and thus renders transgenic rice to be sensitive to bentazon, a herbicide used for rice weed control. We generated transgenic rice plants by this method using a new glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene from Pesudomonas putida as the gene of interest, and demonstrated that these transgenic rice plants were highly sensitive to bentazon but tolerant to glyphosate, which is exactly the opposite of conventional rice. Field trial of these transgenic rice plants further confirmed that they can be selectively killed at 100% by one spray of bentazon at a regular dose used for conventional rice weed control. Furthermore, we found that the terminable transgenic rice created in this study shows no difference in growth, development and yield compared to its non-transgenic control. Therefore, this method of creating transgenic rice constitutes a novel strategy of transgene containment, which appears simple, reliable and inexpensive for implementation. PMID:18350155

  16. Transgenic banana plants expressing Xanthomonas wilt resistance genes revealed a stable non-target bacterial colonization structure.


    Nimusiima, Jean; Köberl, Martina; Tumuhairwe, John Baptist; Kubiriba, Jerome; Staver, Charles; Berg, Gabriele


    Africa is among the continents where the battle over genetically modified crops is currently being played out. The impact of GM in Africa could potentially be very positive. In Uganda, researchers have developed transgenic banana lines resistant to banana Xanthomonas wilt. The transgenic lines expressing hrap and pflp can provide a timely solution to the pandemic. However, the impact of the transgenes expression on non-target microorganisms has not yet been investigated. To study this effect, transgenic and control lines were grown under field conditions and their associated microbiome was investigated by 16S rRNA gene profiling combining amplicon sequencing and molecular fingerprinting. Three years after sucker planting, no statistically significant differences between transgenic lines and their non-modified predecessors were detected for their associated bacterial communities. The overall gammaproteobacterial rhizosphere microbiome was highly dominated by Xanthomonadales, while Pseudomonadales and Enterobacteriales were accumulated in the pseudostem. Shannon indices revealed much higher diversity in the rhizosphere than in the pseudostem endosphere. However, the expression of the transgenes did not result in changes in the diversity of Gammaproteobacteria, the closest relatives of the target pathogen. In this field experiment, the expression of the resistance genes appears to have no consequences for non-target rhizobacteria and endophytes. PMID:26657016

  17. Transgenic banana plants expressing Xanthomonas wilt resistance genes revealed a stable non-target bacterial colonization structure

    PubMed Central

    Nimusiima, Jean; Köberl, Martina; Tumuhairwe, John Baptist; Kubiriba, Jerome; Staver, Charles; Berg, Gabriele


    Africa is among the continents where the battle over genetically modified crops is currently being played out. The impact of GM in Africa could potentially be very positive. In Uganda, researchers have developed transgenic banana lines resistant to banana Xanthomonas wilt. The transgenic lines expressing hrap and pflp can provide a timely solution to the pandemic. However, the impact of the transgenes expression on non-target microorganisms has not yet been investigated. To study this effect, transgenic and control lines were grown under field conditions and their associated microbiome was investigated by 16S rRNA gene profiling combining amplicon sequencing and molecular fingerprinting. Three years after sucker planting, no statistically significant differences between transgenic lines and their non-modified predecessors were detected for their associated bacterial communities. The overall gammaproteobacterial rhizosphere microbiome was highly dominated by Xanthomonadales, while Pseudomonadales and Enterobacteriales were accumulated in the pseudostem. Shannon indices revealed much higher diversity in the rhizosphere than in the pseudostem endosphere. However, the expression of the transgenes did not result in changes in the diversity of Gammaproteobacteria, the closest relatives of the target pathogen. In this field experiment, the expression of the resistance genes appears to have no consequences for non-target rhizobacteria and endophytes. PMID:26657016


    SciTech Connect

    O'Rourke, L.; Teyssier, D.; Kueppers, M.; Snodgrass, C.; De Val-Borro, M.; Hartogh, P.; Biver, N.; Bockelee-Morvan, D.; Hsieh, H.; Micheli, M.; Fernandez, Y.


    A new Main-Belt Comet (MBC) P/2012 T1 (PANSTARRS) was discovered on 2012 October 6, approximately one month after its perihelion, by the Pan-STARRS1 survey based in Hawaii. It displayed cometary activity upon its discovery with one hypothesis being that the activity was driven by sublimation of ices; as a result, we searched for emission assumed to be driven by the sublimation of subsurface ices. Our search was of the H{sub 2}O 1{sub 10}-1{sub 01} ground state rotational line at 557 GHz from P/2012 T1 (PANSTARRS) with the Heterodyne Instrument for the Far Infrared on board the Herschel Space Observatory on 2013 January 16, when the object was at a heliocentric distance of 2.504 AU and a geocentric distance of 2.064 AU. Perihelion was in early 2012 September at a distance of 2.411 AU. While no H{sub 2}O line emission was detected in our observations, we were able to derive sensitive 3{sigma} upper limits for the water production rate and column density of <7.63 Multiplication-Sign 10{sup 25} molecules s{sup -1} and of <1.61 Multiplication-Sign 10{sup 11} cm{sup -2}, respectively. An observation taken on 2013 January 15 using the Very Large Telescope found the MBC to be active during the Herschel observation, suggesting that any ongoing sublimation due to subsurface ice was lower than our upper limit.

  19. Determination of an upper limit for the water outgassing rate of main-belt comet P/2012 T1 (PANSTARRS)

    NASA Astrophysics Data System (ADS)

    O'Rourke, Laurence; Snodgrass, Colin; de Val-Borro, Miguel; Biver, Nicolas; Bockelée-Morvan, Dominique; Hsieh, Henry; Teyssier, David; Fernandez, Yan; Küppers, Michael; Micheli, Marco; Hartogh, Paul


    A new Main-Belt Comet (MBC) P/2012 T1 (PANSTARRS) was discovered on 2012 October 6, approximately one month after its perihelion, by the Pan-STARRS1 survey based in Hawaii (Wainscoat et al. 2012). It displayed cometary activity upon its discovery with one hypothesis being that the activity was driven by sublimation of ices; as a result, we searched for emission assumed to be driven by the sublimation of subsurface ices. Our search was of the H2O 110--101 ground state rotational line at 557 GHz from P/2012 T1 (PANSTARRS) with the Heterodyne Instrument for the Far Infrared (HIFI; de Graauw et al. 2010) on board the Herschel Space Observatory (Pilbratt et al, 2010) on 2013 January 16, when the object was at a heliocentric distance of 2.504 AU and a distance from Herschel of 2.059 AU. Perihelion was in early 2012 September at a heliocentric distance of 2.411 AU. To analyse the data we used a molecular excitation model equivalent to that utilized to analyze both Herschel and ground-based cometary observations (Hartogh et al. 2010, 2011; de Val-Borro et al. 2010, 2012a, 2012b). While no H2O line emission was detected in our observations, we were able to derive sensitive 3sigma upper limits for the water production rate and column density of

  20. Effects of Transgenic cry1Ca Rice on the Development of Xenopus laevis

    PubMed Central

    Zhu, Haojun; Li, Yunhe; Ding, Jiatong; Peng, Yufa


    In fields of genetically modified, insect-resistant rice expressing Bacillus thuringiensis (Bt) proteins, frogs are exposed to Bt Cry proteins by consuming both target and non-target insects, and through their highly permeable skin. In the present study, we assessed the potential risk posed by transgenic cry1Ca rice (T1C-19) on the development of a frog species by adding purified Cry1Ca protein or T1C-19 rice straw into the rearing water of Xenopus laevis tadpoles, and by feeding X. laevis froglets diets containing rice grains of T1C-19 or its non-transformed counterpart MH63. Our results showed that there were no significant differences among groups receiving 100 μg L–1 or 10 μg L–1 Cry1Ca and the blank control in terms of time to completed metamorphosis, survival rate, body weight, body length, organ weight and liver enzyme activity after being exposed to the Cry1Ca (P > 0.05). Although some detection indices in the rice straw groups were significantly different from those of the blank control group (P < 0.05), there was no significant difference between the T1C-19 and MH63 rice straw groups. Moreover, there were no significant differences in the mortality rate, body weight, daily weight gain, liver and fat body weight of the froglets between the T1C-19 and MH63 dietary groups after 90 days, and there were no abnormal pathological changes in the stomach, intestines, livers, spleens and gonads. Thus, we conclude that the planting of transgenic cry1Ca rice will not adversely affect frog development. PMID:26695426

  1. Strain-dependent T1 Relaxation Profiles in Articular Cartilage by MRI at Microscopic Resolutions

    PubMed Central

    Xia, Yang; Wang, Nian; Lee, Jihyun; Badar, Farid


    To investigate the dependency of T1 relaxation on mechanical strain in articular cartilage, quantitative MRI T1 imaging experiments were carried out on cartilage before/after the tissue was immersed in gadolinium contrast agent and when the tissue was being compressed (up to ~ 48% strains). The spatial resolution across the cartilage depth was 17.6μm. The T1 profile in native tissue (without the presence of gadolinium ions) was strongly strain-dependent, which is also depth-dependent. At the modest strains (e.g., 14% strain), T1 reduced by up to 68% in the most surface portion of the tissue. Further compression (e.g., 45% strain) reduced T1 mostly in the middle and deep portions of the tissue. For the gadolinium-immersed tissue, both modest and heavy compressions (up to 48% strain) increased T1 slightly but significantly, although the overall shapes of the T1 profiles remained approximately the same regardless of the amount of strains. The complex relationships between the T1 profiles and the mechanical strains were a direct consequence of the depth-dependent proteoglycan concentration in the tissue, which determined the tissue’s mechanical properties. This finding has potential implications in the use of gadolinium contrast agent in clinical MRI of cartilage (the dGEMRIC procedure), when the loading or loading history of patients is considered. PMID:21452280

  2. Enzyme inhibitors to increase poly-3-hydroxybutyrate production by transgenic tobacco.


    Suzuki, Yoshikatsu; Kurano, Minoru; Arai, Yuko; Nakashita, Hideo; Doi, Yoshiharu; Usami, Ron; Horikoshi, Kohki; Yamaguchi, Isamu


    Chemical regulation of secondary-metabolite synthesis was investigated through the improvement of poly-3-hydroxybutyrate (PHB) production in transgenic tobacco plants by the use of enzyme inhibitors. Two tobacco lines, BC3 and rCAB8, that produce PHB in both the cytosol and plastids were used. An acetyl-CoA carboxylase inhibitor, D-(+)-Quizalofop-ethyl, increased PHB accumulation in both lines 2-fold. The accumulation rate of plastidial PHB in the rCAB8 line was 2.5-fold higher than that of cytosolic PHB in the BC3 line. A specific inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase, mevastatin, also increased PHB accumulation but only in the BC3 line. These results indicated that chemical regulation of the native metabolic flows by the specific enzyme inhibitors increased secondary-metabolite production in the transgenic tobacco plants we used. PMID:12596845

  3. Impact of the ahas transgene for herbicides resistance on biological nitrogen fixation and yield of soybean.


    Hungria, Mariangela; Nakatani, André Shigueyoshi; Souza, Rosinei Aparecida; Sei, Fernando Bonafé; de Oliveira Chueire, Ligia Maria; Arias, Carlos Arrabal


    Studies on the effects of transgenes in soybean [Glycine max (L.) Merr.] and the associated use of specific herbicides on biological nitrogen fixation (BNF) are still few, although it is important to ensure minimal impacts on benefits provided by the root-nodule symbiosis. Cultivance CV127 transgenic soybean is a cultivar containing the ahas gene, which confers resistance to herbicides of the imidazolinone group. The aim of this study was to assess the effects of the ahas transgene and of imidazolinone herbicide on BNF parameters and soybean yield. A large-scale set of field experiments was conducted, for three cropping seasons, at nine sites in Brazil, with a total of 20 trials. The experiment was designed as a completely randomized block with four replicates and the following treatments: (T1) near isogenic transgenic soybean (Cultivance CV127) + herbicide of the imidazolinone group (imazapyr); (T2) near isogenic transgenic soybean + conventional herbicides; and (T3) parental conventional soybean (Conquista) + conventional herbicides; in addition, two commercial cultivars were included, Monsoy 8001 (M-SOY 8001) (T4), and Coodetec 217 (CD 217) (T5). At the R2 growth stage, plants were collected and BNF parameters evaluated. In general, there were no effects on BNF parameters due to the transgenic trait or associated with the specific herbicide. Similarly, at the final harvest, no grain-yield effects were detected related to the ahas gene or to the specific herbicide. However, clear effects on BNF and grain yield were attributed to location and cropping season. PMID:25201300

  4. Loss of PiT-1 Results in Abnormal Endocytosis in the Yolk Sac Visceral Endoderm

    PubMed Central

    Wallingford, Mary C.; Giachelli, Cecilia M.


    PiT-1 protein is a transmembrane sodium-dependent phosphate (Pi) transporter. PiT-1 knock out (KO) embryos die from largely unknown causes by embryonic day (E) 12.5. We tested the hypothesis that PiT-1 is required for endocytosis in the embryonic yolk sac (YS) visceral endoderm (VE). Here we present data supporting that PiT-1 KO results in a YS remodeling defect and decreased endocytosis in the YS VE. The remodeling defect is not due to an upstream cardiomyocyte requirement for PiT-1, as SM22αCre-specific KO of PiT-1 in the developing heart and the YS mesodermal layer (ME) does not recapitulate the PiT-1 global KO phenotype. Furthermore, we find that high levels of PiT-1 protein localize to the YS VE apical membrane. Together these data support that PiT-1 is likely required in YS VE. During normal development maternal immunoglobulin (IgG) is endocytosed into YS VE and accumulates in the apical side of the VE in a specialized lysosome termed the apical vacuole (AV). We have identified a reduction in PiT-1 KO VE cell height and a striking loss of IgG accumulation in the PiT-1 KO VE. The endocytosis genes Tfeb, Lamtor2 and Snx2 are increased at the RNA level. Lysotracker Red staining reveals a loss of distinct AVs, and yolk sacs incubated ex vivo with phRODO Green Dextran for Endocytosis demonstrate a functional loss of endocytosis. As yolk sac endocytosis is controlled in part by microautophagy, but expression of LC3 had not been examined, we investigated LC3 expression during yolk sac development and found stage-specific LC3 RNA expression that is predominantly from the YS VE layer at E9.5. Normalized LC3-II protein levels are decreased in the PiT-1 KO YS, supporting a requirement for PiT-1 in autophagy in the YS. Therefore, we propose the novel idea that PiT-1 is central to the regulation of endocytosis and autophagy in the YS VE. PMID:25138534

  5. Dispersion of T1 and T2 nuclear magnetic resonance relaxation in crude oils.


    Chen, Joseph J; Hürlimann, Martin; Paulsen, Jeffrey; Freed, Denise; Mandal, Soumyajit; Song, Yi-Qiao


    Crude oils, which are complex mixtures of hydrocarbons, can be characterized by nuclear magnetic resonance diffusion and relaxation methods to yield physical properties and chemical compositions. In particular, the field dependence, or dispersion, of T1 relaxation can be used to investigate the presence and dynamics of asphaltenes, the large molecules primarily responsible for the high viscosity in heavy crudes. However, the T2 relaxation dispersion of crude oils, which provides additional insight when measured alongside T1, has yet to be investigated systematically. Here we present the field dependence of T1-T2 correlations of several crude oils with disparate densities. While asphaltene and resin-containing crude oils exhibit significant T1 dispersion, minimal T2 dispersion is seen in all oils. This contrasting behavior between T1 and T2 cannot result from random molecular motions, and thus, we attribute our dispersion results to highly correlated molecular dynamics in asphaltene-containing crude oils. PMID:24919743

  6. T 1 Relaxation Measurement of Ex-Vivo Breast Cancer Tissues at Ultralow Magnetic Fields

    PubMed Central

    Lee, Seong-Joo; Shim, Jeong Hyun; Kim, Kiwoong; Hwang, Seong-min; Yu, Kwon Kyu; Lim, Sanghyun; Han, Jae Ho; Yim, Hyunee; Kim, Jang-Hee; Jung, Yong Sik; Kim, Ku Sang


    We investigated T1 relaxations of ex-vivo cancer tissues at low magnetic fields in order to check the possibility of achieving a T1 contrast higher than those obtained at high fields. The T1 relaxations of fifteen pairs (normal and cancerous) of breast tissue samples were measured at three magnetic fields, 37, 62, and 122 μT, using our superconducting quantum interference device-based ultralow field nuclear magnetic resonance setup, optimally developed for ex-vivo tissue studies. A signal reconstruction based on Bayesian statistics for noise reduction was exploited to overcome the low signal-to-noise ratio. The ductal and lobular-type tissues did not exhibit meaningful T1 contrast values between normal and cancerous tissues at the three different fields. On the other hand, an enhanced T1 contrast was obtained for the mucinous cancer tissue. PMID:25705658

  7. Transgenic Models in Retinoblastoma Research

    PubMed Central

    Nair, Rohini M.; Vemuganti, Geeta K.


    Understanding the mechanism of retinoblastoma (Rb) tumor initiation, development, progression and metastasis in vivo mandates the use of animal models that mimic this intraocular tumor in its genetic, anatomic, histologic and ultrastructural features. An early setback for developing mouse Rb models was that Rb mutations did not cause tumorigenesis in murine retinas. Subsequently, the discovery that the p107 protein takes over the role of pRb in mice led to the development of several animal models that phenotypically and histologically resemble the human form. This paper summarizes the transgenic models that have been developed over the last three decades. PMID:27171579

  8. Transgenic Models in Retinoblastoma Research.


    Nair, Rohini M; Vemuganti, Geeta K


    Understanding the mechanism of retinoblastoma (Rb) tumor initiation, development, progression and metastasis in vivo mandates the use of animal models that mimic this intraocular tumor in its genetic, anatomic, histologic and ultrastructural features. An early setback for developing mouse Rb models was that Rb mutations did not cause tumorigenesis in murine retinas. Subsequently, the discovery that the p107 protein takes over the role of pRb in mice led to the development of several animal models that phenotypically and histologically resemble the human form. This paper summarizes the transgenic models that have been developed over the last three decades. PMID:27171579

  9. The Rb7 Matrix Attachment Region Increases the Likelihood and Magnitude of Transgene Expression in Tobacco Cells: A Flow Cytometric Study

    PubMed Central

    Halweg, Christopher; Thompson, William F.; Spiker, Steven


    Many studies in both plant and animal systems have shown that matrix attachment regions (MARs) can increase expression of transgenes in whole organisms or cells in culture. Because histochemical assays often indicate variegated transgene expression, a question arises: Do MARs increase transgene expression by increasing the percentage of cells expressing the transgene (likelihood), by increasing the level of expression in expressing cells (magnitude), or both? To address this question, we used flow cytometry to measure green fluorescent protein (GFP) expression in individual tobacco (Nicotiana tabacum) cells from lines transformed by Agrobacterium tumefaciens. We conclude that MAR-mediated overall increases in transgene expression involve both likelihood and magnitude. On average, cell lines transformed with the Rb7 MAR-containing vector expressed GFP at levels 2.0- to 3.7-fold higher than controls. MAR lines had fewer nonexpressing cells than control lines (10% versus 45%), and the magnitude of GFP expression in expressing cells was greater in MAR lines by 1.9- to 2.9-fold. We also show that flow cytometry measurements on cells from isogenic lines are consistent with those from populations of independently transformed cell lines. By obviating the need to establish isogenic lines, this use of flow cytometry could greatly simplify the evaluation of MARs or other sequence elements that affect transgene expression. PMID:15659622

  10. Aspirin Breaks the Crosstalk between 3T3-L1 Adipocytes and 4T1 Breast Cancer Cells by Regulating Cytokine Production.


    Hsieh, Chia-Chien; Huang, Yu-Shan


    Breast cancer is one of the most common cancers in women worldwide. The obesity process is normally accompanied by chronic, low-grade inflammation. Infiltration by inflammatory cytokines and immune cells provides a favorable microenvironment for tumor growth, migration, and metastasis. Epidemiological evidence has shown that aspirin is an effective agent against several types of cancer. The aim of this study is to investigate the anti-inflammatory and anti-cancer effects of aspirin on 3T3-L1 adipocytes, 4T1 murine breast cancer cells, and their crosstalk. The results showed that aspirin treatment inhibited differentiation and lipid accumulation by 3T3-L1 preadipocytes, and decreased the secretion of the inflammatory adipokine MCP-1 after stimulation with tumor necrosis factor (TNF)-α or conditioned medium from RAW264.7 cells. In 4T1 cells, treatment with aspirin decreased cell viability and migration, possibly by suppressing MCP-1 and VEGF secretion. Subsequently, culture of 4T1 cells in 3T3-L1 adipocyte-conditioned medium (Ad-CM) and co-culture of 3T3-L1 and 4T1 cells using a transwell plate were performed to clarify the relationship between these two cell lines. Aspirin exerted its inhibitory effects in the transwell co-culture system, as well as the conditioned-medium model. Aspirin treatment significantly inhibited the proliferation of 4T1 cells, and decreased the production of MCP-1 and PAI-1 in both the Ad-CM model and co-culture system. Aspirin inhibited inflammatory MCP-1 adipokine production by 3T3-L1 adipocytes and the cell growth and migration of 4T1 cells. It also broke the crosstalk between these two cell lines, possibly contributing to its chemopreventive properties in breast cancer. This is the first report that aspirin's chemopreventive activity supports the potential application in auxiliary therapy against obesity-related breast cancer development. PMID:26794215

  11. Transgenic songbirds with suppressed or enhanced activity of CREB transcription factor.


    Abe, Kentaro; Matsui, Sumiko; Watanabe, Dai


    Songbirds postnatally develop their skill to utter and to perceive a vocal signal for communication. How genetic and environmental influences act in concert to regulate the development of such skill is not fully understood. Here, we report the phenotype of transgenic songbirds with altered intrinsic activity of cAMP response element-binding protein (CREB) transcription factor. By viral vector-mediated modification of genomic DNA, we established germ line-transmitted lines of zebra finches, which exhibited enhanced or suppressed activity of CREB. Although intrinsically acquired vocalizations or their hearing ability were not affected, the transgenic birds showed reduced vocal learning quality of their own songs and impaired audio-memory formation against conspecific songs. These results thus demonstrate that appropriate activity of CREB is necessary for the postnatal acquisition of learned behavior in songbirds, and the CREB transgenic birds offer a unique opportunity to separately manipulate both genetic and environmental factors that impinge on the postnatal song learning. PMID:26048905

  12. Virus-Neutralizing Monoclonal Antibody Expressed in Milk of Transgenic Mice Provides Full Protection against Virus-Induced Encephalitis

    PubMed Central

    Kolb, Andreas F.; Pewe, Lecia; Webster, John; Perlman, Stanley; Whitelaw, C. Bruce A.; Siddell, Stuart G.


    Neutralizing antibodies represent a major host defense mechanism against viral infections. In mammals, passive immunity is provided by neutralizing antibodies passed to the offspring via the placenta or the milk as immunoglobulin G and secreted immunoglobulin A. With the long-term goal of producing virus-resistant livestock, we have generated mice carrying transgenes that encode the light and heavy chains of an antibody that is able to neutralize the neurotropic JHM strain of murine hepatitis virus (MHV-JHM). MHV-JHM causes acute encephalitis and acute and chronic demyelination in susceptible strains of mice and rats. Transgene expression was targeted to the lactating mammary gland by using the ovine β-lactoglobulin promoter. Milk from these transgenic mice contained up to 0.7 mg of recombinant antibody/ml. In vitro analysis of milk derived from different transgenic lines revealed a linear correlation between antibody expression and virus-neutralizing activity, indicating that the recombinant antibody is the major determinant of MHV-JHM neutralization in murine milk. Offspring of transgenic and control mice were challenged with a lethal dose of MHV-JHM. Litters suckling nontransgenic dams succumbed to fatal encephalitis, whereas litte