Science.gov

Sample records for t1 transgenic lines

  1. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A two-year field trial was conducted to assess the impacts of two transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. The arthropods were classified into five guilds, including herbivores, parasitoids, predators...

  2. No direct effects of two transgenic Bt rice lines, T1C-19 and T2A-1, on the arthropod communities.

    PubMed

    Lu, Z B; Tian, J C; Han, N S; Hu, C; Peng, Y F; Stanley, David; Ye, G Y

    2014-10-01

    A 2-yr field trial was conducted to assess the impacts of two new transgenic Bt rice lines, T1C-19 expressing Cry1C protein and T2A-1 expressing Cry2A protein, on the arthropod community sampled via vacuum. All the arthropods were classified into five guilds, including herbivores, parasitoids, predators, detritivores, and others. The seasonal density and dominance distribution of each guild and community-level indices (species richness, Shannon-Wiener diversity index, Simpson diversity index, and evenness index) were compared among rice types. Principal response curves were used to investigate the differences of entire arthropod community of Bt rice plots relative to non-Bt rice plots. The results showed no significant difference was detected in the community-level indices and dominance distribution of guilds between Bt and non-Bt rice plots. The seasonal density of herbivores, detritivores, and others as well as density of the arthropod overall community were also not significantly affected by rice types in either year, although the density of predators and parasitoids in Bt rice plots was significantly lower than those in non-Bt rice plots. The lower abundances of Braconidae, Eulophidae, Cyrtorhinus lividipennis (Reuter) (Hemiptera: Miridae), and Theridiidae in Bt rice plots are likely attributed to the lower abundances of prey species or hosts. Principal response curves revealed that arthropod community in Bt was similar with that in non-Bt rice plots. In conclusion, our findings indicate that these two tested Bt rice lines had no marked negative effects on the arthropod community in the paddy fields.

  3. Transgenic cry1C(⁎) gene rough rice line T1C-19 does not change the host preferences of the non-target stored product pest, Rhyzopertha dominica (Fabricius) (Coleoptera: Bostrichidae), and its parasitoid wasp, Anisopteromalus calandrae (Howard) (Hymenoptera: Pteromalidae).

    PubMed

    Sun, Xiao; Yan, Miao-Jun; Zhang, Aijun; Wang, Man-Qun

    2015-10-01

    Rough rice grains are often stored for extended periods before they are used or consumed. However, during storage, the rough rice is vulnerable to insect infestation, resulting in significant economic loss. Previous studies have shown that volatiles cues, physical characteristics, and taste chemicals on the grains could be the important key behavior factors for storage insect pests to locate the hosts and select oviposition sites. It is also well known that the transgenic Bt rough rice line T1C-19, which expresses a cry1C(⁎) gene has a high resistance to Lepidoptera pests. However, there were no evidences to show the consequences of host preference for non-target insect pests after growing Bt transgenic rice. In this study, the potential key factors of Bt rough rice were investigated for their impacts on the behaviors of non-target pest lesser grain borer Rhyzopertha dominica, the main weevil pest of grain and its parasitic wasps Anisopteromalus calandrae, the natural enemy of the beetle. Both electronic nose and electronic tongue analyses showed that the parameters of Bt rough rice were analogous to those of the non-Bt rough rice. The volatile profiles of Bt and non-Bt rough rice examined by gas chromatographic mass spectrometry (GC-MS) were similar. For most volatile compounds, there were no significantly quantitative differences in compound quantities between Bt and non-Bt rough rice. The densities of sclereids and trichomes on the rough rice husk surface were statistically equal in Bt and non-Bt rough rice. The non-target pest, R. dominica, and its parasitoid wasp, A. calandrae, were attracted to both rough rice and could not distinguish the transgenic T1C-19 from the isogenic rough rice. These results demonstrated that Bt rough rice has no negative impacts on the host preference behaviors of non-target stored product pest R. dominica and its parasitoid A. calandrae.

  4. Transgenic American chestnuts show enhanced blight resistance and transmit the trait to T1 progeny.

    PubMed

    Newhouse, Andrew E; Polin-McGuigan, Linda D; Baier, Kathleen A; Valletta, Kristia E R; Rottmann, William H; Tschaplinski, Timothy J; Maynard, Charles A; Powell, William A

    2014-11-01

    American chestnut (Castanea dentata) is a classic example of a native keystone species that was nearly eradicated by an introduced fungal pathogen. This report describes progress made toward producing a fully American chestnut tree with enhanced resistance to the blight fungus (Cryphonectria parasitica). The transgenic American chestnut 'Darling4,' produced through an Agrobacterium co-transformation procedure to express a wheat oxalate oxidase gene driven by the VspB vascular promoter, shows enhanced blight resistance at a level intermediate between susceptible American chestnut and resistant Chinese chestnut (Castanea mollissima). Enhanced resistance was identified first with a leaf-inoculation assay using young chestnuts grown indoors, and confirmed with traditional stem inoculations on 3- and 4-year-old field-grown trees. Pollen from 'Darling4' and other events was used to produce transgenic T1 seedlings, which also expressed the enhanced resistance trait in leaf assays. Outcrossed transgenic seedlings have several advantages over tissue-cultured plantlets, including increased genetic diversity and faster initial growth. This represents a major step toward the restoration of the majestic American chestnut.

  5. Proatherogenic Abnormalities Of Lipid Metabolism In SirT1 Transgenic Mice Are Mediated Through Creb Deacetylation

    PubMed Central

    Qiang, Li; Lin, Hua V.; Kim-Muller, Ja Young; Welch, Carrie L.; Gu, Wei; Accili, Domenico

    2011-01-01

    SUMMARY Dyslipidemia and atherosclerosis are associated with reduced insulin sensitivity and diabetes, but the mechanism is unclear. Gain-of-function of the gene encoding deacetylase SirT1 improves insulin sensitivity, and could be expected to protect against lipid abnormalities. Surprisingly, when transgenic mice overexpressing SirT1 (SirBACO) are placed on atherogenic diet, they maintain better glucose homeostasis, but develop worse lipid profiles and larger atherosclerotic lesions than controls. We show that transcription factor cAMP response element binding protein (Creb) is deacetylated in SirBACO mice. We identify Lys136 is a substrate for SirT1-dependent deacetylation that affects Creb activity by preventing its cAMP-dependent phosphorylation, leading to reduced expression of glucogenic genes, and promoting hepatic lipid accumulation and secretion. Expression of constitutively acetylated Creb (K136Q) in SirBACO mice mimics Creb activation and abolishes the dyslipidemic and insulin-sensitizing effects of SirT1 gain-of-function. We propose that SirT1-dependent Creb deacetylation regulates the balance between glucose and lipid metabolism, integrating fasting signals. PMID:22078933

  6. Transgene integration and chromosome alterations in two transgenic lines of tritordeum.

    PubMed

    Barro, F; Martín, A; Cabrera, A

    2003-01-01

    Plants from two transgenic lines of tritordeum (an amphiploid between Triticum turgidum cv. durum and Hordeumn chilense) have been analyzed by fluorescence in-situ hybridization (FISH) to characterize the transgene integration sites and chromosome rearrangements. Transgenic lines were transformed in two different events with the genes encoding for the high-molecular-weight glutenin subunits (HMW-GS), 1Ax1 and/or 1Dx5. Three integration sites and four translocations were detected. All three integration sites were located on chromosome segments of Hordeum chilense translocated into wheat chromosomes. No translocations from wheat into H. chilense chromosomes were observed. Both HMW-GS transgenes were expressed at high levels in the endosperm of transgenic plants. The analysis by FISH of transgenic plants allowed the early detection of homozygous and heterozygous plants. The consequences and implications of translocations on breeding are discussed.

  7. Development of stem borer resistant transgenic parental lines involved in the production of hybrid rice.

    PubMed

    Ramesh, S; Nagadhara, D; Pasalu, I C; Kumari, A Padma; Sarma, N P; Reddy, V D; Rao, K V

    2004-07-15

    Stem borer resistant transgenic parental lines, involved in hybrid rice, were produced by Agrobacterium-mediated gene transfer method. Two pSB111 super-binary vectors containing modified cry1Ab/cry1Ac genes driven by maize ubiquitin promoter, and herbicide resistance gene bar driven by cauliflower mosaic virus 35S promoter were, used in this study. Embryogenic calli after co-cultivation with Agrobacterium were selected on the medium containing phosphinothricin. Southern blot analyses of primary transformants revealed the stable integration of bar, cry1Ab and cry1Ac coding sequences into the genomes of three parental lines with a predominant single copy integration and without any rearrangement of T-DNA. T1 progeny plants disclosed a monogenic pattern (3:1) of transgene segregation as confirmed by molecular analyses. Furthermore, the co-segregation of bar and cry genes in T1 progenies suggested that the transgenes are integrated at a single site in the rice genome. In different primary transformants with alien inbuilt resistance, the levels of cry proteins varied between 0.03 and 0.13% of total soluble proteins. These transgenic lines expressing insecticidal proteins afforded substantial resistance against stem borers. This is the first report of its kind dealing with the introduction of Bacillus thuringiensis (Bt) cry genes into the elite parental lines involved in the development of hybrid rice.

  8. Response of sensitive human ataxia and resistant T-1 cell lines to accelerated heavy ions

    SciTech Connect

    Tobias, C.A.; Blakely, E.A.; Chang, P.Y.; Lommel, L.; Roots, R.

    1983-07-01

    The radiation dose responses of fibroblast from a patient with Ataxia telangiectasis (AT-2SF) and an established line of human T-1 cells were studied. Nearly monoenergetic accelerated neon and argon ions were used at the Berkeley Bevalac with various residual range values. The LET of the particles varied from 30 keV/..mu..m to over 1000 keV/..mu..m. All Ataxia survival curves were exponential functions of the dose. Their radiosensitivity reached peak values at 100 to 200 keV/..mu..m. Human T-1 cells have effective sublethal damage repair as has been evidenced by split dose experiments, and they are much more resistant to low LET than to high LET radiation. The repair-misrepair model has been used to interpret these results. We have obtained mathematical expressions that describe the cross sections and inactivation coefficients for both human cell lines as a function of the LET and the type of particle used. The results suggest either that high-LET particles induce a greater number of radiolesions per track or that heavy-ions at high LET induce lesions that kill cells more effectively and that are different from those produced at low LET. We assume that the lesions induced in T-1 and Ataxia cells are qualitatively similar and that each cell line attempts to repair these lesions. The result in most irradiated Ataxia cells, however, is either lethal misrepair or incomplete repair leading to cell death. 63 references, 10 figures, 1 table.

  9. Skin Fibroblasts from Patients with Type 1 Diabetes (T1D) Can Be Chemically Transdifferentiated into Insulin-Expressing Clusters: A Transgene-Free Approach

    PubMed Central

    Pereyra-Bonnet, Federico; Gimeno, María L.; Argumedo, Nelson R.; Ielpi, Marcelo; Cardozo, Johana A.; Giménez, Carla A.; Hyon, Sung-Ho; Balzaretti, Marta; Loresi, Mónica; Fainstein-Day, Patricia; Litwak, León E.; Argibay, Pablo F.

    2014-01-01

    The conversion of differentiated cells into insulin-producing cells is a promising approach for the autologous replacement of pancreatic cells in patients with type 1 diabetes (T1D). At present, cellular reprogramming strategies encompass ethical problems, epigenetic failure or teratoma formation, which has prompted the development of new approaches. Here, we report a novel technique for the conversion of skin fibroblasts from T1D patients into insulin-expressing clusters using only drug-based induction. Our results demonstrate that skin fibroblasts from diabetic patients have pancreatic differentiation capacities and avoid the necessity of using transgenic strategies, stem cell sources or global demethylation steps. These findings open new possibilities for studying diabetes mechanisms, drug screenings and ultimately autologous transgenic-free regenerative medicine therapies in patients with T1D. PMID:24963634

  10. Hybridization of downregulated-COMT transgenic switchgrass lines with field-selected switchgrass for improved biomass traits

    DOE PAGES

    Baxter, Holly L.; Alexander, Lisa W.; Mazarei, Mitra; ...

    2016-01-21

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. For instance, downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In this present study we sought to further improve biomass characteristics by crossing the downregulated COMT T1 lines with high-yielding switchgrass accessions in two genetic backgrounds ('Alamo' and 'Kanlow'). Crosses and T2 progeny analyses were made under greenhouse conditions to assess maternal effects, plant morphology and yield, and cell wall traits. Female parent type influenced morphology, but had no effect on cell wall traits. T2 hybrids producedmore » with T1 COMT-downregulated switchgrass as the female parent were taller, produced more tillers, and produced 63% more biomass compared with those produced using the field selected accession as the female parent. Transgene status (presence or absence of transgene) influenced both growth and cell wall traits. T2 transgenic hybrids were 7% shorter 80 days after sowing and produced 43% less biomass than non-transgenic null-segregant hybrids. Cell wall-related differences included lower lignin content, reduced syringyl-to-guaiacyl (S/G) lignin monomer ratio, and a 12% increase in total sugar release in the T2 transgenic hybrids compared to non-transgenic null segregants. This is the first study to evaluate the feasibility of transferring the low-recalcitrance traits associated with a transgenic switchgrass line into high-yielding field varieties in an attempt to improve growth-related traits. Lastly, our results provide insights into the possible improvement of switchgrass productivity via biotechnology paired with plant breeding.« less

  11. Hybridization of downregulated-COMT transgenic switchgrass lines with field-selected switchgrass for improved biomass traits

    SciTech Connect

    Baxter, Holly L.; Alexander, Lisa W.; Mazarei, Mitra; Haynes, Ellen; Turner, Geoffrey B.; Sykes, Robert W.; Decker, Stephen R.; Davis, Mark F.; Dixon, Richard A.; Wang, Zeng-Yu; Neal Stewart, C.

    2016-01-21

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. For instance, downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further improve biomass characteristics by crossing the downregulated COMT T1 lines with high-yielding switchgrass accessions in two genetic backgrounds ('Alamo' and 'Kanlow'). Crosses and T2 progeny analyses were made under greenhouse conditions to assess maternal effects, plant morphology and yield, and cell wall traits. Female parent type influenced morphology, but had no effect on cell wall traits. T2 hybrids produced with T1 COMT-downregulated switchgrass as the female parent were taller, produced more tillers, and produced 63% more biomass compared with those produced using the field selected accession as the female parent. Transgene status (presence or absence of transgene) influenced both growth and cell wall traits. T2 transgenic hybrids were 7% shorter 80 days after sowing and produced 43% less biomass than non-transgenic null-segregant hybrids. Cell wall-related differences included lower lignin content, reduced syringyl-to-guaiacyl (S/G) lignin monomer ratio, and a 12% increase in total sugar release in the T2 transgenic hybrids compared to non-transgenic null segregants. This is the first study to evaluate the feasibility of transferring the low-recalcitrance traits associated with a transgenic switchgrass line into high-yielding field varieties in an attempt to improve growth-related traits. Our results provide insights into the possible improvement of switchgrass productivity via biotechnology paired with plant breeding.

  12. Host status of three transgenic plum lines to Mesocriconema xenoplax

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gastrodianin anti-fungal protein (GAFP) increases tolerance against Phytophthora root rot and root knot nematode (Meloidogyne incognita) in transgenic plum lines. However, nothing is known about the potential of GAFP lectin to confer resistance to the ring nematode Mesocriconema xenoplax. Three t...

  13. Case Study: Polycystic Livers in a Transgenic Mouse Line

    SciTech Connect

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.; Diekwisch, Thomas G. H.; Ito, Yoshihiro; Fortman, Jeffrey D.

    2014-04-01

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycystic livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.

  14. Accumulation of nickel in transgenic tobacco

    NASA Astrophysics Data System (ADS)

    Sidik, Nik Marzuki; Othman, Noor Farhan

    2013-11-01

    The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TF<1) at all levels of metal treatment. Among the 4 transgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

  15. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer.

    PubMed

    Silva, Vera L; Ferreira, Debora; Nobrega, Franklin L; Martins, Ivone M; Kluskens, Leon D; Rodrigues, Ligia R

    2016-01-01

    The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line- 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 -CPTASNTSC and 4T1pep2-EVQSSKFPAHVS) were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy.

  16. Selection of Novel Peptides Homing the 4T1 CELL Line: Exploring Alternative Targets for Triple Negative Breast Cancer

    PubMed Central

    Nobrega, Franklin L.; Martins, Ivone M.

    2016-01-01

    The use of bacteriophages to select novel ligands has been widely explored for cancer therapy. Their application is most warranted in cancer subtypes lacking knowledge on how to target the cancer cells in question, such as the triple negative breast cancer, eventually leading to the development of alternative nanomedicines for cancer therapeutics. Therefore, the following study aimed to select and characterize novel peptides for a triple negative breast cancer murine mammary carcinoma cell line– 4T1. Using phage display, 7 and 12 amino acid random peptide libraries were screened against the 4T1 cell line. A total of four rounds, plus a counter-selection round using the 3T3 murine fibroblast cell line, was performed. The enriched selective peptides were characterized and their binding capacity towards 4T1 tissue samples was confirmed by immunofluorescence and flow cytometry analysis. The selected peptides (4T1pep1 –CPTASNTSC and 4T1pep2—EVQSSKFPAHVS) were enriched over few rounds of selection and exhibited specific binding to the 4T1 cell line. Interestingly, affinity to the human MDA-MB-231 cell line was also observed for both peptides, promoting the translational application of these novel ligands between species. Additionally, bioinformatics analysis suggested that both peptides target human Mucin-16. This protein has been implicated in different types of cancer, as it is involved in many important cellular functions. This study strongly supports the need of finding alternative targeting systems for TNBC and the peptides herein selected exhibit promising future application as novel homing peptides for breast cancer therapy. PMID:27548261

  17. Inheritance of transgenes in transgenic Bt lines resistance to Helicoerpa armigera in upland cotton.

    PubMed

    Zhang, Baolong; Guo, Wangzhen; Zhang, Tianzhen

    2013-01-01

    Six transgenic Bt cotton cultivars (lines) including GKsu12, GK19, MR1, GK5, 109B, and SGK1 are highly resistant to bollworm from the seedling to boll-setting stages in bioassays with detached cotton leaves, though there are differences in resistant level and Bt toxin content in these transgenic cottons. Genetics analysis reveals that the resistance to Helicoverpa armigera in these six transgenic Bt cotton cultivars (lines) are controlled by one pair of dominant genes. Allelic tests further demonstrate some populations are in Mendel segregation for two nonallelic genes, i.e., the inserted Bt gene in GKsu12 is nonallelic to that of SGK1, GK5, 109B, and GK19 and Bt genes in GK19 and SGK1 are likely inserted in the same or in close proximity (genetically closely linked), while some F(2) produce abnormal segregation patterns, with a segregation of resistance to Helicoerpa armigera vary between 15:1 and 3:1, though their Bt segregation fit into 15:1 by PCR analysis, suggesting Bt gene silence in these populations. Two genes silence may occur in these populations due to the homologous sequence by crossing since the silenced individuals accounted for 1/16 of the F(2) populations for allelic test. To those silenced populations, one of their parents all showed high resistance to bollworm.

  18. Generation and characterization of transgenic plum lines expressing gafp-1 with the bul409 promoter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Gastrodia anti fungal protein (GAFP-1) is a mannose-binding lectin that can confer increased disease resistance in transgenic tobacco and plum. In all previously-generated transgenic lines, the gene was under the control of the 35SCaMV promoter. In this study, transgenic plum lines were create...

  19. Efficient selection and evaluation of transgenic lines of Crambe abyssinica

    PubMed Central

    Li, Xueyuan; Fan, Jing; Gruber, Jens; Guan, Rui; Frentzen, Margrit; Zhu, Li-Hua

    2013-01-01

    Crambe abyssinica is a dedicated oilseed crop suitable for production of industrial feedstocks. Genetic modification of crambe has progressed substantially in the last few years, but the transformation efficiency needs to be further improved. Meanwhile, developing a reliable molecular system including Southern blot and qRT-PCR analyses is desired for effectively evaluating transgenic lines and gene expression levels of both endogenous and transgenes. In this study, we have developed an efficient transformation protocol with hygromycin as the selective agent for crambe transformation. In the regeneration test, addition of hygromycin at concentration of 5 mg L−1 resulted in 18% of shoot regeneration using crambe hypocotyls as explants, while no regeneration occurred when the hygromycin concentration reached 10 mg L−1. Based on this result, the hygromycin concentration up to 10 mg L−1 was used in the subsequent transformations. The results showed that the transformation efficiency under constant low selection pressure (H3-H3) was similar to that under higher selection pressure first, followed by transfer to lower selection pressure (H10-H3). The PCR, Southern blot and fatty acid composition analyses confirmed the integration of transgenes in the crambe genome. We have also optimized the Southern and qRT-PCR methods for future studies on crambe or related species. For Southern blot analysis on crambe, more than 50 μg DNA is required for a clear band. The choice of enzymes for DNA digestion was not rigid for confirmation of the T-DNA integration, while for determining the copy number of transgenes, suitable enzymes should be chosen. Increasing the enzyme concentration could improve the digestion and 20 μl enzyme was recomended for a complete digestion of up to 80 μg crambe DNA. For qRT-PCR analysis, around 20 days after flowering was observed to be the suitable sampling time for expresseion analysis of genes invovled in the seed oil biosynthesis. PMID:23750164

  20. Efficient selection and evaluation of transgenic lines of Crambe abyssinica.

    PubMed

    Li, Xueyuan; Fan, Jing; Gruber, Jens; Guan, Rui; Frentzen, Margrit; Zhu, Li-Hua

    2013-01-01

    Crambe abyssinica is a dedicated oilseed crop suitable for production of industrial feedstocks. Genetic modification of crambe has progressed substantially in the last few years, but the transformation efficiency needs to be further improved. Meanwhile, developing a reliable molecular system including Southern blot and qRT-PCR analyses is desired for effectively evaluating transgenic lines and gene expression levels of both endogenous and transgenes. In this study, we have developed an efficient transformation protocol with hygromycin as the selective agent for crambe transformation. In the regeneration test, addition of hygromycin at concentration of 5 mg L(-1) resulted in 18% of shoot regeneration using crambe hypocotyls as explants, while no regeneration occurred when the hygromycin concentration reached 10 mg L(-1). Based on this result, the hygromycin concentration up to 10 mg L(-1) was used in the subsequent transformations. The results showed that the transformation efficiency under constant low selection pressure (H3-H3) was similar to that under higher selection pressure first, followed by transfer to lower selection pressure (H10-H3). The PCR, Southern blot and fatty acid composition analyses confirmed the integration of transgenes in the crambe genome. We have also optimized the Southern and qRT-PCR methods for future studies on crambe or related species. For Southern blot analysis on crambe, more than 50 μg DNA is required for a clear band. The choice of enzymes for DNA digestion was not rigid for confirmation of the T-DNA integration, while for determining the copy number of transgenes, suitable enzymes should be chosen. Increasing the enzyme concentration could improve the digestion and 20 μl enzyme was recomended for a complete digestion of up to 80 μg crambe DNA. For qRT-PCR analysis, around 20 days after flowering was observed to be the suitable sampling time for expresseion analysis of genes invovled in the seed oil biosynthesis.

  1. In vivo immunomodulatory effects of Antrodia camphorata polysaccharides in a T1/T2 doubly transgenic mouse model for inhibiting infection of Schistosoma mansoni

    SciTech Connect

    Cheng, P.-C.; Hsu, C.-Y.; Chen, C.-C.; Lee, K.-M.

    2008-03-01

    Antrodia camphorata (A. camphorata) is a fungus commonly used for treatment of viral hepatitis and cancer in Chinese folk medicine. Extract of A. camphorate is reported to possess anti-inflammatory, antihepatitis B virus and anticancer activities. In this study, we tested the in vivo effects of polysaccharides derived from A. camphorata (AC-PS) on immune function by detection of cytokine expression and evaluation of the immune phenotype in a T1/T2 doubly transgenic mouse model. The protective effect of AC-PS in mice was tested by infection with Schistosoma mansoni. The induction of large amounts of IFN-{gamma}, IL-2 and TNF-a mRNA were detected after 2 and 4 weeks of oral AC-PS administration in BALB/c and C57BL/6 mice. In transgenic mice, 3 to 6 weeks of oral AC-PS administration increased the proportion of CD4{sup +} T cells and B cells within the spleen. More specifically, there was an increase of Th1 CD4{sup +} T cells and Be1 cells among spleen cells as observed by detection the of Type1/Type2 marker molecules. By using a disease model of parasitic infection, we found that AC-PS treatment inhibited infection with S. mansoni in BALB/C and C57BL/6 mice. AC-PS appears to influence the immune system of mice into developing Th1 responses and have potential for preventing infection with S. mansoni.

  2. Molecular and functional characterization of cry1Ac transgenic pea lines.

    PubMed

    Teressa Negawo, Alemayehu; Baranek, Linda; Jacobsen, Hans-Jörg; Hassan, Fathi

    2016-10-01

    Transgenic pea lines transformed with the cry1Ac gene were characterized at molecular (PCR, RT-PCR, qRT-PCR and immunostrip assay) and functional levels (leaf paint and insect feeding bioassays). The results showed the presence, expression, inheritance and functionality of the introduced transgene at different progeny levels. Variation in the expression of the cry1Ac gene was observed among the different transgenic lines. In the insect bioassay studies using the larvae of Heliothis virescens, both larval survival and plant damage were highly affected on the different transgenic plants. Up to 100 % larval mortality was observed on the transgenic plants compared to 17.42 % on control plants. Most of the challenged transgenic plants showed very negligible to substantially reduced feeding damage indicating the insect resistance of the developed transgenic lines. Further analysis under field condition will be required to select promising lines for future uses.

  3. Generation of Doubled Haploid Transgenic Wheat Lines by Microspore Transformation

    PubMed Central

    Liu, Weiguo; Konzak, Calvin F.; von Wettstein, Diter; Rustgi, Sachin

    2013-01-01

    Microspores can be induced to develop homozygous doubled haploid plants in a single generation. In the present experiments androgenic microspores of wheat have been genetically transformed and developed into mature homozygous transgenic plants. Two different transformation techniques were investigated, one employing electroporation and the other co-cultivation with Agrobacterium tumefaciens. Different tissue culture and transfection conditions were tested on nine different wheat cultivars using four different constructs. A total of 19 fertile transformants in five genotypes from four market classes of common wheat were recovered by the two procedures. PCR followed by DNA sequencing of the products, Southern blot analyses and bio/histo-chemical and histological assays of the recombinant enzymes confirmed the presence of the transgenes in the T0 transformants and their stable inheritance in homozygous T1∶2 doubled haploid progenies. Several decisive factors determining the transformation and regeneration efficiency with the two procedures were determined: (i) pretreatment of immature spikes with CuSO4 solution (500 mg/L) at 4°C for 10 days; (ii) electroporation of plasmid DNA in enlarged microspores by a single pulse of ∼375 V; (iii) induction of microspores after transfection at 28°C in NPB-99 medium and regeneration at 26°C in MMS5 medium; (iv) co-cultivation with Agrobacterium AGL-1 cells for transfer of plasmid T-DNA into microspores at day 0 for <24 hours; and (v) elimination of AGL-1 cells after co-cultivation with timentin (200–400 mg/L). PMID:24260351

  4. Development of Transgenic Cotton Lines Expressing Allium sativum Agglutinin (ASAL) for Enhanced Resistance against Major Sap-Sucking Pests

    PubMed Central

    Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1–2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects. PMID:24023750

  5. Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

    PubMed

    Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2013-01-01

    Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

  6. Toxicity assessment of transgenic papaya ringspot virus of 823-2210 line papaya fruits.

    PubMed

    Lin, Hsin-Tang; Yen, Gow-Chin; Huang, Ting-Tzu; Chan, Lit-Fu; Cheng, Ying-Huey; Wu, Jhaol-Huei; Yeh, Shyi-Dong; Wang, Sheng-Yang; Liao, Jiunn-Wang

    2013-02-20

    The transgenic papaya is a valuable strategy for creating plants resistant to papaya ringspot virus (PRSV) infection and increasing production. This study was further performed to evaluate the comparative toxicity effects of the newly developed transgenic line of the fruits of two backcross transgenic papaya lines (2210 and 823) and one hybrid line (823-2210) and compare to their parent non-transgenic (TN-2) counterparts. The stability analysis of coat protein (CP) of PRSV was investigated using the digestion stability assays in simulated gastric fluid (SGF), simulated intestinal fluid (SIF), and bile salts to detect the CP fragments. Results revealed that the CP fragments were rapidly hydrolyzed in SGF and were undetectable in organs and gastrointestinal contents in rats. For the genotoxicity, three in vitro assays were conducted and exhibited that non-transgenic and backcross transgenic papaya fruits were negative. Moreover, a repeated animal feeding study was conducted by feeding 2 g/kg of body weight (bw) of non-transgenic and backcross transgenic papaya fruits for 28 days in rats. There were no biological or toxicological significances between non-transgenic and backcross transgenic papaya fruits in rats. The results demonstrated that the backcross transgenic papaya fruit can be recognized as an equivalent substitution for traditional papaya in food safety.

  7. Stripe rust resistance and dough quality of new wheat - Dasypyrum villosum translocation lines T1DL•1V#3S and T1DS•1V#3L and the location of HMW-GS genes.

    PubMed

    Zhao, W C; Gao, X; Dong, J; Zhao, Z J; Chen, Q G; Chen, L G; Shi, Y G; Li, X Y

    2015-07-17

    The transfer of agronomically useful genes from wild wheat species into cultivated wheat is one of the most effective approaches to improvement of wheat varieties. To evaluate the transfer of genes from Dasypyrum villosum into Triticum aestivum, wheat quality and disease resistance was evaluated in two new translocation lines, T1DL•1V#3S and T1DS•1V#3L. We examined the levels of stripe rust resistance and dough quality in the two lines, and identified and located the stripe rust resistant genes and high molecular weight glutenin subunit (HMW-GS) genes Glu-V1 of D. villosum. Compared to the Chinese Spring (CS) variety, T1DL•1V#3S plants showed moderate resistance to moderate susceptibility to the stripe rust races CYR33 and Su11-4. However, T1DS•1V#3L plants showed high resistance or immunity to these stripe rusts. The genes for resistance to stripe rust were located on 1VL of D. villosum. In comparison to CS, the dough from T1DS•1V#3L had a significantly shorter developing time (1.45 min) and stable time (1.0 min), a higher weakness in gluten strength (208.5 FU), and a lower farinograph quality index (18). T1DL•1V#3S had a significantly longer developing time (4.2 min) and stable time (5.25 min), a lower weakness in gluten strength (53 FU) and a higher farinograph quality index (78.5). We also found that T1DS•1V#3L had reduced gluten strength and dough quality compared to CS, but T1DL•1V#3S had increased gluten strength and dough quality. The results of SDS-PAGE analysis indicated that Glu-V1 of D. villosum was located on short arm 1VS and long arm 1VL. These results prove that the new translocation lines, T1DS•1V#3L and T1DS•1V#3L, have valuable stripe rust resistance and dough quality traits that will be important for improving wheat quality and resistance in future wheat breeding programs.

  8. Comparison of three transgenic Bt rice lines for insecticidal protein expression and resistance against a target pest, Chilo suppressalis (Lepidoptera: Crambidae).

    PubMed

    Wang, Ya-Nan; Ke, Kai-Qie; Li, Yun-He; Han, Lan-Zhi; Liu, Yan-Min; Hua, Hong-Xia; Peng, Yu-Fa

    2016-02-01

    Two transgenic rice lines (T2A-1 and T1C-19b) expressing cry2A and cry1C genes, respectively, were developed in China, targeting lepidopteran pests including Chilo suppressalis (Walker) (Lepidoptera: Crambidae). The seasonal expression of Cry proteins in different tissues of the rice lines and their resistance to C. suppressalis were assessed in comparison to a Bt rice line expressing a cry1Ab/Ac fusion gene, Huahui 1, which has been granted a biosafety certificate. In general, levels of Cry proteins were T2A-1 > Huahui 1 > T1C-19b among rice lines, and leaf > stem > root among rice tissues. The expression patterns of Cry protein in the rice line plants were similar: higher level at early stages than at later stages with an exception that high Cry1C level in T1C-19b stems at the maturing stage. The bioassay results revealed that the three transgenic rice lines exhibited significantly high resistance against C. suppressalis larvae throughout the rice growing season. According to Cry protein levels in rice tissues, the raw and corrected mortalities of C. suppressalis caused by each Bt rice line were the highest in the seedling and declined through the jointing stage with an exception for T1C-19b providing an excellent performance at the maturing stage. By comparison, T1C-19b exhibited more stable and greater resistance to C. suppressalis larvae than T2A-1, being close to Huahui 1. The results suggest cry1C is an ideal Bt gene for plant transformation for lepidopteran pest control, and T1C-19b is a promising Bt rice line for commercial use for tolerating lepidopteran rice pests.

  9. Generation of stable Xenopus laevis transgenic lines expressing a transgene controlled by weak promoters.

    PubMed

    L'hostis-Guidet, Anne; Recher, Gaëlle; Guillet, Brigitte; Al-Mohammad, Abdulrahim; Coumailleau, Pascal; Tiaho, François; Boujard, Daniel; Madigou, Thierry

    2009-10-01

    Combining two existing protocols of trangenesis, namely the REMI and the I-SceI meganuclease methods, we generated Xenopus leavis expressing a transgene under the control of a promoter that presented a restricted pattern of activity and a low level of expression. This was realized by co-incubating sperm nuclei, the I-SceI enzyme and the transgene prior to transplantation into unfertilized eggs. The addition of the woodchuck hepatitis virus posttranscriptional regulatory element in our constructs further enhanced the expression of the transgene without affecting the tissue-specificity of the promoter activity. Using this combination of methods we produced high rates of fully transgenic animals that stably transmitted the transgene to the next generations with a transmission rate of 50% indicating a single integration event.

  10. Comparative fitness assessment of Anopheles stephensi transgenic lines receptive to site-specific integration.

    PubMed

    Amenya, D A; Bonizzoni, M; Isaacs, A T; Jasinskiene, N; Chen, H; Marinotti, O; Yan, G; James, A A

    2010-04-01

    Genetically modified mosquitoes that are unable to transmit pathogens offer opportunities for controlling vector-borne diseases such as malaria and dengue. Site-specific gene recombination technologies are advantageous in the development of these insects because antipathogen effector genes can be inserted at integration sites in the genome that cause the least alteration in mosquito fitness. Here we describe Anopheles stephensi transgenic lines containing phi C31 attP'docking' sites linked to a fluorescent marker gene. Chromosomal insertion sites were determined and life-table parameters were assessed for transgenic mosquitoes of each line. No significant differences in fitness between the transgenic and nontransgenic mosquitoes were detected in this study. These transgenic lines are suitable for future site-specific integrations of antiparasite transgenes into the attP sites.

  11. Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

  12. Field Performance of Transgenic Sugarcane Lines Resistant to Sugarcane Mosaic Virus

    PubMed Central

    Yao, Wei; Ruan, Miaohong; Qin, Lifang; Yang, Chuanyu; Chen, Rukai; Chen, Baoshan; Zhang, Muqing

    2017-01-01

    Sugarcane mosaic disease is mainly caused by the sugarcane mosaic virus (SCMV), which can significantly reduce stalk yield and sucrose content of sugarcane in the field. Coat protein mediated protection (CPMP) is an effective strategy to improve virus resistance. A 2-year field study was conducted to compare five independent transgenic sugarcane lines carrying the SCMV-CP gene (i.e., B2, B36, B38, B48, and B51) with the wild-type parental clone Badila (WT). Agronomic performance, resistance to SCMV infection, and transgene stability were evaluated and compared with the wild-type parental clone Badila (WT) at four experimental locations in China across two successive seasons, i.e., plant cane (PC) and 1st ratoon cane (1R). All transgenic lines derived from Badila had significantly greater tons of cane per hectare (TCH) and tons of sucrose per hectare (TSH) as well as lower SCMV disease incidence than those from Badila in the PC and 1R crops. The transgenic line B48 was highly resistant to SCMV with less than 3% incidence of infection. The recovery phenotype of transgenic line B36 was infected soon after virus inoculation, but the subsequent leaves showed no symptoms of infection. Most control plants developed symptoms that persisted and spread throughout the plant with more than 50% incidence. B48 recorded an average of 102.72 t/ha, which was 67.2% more than that for Badila. The expression of the transgene was stable over many generations with vegetative propagation. These results show that SCMV-resistant transgenic lines derived from Badila can provide resistant germplasm for sugarcane breeding and can also be used to study virus resistance mechanisms. This is the first report on the development and field performance of transgenic sugarcane plants that are resistant to SCMV infection in China. PMID:28228765

  13. Assessment of Stress Tolerance, Productivity, and Forage Quality in T1 Transgenic Alfalfa Co-overexpressing ZxNHX and ZxVP1-1 from Zygophyllum xanthoxylum

    PubMed Central

    Kang, Peng; Bao, Ai-Ke; Kumar, Tanweer; Pan, Ya-Qing; Bao, Zhulatai; Wang, Fei; Wang, Suo-Min

    2016-01-01

    Salinization, desertification, and soil nutrient deprivation are threatening the production of alfalfa (Medicago sativa L.) in northern China. We have previously generated T0 transgenic alfalfa co-overexpressing Zygophyllum xanthoxylum ZxNHX and ZxVP1-1 genes with enhanced salt and drought tolerance. To further develop this excellent breeding material into the new forage cultivar, stress tolerance, productivity, and forage quality of T1 transgenic alfalfa (GM) were assessed in this study. The GM inherited the traits of salt and drought tolerance from T0 generation. Most importantly, co-overexpression of ZxNHX and ZxVP1-1 enhanced the tolerance to Pi deficiency in GM, which was associated with more Pi accumulation in plants. Meanwhile, T1 transgenic alfalfa developed a larger root system with increased root size, root dry weight and root/shoot ratio, which may be one important reason for the improvement of phosphorus nutrition and high biomass accumulation in GM under various conditions. GM also accumulated more crude protein, crude fiber, crude fat, and crude ash than wild-type (WT) plants, especially under stress conditions and in the field. More interestingly, the crude fat contents sharply dropped in WT (by 66-74%), whereas showed no change or decreased less in GM, when subjected to salinity, drought or low-Pi. Our results indicate that T1 transgenic alfalfa co-overexpressing ZxNHX and ZxVP1-1 shows stronger stress tolerance, higher productivity and better forage quality. This study provides a solid foundation for creating the alfalfa cultivars with high yield, good quality and wide adaptability on saline, dry, and nutrient-deprived marginal lands of northern China. PMID:27833624

  14. Cell lines from MYCN transgenic murine tumours reflect the molecular and biological characteristics of human neuroblastoma.

    PubMed

    Cheng, Andy J; Cheng, Ngan Ching; Ford, Jette; Smith, Janice; Murray, Jayne E; Flemming, Claudia; Lastowska, Maria; Jackson, Michael S; Hackett, Christopher S; Weiss, William A; Marshall, Glenn M; Kees, Ursula R; Norris, Murray D; Haber, Michelle

    2007-06-01

    Overexpression of the human MYCN oncogene driven by a tyrosine hydroxylase promoter causes tumours in transgenic mice that recapitulate the childhood cancer neuroblastoma. To establish an in vitro model to study this process, a series of isogenic cell lines were developed from these MYCN-driven murine tumours. Lines were established from tumours arising in homozygous and hemizygous MYCN transgenic mice. Hemizygous tumours gave rise to cell lines growing only in suspension. Homozygous tumours gave rise to similar suspension lines as well as morphologically distinct substrate-adherent lines characteristic of human S-type neuroblastoma cells. FISH analysis demonstrated selective MYCN transgene amplification in cell lines derived from hemizygous mice. Comparative genomic hybridisation (CGH) and fluorescence in situ hybridisation (FISH) analysis confirmed a range of neuroblastoma-associated genetic changes in the various lines, in particular, gain of regions syntenic with human 17q. These isogenic lines together with the transgenic mice thus represent valuable models for investigating the biological characteristics of aggressive neuroblastoma.

  15. Transgenic soybean overexpressing GmSamT1 exhibits resistance to multiple-HG types of soybean cysts nematode heterodera glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean (Glycine max (L.) Merr.) salicylic acid methyl transferase (GmSAMT1) catalyzes the conversion of salicylic acid to methyl salicylate. Prior results showed that when GmSAMT1 was overexpressed in transgenic soybean hairy roots, resistance is conferred against soybean cyst nematode (SCN), Heter...

  16. Germline transmission of a novel rat embryonic stem cell line derived from transgenic rats.

    PubMed

    Men, Hongsheng; Bauer, Beth A; Bryda, Elizabeth C

    2012-09-20

    Germline-competent rat embryonic stem (ES) cell lines are important resources for the creation of mutant rat models using ES-cell-based gene targeting technology. The ability to isolate germline-competent ES cell lines from any rat strain, including genetically modified strains, would allow for more sophisticated genetic manipulations without extensive breeding. Sprague Dawley (SD) males carrying an enhanced green fluorescent protein (EGFP) transgene were used as the founder animals for the derivation of ES cell lines. A number of ES cell lines were established and subjected to rigorous quality control testing that included assessment of pluripotency factor expression, karyotype analysis, and pathogen/sterility testing. Two male ES cell lines, SD-Tg.EC1/Rrrc and SD-Tg.EC8/Rrrc, were injected into blastocysts recovered from a cross of Dark Agouti (DA) males with SD females. Resulting chimeric animals were bred with wild-type SD mates to verify the germline transmissibility of the ES cell lines by identifying pups carrying the ES cell line-derived EGFP transgene. While both ES cell lines gave rise to chimeric animals, only SD-Tg.EC1 was germline competent. This confirms the feasibility of deriving germline-competent ES cell lines from transgenic rat strains and provides a novel ES cell line with a stable green fluorescent protein (GFP) reporter for future genetic manipulations to create new rat models.

  17. A new human cholangiocellular carcinoma cell line (HuCC-T1) producing carbohydrate antigen 19/9 in serum-free medium.

    PubMed

    Miyagiwa, M; Ichida, T; Tokiwa, T; Sato, J; Sasaki, H

    1989-06-01

    A human cholangiocellular carcinoma cell line, HuCC-T1, was established in vitro from the malignant cells of ascites of a 56-yr-old patient. Histologic findings of the primary liver tumor revealed a moderately differentiated adenocarcinoma. Tumor cells from the ascites have been cultured with RPMI 1640 medium containing 0.2% lactalbumin hydrolysate and the cultured cells grew as monolayers with a population doubling time of 74 h during exponential growth at Passage 25. They had an epithelial-like morphology and were positive for mucine staining. Ultrastructural studies revealed the presence of microvilli on the cell surface and poorly developed organelles in the cytoplasm. The HuCC-T1 cell was tumorigenic in nude mice. The number of chromosomes in HuCC-T1 ranged from 61 to 80. These human cholangiocellular carcinoma cells in serum-free medium secreted several tumor markers, including carbohydrate antigen 19/9, carbohydrate antigen 125, carcinoembryonic antigen, and tissue polypeptide antigen. The carbohydrate antigen 19/9 secretion level of HuCC-T1 cells cultured in RPMI 1640 medium with 1% fetal bovine serum was sixfold higher than that with 0.2% lactalbumin hydrolysate. These findings suggest that HuCC-T1 will provide useful information to clarify the mechanism of tumor marker secretion and tumor cell growth in the human cholangiocellular carcinoma.

  18. A Transgenic Durum Wheat Line that is Free of Marker Genes and Expresses 1dy10

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We used a combination of “clean gene” technology and positive selection to generate transgenic durum wheat lines free of herbicide and antibiotic resistance marker genes. Biolistic transformation experiments were carried out using three “minimal gene cassettes” consisting of linear DNA fragments exc...

  19. Cytotoxicity and Apoptosis Induction of Ardisia crispa and Its Solvent Partitions against Mus musculus Mammary Carcinoma Cell Line (4T1)

    PubMed Central

    Nordin, Muhammad Luqman; Zakaria, Zainul Amiruddin; Othman, Fauziah; Abdullah, Muhammad Nazrul Hakim

    2017-01-01

    This study was conducted to investigate the cytotoxicity and apoptosis effect of A. crispa extract and its solvent partition (ethyl acetate and aqueous extract) against Mus musculus mammary carcinoma cell line (4T1). The normal mouse fibroblast cell line (NIH3T3) was used as comparison for selective cytotoxicity properties. The cytotoxicity evaluation was assessed using MTT assay. AO/PI dual fluorescent staining assay and Annexin V-FITC were used for apoptosis analysis. Results showed that 80% methanol extract from leaves showed most promising antimammary cancer agent with IC50 value of 42.26 ± 1.82 μg/mL and selective index (SI) value of 10.22. Ethyl acetate was cytotoxic for both cancer and normal cell while aqueous extract exhibited poor cytotoxic effect. 4T1 cells labelled with AO/PI and Annexin V-FITC and treated with 80% methanol extract demonstrated that the extract induces apoptosis to 4T1 mammary cancer cells. In conclusion, 80% methanol extract of A. crispa was selectively cytotoxic towards 4T1 cells but less cytotoxic towards NIH3T3 cells and induced the cancerous cells into apoptotic stage as early as 6 hours.

  20. A Tie2-driven BAC-TRAP transgenic line for in vivo endothelial gene profiling

    PubMed Central

    Santhosh, Devi; Huang, Zhen

    2016-01-01

    Recent technological innovations including bacterial artificial chromosome-based translating ribosome affinity purification (BAC-TRAP) have greatly facilitated analysis of cell type-specific gene expression in vivo, especially in the nervous system. To better study endothelial gene expression in vivo, we have generated a BAC-TRAP transgenic mouse line where the L10a ribosomal subunit is tagged with EGFP and placed under the control of the endothelium-specific Tie2 (Tek) promoter. We show that transgene expression in this line is widely, but specifically, detected in endothelial cells in several brain regions throughout pre- and postnatal development, as well as in other organs. We also show that this line results in highly significant enrichment of endothelium-specific mRNAs from brain tissues at different stages. This BAC-TRAP line therefore provides a useful genetic tool for in vivo endothelial gene profiling under various developmental, physiological, and pathological conditions. PMID:26817747

  1. Assessment of Fecundity and Germ Line Transmission in Two Transgenic Pig Lines Produced by Sleeping Beauty Transposition

    PubMed Central

    Garrels, Wiebke; Holler, Stephanie; Cleve, Nicole; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A.

    2012-01-01

    Recently, we described a simplified injection method for producing transgenic pigs using a non-autonomous Sleeping Beauty transposon system. The founder animals showed ubiquitous expression of the Venus fluorophore in almost all cell types. To assess, whether expression of the reporter fluorophore affects animal welfare or fecundity, we analyzed reproductive parameters of two founder boars, germ line transmission, and organ and cell specific transgene expression in animals of the F1 and F2 generation. Molecular analysis of ejaculated sperm cells suggested three monomeric integrations of the Venus transposon in both founders. To test germ line transmission of the three monomeric transposon integrations, wild-type sows were artificially inseminated. The offspring were nursed to sexual maturity and hemizygous lines were established. A clear segregation of the monomeric transposons following the Mendelian rules was observed in the F1 and F2 offspring. Apparently, almost all somatic cells, as well as oocytes and spermatozoa, expressed the Venus fluorophore at cell-type specific levels. No detrimental effects of Venus expression on animal health or fecundity were found. Importantly, all hemizygous lines expressed the fluorophore in comparable levels, and no case of transgene silencing or variegated expression was found after germ line transmission, suggesting that the insertions occurred at transcriptionally permissive loci. The results show that Sleeping Beauty transposase-catalyzed transposition is a promising approach for stable genetic modification of the pig genome. PMID:24705079

  2. Transcriptional signature of accessory cells in the lateral line, using the Tnk1bp1:EGFP transgenic zebrafish line

    PubMed Central

    2012-01-01

    Background Because of the structural and molecular similarities between the two systems, the lateral line, a fish and amphibian specific sensory organ, has been widely used in zebrafish as a model to study the development/biology of neuroepithelia of the inner ear. Both organs have hair cells, which are the mechanoreceptor cells, and supporting cells providing other functions to the epithelium. In most vertebrates (excluding mammals), supporting cells comprise a pool of progenitors that replace damaged or dead hair cells. However, the lack of regenerative capacity in mammals is the single leading cause for acquired hearing disorders in humans. Results In an effort to understand the regenerative process of hair cells in fish, we characterized and cloned an egfp transgenic stable fish line that trapped tnks1bp1, a highly conserved gene that has been implicated in the maintenance of telomeres' length. We then used this Tg(tnks1bp1:EGFP) line in a FACsorting strategy combined with microarrays to identify new molecular markers for supporting cells. Conclusions We present a Tg(tnks1bp1:EGFP) stable transgenic line, which we used to establish a transcriptional profile of supporting cells in the zebrafish lateral line. Therefore we are providing a new set of markers specific for supporting cells as well as candidates for functional analysis of this important cell type. This will prove to be a valuable tool for the study of regeneration in the lateral line of zebrafish in particular and for regeneration of neuroepithelia in general. PMID:22273551

  3. RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

    NASA Astrophysics Data System (ADS)

    Wang, Tiegu; Huang, Qunce; Feng, Weisen

    2007-10-01

    Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

  4. A conditional transgenic mouse line for targeted expression of the stem cell marker LGR5.

    PubMed

    Norum, Jens Henrik; Bergström, Åsa; Andersson, Agneta Birgitta; Kuiper, Raoul V; Hoelzl, Maria A; Sørlie, Therese; Toftgård, Rune

    2015-08-15

    LGR5 is a known marker of embryonic and adult stem cells in several tissues. In a mouse model, Lgr5+ cells have shown tumour-initiating properties, while in human cancers, such as basal cell carcinoma and colon cancer, LGR5 expression levels are increased: however, the effect of increased LGR5 expression is not fully understood. To study the effects of elevated LGR5 expression levels we generated a novel tetracycline-responsive, conditional transgenic mouse line expressing human LGR5, designated TRELGR5. In this transgenic line, LGR5 expression can be induced in any tissue depending on the expression pattern of the chosen transcriptional regulator. For the current study, we used transgenic mice with a tetracycline-regulated transcriptional transactivator linked to the bovine keratin 5 promoter (K5tTA) to drive expression of LGR5 in the epidermis. As expected, expression of human LGR5 was induced in the skin of double transgenic mice (K5tTA;TRELGR5). Inducing LGR5 expression during embryogenesis and early development resulted in macroscopically and microscopically detectable phenotypic changes, including kink tail, sparse fur coat and enlarged sebaceous glands. The fur and sebaceous gland phenotypes were reversible upon discontinued expression of transgenic LGR5, but this was not observed for the kink tail phenotype. There were no apparent phenotypic changes if LGR5 expression was induced at three weeks of age. The results demonstrate that increased expression of LGR5 during embryogenesis and the neonatal period alter skin development and homeostasis.

  5. Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes.

    PubMed

    Yang, R L; Wang, A X; Zhang, J; Dong, Y; Yang, M S; Wang, J M

    2016-04-29

    We characterized new transgenic varieties of poplar with multiple insect-resistant and salt stress tolerant genes. Two insect-resistant Bacillus thuringiensis (Bt) genes, Cry1Ac and Cry3A, and a salt-tolerant gene, Betaine aldehyde dehydrogenase (BADH) were inserted into a vector, p209-Cry1Ac-Cry3A-BADH. The clone of Populus x euramericana was transformed by the vector using the Agrobacterium-mediated method. Three transgenic lines were assessed using genetic detection and resistance expression analysis. PCR revealed that exogenous genes Cry1Ac, Cry3A, BADH and selective marker gene NPTII were present in three transgenic lines. Quantitative real-time PCR (qPCR) showed significant differences in the transcriptional abundance of three exogenous genes in different lines. Results of assays for Bt toxic proteins showed that the Cry1Ac and Cry3A toxic protein content of each line was 12.83-26.32 and 2108.91-2724.79 ng/g, respectively. The Cry1Ac toxic protein content of different lines was significantly different; the Cry3A toxic protein content was about 100 times higher than that of the Cry1Ac toxic protein. The insect-resistance test revealed the mortality rate of transgenic lines to Hyphantria cunea L1 larvae varied by 42.2-66.7%, which was significantly higher than non-transgenic lines. The mortality rate of L1 and L2 Plagiodera versicolora larvae was 100%. The insecticidal effect of transgenic lines to P. versicolora larvae was higher than that to H. cunea larvae. NaCl stress tolerance of three transgenic lines under 3-6% NaCl concentration was significantly higher than that of non-transgenic lines.

  6. Evaluation of the Agronomic Performance of Atrazine-Tolerant Transgenic japonica Rice Parental Lines for Utilization in Hybrid Seed Production

    PubMed Central

    Li, Yanlan; Li, Yanan; Wang, Shengjun; Su, Jinping; Liu, Xuejun; Chen, Defu; Chen, Xiwen

    2014-01-01

    Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.). To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA) from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer), and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9–7.0% or 0.8–8.7% respectively, for transgenic lines, and 44.0–59.2% or 28.1–30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production. PMID:25275554

  7. Evaluation of the agronomic performance of atrazine-tolerant transgenic japonica rice parental lines for utilization in hybrid seed production.

    PubMed

    Zhang, Luhua; Chen, Haiwei; Li, Yanlan; Li, Yanan; Wang, Shengjun; Su, Jinping; Liu, Xuejun; Chen, Defu; Chen, Xiwen

    2014-01-01

    Currently, the purity of hybrid seed is a crucial limiting factor when developing hybrid japonica rice (Oryza sativa L.). To chemically control hybrid seed purity, we transferred an improved atrazine chlorohydrolase gene (atzA) from Pseudomonas ADP into hybrid japonica parental lines (two maintainers, one restorer), and Nipponbare, by using Agrobacterium-mediated transformation. We subsequently selected several transgenic lines from each genotype by using PCR, RT-PCR, and germination analysis. In the presence of the investigated atrazine concentrations, particularly 150 µM atrazine, almost all of the transgenic lines produced significantly larger seedlings, with similar or higher germination percentages, than did the respective controls. Although the seedlings of transgenic lines were taller and gained more root biomass compared to the respective control plants, their growth was nevertheless inhibited by atrazine treatment compared to that without treatment. When grown in soil containing 2 mg/kg or 5 mg/kg atrazine, the transgenic lines were taller, and had higher total chlorophyll contents than did the respective controls; moreover, three of the strongest transgenic lines completely recovered after 45 days of growth. After treatment with 2 mg/kg or 5 mg/kg of atrazine, the atrazine residue remaining in the soil was 2.9-7.0% or 0.8-8.7% respectively, for transgenic lines, and 44.0-59.2% or 28.1-30.8%, respectively, for control plants. Spraying plants at the vegetative growth stage with 0.15% atrazine effectively killed control plants, but not transgenic lines. Our results indicate that transgenic atzA rice plants show tolerance to atrazine, and may be used as parental lines in future hybrid seed production.

  8. Germ-Line Recombination Activity of the Widely Used hGFAP-Cre and Nestin-Cre Transgenes

    PubMed Central

    Zhang, Jiong; Dublin, Pavel; Griemsmann, Stephanie; Klein, Alexandra; Brehm, Ralph; Bedner, Peter; Fleischmann, Bernd K.; Steinhäuser, Christian; Theis, Martin

    2013-01-01

    Herein we demonstrate with PCR, immunodetection and reporter gene approaches that the widely used human Glial Fibrillary Acidic Protein (hGFAP)-Cre transgene exhibits spontaneous germ-line recombination activity in leading to deletion in brain, heart and tail tissue with high frequency. The ectopic activity of hGFAP-Cre requires a rigorous control. We likewise observed that a second widely used nestin-Cre transgene shows germ-line deletion. Here we describe procedures to identify mice with germ-line recombination mediated by the hGFAP-Cre and nestin-Cre transgenes. Such control is essential to avoid pleiotropic effects due to germ-line deletion of loxP-flanked target genes and to maintain the CNS-restricted deletion status in transgenic mouse colonies. PMID:24349371

  9. A Phox2b::FLPo transgenic mouse line suitable for intersectional genetics

    PubMed Central

    Hirsch, Marie-Rose; d’Autréaux, Fabien; Dymecki, Susan M.; Brunet, Jean-François; Goridis, Christo

    2014-01-01

    Phox2b is a transcription factor expressed in the central and peripheral neurons that control cardiovascular, respiratory and digestive functions and essential for their development. Several populations known or suspected to regulate visceral functions express Phox2b in the developing hindbrain. Extensive cell migration and lack of suitable markers have greatly hampered studying their development. Reasoning that intersectional fate mapping may help to overcome these impediments, we have generated a BAC transgenic mouse line, P2b::FLPo, which expresses codon-optimized FLP recombinase in Phox2b expressing cells. By partnering the P2b::FLPo with the FLP-responsive RC::Fela allele, we show that FLP recombination switches on lineage tracers in the cells that express or have expressed Phox2b, permanently marking them for study across development. Taking advantage of the dualrecombinase feature of RC::Fela, we further show that the P2b::FLPo transgene can be partnered with Lbx1Cre as Cre driver to generate triple transgenics in which neurons having a history of both Phox2b and Lbx1 expression are specifically labelled. Hence, the P2b::FLPo line when partnered with a suitable Cre driver provides a tool for tracking and accessing genetically subsets of Phox2b-expressing neuronal populations, which has not been possible by Cremediated recombination alone. PMID:23592597

  10. (E)-β-farnesene gene reduces Lipaphis erysimi colonization in transgenic Brassica juncea lines.

    PubMed

    Verma, Shiv Shankar; Sinha, Rakesh Kumar; Jajoo, Anajna

    2015-01-01

    Aphids are the major concern that significantly reduces the yield of crops. (E)-β-farnesene (Eβf) is the principal component of the alarm pheromone of many aphids. The results of current research support the direct defense response of (E)-β-farnesene (Eβf) against aphid Lipaphis erysimi (L.) Kaltenbach in Brassica juncea. Eβf gene was isolated from Mentha arvensis and transformed into B. juncea, showed direct repellent against aphid colonization. The seasonal mean population (SMP) recorded under field condition showed significantly higher aphid colonization in wild type in comparison to most of the transgenic lines, and shows positive correlation with the repellency of transgenic plant expressing (E)-β-farnesene. The current research investigation provides direct evidence for aphid control in B. juncea using Eβf, a non-toxic mode of action.

  11. A Tie2-driven BAC-TRAP transgenic line for in vivo endothelial gene profiling.

    PubMed

    Santhosh, Devi; Huang, Zhen

    2016-03-01

    Recent technological innovations including bacterial artificial chromosome-based translating ribosome affinity purification (BAC-TRAP) have greatly facilitated analysis of cell type-specific gene expression in vivo, especially in the nervous system. To better study endothelial gene expression in vivo, we have generated a BAC-TRAP transgenic mouse line where the L10a ribosomal subunit is tagged with EGFP and placed under the control of the endothelium-specific Tie2 (Tek) promoter. We show that transgene expression in this line is widely, but specifically, detected in endothelial cells in several brain regions throughout pre- and postnatal development, as well as in other organs. We also show that this line results in highly significant enrichment of endothelium-specific mRNAs from brain tissues at different stages. This BAC-TRAP line therefore provides a useful genetic tool for in vivo endothelial gene profiling under various developmental, physiological, and pathological conditions. genesis 54:136-145, 2016. © 2016 Wiley Periodicals, Inc.

  12. Evaluating Tissue-Specific Recombination in a Pdgfrα-CreERT2 Transgenic Mouse Line

    PubMed Central

    O’Rourke, Megan; Cullen, Carlie L.; Auderset, Loic; Pitman, Kimberley A.; Achatz, Daniela; Gasperini, Robert; Young, Kaylene M.

    2016-01-01

    In the central nervous system (CNS) platelet derived growth factor receptor alpha (PDGFRα) is expressed exclusively by oligodendrocyte progenitor cells (OPCs), making the Pdgfrα promoter an ideal tool for directing transgene expression in this cell type. Two Pdgfrα-CreERT2 mouse lines have been generated for this purpose which, when crossed with cre-sensitive reporter mice, allow the temporally restricted labelling of OPCs for lineage-tracing studies. These mice have also been used to achieve the deletion of CNS-specific genes from OPCs. However the ability of Pdgfrα-CreERT2 mice to induce cre-mediated recombination in PDGFRα+ cell populations located outside of the CNS has not been examined. Herein we quantify the proportion of PDGFRα+ cells that become YFP-labelled following Tamoxifen administration to adult Pdgfrα-CreERT2::Rosa26-YFP transgenic mice. We report that the vast majority (>90%) of PDGFRα+ OPCs in the CNS, and a significant proportion of PDGFRα+ stromal cells within the bone marrow (~38%) undergo recombination and become YFP-labelled. However, only a small proportion of the PDGFRα+ cell populations found in the sciatic nerve, adrenal gland, pituitary gland, heart, gastrocnemius muscle, kidney, lung, liver or intestine become YFP-labelled. These data suggest that Pdgfrα-CreERT2 transgenic mice can be used to achieve robust recombination in OPCs, while having a minimal effect on most PDGFRα+ cell populations outside of the CNS. PMID:27626928

  13. Enhancement of tolerance to soft rot disease in the transgenic Chinese cabbage (Brassica rapa L. ssp. pekinensis) inbred line, Kenshin.

    PubMed

    Vanjildorj, Enkhchimeg; Song, Seo Young; Yang, Zhi Hong; Choi, Jae Eul; Noh, Yoo Sun; Park, Suhyoung; Lim, Woo Jin; Cho, Kye Man; Yun, Han Dae; Lim, Yong Pyo

    2009-10-01

    We developed a transgenic Chinese cabbage (Brassica rapa L. ssp. pekinensis) inbred line, Kenshin, with high tolerance to soft rot disease. Tolerance was conferred by expression of N-acyl-homoserine lactonase (AHL-lactonase) in Chinese cabbage through an efficient Agrobacterium-mediated transformation method. To synthesize and express the AHL-lactonase in Chinese cabbage, the plant was transformed with the aii gene (AHL-lactonase gene from Bacillus sp. GH02) fused to the PinII signal peptide (protease inhibitor II from potato). Five transgenic lines were selected by growth on hygromycin-containing medium (3.7% transformation efficiency). Southern blot analysis showed that the transgene was stably integrated into the genome. Among these five transgenic lines, single copy number integrations were observed in four lines and a double copy number integration was observed in one transgenic line. Northern blot analysis confirmed that pinIISP-aii fusion gene was expressed in all the transgenic lines. Soft rot disease tolerance was evaluated at tissue and seedling stage. Transgenic plants showed a significantly enhanced tolerance (2-3-fold) to soft rot disease compared to wild-type plants. Thus, expression of the fusion gene pinIISP-aii reduces susceptibility to soft rot disease in Chinese cabbage. We conclude that the recombinant AHL-lactonase, encoded by aii, can effectively quench bacterial quorum-sensing and prevent bacterial population density-dependent infections. To the best of our knowledge, the present study is the first to demonstrate the transformation of Chinese cabbage inbred line Kenshin, and the first to describe the effect of the fusion gene pinIISP-aii on enhancement of soft rot disease tolerance.

  14. [Construction of mouse VCAM-1 expression vector and establishment of stably transfected MSC line C3H10T1/2].

    PubMed

    Chen, Hui; Zhu, Heng; Chu, Ya-Nan; Xu, Fen-Fen; Liu, Yuan-Lin; Tang, Bo; Li, Xi-Mei; Hu, Liang-Ding; Zhang, Yi

    2014-10-01

    This study was aimed to construct the mouse VCAM-1 expression vector, to establish the stably transfected MSC line and to investigate the effect of VCAM-1-modified mesenchymal stem cells (MSC) on the immunological characteristics of MSC. The cDNA of murine VCAM-1 gene was amplified by RT-PCR from the total RNA isolated from the mouse spleen; then the cDNA was inserted into the retrovirus vector PMSCVmigr-1; the recombinant plasmid was confirmed by restriction endonuclease experiments and sequencing, then designated as PMSCVmigr-1-mVCAM-1; the recombinant plasmid PMSCVmigr-1-mVCAM-1 was transfected into 293 cells by lipofecamin and the supernatant was collected to transfect MSC cell line (C3H10T1/2). Moreover, VCAM-1 expression on MSC was evaluated by FACS. Furthermore, the inhibitory effect of VCAM-1-MSC on lymphocytic transformation was tested by (3)H-TdR incorporation assay. The results indicated that the successful construction of recombinant retroviral expression plasmid of mouse VCAM-1 was confirmed by digesting and sequancing. After transfection of MSC with retroviral supernaptant, the high expression of VCAM-1 on MSC could be detected by flow cytometry. The MSC high expressing VCAM-1 could significantly inhibit the proliferation of Con A-inducing lymphocytes in dose-depentent marrer. It is concluded that recombinant retroviral encoding VCAM-1 (PMSCVmigr-1-mVCAM-1) has been successfully constructed and mouse VCAM-1 has been stably expressed in C3H10T1/2. MSC over-expressing VCAM-1 show more potent immunosuppressive effect on cellular immune reaction in vitro. Our data laid a foundation for the subsequent studying the effect of VCAM-1 transfecting into MSC on immune related disease study.

  15. Hybridization of downregulated-COMT transgenic switchgrass lines with field-selected switchgrass for improved biomass traits

    SciTech Connect

    Baxter, Holly L.; Alexander, Lisa W.; Mazarei, Mitra; Haynes, Ellen; Turner, Geoffrey B.; Sykes, Robert W.; Decker, Stephen R.; Davis, Mark F.; Dixon, Richard A.; Wang, Zeng-Yu; Neal Stewart, C.

    2016-01-21

    Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. For instance, downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In this present study we sought to further improve biomass characteristics by crossing the downregulated COMT T1 lines with high-yielding switchgrass accessions in two genetic backgrounds ('Alamo' and 'Kanlow'). Crosses and T2 progeny analyses were made under greenhouse conditions to assess maternal effects, plant morphology and yield, and cell wall traits. Female parent type influenced morphology, but had no effect on cell wall traits. T2 hybrids produced with T1 COMT-downregulated switchgrass as the female parent were taller, produced more tillers, and produced 63% more biomass compared with those produced using the field selected accession as the female parent. Transgene status (presence or absence of transgene) influenced both growth and cell wall traits. T2 transgenic hybrids were 7% shorter 80 days after sowing and produced 43% less biomass than non-transgenic null-segregant hybrids. Cell wall-related differences included lower lignin content, reduced syringyl-to-guaiacyl (S/G) lignin monomer ratio, and a 12% increase in total sugar release in the T2 transgenic hybrids compared to non-transgenic null segregants. This is the first study to evaluate the feasibility of transferring the low-recalcitrance traits associated with a transgenic switchgrass line into high-yielding field varieties in an attempt to improve growth-related traits. Lastly, our results provide insights into the possible improvement of switchgrass productivity via biotechnology paired with plant breeding.

  16. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies.

    PubMed

    Marquart, Gregory D; Tabor, Kathryn M; Brown, Mary; Strykowski, Jennifer L; Varshney, Gaurav K; LaFave, Matthew C; Mueller, Thomas; Burgess, Shawn M; Higashijima, Shin-Ichi; Burgess, Harold A

    2015-01-01

    Transgenic methods enable the selective manipulation of neurons for functional mapping of neuronal circuits. Using confocal microscopy, we have imaged the cellular-level expression of 109 transgenic lines in live 6 day post fertilization larvae, including 80 Gal4 enhancer trap lines, 9 Cre enhancer trap lines and 20 transgenic lines that express fluorescent proteins in defined gene-specific patterns. Image stacks were acquired at single micron resolution, together with a broadly expressed neural marker, which we used to align enhancer trap reporter patterns into a common 3-dimensional reference space. To facilitate use of this resource, we have written software that enables searching for transgenic lines that label cells within a selectable 3-dimensional region of interest (ROI) or neuroanatomical area. This software also enables the intersectional expression of transgenes to be predicted, a feature which we validated by detecting cells with co-expression of Cre and Gal4. Many of the imaged enhancer trap lines show intrinsic brain-specific expression. However, to increase the utility of lines that also drive expression in non-neuronal tissue we have designed a novel UAS reporter, that suppresses expression in heart, muscle, and skin through the incorporation of microRNA binding sites in a synthetic 3' untranslated region. Finally, we mapped the site of transgene integration, thus providing molecular identification of the expression pattern for most lines. Cumulatively, this library of enhancer trap lines provides genetic access to 70% of the larval brain and is therefore a powerful and broadly accessible tool for the dissection of neural circuits in larval zebrafish.

  17. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies

    PubMed Central

    Marquart, Gregory D.; Tabor, Kathryn M.; Brown, Mary; Strykowski, Jennifer L.; Varshney, Gaurav K.; LaFave, Matthew C.; Mueller, Thomas; Burgess, Shawn M.; Higashijima, Shin-ichi; Burgess, Harold A.

    2015-01-01

    Transgenic methods enable the selective manipulation of neurons for functional mapping of neuronal circuits. Using confocal microscopy, we have imaged the cellular-level expression of 109 transgenic lines in live 6 day post fertilization larvae, including 80 Gal4 enhancer trap lines, 9 Cre enhancer trap lines and 20 transgenic lines that express fluorescent proteins in defined gene-specific patterns. Image stacks were acquired at single micron resolution, together with a broadly expressed neural marker, which we used to align enhancer trap reporter patterns into a common 3-dimensional reference space. To facilitate use of this resource, we have written software that enables searching for transgenic lines that label cells within a selectable 3-dimensional region of interest (ROI) or neuroanatomical area. This software also enables the intersectional expression of transgenes to be predicted, a feature which we validated by detecting cells with co-expression of Cre and Gal4. Many of the imaged enhancer trap lines show intrinsic brain-specific expression. However, to increase the utility of lines that also drive expression in non-neuronal tissue we have designed a novel UAS reporter, that suppresses expression in heart, muscle, and skin through the incorporation of microRNA binding sites in a synthetic 3′ untranslated region. Finally, we mapped the site of transgene integration, thus providing molecular identification of the expression pattern for most lines. Cumulatively, this library of enhancer trap lines provides genetic access to 70% of the larval brain and is therefore a powerful and broadly accessible tool for the dissection of neural circuits in larval zebrafish. PMID:26635538

  18. Relationship between expression of epidermal growth factor and simian virus 40 T antigen in a line of transgenic mice.

    PubMed

    Lafond, R E; Giammalvo, J T; Norkin, L C

    1995-09-01

    The pattern of expression of the simian virus 40 (SV40) T antigen gene and resultant dysplasia were re-examined in a line of transgenic mice in which the T antigen gene was under the control of the SV40 early promoter. We found that T antigen expression in the kidney, and resulting dysplastic lesions, occurred exclusively in the distal convoluted tubules and the ascending limbs of Henle. Epidermal growth factor (EGF) expression in the kidney of normal mice was similarly immunolocalized. The correlation between high EGF immunoreactivity in normal mouse tissues and T antigen expression in the transgenic counterpart was also seen in the choroid plexus epithelium and in the submandibular glands of male mice. T antigen was not found in the submandibular gland of transgenic females. Similarly, EGF was only rarely detected in the normal female submandibular gland. In contrast to the correlation between T antigen expression in the transgenic mice and EGF expression in the corresponding tissues of the normal mice, within the dysplastic lesions of the transgenic mice EGF expression was severely diminished. Adenocarcinomas of the male submandibular gland from another line of transgenic mice that expresses the Int-1 transgene, showed similarly reduced levels of immunostaining for EGF. Thus, reduced expression of EGF might be a general feature of dysplasia and tumorigenesis in those tissues that normally express EGF.

  19. Transgenic mouse lines for non-invasive ratiometric monitoring of intracellular chloride

    PubMed Central

    Batti, Laura; Mukhtarov, Marat; Audero, Enrica; Ivanov, Anton; Paolicelli, Rosa Chiara; Zurborg, Sandra; Gross, Cornelius; Bregestovski, Piotr; Heppenstall, Paul A.

    2013-01-01

    Chloride is the most abundant physiological anion and participates in a variety of cellular processes including trans-epithelial transport, cell volume regulation, and regulation of electrical excitability. The development of tools to monitor intracellular chloride concentration ([Cli]) is therefore important for the evaluation of cellular function in normal and pathological conditions. Recently, several Cl-sensitive genetically encoded probes have been described which allow for non-invasive monitoring of [Cli]. Here we describe two mouse lines expressing a CFP-YFP-based Cl probe called Cl-Sensor. First, we generated transgenic mice expressing Cl-Sensor under the control of the mouse Thy1 mini promoter. Cl-Sensor exhibited good expression from postnatal day two (P2) in neurons of the hippocampus and cortex, and its level increased strongly during development. Using simultaneous whole-cell monitoring of ionic currents and Cl-dependent fluorescence, we determined that the apparent EC50 for Cli was 46 mM, indicating that this line is appropriate for measuring neuronal [Cli] in postnatal mice. We also describe a transgenic mouse reporter line for Cre-dependent conditional expression of Cl-Sensor, which was targeted to the Rosa26 locus and by incorporating a strong exogenous promoter induced robust expression upon Cre-mediated recombination. We demonstrate high levels of tissue-specific expression in two different Cre-driver lines targeting cells of the myeloid lineage and peripheral sensory neurons. Using these mice the apparent EC50 for Cli was estimated to be 61 and 54 mM in macrophages and DRG, respectively. Our data suggest that these mouse lines will be useful models for ratiometric monitoring of Cli in specific cell types in vivo. PMID:23734096

  20. A human beta cell line with drug inducible excision of immortalizing transgenes

    PubMed Central

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  1. A Transgenic Mouse Line Expressing the Red Fluorescent Protein tdTomato in GABAergic Neurons

    PubMed Central

    Besser, Stefanie; Sicker, Marit; Marx, Grit; Winkler, Ulrike; Eulenburg, Volker; Hülsmann, Swen; Hirrlinger, Johannes

    2015-01-01

    GABAergic inhibitory neurons are a large population of neurons in the central nervous system (CNS) of mammals and crucially contribute to the function of the circuitry of the brain. To identify specific cell types and investigate their functions labelling of cell populations by transgenic expression of fluorescent proteins is a powerful approach. While a number of mouse lines expressing the green fluorescent protein (GFP) in different subpopulations of GABAergic cells are available, GFP expressing mouse lines are not suitable for either crossbreeding to other mouse lines expressing GFP in other cell types or for Ca2+-imaging using the superior green Ca2+-indicator dyes. Therefore, we have generated a novel transgenic mouse line expressing the red fluorescent protein tdTomato in GABAergic neurons using a bacterial artificial chromosome based strategy and inserting the tdTomato open reading frame at the start codon within exon 1 of the GAD2 gene encoding glutamic acid decarboxylase 65 (GAD65). TdTomato expression was observed in all expected brain regions; however, the fluorescence intensity was highest in the olfactory bulb and the striatum. Robust expression was also observed in cortical and hippocampal neurons, Purkinje cells in the cerebellum, amacrine cells in the retina as well as in cells migrating along the rostral migratory stream. In cortex, hippocampus, olfactory bulb and brainstem, 80% to 90% of neurons expressing endogenous GAD65 also expressed the fluorescent protein. Moreover, almost all tdTomato-expressing cells coexpressed GAD65, indicating that indeed only GABAergic neurons are labelled by tdTomato expression. This mouse line with its unique spectral properties for labelling GABAergic neurons will therefore be a valuable new tool for research addressing this fascinating cell type. PMID:26076353

  2. [Investigation of neuroprotective activity of apolipoprotein E peptide mimetic Cog1410 in transgenic lines of Drosophila melanogaster].

    PubMed

    Latypova, E M; Timoshenko, S I; Kislik, G A; Vitek, M; Shvartsman, A L; Sarantseva, S V

    2014-01-01

    The neuroprotective activity of apolipoprotein E (apoE) peptide mimetic Cog1410, containing amino acid sequence of the receptor-binding domain apoE, has been investigated in transgenic lines of Drosophila melanogaster expressing human APP and beta-secretase. Expression of two transgenes caused neuropathological processes attributed to Alzheimer's disease: neurodegeneration, cognitive abnormality and amyloid deposits formation in brain. It was shown that Cog 1410 reduces neurodegeneration in brain of transgenic flies and improves cognitive functions (odor recognition). These data suggest that Cog1410 is a potential neuroprotector that can be used in AD treatment.

  3. Quantitative proteomic analysis of wheat grain proteins reveals differential effects of silencing of omega-5 gliadin genes in transgenic lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel wheat lines with altered flour compositions can be used to decipher the roles of specific gluten proteins in flour quality. Grain proteins from transgenic wheat lines in which genes encoding the omega-5 gliadins were silenced by RNA interference (RNAi) were analyzed in detail by quantitative 2...

  4. Burial and seed survival in Brassica napus subsp. oleifera and Sinapis arvensis including a comparison of transgenic and non-transgenic lines of the crop.

    PubMed Central

    Hails, R S; Rees, M; Kohn, D D; Crawley, M J

    1997-01-01

    The creation of transgenic plants through genetic engineering has focused interest on how the fitness of a plant species may be altered by small changes in its genome. This study concentrates on a key component of fitness: persistence of seeds overwinter. Seeds of three lines of oilseed rape (Brassica napus subsp. oleifera DC Metzger) and of charlock (Sinapis arvensis L.) were buried in nylon mesh bags at two depths in four habitats in each of three geographically separated sites: Cornwall, Berkshire and Sutherland. Seeds were recovered after 12 and 24 months. Charlock exhibited much greater seed survival (average 60% surviving the first year and 32.5% surviving the second year) than oilseed rape (1.5% surviving the first year and 0.2% surviving the second) at all sites. Charlock showed higher survival at 15 cm burial than 2 cm burial at certain sites, but oilseed rape showed no depth effect. Different genetic lines of oilseed rape displayed different rates of seed survival; non-transgenic rape showed greater survival (2%) than the two transgenic lines, one developed for tolerance to the antibiotic kanamycin (0.3%) and one for tolerance to both kanamycin and the herbicide glufosinate (0.25%). The absolute and relative performances of the different genetic lines of oilseed rape were context specific, illustrating the need to test hypotheses in a wide range of ecological settings. PMID:9061957

  5. Mobility properties of the Hermes transposable element in transgenic lines of Aedes aegypti

    PubMed Central

    Smith, Ryan C.

    2010-01-01

    The Hermes transposable element has been used to genetically transform a wide range of insect species, including the mosquito, Aedes aegypti, a vector of several important human pathogens. Hermes integrations into the mosquito germline are characterized by the non-canonical integration of the transposon and flanking plasmid and, once integrated, Hermes is stable in the presence of its transposase. In an effort to improve the post-integration mobility of Hermes in the germline of Ae. aegypti, a transgenic helper Mos1 construct expressing Hermes transposase under the control of a testis-specific promoter was crossed to a separate transgenic strain containing a target Hermes transposon. In less than 1% of the approximately 1,500 progeny from jumpstarter lines analyzed, evidence of putative Hermes germline remobilizations were detected. These recovered transposition events occur through an aberrant mechanism and provide insight into the non-canonical cut-and-paste transposition of Hermes in the germ line of Ae. aegypti. PMID:20596755

  6. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    PubMed

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue.

  7. Facilitating the recovery of phenotypically normal transgenic lines in clonal crops: a new strategy illustrated in potato.

    PubMed

    Barrell, Philippa J; Conner, Anthony J

    2011-04-01

    Transgenic plants frequently exhibit altered phenotypes, unrelated to transgene expression, which are attributed to tissue culture-induced variation and/or insertional mutagenesis. Distinguishing between these possibilities has been difficult in clonal crops such as potato, due to their highly heterozygous background and the resulting inherent phenotypic variability associated with segregation. This study reports the use of transgene integration as a molecular marker to trace the clonal origin of single cells in tissue culture. Following transformation, multiple shoots have been regenerated from cell colonies of potato (Solanum tuberosum L.) and Southern analysis used to confirm their derivation from a single transformed cell. Analysis of phenotypic variation in field trials has demonstrated marked differences between these multiple regeneration events, the origin of which must have occurred after T-DNA insertion, and consequently during the tissue culture phase. This result unequivocally demonstrates that somaclonal variation occurs during tissue culture and independent of transgene insertion. Furthermore, the first shoots recovered do not necessarily exhibit less somaclonal variation, since later regeneration events can give rise to plants that are more phenotypically normal. Therefore, when developing transgenic lines for genetic improvement of clonal crops, multiple shoots should be regenerated and evaluated from each transformation event to facilitate the recovery of phenotypically normal transgenic lines.

  8. Putrescine accumulation in Arabidopsis thaliana transgenic lines enhances tolerance to dehydration and freezing stress

    PubMed Central

    Alet, Analía I; Sanchez, Diego H; Cuevas, Juan C; del Valle, Secundino; Altabella, Teresa; Tiburcio, Antonio F; Marco, Francisco; Ferrando, Alejandro; Espasandín, Fabiana D; González, María E; Carrasco, Pedro

    2011-01-01

    Polyamines have been globally associated to plant responses to abiotic stress. Particularly, putrescine has been related to a better response to cold and dehydration stresses. It is known that this polyamine is involved in cold tolerance, since Arabidopsis thaliana plants mutated in the key enzyme responsible for putrescine synthesis (arginine decarboxilase, ADC; EC 4.1.1.19) are more sensitive than the wild type to this stress. Although it is speculated that the overexpression of ADC genes may confer tolerance, this is hampered by pleiotropic effects arising from the constitutive expression of enzymes from the polyamine metabolism. Here, we present our work using A. thaliana transgenic plants harboring the ADC gene from oat under the control of a stress-inducible promoter (pRD29A) instead of a constitutive promoter. The transgenic lines presented in this work were more resistant to both cold and dehydration stresses, associated with a concomitant increment in endogenous putrescine levels under stress. Furthermore, the increment in putrescine upon cold treatment correlates with the induction of known stress-responsive genes, and suggests that putrescine may be directly or indirectly involved in ABA metabolism and gene expression. PMID:21330789

  9. Molecular analysis, cytogenetics and fertility of introgression lines from transgenic wheat to Aegilops cylindrica host.

    PubMed

    Schoenenberger, Nicola; Guadagnuolo, Roberto; Savova-Bianchi, Dessislava; Küpfer, Philippe; Felber, François

    2006-12-01

    Natural hybridization and backcrossing between Aegilops cylindrica and Triticum aestivum can lead to introgression of wheat DNA into the wild species. Hybrids between Ae. cylindrica and wheat lines bearing herbicide resistance (bar), reporter (gus), fungal disease resistance (kp4), and increased insect tolerance (gna) transgenes were produced by pollination of emasculated Ae. cylindrica plants. F1 hybrids were backcrossed to Ae. cylindrica under open-pollination conditions, and first backcrosses were selfed using pollen bags. Female fertility of F1 ranged from 0.03 to 0.6%. Eighteen percent of the sown BC1s germinated and flowered. Chromosome numbers ranged from 30 to 84 and several of the plants bore wheat-specific sequence-characterized amplified regions (SCARs) and the bar gene. Self fertility in two BC1 plants was 0.16 and 5.21%, and the others were completely self-sterile. Among 19 BC1S1 individuals one plant was transgenic, had 43 chromosomes, contained the bar gene, and survived glufosinate treatments. The other BC1S1 plants had between 28 and 31 chromosomes, and several of them carried SCARs specific to wheat A and D genomes. Fertility of these plants was higher under open-pollination conditions than by selfing and did not necessarily correlate with even or euploid chromosome number. Some individuals having supernumerary wheat chromosomes recovered full fertility.

  10. Putrescine accumulation in Arabidopsis thaliana transgenic lines enhances tolerance to dehydration and freezing stress.

    PubMed

    Alet, Analía I; Sanchez, Diego H; Cuevas, Juan C; Del Valle, Secundino; Altabella, Teresa; Tiburcio, Antonio F; Marco, Francisco; Ferrando, Alejandro; Espasandín, Fabiana D; González, María E; Ruiz, Oscar A; Carrasco, Pedro

    2011-02-01

    Polyamines have been globally associated to plant responses to abiotic stress. Particularly, putrescine has been related to a better response to cold and dehydration stresses. It is known that this polyamine is involved in cold tolerance, since Arabidopsis thaliana plants mutated in the key enzyme responsible for putrescine synthesis (arginine decarboxilase, ADC; EC 4.1.1.19) are more sensitive than the wild type to this stress. Although it is speculated that the over-expression of ADC genes may confer tolerance, this is hampered by pleiotropic effects arising from the constitutive expression of enzymes from the polyamine metabolism. Here, we present our work using A. thaliana transgenic plants harboring the ADC gene from oat under the control of a stress-inducible promoter (pRD29A) instead of a constitutive promoter. The transgenic lines presented in this work were more resistant to both cold and dehydration stresses, associated with a concomitant increment in endogenous putrescine levels under stress. Furthermore, the increment in putrescine upon cold treatment correlated with the induction of known stress-responsive genes, and suggested that putrescine may be directly or indirectly involved in ABA metabolism and gene expression.

  11. Germ-line transmission of lentiviral PGK-EGFP integrants in transgenic cattle: new perspectives for experimental embryology.

    PubMed

    Reichenbach, Myriam; Lim, Tiongti; Reichenbach, Horst-Dieter; Guengoer, Tuna; Habermann, Felix A; Matthiesen, Marieke; Hofmann, Andreas; Weber, Frank; Zerbe, Holm; Grupp, Thomas; Sinowatz, Fred; Pfeifer, Alexander; Wolf, Eckhard

    2010-08-01

    Lentiviral vectors are a powerful tool for the genetic modification of livestock species. We previously generated transgenic founder cattle with lentiviral integrants carrying enhanced green fluorescent protein (EGFP) under the control of the phosphoglycerate kinase (PGK) promoter. In this study, we investigated the transmission of LV-PGK-EGFP integrants through the female and male germ line in cattle. A transgenic founder heifer (#562, Kiki) was subjected to superovulation treatment and inseminated with semen from a non-transgenic bull. Embryos were recovered and transferred to synchronized recipient heifers, resulting in the birth of a healthy male transgenic calf expressing EGFP as detected by in vivo imaging. Semen from a transgenic founder bull (#561, Jojo) was used for in vitro fertilization (IVF) of in vitro matured (IVM) oocytes from non-transgenic cows. The rates of cleavage and development to blastocyst in vitro corresponded to 52.0 +/- 4.1 and 24.5 +/- 4.4%, respectively. Expression of EGFP was observed at blastocyst stage (day 7 after IVF) and was seen in 93.0% (281/302) of the embryos. 24 EGFP-expressing embryos were transferred to 9 synchronized recipients. Analysis of 2 embryos, flushed from the uterus on day 15, two fetuses recovered on day 45, and a healthy male transgenic calf revealed consistent high-level expression of EGFP in all tissues investigated. Our study shows for the first time transmission of lentiviral integrants through the germ line of female and male transgenic founder cattle. The pattern of inheritance was consistent with Mendelian rules. Importantly, high fidelity expression of EGFP in embryos, fetuses, and offspring of founder #561 provides interesting tools for developmental studies in cattle, including interactions of gametes, embryos and fetuses with their maternal environment.

  12. Establishment and characterization of fetal fibroblast cell lines for generating human lysozyme transgenic goats by somatic cell nuclear transfer.

    PubMed

    Liu, Jun; Luo, Yan; Zheng, Liming; Liu, Qingqing; Yang, Zhongcai; Wang, Yongsheng; Su, Jianmin; Quan, Fusheng; Zhang, Yong

    2013-10-01

    This study was performed to qualify goat fetal fibroblast (GFF) cell lines for genetic modification and somatic cell nuclear transfer (SCNT) to produce human lysozyme (hLYZ) transgenic goats. Nine GFF cell lines were established from different fetuses, and the proliferative lifespan and chromosomal stability were analyzed. The results suggested that cell lines with a longer lifespan had stable chromosomes compared with those of cells lines with a shorter lifespan. According to the proliferative lifespan, we divided GFF cell lines into two groups: cell lines with a long lifespan (GFF1/2/7/8/9; group L) and cell lines with a short lifespan (GFF3/4/5/6; group S). Next, a hLYZ expression vector was introduced into these cell lines by electroporation. The efficiencies of colony formation, expansion in culture, and the quality of transgenic clonal cell lines were significant higher in group L than those in group S. The mean fusion rate and blastocyst rate in group L were higher than those in group S (80.3 ± 1.7 vs. 65.1 ± 4.2 % and 19.5 ± 0.6 vs. 15.1 ± 1.1 %, respectively, P < 0.05). After transferring cloned embryos into the oviducts of recipient goats, three live kids were born. PCR and Southern blot analyses confirmed integration of the transgene in cloned goats. In conclusion, the lifespan of GFF cell lines has a major effect on the efficiency to produce transgenic cloned goats. Therefore, the proliferative lifespan of primary cells may be used as a criterion to characterize the quality of cell lines for genetic modification and SCNT.

  13. De novo piRNA cluster formation in the Drosophila germ line triggered by transgenes containing a transcribed transposon fragment

    PubMed Central

    Olovnikov, Ivan; Ryazansky, Sergei; Shpiz, Sergey; Lavrov, Sergey; Abramov, Yuri; Vaury, Chantal; Jensen, Silke; Kalmykova, Alla

    2013-01-01

    PIWI-interacting RNAs (piRNAs) provide defence against transposable element (TE) expansion in the germ line of metazoans. piRNAs are processed from the transcripts encoded by specialized heterochromatic clusters enriched in damaged copies of transposons. How these regions are recognized as a source of piRNAs is still elusive. The aim of this study is to determine how transgenes that contain a fragment of the Long Interspersed Nuclear Elements (LINE)-like I transposon lead to an acquired TE resistance in Drosophila. We show that such transgenes, being inserted in unique euchromatic regions that normally do not produce small RNAs, become de novo bidirectional piRNA clusters that silence I-element activity in the germ line. Strikingly, small RNAs of both polarities are generated from the entire transgene and flanking genomic sequences—not only from the transposon fragment. Chromatin immunoprecipitation analysis shows that in ovaries, the trimethylated histone 3 lysine 9 (H3K9me3) mark associates with transgenes producing piRNAs. We show that transgene-derived hsp70 piRNAs stimulate in trans cleavage of cognate endogenous transcripts with subsequent processing of the non-homologous parts of these transcripts into piRNAs. PMID:23620285

  14. De novo piRNA cluster formation in the Drosophila germ line triggered by transgenes containing a transcribed transposon fragment.

    PubMed

    Olovnikov, Ivan; Ryazansky, Sergei; Shpiz, Sergey; Lavrov, Sergey; Abramov, Yuri; Vaury, Chantal; Jensen, Silke; Kalmykova, Alla

    2013-06-01

    PIWI-interacting RNAs (piRNAs) provide defence against transposable element (TE) expansion in the germ line of metazoans. piRNAs are processed from the transcripts encoded by specialized heterochromatic clusters enriched in damaged copies of transposons. How these regions are recognized as a source of piRNAs is still elusive. The aim of this study is to determine how transgenes that contain a fragment of the Long Interspersed Nuclear Elements (LINE)-like I transposon lead to an acquired TE resistance in Drosophila. We show that such transgenes, being inserted in unique euchromatic regions that normally do not produce small RNAs, become de novo bidirectional piRNA clusters that silence I-element activity in the germ line. Strikingly, small RNAs of both polarities are generated from the entire transgene and flanking genomic sequences--not only from the transposon fragment. Chromatin immunoprecipitation analysis shows that in ovaries, the trimethylated histone 3 lysine 9 (H3K9me3) mark associates with transgenes producing piRNAs. We show that transgene-derived hsp70 piRNAs stimulate in trans cleavage of cognate endogenous transcripts with subsequent processing of the non-homologous parts of these transcripts into piRNAs.

  15. zebraflash transgenic lines for in vivo bioluminescence imaging of stem cells and regeneration in adult zebrafish.

    PubMed

    Chen, Chen-Hui; Durand, Ellen; Wang, Jinhu; Zon, Leonard I; Poss, Kenneth D

    2013-12-01

    The zebrafish has become a standard model system for stem cell and tissue regeneration research, based on powerful genetics, high tissue regenerative capacity and low maintenance costs. Yet, these studies can be challenged by current limitations of tissue visualization techniques in adult animals. Here we describe new imaging methodology and present several ubiquitous and tissue-specific luciferase-based transgenic lines, which we have termed zebraflash, that facilitate the assessment of regeneration and engraftment in freely moving adult zebrafish. We show that luciferase-based live imaging reliably estimates muscle quantity in an internal organ, the heart, and can longitudinally follow cardiac regeneration in individual animals after major injury. Furthermore, luciferase-based detection enables visualization and quantification of engraftment in live recipients of transplanted hematopoietic stem cell progeny, with advantages in sensitivity and gross spatial resolution over fluorescence detection. Our findings present a versatile resource for monitoring and dissecting vertebrate stem cell and regeneration biology.

  16. [Creation of transgenic sugar beet lines expressing insect pest resistance genes cry1C and cry2A].

    PubMed

    Litvin, D I; Sivura, V V; Kurilo, V V; Oleneva, V D; Emets, A I; Blium, Ia B

    2014-01-01

    Impact of insect pests makes a significant limitation of the sugar beet crop yield. Integration of cry-genes of Bacillus thuringiensis into plant genome is one of the promising strategies to ensure plant resistance. The aim of this work was to obtain sugar beet lines (based on the MM 1/2 line) transformed with cry2A and cry1Cgenes. We have optimized transformation protocol and direct plant let regeneration protocol from leaf explants using 1 mg/l benzylaminopurine as well as 0,25 mg/l benzylaminopurine and 0,1 mg/l indole-butyric acid. Consequently, transgenic sugar beet lines transformed with vector constructs pRD400-cry1C and pRD400-cry2A have been obtained. PCR analysis revealed integration of cry2A and cry1C into genome of transgenic lines and expression of these genes in leaf tissues was shown by reverse transcription PCR.

  17. Evaluation of potato tuber moth (Lepidoptera: Gelechiidae) resistance in tubers of Bt-cry5 transgenic potato lines.

    PubMed

    Mohammed, A; Douches, D S; Pett, W; Grafius, E; Coombs, J; Liswidowati; Li, W; Madkour, M A

    2000-04-01

    The potato tuber moth, Phthorimaea operculella (Zeller), in tropical and subtropical countries, is the most destructive pest of potato, Solanum tuberosum L. The larvae attack foliage and tubers in the field and in storage. The purpose of this study was to evaluate the efficacy of a Bt-cry5 transgene to control the potato tuber moth in tuber tissues. Tuber bioassays using stored (11-12 mo old) and newly harvested tubers of Bt-cry5-Lemhi Russet and Bt-cry5-Atlantic potato lines showed up to 100% mortality of 1st instars. Mortality was lowest in the newly harvested tubers of Bt-cry5-Atlantic lines (47.1-67.6%). Potato tuber moth mortality was 100% in the Bt-cry5-Spunta lines that were transformed with Bt-cry5 gene controlled by the CaMV 35S promoter (pBIML5 vector) and in 2 of 3 lines transformed with Bt-cry5 gene controlled by the Gelvin super promoter (pBIML1 vector). The transgenic Spunta lines expressing Bt-cry5 controlled by the patatin promoter (pBMIL2 vector) showed the lowest tuber moth mortality (25.6 and 31.1%). The Bt-cry5 transgenic lines with high tuber expression of B. thuringiensis have value in an integrated pest management system to control potato tuber moth.

  18. Zebrafish Transgenic Line huORFZ Is an Effective Living Bioindicator for Detecting Environmental Toxicants

    PubMed Central

    Chu, Chien; Li, Hong-Ping; Tsai, Huai-Jen

    2014-01-01

    Reliable animal models are invaluable for monitoring the extent of pollution in the aquatic environment. In this study, we demonstrated the potential of huORFZ, a novel transgenic zebrafish line that harbors a human upstream open reading frame of the chop gene fused with GFP reporter, as an animal model for monitoring environmental pollutants and stress-related cellular processes. When huORFZ embryos were kept under normal condition, no leaked GFP signal could be detected. When treated with hazardous chemicals, including heavy metals and endocrine-disrupting chemicals near their sublethal concentrations (LC50), huORFZ embryos exhibited different tissue-specific GFP expression patterns. For further analysis, copper (Cu2+), cadmium (Cd2+) and Chlorpyrifos were applied. Cu2+ triggered GFP responses in skin and muscle, whereas Cd2+ treatment triggered GFP responses in skin, olfactory epithelium and pronephric ducts. Moreover, fluorescence intensity, as exhibited by huORFZ embryos, was dose-dependent. After surviving treated embryos were returned to normal condition, survival rates, as well as TUNEL signals, returned to pretreatment levels with no significant morphological defects observed. Such results indicated the reversibility of treatment conditions used in this study, as long as embryos survived such conditions. Notably, GFP signals decreased along with recovery, suggesting that GFP signaling of huORFZ embryos likely reflected the overall physiological condition of the individual. To examine the performance of the huORFZ line under real-world conditions, we placed huORFZ embryos in different river water samples. We found that the huORFZ embryos correctly detected the presence of various kinds of pollutants. Based on these findings, we concluded that such uORFchop-based system can be integrated into a first-line water alarm system monitoring the discharge of hazardous pollutants. PMID:24594581

  19. Developing Fiber Specific Promoter-Reporter Transgenic Lines to Study the Effect of Abiotic Stresses on Fiber Development in Cotton

    PubMed Central

    Chen, Junping; Burke, John J.

    2015-01-01

    Cotton is one of the most important cash crops in US agricultural industry. Environmental stresses, such as drought, high temperature and combination of both, not only reduce the overall growth of cotton plants, but also greatly decrease cotton lint yield and fiber quality. The impact of environmental stresses on fiber development is poorly understood due to technical difficulties associated with the study of developing fiber tissues and lack of genetic materials to study fiber development. To address this important question and provide the need for scientific community, we have generated transgenic cotton lines harboring cotton fiber specific promoter (CFSP)-reporter constructs from six cotton fiber specific genes (Expansin, E6, Rac13, CelA1, LTP, and Fb late), representing genes that are expressed at different stages of fiber development. Individual CFSP::GUS or CFSP::GFP construct was introduced into Coker 312 via Agrobacterium mediated transformation. Transgenic cotton lines were evaluated phenotypically and screened for the presence of selectable marker, reporter gene expression, and insertion numbers. Quantitative analysis showed that the patterns of GUS reporter gene activity during fiber development in transgenic cotton lines were similar to those of the native genes. Greenhouse drought and heat stress study showed a correlation between the decrease in promoter activities and decrease in fiber length, increase in micronaire and changes in other fiber quality traits in transgenic lines grown under stressed condition. These newly developed materials provide new molecular tools for studying the effects of abiotic stresses on fiber development and may be used in study of cotton fiber development genes and eventually in the genetic manipulation of fiber quality. PMID:26030401

  20. Generation of Transgenic Mouse Fluorescent Reporter Lines for Studying Hematopoietic Development

    PubMed Central

    Vacaru, Andrei M.; Vitale, Joseph; Nieves, Johnathan; Baron, Margaret H.

    2015-01-01

    During the development of the hematopoietic system, at least 8 distinct lineages are generated in the mouse embryo. Transgenic mice expressing fluorescent proteins at various points in the hematopoietic hierarchy, from hematopoietic stem cell to multipotent progenitors to each of the final differentiated cell types, have provided valuable tools for tagging, tracking, and isolating these cells. In this chapter, we discuss general considerations in designing a transgene, survey available fluorescent probes, and methods for confirming and analyzing transgene expression in the hematopoietic systems of the embryo, fetus, and postnatal/adult animal. PMID:25064110

  1. Generation of a transgenic mouse line for conditional expression of human IL-6

    PubMed Central

    Mori, Taiki; Murasawa, Yusuke; Ikai, Rina; Hayakawa, Tomoko; Nakamura, Hiroyuki; Ogiso, Noboru; Niida, Shumpei; Watanabe, Ken

    2016-01-01

    IL-6 is a cytokine that is involved in various physiological and pathological conditions, and approaches using gain-of-function transgenic animals have contributed in elucidating IL-6 function. However, studies of the multiple functions of IL-6 in vivo are very time consuming because they require the generation of transgenic mice that harbor the gene encoding IL-6 under the control of specific promoters to mimic different pathologies. Here, we report the establishment of a conditional human IL-6 transgenic mouse, LGL-IL6, which conditionally expresses human IL-6 by taking advantage of the well-characterized Cre recombinase drivers. PMID:27349442

  2. Two step male release strategy using transgenic mosquito lines to control transmission of vector-borne diseases.

    PubMed

    Carvalho, Danilo Oliveira; Costa-da-Silva, André Luis; Lees, Rosemary Susan; Capurro, Margareth Lara

    2014-04-01

    Mosquitoes are responsible for the transmission of pathogens that cause devastating human diseases such as malaria and dengue. The current increase in mean global temperature and changing sea level interfere with precipitation frequency and some other climatic conditions which, in general, influence the rate of development of insects and etiologic agents causing acceleration as the temperature rises. The most common strategy employed to combat target mosquito species is the Integrated Vector Management (IVM), which comprises the use of multiple activities and various approaches to preventing the spread of a vector in infested areas. IVM programmes are becoming ineffective; and the global scenario is threatening, requiring new interventions for vector control and surveillance. Not surprisingly, there is a growing need to find alternative methods to combat the mosquito vectors. The possibility of using transgenic mosquitoes to fight against those diseases has been discussed over the last two decades and this use of transgenic lines to suppress populations or to replace them is still under investigation through field and laboratory trials. As an alternative, the available transgenic strategies could be improved by coupling suppression and substitution strategies. The idea is to first release a suppression line to significantly reduce the wild population, and once the first objective is reached a second release using a substitution line could be then performed. Examples of targeting this approach against vectors of malaria and dengue are discussed.

  3. Germ-line deletion of p53 reveals a multistage tumor progression in spi-1/PU.1 transgenic proerythroblasts.

    PubMed

    Scolan, E L; Wendling, F; Barnache, S; Denis, N; Tulliez, M; Vainchenker, W; Moreau-Gachelin, F

    2001-09-06

    Activation of the spi-1/PU.1 proto-oncogene and loss of p53 function are genetic alterations associated with the emergence of Friend malignant erythroleukemic cells. To address the role of p53 during erythroleukemogenesis, spi-1 transgenic mice (spi-1-Tg) which develop erythroleukemia were bred with p53-deficient mice. Three classes of spi-1 transgenic mice differing in their p53 functional status (p53(+/+), p53(+/-) and p53(-/-)) were generated. These mice developed a unique pattern of erythroleukemia. In wild-type p53 spi-1-Tg mice, none of the primary erythroleukemic spleen cells displayed autonomous growth in vitro and in vivo. In contrast, in p53(+/-) spi-1-Tg mice, erythroleukemic cells gave rise to growth factor-independent cell lines and generated tumors in vivo. Malignancy was associated with loss of the wild-type p53 allele. The p53(-/-) spi-1-Tg mice developed erythroleukemia with a total incidence and a reduced latency compared to the two other genotypes. Unexpectedly, 50% of p53(-/-) spi-1-Tg erythroleukemic spleens generated cell lines that were strictly dependent upon erythropoietin (Epo) for proliferation, whereas the remainder proliferated independently of cytokines. Moreover, only 70% of these spleen cells were tumorigenic. These findings indicate that p53 germ-line deletion did not confer malignancy to spi-1-transgenic proerythroblasts. Moreover Epo independence and tumorigenicity appear as separable phenotypic characteristics revealing that the spi-1-Tg proerythroblasts progress towards malignancy through multiple oncogenic events.

  4. Cre recombinase-regulated Endothelin1 transgenic mouse lines: novel tools for analysis of embryonic and adult disorders

    PubMed Central

    Tavares, Andre L.P.; Clouthier, David E.

    2015-01-01

    Endothelin-1 (EDN1) influences both craniofacial and cardiovascular development and a number of adult physiological conditions by binding to one or both of the known endothelin receptors, thus initiating multiple signaling cascades. Animal models containing both conventional and conditional loss of the Edn1 gene have been used to dissect EDN1 function in both embryos and adults. However, while transgenic Edn1 over-expression or targeted genomic insertion of Edn1 has been performed to understand how elevated levels of Edn1 result in or exacerbate disease states, an animal model in which Edn1 over-expression can be achieved in a spatiotemporal-specific manner has not been reported. Here we describe the creation of Edn1 conditional over-expression transgenic mouse lines in which the chicken β-actin promoter and an Edn1 cDNA are separated by a strong stop sequence flanked by loxP sites. In the presence of Cre, the stop cassette is removed, leading to Edn1 expression. Using the Wnt1-Cre strain, in which Cre expression is targeted to the Wnt1-expressing domain of the central nervous system (CNS) from which neural crest cells (NCCs) arise, we show that stable CBA-Edn1 transgenic lines with varying EDN1 protein levels develop defects in NCC-derived tissues of the face, though the severity differs between lines. We also show that Edn1 expression can be achieved in other embryonic tissues utilizing other Cre strains, with this expression also resulting in developmental defects. CBA-Edn1 transgenic mice will be useful in investigating diverse aspects of EDN1-mediated-development and disease, including understanding how NCCs achieve and maintain a positional and functional identity and how aberrant EDN1 levels can lead to multiple physiological changes and diseases. PMID:25725491

  5. The Use of Transcription Terminators to Generate Transgenic Lines of Chinese Hamster Ovary Cells (CHO) with Stable and High Level of Reporter Gene Expression

    PubMed Central

    Gasanov, N. B.; Toshchakov, S. V.; Georgiev, P. G.; Maksimenko, O. G.

    2015-01-01

    Mammalian cell lines are widely used to produce recombinant proteins. Stable transgenic cell lines usually contain many insertions of the expression vector in one genomic region. Transcription through transgene can be one of the reasons for target gene repression after prolonged cultivation of cell lines. In the present work, we used the known transcription terminators from the SV40 virus, as well as the human β- and γ-globin genes, to prevent transcription through transgene. The transcription terminators were shown to increase and stabilize the expression of the EGFP reporter gene in transgenic lines of Chinese hamster ovary (CHO) cells. Hence, transcription terminators can be used to create stable mammalian cells with a high and stable level of recombinant protein production. PMID:26483962

  6. Visualization of craniofacial development in the sox10: kaede transgenic zebrafish line using time-lapse confocal microscopy.

    PubMed

    Gfrerer, Lisa; Dougherty, Max; Liao, Eric C

    2013-09-30

    Vertebrate palatogenesis is a highly choreographed and complex developmental process, which involves migration of cranial neural crest (CNC) cells, convergence and extension of facial prominences, and maturation of the craniofacial skeleton. To study the contribution of the cranial neural crest to specific regions of the zebrafish palate a sox10: kaede transgenic zebrafish line was generated. Sox10 provides lineage restriction of the kaede reporter protein to the neural crest, thereby making the cell labeling a more precise process than traditional dye or reporter mRNA injection. Kaede is a photo-convertible protein that turns from green to red after photo activation and makes it possible to follow cells precisely. The sox10: kaede transgenic line was used to perform lineage analysis to delineate CNC cell populations that give rise to maxillary versus mandibular elements and illustrate homology of facial prominences to amniotes. This protocol describes the steps to generate a live time-lapse video of a sox10: kaede zebrafish embryo. Development of the ethmoid plate will serve as a practical example. This protocol can be applied to making a time-lapse confocal recording of any kaede or similar photoconvertible reporter protein in transgenic zebrafish. Furthermore, it can be used to capture not only normal, but also abnormal development of craniofacial structures in the zebrafish mutants.

  7. Diversity of Reporter Expression Patterns in Transgenic Mouse Lines Targeting Corticotropin-Releasing Hormone-Expressing Neurons

    PubMed Central

    Molet, Jenny; Gunn, Benjamin G.; Ressler, Kerry

    2015-01-01

    Transgenic mice, including lines targeting corticotropin-releasing factor (CRF or CRH), have been extensively employed to study stress neurobiology. These powerful tools are poised to revolutionize our understanding of the localization and connectivity of CRH-expressing neurons, and the crucial roles of CRH in normal and pathological conditions. Accurate interpretation of studies using cell type-specific transgenic mice vitally depends on congruence between expression of the endogenous peptide and reporter. If reporter expression does not faithfully reproduce native gene expression, then effects of manipulating unintentionally targeted cells may be misattributed. Here, we studied CRH and reporter expression patterns in 3 adult transgenic mice: Crh-IRES-Cre;Ai14 (tdTomato mouse), Crfp3.0CreGFP, and Crh-GFP BAC. We employed the CRH antiserum generated by Vale after validating its specificity using CRH-null mice. We focused the analyses on stress-salient regions, including hypothalamus, amygdala, bed nucleus of the stria terminalis, and hippocampus. Expression patterns of endogenous CRH were consistent among wild-type and transgenic mice. In tdTomato mice, most CRH-expressing neurons coexpressed the reporter, yet the reporter identified a few non-CRH-expressing pyramidal-like cells in hippocampal CA1 and CA3. In Crfp3.0CreGFP mice, coexpression of CRH and the reporter was found in central amygdala and, less commonly, in other evaluated regions. In Crh-GFP BAC mice, the large majority of neurons expressed either CRH or reporter, with little overlap. These data highlight significant diversity in concordant expression of reporter and endogenous CRH among 3 available transgenic mice. These findings should be instrumental in interpreting important scientific findings emerging from the use of these potent neurobiological tools. PMID:26402844

  8. Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice

    SciTech Connect

    Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros

    2009-06-26

    The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.

  9. Study of heat and radiation response of a malignant, melanin-producing cell line derived from C3H 10T1/2 cells transformed in culture by radiation

    SciTech Connect

    Raaphorst, G.P.; Vadasz, J.; Azzam, E.I.

    1986-12-01

    The mouse C3H 10T1/2 cell line was transformed to the malignant state using ionizing radiation. One of the transformed lines (R25) that was isolated, displayed some properties similar to malignant melanoma cells. The cells became dark and pigmented after prolonged time in culture and this cell line produced tumors in C3H mice. The radiation survival curve of R25 had a large shoulder which was also observed for human melanoma cell lines. R25 was more resistant to heating at 45.0 degrees C than the normal cell line. Heating at 45.0 degrees C before irradiation resulted in a reduction of the survival curve shoulder. The heat and radiation sensitivity of R25 did not appear to be related to the melanin content of these cells.

  10. Assessment of Fetal Cell Chimerism in Transgenic Pig Lines Generated by Sleeping Beauty Transposition

    PubMed Central

    Garrels, Wiebke; Holler, Stephanie; Taylor, Ulrike; Herrmann, Doris; Niemann, Heiner; Ivics, Zoltan; Kues, Wilfried A.

    2014-01-01

    Human cells migrate between mother and fetus during pregnancy and persist in the respective host for long-term after birth. Fetal microchimerism occurs also in twins sharing a common placenta or chorion. Whether microchimerism occurs in multiparous mammals such as the domestic pig, where fetuses have separate placentas and chorions, is not well understood. Here, we assessed cell chimerism in litters of wild-type sows inseminated with semen of transposon transgenic boars. Segregation of three independent monomeric transposons ensured an excess of transgenic over non-transgenic offspring in every litter. Transgenic siblings (n = 35) showed robust ubiquitous expression of the reporter transposon encoding a fluorescent protein, and provided an unique resource to assess a potential cell trafficking to non-transgenic littermates (n = 7) or mothers (n = 4). Sensitive flow cytometry, fluorescence microscopy, and real-time PCR provided no evidence for microchimerism in porcine littermates, or piglets and their mothers in both blood and solid organs. These data indicate that the epitheliochorial structure of the porcine placenta effectively prevents cellular exchange during gestation. PMID:24811124

  11. Generation and characterization of transgenic plum lines expressing the Gastrodia anti-fungal protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Gastrodia anti-fungal protein (GAFP) is a monocot mannose-binding plant lectin isolated from the Asiatic orchid Gastrodia elata. This lectin has provided documented disease resistance in transgenic tobacco and cotton against several root diseases, but it's potential to confer disease resistance...

  12. Nutritional properties of tubers of conventionally bred and transgenic lines of potato resistant to necrotic strain of Potato virus Y (PVYN).

    PubMed

    Juśkiewicz, Jerzy; Zduńczyk, Zenon; Fornal, Józef

    2005-01-01

    The potential effect of genetic modification on nutritional properties of potatoes transformed to improve resistance to a necrotic strain of Potato virus Y was determined in a rat experiment. Autoclaved tubers from four transgenic lines were included to a diet in the amount of 40% and compared with the conventional cv. Irga. The experiment lasted 3 weeks and special attention was paid to nutritional properties of diets, caecal metabolism and serum indices. Genetic modification of potato had no negative effect on the chemical composition and nutritional properties of tubers, ecosystem of the caecum, activity of serum enzymes and non-specific defence mechanism of the rats. Obtained results indicate that transgenic potato with improved resistance to PVY(N): line R1F (truncated gene coding for PVY(N) polymerase in sense orientation), R2P (truncated gene coding for PVY(N) polymerase in antisense orientation), and NTR1.16 (non-translated regions of PVY(N) genome in sense orientation) are substantial and nutritional equivalence to the non-transgenic cultivar. Tubers of transgenic line NTR2.27 (non-translated regions of PVY(N) genome in antisense orientation) increased the bulk of caecal digesta and the production of SCFA as compared to tubers of the conventional cultivar and the other transgenic clones. Taking into account some deviations, it seems reasonable to undertake a long-term feeding study to confirm the nutritional properties of tubers of transgenic lines.

  13. The plasticizer BBP selectively inhibits epigenetic regulator sirtuin during differentiation of C3H10T1/2 stem cell line.

    PubMed

    Zhang, Jian; Choudhury, Mahua

    2017-03-01

    Exposure to environmental chemicals can perturb an individual's metabolic set point, especially during critical periods of development, and as a result increase his or her propensity towards obesity that is manifested later in life and possibly in successive generations. We hypothesized that benzyl butyl phthalate (BBP), a widespread endocrine disruptor, may impair one important epigenetic regulator, sirtuin, in mesenchymal stem cells and induce adipogenesis. Our results showed that gene expression of two well-known adipogenic markers, aP2 and PPARγ, were significantly increased from day 2 to day 8 under 50μM BBP exposure when compared to control in C3H10T1/2 stem cells (p<0.05) and induced adipogenesis. Sirt1 gene expression was also significantly decreased at day 2, 4, 6, and 8 (p<0.05). However, Sirt7 gene expression was decreased only at day 2 and 8 (p<0.05) while other sirtuin transcriptional levels remained unaltered throughout. Furthermore, Sirt1 and Sirt3 protein expression was decreased (p<0.05) and overall protein hyperacetylation was observed at day 8. Furthermore, FOXO1 and β-catenin, Sirt1 targets and adipogenesis regulators, were hyperacetylated at day 8. PGC1α, NRF1, NRF2, and Tfam, were also significantly decreased (p<0.05). In conclusion, our study suggests for the first time that BBP, a potential epigenetic disruptor, can lead to increased adipogenesis and metabolic dysregulation by impairing vital epigenetic regulators.

  14. Cardiac T1 Imaging

    PubMed Central

    Jerosch-Herold, Michael; Kwong, Raymond Y.

    2014-01-01

    T1 mapping of the heart has evolved into a valuable tool to evaluate myocardial tissue properties, with or without contrast injection, including assessment of myocardial edema and free water content, extra-cellular volume (expansion), and most recently cardiomyocyte hypertrophy. The MRI pulse sequence techniques developed for these applications have had to address at least two important considerations for cardiac applications: measure magnetization inversion recoveries during cardiac motion with sufficient temporal resolution for the shortest expected T1 values, and, secondly, obtain these measurements within a time during which a patient can comfortably suspend breathing. So-called Look-Locker techniques, and variants thereof, which all sample multiple points of a magnetization recovery after each magnetization preparation have therefore become a mainstay in this field. The rapid pace of advances and new findings based on cardiac T1 mapping for assessment of diffuse fibrosis, or myocardial edema show that these techniques enrich the capabilities of MRI for myocardial tissue profiling, which is arguably unmatched by other cardiac imaging modalities. PMID:24509619

  15. Molecular cytogenetic analyses of HIG, a novel human cell line carrying t(1;3)(p36.3;q25.3) established from a patient with chronic myelogenous leukemia in blastic crisis.

    PubMed

    Hosoya, Noriko; Ogawa, Seishi; Motokura, Tohru; Hangaishi, Akira; Wang, Lili; Qiao, Ying; Nannya, Yasuhito; Kogi, Mieko; Hirai, Hisamaru

    2003-12-01

    Chromosomal abnormalities involving 1p36, 3q21, and/or 3q26 have been reported in a subset of myeloid neoplasms having characteristic dysmegakaryopoiesis, and the overexpression of EVI1 on 3q26 or of MEL1 on 1p36 has been implicated in their pathogenesis. We describe molecular cytogenetic analyses of a novel human cell line, HIG, established from a unique case in which a novel translocation t(1;3)(p36;q26) appeared as the sole additional chromosomal abnormality at the time of blastic transformation of chronic myelogenous leukemia. The patient displayed clinical features resembling those of the 3q21q26 syndrome. The HIG cell line retained der(1)t(1;3)(p36;q26) but lost t(9;22)(q34;q11). To identify the relevant gene that would be deregulated by this translocation, we molecularly cloned the translocation's breakpoints. They were distant from the breakpoint cluster regions of the 3q21q26 syndrome or t(1;3)(p36;q21), and neither the EVI1 nor the MEL1 transcript was detected in the HIG cell line. None of the genes located within 150 kilobase pairs of the breakpoints were aberrantly expressed, suggesting that in this case other gene(s) more distant from the breakpoints are deregulated by possible remote effects. Further analyses of the deregulated genes in the HIG cell line should provide important insight into the mechanisms involved in these types of leukemias.

  16. A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis.

    PubMed

    Marquès-Bueno, Maria Mar; Morao, Ana K; Cayrel, Anne; Platre, Matthieu P; Barberon, Marie; Caillieux, Erwann; Colot, Vincent; Jaillais, Yvon; Roudier, François; Vert, Grégory

    2016-01-01

    Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis.

  17. A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis

    PubMed Central

    Platre, Matthieu Pierre; Barberon, Marie; Caillieux, Erwann; Colot, Vincent

    2016-01-01

    Summary Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936

  18. c-RET Molecule in Malignant Melanoma from Oncogenic RET-Carrying Transgenic Mice and Human Cell Lines

    PubMed Central

    Takeda, Kozue; Iida, Machiko; Kumasaka, Mayuko; Matsumoto, Yoshinari; Kato, Masashi

    2010-01-01

    Malignant melanoma is one of the most aggressive cancers and its incidence worldwide has been increasing at a greater rate than that of any other cancer. We previously reported that constitutively activated RFP-RET-carrying transgenic mice (RET-mice) spontaneously develop malignant melanoma. In this study, we showed that expression levels of intrinsic c-Ret, glial cell line-derived neurotrophic factor (Gdnf) and Gdnf receptor alpha 1 (Gfra1) transcripts in malignant melanomas from RET-transgenic mice were significantly upregulated compared with those in benign melanocytic tumors. These results suggest that not only introduced oncogenic RET but also intrinsic c-Ret/Gdnf are involved in murine melanomagenesis in RET-mice. We then showed that c-RET and GDNF transcript expression levels in human malignant melanoma cell lines (HM3KO and MNT-1) were higher than those in primary cultured normal human epithelial melanocytes (NHEM), while GFRa1 transcript expression levels were comparable among NHEM, HM3KO and MNT-1. We next showed c-RET and GFRa1 protein expression in HM3KO cells and GDNF-mediated increased levels of their phosphorylated c-RET tyrosine kinase and signal transduction molecules (ERK and AKT) sited potentially downstream of c-RET. Taken together with the finding of augmented proliferation of HM3KO cells after GDNF stimulation, our results suggest that GDNF-mediated c-RET kinase activation is associated with the pathogenesis of malignant melanoma. PMID:20422010

  19. T-1 Training Area

    ScienceCinema

    None

    2016-07-12

    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  20. T-1 Training Area

    SciTech Connect

    2014-11-07

    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  1. Development of transgenic lines of Eimeria tenella expressing M2e-enhanced yellow fluorescent protein (M2e-EYFP).

    PubMed

    Liu, Xianyong; Zou, Jun; Yin, Guangwen; Su, Huali; Huang, Xiaoxi; Li, Jianan; Xie, Li; Cao, Yingqiong; Cui, Yujuan; Suo, Xun

    2013-03-31

    Eimeria parasites are obligate intracellular apicomplexan protists that can cause coccidiosis, resulting in substantial economic losses in the poultry industry annually. As the component of anticoccidial vaccines, seven Eimeria spp. of chickens are characterized with potent immunogenicity. Whether genetically modified Eimeria spp. maintains this property or not needs to be verified. In this study, two identical transgenic lines of Eimeria tenella were developed by virtue of single sporocyst isolation from a stably transfected population expressing fused protein of M2 ectodomain of avian influenza virus (M2e) and enhanced yellow fluorescent protein (EYFP). The chromosomal integration and expression of M2e-EYFP were confirmed by Southern blot, plasmid rescue and Western blot analysis. We found that the reproduction of transgenic parasites was higher than that of the parental strain. Chickens challenged with wild type E. tenella after immunization with 200 oocysts of transgenic parasites had similar performance compared to those in non-immunized and non-challenged group. In another trial, the performance of transgenic parasite-immunized birds was also comparable to that of the Decoquinate Premix-treated chickens. These results suggest that this transgenic line of E. tenella is capable of inducing potent protection against homologous challenge as a live anticoccidial vaccine. Taking together, our study indicates that transgenic eimerian parasites have the potential to be developed as a vaccine vehicle for animal use in the future.

  2. MOUSE TRANSGENIC LINES THAT SELECTIVELY LABEL TYPE I, TYPE IIA AND TYPES IIX+B SKELETAL MUSCLE FIBERS

    PubMed Central

    Chakkalakal, Joe V.; Kuang, Shihuan; Buffelli, Mario; Lichtman, Jeff W.; Sanes, Joshua R.

    2014-01-01

    Skeletal muscle fibers vary in contractile and metabolic properties. Four main fiber types are present in mammalian trunk and limb muscles; they are called I, IIA, IIX and IIB, ranging from slowest- to fastest-contracting. Individual muscles contain stereotyped proportions of two or more fiber types. Fiber type is determined by a combination of nerve-dependent and –independent influences, leading to formation of “homogeneous motor units” in which all branches of a single motor neuron form synapses on fibers of a single type. Fiber type composition of muscles can be altered in adulthood by multiple factors including exercise, denervation, hormones and aging. To facilitate analysis of muscle development, plasticity and innervation, we generated transgenic mouse lines in which Type I, Type IIA, and Type IIX+B fibers can be selectively labeled with distinguishable fluorophores. We demonstrate their use for motor unit reconstruction and live imaging of nerve-dependent alterations in fiber type. PMID:21898764

  3. Cotton GalT1 Encoding a Putative Glycosyltransferase Is Involved in Regulation of Cell Wall Pectin Biosynthesis during Plant Development

    PubMed Central

    Qin, Li-Xia; Rao, Yue; Li, Long; Huang, Jun-Feng; Xu, Wen-Liang; Li, Xue-Bao

    2013-01-01

    Arabinogalactan proteins (AGPs), are a group of highly glycosylated proteins that are found throughout the plant kingdom. To date, glycosyltransferases that glycosylate AGP backbone have remained largely unknown. In this study, a gene (GhGalT1) encoding a putative β-1,3-galactosyltransferase (GalT) was identified in cotton. GhGalT1, belonging to CAZy GT31 family, is the type II membrane protein that contains an N-terminal transmembrane domain and a C-terminal galactosyltransferase functional domain. A subcellular localization assay demonstrated that GhGalT1 was localized in the Golgi apparatus. RT-PCR analysis revealed that GhGalT1 was expressed at relatively high levels in hypocotyls, roots, fibers and ovules. Overexpression of GhGalT1 in Arabidopsis promoted plant growth and metabolism. The transgenic seedlings had much longer primary roots, higher chlorophyll content, higher photosynthetic efficiency, the increased biomass, and the enhanced tolerance to exogenous D-arabinose and D-galactose. In addition, gas chromatography (GC) analysis of monosaccharide composition of cell wall fractions showed that pectin was changed in the transgenic plants, compared with that of wild type. Three genes (GAUT8, GAUT9 and xgd1) involved in pectin biosynthesis were dramatically up-regulated in the transgenic lines. These data suggested that GhGalT1 may be involved in regulation of pectin biosynthesis required for plant development. PMID:23527103

  4. Cotton GalT1 encoding a putative glycosyltransferase is involved in regulation of cell wall pectin biosynthesis during plant development.

    PubMed

    Qin, Li-Xia; Rao, Yue; Li, Long; Huang, Jun-Feng; Xu, Wen-Liang; Li, Xue-Bao

    2013-01-01

    Arabinogalactan proteins (AGPs), are a group of highly glycosylated proteins that are found throughout the plant kingdom. To date, glycosyltransferases that glycosylate AGP backbone have remained largely unknown. In this study, a gene (GhGalT1) encoding a putative β-1,3-galactosyltransferase (GalT) was identified in cotton. GhGalT1, belonging to CAZy GT31 family, is the type II membrane protein that contains an N-terminal transmembrane domain and a C-terminal galactosyltransferase functional domain. A subcellular localization assay demonstrated that GhGalT1 was localized in the Golgi apparatus. RT-PCR analysis revealed that GhGalT1 was expressed at relatively high levels in hypocotyls, roots, fibers and ovules. Overexpression of GhGalT1 in Arabidopsis promoted plant growth and metabolism. The transgenic seedlings had much longer primary roots, higher chlorophyll content, higher photosynthetic efficiency, the increased biomass, and the enhanced tolerance to exogenous D-arabinose and D-galactose. In addition, gas chromatography (GC) analysis of monosaccharide composition of cell wall fractions showed that pectin was changed in the transgenic plants, compared with that of wild type. Three genes (GAUT8, GAUT9 and xgd1) involved in pectin biosynthesis were dramatically up-regulated in the transgenic lines. These data suggested that GhGalT1 may be involved in regulation of pectin biosynthesis required for plant development.

  5. Generating a transgenic mouse line stably expressing human MHC surface antigen from a HAC carrying multiple genomic BACs.

    PubMed

    Hasegawa, Yoshinori; Ishikura, Tomoyuki; Hasegawa, Takanori; Watanabe, Takashi; Suzuki, Junpei; Nakayama, Manabu; Okamura, Yoshiaki; Okazaki, Tuneko; Koseki, Haruhiko; Ohara, Osamu; Ikeno, Masashi; Masumoto, Hiroshi

    2015-03-01

    The human artificial chromosome (HAC) vector is a promising tool to improve the problematic suppression and position effects of transgene expression frequently seen in transgenic cells and animals produced by conventional plasmid or viral vectors. We generated transgenic mice maintaining a single HAC vector carrying two genomic bacterial artificial chromosomes (BACs) from human HLA-DR loci (DRA and DRB1). Both transgenes on the HAC in transgenic mice exhibited tissue-specific expression in kidney, liver, lung, spleen, lymph node, bone marrow, and thymus cells in RT-PCR analysis. Stable functional expression of a cell surface HLA-DR marker from both transgenes, DRA and DRB1 on the HAC, was detected by flow cytometric analysis of splenocytes and maintained through at least eight filial generations. These results indicate that the de novo HAC system can allow us to manipulate multiple BAC transgenes with coordinated expression as a surface antigen through the generation of transgenic animals.

  6. The β-actin gene promoter of rohu carp (Labeo rohita) drives reporter gene expressions in transgenic rohu and various cell lines, including spermatogonial stem cells.

    PubMed

    Barman, Hirak Kumar; Mohanta, Ramya; Patra, Swagat Kumar; Chakrapani, Vemulawada; Panda, Rudra Prasanna; Nayak, Swapnarani; Jena, Sasmita; Jayasankar, Pallipuram; Nandanpawar, Priyanka

    2015-06-01

    We previously characterized the β-actin gene promoter of Indian domesticated rohu carp (Labeo rohita) and made a reporter construct via fusion to green fluorescence protein (GFP) cDNA. In this study, the same construct was used to breed transgenic rohu fish. About 20% of the transgenic offspring showed ubiquitous expression of the reporter GFP gene. In a few of the transgenic fish, we documented massive epithelial and/or muscular expression with visible green color under normal light. The expression of GFP mRNA was higher in the muscle tissue of transgenic fish than in that of non-transgenic fish. A highly efficient nucleofection protocol was optimized to transfect proliferating spermatogonial cells of rohu using this reporter construct. The β-actin promoter also drove expressions in HEK293 (derived from human embryonic kidney cells), K562 (human leukemic cells) and SF21 (insect ovarian cells) lines. These findings imply conserved regulatory mechanisms of β-actin gene expression across eukaryotes. Furthermore, the isolated β-actin promoter with consensus regulatory elements has the potential to be used in generating transgenic carp with genes of interest and in basic biology research.

  7. Umbelliprenin is Potentially Toxic Against the HT29, CT26, MCF-7, 4T1, A172, and GL26 Cell Lines, Potentially Harmful Against Bone Marrow-Derived Stem Cells, and Non-Toxic Against Peripheral Blood Mononuclear Cells

    PubMed Central

    Rashidi, Mohsen; Ziai, Seyed Ali; Moini Zanjani, Taraneh; Khalilnezhad, Ahad; Jamshidi, Hamidreza; Amani, Davar

    2016-01-01

    Background Resistance to chemotherapy is a growing concern, thus natural anticancer agents are drawing the attention of many scientists and clinicians. One natural anticancer agent, umbelliprenin, is a coumarin produced by many species of Ferula. Objectives We aimed to examine the inhibitory effect of umbelliprenin on human and mouse bone marrow-derived stem cells (BMDSCs), peripheral blood mononuclear cells (PBMCs), and different cancer cell lines. Materials and Methods In this in vitro experimental study, the HT29, CT26, MCF-7, 4T1, A172, and GL26 cancer cells and human and mouse BMDSCs and PBMCs were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), incubated at 37°C for 24 hours in a 5% CO2 atmosphere, and then were treated with different concentrations of umbelliprenin dissolved in dimethyl sulfoxide (DMSO) (3, 6, 12, 25, 50, 100, and 200 µg/mL) for 24, 48, and 72 hours at 37°C. Each experiment was performed in triplicate. Finally, the cell survival rate was assessed by MTT assay. The IC50 values were calculated based on the log values using GraphPad Prism version 5 software for windows (La Jolla CA, USA) and were expressed as mean ± SEM. Results Umbelliprenin inhibited the cancer cells in a concentration-dependent (P < 0.05) but not time-dependent manner (P > 0.05). The most sensitive and resistant cell lines at the 24-hour incubation time were 4T1 (IC50, 30.9 ± 3.1 µg/mL) and A172 (IC50, 51.9 ± 6.7 µg/mL); at the 48-hour incubation time: 4T1 (IC50, 30.6 ± 2.6 µg/mL) and CT26 (IC50, 53.2 ± 3.6 µg/mL); and at the 72-hour incubation time: HT29 (IC50, 37.1 ± 1.4 µg/mL) and 4T1 (IC50, 62.2 ± 4.8 µg/mL). Both human and mouse BMDSCs showed the highest resistance at the 24-hour incubation time (IC50s, 254.7 ± 21 and 204.4 ± 4.5 µg/mL, respectively) and the highest sensitivity at the 72-hour incubation time (IC50s, 120.4 ± 5 and 159.0 ± 7.3 µg/mL, respectively). The PBMCs of both human and mouse origin revealed very

  8. A new transgenic rice line exhibiting enhanced ferric iron reduction and phytosiderophore production confers tolerance to low iron availability in calcareous soil.

    PubMed

    Masuda, Hiroshi; Shimochi, Erika; Hamada, Tatsuro; Senoura, Takeshi; Kobayashi, Takanori; Aung, May Sann; Ishimaru, Yasuhiro; Ogo, Yuko; Nakanishi, Hiromi; Nishizawa, Naoko K

    2017-01-01

    Iron (Fe) deficiency is a critical agricultural problem, especially in calcareous soil, which is distributed worldwide. Rice plants take up Fe(II) from soil through a OsIRT1 transporter (Strategy I-related system) and also take up Fe(III) via a phytosiderophore-based system (Strategy II system). However, rice plants are susceptible to low-Fe conditions because they have low Fe(III) reduction activity and low-level phytosiderophore secretion. Previously, we produced transgenic rice plants expressing a mutationally reconstructed yeast ferric chelate reductase, refre1/372, under the control of the OsIRT1 promoter. This transgenic rice line exhibited higher Fe(III) chelate reductase activity and tolerance to Fe deficiency. In addition, we produced transgenic rice overexpressing the Fe deficiency-inducible transcription factor, OsIRO2, which regulates the expression of various genes involved in the strategy II Fe(III) uptake system, including OsNAS1, OsNAAT1, OsDMAS1, OsYSL15, and TOM1. This transgenic rice exhibited improved phytosiderophore secretion ability and tolerance to Fe deficiency. In the present research, transgenic rice plants that possess both the OsIRT1 promoter-refre1/372 and the 35S promoter-OsIRO2 (RI lines) were produced to enhance both Strategy I Fe(II) reductase ability and Strategy II phytosiderophore productivity. RI lines exhibited enhanced tolerance to Fe-deficient conditions at the early and middle-late stages of growth in calcareous soil, compared to both the non-transgenic line and lines harboring either OsIRT1 promoter-refre1/372 or 35S promoter-OsIRO2 alone. RI lines also exhibited a 9-fold higher yield than the non-transgenic line. Moreover, we successfully produced Fe-deficiency-tolerant Tachisugata rice, which is a high-biomass variety used as fodder. Collectively, our results demonstrate that combined enhancement of two Fe uptake systems in rice is highly effective in conferring tolerance to low Fe availability in calcareous soil.

  9. A new transgenic rice line exhibiting enhanced ferric iron reduction and phytosiderophore production confers tolerance to low iron availability in calcareous soil

    PubMed Central

    Hamada, Tatsuro; Senoura, Takeshi; Kobayashi, Takanori; Aung, May Sann; Ishimaru, Yasuhiro; Ogo, Yuko; Nakanishi, Hiromi; Nishizawa, Naoko K.

    2017-01-01

    Iron (Fe) deficiency is a critical agricultural problem, especially in calcareous soil, which is distributed worldwide. Rice plants take up Fe(II) from soil through a OsIRT1 transporter (Strategy I-related system) and also take up Fe(III) via a phytosiderophore-based system (Strategy II system). However, rice plants are susceptible to low-Fe conditions because they have low Fe(III) reduction activity and low-level phytosiderophore secretion. Previously, we produced transgenic rice plants expressing a mutationally reconstructed yeast ferric chelate reductase, refre1/372, under the control of the OsIRT1 promoter. This transgenic rice line exhibited higher Fe(III) chelate reductase activity and tolerance to Fe deficiency. In addition, we produced transgenic rice overexpressing the Fe deficiency-inducible transcription factor, OsIRO2, which regulates the expression of various genes involved in the strategy II Fe(III) uptake system, including OsNAS1, OsNAAT1, OsDMAS1, OsYSL15, and TOM1. This transgenic rice exhibited improved phytosiderophore secretion ability and tolerance to Fe deficiency. In the present research, transgenic rice plants that possess both the OsIRT1 promoter-refre1/372 and the 35S promoter-OsIRO2 (RI lines) were produced to enhance both Strategy I Fe(II) reductase ability and Strategy II phytosiderophore productivity. RI lines exhibited enhanced tolerance to Fe-deficient conditions at the early and middle-late stages of growth in calcareous soil, compared to both the non-transgenic line and lines harboring either OsIRT1 promoter-refre1/372 or 35S promoter-OsIRO2 alone. RI lines also exhibited a 9-fold higher yield than the non-transgenic line. Moreover, we successfully produced Fe-deficiency-tolerant Tachisugata rice, which is a high-biomass variety used as fodder. Collectively, our results demonstrate that combined enhancement of two Fe uptake systems in rice is highly effective in conferring tolerance to low Fe availability in calcareous soil. PMID

  10. Behavior of the hobo transposable element with regard to TPE repeats in transgenic lines of Drosophila melanogaster.

    PubMed

    Souames, Sémi; Bazin, Claude; Bonnivard, Eric; Higuet, Dominique

    2003-12-01

    The hobo transposable element of Drosophila melanogaster is known to induce a hybrid dysgenesis syndrome. Moreover it displays a polymorphism of a microsatellite in its coding region: TPE repeats. In European populations, surveys of the distribution of hobo elements with regard to TPE repeats revealed that the 5TPE element is distributed along a frequency gradient, and it is even more frequent than the 3TPE element in Western populations. This suggests that the invasive ability of the hobo elements could be related to the number of TPE repeats they contain. To test this hypothesis we monitored the evolution of 16 lines derived from five initial independent transgenic lines bearing the 3TPE element and/or the 5TPE element. Four lines bearing 5TPE elements and four bearing 3TPE elements were used as a noncompetitive genetic background to compare the evolution of the 5TPE element to that of the 3TPE element. Eight lines bearing both elements provided a competitive genetic context to study potential interactions between these two elements. We studied genetic and molecular aspects of the first 20 generations. At the molecular level, we showed that the 5TPE element is able to spread within the genome at least as efficiently as the 3TPE element. Surprisingly, at the genetic level we found that the 5TPE element is less active than the 3TPE element, and moreover may be able to regulate the activity of the 3TPE element. Our findings suggest that the invasive potential of the 5TPE element could be due not only to its intrinsic transposition capacity but also to a regulatory potential.

  11. A new transgenic mouse line for tetracycline inducible transgene expression in mature melanocytes and the melanocyte stem cells using the Dopachrome tautomerase promoter.

    PubMed

    Woods, Susan L; Bishop, J Michael

    2011-04-01

    We have generated a novel transgenic mouse to direct inducible and reversible transgene expression in the melanocytic compartment. The Dopachrome tautomerase (Dct) control sequences we used are active early in the development of melanocytes and so this system was designed to enable the manipulation of transgene expression during development in utero and in the melanocyte stem cells as well as mature melanocytes. We observed inducible lacZ and GFP reporter transgene activity specifically in melanocytes and melanocyte stem cells in mouse skin. This mouse model will be a useful tool for the pigment cell community to investigate the contribution of candidate genes to normal melanocyte and/or melanoma development in vivo. Deregulated expression of the proto-oncogene MYC has been observed in melanoma, however whether MYC is involved in tumorigenesis in pigment cells has yet to be directly investigated in vivo. We have used our system to over-express MYC in the melanocytic compartment and show for the first time that increased MYC expression can indeed promote melanocytic tumor formation.

  12. A Phox2b BAC Transgenic Rat Line Useful for Understanding Respiratory Rhythm Generator Neural Circuitry

    PubMed Central

    Ikeda, Keiko; Takahashi, Masanori; Sato, Shigeru; Igarashi, Hiroyuki; Ishizuka, Toru; Yawo, Hiromu; Arata, Satoru; Southard-Smith, E. Michelle; Kawakami, Kiyoshi; Onimaru, Hiroshi

    2015-01-01

    The key role of the respiratory neural center is respiratory rhythm generation to maintain homeostasis through the control of arterial blood pCO2/pH and pO2 levels. The neuronal network responsible for respiratory rhythm generation in neonatal rat resides in the ventral side of the medulla and is composed of two groups; the parafacial respiratory group (pFRG) and the pre-Bötzinger complex group (preBötC). The pFRG partially overlaps in the retrotrapezoid nucleus (RTN), which was originally identified in adult cats and rats. Part of the pre-inspiratory (Pre-I) neurons in the RTN/pFRG serves as central chemoreceptor neurons and the CO2 sensitive Pre-I neurons express homeobox gene Phox2b. Phox2b encodes a transcription factor and is essential for the development of the sensory-motor visceral circuits. Mutations in human PHOX2B cause congenital hypoventilation syndrome, which is characterized by blunted ventilatory response to hypercapnia. Here we describe the generation of a novel transgenic (Tg) rat harboring fluorescently labeled Pre-I neurons in the RTN/pFRG. In addition, the Tg rat showed fluorescent signals in autonomic enteric neurons and carotid bodies. Because the Tg rat expresses inducible Cre recombinase in PHOX2B-positive cells during development, it is a potentially powerful tool for dissecting the entire picture of the respiratory neural network during development and for identifying the CO2/O2 sensor molecules in the adult central and peripheral nervous systems. PMID:26147470

  13. Effect of vegetation of transgenic Bt rice lines and their straw amendment on soil enzymes, respiration, functional diversity and community structure of soil microorganisms under field conditions.

    PubMed

    Fang, Hua; Dong, Bin; Yan, Hu; Tang, Feifan; Wang, Baichuan; Yu, Yunlong

    2012-01-01

    With the development of transgenic crops, there is an increasing concern about the possible adverse effects of their vegetation and residues on soil environmental quality. This study was carried out to evaluate the possible effects of the vegetation of transgenic Bt rice lines Huachi B6 (HC) and TT51 (TT) followed by the return of their straw to the soil on soil enzymes (catalase, urease, neutral phosphatase and invertase), anaerobic respiration activity, microbial utilization of carbon substrates and community structure, under field conditions. The results indicated that the vegetation of the two transgenic rice lines (HC and TT) and return of their straw had few adverse effects on soil enzymes and anaerobic respiration activity compared to their parent and distant parent, although some transient differences were observed. The vegetation and subsequent straw amendment of Bt rice HC and TT did not appear to have a harmful effect on the richness, evenness and community structure of soil microorganisms. No different pattern of impact due to plant species was found between HC and TT. It could be concluded that the vegetation of transgenic Bt rice lines and the return of their straw as organic fertilizer may not alter soil microbe-mediated functions.

  14. Transgenic barley lines prove the involvement of TaCBF14 and TaCBF15 in the cold acclimation process and in frost tolerance.

    PubMed

    Soltész, Alexandra; Smedley, Mark; Vashegyi, Ildikó; Galiba, Gábor; Harwood, Wendy; Vágújfalvi, Attila

    2013-04-01

    The enhancement of winter hardiness is one of the most important tasks facing breeders of winter cereals. For this reason, the examination of those regulatory genes involved in the cold acclimation processes is of central importance. The aim of the present work was the functional analysis of two wheat CBF transcription factors, namely TaCBF14 and TaCBF15, shown by previous experiments to play a role in the development of frost tolerance. These genes were isolated from winter wheat and then transformed into spring barley, after which the effect of the transgenes on low temperature stress tolerance was examined. Two different types of frost tests were applied; plants were hardened at low temperature before freezing, or plants were subjected to frost without a hardening period. The analysis showed that TaCBF14 and TaCBF15 transgenes improve the frost tolerance to such an extent that the transgenic lines were able to survive freezing temperatures several degrees lower than that which proved lethal for the wild-type spring barley. After freezing, lower ion leakage was measured in transgenic leaves, showing that these plants were less damaged by the frost. Additionally, a higher Fv/Fm parameter was determined, indicating that photosystem II worked more efficiently in the transgenics. Gene expression studies showed that HvCOR14b, HvDHN5, and HvDHN8 genes were up-regulated by TaCBF14 and TaCBF15. Beyond that, transgenic lines exhibited moderate retarded development, slower growth, and minor late flowering compared with the wild type, with enhanced transcript level of the gibberellin catabolic HvGA2ox5 gene.

  15. Detection of feral GT73 transgenic oilseed rape (Brassica napus) along railway lines on entry routes to oilseed factories in Switzerland.

    PubMed

    Hecht, Mirco; Oehen, Bernadette; Schulze, Jürg; Brodmann, Peter; Bagutti, Claudia

    2014-01-01

    To obtain a reference status prior to cultivation of genetically modified oilseed rape (OSR, Brassica napus L.) in Switzerland, the occurrence of feral OSR was monitored along transportation routes and at processing sites. The focus was set on the detection of (transgenic) OSR along railway lines from the Swiss borders with Italy and France to the respective oilseed processing factories in Southern and Northern Switzerland (Ticino and region of Basel). A monitoring concept was developed to identify sites of largest risk of escape of genetically modified plants into the environment in Switzerland. Transport spillage of OSR seeds from railway goods cars particularly at risk hot spots such as switch yards and (un)loading points but also incidental and continuous spillage were considered. All OSR plants, including their hybridization partners which were collected at the respective monitoring sites were analyzed for the presence of transgenes by real-time PCR. On sampling lengths each of 4.2 and 5.7 km, respectively, 461 and 1,574 plants were sampled in Ticino and the region of Basel. OSR plants were found most frequently along the routes to the oilseed facilities, and in larger amounts on risk hot spots compared to sites of random sampling. At three locations in both monitored regions, transgenic B. napus line GT73 carrying the glyphosate resistance transgenes gox and CP4 epsps were detected (Ticino, 22 plants; in the region of Basel, 159).

  16. Establishment of a preadipocyte cell line derived from mature adipocytes of GFP transgenic mice and formation of adipose tissue.

    PubMed

    Nobusue, Hiroyuki; Endo, Tsuyoshi; Kano, Koichiro

    2008-06-01

    We established a preadipocyte cell line from mature adipocytes obtained from subcutaneous fat tissue of green fluorescent protein (GFP) transgenic mice. The floating top layer, containing mature adipocytes, was isolated from subcutaneous fat tissue by collagenase digestion and filtration. Fluorescence-activated cell sorting and microscopic analysis revealed that the floating cell fraction comprised a highly homogeneous adipocyte population with no adipose stromal-vascular cells. Isolated mature adipocytes dedifferentiated into fibroblast-like cells and actively proliferated in ceiling culture. In vitro studies showed that the cells could redifferentiate into mature adipocytes in an identical way to 3T3-L1 preadipocytes. No changes in the differentiation pattern were observed during the propagation of our cells. They were successfully maintained and differentiated for at least 22 passages. We named these cells dedifferentiated fat (DFAT-GFP) cells. When DFAT-GFP cells were implanted subcutaneously into C57BL/6N mice, they developed highly vascularized fat pads that morphologically resembled normal subcutaneous adipose tissue and consisted of GFP-positive cells; however, implanted 3T3-L1 cells did not have such an effect on the mice. We conclude that DFAT-GFP cells provide a model that should enable us to study the mechanisms of adipocyte differentiation and adipose tissue formation in vivo and in vitro.

  17. Generation of hermaphrodite transgenic papaya lines with virus resistance via transformation of somatic embryos derived from adventitious roots of in vitro shoots.

    PubMed

    Kung, Yi-Jung; Yu, Tsong-Ann; Huang, Chiung-Huei; Wang, Hui-Chin; Wang, Shin-Lan; Yeh, Shyi-Dong

    2010-08-01

    Papaya production is seriously limited by Papaya ringspot virus (PRSV) worldwide and Papaya leaf-distortion mosaic virus (PLDMV) in Eastern Asia. An efficient transformation method for developing papaya lines with transgenic resistance to these viruses and commercially desirable traits, such as hermaphroditism, is crucial to shorten the breeding program for this fruit crop. In this investigation, an untranslatable chimeric construct pYP08 containing truncated PRSV coat protein (CP) and PLDMV CP genes coupled with the 3' untranslational region of PLDMV, was generated. Root segments from different portions of adventitious roots of in vitro multiple shoots of hermaphroditic plants of papaya cultivars 'Tainung No. 2', 'Sunrise', and 'Thailand' were cultured on induction medium for regeneration into somatic embryos. The highest frequency of somatic embryogenesis was from the root-tip segments of adventitious roots developed 2-4 weeks after rooting in perlite medium. After proliferation, embryogenic tissues derived from somatic embryos were wounded in liquid-phase by carborundum and transformed by Agrobacterium carrying pYP08. Similarly, another construct pBG-PLDMVstop containing untranslatable CP gene of PLDMV was also transferred to 'Sunrise' and 'Thailand', the parental cultivars of 'Tainung No. 2'. Among 107 transgenic lines regenerated from 349 root-tip segments, nine lines of Tainung No. 2 carrying YP08 were highly resistant to PRSV and PLDMV, and 9 lines (8 'Sunrise' and 1 'Thailand') carrying PLDMV CP highly resistant to PLDMV, by a mechanism of post-transcriptional gene silencing. The hermaphroditic characteristics of the transgenic lines were confirmed by PCR with sex-linked primers and phenotypes of flower and fruit. Our approach has generated transgenic resistance to both PRSV and PLDMV with commercially desirable characters and can significantly shorten the time-consuming breeding programs for the generation of elite cultivars of papaya hybrids.

  18. Inducible responses to DNA damage in the mouse embryo fibroblasts cell line C3H/10T1/2 and its transformed counterpart C3H/MCA

    SciTech Connect

    Miller, L.S.

    1987-01-01

    Early passage mouse embryo fibroblasts cells (C3H/10T1/2) were treated with ultraviolet (UV) radiation of 12-O-tetradecanoylphorbol-13-acetate (TPA) in order to determine whether such treatment induced DNA repair processes, measured as increased survival and mutagenesis of Herpes simplex (HSV-1). No enhanced host cell reactivation of UV-irradiated virus was observed following treatment of cells with UV-irradiation or TPA. Replication of undamaged virus in untreated C3H cells resulted in an increase over the background mutation frequency. When the cells were UV-irradiated and infected with unirradiated virus, a decrease in mutagenesis was observed. Decreased untargeted mutagenesis was shown to be dose- and time-dependent, reaching a minimum at a fluence of 5-7 Jm/sup /minus/2/ for 24 hours between irradiation and infection of cells. There was no change in mutagenesis of UV-irradiated virus grown in UV-irradiated cells compared to untreated cells. The repair capacity of methylcholanthrene-transformed C3H cells (MCA cells) was compared with untransformed C3H cells. The cell lines demonstrated similar cell survival curves following UV-irradiation but differed markedly in their ability to repair damaged HSV-1.

  19. Transgenic rice plants expressing cry1Ia5 gene are resistant to stem borer (Chilo agamemnon).

    PubMed

    Moghaieb, Reda E A

    2010-01-01

    The stem borer, Chilo agamemnon Bles., is the most serious insect pest in rice fields of the Egyptian Nile Delta. To induce rice plant resistance to Chilo agamemnon, the cry1Ia5 gene was introduced to rice plants (Oryza sativa L.). The integration of the cry1Ia5 gene into the plant genome was confirmed using PCR and Southern blot analyses. The obtained plantlets were transferred to the greenhouse until seeds were collected. Northern blot analysis of the T1 plants confirmed the expression of the cry1Ia5 gene. The insecticidal activity of the transgenic plants against the rice stem borer Chilo agamemnon were tested. The third larval instars were fed on stem cuts from three transgenic lines (L1, L2 and L3) as well as cuts from the control (gfp-transgenic) plants for one week and the mortality percentage was daily recorded. Transgenic line-3 showed the highest mortality percentage after one day (50%) followed by L2 (25%) then L1 (0%). Two days post treatment the mortality percentage increased to 70, 45 and 25% for transgenic lines 1, 2 and 3 respectively. Mortality of 100% was recorded four days post treatment, while those fed on the gfp-transgenic rice (control) showed 0% mortality. Thus, transgenic plants showed high resistance to stem borers and can serve as a novel genetic resource in breeding programs. Transgenic plants expressing BT protein were normal in phenotype with as good seed setting as the nontransgenic control plants.

  20. Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines

    PubMed Central

    Vuong, Helen E.; de Sevilla Müller, Luis Pérez; Hardi, Claudia N.; McMahon, Douglas G.; Brecha, Nicholas C.

    2015-01-01

    Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) line with three catecholamine-related Cre recombinase lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ~6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium somal diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines were generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. PMID:26335381

  1. Effects of defoliating insect resistance QTLs and a cry1Ac transgene in soybean near-isogenic lines.

    PubMed

    Zhu, S; Walker, D R; Boerma, H R; All, J N; Parrott, W A

    2008-02-01

    The crystal proteins coded by transgenes from Bacillus thuringiensis (Bt) have shown considerable value in providing effective insect resistance in a number of crop species, including soybean, Glycine max (L.) Merr. Additional sources of soybean insect resistance would be desirable to manage the development of tolerance/resistance to crystal proteins by defoliating insects and to sustain the deployment of Bt crops. The objective of this study was to evaluate the effects and interactions of three insect resistance quantitative trait loci (QTLs; QTL-M, QTL-H, and QTL-G) originating from Japanese soybean PI 229358 and a cry1Ac gene in a "Benning" genetic background. A set of 16 BC(6)F(2)-derived near isogenic lines (NILs) was developed using marker-assisted backcrosses and evaluated for resistance to soybean looper [SBL, Pseudoplusia includens (Walker)] and corn earworm [CEW, Helicoverpa zea (Boddie)] in field cage, greenhouse, and detached leaf assays. Both Bt and QTL-M had significantly reduced defoliation by both SBL and CEW and reduced larval weight of CEW. The antibiosis QTL-G had a significant effect on reducing CEW larval weight and also a significant effect on reducing defoliation by SBL and CEW in some assays. The antixenosis QTL-H had no main effect, but it appeared to function through interaction with QTL-M and QTL-G. Adding QTL-H and QTL-G further enhanced the resistance of the Bt and QTL-M combination to CEW in the field cage assay. These results should help guide the development of strategies for effective management of insect pests and for sustainable deployment of Bt genes.

  2. Activation of transgenic estrogen receptor-beta by selected phytoestrogens in a stably transduced rat serotonergic cell line.

    PubMed

    Amer, Dena A M; Kretzschmar, Georg; Müller, Nicole; Stanke, Nicole; Lindemann, Dirk; Vollmer, Günter

    2010-06-01

    Many flavonoids, a major group of phenolic plant-derived secondary metabolites, are known to possess estrogen-like bioactivities. However, little is known about their estrogenic properties in the central nervous system due to the lack of suitable cellular models expressing sufficient amounts of functional estrogen receptor beta (ERbeta). To overcome this deficit, we have created a cellular model, which is serotonergic in origin, to study properties of estrogenic substances by stably transducing RN46A-B14 cells derived from raphe nuclei region of the rat brain with a lentiviral vector encoding a human ERbeta. We clearly showed that the transgenic human ERbeta is a spontaneously expressed and a functional receptor. We have further assessed the estrogenicity of three different isoflavones and four different naringenin-type flavanones in this cell line utilizing a luciferase reporter gene assay. Genistein (GEN), Daidzein (DAI), Equol (EQ), Naringenin (NAR) and 8-prenylnaringenin (8-PN) showed strong estrogenic activity in a concentration-dependent manner as compared to 7-(O-prenyl)naringenin-4'-acetate (7-O-PN) which was only slightly estrogenic and 6-(1,1-dimethylallyl)naringenin (6-DMAN) that neither showed estrogenic nor anti-estrogenic activity in our model. All observed effects could be antagonized by the anti-estrogen fulvestrant. Moreover, co-treatment of cells with 17beta-estradiol (E2) and either GEN or DAI showed a slight additive effect as compared to EQ. On the other hand, 8-PN in addition to 7-O-PN, but not NAR and 6-DMAN, were able to slightly antagonize the responses triggered by E2. Our newly established cellular model may prove to be a useful tool in explicating basic physiological properties of ERbeta in the brain and may help unravel molecular and cellular mechanisms involved in serotonergic mood regulation by estrogen or potential plant-derived secondary metabolites.

  3. Generation of transgenic watermelon resistant to Zucchini yellow mosaic virus and Papaya ringspot virus type W.

    PubMed

    Yu, Tsong-Ann; Chiang, Chu-Hui; Wu, Hui-Wen; Li, Chin-Mei; Yang, Ching-Fu; Chen, Jun-Han; Chen, Yu-Wen; Yeh, Shyi-Dong

    2011-03-01

    Zucchini yellow mosaic virus (ZYMV) and Papaya ringspot virus type W (PRSV W) are major limiting factors for production of watermelon worldwide. For the effective control of these two viruses by transgenic resistance, an untranslatable chimeric construct containing truncated ZYMV coat protein (CP) and PRSV W CP genes was transferred to commercial watermelon cultivars by Agrobacterium-mediated transformation. Using our protocol, a total of 27 putative transgenic lines were obtained from three cultivars of 'Feeling' (23 lines), 'China baby' (3 lines), and 'Quality' (1 line). PCR and Southern blot analyses confirmed that the chimeric construct was incorporated into the genomic DNA of the transformants. Greenhouse evaluation of the selected ten transgenic lines of 'Feeling' cultivar revealed that two immune lines conferred complete resistance to ZYMV and PRSV W, from which virus accumulation were not detected by Western blotting 4 weeks after inoculation. The transgenic transcript was not detected, but small interfering RNA (siRNA) was readily detected from the two immune lines and T(1) progeny of line ZW 10 before inoculation, indicating that RNA-mediated post-transcriptional gene silencing (PTGS) is the underlying mechanism for the double-virus resistance. The segregation ratio of T(1) progeny of the immune line ZW10 indicated that the single inserted transgene is nuclearly inherited and associated with the phenotype of double-virus resistance as a dominant trait. The transgenic lines derived from the commercial watermelon cultivars have great potential for control of the two important viruses and can be implemented directly without further breeding.

  4. T24 HRAS transformed NIH/3T3 mouse cells (GhrasT-NIH/3T3) in serial tumorigenic in vitro/in vivo passages give rise to increasingly aggressive tumorigenic cell lines T1-A and T2-A and metastatic cell lines T3-HA and T4-PA.

    PubMed

    Ray, Durwood B; Merrill, Gerald A; Brenner, Frederic J; Lytle, Laurie S; Lam, Tan; McElhinney, Aaron; Anders, Joel; Rock, Tara Tauber; Lyker, Jennifer Kier; Barcus, Scott; Leslie, Kara Hust; Kramer, Jill M; Rubenstein, Eric M; Pryor Schanz, Karen; Parkhurst, Amy J; Peck, Michelle; Good, Kimberly; Granath, Kristi Lemke; Cifra, Nicole; Detweiler, Jessalee Wantz; Stevens, Laura; Albertson, Richard; Deir, Rachael; Stewart, Elisabeth; Wingard, Katherine; Richardson, Micah Rose; Blizard, Sarah B; Gillespie, Lauren E; Kriley, Charles E; Rzewnicki, Daniel I; Jones, David H

    2016-01-01

    Cancer cells often arise progressively from "normal" to "pre-cancer" to "transformed" to "local metastasis" to "metastatic disease" to "aggressive metastatic disease". Recent whole genome sequencing (WGS) and spectral karyotyping (SKY) of cancer cells and tumorigenic models have shown this progression involves three major types of genome rearrangements: ordered small step-wise changes, more dramatic "punctuated evolution" (chromoplexy), and large catastrophic steps (chromothripsis) which all occur in random combinations to generate near infinite numbers of stochastically rearranged metastatic cancer cell genomes. This paper describes a series of mouse cell lines developed sequentially to mimic this type of progression. This starts with the new GhrasT-NIH/Swiss cell line that was produced from the NIH/3T3 cell line that had been transformed by transfection with HRAS oncogene DNA from the T24 human bladder carcinoma. These GhrasT-NIH/Swiss cells were injected s.c. into NIH/Swiss mice to produce primary tumors from which one was used to establish the T1-A cell line. T1-A cells injected i.v. into the tail vein of a NIH/Swiss mouse produced a local metastatic tumor near the base of the tail from which the T2-A cell line was established. T2-A cells injected i.v. into the tail vein of a nude NIH/Swiss mouse produced metastases in the liver and one lung from which the T3-HA (H=hepatic) and T3-PA (P=pulmonary) cell lines were developed, respectively. T3-HA cells injected i.v. into a nude mouse produced a metastasis in the lung from which the T4-PA cell line was established. PCR analysis indicated the human T24 HRAS oncogene was carried along with each in vitro/in vivo transfer step and found in the T2-A and T4-PA cell lines. Light photomicrographs indicate that all transformed cells are morphologically similar. GhrasT-NIH/Swiss cells injected s.c. produced tumors in 4% of NIH/Swiss mice in 6-10 weeks; T1-A cells injected s.c. produced tumors in 100% of NIH/Swiss mice in 7

  5. Development of a transgenic Plasmodium berghei line (Pb pfpkg) expressing the P. falciparum cGMP-dependent protein kinase, a novel antimalarial drug target.

    PubMed

    Tewari, Rita; Patzewitz, Eva-Maria; Poulin, Benoit; Stewart, Lindsay; Baker, David A

    2014-01-01

    With the inevitable selection of resistance to antimalarial drugs in treated populations, there is a need for new medicines to enter the clinic and new targets to progress through the drug discovery pipeline. In this study we set out to develop a transgenic rodent model for testing inhibitors of the Plasmodium falciparum cyclic GMP-dependent kinase in vivo. A model was needed that would allow us to investigate whether differences in amino acid sequence of this enzyme between species influences in vivo efficacy. Here we report the successful development of a transgenic P. berghei line in which the cyclic GMP-dependent protein kinase (PKG) was replaced by the P. falciparum orthologue. We demonstrate that the P. falciparum orthologue was able to functionally complement the endogenous P. berghei pkg gene throughout blood stage development and early sexual development. However, subsequent development in the mosquito was severely compromised. We show that this is due to a defect in the female lineage of the transgenic by using genetic crosses with both male and female deficient P. berghei lines. This defect could be due to expression of a female-specific target in the mosquito stages of P. berghei that cannot be phosphorylated by the P. falciparum kinase. Using a previously reported anti-coccidial inhibitor of the cyclic GMP-dependent protein kinase, we show no difference in in vivo efficacy between the transgenic and control P. berghei lines. This in vivo model will be useful for screening future generations of cyclic GMP-dependent protein kinase inhibitors and allowing us to overcome any species-specific differences in the enzyme primary sequence that would influence in vivo efficacy in the rodent model. The approach will also be applicable to in vivo testing of other antimalarial compounds where the target is known.

  6. Overexpression of osmotin gene confers tolerance to salt and drought stresses in transgenic tomato (Solanum lycopersicum L.).

    PubMed

    Goel, D; Singh, A K; Yadav, V; Babbar, S B; Bansal, K C

    2010-09-01

    Abiotic stresses, especially salinity and drought, are major limiting factors for plant growth and crop productivity. In an attempt to develop salt and drought tolerant tomato, a DNA cassette containing tobacco osmotin gene driven by a cauliflower mosaic virus 35S promoter was transferred to tomato (Solanum lycopersicum) via Agrobacterium-mediated transformation. Putative T0 transgenic plants were screened by PCR analysis. The selected transformants were evaluated for salt and drought stress tolerance by physiological analysis at T1 and T2 generations. Integration of the osmotin gene in transgenic T1 plants was verified by Southern blot hybridization. Transgenic expression of the osmotin gene was verified by RT-PCR and northern blotting in T1 plants. T1 progenies from both transformed and untransformed plants were tested for salt and drought tolerance by subjecting them to different levels of NaCl stress and by withholding water supply, respectively. Results from different physiological tests demonstrated enhanced tolerance to salt and drought stresses in transgenic plants harboring the osmotin gene as compared to the wild-type plants. The transgenic lines showed significantly higher relative water content, chlorophyll content, proline content, and leaf expansion than the wild-type plants under stress conditions. The present investigation clearly shows that overexpression of osmotin gene enhances salt and drought stress tolerance in transgenic tomato plants.

  7. Establishment of renal proximal tubule cell lines by targeted oncogenesis in transgenic mice using the L-pyruvate kinase-SV40 (T) antigen hybrid gene.

    PubMed

    Cartier, N; Lacave, R; Vallet, V; Hagege, J; Hellio, R; Robine, S; Pringault, E; Cluzeaud, F; Briand, P; Kahn, A

    1993-03-01

    Targeted oncogenesis allowed us to obtain two cell lines which have been derived from the proximal tubule of kidney from transgenic mice harbouring the simian virus (SV40) large T and small t antigens placed under the control of the 5' regulatory sequence from the rat L-type pyruvate kinase (L-PK) gene. The cell lines (PKSV-PCT and PKSV-PR cells) were derived from early (PCT) and late (Pars Recta, PR) microdissected proximal tubules grown in D-glucose-enriched medium. In such conditions of culture, both cell lines exhibited L-PK transcripts, a stable expression of SV40-encoded nuclear large T antigen, a prolonged life span but failed to induce tumors when injected sub-cutaneously into athymic (nu-nu) mice. Confluent cells, grown on plastic support or porous filters, were organized as monolayers of polarized cuboid cells with well developed apical microvilli and formed domes. Both cell lines exhibited morphological features of proximal tubule cells with villin located in the apical brush-border and substantial amounts of hydrolase activity. By immunofluorescence studies using specific antibodies, aminopeptidase N appeared restricted to the apical microvillar domain, whereas the H2 histocompatibility antigen was distributed in the cytoplasm and lateral membranes. These results demonstrate that the proximal morphological phenotype has been fully preserved in these cultured cells derived from tissue-specific targeted oncogenesis in transgenic mice.

  8. Effects of Defoliating Insect Resistance QTLs and a crylAc Transgene in Soybean Near-Isogenic Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Additional sources of resistance would be desirable to manage defoliating insect resistance to crystal proteins coded by transgenes from Bacillus thuringiensis (Bt) and to sustain the deployment of Bt crops. The objective of this study was to evaluate the effects and interactions of three soybean (G...

  9. Salicylic acid deficiency in NahG transgenic lines and sid2 mutants increases seed yield in the annual plant Arabidopsis thaliana.

    PubMed

    Abreu, Maria Elizabeth; Munné-Bosch, Sergi

    2009-01-01

    Salicylic acid-deficient NahG transgenic lines and sid2 mutants were used to evaluate the role of this compound in the development of the short-lived, annual plant Arabidopsis thaliana, with a particular focus on the interplay between salicylic acid and other phytohormones. Low salicylic acid levels led to increased growth, as well as to smaller abscisic acid levels and reduced damage to PSII (as indicated by F(v)/F(m) ratios) during the reproductive stages in rosette leaves of NahG transgenic lines and sid2 mutants, compared with wild-type plants. Furthermore, salicylic acid deficiency highly influenced seed yield and composition. Seed production increased by 4.4-fold and 3.5-fold in NahG transgenic lines and sid2 mutants, respectively, compared to the wild type. Salicylic acid deficiency also improved seed composition in terms of antioxidant vitamin concentrations, seeds of salicylic acid-deficient plants showing higher levels of alpha- and gamma-tocopherol (vitamin E) and beta-carotene (pro-vitamin A) than seeds of wild-type plants. Seeds of salicylic acid-deficient plants also showed higher nitrogen concentrations than seeds of wild-type plants. It is concluded that (i) the sid2 gene, which encodes for isochorismate synthase, plays a central role in salicylic acid biosynthesis during plant development in A. thaliana, (ii) salicylic acid plays a role in the regulation of growth, senescence, and seed production, (iii) there is a cross-talk between salicylic acid and other phytohormones during plant development, and (iv) the concentrations of antioxidant vitamins in seeds may be influenced by the endogenous levels of salicylic acid in plants.

  10. Transgenic mouse lines expressing rat AH receptor variants - A new animal model for research on AH receptor function and dioxin toxicity mechanisms

    SciTech Connect

    Pohjanvirta, Raimo

    2009-04-15

    Han/Wistar (Kuopio; H/W) rats are exceptionally resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) toxicity mainly because of their mutated aryl hydrocarbon receptor (AHR) gene. In H/W rats, altered splicing of the AHR mRNA generates two AHR proteins: deletion (DEL) and insertion (INS) variants, with the INS isoform being predominantly expressed. To gain further insight into their functional properties, cDNAs of these and rat wild-type (rWT) isoform were transferred into C57BL/6J-derived mice by microinjection. The endogenous mouse AHR was eliminated by selective crossing with Ahr-null mice. A single mouse line was obtained for each of the three constructs. The AHR mRNA levels in tissues were generally close to those of C57BL/6 mice in INS and DEL mice and somewhat higher in rWT mice; in testis, however, all 3 constructs exhibited marked overexpression. The transgenic mouse lines were phenotypically normal except for increased testis weight. Induction of drug-metabolizing enzymes by TCDD occurred similarly to that in C57BL/6 mice, but there tended to be a correlation with AHR concentrations, especially in testis. In contrast to C57BL/6 mice, the transgenics did not display any major gender difference in susceptibility to the acute lethality and hepatotoxicity of TCDD; rWT mice were highly sensitive, DEL mice moderately resistant and INS mice highly resistant. Co-expression of mouse AHR and rWT resulted in augmented sensitivity to TCDD and abolished the natural resistance of female C57BL/6 mice, whereas mice co-expressing mouse AHR and INS were resistant. Thus, these transgenic mouse lines provide a novel promising tool for molecular studies on dioxin toxicity and AHR function.

  11. Transgenic Pearl Millet Male Fertility Restorer Line (ICMP451) and Hybrid (ICMH451) Expressing Brassica juncea Nonexpressor of Pathogenesis Related Genes 1 (BjNPR1) Exhibit Resistance to Downy Mildew Disease

    PubMed Central

    Khareedu, Venkateswara Rao; Vudem, Dashavantha Reddy

    2014-01-01

    Brassica juncea Nonexpressor of pathogenesis-related genes 1 (BjNPR1) has been introduced into pearl millet male fertility restorer line ICMP451 by Agrobacterium tumefaciens-mediated genetic transformation. Transgenic pearl millet plants were regenerated from the phosphinothricin-resistant calli obtained after co-cultivation with A. tumefaciens strain LBA4404 harbouring Ti plasmid pSB111-bar-BjNPR1. Molecular analyses confirmed the stable integration and expression of BjNPR1 in transgenic pearl millet lines. Transgenes BjNPR1 and bar were stably inherited and disclosed co-segregation in subsequent generations in a Mendelian fashion. Transgenic pearl millet hybrid ICMH451-BjNPR1 was developed by crossing male-sterile line 81A X homozygous transgenic line ICMP451-BjNPR1. T3 and T4 homozygous lines of ICMP451-BjNPR1 and hybrid ICMH451-BjNPR1 exhibited resistance to three strains of downy mildew pathogen, while the untransformed ICMP451 and the isogenic hybrid ICMH451 plants were found susceptible. Following infection with S. graminicola, differential expression of systemic acquired resistance pathway genes, UDP-glucose salicylic acid glucosyl transferase and pathogenesis related gene 1 was observed in transgenic ICMP451-BjNPR1 and untransformed plants indicating the activation of systemic acquired resistance pathway contributing to the transgene-mediated resistance against downy mildew. The transgenic pearl millet expressing BjNPR1 showed resistance to multiple strains of S. graminicola and, as such, seems promising for the development of durable downy mildew resistant hybrids. PMID:24603762

  12. The HSP terminator of Arabidopsis thaliana induces a high level of miraculin accumulation in transgenic tomatoes.

    PubMed

    Hirai, Tadayoshi; Kurokawa, Natsuko; Duhita, Narendra; Hiwasa-Tanase, Kyoko; Kato, Kazuhisa; Kato, Ko; Ezura, Hiroshi

    2011-09-28

    High-level accumulation of the target recombinant protein is a significant issue in heterologous protein expression using transgenic plants. Miraculin, a taste-modifying protein, was accumulated in transgenic tomatoes using an expression cassette in which the miraculin gene was expressed by the cauliflower mosaic virus (CaMV) 35S promoter and the heat shock protein (HSP) terminator (MIR-HSP). The HSP terminator was derived from heat shock protein 18.2 in Arabidopsis thaliana . Using this HSP-containing cassette, the miraculin concentration in T0 transgenic tomato lines was 1.4-13.9% of the total soluble protein (TSP), and that in the T1 transgenic tomato line homozygous for the miraculin gene reached 17.1% of the TSP. The accumulation level of the target protein was comparable to levels observed with chloroplast transformation. The high-level accumulation of miraculin in T0 transgenic tomato lines achieved by the HSP terminator was maintained in the successive T1 generation, demonstrating the genetic stability of this accumulation system.

  13. Production of early flowering transgenic barley expressing the early flowering allele of Cryptochrome2 gene.

    PubMed

    El-Assal, Salah El-Din; Abd-Alla, Samir M; El-Tarras, Adel A; El-Awady, Mohamed A

    2011-01-01

    This work was carried out in order to develop early flowering barley lines. These lines will be useful to producers by enabling multiple crops within a single season and increasing production. Transgenic barley plants containing the natural early flowering time AtCRY2 allele from the Cape Verde Island (Cvi) ecotype of Arabidopsis have been generated using biolistic transformation. Immature embryo derived calli of two commercially important barley cultivars (El-Dwaser and El-Taif), were transformed using a pCAMBIA-2300 plasmid harboring a genomic fragment containing the AtCRY2-Cvi allele. Transformation was performed utilizing 600 immature embryos for each cultivar. Stable transformation was confirmed in T 0 and T 1 plants by using genomic PCR, RT-PCR and western blot analysis with AtCRY2 specific primers and antibodies, respectively. The transformation efficiency was 5.6% and 3.4% for El-Dwaser and El-Taif cultivars, respectively. Seeds from several T 1 lines were germinated on kanamycin plates and the lines that contained a single locus were selected for further evaluation. The transformed barley plants showed the specific AtCRY2-Cvi flowering phenotype, i.e. early flowering and day length insensitivity, compared to the non transgenic plants. The time to flowering in transgenic T 1 plants was assessed and two lines exhibited flowering more than 25 days earlier than the parental cultivars under short day conditions.

  14. Characterization of Changes in Gluten Proteins in Low-Gliadin Transgenic Wheat Lines in Response to Application of Different Nitrogen Regimes

    PubMed Central

    García-Molina, María Dolores; Barro, Francisco

    2017-01-01

    Gluten proteins are major determinants of the bread making quality of wheat but also of important gluten-related disorders. The gluten protein accumulation during grain filling is strongly influenced by nitrogen fertilization. We have characterized the gluten proteins in low-gliadin wheat lines as influenced by nitrogen treatments in two experiments. These transgenic lines, D783, D793, C655, D577, and E82 were obtained by using two different RNAi silencing fragments and two endosperm-specific promoters to drive the silencing fragments (d-hordein and γ-gliadin). In Experiment 1, we used three nitrogen fertilizer rates (120, 360, and 1080 mg N) added at sowing stage and combined with two sulfur rates (8 and 30 mg S); Experiment 2 included two nitrogen levels (120 and 1080 mg N), which were added according to the greatest demand per plant using split applications. The protein quantification was accomplished by Reverse-Phase High-Performance Liquid Chromatography and gluten content (ppm) determined using monoclonal antibody R5 (Competitive R5 ELISA). The results showed differences in protein accumulation between the two transgenic lines with the same silencing fragment but different promoter. Lines D793 and E82 showed low gliadin and an increment in glutenin content with increasing nitrogen. Competitive ELISA R5 showed a significant decrease in gluten content using split applications of nitrogen (Experiment 2) with 120 mg N compared to Experiment 1. In addition, line E82 ensures that variations in N fertilization will not result in increased gluten content. PMID:28289425

  15. Characterization of Circadian-associated pseudo-response regulators: I. Comparative studies on a series of transgenic lines misexpressing five distinctive PRR Genes in Arabidopsis thaliana.

    PubMed

    Matsushika, Akinori; Murakami, Masaya; Ito, Shogo; Nakamichi, Norihito; Yamashino, Takafumi; Mizuno, Takeshi

    2007-02-01

    Every member of a small family of Pseudo-Response Regulator (PRR) genes, including Timing of Cab Expression 1 (TOC1 [or PRR1]), are believed to play roles close to the circadian clock in the model higher plant Arabidopsis thaliana. In this study we established a transgenic line that misexpresses (or overexpresses) the PRR7 gene. As compared with wild-type plants, the resulting PRR7-misexpressing plants (designated PRR7-ox) showed characteristic phenotypes as to hallmarked circadian-associated biological events: (i) early flowering in a manner independent of photoperiodicity, (ii) hypersensitive response to red light during early photomorphogenesis, and (iii) altered free-running rhythms with long period of clock-associated genes. Finally, a series of all transgenic lines (PRR1-ox, PRR3-ox, PRR5-ox, PRR7-ox, and PRR9-ox) were characterized comparatively with regard to their clock-associated roles. The results suggested that the five homologous PRR factors play coordinate roles, distinctively from one another, and closely to the circadian clock in higher plants.

  16. The tiered-evaluation of the effects of transgenic cry1c rice on Cyrtorhinus lividipennis, a main predator of Nilaparvata lugens

    PubMed Central

    Han, Yu; Ma, Fugang; Nawaz, Muhammad; Wang, Yu; Cai, Wanlun; Zhao, Jing; He, Yueping; Hua, Hongxia; Zou, Yulan

    2017-01-01

    T1C-19, a newly developed transgenic cry1C rice line, expresses cry1C under the control of the maize ubiquitin promoter, and is highly resistant to lepidopteran pests of rice. Cyrtorhinus lividipennis is the major predator of the eggs and young nymphs of Nilaparvata lugens, which is the main non-target sap-sucking insect pest of Bt rice. C. lividipennis may be exposed to Cry1C protein, thus biosafety evaluations of transgenic cry1C rice on C. lividipennis should be conducted before the commercialization of T1C-19. In the current study, we tested the direct toxicity of elevated doses of Cry1C to C. lividipennis, effects of T1C-19 on the life-table parameters of C. lividipennis via preying planthoppers, and effects of T1C-19 on the population density and dynamics in rice fields. No detrimental effects on development, survival, female ratio and body weight of C. lividipennis were caused by direct exposure to elevated doses of the Cry1C protein or prey-mediated exposure to realistic doses of the protein. The population density and dynamics did not significantly differ between C. lividipennis in T1C-19 and non-transgenic rice fields. Thus, transgenic cry1C rice had no negative effects on C. lividipennis. This is the first report of the effects of transgenic cry1C rice on C. lividipennis. PMID:28205641

  17. The tiered-evaluation of the effects of transgenic cry1c rice on Cyrtorhinus lividipennis, a main predator of Nilaparvata lugens

    NASA Astrophysics Data System (ADS)

    Han, Yu; Ma, Fugang; Nawaz, Muhammad; Wang, Yu; Cai, Wanlun; Zhao, Jing; He, Yueping; Hua, Hongxia; Zou, Yulan

    2017-02-01

    T1C-19, a newly developed transgenic cry1C rice line, expresses cry1C under the control of the maize ubiquitin promoter, and is highly resistant to lepidopteran pests of rice. Cyrtorhinus lividipennis is the major predator of the eggs and young nymphs of Nilaparvata lugens, which is the main non-target sap-sucking insect pest of Bt rice. C. lividipennis may be exposed to Cry1C protein, thus biosafety evaluations of transgenic cry1C rice on C. lividipennis should be conducted before the commercialization of T1C-19. In the current study, we tested the direct toxicity of elevated doses of Cry1C to C. lividipennis, effects of T1C-19 on the life-table parameters of C. lividipennis via preying planthoppers, and effects of T1C-19 on the population density and dynamics in rice fields. No detrimental effects on development, survival, female ratio and body weight of C. lividipennis were caused by direct exposure to elevated doses of the Cry1C protein or prey-mediated exposure to realistic doses of the protein. The population density and dynamics did not significantly differ between C. lividipennis in T1C-19 and non-transgenic rice fields. Thus, transgenic cry1C rice had no negative effects on C. lividipennis. This is the first report of the effects of transgenic cry1C rice on C. lividipennis.

  18. Efficient generation of marker-free transgenic rice plants using an improved transposon-mediated transgene reintegration strategy.

    PubMed

    Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong; Qu, Shaohong

    2015-01-01

    Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops.

  19. Transgenic rice plants expressing synthetic cry2AX1 gene exhibits resistance to rice leaffolder (Cnaphalocrosis medinalis).

    PubMed

    Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V

    2016-06-01

    Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T1 progenies through Southern and ELISA. In T1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.

  20. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    PubMed

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P < 0.05) and the electrolyte leakage significantly lower (P < 0.05) in the order 2.3 kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P < 0.01) compared, respectively, to the best 1.9 kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  1. [Transgenic wheat (Triticum aestivum L.) with increased resistance to the storage pest obtained by Agrobacterium tumefaciens--mediated].

    PubMed

    Bi, Rui-Ming; Jia, Hai-Yan; Feng, De-Shun; Wang, Hong-Gang

    2006-05-01

    The transgenic wheat of improved resistance to the storage pest was production. We have introduced the cowpea trypsin inhibitor gene (CpTI) into cultured embryonic callus cells of immature embryos of wheat elite line by Agrobacterium-mediated method. Independent plantlets were obtained from the kanamycin-resistant calli after screening. PCR and real time PCR analysis, PCR-Southern and Southern blot hybridization indicated that there were 3 transgenic plants viz. transformed- I, II and III (T- I, T-II and T-III). The transformation frequencies were obviously affected by Agrobacterium concentration, the infection duration and transformation treatment. The segregations of CpTI in the transgenic wheat progenies were not easily to be elucidated, and some transgenic wheat lines (T- I and T-III) showed Mendelian segregations. The determinations of insect resistance to the stored grain insect of wheat viz. the grain moth (Sitotroga cerealella Olivier) indicated that the 3 transgenic wheat progeny seeds moth-resistance was improved significantly. The seed moth-eaten ratio of T- I, T-II, T-III and nontransformed control was 19.8%, 21.9%, 32.9% and 58.3% respectively. 3 transgenic wheat T1 PCR-positive plants revealed that the 3 transgenic lines had excellent agronomic traits. They supplied good germplasm resource of insect-resistance for wheat genetic improvement.

  2. Transgenic sorghum plants via microprojectile bombardment.

    PubMed

    Casas, A M; Kononowicz, A K; Zehr, U B; Tomes, D T; Axtell, J D; Butler, L G; Bressan, R A; Hasegawa, P M

    1993-12-01

    Transgenic sorghum plants have been obtained after microprojectile bombardment of immature zygotic embryos of a drought-resistant sorghum cultivar, P898012. DNA delivery parameters were optimized based on transient expression of R and C1 maize anthocyanin regulatory elements in scutellar cells. The protocol for obtaining transgenic plants consists of the delivery of the bar gene to immature zygotic embryos and the imposition of bialaphos selection pressure at various stages during culture, from induction of somatic embryogenesis to rooting of regenerated plantlets. One in about every 350 embryos produced embryogenic tissues that survived bialaphos treatment; six transformed callus lines were obtained from three of the eight sorghum cultivars used in this research. Transgenic (T0) plants were obtained from cultivar P898012 (two independent transformation events). The presence of the bar and uidA genes in the T0 plants was confirmed by Southern blot analysis of genomic DNA. Phosphinothricin acetyltransferase activity was detected in extracts of the T0 plants. These plants were resistant to local application of the herbicide Ignite/Basta, and the resistance was inherited in T1 plants as a single dominant locus.

  3. Characterization of the BAC Id3-enhanced green fluorescent protein transgenic mouse line for in vivo imaging of astrocytes

    PubMed Central

    Lamantia, Cassandra; Tremblay, Marie-Eve; Majewska, Ania

    2014-01-01

    Abstract. Astrocytes are highly ramified glial cells with critical roles in brain physiology and pathology. Recently, breakthroughs in imaging technology have expanded our understanding of astrocyte function in vivo. The in vivo study of astrocytic dynamics, however, is limited by the tools available to label astrocytes and their processes. Here, we characterize the bacterial artificial chromosome transgenic Id3-EGFP knock-in mouse to establish its usefulness for in vivo imaging of astrocyte processes. Using fixed brain sections, we observed enhanced green fluorescent protein expression in astrocytes and blood vessel walls throughout the brain, although the extent and cell type specificity of expression depended on the brain area and developmental age. Using in vivo two-photon imaging, we visualized astrocytes in cortical layers 1–3 in both thin skull and window preparations. In adult animals, astrocytic cell bodies and fine processes could be followed over many hours. Our results suggest that Id3 mice could be used for in vivo imaging of astrocytes and blood vessels in development and adulthood. PMID:26157970

  4. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor.

    PubMed

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow.

  5. Investigating Pollen and Gene Flow of WYMV-Resistant Transgenic Wheat N12-1 Using a Dwarf Male-Sterile Line as the Pollen Receptor

    PubMed Central

    Dong, Shanshan; Liu, Yan; Yu, Cigang; Zhang, Zhenhua; Chen, Ming; Wang, Changyong

    2016-01-01

    Pollen-mediated gene flow (PMGF) is the main mode of transgene flow in flowering plants. The study of pollen and gene flow of transgenic wheat can help to establish the corresponding strategy for preventing transgene escape and contamination between compatible genotypes in wheat. To investigate the pollen dispersal and gene flow frequency in various directions and distances around the pollen source and detect the association between frequency of transgene flow and pollen density from transgenic wheat, a concentric circle design was adopted to conduct a field experiment using transgenic wheat with resistance to wheat yellow mosaic virus (WYMV) as the pollen donor and dwarf male-sterile wheat as the pollen receptor. The results showed that the pollen and gene flow of transgenic wheat varied significantly among the different compass sectors. A higher pollen density and gene flow frequency was observed in the downwind SW and W sectors, with average frequencies of transgene flow of 26.37 and 23.69% respectively. The pollen and gene flow of transgenic wheat declined dramatically with increasing distance from its source. Most of the pollen grains concentrated within 5 m and only a few pollen grains were detected beyond 30 m. The percentage of transgene flow was the highest where adjacent to the pollen source, with an average of 48.24% for all eight compass directions at 0 m distance. Transgene flow was reduced to 50% and 95% between 1.61 to 3.15 m, and 10.71 to 20.93 m, respectively. Our results suggest that climate conditions, especially wind direction, may significantly affect pollen dispersal and gene flow of wheat. The isolation-by-distance model is one of the most effective methods for achieving stringent transgene confinement in wheat. The frequency of transgene flow is directly correlated with the relative density of GM pollen grains in air currents, and pollen competition may be a major factor influencing transgene flow. PMID:26975052

  6. Relative transgene expression frequencies in homozygous versus hemizygous transgenic mice.

    PubMed

    Chang, Su-Ping; Opsahl, Margaret L; Whitelaw, C Bruce A; Morley, Steven D; West, John D

    2013-12-01

    We have used a simple binomial model of stochastic transgene inactivation at the level of the chromosome or transgene, rather than the cellular level, for the analysis of two mouse transgenic lines that show variegated patterns of expression. This predicts the percentages of cells that express one, both or neither alleles of the transgene in homozygotes from the observed percentages of cells, which express the transgene in hemizygotes. It adequately explained the relationship between the numbers of cells expressing the transgene in hemizygous and homozygous mosaic 21OH/LacZ mouse adrenals and mosaic BLG/7 mouse mammary glands. The binomial model also predicted that a small proportion of cells in mosaic mammary glands of BLG/7 homozygotes would express both BLG/7 alleles but published data indicated that all cells expressing the transgene showed monoallelic expression. Although it didn't fit all of the BLG/7 data as precisely as a more complex model, which used several ad hoc assumptions to explain these results, the simple binomial model was able to explain the relationship in observed transgene expression frequencies between hemizygous and homozygous mosaic tissues for both 21OH/LacZ and BLG/7 mice. It may prove to be a useful general model for analysing other transgenic animals showing mosaic transgene expression.

  7. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    PubMed Central

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  8. Digestive utilization of phosphorus from plant-based diets in the Cassie line of transgenic Yorkshire pigs that secrete phytase in the saliva.

    PubMed

    Meidinger, R G; Ajakaiye, A; Fan, M Z; Zhang, J; Phillips, J P; Forsberg, C W

    2013-03-01

    A line of transgenic Yorkshire pigs referred to as the Cassie (CA) line was generated, which possessed a stable, low copy number phytase transgene insertion that enabled phytase secretion in the saliva. This study was conducted to assess growth and efficacy for improving P, Ca, and other macromineral utilization in the CA pigs receiving diets typical of those used for commercial swine production. In Exp. 1, 12 CA boars and 12 CA gilts fed diets without supplemental P gained weight and exhibited feed efficiency similar to conventional age-matched 12 Yorkshire boars and 12 Yorkshire gilts raised on similar diets with supplemental P. Serum concentrations of P and Ca were similar for CA and Yorkshire pigs during the growing and finishing phases, indicating that the CA pigs were not P limited. In Exp. 2, 6 CA (13.1 kg BW) and 6 Yorkshire barrows (8.8 kg BW) were fed 3 diets (control; low in Ca and P; and low in Ca, P, and CP) over 3 phases. The CA barrows fed the diet without supplemental P retained 25 to 40% (P < 0.001), 77 to 91% (P < 0.001), and 27 to 56% (P < 0.001) more P during the weaning, growing, and finishing phases, respectively, than conventional Yorkshire barrows fed similar diets without supplemental P. In Exp. 3, CA and Yorkshire barrows of similar ages weighing 66.2 ± 1.7 kg (n = 10) and 50.0 ± 1.0 kg (n = 10), respectively, were used. The P retention of CA finisher barrows fed a diet without supplemental P was 34% greater (P < 0.001) than conventional Yorkshire barrows fed the same diet with 750 units of exogenous phytase/kg diet. Urinary Ca to P ratio in the CA pigs was 0.27, whereas that for the Yorkshire barrows was 30, thereby, indicating that the Yorkshire barrows suffered a P deficiency. Furthermore, digestive utilization of major electrolyte macrominerals, K and Na, was improved (P < 0.05) by 18 and 16%, respectively, in the CA finisher pigs compared with the conventional Yorkshire finisher pigs fed phytase; however, only K exhibited enhanced

  9. Transposon-mediated generation of BCR-ABL1-expressing transgenic cell lines for unbiased sensitivity testing of tyrosine kinase inhibitors

    PubMed Central

    Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A.; Hoermann, Gregor; Valent, Peter; Lion, Thomas

    2016-01-01

    Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance. PMID:27801667

  10. Transgenic zebrafish reporter lines reveal conserved Toll-like receptor signaling potential in embryonic myeloid leukocytes and adult immune cell lineages.

    PubMed

    Hall, Chris; Flores, Maria Vega; Chien, Annie; Davidson, Alan; Crosier, Kathryn; Crosier, Phil

    2009-05-01

    The immune response of a host to an invading pathogen is dependent on the capacity of its immune cell compartment to recognize highly conserved pathogen components using an ancient class of pattern recognition receptors known as Toll-like receptors (TLRs). Initiation of TLR-mediated signaling results in the induction of proinflammatory cytokines that help govern the scale and duration of any ensuing response. Specificity for TLR signaling is, in part, a result of the differential recruitment of intracellular adaptor molecules. Of these, MyD88 is required for the majority of TLR signaling. Zebrafish have been shown to possess TLRs and adaptor molecules throughout early development, including MyD88, strongly suggesting conservation of this ancient defense mechanism. However, information about which embryonic cells/tissues possess this conserved signaling potential is lacking. To help define which embryonic cells, in particular, those of the innate immune system, have the potential for MyD88-dependent, TLR-mediated signaling, we generated transgenic reporter lines using regulatory elements of the myd88 gene to drive the fluorescent reporters enhanced GFP and Discosoma red fluorescent protein 2 within live zebrafish. These lines possess fluorescently marked cells/tissues consistent with endogenous myd88 expression, including a subset of myeloid leukocytes. These innate immune cells were confirmed to express other TLR adaptors including Mal, trif, and Sarm. Live wound-healing and infection assays validated the potential of these myd88-expressing leukocytes to participate in immune responses. These lines will provide a valuable resource for further resolving the contribution of MyD88 to early vertebrate immunity.

  11. Agrobacterium-mediated transformation of safflower and the efficient recovery of transgenic plants via grafting

    PubMed Central

    2011-01-01

    Background Safflower (Carthamus tinctorius L.) is a difficult crop to genetically transform being susceptible to hyperhydration and poor in vitro root formation. In addition to traditional uses safflower has recently emerged as a broadacre platform for the production of transgenic products including modified oils and pharmaceutically active proteins. Despite commercial activities based on the genetic modification of safflower, there is no method available in the public domain describing the transformation of safflower that generates transformed T1 progeny. Results An efficient and reproducible protocol has been developed with a transformation efficiency of 4.8% and 3.1% for S-317 (high oleic acid content) and WT (high linoleic acid content) genotypes respectively. An improved safflower transformation T-DNA vector was developed, including a secreted GFP to allow non-destructive assessment of transgenic shoots. Hyperhydration and necrosis of Agrobacterium-infected cotyledons was effectively controlled by using iota-carrageenan, L-cysteine and ascorbic acid. To overcome poor in vitro root formation for the first time a grafting method was developed for safflower in which ~50% of transgenic shoots develop into mature plants bearing viable transgenic T1 seed. The integration and expression of secreted GFP and hygromycin genes were confirmed by PCR, Southern and Western blot analysis. Southern blot analysis in nine independent lines indicated that 1-7 transgenes were inserted per line and T1 progeny displayed Mendelian inheritance. Conclusions This protocol demonstrates significant improvements in both the efficiency and ease of use over existing safflower transformation protocols. This is the first complete method of genetic transformation of safflower that generates stably-transformed plants and progeny, allowing this crop to benefit from modern molecular applications. PMID:21595986

  12. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons

    PubMed Central

    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua

    2016-01-01

    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  13. The substantive equivalence of transgenic (Bt and Chi) and non-transgenic cotton based on metabolite profiles.

    PubMed

    Modirroosta, Bentol Hoda; Tohidfar, Masoud; Saba, Jalal; Moradi, Foad

    2014-03-01

    Compositional studies comparing transgenic with non-transgenic counterpart plants are almost universally required by governmental regulatory bodies. In the present study, two T(2) transgenic cotton lines containing chitinase (Line 11/57) and Bt lines (Line 61) were compared with non-transgenic counterpart. To do this, biochemical characteristics of leaves and seeds, including amino acids, fatty acids, carbohydrates, anions, and cations contents of the studied lines were analyzed using GC/MS, high-performance liquid chromatography (HPLC), and ion chromatography (IC) analyzers, respectively. polymerase chain reaction (PCR) and Western blot analyses confirmed the presence and expression of Chi and Bt genes in the studied transgenic lines. Although, compositional analysis of leaves contents confirmed no significant differences between transgenic and non-transgenic counterpart lines, but it was shown that glucose content of chitinase lines, fructose content of transgenic lines (Bt and chitinase) and asparagine and glutamine of chitinase lines were significantly higher than the non-transgenic counterpart plants. Both the transgenic lines (Bt and chitinase) showed significant decrease in the amounts of sodium in comparison to the non-transgenic counterpart plants. The experiments on the seeds showed that histidine, isoleucine, leucine, and phenylalanine contents of all transgenic and non-transgenic lines were the same, whereas other amino acids were significantly increased in the transgenic lines. Surprisingly, it was observed that the concentrations of stearic acid, myristic acid, oleic acid, and linoleic acid in the chitinase line were significantly different than those of non-transgenic counterpart plants, but these components were the same in both Bt line and its non-transgenic counterpart. It seems that more changes observed in the seed contents than leaves is via this point that seeds are known as metabolites storage organs, so they show greater changes in the

  14. Characterization of Salinity Tolerance of Transgenic Rice Lines Harboring HsCBL8 of Wild Barley (Hordeum spontanum) Line from Qinghai-Tibet Plateau

    PubMed Central

    Guo, Wanli; Chen, Tianlong; Hussain, Nazim; Zhang, Guoping; Jiang, Lixi

    2016-01-01

    Rice is more sensitive to salinity, particularly at its early vegetative and later productive stages. Wild plants growing in harsh environments such as wild barley from Qinghai-Tibet Plateau adapt to the adverse environment with allelic variations at the loci responsible for stressful environment, which could be used for rice genetic improvement. In this study, we overexpressed HsCBL8 encoding a calcium-sensor calcineurin B-like (CBL) protein in rice. The gene was isolated from XZ166, a wild-barley (Hordeum spontanum) line originated from Qinghai-Tibet Plateau. We found that XZ166 responded to high NaCl concentration (200 mM) with more HsCBL8 transcripts than CM72, a cultivated barley line known for salinity tolerance. XZ166 is significantly different from CM72 with nucleotide sequences at HsCBL8. The overexpression of HsCBL8 in rice resulted in significant improvement of water protection in vivo and plasma membrane, more proline accumulation, and a reduction of overall Na+ uptake but little change in K+ concentration in the plant tissues. Notably, HsCBL8 did not act on some genes downstream of the rice CBL family genes, suggesting an interesting interaction between HsCBL8 and unknown factors to be further investigated. PMID:27891136

  15. Establishment of medaka (Oryzias latipes) transgenic lines with the expression of green fluorescent protein fluorescence exclusively in germ cells: A useful model to monitor germ cells in a live vertebrate

    PubMed Central

    Tanaka, Minoru; Kinoshita, Masato; Kobayashi, Daisuke; Nagahama, Yoshitaka

    2001-01-01

    We have generated transgenic medaka (teleost, Oryzias latipes), which allow us to monitor germ cells by green fluorescent protein (GFP) fluorescence in live specimens. Two medaka strains, himedaka (orange–red variety) and inbred QurtE, were used. The transgenic lines were achieved by microinjection of a construct containing the putative promoter region and 3′ region of the medaka vasa gene (olvas). The intensity of GFP fluorescence increases dramatically in primordial germ cells (PGCs) located in the ventrolateral region of the posterior intestine around stage 25 (the onset of blood circulation). Whole-mount in situ hybridization and monitoring of ectopically located cells by GFP fluorescence suggested that (i) the increase in zygotic olvas expression occurs after PGC specification and (ii) PGCs can maintain their cell characteristics ectopically after stages 20–25. Around the day of hatching, the QurtE strain clearly exhibits sexual dimorphisms in the number of GFP fluorescent germ cells, a finding consistent with the appearance of leucophores, a sex-specific marker of QurtE. The GFP expression persists throughout the later stages in the mature ovary and testis. Thus, these transgenic medaka represent a live vertebrate model to investigate how germ cells migrate to form sexually dimorphic gonads, as well as a potential assay system for environmental substances that may affect gonad development. The use of a transgenic construct as a selective marker to efficiently isolate germ-line-transmitting founders during embryogenesis is also discussed. PMID:11226275

  16. Transgenic Tobacco Lines Expressing Sense or Antisense FERROCHELATASE 1 RNA Show Modified Ferrochelatase Activity in Roots and Provide Experimental Evidence for Dual Localization of Ferrochelatase 1.

    PubMed

    Hey, Daniel; Ortega-Rodes, Patricia; Fan, Tingting; Schnurrer, Florian; Brings, Lea; Hedtke, Boris; Grimm, Bernhard

    2016-12-01

    In plants, two genes encode ferrochelatase (FC), which catalyzes iron chelation into protoporphyrin IX at the final step of heme biosynthesis. FERROCHELATASE1 (FC1) is continuously, but weakly expressed in roots and leaves, while FC2 is dominantly active in leaves. As a continuation of previous studies on the physiological consequences of FC2 inactivation in tobacco, we aimed to assign FC1 function in plant organs. While reduced FC2 expression leads to protoporphyrin IX accumulation in leaves, FC1 down-regulation and overproduction caused reduced and elevated FC activity in root tissue, respectively, but were not associated with changes in macroscopic phenotype, plant development or leaf pigmentation. In contrast to the lower heme content resulting from a deficiency of the dominant FC2 expression in leaves, a reduction of FC1 in roots and leaves does not significantly disturb heme accumulation. The FC1 overexpression was used for an additional approach to re-examine FC activity in mitochondria. Transgenic FC1 protein was immunologically shown to be present in mitochondria. Although matching only a small portion of total cellular FC activity, the mitochondrial FC activity in a FC1 overexpressor line increased 5-fold in comparison with wild-type mitochondria. Thus, it is suggested that FC1 contributes to mitochondrial heme synthesis.

  17. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  18. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    PubMed

    Ke, Liping; Liu, RuiE; Chu, Bijue; Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang

    2012-01-01

    Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  19. Variegated transgene expression in mouse mammary gland is determined by the transgene integration locus.

    PubMed Central

    Dobie, K W; Lee, M; Fantes, J A; Graham, E; Clark, A J; Springbett, A; Lathe, R; McClenaghan, M

    1996-01-01

    Mice carrying an ovine beta-lactoglobulin (BLG) transgene secrete BLG protein into their milk. To explore transgene expression stability, we studied expression levels in three BLG transgenic mouse lines. Unexpectedly, two lines exhibited variable levels of transgene expression. Copy number within lines appeared to be stable and there was no evidence of transgene rearrangement. In the most variable line, BLG production levels were stable within individual mice in two successive lactations. Backcrossing demonstrated that genetic background did not contribute significantly to variable expression. Tissue in situ hybridization revealed mosaicism of transgene expression within individual mammary glands from the two variable lines; in low expressors, discrete patches of cells expressing the transgene were observed. Transgene protein concentrations in milk reflected the proportion of epithelial cells expressing BLG mRNA. Furthermore, chromosomal in situ hybridization revealed that transgene arrays in both lines are situated close to the centromere. We propose that mosaicism of transgene expression is a consequence of the chromosomal location and/or the nature of the primary transgene integration event. Images Fig. 3 Fig. 4 PMID:8692874

  20. Heterologous expression of taro cystatin protects transgenic tomato against Meloidogyne incognita infection by means of interfering sex determination and suppressing gall formation.

    PubMed

    Chan, Yuan-Li; Yang, Ai-Hwa; Chen, Jen-Tzu; Yeh, Kai-Wun; Chan, Ming-Tsair

    2010-03-01

    Plant-parasitic nematodes are a major pest of many plant species and cause global economic loss. A phytocystatin gene, Colocasia esculenta cysteine proteinase inhibitor (CeCPI), isolated from a local taro Kaosiang No. 1, and driven by a CaMV35S promoter was delivered into CLN2468D, a heat-tolerant cultivar of tomato (Solanum lycopersicum). When infected with Meloidogyne incognita, one of root-knot nematode (RKN) species, transgenic T1 lines overexpressing CeCPI suppressed gall formation as evidenced by a pronounced reduction in gall numbers. In comparison with wild-type plants, a much lower proportion of female nematodes without growth retardation was observed in transgenic plants. A decrease of RKN egg mass in transgenic plants indicated seriously impaired fecundity. Overexpression of CeCPI in transgenic tomato has inhibitory functions not only in the early RKN infection stage but also in the production of offspring, which may result from intervention in sex determination.

  1. Transcription activator-like effector nuclease (TALEN)-mediated CLYBL targeting enables enhanced transgene expression and one-step generation of dual reporter human induced pluripotent stem cell (iPSC) and neural stem cell (NSC) lines.

    PubMed

    Cerbini, Trevor; Funahashi, Ray; Luo, Yongquan; Liu, Chengyu; Park, Kyeyoon; Rao, Mahendra; Malik, Nasir; Zou, Jizhong

    2015-01-01

    Targeted genome engineering to robustly express transgenes is an essential methodology for stem cell-based research and therapy. Although designer nucleases have been used to drastically enhance gene editing efficiency, targeted addition and stable expression of transgenes to date is limited at single gene/locus and mostly PPP1R12C/AAVS1 in human stem cells. Here we constructed transcription activator-like effector nucleases (TALENs) targeting the safe-harbor like gene CLYBL to mediate reporter gene integration at 38%-58% efficiency, and used both AAVS1-TALENs and CLYBL-TALENs to simultaneously knock-in multiple reporter genes at dual safe-harbor loci in human induced pluripotent stem cells (iPSCs) and neural stem cells (NSCs). The CLYBL-TALEN engineered cell lines maintained robust reporter expression during self-renewal and differentiation, and revealed that CLYBL targeting resulted in stronger transgene expression and less perturbation on local gene expression than PPP1R12C/AAVS1. TALEN-mediated CLYBL engineering provides improved transgene expression and options for multiple genetic modification in human stem cells.

  2. Expression of Cry1Ab protein in a marker-free transgenic Bt rice line and its efficacy in controlling a target pest, Chilo suppressalis (Lepidoptera: Crambidae).

    PubMed

    Wang, Yanan; Zhang, Lei; Li, Yunhe; Liu, Yanmin; Han, Lanzhi; Zhu, Zhen; Wang, Feng; Peng, Yufa

    2014-04-01

    A marker-free Bt transgenic rice line, mfb-MH86, was recently developed in China, which contains a cry1Ab gene driven by a ubiquitin promoter. This Bt gene confers resistance to a range of lepidopteran species, including the striped stem borer, Chilo suppressalis (Walker). The expression of Cry1Ab protein in mfb-MH86 leaves, stems and leaf sheaths (hereinafter referred to as stems), and roots was evaluated throughout the rice-growing season using an enzyme-linked immunosorbent assay. In addition, mfb-MH86 resistance to C. suppressalis, a major pest of rice, was evaluated in a laboratory bioassay with field-collected rice stems. Cry1Ab protein levels of mfb-MH86 were highest in leaves (9.71-34.09 μg/g dry weight [DW]), intermediate in stems (7.66-18.51 μg/g DW), and lowest in roots (1.95-13.40 μg/g DW). In all tissues, Cry1Ab levels in mfb-MH86 were higher in seedling and tillering stages than in subsequent growth stages. In the laboratory bioassay, mortality of C. suppressalis after 6 d of feeding on mfb-MH86 stems was 100% throughout the rice-growing season; mortality of C. suppressalis when feeding on stems of the nontransformed isoline, MH86, ranged from 15.0 to 38.3%. The results indicate that Cry1Ab protein levels in mfb-MH86 stems are sufficient to protect plants against C. suppressalis throughout the rice-growing season. Although our results are promising, further comprehensive evaluations of mfb-MH86, including field surveys, will be needed before commercial use.

  3. Morphological analysis of the early development of telencephalic and diencephalic gonadotropin-releasing hormone neuronal systems in enhanced green fluorescent protein-expressing transgenic medaka lines.

    PubMed

    Takahashi, Akiko; Islam, M Sadiqul; Abe, Hideki; Okubo, Kataaki; Akazome, Yasuhisa; Kaneko, Takeshi; Hioki, Hiroyuki; Oka, Yoshitaka

    2016-03-01

    Teleosts possess two or three paralogs of gonadotropin-releasing hormone (GnRH) genes: gnrh1, gnrh2, and gnrh3. Some species have lost the gnrh1 and/or gnrh3 genes, whereas gnrh2 has been completely conserved in the teleost species analyzed to date. In most teleosts that possess gnrh1, GnRH1 peptide is the authentic GnRH that stimulates gonadotropin release, whereas GnRH2 and GnRH3, if present, are neuromodulatory. Progenitors of GnRH1 and GnRH3 neurons originate from olfactory placodes and migrate to their destination during early development. However, because of the relatively low affinity/specificity of generally available antibodies that recognize GnRH1 or GnRH3, labeling of these neurons has only been possible using genetic manipulation. We used a model teleost, medaka, which possesses all three paralogous gnrh genes, to analyze development of forebrain GnRH neurons composed of GnRH1 and GnRH3 neurons. Here, we newly generated transgenic medaka lines that express enhanced green fluorescent protein under the control of promoters for gnrh1 or gnrh3, to detect GnRH neurons and facilitate immunohistochemical analysis of the neuronal morphology. We used a combination of immunohistochemistry and three-dimensional confocal microscopy image reconstructions to improve identification of neurites from GnRH1 or GnRH3 neuronal populations with greater precision. This led us to clearly identify the hypophysiotropic innervation of GnRH1 neurons residing in the ventral preoptic area (vPOA) from as early as 10 days post hatching. Furthermore, these analyses also revealed retinopetal projections of nonhypophysiotropic GnRH1 neurons in vPOA, prominent during early developmental stages, and multiple populations of GnRH3 neurons with different origins and migratory pathways.

  4. Transgenic expression of human glial cell line-derived neurotrophic factor from integration-deficient lentiviral vectors is neuroprotective in a rodent model of Parkinson's disease.

    PubMed

    Lu-Nguyen, Ngoc B; Broadstock, Martin; Schliesser, Maximilian G; Bartholomae, Cynthia C; von Kalle, Christof; Schmidt, Manfred; Yáñez-Muñoz, Rafael J

    2014-07-01

    Standard integration-proficient lentiviral vectors (IPLVs) are effective at much lower doses than other vector systems and have shown promise for gene therapy of Parkinson's disease (PD). Their main drawback is the risk of insertional mutagenesis. The novel biosafety-enhanced integration-deficient lentiviral vectors (IDLVs) may offer a significant enhancement in biosafety, but have not been previously tested in a model of a major disease. We have assessed biosafety and transduction efficiency of IDLVs in a rat model of PD, using IPLVs as a reference. Genomic insertion of lentivectors injected into the lesioned striatum was studied by linear amplification-mediated polymerase chain reaction (PCR), followed by deep sequencing and insertion site analysis, demonstrating lack of significant IDLV integration. Reporter gene expression studies showed efficient, long-lived, and transcriptionally targeted expression from IDLVs injected ahead of lesioning in the rat striatum, although at somewhat lower expression levels than from IPLVs. Transgenic human glial cell line-derived neurotrophic factor (hGDNF) expression from IDLVs was used for a long-term investigation of lentivector-mediated, transcriptionally targeted neuroprotection in this PD rat model. Vectors were injected before striatal lesioning, and the results showed improvements in nigral dopaminergic neuron survival and behavioral tests regardless of lentiviral integration proficiency, although they confirmed lower expression levels of hGDNF from IDLVs. These data demonstrate the effectiveness of IDLVs in a model of a major disease and indicate that these vectors could provide long-term PD treatment at low dose, combining efficacy and biosafety for targeted central nervous system applications.

  5. Production of marker-free and RSV-resistant transgenic rice using a twin T-DNA system and RNAi.

    PubMed

    Jiang, Yayuan; Sun, Lin; Jiang, Mingsong; Li, Kaidong; Song, Yunzhi; Zhu, Changxiang

    2013-09-01

    A twin T-DNA system is a convenient strategy for creating selectable marker-free transgenic plants. The standard transformation plasmid, pCAMBIA 1300, was modified into a binary vector consisting of two separate T-DNAs, one of which contained the hygromycin phosphotransferase (hpt) marker gene. Using this binary vector, we constructed two vectors that expressed inverted-repeat (IR) structures targeting the rice stripe virus (RSV) coat protein (CP) gene and the special-disease protein (SP) gene. Transgenic rice lines were obtained via Agrobacterium-mediated transformation. Seven independent clones harbouring both the hpt marker gene and the target genes (RSV CP or SP) were obtained in the primary transformants of pDTRSVCP and pDTRSVSP, respectively. The segregation frequencies of the target gene and the marker gene in the T1 plants were 8.72 percent for pDTRSVCP and 12.33 percent for pDTRSVSP. Two of the pDTRSVCP lines and three pDTRSVSP lines harbouring the homozygous target gene, but not the hpt gene, were strongly resistant to RSV. A molecular analysis of the resistant transgenic plants confirmed the stable integration and expression of the target genes. The resistant transgenic plants displayed lower levels of the transgene transcripts and specific small interfering RNAs, suggesting that RNAi induced the viral resistance.

  6. PeaT1-induced systemic acquired resistance in tobacco follows salicylic acid-dependent pathway.

    PubMed

    Zhang, Wei; Yang, Xiufen; Qiu, Dewen; Guo, Lihua; Zeng, Hongmei; Mao, Jianjun; Gao, Qiufeng

    2011-04-01

    Systemic acquired resistance (SAR) is an inducible defense mechanism which plays a central role in protecting plants from pathogen attack. A new elicitor, PeaT1 from Alternaria tenuissima, was expressed in Escherichia coil and characterized with systemic acquired resistance to tobacco mosaic virus (TMV). PeaT1-treated plants exhibited enhanced systemic resistance with a significant reduction in number and size of TMV lesions on wild tobacco leaves as compared with control. The quantitative analysis of TMV CP gene expression with real-time quantitative PCR showed there was reduction in TMV virus concentration after PeaT1 treatment. Similarly, peroxidase (POD) activity and lignin increased significantly after PeaT1 treatment. The real-time quantitative PCR revealed that PeaT1 also induced the systemic accumulation of pathogenesis-related gene, PR-1a and PR-1b which are the markers of systemic acquired resistance (SAR), NPR1 gene for salicylic acid (SA) signal transduction pathway and PAL gene for SA synthesis. The accumulation of SA and the failure in development of similar level of resistance as in wild type tobacco plants in PeaT1 treated nahG transgenic tobacco plants indicated that PeaT1-induced resistance depended on SA accumulation. The present work suggested that the molecular mechanism of PeaT1 inducing disease resistance in tobacco was likely through the systemic acquired resistance pathway mediated by salicylic acid and the NPR1 gene.

  7. Transgenic Animals.

    ERIC Educational Resources Information Center

    Jaenisch, Rudolf

    1988-01-01

    Describes three methods and their advantages and disadvantages for introducing genes into animals. Discusses the predictability and tissue-specificity of the injected genes. Outlines the applications of transgenic technology for studying gene expression, the early stages of mammalian development, mutations, and the molecular nature of chromosomes.…

  8. Every silver lining has a cloud: the scientific and animal welfare issues surrounding a new approach to the production of transgenic animals.

    PubMed

    Combes, Robert D; Balls, Michael

    2014-05-01

    The scientific basis and advantages of using recently developed CRISPR/Cas-9 technology for transgenesis have been assessed with respect to other production methods, laboratory animal welfare, and the scientific relevance of transgenic models of human diseases in general. As the new technology is straightforward, causes targeted DNA double strand breaks and can result in homozygous changes in a single step, it is more accurate and more efficient than other production methods and speeds up transgenesis. CRISPR/Cas-9 also obviates the use of embryonic stem cells, and is being used to generate transgenic non-human primates (NHPs). While the use of this method reduces the level of animal wastage resulting from the production of each new strain, any long-term contribution to reduction will be offset by the overall increase in the numbers of transgenic animals likely to result from its widespread usage. Likewise, the contribution to refinement of using a more-precise technique, thereby minimising the occurrence of unwanted genetic effects, will be countered by a probable substantial increase in the production of transgenic strains of increasingly sentient species. For ethical and welfare reasons, we believe that the generation of transgenic NHPs should be allowed only in extremely exceptional circumstances. In addition, we present information, which, on both welfare and scientific grounds, leads us to question the current policy of generating ever-more new transgenic models in light of the general failure of many of them, after over two decades of ubiquitous use, to result in significant advances in the understanding and treatment of many key human diseases. Because this unsatisfactory situation is likely to be due to inherent, as well as possibly avoidable, limitations in the transgenic approach to studying disease, which are briefly reviewed, it is concluded that a thorough reappraisal of the rationale for using genetically-altered animals in fundamental research and

  9. Improved nutritive quality and salt resistance in transgenic maize by simultaneously overexpression of a natural lysine-rich protein gene, SBgLR, and an ERF transcription factor gene, TSRF1.

    PubMed

    Wang, Meizhen; Liu, Chen; Li, Shixue; Zhu, Dengyun; Zhao, Qian; Yu, Jingjuan

    2013-04-29

    Maize (Zea mays L.), as one of the most important crops in the world, is deficient in lysine and tryptophan. Environmental conditions greatly impact plant growth, development and productivity. In this study, we used particle bombardment mediated co-transformation to obtain marker-free transgenic maize inbred X178 lines harboring a lysine-rich protein gene SBgLR from potato and an ethylene responsive factor (ERF) transcription factor gene, TSRF1, from tomato. Both of the target genes were successfully expressed and showed various expression levels in different transgenic lines. Analysis showed that the protein and lysine content in T1 transgenic maize seeds increased significantly. Compared to non-transformed maize, the protein and lysine content increased by 7.7% to 24.38% and 8.70% to 30.43%, respectively. Moreover, transgenic maize exhibited more tolerance to salt stress. When treated with 200 mM NaCl for 48 h, both non-transformed and transgenic plant leaves displayed wilting and losing green symptoms and dramatic increase of the free proline contents. However, the degree of control seedlings was much more serious than that of transgenic lines and much more increases of the free proline contents in the transgenic lines than that in the control seedlings were observed. Meanwhile, lower extent decreases of the chlorophyll contents were detected in the transgenic seedlings. Quantitative RT-PCR was performed to analyze the expression of ten stress-related genes, including stress responsive transcription factor genes, ZmMYB59 and ZmMYC1, proline synthesis related genes, ZmP5CS1 and ZmP5CS2, photosynthesis-related genes, ZmELIP, ZmPSI-N, ZmOEE, Zmrbcs and ZmPLAS, and one ABA biosynthesis related gene, ZmSDR. The results showed that with the exception of ZmP5CS1 and ZmP5CS2 in line 9-10 and 19-11, ZmMYC1 in line 19-11 and ZmSDR in line 19-11, the expression of other stress-related genes were inhibited in transgenic lines under normal conditions. After salt treatment

  10. Transgenic mice in developmental toxicology

    SciTech Connect

    Woychik, R.P.

    1992-01-01

    Advances in molecular biology and embryology are being utilized for the generation of transgenic mice, animals that contain specific additions, deletions, or modifications of genes or sequences in their DNA. Mouse embryonic stem cells and homologous recombination procedures have made it possible to target specific DNA structural alterations to highly localized region in the host chromosomes. The majority of the DNA structural rearrangements in transgenic mice can be passed through the germ line and used to establish new genetic traits in the carrier animals. Since the use of transgenic mice is having such an enormous impact on so many areas of mammalian biological research, including developmental toxicology, the objective of this review is to briefly describe the fundamental methodologies for generating transgenic mice and to describe one particular application that has direct relevance to the field of genetic toxicology.

  11. Transgenic mice in developmental toxicology

    SciTech Connect

    Woychik, R.P.

    1992-12-31

    Advances in molecular biology and embryology are being utilized for the generation of transgenic mice, animals that contain specific additions, deletions, or modifications of genes or sequences in their DNA. Mouse embryonic stem cells and homologous recombination procedures have made it possible to target specific DNA structural alterations to highly localized region in the host chromosomes. The majority of the DNA structural rearrangements in transgenic mice can be passed through the germ line and used to establish new genetic traits in the carrier animals. Since the use of transgenic mice is having such an enormous impact on so many areas of mammalian biological research, including developmental toxicology, the objective of this review is to briefly describe the fundamental methodologies for generating transgenic mice and to describe one particular application that has direct relevance to the field of genetic toxicology.

  12. Development of insect-resistant transgenic cotton with chimeric TVip3A* accumulating in chloroplasts.

    PubMed

    Wu, Jiahe; Luo, Xiaoli; Zhang, Xiangrong; Shi, Yuejing; Tian, Yingchuan

    2011-10-01

    An optimized vip3A gene, designated as vip3A* was chemically synthesized and a thi1 gene chloroplast transit peptide coding sequence was attached to its 5' end to produce the tvip3A*. vip3A* and tvip3A* genes were transformed into Gossypium hirsutum cv. Zhongmiansuo35. Of 42 independent transformants, 36 were positive for the vip3A* or tvip3A* gene. Four independent transgenic T1 lines with single-copy insertions and unchanged phenotypes (CTV1 and CTV2 for tvip3A*, and CV1 and CV2 for vip3A*) were selected by Southern blotting, and subjected to an insect bioassay and field assessment. Four homozygous T2 transgenic lines were then selected and the amount of expressed Vip3A* protein was determined by western blotting and ELISA. The protein concentrations of CTV1 and CTV2 were about three-fold higher than those of CV1 and CV2. As expected, the Vip3A* protein of CTV1 and CTV2 were transported to the chloroplasts, where they accumulated. The Vip3A* protein concentration in the chloroplasts of CTV1 and CTV2 was about 15-fold of that of CV1 and CV2. All four transgenic lines showed 100% mortality against fall armyworm (Spodoptera frugiperda) and beet armyworm (Spodoptera exigua) by insect bioassay. Moreover, CTV1 and CTV2 exhibited 100% mortality against cotton bollworm (CBW, Helicoverpa zea), whereas CV1 and CV2 showed 75.0% and 72.5% mortality against CBW, respectively. The field bioassay indicated that CTV1 and CTV2 were more resistant to CBW than CV1 and CV2. Our results suggest that the two tvip3A* transgenic lines (CTV1 and CTV2) can be used to develop insect-resistant cultivars and could be used as a resource for raising multi-toxins-expressing transgenic cotton.

  13. Advanced Colloids Experiment (ACE-T1)

    NASA Technical Reports Server (NTRS)

    Meyer, William V.; Sicker, Ron; Brown, Dan; Eustace, John

    2015-01-01

    Increment 45 - 46 Science Symposium presentation of Advanced Colloids Experiment (ACE-T1) to RPO. The purpose of this event is for Principal Investigators to present their science objectives, testing approach, and measurement methods to agency scientists, managers, and other investigators.

  14. A field-grown transgenic tomato line expressing higher levels of polyamines reveals legume cover crop mulch-specific perturbations in fruit phenotype at the levels of metabolite profiles, gene expression, and agronomic characteristics.

    PubMed

    Neelam, Anil; Cassol, Tatiana; Mehta, Roshni A; Abdul-Baki, Aref A; Sobolev, Anatoli P; Goyal, Ravinder K; Abbott, Judith; Segre, Anna L; Handa, Avtar K; Mattoo, Autar K

    2008-01-01

    Genetic modification of crop plants to introduce desirable traits such as nutritional enhancement, disease and pest resistance, and enhanced crop productivity is increasingly seen as a promising technology for sustainable agriculture and boosting food production in the world. Independently, cultural practices that utilize alternative agriculture strategies including organic cultivation subscribe to sustainable agriculture by limiting chemical usage and reduced tillage. How the two together affect fruit metabolism or plant growth in the field or whether they are compatible has not yet been tested. Fruit-specific yeast S-adenosylmethionine decarboxylase (ySAMdc) line 579HO, and a control line 556AZ were grown in leguminous hairy vetch (Vicia villosa Roth) (HV) mulch and conventional black polyethylene (BP) mulch, and their fruit analysed. Significant genotypexmulch-dependent interactions on fruit phenotype were exemplified by differential profiles of 20 fruit metabolites such as amino acids, sugars, and organic acids. Expression patterns of the ySAMdc transgene, and tomato SAMdc, E8, PEPC, and ICDHc genes were compared between the two lines as a function of growth on either BP or HV mulch. HV mulch significantly stimulated the accumulation of asparagine, glutamate, glutamine, choline, and citrate concomitant with a decrease in glucose in the 556AZ fruits during ripening as compared to BP. It enables a metabolic system in tomato somewhat akin to the one in higher polyamine-accumulating transgenic fruit that have higher phytonutrient content. Finally, synergism was found between HV mulch and transgenic tomato in up-regulating N:C indicator genes PEPC and ICDHc in the fruit.

  15. Feline neural progenitor cells II: use of novel plasmid vector and hybrid promoter to drive expression of glial cell line-derived neurotrophic factor transgene.

    PubMed

    You, X Joann; Yang, Jing; Gu, Ping; Liew, Chee Gee; Klassen, Henry J

    2012-01-01

    Sustained transgene expression is required for the success of cell transplant-based gene therapy. Most widely used are lentiviral-based vectors which integrate into the host genome and thereby maintain sustained transgene expression. This requires integration into the nuclear genome, and potential risks include activation of oncogenes and inactivation of tumor suppressor genes. Plasmids have been used; however lack of sustained expression presents an additional challenge. Here we used the pCAG-PyF101-eGFP plasmid to deliver the human GDNF gene to cat neural progenitor cells (cNPCs). This vector consists of a CAGG composite promoter linked to the polyoma virus mutant enhancer PyF101. Expression of an episomal eGFP reporter and GDNF transgene were stably maintained by the cells, even following induction of differentiation. These genetically modified cells appear suitable for use in allogeneic models of cell-based delivery of GDNF in the cat and may find veterinary applications should such strategies prove clinically beneficial.

  16. Agrobacterium-mediated transformation of polyploid cereals. The efficiency of selection and transgene expression in wheat.

    PubMed

    Przetakiewicz, Anna; Karaś, Agnieszka; Orczyk, Wacław; Nadolska-Orczyk, Anna

    2004-01-01

    Three combinations of Agrobacterium tumefaciens strains and vectors were used in the transformation of selected Polish wheat cultivars. The combinations were: two hypervirulent strains, AGL1, containing the pDM805 binary plasmid, and EHA101, containing pGAH; and the common Agro strain LBA4404, harboring the super-binary pTOK233 vector. pDM805 contained bar under the control of Ubi1 promoter, pGAH had nptII under nos, and pTOK233 had hpt under 35S. Additionally, pDM805 and pTOK233 carried the gus reporter gene under the Act1 promoter or 35S promoter, respectively. The highest selection rate was 12.6% and was obtained with EHA101(pGAH) on a kanamycin-containing medium. Sixty-five of the plants grown on that medium were PCR positive. The second best combination was LBA4404(pTOK233) and kanamycin selection, which gave an average transformation rate of 2.3%. Phosphinothricin selection gave 1.0% transformation efficiency, while hygromycin, depending on the strain/vector used, gave from 0.2 to 0.4%. PCR tests in T1 revealed that 67% of the lines showed a 3:1 segregation ratio, and 11% a 15:1 ratio, while in 22%, segregation was non-Mendelian. The high number of T0 transgenic plants containing one copy of the transgene was confirmed via Southern blot analysis. Kanamycin resistance in the T1 generation was very low; in some lines, all the progeny were kanamycin sensitive. GUS expression, only tested in young T1 plants, was in agreement with Mendelian segregation in three out of the twelve tested. The factors influencing the efficiency of selection and transgene expression are discussed in this paper.

  17. 2013 North Dakota Transgenic Barley Research and FHB Nursery Report

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research continues to develop and test new transgenic plants using genes provided by collaborators. As lines are developed in Golden Promise, they are crossed to Conlon for field testing. Transgenic lines developed in Conlon are being crossed to resistant lines developed by the breeding programs. ...

  18. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.

    PubMed

    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru

    2016-10-01

    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.

  19. Transgenic peppers that are highly tolerant to a new CMV pathotype.

    PubMed

    Lee, Yun Hee; Jung, Min; Shin, Sun Hee; Lee, Ji Hee; Choi, Soon Ho; Her, Nam Han; Lee, Jang Ha; Ryu, Ki Hyun; Paek, Kee Yoeup; Harn, Chee Hark

    2009-02-01

    The CMV (cucumber mosaic virus) is the most frequently occurring virus in chili pepper farms. A variety of peppers that are resistant to CMVP0 were developed in the middle of 1990s through a breeding program, and commercial cultivars have since been able to control the spread of CMVP0. However, a new pathotype (CMVP1) that breaks the resistance of CMVP0-resistant peppers has recently appeared and caused a heavy loss in productivity. Since no genetic source of this new pathotype was available, a traditional breeding method cannot be used to generate a CMVP1-resistant pepper variety. Therefore, we set up a transformation system of pepper using Agrobacterium that had been transfected with the coat protein gene, CMVP0-CP, with the aim of developing a new CMVP1-resistant pepper line. A large number of transgenic peppers (T(1), T(2) and T(3)) were screened for CMVP1 tolerance using CMVP1 inoculation. Transgenic peppers tolerant to CMVP1 were selected in a plastic house as well as in the field. Three independent T(3) pepper lines highly tolerant to the CMVP1 pathogen were found to also be tolerant to the CMVP0 pathogen. These selected T(3) pepper lines were phenotypically identical or close to the non-transformed lines. However, after CMVP1 infection, the height and fruit size of the non-transformed lines became shorter and smaller, respectively, while the T(3) pepper lines maintained a normal phenotype.

  20. Transgenic mouse offspring generated by ROSI.

    PubMed

    Moreira, Pedro; Pérez-Cerezales, Serafín; Laguna, Ricardo; Fernández-Gonzalez, Raúl; Sanjuanbenito, Belén Pintado; Gutiérrez-Adán, Alfonso

    2016-01-01

    The production of transgenic animals is an important tool for experimental and applied biology. Over the years, many approaches for the production of transgenic animals have been tried, including pronuclear microinjection, sperm-mediated gene transfer, transfection of male germ cells, somatic cell nuclear transfer and the use of lentiviral vectors. In the present study, we developed a new transgene delivery approach, and we report for the first time the production of transgenic animals by co-injection of DNA and round spermatid nuclei into non-fertilized mouse oocytes (ROSI). The transgene used was a construct containing the human CMV immediate early promoter and the enhanced GFP gene. With this procedure, 12% of the live offspring we obtained carried the transgene. This efficiency of transgenic production by ROSI was similar to the efficiency by pronuclear injection or intracytoplasmic injection of male gamete nuclei (ICSI). However, ICSI required fewer embryos to produce the same number of transgenic animals. The expression of Egfp mRNA and fluorescence of EGFP were found in the majority of the organs examined in 4 transgenic lines generated by ROSI. Tissue morphology and transgene expression were not distinguishable between transgenic animals produced by ROSI or pronuclear injection. Furthermore, our results are of particular interest because they indicate that the transgene incorporation mediated by intracytoplasmic injection of male gamete nuclei is not an exclusive property of mature sperm cell nuclei with compact chromatin but it can be accomplished with immature sperm cell nuclei with decondensed chromatin as well. The present study also provides alternative procedures for transgene delivery into embryos or reconstituted oocytes.

  1. Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3.

    PubMed

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

  2. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  3. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    PubMed Central

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  4. Assessment of peanut quality and compositional characteristics among transgenic sclerotinia blight-resistant and non-transgenic susceptible cultivars.

    PubMed

    Hu, Jiahuai; Telenko, Darcy E P; Phipps, Patrick M; Grabau, Elizabeth A

    2014-08-06

    This study presents the results of a comparison that includes an analysis of variance and a canonical discriminant analysis to determine compositional equivalence and similarity between transgenic, sclerotinia blight-resistant and non-transgenic, susceptible cultivars of peanut in 3 years of field trials. Three Virginia-type cultivars (NC 7, Wilson, and Perry) and their corresponding transgenic lines (N70, W73, and P39) with a barley oxalate oxidase gene were analyzed for differences in key mineral nutrients, fatty acid components, hay constituents, and grade characteristics. Results from both analyses demonstrated that transgenic lines were compositionally similar to their non-transgenic parent cultivar in all factors as well as market-grade characteristics and nutritional value. Transgenic lines expressing oxalate oxidase for resistance to sclerotinia blight were substantially equivalent to their non-transgenic parent cultivar in quality and compositional characteristics.

  5. On-line casein micelle disruption for downstream purification of recombinant human myelin basic protein produced in the milk of transgenic cows.

    PubMed

    Al-Ghobashy, Medhat A; Williams, Martin A K; Brophy, Brigid; Laible, Götz; Harding, David R K

    2009-06-01

    Downstream purification of a model recombinant protein (human myelin basic protein) from milk of transgenic cows is described. The recombinant protein was expressed as a His tagged fusion protein in the milk of transgenic cows and was found associated with the casein micellar phase. While difficulties in obtaining good recoveries were found when employing conventional micelle disruption procedures, direct capture using the cation exchanger SP Sepharose Big Beads was found successful in the extraction of the recombinant protein. Early breakthrough suggested a slow release of the recombinant protein from the micelles and dictated micelle disruption in order to obtain good yields. A new approach for deconstruction of the calcium core of the casein micelles, employing the interaction between the micellar calcium and the active sites of the cation exchanger resin was developed. Milk samples were loaded to the column in aliquots with a column washing step after each aliquot. This sequential loading approach successfully liberated the recombinant protein from the micelles and was found superior to the conventional sample loading approach. It increased the recovery by more than 25%, reduced fouling due to milk components and improved the column hydrodynamic properties as compared to the conventional sample loading approach. Hardware and software modifications to the chromatography system were necessary in order to keep the whole process automated. A second purification step using a Ni2+ affinity column was used to isolate the recombinant protein at purity more than 90% and a recovery percentage of 78%.

  6. Phenotyping transgenic wheat for drought resistance.

    PubMed

    Saint Pierre, Carolina; Crossa, José L; Bonnett, David; Yamaguchi-Shinozaki, Kazuko; Reynolds, Matthew P

    2012-03-01

    Realistic experimental protocols to screen for drought adaptation in controlled conditions are crucial if high throughput phenotyping is to be used for the identification of high performance lines, and is especially important in the evaluation of transgenes where stringent biosecurity measures restrict the frequency of open field trials. Transgenic DREB1A-wheat events were selected under greenhouse conditions by evaluating survival and recovery under severe drought (SURV) as well as for water use efficiency (WUE). Greenhouse experiments confirmed the advantages of transgenic events in recovery after severe water stress. Under field conditions, the group of transgenic lines did not generally outperform the controls in terms of grain yield under water deficit. However, the events selected for WUE were identified as lines that combine an acceptable yield-even higher yield (WUE-11) under well irrigated conditions-and stable performance across the different environments generated by the experimental treatments.

  7. Expression specificity of GFAP transgenes.

    PubMed

    Su, Mu; Hu, Huimin; Lee, Youngjin; d'Azzo, Alessandra; Messing, Albee; Brenner, Michael

    2004-11-01

    Glial fibrillary acidic protein (GFAP) is an intermediate filament protein found predominantly in astrocytes. This specificity has recommended the GFAP gene promoter for targeting transgene expression to astrocytes. Although both we [Brenner et al. J. Neurosci. 14:1030-1037, (1994)] and others [Mucke et al. New Biol. 3:465-474, (1991)] have reported astrocyte specificity for GFAP promoters, we demonstrate here that these DNA sequences can also direct activity in neurons. The pattern of neuronal activity varied with both the nature of the expressed sequence and the transgene insertion site. Specifically, neuronal expression was very high for a protective protein/cathepsin A minigene, moderate for lacZ and undetectable for GFP. These findings, coupled with a survey of the literature, recommend that investigators using GFAP-driven transgenes verify specificity for each line studied, using a detection system whose sensitivity is sufficient to detect a compromising level of misexpression.

  8. Lines

    ERIC Educational Resources Information Center

    Mires, Peter B.

    2006-01-01

    National Geography Standards for the middle school years generally stress the teaching of latitude and longitude. There are many creative ways to explain the great grid that encircles our planet, but the author has found that students in his college-level geography courses especially enjoy human-interest stories associated with lines of latitude…

  9. SirT1 gain-of-function increases energy efficiency and prevents diabetes in mice

    PubMed Central

    Banks, Alexander S.; Kon, Ning; Knight, Colette; Matsumoto, Michihiro; Gutiérrez-Juárez, Roger; Rossetti, Luciano; Gu, Wei; Accili, Domenico

    2011-01-01

    Summary In yeast, worms and flies, an extra copy of the gene encoding the Sirtuin Sir2 increases metabolic efficiency, as does administration of polyphenols like resveratrol, thought to act through Sirtuins. But evidence that Sirtuin gain-of-function results in increased metabolic efficiency in mammals is limited. We generated transgenic mice with moderate overexpression of SirT1, designed to mimic the Sirtuin gain-of-function that improves metabolism in C.elegans. These mice exhibit normal insulin sensitivity, but decreased food intake and locomotor activity, resulting in decreased energy expenditure. However, in various models of insulin resistance and diabetes, SirT1 transgenics display improved glucose tolerance due to decreased hepatic glucose production and increased adiponectin levels, without changes in body weight or composition. We conclude that SirT1 gain-of-function primes the organism for metabolic adaptation to insulin resistance, increasing hepatic insulin sensitivity and decreasing whole-body energy requirements. These findings have important implications for Sirtuin-based therapies in humans. PMID:18840364

  10. Saturation-inversion-recovery: A method for T1 measurement

    NASA Astrophysics Data System (ADS)

    Wang, Hongzhi; Zhao, Ming; Ackerman, Jerome L.; Song, Yiqiao

    2017-01-01

    Spin-lattice relaxation (T1) has always been measured by inversion-recovery (IR), saturation-recovery (SR), or related methods. These existing methods share a common behavior in that the function describing T1 sensitivity is the exponential, e.g., exp(- τ /T1), where τ is the recovery time. In this paper, we describe a saturation-inversion-recovery (SIR) sequence for T1 measurement with considerably sharper T1-dependence than those of the IR and SR sequences, and demonstrate it experimentally. The SIR method could be useful in improving the contrast between regions of differing T1 in T1-weighted MRI.

  11. Development of insect-resistant transgenic cotton with chimeric TVip3A accumulating in chloroplasts.

    PubMed

    Wu, Jiahe; Tian, Yingchuan

    2013-01-01

    An optimized vip3A gene, designated as vip3A* was chemically synthesized and a thi1 gene chloroplast transit peptide coding sequence was attached to its 5' end to produce the tvip3A*. vip3A* and tvip3A* genes were transformed into Gossypium hirsutum cv. Zhongmiansuo35 mediated by Agrobacterium tumefaciens. Four independent transgenic T1 lines with single-copy insertions and unchanged phenotypes (CTV1 and CTV2 for tvip3A*, and CV1 and CV2 for vip3A*) were selected by Polymerase chain reaction (PCR), Reverse transcription (RT)-PCR, Southern blotting, enzyme-linked immunosorbent assay (ELISA), and insect bioassay. As expected, the Vip3A* protein of CTV1 and CTV2 were transported to the chloroplasts, where they accumulated. Our results suggest that the two tvip3A* transgenic lines (CTV1 and CTV2) can be used to develop insect-resistant cultivars and could be used as a resource for raising multi-toxins-expressing transgenic cotton.

  12. Refinement of the Citrus tristeza virus resistance gene (Ctv) positional map in Poncirus trifoliata and generation of transgenic grapefruit (Citrus paradisi) plant lines with candidate resistance genes in this region.

    PubMed

    Rai, Mamta

    2006-06-01

    Citrus tristeza virus (CTV) is a major pathogen of Citrus. A single dominant gene Ctv present in the trifoliate relative of Citrus, Poncirus trifoliata confers broad spectrum resistance against CTV. Refinement of genetic maps has delimited this gene to a 121 kb region, comprising of ten candidate Ctv resistance genes. The ten candidate genes were individually cloned in Agrobacterium based binary vector and transformed into three CTV susceptible grapefruit varieties. Two of the candidate R-genes, R-2 and R-3 are exclusively expressed in transgenic plants and in Poncirus trifoliata, while five other genes are also expressed in non-transformed Citrus controls. Northern blotting with a CTV derived probe for assessment of infection in virus inoculated plants over a span of three growth periods, each comprising of six to eight weeks, indicates either an absence of initiation of infection or it's slow spread in R-2 plant lines or an initial appearance of infection and it's subsequent obliteration in some R-1 and R-4 plant lines. Limited genome walk up- and downstream form R-1 gene, based on it's 100% sequence identity between Poncirus and Citrus, indicates promoter identity of 92% between the two varieties. Further upstream and downstream sequencing indicates the presence of an O-methyl transferase and a Copia like gene respectively in Citrus instead of the amino acid transporter like gene upstream and a sugar transporter like gene downstream in Poncirus. The possibility of recombinations in the resistance locus of Citrus and the need for consistent monitoring for virus infection and gene expression in the transgenic Citrus trees is discussed.

  13. Improved production of genetically modified fetuses with homogeneous transgene expression after transgene integration site analysis and recloning in cattle.

    PubMed

    Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira

    2011-02-01

    Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.

  14. The hrpZ gene of Pseudomonas syringae pv. phaseolicola enhances resistance to rhizomania disease in transgenic Nicotiana benthamiana and sugar beet.

    PubMed

    Pavli, Ourania I; Kelaidi, Georgia I; Tampakaki, Anastasia P; Skaracis, George N

    2011-03-04

    To explore possible sources of transgenic resistance to the rhizomania-causing Beet necrotic yellow vein virus (BNYVV), Nicotiana benthamiana plants were constructed to express the harpin of Pseudomonas syringae pv. phaseolicola (HrpZ(Psph)). The HrpZ protein was expressed as an N-terminal fusion to the PR1 signal peptide (SP/HrpZ) to direct harpin accumulation to the plant apoplast. Transgene integration was verified by mPCR in all primary transformants (T0), while immunoblot analysis confirmed that the protein HrpZ(Psph) was produced and the signal peptide was properly processed. Neither T0 plants nor selfed progeny (T1) showed macroscopically visible necrosis or any other macroscopic phenotypes. However, plants expressing the SP/HrpZ(Psph) showed increased vigor and grew faster in comparison with non-transgenic control plants. Transgenic resistance was assessed after challenge inoculation with BNYVV on T1 progeny by scoring of disease symptoms and by DAS-ELISA at 20 and 30 dpi. Transgenic and control lines showed significant differences in terms of the number of plants that became infected, the timing of infection and the disease symptoms displayed. Plants expressing the SP/HrpZ(Psph) developed localized leaf necrosis in the infection area and had enhanced resistance upon challenge with BNYVV. In order to evaluate the SP/HrpZ-based resistance in the sugar beet host, A. rhizogenes-mediated root transformation was exploited as a transgene expression platform. Upon BNYVV inoculation, transgenic sugar beet hairy roots showed high level of BNYVV resistance. In contrast, the aerial non-transgenic parts of the same seedlings had virus titers that were comparable to those of the seedlings that were untransformed or transformed with wild type R1000 cells. These findings indicate that the transgenically expressed SP/HrpZ protein results in enhanced rhizomania resistance both in a model plant and sugar beet, the natural host of BNYVV. Possible molecular mechanisms

  15. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress.

    PubMed

    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P; Dobaria, Jentilal R

    2016-01-01

    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity.

  16. Stress Inducible Expression of AtDREB1A Transcription Factor in Transgenic Peanut (Arachis hypogaea L.) Conferred Tolerance to Soil-Moisture Deficit Stress

    PubMed Central

    Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P.; Dobaria, Jentilal R.

    2016-01-01

    Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163

  17. New Transgenic Mouse Lines for Selectively Targeting Astrocytes and Studying Calcium Signals in Astrocyte Processes In Situ and In Vivo.

    PubMed

    Srinivasan, Rahul; Lu, Tsai-Yi; Chai, Hua; Xu, Ji; Huang, Ben S; Golshani, Peyman; Coppola, Giovanni; Khakh, Baljit S

    2016-12-21

    Astrocytes exist throughout the nervous system and are proposed to affect neural circuits and behavior. However, studying astrocytes has proven difficult because of the lack of tools permitting astrocyte-selective genetic manipulations. Here, we report the generation of Aldh1l1-Cre/ERT2 transgenic mice to selectively target astrocytes in vivo. We characterized Aldh1l1-Cre/ERT2 mice using imaging, immunohistochemistry, AAV-FLEX-GFP microinjections, and crosses to RiboTag, Ai95, and new Cre-dependent membrane-tethered Lck-GCaMP6f knockin mice that we also generated. Two to three weeks after tamoxifen induction, Aldh1l1-Cre/ERT2 selectively targeted essentially all adult (P80) brain astrocytes with no detectable neuronal contamination, resulting in expression of cytosolic and Lck-GCaMP6f, and permitting subcellular astrocyte calcium imaging during startle responses in vivo. Crosses with RiboTag mice allowed sequencing of actively translated mRNAs and determination of the adult cortical astrocyte transcriptome. Thus, we provide well-characterized, easy-to-use resources with which to selectively study astrocytes in situ and in vivo in multiple experimental scenarios.

  18. [Transferring the Suaeda salsa glutathione S-transferase and catalase genes enhances low temperature stress resistance in transgenic rice seedlings].

    PubMed

    Zhao, Feng-Yun; Wang, Xiao-Yun; Zhao, Yan-Xiu; Zhang, Hui

    2006-04-01

    The GST (glutathione S-transferase) and GST+CAT1 (catalase 1) of Suaeda salsa were introduced into a low temperature-sensitive rice cultivar (Oryza sativa cv. Zhonghua No.11) by Agrobacterium tumefaciens-mediated transformation under the control of cauliflower mosaic virus (CaMV) 35S promoter, and the transformed calli and plantlets were screened on Murashige and Skoog (1962) medium supplemented with hygromycin 25 microg/mL and cefotaxime 300 microg/mL. The putative primary transformants (T(0) generation) were acclimatized at 26 degrees C /22 degrees C in a greenhouse for 7 d, and then transplanted to the field, where they grew up to maturity under outdoor conditions. 25 and 14 independent transgenic lines of T(1) generation carrying the GST and GST+CAT1 genes, respectively, were identified by PCR amplification. Transgene expression was monitored by RNA-blot hybridization using total RNA samples from leaf tissues. To investigate whether expressing the Suaeda salsa GST and GST+CAT1 in transgenic rice increased low temperature stress tolerance, the T(4) 14-day-old transgenic and non-transgenic rice seedlings were transferred to a low temperature (day 7 degrees C/night 4 degrees C) growth chamber for 3-6 d. The experimental data showed that expressing the Suaeda salsa GST and GST+CAT1 enhanced low temperature stress resistance in transgenic rice seedlings. When treated with low temperature, both GST and CAT activity increased in the transformants with the time of temperature treatment. These transgenic rice plant seedlings exhibited a higher level of photosynthetic capacity than those of the non-transgenic control seedlings under low temperature treatment. Whereas, there were lower H(2)O(2) and MDA (malondialdehyde) content, and relative electrolyte leakage through the plasma membrane was also lower in transgenic rice seedlings than in the parent line under low temperature condition. The results also indicated that GST+CAT1 co-expression conferred greater level of low

  19. Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties.

    PubMed

    Wang, Ke; Liu, Huiyun; Du, Lipu; Ye, Xingguo

    2016-11-10

    Genotype specificity is a big problem lagging the development of efficient hexaploid wheat transformation system. Increasingly, the biosecurity of genetically modified organisms is garnering public attention, so the generation of marker-free transgenic plants is very important to the eventual potential commercial release of transgenic wheat. In this study, 15 commercial Chinese hexaploid wheat varieties were successfully transformed via an Agrobacterium-mediated method, with efficiency of up to 37.7%, as confirmed by the use of Quickstix strips, histochemical staining, PCR analysis and Southern blotting. Of particular interest, marker-free transgenic wheat plants from various commercial Chinese varieties and their F1 hybrids were successfully obtained for the first time, with a frequency of 4.3%, using a plasmid harbouring two independent T-DNA regions. The average co-integration frequency of the gus and the bar genes located on the two independent T-DNA regions was 49.0% in T0 plants. We further found that the efficiency of generating marker-free plants was related to the number of bar gene copies integrated in the genome. Marker-free transgenic wheat plants were identified in the progeny of three transgenic lines that had only one or two bar gene copies. Moreover, silencing of the bar gene was detected in 30.7% of T1 positive plants, but the gus gene was never found to be silenced in T1 plants. Bisulphite genomic sequencing suggested that DNA methylation in the 35S promoter of the bar gene regulatory region might be the main reason for bar gene silencing in the transgenic plants.

  20. Neuroanatomy and transgenic technologies

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

  1. Edible Safety Assessment of Genetically Modified Rice T1C-1 for Sprague Dawley Rats through Horizontal Gene Transfer, Allergenicity and Intestinal Microbiota

    PubMed Central

    Zhao, Kai; Ren, Fangfang; Han, Fangting; Liu, Qiwen; Wu, Guogan; Xu, Yan; Zhang, Jian; Wu, Xiao; Wang, Jinbin; Li, Peng; Shi, Wei; Zhu, Hong; Lv, Jianjun; Zhao, Xiao; Tang, Xueming

    2016-01-01

    In this study, assessment of the safety of transgenic rice T1C-1 expressing Cry1C was carried out by: (1) studying horizontal gene transfer (HGT) in Sprague Dawley rats fed transgenic rice for 90 d; (2) examining the effect of Cry1C protein in vitro on digestibility and allergenicity; and (3) studying the changes of intestinal microbiota in rats fed with transgenic rice T1C-1 in acute and subchronic toxicity tests. Sprague Dawley rats were fed a diet containing either 60% GM Bacillus thuringiensis (Bt) rice T1C-1 expressing Cry1C protein, the parental rice Minghui 63, or a basic diet for 90 d. The GM Bt rice T1C-1 showed no evidence of HGT between rats and transgenic rice. Sequence searching of the Cry1C protein showed no homology with known allergens or toxins. Cry1C protein was rapidly degraded in vitro with simulated gastric and intestinal fluids. The expressed Cry1C protein did not induce high levels of specific IgG and IgE antibodies in rats. The intestinal microbiota of rats fed T1C-1 was also analyzed in acute and subchronic toxicity tests by DGGE. Cluster analysis of DGGE profiles revealed significant individual differences in the rats' intestinal microbiota. PMID:27706188

  2. Efficient Generation of Mice with Consistent Transgene Expression by FEEST

    PubMed Central

    Gao, Lei; Jiang, Yonghua; Mu, Libing; Liu, Yanbin; Wang, Fengchao; Wang, Peng; Zhang, Aiqun; Tang, Nan; Chen, Ting; Luo, Minmin; Yu, Lei; Gao, Shaorong; Chen, Liang

    2015-01-01

    Transgenic mouse models are widely used in biomedical research; however, current techniques for producing transgenic mice are limited due to the unpredictable nature of transgene expression. Here, we report a novel, highly efficient technique for the generation of transgenic mice with single-copy integration of the transgene and guaranteed expression of the gene-of-interest (GOI). We refer to this technique as functionally enriched ES cell transgenics, or FEEST. ES cells harboring an inducible Cre gene enabled the efficient selection of transgenic ES cell clones using hygromycin before Cre-mediated recombination. Expression of the GOI was confirmed by assaying for the GFP after Cre recombination. As a proof-of-principle, we produced a transgenic mouse line containing Cre-activatable tTA (cl-tTA6). This tTA mouse model was able to induce tumor formation when crossed with a transgenic mouse line containing a doxycycline-inducible oncogene. We also showed that the cl-tTA6 mouse is a valuable tool for faithfully recapitulating the clinical course of tumor development. We showed that FEEST can be easily adapted for other genes by preparing a transgenic mouse model of conditionally activatable EGFR L858R. Thus, FEEST is a technique with the potential to generate transgenic mouse models at a genome-wide scale. PMID:26573149

  3. Safety Evaluation of Transgenic Tilapia with Accelerated Growth.

    PubMed

    Guillén; Berlanga; Valenzuela; Morales; Toledo; Estrada; Puentes; Hayes; de la Fuente J

    1999-01-01

    Recent advances in modern marine biotechnology have permitted the generation of new strains of economically important fish species through the transfer of growth hormone genes. These transgenic fish strains show improved growth performance and therefore constitute a better alternative for aquaculture programs. Recently, we have obtained a transgenic tilapia line with accelerated growth. However, before introducing this line into Cuban aquaculture, environmental and food safety assessment was required by national authorities. Experiments were performed to evaluate the behavior of transgenic tilapia in comparison to wild tilapia as a way to assess the environmental impact of introducing transgenic tilapia into Cuban aquaculture. Studies were also conducted to evaluate, according to the principle of substantial equivalence, the safety of consuming transgenic tilapia as food. Behavior studies showed that transgenic tilapia had a lower feeding motivation and dominance status than controls. Food safety assessment indicated that tilapia growth hormone has no biological activity when administered to nonhuman primates. Furthermore, no effects were detected in human healthy volunteers after the consumption of transgenic tilapia. These results showed, at least under the conditions found in Cuba, no environmental implications for the introduction of this transgenic tilapia line and the safety in the consumption of tiGH-transgenic tilapia as an alternative feeding source for humans. These results support the culture and consumption of these transgenic tilapia.

  4. Relative fitness of transgenic vs. non-transgenic maize x teosinte hybrids: a field evaluation.

    PubMed

    Guadagnuolo, R; Clegg, J; Ellstrand, N C

    2006-10-01

    Concern has been often expressed regarding the impact and persistence of transgenes that enter wild populations via gene flow. The impact of a transgene and its persistence are largely determined by the relative fitness of transgenic hybrids and hybrid derivatives compared to non-transgenic plants. Nevertheless, few studies have addressed this question experimentally in the field. Despite the economic importance of maize, and the fact that it naturally hybridizes with the teosinte taxon Zea mays ssp. mexicana, sometimes known as "chalco teosinte," the question has received little experimental attention in this system. Using a glyphosate-tolerant maize cultivar and chalco teosinte as parental lines, we carried out a field experiment testing (1) the relative fitness of maize x teosinte hybrids, compared to their parental taxa, as well as (2) the relative fitness of transgenic hybrids compared to non-transgenic hybrids created from the same parental stock. In order to evaluate the influence of the transgenic construct in different genetic backgrounds, our study included transgenic and non-transgenic pure maize progeny from the cultivar as well. We measured both vegetative and reproductive parameters. Our results demonstrated that hybrids have greater vigor and produced more seeds than the wild parent. However, in the absence of selective pressure from glyphosate herbicide, we did not observe any direct positive or negative impact of the transgene on the fitness or vigor of either the hybrids or pure maize progeny. We discuss our results in terms of the potential for spontaneous transgene flow and introgression from transgenic maize into sympatric teosinte.

  5. mIGF-1/JNK1/SirT1 signaling confers protection against oxidative stress in the heart.

    PubMed

    Vinciguerra, Manlio; Santini, Maria Paola; Martinez, Conception; Pazienza, Valerio; Claycomb, William C; Giuliani, Alessandro; Rosenthal, Nadia

    2012-02-01

    Oxidative stress contributes to the pathogenesis of aging-associated heart failure. Among various signaling pathways mediating oxidative stress, the NAD(+) -dependent protein deacetylase SirT1 has been implicated in the protection of heart muscle. Expression of a locally acting insulin-like growth factor-1 (IGF-1) propeptide (mIGF-1) helps the heart to recover from infarct and enhances SirT1 expression in cardiomyocytes (CM) in vitro, exerting protection from hypertrophic and oxidative stresses. To study the role of mIGF-1/SirT1 signaling in vivo, we generated cardiac-specific mIGF-1 transgenic mice in which SirT1 was depleted from adult CM in a tamoxifen-inducible and conditional fashion. Analysis of these mice confirmed that mIGF-1-induced SirT1 activity is necessary to protect the heart from paraquat (PQ)-induced oxidative stress and lethality. In cultured CM, mIGF-1 increases SirT1 expression through a c-Jun NH(2)-terminal protein kinase 1 (JNK1)-dependent signaling mechanism. Thus, mIGF-1 protects the heart from oxidative stress via SirT1/JNK1 activity, suggesting new avenues for cardiac therapy during aging and heart failure.

  6. An evaluation of new and established methods to determine T‐DNA copy number and homozygosity in transgenic plants.

    PubMed Central

    Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K.; Clemente, Tom E.

    2016-01-01

    Abstract Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL‐)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T‐DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL‐PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T‐DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T‐DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided. PMID:26670088

  7. An evaluation of new and established methods to determine T-DNA copy number and homozygosity in transgenic plants.

    PubMed

    Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K; Clemente, Tom E; Long, Stephen P

    2016-04-01

    Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL-)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T-DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL-PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T-DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T-DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided.

  8. A simple method for NMR t1 noise suppression

    NASA Astrophysics Data System (ADS)

    Mo, Huaping; Harwood, John S.; Yang, Danzhou; Post, Carol Beth

    2017-03-01

    t1 noise appears as random or semi-random spurious streaks along the indirect t1 (F1) dimension of a 2D or nD NMR spectrum. It can significantly downgrade spectral quality, especially for spectra with strong diagonal signals such as NOESY, because useful and weak cross-peaks can be easily buried under t1 noise. One of the significant contributing factors to t1 noise is unwanted and semi-random F2 signal modulation during t1 acquisition. As such, t1 noise from different acquisitions is unlikely to correlate with each other strongly. In the case of NOESY, co-addition of multiple spectra significantly reduces t1 noise compared with conventional acquisition with the same amount of total acquisition time and resolution.

  9. Assessment of inheritance pattern and agronomic performance of transgenic rapeseed having harpin Xooc-encoding hrf2 gene.

    PubMed

    Huo, Rong; Wang, Yu; Ma, Ling-Li; Qiao, Jun-Qing; Shao, Min; Gao, Xue-Wen

    2010-10-01

    hrf2 gene is a member of the harpin-encoding gene family of rice-pathogenic bacterium Xanthomonas oryzae pv. oryzicola. In our previous studies, we observed that harpin(Xooc) could elicit hypersensitive cell death in non-host plants, induce disease and insect resistance in plants, and enhance plant growth. In this study, the rapeseed cultivar, Yangyou 4, was genetically engineered via Agrobacterium-mediated transformation to express the hrf2 gene. Polymerase chain reaction (PCR) and southern blot analyses of T(1) generation of transgenic rapeseed revealed stable integration and expression of the inserted gene hrf2. In addition, the resistance to Sclerotinia sclerotiorum was greatly enhanced. A comparison between agronomic characters of transgenic and control lines displayed significant differences in terms of plant height, stem width, number of pods per plant, number of seeds per pod, 1,000-seed weight, and seed yield per plant. Among lines with resistance to S. sclerotiorum, T(1)1 had improved agronomic traits compared with controls with a 22.7% seed yield increase. These results suggest that the introduction of the hrf2 gene into rapeseed can be an effective strategy for enhancing resistance to S. sclerotiorum.

  10. [Obtaining marker-free transgenic soybean plants with optimal frequency by constructing three T-DNAs binary vector].

    PubMed

    Ye, Xing-Guo; Qin, Hua

    2007-01-01

    Obtaining marker-free plants with high efficiency will benefit the environmental release of transgenic crops. To achieve this point, a binary vector pNB35SVIP1 with three T-DNAs was constructed by using several mediate plasmids, in which one copy of bar gene expression cassette and two copies of VIP1 gene expression cassette were included. EHA101 Agrobacterium strain harboring the final construct was applied to transform soybean (Glycine max) cotyledon nodes. Through 2 - 3 months regeneration and selection on 3 - 5mg/L glufosinate containing medium, transgenic soybean plants were confirmed to be obtained at 0.83% - 3.16%, and co-transformation efficiency of both gene in the same individual reached up to 86.4%, based on southern blot test. By the analysis of PCR, southern blot and northern blot combining with leaf painting of herbicide in T1 progenies, 41 plants were confirmed to be eliminated of bar gene with the frequency of 7.6% . Among the T1 populations tested, the loss of the alien genes happened in 22.7% lines, the silence of bar gene took place in 27.3% lines, and VIP1 gene silence existed in 37.1% marker-free plants. The result also suggested that the plasmid with three T-DNAs might be an ideal vector to generate maker-free genetic modified organism.

  11. Marker-free transgenic (MFT) near-isogenic introgression lines (NIILs) of 'golden' indica rice (cv. IR64) with accumulation of provitamin A in the endosperm tissue.

    PubMed

    Baisakh, Niranjan; Rehana, Sayda; Rai, Mayank; Oliva, Norman; Tan, Jing; Mackill, David J; Khush, Gurdev S; Datta, Karabi; Datta, Swapan K

    2006-07-01

    We have developed near-isogenic introgression lines (NIILs) of an elite indica rice cultivar (IR64) with the genes for beta-carotene biosynthesis from dihaploid (DH) derivatives of golden japonica rice (cv. T309). A careful analysis of the DH lines indicated the integration of the genes of interest [phytoene synthase (psy) and phytoene desaturase (crtI)] and the selectable marker gene (hygromycin phosphotransferase, hph) in two unlinked loci. During subsequent crossing, progenies could be obtained carrying only the locus with psy and crtI, which was segregated independently from the locus containing the hph gene during meiotic segregation. The NIILs (BC(2)F(2)) showed maximum similarity with the recurrent parent cultivar IR64. Further, progenies of two NIILs were devoid of any fragments beyond the left or right border, including the chloramphenicol acetyltransferase (cat) antibiotic resistance gene of the transformation vector. Spectrophotometric readings showed the accumulation of up to 1.06 microg total carotenoids, including beta-carotene, in 1 g of the endosperm. The accumulation of beta-carotene was also evident from the clearly visible yellow colour of the polished seeds.

  12. Transgenic plants with enhanced growth characteristics

    DOEpatents

    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

    2016-09-06

    The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

  13. L-Theanine elicits umami taste via the T1R1 + T1R3 umami taste receptor.

    PubMed

    Narukawa, Masataka; Toda, Yasuka; Nakagita, Tomoya; Hayashi, Yukako; Misaka, Takumi

    2014-06-01

    L-Theanine is a unique amino acid present in green tea. It elicits umami taste and has a considerable effect on tea taste and quality. We investigated L-theanine activity on the T1R1 + T1R3 umami taste receptor. L-Theanine activated T1R1 + T1R3-expressing cells and showed a synergistic response with inosine 5'-monophosphate. The site-directed mutagenesis analysis revealed that L-theanine binds to L-amino acid binding site in the Venus flytrap domain of T1R1. This study shows that L-theanine elicits an umami taste via T1R1 + T1R3.

  14. A Unified Maximum Likelihood Framework for Simultaneous Motion and $T_{1}$ Estimation in Quantitative MR $T_{1}$ Mapping.

    PubMed

    Ramos-Llorden, Gabriel; den Dekker, Arnold J; Van Steenkiste, Gwendolyn; Jeurissen, Ben; Vanhevel, Floris; Van Audekerke, Johan; Verhoye, Marleen; Sijbers, Jan

    2017-02-01

    In quantitative MR T1 mapping, the spin-lattice relaxation time T1 of tissues is estimated from a series of T1 -weighted images. As the T1 estimation is a voxel-wise estimation procedure, correct spatial alignment of the T1 -weighted images is crucial. Conventionally, the T1 -weighted images are first registered based on a general-purpose registration metric, after which the T1 map is estimated. However, as demonstrated in this paper, such a two-step approach leads to a bias in the final T1 map. In our work, instead of considering motion correction as a preprocessing step, we recover the motion-free T1 map using a unified estimation approach. In particular, we propose a unified framework where the motion parameters and the T1 map are simultaneously estimated with a Maximum Likelihood (ML) estimator. With our framework, the relaxation model, the motion model as well as the data statistics are jointly incorporated to provide substantially more accurate motion and T1 parameter estimates. Experiments with realistic Monte Carlo simulations show that the proposed unified ML framework outperforms the conventional two-step approach as well as state-of-the-art model-based approaches, in terms of both motion and T1 map accuracy and mean-square error. Furthermore, the proposed method was additionally validated in a controlled experiment with real T1 -weighted data and with two in vivo human brain T1 -weighted data sets, showing its applicability in real-life scenarios.

  15. Comparative clinicopathological characteristics of colon and rectal T1 carcinoma

    PubMed Central

    Ichimasa, Katsuro; Kudo, Shin-Ei; Miyachi, Hideyuki; Kouyama, Yuta; Hayashi, Takemasa; Wakamura, Kunihiko; Hisayuki, Tomokazu; Kudo, Toyoki; Misawa, Masashi; Mori, Yuichi; Matsudaira, Shingo; Hidaka, Eiji; Hamatani, Shigeharu; Ishida, Fumio

    2017-01-01

    Lymph node metastasis significantly influences the management of patients with colorectal carcinoma. It has been observed that the biology of colorectal carcinoma differs by location. The aim of the current study was to retrospectively compare the clinicopathological characteristics of patients with colon and rectal T1 carcinomas, particularly their rates of lymph node metastasis. Of the 19,864 patients who underwent endoscopic or surgical resection of colorectal neoplasms at Showa University Northern Yokohama Hospital, 557 had T1 surgically resected carcinomas, including 457 patients with colon T1 carcinomas and 100 patients with rectal T1 carcinomas. Analysed clinicopathological features included patient age, gender, tumor size, morphology, tumor budding, invasion depth, vascular invasion, histological grade, lymphatic invasion and lymph node metastasis. Rectal T1 carcinomas were significantly larger than colon T1 carcinomas (mean ± standard deviation: 23.7±13.1 mm vs. 19.9±11.0 mm, P<0.01) and were accompanied by significantly higher rates of vascular invasion (48.0% vs. 30.2%, P<0.01). Significant differences were not observed among any other clinicopathological factors. In conclusion, tumor location itself was not a risk factor for lymph node metastasis in colorectal T1 carcinomas, even though on average, rectal T1 carcinomas were larger and accompanied by a significantly higher rate of vascular invasion than colon T1 carcinomas. PMID:28356962

  16. Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro

    2008-09-24

    A novel analytical procedure based on the combination of multiplex PCR, restriction analysis, and CGE-LIF to unambiguosly and simultaneously confirm the presence of multiple lines of genetically modified corn is proposed. This methodology is based on the amplification of event-specific DNA regions by multiplex PCR using 6-FAM-labeled primers. Subsequently, PCR products are digested by a mixture containing specific restriction endonucleases. Thus, restriction endonucleases selectively recognize DNA target sequences contained in the PCR products and cleave the double-stranded DNA at a given cleavage site. Next, the restriction digest is analyzed by CGE-LIF corroborating the length of the expected restriction fragments, confirming (or not) the existence of GMOs. For accurate size determination of the DNA fragments by CGE-LIF a special standard DNA mixture was produced in this laboratory for calibration. The suitability of this mixture for size determination of labeled DNA fragments is also demonstrated. The usefulness of the proposed methodology is demonstrated through the simultaneous detection and confirmatory analysis of samples containing 0.5% of GA21 and MON863 maize plus an endogenous gene of maize as control.

  17. Transgenic Expression of a Viral Cystatin Gene CpBV-CST1 in Tobacco Confers Insect Resistance.

    PubMed

    Kim, E; Kim, Y; Yeam, I; Kim, Y

    2016-10-01

    A viral gene, CpBV-CST1, was identified from a polydnavirus Cotesia plutellae bracovirus (CpBV). Its protein product was significantly toxic to lepidopteran insects. This study generated a transgenic tobacco plant expressing CpBV-CST1 Expression of transgene CpBV-CST1 was confirmed in T1 generation (second generation after transgenesis) in both mRNA and protein levels. Young larvae of Spodoptera exigua (Hübner) suffered high mortalities after feeding on transgenic tobacco. All 10 T1 transgenic tobacco plants had no significant variation in speed-to-kill. In order to further explore insect resistance of these transgenic tobaccos, bioassays were performed by assessing antixenosis and antibiosis. S. exigua larvae significantly avoided T1 plants in a choice test. Larvae fed with T1 plant exhibited significant decrease in protease activity in the midgut due to consuming CpBV-CST1 protein produced by the transgenic plant. Furthermore, the transgenic tobacco exhibited similar insect resistance to other tobacco-infesting insects, including a leaf-feeding insect, Helicoverpa assulta, and a sap-feeding insect, Myzus persicae These results demonstrate that a viral cystatin gene can be used to develop insect-resistant transgenic plant, suggesting a prospective possibility of expanding the current transgenic approach to high-valued crops.

  18. Characterization of a Maize Wip1 Promoter in Transgenic Plants

    PubMed Central

    Zhang, Shengxue; Lian, Yun; Liu, Yan; Wang, Xiaoqing; Liu, Yunjun; Wang, Guoying

    2013-01-01

    The Maize Wip1 gene encodes a wound-induced Bowman-Birk inhibitor (BBI) protein which is a type of serine protease inhibitor, and its expression is induced by wounding or infection, conferring resistance against pathogens and pests. In this study, the maize Wip1 promoter was isolated and its function was analyzed. Different truncated Wip1 promoters were fused upstream of the GUS reporter gene and transformed into Arabidopsis, tobacco and rice plants. We found that (1) several truncated maize Wip1 promoters led to strong GUS activities in both transgenic Arabidopsis and tobacco leaves, whereas low GUS activity was detected in transgenic rice leaves; (2) the Wip1 promoter was not wound-induced in transgenic tobacco leaves, but was induced by wounding in transgenic rice leaves; (3) the truncated Wip1 promoter had different activity in different organs of transgenic tobacco plants; (4) the transgenic plant leaves containing different truncated Wip1 promoters had low GUS transcripts, even though high GUS protein level and GUS activities were observed; (5) there was one transcription start site of Wip1 gene in maize and two transcription start sites of GUS in Wip1::GUS transgenic lines; (6) the adjacent 35S promoter which is present in the transformation vectors enhanced the activity of the truncated Wip1 promoters in transgenic tobacco leaves, but did not influence the disability of truncated Wip1231 promoter to respond to wounding signals. We speculate that an ACAAAA hexamer, several CAA trimers and several elements similar to ACAATTAC octamer in the 5′-untranslated region might contribute to the strong GUS activity in Wip1231 transgenic lines, meanwhile, compared to the 5′-untranslated region from Wip1231 transgenic lines, the additional upstream open reading frames (uORFs) in the 5′-untranslated region from Wip1737 transgenic lines might contribute to the lower level of GUS transcript and GUS activity. PMID:24322445

  19. Auto-reactive B cells in transgenic mice.

    PubMed

    Pasquali, Jean-Louis; Soulas-Sprauel, Pauline; Korganow, Anne-Sophie; Martin, Thierry

    2007-12-01

    In order to understand how the natural occurrence of autoreactive B cells is controlled in normal individuals, and how self reactive B cells can escape this control during diverse clinical situations, many different transgenic mice have been generated expressing self reactive antibodies. In this review, we focus our attention on disease-associated self reactive transgenic models which show the variety of the tolerization mechanisms. The same transgenic lines are also used to analyse the effects of the autoimmune genetic background on the self reactive B cell fate, as well as to study the influence of infectious agents on the behaviour of the auto-reactive transgenic B cells.

  20. The distribution of cotransformed transgenes in particle bombardment-mediated transformed wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although particle bombardment is the predominant method of foreign DNA direct transfer, whether transgene is integrated randomly into the genome has not been determined. In this study, we identified the distribution of transgene loci in 45 transgenic wheat (Triticum aestivum L.) lines containing c...

  1. Voltage-dependent gating rearrangements in the intracellular T1-T1 interface of a K+ channel.

    PubMed

    Wang, Guangyu; Covarrubias, Manuel

    2006-04-01

    The intracellular tetramerization domain (T1) of most eukaryotic voltage-gated potassium channels (Kv channels) exists as a "hanging gondola" below the transmembrane regions that directly control activation gating via the electromechanical coupling between the S4 voltage sensor and the main S6 gate. However, much less is known about the putative contribution of the T1 domain to Kv channel gating. This possibility is mechanistically intriguing because the T1-S1 linker connects the T1 domain to the voltage-sensing domain. Previously, we demonstrated that thiol-specific reagents inhibit Kv4.1 channels by reacting in a state-dependent manner with native Zn(2+) site thiolate groups in the T1-T1 interface; therefore, we concluded that the T1-T1 interface is functionally active and not protected by Zn(2+) (Wang, G., M. Shahidullah, C.A. Rocha, C. Strang, P.J. Pfaffinger, and M. Covarrubias. 2005. J. Gen. Physiol. 126:55-69). Here, we co-expressed Kv4.1 channels and auxiliary subunits (KChIP-1 and DPPX-S) to investigate the state and voltage dependence of the accessibility of MTSET to the three interfacial cysteines in the T1 domain. The results showed that the average MTSET modification rate constant (k(MTSET)) is dramatically enhanced in the activated state relative to the resting and inactivated states (approximately 260- and approximately 47-fold, respectively). Crucially, under three separate conditions that produce distinct activation profiles, k(MTSET) is steeply voltage dependent in a manner that is precisely correlated with the peak conductance-voltage relations. These observations strongly suggest that Kv4 channel gating is tightly coupled to voltage-dependent accessibility changes of native T1 cysteines in the intersubunit Zn(2+) site. Furthermore, cross-linking of cysteine pairs across the T1-T1 interface induced substantial inhibition of the channel, which supports the functionally dynamic role of T1 in channel gating. Therefore, we conclude that the complex

  2. Comparison of T1rho and T2 Mapping of Knee Articular Cartilage in an Asymptomatic Population

    PubMed Central

    Yoon, Min A; Im, A Lan; Kang, Chang Ho; Kim, Baek Hyun; Kim, In Seong

    2016-01-01

    Objective To analyze subregional differences in T1rho (T1ρ) and T2 values and their correlation in asymptomatic knee cartilage, and to evaluate angular dependence with magic angles. Materials and Methods Six asymptomatic volunteers underwent knee MRI with T1ρ and T2 mapping. T1ρ and T2 values were measured by two radiologists independently, at nine subregions in the medial femoral condyle (MFC) cartilage, at angles of ± 0°, 15°, 35°, 55°, 75° respective to a vertical line (B0) bisecting the width of the distal femur, and at two locations in the patella. Subregional values of T1ρ and T2 were analyzed and significant differences in three divided portions of the MFC (anterior, central, and posterior) were statistically evaluated. Correlation between T1ρ and T2 and angular dependence with magic angles were also assessed for statistical significance. Results T1ρ values were lowest at +15° and highest at -55°. T2 values were lowest at +75° and highest at +35°. Both T1ρ and T2 were higher in superior patella than inferior patella. T1ρ showed significant differences in the three divided portions of the MFC, while T2 showed significant differences only between central and posterior portions. There was a weak correlation between T1ρ and T2 (r = 0.217, p = 0.127). T1ρ showed more angular dependence than T2. Conclusion T1ρ and T2 showed different subregional values and angular dependence in asymptomatic knee cartilage with a weak correlation. Awareness of these differences will aid in assessment of cartilage in a specific subregion of the knee. PMID:27833407

  3. Three-dimensional ultrashort echo time cones T1ρ (3D UTE-cones-T1ρ ) imaging.

    PubMed

    Ma, Ya-Jun; Carl, Michael; Shao, Hongda; Tadros, Anthony S; Chang, Eric Y; Du, Jiang

    2017-03-20

    We report a novel three-dimensional (3D) ultrashort echo time (UTE) sequence employing Cones trajectory and T1ρ preparation (UTE-Cones-T1ρ ) for quantitative T1ρ assessment of short T2 tissues in the musculoskeletal system. A basic 3D UTE-Cones sequence was combined with a spin-locking preparation pulse for T1ρ contrast. A relatively short TR was used to decrease the scan time, which required T1 measurement and compensation using 3D UTE-Cones data acquisitions with variable TRs. Another strategy to reduce the total scan time was to acquire multiple Cones spokes (Nsp ) after each T1ρ preparation and fat saturation. Four spin-locking times (TSL = 0-20 ms) were acquired over 12 min, plus another 7 min for T1 measurement. The 3D UTE-Cones-T1ρ sequence was compared with a two-dimensional (2D) spiral-T1ρ sequence for the imaging of a spherical CuSO4 phantom and ex vivo meniscus and tendon specimens, as well as the knee and ankle joints of healthy volunteers, using a clinical 3-T scanner. The CuSO4 phantom showed a T1ρ value of 76.5 ± 1.6 ms with the 2D spiral-T1ρ sequence, as well as 85.7 ± 3.6 and 89.2 ± 1.4 ms for the 3D UTE-Cones-T1ρ sequences with Nsp of 1 and 5, respectively. The 3D UTE-Cones-T1ρ sequence provided shorter T1ρ values for the bovine meniscus sample relative to the 2D spiral-T1ρ sequence (10-12 ms versus 16 ms, respectively). The cadaveric human Achilles tendon sample could only be imaged with the 3D UTE-Cones-T1ρ sequence (T1ρ  = 4.0 ± 0.9 ms), with the 2D spiral-T1ρ sequence demonstrating near-zero signal intensity. Human studies yielded T1ρ values of 36.1 ± 2.9, 18.3 ± 3.9 and 3.1 ± 0.4 ms for articular cartilage, meniscus and the Achilles tendon, respectively. The 3D UTE-Cones-T1ρ sequence allows volumetric T1ρ measurement of short T2 tissues in vivo.

  4. Enhanced salt tolerance of transgenic progeny of tall fescue (Festuca arundinacea) expressing a vacuolar Na+/H+ antiporter gene from Arabidopsis.

    PubMed

    Zhao, Junsheng; Zhi, Daying; Xue, Zheyong; Liu, Heng; Xia, Guangmin

    2007-10-01

    Salinity is a major abiotic stress factor limiting crop production. To generate salt-tolerant turf and forage, we had transformed tall fescue (Festuca arundinacea) with AtNHX1, a vacuolar Na(+)/H(+) antiporter gene from Arabidopsis thaliana. In this paper, we report that overexpression of the AtNHX1 gene confers enhanced salt tolerance to the transformed tall fescue progenies. DNA gel blot analysis and reverse transcription (RT) polymerase chain reaction (PCR) were carried out to confirm the inheritance and expression of the AtNHX1 gene in transgenic T(1) and T(2) lines. These transgenic lines showed no phenotypic changes or yield reduction. Plants carrying the AtNHX1 gene were more resistant to a 20 mM NaCl solution than control plants. The roots of the transgenic lines had a higher sodium content than controls, due to an increased Na(+)/H(+) antiporter activity in tonoplast vesicles. Our results suggest that this accumulation of sodium in vacuoles of root cells, mediated by vacuolar Na(+)/H(+) antiporters, reduced the toxic effects of salinity to tall fescue and thus enhanced its salt tolerance.

  5. Engineering Transgenic Plants for the Sustained Containment and In Situ Treatment of Energetic Materials

    DTIC Science & Technology

    2009-06-01

    cloacae nitroreductase ...................................... 24 Figure 9 Relative quantitative levels of nfsI expression in transgenic plant lines... Plant Line Fo ld e xp re ss io n Figure 10. Relative quantitative levels of nfsI expression in transgenic plant lines Results are the mean...relative to the lowest nfsI expressing transgenic line, NR 20-3 (Figure 10). 0 10 20 30 40 50 60 70 80 NR 20-3 NR 3-2, T0 NR 3-2, T2 NR 9-1 Transgenic

  6. Stable CoT-1 repeat RNA is abundant and associated with euchromatic interphase chromosomes

    PubMed Central

    Hall, Lisa L.; Carone, Dawn M.; Gomez, Alvin; Kolpa, Heather J.; Byron, Meg; Mehta, Nitish; Fackelmayer, Frank O.; Lawrence, Jeanne B.

    2014-01-01

    SUMMARY Recent studies recognize a vast diversity of non-coding RNAs with largely unknown functions, but few have examined interspersed repeat sequences, which constitute almost half our genome. RNA hybridization in situ using CoT-1 (highly repeated) DNA probes detects surprisingly abundant euchromatin-associated RNA comprised predominantly of repeat sequences (“CoT-1 RNA”), including LINE-1. CoT-1-hybridizing RNA strictly localizes to the interphase chromosome territory in cis, and remains stably associated with the chromosome territory following prolonged transcriptional inhibition. The CoT-1 RNA territory resists mechanical disruption and fractionates with the non-chromatin scaffold, but can be experimentally released. Loss of repeat-rich, stable nuclear RNAs from euchromatin corresponds to aberrant chromatin distribution and condensation. CoT-1 RNA has several properties similar to XIST chromosomal RNA, but is excluded from chromatin condensed by XIST. These findings impact two “black boxes” of genome science: the poorly understood diversity of non-coding RNA and the unexplained abundance of repetitive elements. PMID:24581492

  7. Pyramiding transgenic resistance in elite indica rice cultivars against the sheath blight and bacterial blight.

    PubMed

    Maruthasalam, S; Kalpana, K; Kumar, K K; Loganathan, M; Poovannan, K; Raja, J A J; Kokiladevi, E; Samiyappan, R; Sudhakar, D; Balasubramanian, P

    2007-06-01

    Elite indica rice cultivars were cotransformed with genes expressing a rice chitinase (chi11) and a thaumatin-like protein (tlp) conferring resistance to fungal pathogens and a serine-threonine kinase (Xa21) conferring bacterial blight resistance, through particle bombardment, with a view to pyramiding sheath blight and bacterial blight resistance. Molecular analyses of putative transgenic lines by polymerase chain reaction, Southern Blot hybridization, and Western Blotting revealed stable integration and expression of the transgenes in a few independent transgenic lines. Progeny analyses showed the stable inheritance of transgenes to their progeny. Coexpression of chitinase and thaumatin-like protein in the progenies of a transgenic Pusa Basmati1 line revealed an enhanced resistance to the sheath blight pathogen, Rhizoctonia solani, as compared to that in the lines expressing the individual genes. A transgenic Pusa Basmati1 line pyramided with chi11, tlp, and Xa21 showed an enhanced resistance to both sheath blight and bacterial blight.

  8. Systematic T1 improvement for hyperpolarized 129xenon

    NASA Astrophysics Data System (ADS)

    Repetto, Maricel; Babcock, Earl; Blümler, Peter; Heil, Werner; Karpuk, Sergei; Tullney, Kathlynne

    2015-03-01

    The spin-lattice relaxation time T1 of hyperpolarized (HP)-129Xe was improved at typical storage conditions (i.e. low and homogeneous magnetic fields). Very long wall relaxation times T1wall of about 18 h were observed in uncoated, spherical GE180 glass cells of ∅ = 10 cm which were free of rubidium and not permanently sealed but attached to a standard glass stopcock. An "aging" process of the wall relaxation was identified by repeating measurements on the same cell. This effect could be easily removed by repeating the initial cleaning procedure. In this way, a constant wall relaxation was ensured. The Xe nuclear spin-relaxation rate 1 /T1Xel -Xe due to van der Waals molecules was investigated too, by admixing three different buffer gases (N2, SF6 and CO2). Especially CO2 exhibited an unexpected high efficiency (r) in shortening the lifetime of the Xe-Xe dimers and hence prolonging the total T1 relaxation even further. These measurements also yielded an improved accuracy for the van der Waals relaxation for pure Xe (with 85% 129Xe) of T1Xe -Xe = (4.6 ± 0.1)h . Repeating the measurements with HP 129Xe in natural abundance in mixtures with SF6, a strong dependence of T1Xe -Xe and r on the isotopic enrichment was observed, uncovering a shorter T1Xe -Xe relaxation for the 129Xe in natural composition as compared to the 85% isotopically enriched gas.

  9. Up-regulation of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase enhances production of essential oils and sterols in transgenic Lavandula latifolia.

    PubMed

    Muñoz-Bertomeu, Jesús; Sales, Ester; Ros, Roc; Arrillaga, Isabel; Segura, Juan

    2007-11-01

    Spike lavender (Lavandula latifolia) essential oil is widely used in the perfume, cosmetic, flavouring and pharmaceutical industries. Thus, modifications of yield and composition of this essential oil by genetic engineering should have important scientific and commercial applications. We generated transgenic spike lavender plants expressing the Arabidopsis thaliana HMG1 cDNA, encoding the catalytic domain of 3-hydroxy-3-methylglutaryl CoA reductase (HMGR1S), a key enzyme of the mevalonic acid (MVA) pathway. Transgenic T0 plants accumulated significantly more essential oil constituents as compared to controls (up to 2.1- and 1.8-fold in leaves and flowers, respectively). Enhanced expression of HMGR1S also increased the amount of the end-product sterols, beta-sitosterol and stigmasterol (average differences of 1.8- and 1.9-fold, respectively), but did not affect the accumulation of carotenoids or chlorophylls. We also analysed T1 plants derived from self-pollinated seeds of T0 lines that flowered after growing for 2 years in the greenhouse. The increased levels of essential oil and sterols observed in the transgenic T0 plants were maintained in the progeny that inherited the HMG1 transgene. Our results demonstrate that genetic manipulation of the MVA pathway increases essential oil yield in spike lavender, suggesting a contribution for this cytosolic pathway to monoterpene and sesquiterpene biosynthesis in leaves and flowers of the species.

  10. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision

    PubMed Central

    Woo, Hee-Jong; Qin, Yang; Park, Soo-Yun; Park, Soon Ki; Cho, Yong-Gu; Shin, Kong-Sik; Lim, Myung-Ho; Cho, Hyun-Suk

    2015-01-01

    Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM) crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP) gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice. PMID:26172549

  11. Transfer of the IL-37b gene elicits anti-tumor responses in mice bearing 4T1 breast cancer

    PubMed Central

    Wang, Wei-qiang; Zhao, Dan; Zhou, Yu-shan; Hu, Xiao-yu; Sun, Zhi-na; Yu, Gang; Wu, Wan-tong; Chen, Song; Kuang, Jiu-long; Xu, Guo-gang; Han, Zhong-chao; Wang, Bang-mao; Yang, Jing-xian; Feng, Xiao-ming

    2015-01-01

    Aim: IL-37b has shown anti-cancer activities in addition to its anti-inflammatory properties. In this study, we investigated the effects of IL-37b on breast carcinoma growth in mice and to determine the involvement of T cell activation in the effects. Methods: IL-37b gene was transferred into mouse breast carcinoma cell line 4T1 (4T1-IL37b cells), the expression of secretory IL-37b by the cells was detected, and the effects of IL-37b expression on the cell proliferation in vitro was evaluated. After injection of 4T1 cells or 4T1-IL37b cells into immunocompetent BALB/c mice, immunodeficient BALB/c nude mice and NOD-SCID mice, the tumor growth and survival rate were measured. The proliferation of T cells in vitro was also detected. Results: IL-37b was detected in the supernatants of 4T1-IL37b cells with a concentration of 12.02±0.875 ng/mL. IL-37b expression did not affect 4T1 cell proliferation in vitro. BALB/c mice inoculated with 4T1-IL37b cells showed significant retardation of tumor growth. BALB/c mice inoculated with both 4T1 cells and mitomycin C-treated 4T1-IL37b cells also showed significant retardation of tumor growth. But the anti-cancer activity of IL-37b was abrogated in BALB/c nude mice and NOD-SCID mice inoculated with 4T1-IL37b cells. Recombinant IL-37b slightly promoted CD4+ T cell proliferation without affecting CD8+ T cell proliferation. Conclusion: IL-37b exerts anti-4T1 breast carcinoma effects in vivo by modulating the tumor microenvironment and influencing T cell activation. PMID:25832432

  12. Irreversible change in the T1 temperature dependence with thermal dose using the proton resonance frequency-T1 technique.

    PubMed

    Diakite, Mahamadou; Payne, Allison; Todd, Nick; Parker, Dennis L

    2013-04-01

    Denaturation of macromolecules within the tissues is believed to be the major factor contributing to the damage of tissues upon hyperthermia. As a result, the value of the spin-lattice relaxation time T1 of the tissue water, which is related to the translational and rotational rates of water, represents an intrinsic probe for investigating structural changes in tissues at high temperature. Therefore, the goal of this work is to investigate whether the simultaneous measurement of temperature and T1 using a hybrid proton resonance frequency (PRF)-T1 measurement technique can be used to detect irreversible changes in T1 that might be indicative of tissue damage. A new hybrid PRF-T1 sequence was implemented based on the variable flip angle driven-equilibrium single-pulse observation (DESPOT)1 method from a standard three dimensional segmented echo-planar imaging sequence by alternating two flip angles from measurement to measurement. The structural changes of the heated tissue volumes were analyzed based on the derived T1 values and the corresponding PRF temperatures. Using the hybrid PRF-T1 technique, we demonstrate that the change of spin lattice relaxation time T1 is reversible with temperature for low thermal dose (thermal dose ≤ 240 cumulative equivalent minutes [CEM] 43°C) and irreversible with temperature after significant accumulation of thermal dose in ex vivo chicken breast tissue. These results suggest that the hybrid PRF-T1 method may be a potentially powerful tool to investigate the extent and mechanism of heat damage of biological tissues.

  13. Transgenic Gladiolus plants transformed with the bean yellow mosaic virus coat-protein gene in either sense or antisense orientation.

    PubMed

    Kamo, Kathryn; Gera, Abed; Cohen, Jacob; Hammond, John; Blowers, Alan; Smith, Franzine; Van Eck, Joyce

    2005-02-01

    Transgenic Gladiolus plants transformed with the bean yellow mosaic virus (BYMV) coat-protein (CP) gene in either sense or antisense (AS) orientation were developed using biolistics. Four of the plants were confirmed to carry the CP gene in the sense orientation of the gene and seven plants in the AS orientation. Two of the CP plant lines and all of the AS lines showed DNA rearrangements of the transgene in addition to an intact copy of the transgene. The copy number ranged from one to nine. Of the 11 lines, eight had only one to four copies of the transgene. Transcription of the transgene occurred for three of the CP lines and five of the AS lines as determined by Northern hybridization. All 11 plant lines were challenged with BYMV using controlled aphid transmission. One month following aphid transmission, the transgenic plants were examined by immunoelectron microscopy for presence of the virus. Several transgenic plant lines containing either antiviral transgene showed a lower incidence of infection (percentage of plants infected as detected by immunoelectron microscopy) than the non-transformed plants. Most of the CP- and AS-transgenic plants that did not contain BYMV 1 month after challenge were found to contain BYMV the next season. It appeared that BYMV infection was delayed in the CP- and AS-transgenic lines but that the transgenes did not prevent eventual infection of BYMV. This is the first report of developing a floral bulb crop with antiviral genes to BYMV.

  14. Secretion of N- and O-linked Glycoproteins from 4T1 Murine Mammary Carcinoma Cells

    PubMed Central

    Phang, Wai-Mei; Tan, Aik-Aun; Gopinath, Subash C.B.; Hashim, Onn H.; Kiew, Lik Voon; Chen, Yeng

    2016-01-01

    Breast cancer is one of the most common cancers that affect women globally and accounts for ~23% of all cancers diagnosed in women. Breast cancer is also one of the leading causes of death primarily due to late stage diagnoses and a lack of effective treatments. Therefore, discovering protein expression biomarkers is mandatory for early detection and thus, critical for successful therapy. Two-dimensional electrophoresis (2D-E) coupled with lectin-based analysis followed by mass spectrometry were applied to identify potential biomarkers in the secretions of a murine mammary carcinoma cell line. Comparisons of the protein profiles of the murine 4T1 mammary carcinoma cell line and a normal murine MM3MG mammary cell line indicated that cadherin-1 (CDH), collagenase 3 (MMP-13), Viral envelope protein G7e (VEP), Gag protein (GAG) and Hypothetical protein LOC433182 (LOC) were uniquely expressed by the 4T1 cells, and pigment epithelium-derived factor (PEDF) was exclusively secreted by the MM3MG cells. Further analysis by a lectin-based study revealed that aberrant O-glycosylated CDH, N-glycosylated MMP-13 and LOC were present in the 4T1 medium. These differentially expressed N- and O-linked glycoprotein candidates, which were identified by combining lectin-based analysis with 2D-E, could serve as potential diagnostic and prognostic markers for breast cancer. PMID:27226773

  15. Weeding with transgenes.

    PubMed

    Duke, Stephen O

    2003-05-01

    Transgenes promise to reduce insecticide and fungicide use but relatively little has been done to significantly reduce herbicide use through genetic engineering. Recently, three strategies for transgene utilization have been developed that have the potential to change this. These are the improvement of weed-specific biocontrol agents, enhancement of crop competition or allelopathic traits, and production of cover crops that will self-destruct near the time of planting. Failsafe risk mitigation technologies are needed for most of these strategies.

  16. [Enhancement of artemisinin biosynthesis in transgenic Artemisia annua L. by overexpressed HDR and ADS genes].

    PubMed

    Wang, Ya-Xiong; Long, Shi-Ping; Zeng, Li-Xia; Xiang, Li-En; Lin, Zhi; Chen, Min; Liao, Zhi-Hua

    2014-09-01

    Artemisnin is a novel sesquiterpene lactone with an internal peroxide bridge structure, which is extracted from traditional Chinese herb Artemisia annua L. (Qinghao). Recommended by World Health Organization, artemisinin is the first-line drug in the treatment of encephalic and chloroquine-resistant malaria. In the present study, transgenic A. annua plants were developed by overexpressing the key enzymes involved in the biosynthetic pathway of artemisinin. Based on Agrobacterium-mediated transformation methods, transgenic plants of A. annua with overexpression of both HDR and ADS were obtained through hygromycin screening. The genomic PCR analysis confirmed six transgenic lines in which both HDR and ADS were integrated into genome. The gene expression analysis given by real-time quantitative PCR showed that all the transgenic lines had higher expression levels of HDR and ADS than the non-transgenic control (except ah3 in which the expression level of ADS showed no significant difference compared with control); and the HPLC analysis of artemisinin demonstrated that transgenic A. annua plants produced artemisinin at significantly higher level than non-transgenic plants. Especially, the highest content of artemisinin was found in transgenic line ah70, in which the artemisinin content was 3.48 times compared with that in non-transgenic lines. In summary, overexpression of HDR and ADS facilitated artemisinin biosynthesis and this method could be applied to develop transgenic plants of A. annua with higher yield of artemisinin.

  17. Systematic T1 improvement for hyperpolarized 129xenon.

    PubMed

    Repetto, Maricel; Babcock, Earl; Blümler, Peter; Heil, Werner; Karpuk, Sergei; Tullney, Kathlynne

    2015-03-01

    The spin-lattice relaxation time T1 of hyperpolarized (HP)-(129)Xe was improved at typical storage conditions (i.e. low and homogeneous magnetic fields). Very long wall relaxation times T(1)(wall) of about 18 h were observed in uncoated, spherical GE180 glass cells of ∅=10 cm which were free of rubidium and not permanently sealed but attached to a standard glass stopcock. An "aging" process of the wall relaxation was identified by repeating measurements on the same cell. This effect could be easily removed by repeating the initial cleaning procedure. In this way, a constant wall relaxation was ensured. The Xe nuclear spin-relaxation rate 1/T1(Xe-Xe) due to van der Waals molecules was investigated too, by admixing three different buffer gases (N(2), SF(6) and CO(2)). Especially CO(2) exhibited an unexpected high efficiency (r) in shortening the lifetime of the Xe-Xe dimers and hence prolonging the total T1 relaxation even further. These measurements also yielded an improved accuracy for the van der Waals relaxation for pure Xe (with 85% (129)Xe) of T(1)(Xe-Xe)=(4.6±0.1)h. Repeating the measurements with HP (129)Xe in natural abundance in mixtures with SF6, a strong dependence of T(1)(Xe-Xe) and r on the isotopic enrichment was observed, uncovering a shorter T(1)(Xe-Xe) relaxation for the (129)Xe in natural composition as compared to the 85% isotopically enriched gas.

  18. Hyperpolarized (129)Xe T (1) in oxygenated and deoxygenated blood

    NASA Technical Reports Server (NTRS)

    Albert, M. S.; Balamore, D.; Kacher, D. F.; Venkatesh, A. K.; Jolesz, F. A.

    2000-01-01

    The viability of the new technique of hyperpolarized (129)Xe MRI (HypX-MRI) for imaging organs other than the lungs depends on whether the spin-lattice relaxation time, T(1), of (129)Xe is sufficiently long in the blood. In previous experiments by the authors, the T(1) was found to be strongly dependent upon the oxygenation of the blood, with T(1) increasing from about 3 s in deoxygenated samples to about 10 s in oxygenated samples. Contrarily, Tseng et al. (J. Magn. Reson. 1997; 126: 79-86) reported extremely long T(1) values deduced from an indirect experiment in which hyperpolarized (129)Xe was used to create a 'blood-foam'. They found that oxygenation decreased T(1). Pivotal to their experiment is the continual and rapid exchange of hyperpolarized (129)Xe between the gas phase (within blood-foam bubbles) and the dissolved phase (in the skin of the bubbles); this necessitated a complicated analysis to extract the T(1) of (129)Xe in blood. In the present study, the experimental design minimizes gas exchange after the initial bolus of hyperpolarized (129)Xe has been bubbled through the sample. This study confirms that oxygenation increases the T(1) of (129)Xe in blood, from about 4 s in freshly drawn venous blood, to about 13 s in blood oxygenated to arterial levels, and also shifts the red blood cell resonance to higher frequency. Copyright 2000 John Wiley & Sons, Ltd. Abbreviations used BOLD blood oxygen level dependent NOE nuclear overhouses effect PO(2) oxygen partial pressure RBC red blood cells RF radio frequency SNR signal-to-noise ratio.

  19. [Inheritance and expression stability of transgene in transgenic animals].

    PubMed

    Kong, Qing-Ran; Liu, Zhong-Hua

    2011-05-01

    Transgenic technology is one of the most hotspots in biology. In the past decade, the progress in animal cloning has provided an alternative method to improve transgenic efficiency. Many kinds of transgenic animals have been successfully produced via the combination of transfection and nuclear transfer. However, the ultimate aim of transgenesis is not to produce several transgenic animals, but to service for the needs of human. In animal production, transgenic technology has been used to breed new livestock, which has received a lot of attention in China. It has been evidenced that inheritance and expression instability of transgene in transgenic animals is still the major limitation, which is attributed to position effect, epigenetic modification, and hereditary efficiency of transgene. In this review, we discussed the three points for promoting the industrialization of animal transgenic breeding.

  20. Genetic and biochemical dissection of transgenic RNA-mediated virus resistance.

    PubMed Central

    Goodwin, J; Chapman, K; Swaney, S; Parks, T D; Wernsman, E A; Dougherty, W G

    1996-01-01

    RNA-mediated virus resistance has been observed in transgenic plants at varying frequencies, suggesting that a nuclear requirement or other pre-condition must be met. This study was undertaken to characterize genetically transgenes that confer a highly resistant state to infection by tobacco etch virus (TEV). Transgenic tobacco line 2RC-6.13, expressing an untranslatable mRNA containing the TEV coat protein open reading frame, had three distinct transgene integration events that segregated as two linkage groups. A genetic series of plants that contained zero, one, two, or all three transgene inserts in both homozygous and heterozygous conditions was produced and examined. Genetic and biochemical data suggested that RNA-mediated virus resistance is a multigenic trait in line 2RC-6.13; three or more transgenes were necessary to establish the highly resistant state. One or two transgene copies resulted in an inducible form of resistance (i.e., recovery). Transcription rates and steady state RNA levels of the transgene-derived transcript present in different members of the genetic series supported a post-transcriptional RNA degradation process as the underlying mechanism for transgene transcript reduction and virus resistance. This degradation process appeared to initiate via cleavage of specific sites within the target RNA sequence, as determined by RNA get blot and primer extension analyses of transgene-derived mRNA from various transgenic plant lines. PMID:8597662

  1. Estimating T1 from Multichannel Variable Flip Angle SPGR Sequences

    PubMed Central

    Trzasko, Joshua D.; Mostardi, Petrice M.; Riederer, Stephen J.; Manduca, Armando

    2013-01-01

    Quantitative estimation of T1 is a challenging but important task inherent to many clinical applications. The most commonly used paradigm for estimating T1 in vivo involves performing a sequence of spoiled gradient-recalled echo acquisitions at different flip angles, followed by fitting of an exponential model to the data. Although there has been substantial work comparing different fitting methods, there has been little discussion on how these methods should be applied for data acquired using multichannel receivers. In this note, we demonstrate that the manner in which multichannel data is handled can have a substantial impact on T1 estimation performance and should be considered equally as important as choice of flip angles or fitting strategy. PMID:22807160

  2. Expression of spearmint limonene synthase in transgenic spike lavender results in an altered monoterpene composition in developing leaves.

    PubMed

    Muñoz-Bertomeu, Jesús; Ros, Roc; Arrillaga, Isabel; Segura, Juan

    2008-01-01

    We generated transgenic spike lavender (Lavandula latifolia) plants constitutively expressing the limonene synthase (LS) gene from spearmint (Mentha spicata), encoding the LS enzyme that catalyzes the synthesis of limonene from geranyl diphosphate. Overexpression of the LS transgene did not consistently affect monoterpene profile in pooled leaves or flowers from transgenic T(0) plants. Analyses from cohorts of leaves sampled at different developmental stages showed that essential oil accumulation in transgenic and control plants was higher in developing than in mature leaves. Furthermore, developing leaves of transgenic plants contained increased limonene contents (more than 450% increase compared to controls) that correlated with the highest transcript accumulation of the LS gene. The levels of other monoterpene pathway components were also significantly altered. T(0) transgenic plants were grown for 2 years, self-pollinated, and the T(1) seeds obtained. The increased limonene phenotype was maintained in the progenies that inherited the LS transgene.

  3. Myocardial T1 mapping: modalities and clinical applications

    PubMed Central

    Jellis, Christine L.

    2014-01-01

    Myocardial fibrosis appears to be linked to myocardial dysfunction in a multitude of non-ischemic cardiomyopathies. Accurate non-invasive quantitation of this extra-cellular matrix has the potential for widespread clinical benefit in both diagnosis and guiding therapeutic intervention. T1 mapping is a cardiac magnetic resonance (CMR) imaging technique, which shows early clinical promise particularly in the setting of diffuse fibrosis. This review will outline the evolution of T1 mapping and the various techniques available with their inherent advantages and limitations. Histological validation of this technique remains somewhat limited, however clinical application in a range of pathologies suggests strong potential for future development. PMID:24834410

  4. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial.

  5. A novel enterocin T1 with anti-Pseudomonas activity produced by Enterococcus faecium T1 from Chinese Tibet cheese.

    PubMed

    Liu, Hui; Zhang, Lanwei; Yi, Huaxi; Han, Xue; Gao, Wei; Chi, Chunliang; Song, Wei; Li, Haiying; Liu, Chunguang

    2016-02-01

    An enterocin-producing Enterococcus faecium T1 was isolated from Chinese Tibet cheese. The enterocin was purified by SP-Sepharose and reversed phase HPLC. It was identified as unique from other reported bacteriocins based on molecular weight (4629 Da) and amino acid compositions; therefore it was subsequently named enterocin T1. Enterocin T1 was stable at 80-100 °C and over a wide pH range, pH 3.0-10.0. Protease sensitivity was observed to trypsin, pepsin, papain, proteinase K, and pronase E. Importantly, enterocin T1 was observed to inhibit the growth of numerous Gram-negative and Gram-positive bacteria including Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas fluorescens, Escherichia coli, Salmonella typhimurium, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Listeria monocytogenes. Take together, these results suggest that enterocin T1 is a novel bacteriocin with the potential to be used as a bio-preservative to control Pseudomonas spp. in food.

  6. Overexpression of a Cytosolic Abiotic Stress Responsive Universal Stress Protein (SbUSP) Mitigates Salt and Osmotic Stress in Transgenic Tobacco Plants

    PubMed Central

    Udawat, Pushpika; Jha, Rajesh K.; Sinha, Dinkar; Mishra, Avinash; Jha, Bhavanath

    2016-01-01

    The universal stress protein (USP) is a ubiquitous protein and plays an indispensable role in plant abiotic stress tolerance. The genome of Salicornia brachiata contains two homologs of intron less SbUSP gene which encodes for salt and osmotic responsive USP. In vivo localization reveals that SbUSP is a membrane bound cytosolic protein. The role of the gene was functionally validated by developing transgenic tobacco and compared with control [wild-type (WT) and vector control (VC)] plants under different abiotic stress condition. Transgenic lines (T1) exhibited higher chlorophyll, relative water, proline, total sugar, reducing sugar, free amino acids, polyphenol contents, osmotic potential, membrane stability, and lower electrolyte leakage and lipid peroxidation (malondialdehyde content) under stress treatments than control (WT and VC) plants. Lower accumulation of H2O2 and O2− radicals was also detected in transgenic lines compared to control plants under stress conditions. Present study confers that overexpression of the SbUSP gene enhances plant growth, alleviates ROS buildup, maintains ion homeostasis and improves the physiological status of the plant under salt and osmotic stresses. Principal component analysis exhibited a statistical distinction of plant response to salinity stress, and a significant response was observed for transgenic lines under stress, which provides stress endurance to the plant. A possible signaling role is proposed that some downstream genes may get activated by abiotic stress responsive cytosolic SbUSP, which leads to the protection of cell from oxidative damages. The study unveils that ectopic expression of the gene mitigates salt or osmotic stress by scavenging ROS and modulating the physiological process of the plant. PMID:27148338

  7. Transgenic switchgrass (Panicum virgatum L.) targeted for reduced recalcitrance to bioconversion: A two-year comparative analysis of field-grown lines modified for target gene or genetic element expression

    SciTech Connect

    Dumitrache, Alexandru; Natzke, Jace; Rodriguez, Jr., Miguel; Yee, Kelsey L.; Thompson, Olivia A.; Poovaiah, Charleson R.; Shen, Hui; Mazarei, Mitra; Baxter, Holly L.; Fu, Chunxiang; Wang, Zeng -Yu; Biswal, Ajaya K.; Li, Guifen; Tang, Yuhong; Stewart, Jr., C. Neal; Dixon, Richard A.; Nelson, Richard S.; Mohnen, Debra; Mielenz, Jonathan; Brown, Steven D.; Davison, Brian H.

    2016-11-18

    Five different types of transgenic (GAUT4, miRNA, MYB4, COMT and FPGS) Panicum virgatum L. (switchgrass) were grown in a field in Knoxville, Tenn., USA over two consecutive years between 2011 and 2015 in separate experiments. Clonal replicates were established (year-one) and produced much greater biomass during the second year. After each growing season the above ground biomass was analyzed for cell wall sugars and for recalcitrance to enzymatic digestibility, and biofuel using a separate hydrolysis and fermentation (SHF) screen. Here, each transgenic event and control had more glucan, xylan and less ethanol (g/g basis) from the second year of growth relative to the first year plants. There was no correlation between plant carbohydrate content and biofuel production. In each of cell wall-targeted transgenics, GAUT4, MYB4, COMT and FPGS, the second year of growth resulted in increased carbohydrate abundance (up to 12%) and reduced recalcitrance through higher ethanol yields (up to 21%) over the non-transgenic control plants.

  8. Transgenic switchgrass (Panicum virgatum L.) targeted for reduced recalcitrance to bioconversion: A two-year comparative analysis of field-grown lines modified for target gene or genetic element expression

    DOE PAGES

    Dumitrache, Alexandru; Natzke, Jace; Rodriguez, Jr., Miguel; ...

    2016-11-18

    Five different types of transgenic (GAUT4, miRNA, MYB4, COMT and FPGS) Panicum virgatum L. (switchgrass) were grown in a field in Knoxville, Tenn., USA over two consecutive years between 2011 and 2015 in separate experiments. Clonal replicates were established (year-one) and produced much greater biomass during the second year. After each growing season the above ground biomass was analyzed for cell wall sugars and for recalcitrance to enzymatic digestibility, and biofuel using a separate hydrolysis and fermentation (SHF) screen. Here, each transgenic event and control had more glucan, xylan and less ethanol (g/g basis) from the second year of growthmore » relative to the first year plants. There was no correlation between plant carbohydrate content and biofuel production. In each of cell wall-targeted transgenics, GAUT4, MYB4, COMT and FPGS, the second year of growth resulted in increased carbohydrate abundance (up to 12%) and reduced recalcitrance through higher ethanol yields (up to 21%) over the non-transgenic control plants.« less

  9. Transfer of hyperpolarization from long T 1 storage nuclei to short T 1 neighbors using FLOPSY-8

    NASA Astrophysics Data System (ADS)

    Moreno, Karlos X.; Harrison, Crystal; Dean Sherry, A.; Malloy, Craig R.; Merritt, Matthew E.

    2011-12-01

    Nuclei with long T 1s are optimal targets for dynamic nuclear polarization (DNP). Therefore, most of the agents used in metabolic imaging and spectroscopy studies are based on carboxylic acid moieties that lack protons, a strong source of dipolar relaxation. Metabolic flux information encoded into spectra of small molecule metabolites in the form of the 13C isotopomer data cannot be accessed using standard 13C hyperpolarization methods because protonated carbons relax too quickly through T 1 dipolar relaxation. It is shown here that the longitudinal mixing sequence FLOPSY-8 can be used to transfer polarization from a long T 1 storage nucleus to adjacent protonated carbons so that they may be detected with high sensitivity. We demonstrate that FLOPSY-8 allows a direct readout of isotopomer populations in butyrate and glutamate in vitro.

  10. T2 can be greater than 2T1

    NASA Astrophysics Data System (ADS)

    Sevian, H. M.; Skinner, J. L.

    1989-08-01

    We consider a quantum-mechanical two-level system under the influence of both diagonal and off-diagonal stochastic perturbations, and focus on the decay times T1 and T2, which refer to the relaxation to equilibrium of the populations and relative phase of the two levels, respectively. From both theoretical and experimental viewpoints one traditionally expects that T2≤2T1. On the other hand, from a fourth-order cumulant expansion calculation of the asymptotic time dependence of the density matrix elements, Budimir and Skinner [J. Stat. Phys. 49, 1029 (1987)] showed that, in fact, in some instances T2>2T1. In this paper we solve the stochastic model numerically, which leads to the exact time dependence of the density matrix at all times. We find that the analytic prediction that T2>2T1 is not only correct, but also meaningful, in the sense that the density matrix elements decay exponentially after only a short transient time.

  11. Pharmacological characterisation of the GlyT-1 glycine transporter using two novel radioligands.

    PubMed

    Herdon, Hugh J; Roberts, Jennifer C; Coulton, Steve; Porter, Rod A

    2010-11-01

    . Glycine produced concentration-dependent decreases in binding affinity of both radioligands without major changes in B(max) values, suggesting that both [(3)H]-SB-733993 and [(3)H]-GSK931145 bind to sites on GlyT-1 that are orthosteric to the site at which glycine itself binds. Overall, these results show that both [(3)H]-SB-733993 and [(3)H]-GSK931145 are useful radioligands for studies on GlyT-1 in both cell lines and native tissues, with [(3)H]-GSK931145 being the radioligand of choice for further studies on GlyT-1 expression and pharmacology.

  12. Are turns required for the folding of ribonuclease T1?

    PubMed Central

    Garrett, J. B.; Mullins, L. S.; Raushel, F. M.

    1996-01-01

    Ribonuclease T1 (RNase T1) is a small, globular protein of 104 amino acids for which extensive thermodynamic and structural information is known. To assess the specific influence of variations in amino acid sequence on the mechanism for protein folding, circularly permuted variants of RNase T1 were constructed and characterized in terms of catalytic activity and thermodynamic stability. The disulfide bond connecting Cys-2 and Cys-10 was removed by mutation of these residues to alanine (C2, 10A) to avoid potential steric problems imposed by the circular permutations. The original amino-terminus and carboxyl-terminus of the mutant (C2, 10A) were subsequently joined with a tripeptide linker to accommodate a reverse turn and new termini were introduced throughout the primary sequence in regions of solvent-exposed loops at Ser-35 (cp35S1), Asp-49 (cp49D1), Gly-70 (cp70G1), and Ser-96 (cp96S1). These circularly permuted RNase T1 mutants retained 35-100% of the original catalytic activity for the hydrolysis of guanylyl(3'-->5')cytidine, suggesting that the overall tertiary fold of these mutants is very similar to that of wild-type protein. Chemical denaturation curves indicated thermodynamic stabilities at pH 5.0 of 5.7, 2.9, 2.6, and 4.6 kcal/mol for cp35S1, cp49D1, cp70G1, and cp96S1, respectively, compared to a value of 10.1 kcal/mol for wild-type RNase T1 and 6.4 kcal/mol for (C2, 10A) T1. A fifth set of circularly permuted variants was attempted with new termini positioned in a tight beta-turn between Glu-82 and Gln-85. New termini were inserted at Asn-83 (cp83N1), Asn-84 (cp84N1), and Gln-85 (cp85Q1). No detectable amount of protein was ever produced for any of the mutations in this region, suggesting that this turn may be critical for the proper folding and/or thermodynamic stability of RNase T1. PMID:8745397

  13. Development of a Conditional Transgenic Mouse Model to Test the Fallopian Tube Origin of Serous Ovarian Cancer

    DTIC Science & Technology

    2009-03-01

    transgene plasmid to follow up on this next strategy. KEY RESEARCH ACCOMPLISHMENTS: • molecular cloning of Ovgp1-lacZ reporter gene plasmid...high-expressing 242 line • molecular cloning of Ovgp1-Cre transgene plasmid REPORTABLE OUTCOMES: • generation of two Ovgp1-lacZ transgenic

  14. A dominant-negative mutation within AtMYB90 blocks flower pigment production in transgenic tobacco.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    During de novo shoot induction in cultured transgenic tobacco callus a spontaneous mutation within the coding region of a AtMYB90 transgene produced a plant line in which the original transgene-induced over-pigmented phenotype (dark red/purple from anthocyanin overproduction in most tissues) was los...

  15. Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

    PubMed Central

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2015-01-01

    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  16. [Generation of sugar beet transgenic plants expressing bar gene].

    PubMed

    Mishutkina, Ia V; Kamionskaia, A M; Skriabin, K G

    2010-01-01

    The parameters of transformation using Agrobacterium tumefaciens EHA 105 for 5 domestic sorts and lines of sugar beet (Beta vulgaris L. var. saccharifera (Alef) Krass) were optimized. The system of transgenic tissue selection based on resistance to phosphinothricin, allowing to avoid the appearing of chimeric shoots among initial transformants was developed. The transgenic plants of sugar beet sorts Ramonskaya single seed 47, L'govskaya single seed 52 and RMS 73, and LBO 17 and LBO 19 lines expressing the gene of phosphinothricin acetyl transferase bar have been obtained. The resistance of these sorts and lines to the effect of phosphinothricin in vitro has been shown.

  17. Generation of transgenic papaya with double resistance to Papaya ringspot virus and Papaya leaf-distortion mosaic virus.

    PubMed

    Kung, Yi-Jung; Bau, Huey-Jiunn; Wu, Yi-Ling; Huang, Chiung-Huei; Chen, Tsui-Miao; Yeh, Shyi-Dong

    2009-11-01

    During the field tests of coat protein (CP)-transgenic papaya lines resistant to Papaya ringspot virus (PRSV), another Potyvirus sp., Papaya leaf-distortion mosaic virus (PLDMV), appeared as an emerging threat to the transgenic papaya. In this investigation, an untranslatable chimeric construct containing the truncated CP coding region of the PLDMV P-TW-WF isolate and the truncated CP coding region with the complete 3' untranslated region of PRSV YK isolate was transferred into papaya (Carica papaya cv. Thailand) via Agrobacterium-mediated transformation to generate transgenic plants with resistance to PLDMV and PRSV. Seventy-five transgenic lines were obtained and challenged with PRSV YK or PLDMV P-TW-WF by mechanical inoculation under greenhouse conditions. Thirty-eight transgenic lines showing no symptoms 1 month after inoculation were regarded as highly resistant lines. Southern and Northern analyses revealed that four weakly resistant lines have one or two inserts of the construct and accumulate detectable amounts of transgene transcript, whereas nine resistant lines contain two or three inserts without significant accumulation of transgene transcript. The results indicated that double virus resistance in transgenic lines resulted from double or more copies of the insert through the mechanism of RNA-mediated posttranscriptional gene silencing. Furthermore, three of nine resistant lines showed high levels of resistance to heterologous PRSV strains originating from Hawaii, Thailand, and Mexico. Our transgenic lines have great potential for controlling a number of PRSV strains and PLDMV in Taiwan and elsewhere.

  18. Enhanced drought tolerance in transgenic Leymus chinensis plants with constitutively expressed wheat TaLEA3.

    PubMed

    Wang, Lijuan; Li, Xiaofeng; Chen, Shuangyan; Liu, Gongshe

    2009-02-01

    Leymus chinensis is an important grassland perennial grass. However, its drought tolerance requires to be improved. LEA (late embryogenesis abundant) genes are believed to confer resistance to drought and water deficiency. Using Agrobacterium-mediated transformation, a wheat LEA gene, TaLEA(3), was integrated into L. chinensis. The transgenic lines showed enhanced growth ability under drought stress during which transgenic lines had increased the relative water content, leaf water potential, relative average growth rate, but decreased the malondialdehyde content compared with the non-transgenic plant. Thus, transgenic breeding is an efficient approach to enhance drought tolerance in L. chinensis.

  19. Transgenic Crops for Herbicide Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since their introduction in 1995, crops made resistant to the broad-spectrum herbicides glyphosate and glufosinate with transgenes are widely available and used in much of the world. As of 2008, over 80% of the transgenic crops grown world-wide have this transgenic trait. This technology has had m...

  20. Functionally active t1-t1 interfaces revealed by the accessibility of intracellular thiolate groups in kv4 channels.

    PubMed

    Wang, Guangyu; Shahidullah, Mohammad; Rocha, Carmen A; Strang, Candace; Pfaffinger, Paul J; Covarrubias, Manuel

    2005-07-01

    Gating of voltage-dependent K(+) channels involves movements of membrane-spanning regions that control the opening of the pore. Much less is known, however, about the contributions of large intracellular channel domains to the conformational changes that underlie gating. Here, we investigated the functional role of intracellular regions in Kv4 channels by probing relevant cysteines with thiol-specific reagents. We find that reagent application to the intracellular side of inside-out patches results in time-dependent irreversible inhibition of Kv4.1 and Kv4.3 currents. In the absence or presence of Kv4-specific auxiliary subunits, mutational and electrophysiological analyses showed that none of the 14 intracellular cysteines is essential for channel gating. C110, C131, and C132 in the intersubunit interface of the tetramerization domain (T1) are targets responsible for the irreversible inhibition by a methanethiosulfonate derivative (MTSET). This result is surprising because structural studies of Kv4-T1 crystals predicted protection of the targeted thiolate groups by constitutive high-affinity Zn(2+) coordination. Also, added Zn(2+) or a potent Zn(2+) chelator (TPEN) does not significantly modulate the accessibility of MTSET to C110, C131, or C132; and furthermore, when the three critical cysteines remained as possible targets, the MTSET modification rate of the activated state is approximately 200-fold faster than that of the resting state. Biochemical experiments confirmed the chemical modification of the intact alpha-subunit and the purified tetrameric T1 domain by MTS reagents. These results conclusively demonstrate that the T1--T1 interface of Kv4 channels is functionally active and dynamic, and that critical reactive thiolate groups in this interface may not be protected by Zn(2+) binding.

  1. Functionally Active T1-T1 Interfaces Revealed by the Accessibility of Intracellular Thiolate Groups in Kv4 Channels

    PubMed Central

    Wang, Guangyu; Shahidullah, Mohammad; Rocha, Carmen A.; Strang, Candace; Pfaffinger, Paul J.; Covarrubias, Manuel

    2005-01-01

    Gating of voltage-dependent K+ channels involves movements of membrane-spanning regions that control the opening of the pore. Much less is known, however, about the contributions of large intracellular channel domains to the conformational changes that underlie gating. Here, we investigated the functional role of intracellular regions in Kv4 channels by probing relevant cysteines with thiol-specific reagents. We find that reagent application to the intracellular side of inside-out patches results in time-dependent irreversible inhibition of Kv4.1 and Kv4.3 currents. In the absence or presence of Kv4-specific auxiliary subunits, mutational and electrophysiological analyses showed that none of the 14 intracellular cysteines is essential for channel gating. C110, C131, and C132 in the intersubunit interface of the tetramerization domain (T1) are targets responsible for the irreversible inhibition by a methanethiosulfonate derivative (MTSET). This result is surprising because structural studies of Kv4-T1 crystals predicted protection of the targeted thiolate groups by constitutive high-affinity Zn2+ coordination. Also, added Zn2+ or a potent Zn2+ chelator (TPEN) does not significantly modulate the accessibility of MTSET to C110, C131, or C132; and furthermore, when the three critical cysteines remained as possible targets, the MTSET modification rate of the activated state is ∼200-fold faster than that of the resting state. Biochemical experiments confirmed the chemical modification of the intact α-subunit and the purified tetrameric T1 domain by MTS reagents. These results conclusively demonstrate that the T1T1 interface of Kv4 channels is functionally active and dynamic, and that critical reactive thiolate groups in this interface may not be protected by Zn2+ binding. PMID:15955876

  2. Transgenic mammals and biotechnology.

    PubMed

    Westphal, H

    1989-02-01

    Biotechnology has begun to realize the enormous potential of transgenic technology: mice with human genes that produce human proteins of therapeutic value in their milk, pigs that express bovine genes that help them gain weight and lose backfat, animals with engineered gene defects that mimic human genetic diseases.

  3. [Progress on transgenic mosquitoes].

    PubMed

    Yang, Pin

    2011-04-30

    The genetically modified mosquitoes have been developed aiming to control mosquito-borne diseases by either reducing population sizes or replacing existing populations with vectors unable to transmit the disease. introduces some progress on the generation of transgenic mosquitoes and their fitness in wild population. This paper

  4. Transgenic Farm Animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The development of recombinant DNA technology has enabled scientists to isolate single genes, analyze and modify their nucleotide structure(s), make copies of these isolated genes, and insert copies of these genes into the genome of plants and animals. The transgenic technology of adding genes to li...

  5. Obesity-related abnormalities couple environmental triggers with genetic susceptibility in adult-onset T1D.

    PubMed

    Nguyen, K Hoa; Ande, Sudharsana R; Mishra, Suresh

    2016-01-29

    The incidence of adult-onset T1D in low-risk non-HLA type has increased several folds, whereas the contemporaneous incidence in high-risk HLA-type remains stable. Various factors behind this selective increase in T1D in young adults remain unclear. Obesity and its associated abnormalities appear to be an important determinant; however, the underlying mechanism involved is not understood. Recently, we have developed two novel transgenic obese mice models, Mito-Ob and m-Mito-Ob, by expressing a pleiotropic protein prohibitin (PHB) and a phospho mutant form of PHB (Y114F-PHB or m-PHB) from the aP2 gene promoter, respectively. Both mice models develop obesity in a sex-neutral manner, independent of diet; but obesity associated chronic low-grade inflammation and insulin resistance in a male sex-specific manner. Interestingly, on a high fat diet (HFD) only male m-Mito-Ob mice displayed marked mononuclear cell infiltration in pancreas and developed insulitis that mimic adult-onset T1D. Male Mito-Ob mice that share the metabolic phenotype of male m-Mito-Ob mice, and female m-Mito-Ob that harbor m-PHB similar to male m-Mito-Ob mice, did not develop insulitis. Thus, insulitis development in male m-Mito-Ob in response to HFD requires both, obesity-related abnormalities and m-PHB. Collectively, this data provides a proof-of-concept that obesity-associated abnormalities couple environmental triggers with genetic susceptibility in adult-onset T1D and reveals PHB as a potential susceptibility gene for T1D.

  6. Transgenic animal bioreactors.

    PubMed

    Houdebine, L M

    2000-01-01

    The production of recombinant proteins is one of the major successes of biotechnology. Animal cells are required to synthesize proteins with the appropriate post-translational modifications. Transgenic animals are being used for this purpose. Milk, egg white, blood, urine, seminal plasma and silk worm cocoon from transgenic animals are candidates to be the source of recombinant proteins at an industrial scale. Although the first recombinant protein produced by transgenic animals is expected to be in the market in 2000, a certain number of technical problems remain to be solved before the various systems are optimized. Although the generation of transgenic farm animals has become recently easier mainly with the technique of animal cloning using transfected somatic cells as nuclear donor, this point remains a limitation as far as cost is concerned. Numerous experiments carried out for the last 15 years have shown that the expression of the transgene is predictable only to a limited extent. This is clearly due to the fact that the expression vectors are not constructed in an appropriate manner. This undoubtedly comes from the fact that all the signals contained in genes have not yet been identified. Gene constructions thus result sometime in poorly functional expression vectors. One possibility consists in using long genomic DNA fragments contained in YAC or BAC vectors. The other relies on the identification of the major important elements required to obtain a satisfactory transgene expression. These elements include essentially gene insulators, chromatin openers, matrix attached regions, enhancers and introns. A certain number of proteins having complex structures (formed by several subunits, being glycosylated, cleaved, carboxylated...) have been obtained at levels sufficient for an industrial exploitation. In other cases, the mammary cellular machinery seems insufficient to promote all the post-translational modifications. The addition of genes coding for enzymes

  7. [Management of T1a vocal fold carcinoma].

    PubMed

    Reiter, R; Brosch, S; Smith, E; Pickhard, A

    2013-12-01

    About 2/3 of the larynx carcinomas affect the vocal chords. The main risk factor is smoking. Carcinomas in this localisation often arise from leukoplakias with dysplasia. A typical symptom is dysphonia. Arrest of vibration in microlaryngostroboscopy is a hint that a carcinoma could be present. Transoral laser cordectomy or radiotherapy show equivalent oncological results and results in quality of voice in the treatment of vocal fold carcinoma (T1a). As lymph node and distant metastasis are very rare, follow-up can concentrate on microlaryngoscopy. In case of a suspicious area on the vocal fold, biopsy of the affected tissue is needed to plan correct treatment. The prognosis of the T1 vocal chord carcinoma is quite good with a 5-year survival rate of almost 100%.

  8. Viable transgenic goats derived from skin cells.

    PubMed

    Behboodi, Esmail; Memili, Erdogan; Melican, David T; Destrempes, Margaret M; Overton, Susan A; Williams, Jennifer L; Flanagan, Peter A; Butler, Robin E; Liem, Hetty; Chen, Li How; Meade, Harry M; Gavin, William G; Echelard, Yann

    2004-06-01

    The current study was undertaken to evaluate the possibility of expanding transgenic goat herds by means of somatic cell nuclear transfer (NT) using transgenic goat cells as nucleus donors. Skin cells from adult, transgenic goats were first synchronized at quiescent stage (G0) by serum starvation and then induced to exit G0 and proceed into G1. Oocytes collected from superovulated donors were enucleated, karyoplast-cytoplast couplets were constructed, and then fused and activated simultaneously by a single electrical pulse. Fused couplets were either co-cultured with oviductal cells in TCM-199 medium (in vitro culture) or transferred to intermediate recipient goat oviducts (in vivo culture) until final transfer. The resulting morulae and blastocysts were transferred to the final recipients. Pregnancies were confirmed by ultrasonography 25-30 days after embryo transfer. In vitro cultured NT embryos developed to morulae and blastocyst stages but did not produce any pregnancies while 30% (6/20) of the in vivo derived morulae and blastocysts produced pregnancies. Two of these pregnancies were resorbed early in gestation. Of the four recipients that maintained pregnancies to term, two delivered dead fetuses 2-3 days after their due dates, and two recipients gave birth to healthy kids at term. Fluorescence in situ hybridization (FISH) analysis confirmed that both kids were transgenic and had integration sites consistent with those observed in the adult cell line.

  9. Clinical Outcomes in cT1 Micropapillary Bladder Cancer

    PubMed Central

    Willis, DL; Fernandez, MI; Dickstein, RJ; Parikh, S; Shah, JB; Pisters, LL; Guo, CC; Henderson, S; Czerniak, BA; Grossman, HB; Dinney, CP; Kamat, AM

    2015-01-01

    Purpose While many urologists recommend radical cystectomy for patient with micropapillary bladder cancer (MPBC) invading the lamina propria (cT1), contradictory small reports exist regarding the efficacy of conservative management with intravesical BCG for this disease. Herein we report our updated experience with largest series of patients with cT1 MPBC. Materials and Methods An IRB approved review of our cancer database identified 283 patients with MPBC, including 72 staged as cT1N0M0 at diagnosis and initiation of therapy. Survival analysis was performed using Kaplan-Meier estimator and compared using the log-rank test. Results Within this 72 patient cohort, 40 received primary intravesical BCG and 26 underwent upfront radical cystectomy. Patients receiving BCG experienced high rates of disease recurrence (75%) and progression (45%); 35% developed lymph node metastasis. Patients treated with upfront cystectomy had improved survival compared to patients treated with primary BCG (5 year disease specific survival (DSS) of 100% vs. 60% respectively, p=0.006) or patients undergoing delayed cystectomy after recurrence (5 yr. DSS: 62%, p=0.015). Prognosis was especially poor in patients who waited for progression prior to undergoing radical cystectomy, with an estimated 5-year DSS of only 24% and a median survival of 35 months. In patients treated with upfront cystectomy, pathologic upstaging occurred in 27%, including 20% with lymph node metastasis. Conclusions While certain patients with T1 MPBC may respond to intravesical BCG, improved survival is seen in those patients who undergo early radical cystectomy. Further molecular studies are needed to identify subsets of patients able to spare their bladders safely. PMID:25254936

  10. Neuropathological changes in transgenic mice carrying copies of a transcriptionally activated Mos protooncogene.

    PubMed

    Propst, F; Rosenberg, M P; Cork, L C; Kovatch, R M; Rauch, S; Westphal, H; Khillan, J; Schulz, N T; Vande Woude, G F; Neumann, P E; Newmann, P E

    1990-12-01

    Independent transgenic mouse lines carrying the mouse Mos protooncogene linked to a retroviral transcriptional control sequence display behavioral abnormalities including circling, head tilting, and head bobbing. This dominant phenotype shows various degrees of penetrance in different transgenic founder animals and lines. Neuronal and axonal degeneration, gliosis, and inflammatory infiltrates are found in all transgenic mouse lines in which behavioral traits are present. Recordings of auditory-evoked potentials in mice of one of these lines demonstrate that transgenic mice are deaf; in these mice spiral ganglia degenerate and most of the cochlear hair cells are absent. By using an S1 nuclease protection assay, we have detected RNA expression of the transgene in all tissues examined and, in particular, at high levels in brain. In situ hybridization experiments show that Mos expression can be detected in specific areas of the central nervous system. Lesions are present in areas with demonstrable overexpression of Mos.

  11. The oncogenic fusion protein RUNX1-CBFA2T1 supports proliferation and inhibits senescence in t(8;21)-positive leukaemic cells

    PubMed Central

    Martinez, Natalia; Drescher, Bettina; Riehle, Heidemarie; Cullmann, Claire; Vornlocher, Hans-Peter; Ganser, Arnold; Heil, Gerhard; Nordheim, Alfred; Krauter, Jürgen; Heidenreich, Olaf

    2004-01-01

    Background The fusion protein RUNX1-CBFA2T1 associated with t(8;21)-positive acute myeloid leukaemia is a potent inhibitor of haematopoetic differentiation. The role of RUNX1-CBFA2T1 in leukaemic cell proliferation is less clear. We examined the consequences of siRNA-mediated RUNX1-CBFA2T1 depletion regarding proliferation and clonogenicity of t(8;21)-positive cell lines. Methods The t(8;21)-positive cell line Kasumi-1 was electroporated with RUNX1-CBFA2T1 or control siRNAs followed by analysis of proliferation, colony formation, cell cycle distribution, apoptosis and senescence. Results Electroporation of Kasumi-1 cells with RUNX1-CBFA2T1 siRNAs, but not with control siRNAs, resulted in RUNX1-CBFA2T1 suppression which lasted for at least 5 days. A single electroporation with RUNX1-CBFA2T1 siRNA severely diminished the clonogenicity of Kasumi-1 cells. Prolonged RUNX1-CBFA2T1 depletion inhibited proliferation in suspension culture and G1-S transition during the cell cycle, diminished the number of apoptotic cells, but induced cellular senescence. The addition of haematopoetic growth factors could not rescue RUNX1-CBFA2T1-depleted cells from senescence, and could only partially restore their clonogenicity. Conclusions RUNX1-CBFA2T1 supports the proliferation and expansion of t(8;21)-positive leukaemic cells by preventing cellular senescence. These findings suggest a central role of RUNX1-CBFA2T1 in the maintenance of the leukaemia. Therefore, RUNX1-CBFA2T1 is a promising and leukaemia-specific target for molecularly defined therapeutic approaches. PMID:15298716

  12. Generation of transgenic oriental melon resistant to Zucchini yellow mosaic virus by an improved cotyledon-cutting method.

    PubMed

    Wu, Hui-Wen; Yu, Tsong-Ann; Raja, Joseph A J; Wang, Hui-Chin; Yeh, Shyi-Dong

    2009-07-01

    Production of melon (Cucumis melo L.) worldwide is often limited by the potyvirus, Zucchini yellow mosaic virus (ZYMV). In order to engineer melon lines resistant to ZYMV, a construct containing the translatable coat protein (CP) sequence coupled with the 3' non-translatable region of the virus was generated and used to transform an elite cultivar of oriental melon (Silver light) mediated by Agrobacterium using an improved cotyledon-cutting method. Removal of 1-mm portion from the proximal end of cotyledons greatly increased the frequency of transgenic regenerants by significantly decreasing the incidence of false positive and aberrant transformants. Results of greenhouse evaluation of transgenic lines by mechanical challenge with ZYMV identified transgenic lines exhibiting different levels of resistance or complete immunity to ZYMV. Southern hybridization of transgenic lines revealed random insertion of the transgene in host genome, with insert numbers differing among transformants. Northern hybridization revealed great variations in the levels of accumulation of the transgene transcripts among transgenic lines, and evidenced an inverse correlation of the levels of accumulation of transgene transcript to the degrees of virus resistance, indicating post-transcriptional gene silencing (PTGS)-mediated transgenic resistance. These transgenic melon lines with high degrees of resistance to ZYMV have great potential for the control of ZYMV in East Asia.

  13. Conditional overexpression of transgenes in megakaryocytes and platelets in vivo

    PubMed Central

    Nguyen, Hao G.; Yu, Guangyao; Makitalo, Maria; Yang, Dan; Xie, Hou-Xiang; Jones, Matthew R.; Ravid, Katya

    2005-01-01

    Megakaryocyte (MK)–specific transgene expression has proved valuable in studying thrombotic and hemostatic processes. Constitutive expression of genes, however, could result in altered phenotypes due to compensatory mechanisms or lethality. To circumvent these limitations, we used the tetracycline/doxycycline (Tet)–off system to conditionally over-express genes in megakaryocytes and platelets in vivo. We generated 3 transactivator transgenic lines expressing the Tet transactivator element (tTA), under the control of the MK-specific platelet factor 4 promoter (PF4-tTA-VP16). Responder lines were simultaneously generated, each with a bidirectional minimal cytomegalovirus (CMV)–tTA responsive promoter driving prokaryotic β-galactosidase gene, as a cellular reporter, and a gene of interest (in this case, the mitotic regulator Aurora-B). A transactivator founder line that strongly expressed PF4-driven tTA–viral protein 16 (VP16) was crossbred to a responder line. The homozygous double-transgenic mouse line exhibited doxycycline-dependent transgene overexpression in MKs and platelets. Using this line, platelets were conveniently indicated at sites of induced stress by β-galactosidase staining. In addition, we confirmed our earlier report on effects of constitutive expression of Aurora-B, indicating a tight regulation at protein level and a modest effect on MK ploidy. Hence, we generated a new line, PF4-tTA-VP16, that is available for conditionally overexpressing genes of interest in the MK/platelet lineage in vivo. PMID:15890684

  14. Constitutive overexpression of the TaNF-YB4 gene in transgenic wheat significantly improves grain yield.

    PubMed

    Yadav, Dinesh; Shavrukov, Yuri; Bazanova, Natalia; Chirkova, Larissa; Borisjuk, Nikolai; Kovalchuk, Nataliya; Ismagul, Ainur; Parent, Boris; Langridge, Peter; Hrmova, Maria; Lopato, Sergiy

    2015-11-01

    Heterotrimeric nuclear factors Y (NF-Ys) are involved in regulation of various vital functions in all eukaryotic organisms. Although a number of NF-Y subunits have been characterized in model plants, only a few have been functionally evaluated in crops. In this work, a number of genes encoding NF-YB and NF-YC subunits were isolated from drought-tolerant wheat (Triticum aestivum L. cv. RAC875), and the impact of the overexpression of TaNF-YB4 in the Australian wheat cultivar Gladius was investigated. TaNF-YB4 was isolated as a result of two consecutive yeast two-hybrid (Y2H) screens, where ZmNF-YB2a was used as a starting bait. A new NF-YC subunit, designated TaNF-YC15, was isolated in the first Y2H screen and used as bait in a second screen, which identified two wheat NF-YB subunits, TaNF-YB2 and TaNF-YB4. Three-dimensional modelling of a TaNF-YB2/TaNF-YC15 dimer revealed structural determinants that may underlie interaction selectivity. The TaNF-YB4 gene was placed under the control of the strong constitutive polyubiquitin promoter from maize and introduced into wheat by biolistic bombardment. The growth and yield components of several independent transgenic lines with up-regulated levels of TaNF-YB4 were evaluated under well-watered conditions (T1-T3 generations) and under mild drought (T2 generation). Analysis of T2 plants was performed in large deep containers in conditions close to field trials. Under optimal watering conditions, transgenic wheat plants produced significantly more spikes but other yield components did not change. This resulted in a 20-30% increased grain yield compared with untransformed control plants. Under water-limited conditions transgenic lines maintained parity in yield performance.

  15. Limited Fitness Advantages of Crop-Weed Hybrid Progeny Containing Insect-Resistant Transgenes (Bt/CpTI) in Transgenic Rice Field

    PubMed Central

    Yang, Xiao; Wang, Feng; Su, Jun; Lu, Bao-Rong

    2012-01-01

    Background The spread of insect-resistance transgenes from genetically engineered (GE) rice to its coexisting weedy rice (O. sativa f. spontanea) populations via gene flow creates a major concern for commercial GE rice cultivation. Transgene flow to weedy rice seems unavoidable. Therefore, characterization of potential fitness effect brought by the transgenes is essential to assess environmental consequences caused by crop-weed transgene flow. Methodology/Principal Findings Field performance of fitness-related traits was assessed in advanced hybrid progeny of F4 generation derived from a cross between an insect-resistant transgenic (Bt/CpTI) rice line and a weedy strain. The performance of transgene-positive hybrid progeny was compared with the transgene-negative progeny and weedy parent in pure and mixed planting of transgenic and nontransgenic plants under environmental conditions with natural vs. low insect pressure. Results showed that under natural insect pressure the insect-resistant transgenes could effectively suppress target insects and bring significantly increased fitness to transgenic plants in pure planting, compared with nontransgenic plants (including weedy parent). In contrast, no significant differences in fitness were detected under low insect pressure. However, such increase in fitness was not detected in the mixed planting of transgenic and nontransgenic plants due to significantly reduced insect pressure. Conclusions/Significance Insect-resistance transgenes may have limited fitness advantages to hybrid progeny resulted from crop-weed transgene flow owning to the significantly reduced ambient target insect pressure when an insect-resistant GE crop is grown. Given that the extensive cultivation of an insect-resistant GE crop will ultimately reduce the target insect pressure, the rapid spread of insect-resistance transgenes in weedy populations in commercial GE crop fields may be not likely to happen. PMID:22815975

  16. T1 and susceptibility contrast at high fields

    NASA Astrophysics Data System (ADS)

    Neelavalli, Jaladhar

    Clinical imaging at high magnetic field strengths (≥ 3Tesla) is sought after primarily due to the increased signal strength available at these fields. This increased SNR can be used to perform: (a) high resolution imaging in the same time as at lower field strengths; (b) the same resolution imaging with much faster acquisition; and (c) functional MR imaging (fMRI), dynamic perfusion and diffusion imaging with increased sensitivity. However they are also associated with increased power deposition (SAR) due to increase in imaging frequency and longer T1 relaxation times. Longer T1s mean longer imaging times for generating good T1 contrast images. On the other hand for faster imaging, at high fields fast spin echo or magnetization prepared sequences are conventionally proposed which are, however, associated with high SAR values. Imaging with low SAR is more and more important as we move towards high fields and particularly for patients with metallic implants like pacemakers or deep brain stimulator. The SAR limit acceptable for these patients is much less than the limit acceptable for normal subjects. A new method is proposed for imaging at high fields with good contrast with simultaneous reduction in power deposition. Further, T1 based contrast optimization problem in FLASH imaging is considered for tissues with different T1s but same spin densities. The solution providing optimal imaging parameters is simplified for quick and easy computation in a clinical setting. The efficacy of the simplification is evaluated and practical limits under which the simplification can be applied are worked out. The phase difference due to variation in magnetic susceptibility property among biological tissues is another unique source of contrast which is different from the conventional T1, T2 and T2* contrast. This susceptibility based phase contrast has become more and more important at high fields, partly due to contrast generation issues due to longer T 1s and shorter T2s and

  17. NF-κB signaling regulates cell-autonomous regulation of CXCL10 in breast cancer 4T1 cells

    PubMed Central

    Jin, Won Jong; Kim, Bongjun; Kim, Darong; Park Choo, Hea-Young; Kim, Hong-Hee; Ha, Hyunil; Lee, Zang Hee

    2017-01-01

    The chemokine CXCL10 and its receptor CXCR3 play a role in breast cancer metastasis to bone and osteoclast activation. However, the mechanism of CXCL10/CXCR3-induced intracellular signaling has not been fully investigated. To evaluate CXCL10-induced cellular events in the mouse breast cancer cell line 4T1, we developed a new synthetic CXCR3 antagonist JN-2. In this study, we observed that secretion of CXCL10 in the supernatant of 4T1 cells was gradually increased during cell growth. JN-2 inhibited basal and CXCL10-induced CXCL10 expression and cell motility in 4T1 cells. Treatment of 4T1 cells with CXCL10 increased the expression of P65, a subunit of the NF-κB pathway, via activation of the NF-κB transcriptional activity. Ectopic overexpression of P65 increased CXCL10 secretion and blunted JN-2-induced suppression of CXCL10 secretion, whereas overexpression of IκBα suppressed CXCL10 secretion. These results indicate that the CXCL10/CXCR3 axis creates a positive feedback loop through the canonical NF-κB signaling pathway in 4T1 cells. In addition, treatment of osteoblasts with conditioned medium from JN-2-treated 4T1 cells inhibited the expression of RANKL, a crucial cytokine for osteoclast differentiation, which resulted in an inhibitory effect on osteoclast differentiation in the co-culture system of bone marrow-derived macrophages and osteoblasts. Direct intrafemoral injection of 4T1 cells induced severe bone destruction; however, this effect was suppressed by the CXCR3 antagonist via downregulation of P65 expression in an animal model. Collectively, these results suggest that the CXCL10/CXCR3-mediated NF-κB signaling pathway plays a role in the control of autonomous regulation of CXCL10 and malignant tumor properties in breast cancer 4T1 cells. PMID:28209986

  18. Zn2+-dependent redox switch in the intracellular T1-T1 interface of a Kv channel.

    PubMed

    Wang, Guangyu; Strang, Candace; Pfaffinger, Paul J; Covarrubias, Manuel

    2007-05-04

    The thiol-based redox regulation of proteins plays a central role in cellular signaling. Here, we investigated the redox regulation at the Zn(2+) binding site (HX(5)CX(20)CC) in the intracellular T1-T1 inter-subunit interface of a Kv4 channel. This site undergoes conformational changes coupled to voltage-dependent gating, which may be sensitive to oxidative stress. The main results show that internally applied nitric oxide (NO) inhibits channel activity profoundly. This inhibition is reversed by reduced glutathione and suppressed by intracellular Zn(2+), and at least two Zn(2+) site cysteines are required to observe the NO-induced inhibition (Cys-110 from one subunit and Cys-132 from the neighboring subunit). Biochemical evidence suggests strongly that NO induces a disulfide bridge between Cys-110 and Cys-132 in intact cells. Finally, further mutational studies suggest that intra-subunit Zn(2+) coordination involving His-104, Cys-131, and Cys-132 protects against the formation of the inhibitory disulfide bond. We propose that the interfacial T1 Zn(2+) site of Kv4 channels acts as a Zn(2+)-dependent redox switch that may regulate the activity of neuronal and cardiac A-type K(+) currents under physiological and pathological conditions.

  19. Transgenic grasspea (Lathyrus sativus L.): factors influencing agrobacterium-mediated transformation and regeneration.

    PubMed

    Barik, D P; Mohapatra, U; Chand, P K

    2005-11-01

    A reproducible procedure was developed for genetic transformation of grasspea using epicotyl segment co-cultivation with Agrobacterium. Two disarmed Agrobacterium tumefaciens strains, EHA 105 and LBA 4404, both carrying the binary plasmid p35SGUSINT with the neomycin phosphotransferase II (nptII) gene and the beta-glucuronidase (gus)-intron, were studied as vector systems. The latter was found to have a higher transforming ability. Several key factors modifying the transformation rate were optimized. The highest transformation rate was achieved using hand-pricked explants for infection with an Agrobacterium culture corresponding to OD(600) congruent with 0.6 and diluted to a cell density of 10(9) cells ml(-1) for 10 min, followed by co-cultivation for 4 days in a medium maintained at pH 5.6. Putative transformed explants capable of forming shoots were selected on regeneration medium containing kanamycin (100 mug ml(-1)). We achieved up to 36% transient expression based on the GUS histochemical assay. Southern hybridization of genomic DNA of the kanamycin-resistant GUS-expressive shoots to a gus-intron probe substantiated the integration of the transgene. Transformed shoots were rooted on half-strength MS containing 0.5 mg l(-1) indole-3-acetic acid, acclimated in vermi-compost and established in the experimental field. Germ-line transformation was evident through progeny analysis. Among T(1) seedlings of most transgenic plant lines, kanamycin-resistant and -sensitive plants segregated in a ratio close to 3:1.

  20. Efficient and Rapid Development of Transgenic Hamster Models of TSEs Using a Radical New Technology

    DTIC Science & Technology

    2007-09-01

    high scrapie susceptibility genotype VVRRQQ. All three lines of the mouse transgenics carrying sheep, human, and elk PrP have been now re-derived. We...have observed the first transmission of the disease from our standard scrapie -infected sheep brain inoculum to the transgenic mice with sheep PrP and...already been distributed. 15. SUBJECT TERMS Transgenic, Mouse, Hamster, TSE, Sheep Scrapie , TOSK, transposon 16. SECURITY CLASSIFICATION OF

  1. Transgenes for tea?

    PubMed

    Heritage, John

    2005-01-01

    So far, no compelling scientific evidence has been found to suggest that the consumption of transgenic or genetically modified (GM) plants by animals or humans is more likely to cause harm than is the consumption of their conventional counterparts. Despite this lack of scientific evidence, the economic prospects for GM plants are probably limited in the short term and there is public opposition to the technology. Now is a good time to address several issues concerning GM plants, including the potential for transgenes to migrate from GM plants to gut microbes or to animal or human tissues, the consequences of consuming GM crops, either as fresh plants or as silage, and the problems caused by current legislation on GM labelling and beyond.

  2. Transgenics in crops

    NASA Technical Reports Server (NTRS)

    Li, Y.; Wu, Y. H.; McAvoy, R.; Duan, H.

    2001-01-01

    With rapid world population growth and declining availability of fresh water and arable land, a new technology is urgently needed to enhance agricultural productivity. Recent discoveries in the field of crop transgenics clearly demonstrate the great potential of this technology for increasing food production and improving food quality while preserving the environment for future generations. In this review, we briefly discuss some of the recent achievements in crop improvement that have been made using gene transfer technology.

  3. The TOTEM T1 read out card motherboard

    NASA Astrophysics Data System (ADS)

    Minutoli, S.; Lo Vetere, M.; Robutti, E.

    2010-12-01

    This article describes the Read Out Card (ROC) motherboard, which is the main component of the T1 forward telescope front-end electronic system. The ROC main objectives are to acquire tracking data and trigger information from the detector. It performs data conversion from electrical to optical format and transfers the data streams to the next level of the system and it implements Slow Control modules which are able to receive, decode and distribute the LHC machine low jitter clock and fast command. The ROC also provides a spy mezzanine connection based on programmable FPGA and USB2.0 for laboratory and portable DAQ debugging system.

  4. T-1 Test Program Ver. 6.0.1

    SciTech Connect

    Perlinski, Anthony W.

    2004-05-21

    The software allows for easy setup and testing of a variety of RF Electronic Sensor Platforms (ESPs). The software interprets RF messages from the ESP and displays the information in a graphical user interface. This program is used primarily for testing of the T-1 Electronic Sensor Platform. The software imports Electronic Tag Data files which are created from the Electronic Sensor Platform Programmer (ESPP). The software will automatically add sensors to its database when a RF message s received that the program recognizes. Any data that is generated can be stored to a file for later analysis.

  5. Transgenic control of perforin gene expression

    SciTech Connect

    Lichtenheld, M.G.; Podack, E.R.; Levy, R.B.

    1995-03-01

    Perforin is a pore-forming effector molecule of CTL and NK cells. To characterize perforin gene expression and its transcriptional control mechanisms in vivo, expression of a cell surface tag, i.e., human CD4, was driven by 5.1 kb of the murin perforin 5{prime} flanking and promoter region in transgenic mice. Six out of seven transgenic lines expressed the perforin-tag hybrid gene at low to intermediate levels, depending on the integration site. Transgene expression occurred in all cells that physiologically are able to express perforin. At the whole organ level, significant amounts of transgenic mRNA and endogenous perforin mRNA were co-expressed in the lymphoid organs, as well as in the lung, the ileum, the oviduct/uterus, and the bone marrow. At the single cell level, the perforin tag was present on NK cells and on CD8{sup +}, as well as on CD4{sup +} cells. Also targeted were Thy-1.2{sup +} {gamma}{delta} T cells, but not Thy-1.2{sup -} {gamma}{delta} T cells, B cells, nor monocytes. During thymic T cell development, transgene expression occurred in double negative (CD4{sup -}CD8{sup -}) thymocytes and was detected at all subsequent stages, but exceeded the expression levels of the endogenous gene in the thymus. In conclusion, the analyzed perforin 5{prime} flanking and promoter region contains important cis-acting sequences that restrict perforin expression to T cells and NK cells, and therefore provides a unique tool for manipulating T cell and/or Nk cell-mediated immune responses in transgenic mice. On the other hand, the normal control of perforin gene expression involves at least one additional negative control mechanism that was not mediated by the transgenic promoter and upstream region. This control restricts perforin gene expression in thymically developing T cells and in most resting peripheral T cells, but can be released upon T cell activation. 43 refs., 7 figs., 1 tab.

  6. Comparative analysis of nutritional compositions of transgenic RNAi-mediated virus-resistant bean (event EMB-PV051-1) with its non-transgenic counterpart.

    PubMed

    Carvalho, José L V; de Oliveira Santos, Juliana; Conte, Carmine; Pacheco, Sidney; Nogueira, Elsa O P L; Souza, Thiago L P O; Faria, Josias C; Aragão, Francisco J L

    2015-10-01

    Golden mosaic is among the most economically important diseases that severely reduce bean production in Latin America. In 2011, a transgenic bean event named Embrapa 5.1 (EMB-PV051-1), resistant to bean golden mosaic virus, was approved for commercial release in Brazil. The aim of this study was to measure and evaluate the nutritional components of the beans, as well as the anti-nutrient levels in the primary transgenic line and its derived near-isogenic lines after crosses and backcrosses with two commercial cultivars. Nutritional assessment of transgenic crops used for human consumption is an important aspect of safety evaluations. Results demonstrated that the transgenic bean event, cultivated under field conditions, was substantially equivalent to that of the non-transgenic bean plants. In addition, the amounts of the nutritional components are within the range of values observed for several bean commercial varieties grown across a range of environments and seasons.

  7. Transgenic fish systems and their application in ecotoxicology.

    PubMed

    Lee, Okhyun; Green, Jon M; Tyler, Charles R

    2015-02-01

    The use of transgenics in fish is a relatively recent development for advancing understanding of genetic mechanisms and developmental processes, improving aquaculture, and for pharmaceutical discovery. Transgenic fish have also been applied in ecotoxicology where they have the potential to provide more advanced and integrated systems for assessing health impacts of chemicals. The zebrafish (Daniorerio) is the most popular fish for transgenic models, for reasons including their high fecundity, transparency of their embryos, rapid organogenesis and availability of extensive genetic resources. The most commonly used technique for producing transgenic zebrafish is via microinjection of transgenes into fertilized eggs. Transposon and meganuclease have become the most reliable methods for insertion of the genetic construct in the production of stable transgenic fish lines. The GAL4-UAS system, where GAL4 is placed under the control of a desired promoter and UAS is fused with a fluorescent marker, has greatly enhanced model development for studies in ecotoxicology. Transgenic fish have been developed to study for the effects of heavy metal toxicity (via heat-shock protein genes), oxidative stress (via an electrophile-responsive element), for various organic chemicals acting through the aryl hydrocarbon receptor, thyroid and glucocorticoid response pathways, and estrogenicity. These models vary in their sensitivity with only very few able to detect responses for environmentally relevant exposures. Nevertheless, the potential of these systems for analyses of chemical effects in real time and across multiple targets in intact organisms is considerable. Here we illustrate the techniques used for generating transgenic zebrafish and assess progress in the development and application of transgenic fish (principally zebrafish) for studies in environmental toxicology. We further provide a viewpoint on future development opportunities.

  8. Extended ISIS sequences insensitive to T(1) smearing.

    PubMed

    Ljungberg, M; Starck, G; Vikhoff-Baaz, B; Alpsten, M; Ekholm, S; Forssell-Aronsson, E

    2000-10-01

    Image selected in vivo spectroscopy (ISIS) is a volume selection method often used for in vivo (31)P MRS, since it is suitable for measurements of substances with short T(2). However, ISIS can suffer from significant signal contributions caused by T(1) smearing from regions outside the VOI. A computer model was developed to simulate this contamination. The simulation results for the ISIS experiment order implemented in our MR system (ISIS-0) were in agreement with results obtained from phantom measurements. A new extended ISIS experiment order (E-ISIS) was developed, consisting of four "optimal" ISIS experiment orders (ISIS-1 to ISIS-4) performed consecutively with dummy ISIS experiments in between. The simulation results show that contamination due to T(1) smearing is, effectively, eliminated with E-ISIS and is significantly lower than for ISIS-0 and ISIS-1. E-ISIS offers increased accuracy for quantitative and qualitative determination of substances studied using in vivo MRS. Hence, E-ISIS can be valuable for both clinical and research applications.

  9. Pulsed eldor measurement of nitrogen T1 in spin labels

    NASA Astrophysics Data System (ADS)

    Hyde, James S.; Froncisz, W.; Mottley, C.

    1984-10-01

    A 180° pulse is delivered to one hyperfine line of a nitroxide spin label, and the arrival and disappearance of saturation at another hyperfine line is monitored with a second microwave field. Electron and nitrogen nuclear relaxation times are found to be in poor agreement ,vith the electron-nuclear dipolar (END) mechanism.

  10. Assessment of the diversity and dynamics of Plum pox virus and aphid populations in transgenic European plums under Mediterranean conditions.

    PubMed

    Capote, Nieves; Pérez-Panadés, Jordi; Monzó, César; Carbonell, Emilio; Urbaneja, Alberto; Scorza, Ralph; Ravelonandro, Michel; Cambra, Mariano

    2008-06-01

    The molecular variability of Plum pox virus (PPV) populations was compared in transgenic European plums (Prunus domestica L.) carrying the coat protein (CP) gene of PPV and non-transgenic plums in an experimental orchard in Valencia, Spain. A major objective of this study was to detect recombination between PPV CP transgene transcripts and infecting PPV RNA. Additionally, we assessed the number and species of PPV aphid vectors that visited transgenic and non-transgenic plum trees. Test trees consisted of five different P. domestica transgenic lines, i.e. the PPV-resistant C5 'HoneySweet' line and the PPV-susceptible C4, C6, PT6 and PT23 lines, and non-transgenic P. domestica and P. salicina Lind trees. No significant difference in the genetic diversity of PPV populations infecting transgenic and conventional plums was detected, in particular no recombinant between transgene transcripts and incoming viral RNA was found at detectable levels. Also, no significant difference was detected in aphid populations, including viruliferous individuals, that visited transgenic and conventional plums. Our data indicate that PPV-CP transgenic European plums exposed to natural PPV infection over an 8 year period caused limited, if any, risk beyond the cultivation of conventional plums under Mediterranean conditions in terms of the emergence of recombinant PPV and diversity of PPV and aphid populations.

  11. New T1-based superconductor T1PbSrRCuO without Ca with Tc above 100 K

    NASA Astrophysics Data System (ADS)

    Sheng, Z. Z.; Xin, Y.; Meason, J. M.

    1991-04-01

    Ca-free T1PbSrRCuO samples (R=rare earths) with Tc up to above 100 K were prepared, and studied by resistance and ac susceptibility measurements and by powder x-ray diffraction analyses. A 1212-type phase (Tl1-xPbx)Sr2(Sr1-yRy)Cu2Oz is responsible for the observed supercondcutivity. A rare-earth is required for the formation of the 1212 phase. Pb-dopping is necessary to increase the Tc of the 1212 phase from 90 K to above 100 K.

  12. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    PubMed

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  13. Allergenicity assessment of the Papaya ringspot virus coat protein expressed in transgenic Rainbow papaya

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The virus-resistant, transgenic commercial papaya cultivars Rainbow and SunUp (Carica papaya L.) have been consumed locally in Hawaii and elsewhere in the mainland US and Canada since their release to planters in Hawaii in 1998. These cultivars are derived from transgenic papaya line 55-1 and carry ...

  14. Transgenic algae engineered for higher performance

    DOEpatents

    Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

    2014-10-21

    The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

  15. Transmembrane segment 5 of the dipeptide transporter hPepT1 forms a part of the substrate translocation pathway.

    PubMed

    Kulkarni, Ashutosh A; Haworth, Ian S; Lee, Vincent H L

    2003-06-20

    This study is the first systematic attempt to investigate the role of transmembrane segment 5 of hPepT1, the most conserved segment across different species, in forming a part of the aqueous substrate translocation pathway. We used cysteine-scanning mutagenesis in conjunction with the sulfhydryl-specific reagents, MTSEA and MTSET. Neither of these reagents reduced wild-type-hPepT1 transport activity in HEK293 cells and Xenopus oocytes. Twenty-one single cysteine mutations in hPepT1 were created by replacing each residue within TMS5 with a cysteine. HEK293 cells were then transfected with each mutated protein and the steady-state protein level, [3H]Gly-Sar uptake activity, and sensitivity to the MTS reagents were measured. S164C-, L168C-, G173C-, and I179C-hPepT1 were not expressed on the plasma membrane. Y167C-, N171C-, and S174C-hPepT1 showed T1. P182C-hPepT1 showed approximately 40% specific activity whereas all the remaining transporters, although still sensitive to single cysteine mutations, exhibited more than 50% specific activity when compared to WT-hPepT1. The activity of F166C-, L176C-, S177C-, T178C-, I180C-, T181C-, and P182C-hPepT1 was partially inhibited, while the activity of F163C- and I170C-hPepT1 was completely inhibited by 2.5mM MTSEA. F163C, I165C, F166C, A169C, I170C, S177C, T181C, and P182C were clearly accessible to 1mM MTSET. Overall, these results suggest that TMS5 lines the putative aqueous channel and is slightly tilted from the vertical axis of the channel, with the exofacial half forming a classical amphipathic alpha-helix and the cytoplasmic half being highly solvent accessible.

  16. Transgenic tobacco plants expressing a dimeric single-chain variable fragment (scfv) antibody against Salmonella enterica serotype Paratyphi B.

    PubMed

    Makvandi-Nejad, Shokouh; McLean, Michael D; Hirama, Tomoko; Almquist, Kurt C; Mackenzie, C Roger; Hall, J Christopher

    2005-10-01

    Transgenic tobacco plants were produced that express an anti-Salmonella enterica single-chain variable fragment (scFv) antibody that binds to the lipopolysaccharide (LPS) of S. enterica Paratyphi B. The coding sequence of this scFv was optimized for expression in tobacco, synthesized and subsequently placed behind three different promoters: an enhanced tobacco constitutive ubiquitous promoter (EntCUP4), and single- and double-enhancer versions of the Cauliflower Mosaic Virus 35S promoter (CaMV 35S). These chimeric genes were introduced into Nicotiana tabacum cv. 81V9 by Agrobacterium-mediated transformation and 50 primary transgenic (T(0)) plants per construct were produced. Among these plants, 23 were selected for the ability to express active scFv as determined by enzyme-linked immunosorbent assay (ELISA) using S. enterica LPS as antigen. Expanded bed adsorption-immobilized metal affinity chromatography (EBA-IMAC) was used to purify 41.7 mug of scFv/g from leaf tissue. Gel filtration and surface plasmon resonance (SPR) analyses demonstrated that the purified scFv was active as a dimer or higher-order multimer. In order to identify T(1) plants suitable for development of homozygous lines with heritable scFv expression, kanamycin-resistance segregation analyses were performed to determine the number of T-DNA loci in each T(0) plant, and quantitative ELISA and immunoblot analyses were used to compare expression of active and total anti-Salmonella scFv, respectively, in the T(1) generation. As S. enterica causes millions of enteric fevers and hundreds of thousands of deaths worldwide each year, large-scale production and purification of this scFv will have potential for uses in diagnosis and detection, as a therapeutic agent, and in applications such as water system purification.

  17. T1- and T2-weighted imaging at 8 Tesla.

    PubMed

    Kangarlu, A; Abduljalil, A M; Robitaille, P M

    1999-01-01

    In this work, both T1- and T2-weighted fast imaging methods at 8 T are presented. These include the modified driven equilibrium Fourier transform (MDEFT) and rapid acquisition with relaxation enhancement (RARE) methods, respectively. Axial MDEFT images were acquired with large nutation angles, both partially suppressing gray and white matter and permitting the visualization of vascular structures rich in unsaturated spins. Sagittal RARE images, acquired from the same volunteer, were highly T2-weighted, thus highlighting the CSF. At the same time, they provided good visualization of the corpus callosum, cerebellum, and gray and white matter structures. Importantly, both MDEFT and RARE images could be acquired without violating specific absorption rate guidelines.

  18. MAIN-BELT COMET P/2012 T1 (PANSTARRS)

    SciTech Connect

    Hsieh, Henry H.; Kaluna, Heather M.; Yang Bin; Haghighipour, Nader; Micheli, Marco; Denneau, Larry; Jedicke, Robert; Kleyna, Jan; Veres, Peter; Wainscoat, Richard J.; Ansdell, Megan; Elliott, Garrett T.; Keane, Jacqueline V.; Meech, Karen J.; Riesen, Timm E.; Sonnett, Sarah; Novakovic, Bojan; Fitzsimmons, Alan; Moskovitz, Nicholas A.; Sheppard, Scott S.; and others

    2013-07-01

    We present initial results from observations and numerical analyses aimed at characterizing the main-belt comet P/2012 T1 (PANSTARRS). Optical monitoring observations were made between 2012 October and 2013 February using the University of Hawaii 2.2 m telescope, the Keck I telescope, the Baade and Clay Magellan telescopes, Faulkes Telescope South, the Perkins Telescope at Lowell Observatory, and the Southern Astrophysical Research Telescope. The object's intrinsic brightness approximately doubles from the time of its discovery in early October until mid-November and then decreases by {approx}60% between late December and early February, similar to photometric behavior exhibited by several other main-belt comets and unlike that exhibited by disrupted asteroid (596) Scheila. We also used Keck to conduct spectroscopic searches for CN emission as well as absorption at 0.7 {mu}m that could indicate the presence of hydrated minerals, finding an upper limit CN production rate of Q{sub CN} < 1.5 Multiplication-Sign 10{sup 23} mol s{sup -1}, from which we infer a water production rate of Q{sub H{sub 2O}}<5 Multiplication-Sign 10{sup 25} mol s{sup -1}, and no evidence of the presence of hydrated minerals. Numerical simulations indicate that P/2012 T1 is largely dynamically stable for >100 Myr and is unlikely to be a recently implanted interloper from the outer solar system, while a search for potential asteroid family associations reveals that it is dynamically linked to the {approx}155 Myr old Lixiaohua asteroid family.

  19. Differential Regulation of ERK1/2 and mTORC1 Through T1R1/T1R3 in MIN6 Cells.

    PubMed

    Wauson, Eric M; Guerra, Marcy L; Dyachok, Julia; McGlynn, Kathleen; Giles, Jennifer; Ross, Elliott M; Cobb, Melanie H

    2015-08-01

    The MAPKs ERK1/2 respond to nutrients and other insulin secretagogues in pancreatic β-cells and mediate nutrient-dependent insulin gene transcription. Nutrients also stimulate the mechanistic target of rapamycin complex 1 (mTORC1) to regulate protein synthesis. We showed previously that activation of both ERK1/2 and mTORC1 in the MIN6 pancreatic β-cell-derived line by extracellular amino acids (AAs) is at least in part mediated by the heterodimeric T1R1/T1R3, a G protein-coupled receptor. We show here that AAs differentially activate these two signaling pathways in MIN6 cells. Pretreatment with pertussis toxin did not prevent the activation of either ERK1/2 or mTORC1 by AAs, indicating that G(I) is not central to either pathway. Although glucagon-like peptide 1, an agonist for a G(s-)coupled receptor, activated ERK1/2 well and mTORC1 to a small extent, AAs had no effect on cytosolic cAMP accumulation. Ca(2+) entry is required for ERK1/2 activation by AAs but is dispensable for AA activation of mTORC1. Pretreatment with UBO-QIC, a selective G(q) inhibitor, reduced the activation of ERK1/2 but had little effect on the activation of mTORC1 by AAs, suggesting a differential requirement for G(q). Inhibition of G(12/13) by the overexpression of the regulator of G protein signaling domain of p115 ρ-guanine nucleotide exchange factor had no effect on mTORC1 activation by AAs, suggesting that these G proteins are also not involved. We conclude that AAs regulate ERK1/2 and mTORC1 through distinct signaling pathways.

  20. Differential Regulation of ERK1/2 and mTORC1 Through T1R1/T1R3 in MIN6 Cells

    PubMed Central

    Wauson, Eric M.; Guerra, Marcy L.; Dyachok, Julia; McGlynn, Kathleen; Giles, Jennifer; Ross, Elliott M.

    2015-01-01

    The MAPKs ERK1/2 respond to nutrients and other insulin secretagogues in pancreatic β-cells and mediate nutrient-dependent insulin gene transcription. Nutrients also stimulate the mechanistic target of rapamycin complex 1 (mTORC1) to regulate protein synthesis. We showed previously that activation of both ERK1/2 and mTORC1 in the MIN6 pancreatic β-cell-derived line by extracellular amino acids (AAs) is at least in part mediated by the heterodimeric T1R1/T1R3, a G protein-coupled receptor. We show here that AAs differentially activate these two signaling pathways in MIN6 cells. Pretreatment with pertussis toxin did not prevent the activation of either ERK1/2 or mTORC1 by AAs, indicating that Gi is not central to either pathway. Although glucagon-like peptide 1, an agonist for a Gs-coupled receptor, activated ERK1/2 well and mTORC1 to a small extent, AAs had no effect on cytosolic cAMP accumulation. Ca2+ entry is required for ERK1/2 activation by AAs but is dispensable for AA activation of mTORC1. Pretreatment with UBO-QIC, a selective Gq inhibitor, reduced the activation of ERK1/2 but had little effect on the activation of mTORC1 by AAs, suggesting a differential requirement for Gq. Inhibition of G12/13 by the overexpression of the regulator of G protein signaling domain of p115 ρ-guanine nucleotide exchange factor had no effect on mTORC1 activation by AAs, suggesting that these G proteins are also not involved. We conclude that AAs regulate ERK1/2 and mTORC1 through distinct signaling pathways. PMID:26168033

  1. Plant biotechnology: transgenic crops.

    PubMed

    Shewry, Peter R; Jones, Huw D; Halford, Nigel G

    2008-01-01

    Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

  2. Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).

    PubMed

    Singh, Natwar; Mishra, Avinash; Jha, Bhavanath

    2014-08-15

    Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture.

  3. [Obtaining transgenic rice plants and their progenies using Agrobacterium tumefaciens].

    PubMed

    Yin, Z C; Yang, F; Xu, Y; Li, B J

    1998-12-01

    Rice (Oriza sativa L.) suspension cells of Taipei 309 were co-cultivated with A. tumefaciens stran EHA101 harbouring binary vector pBYT2 for 3 days in the presence of vir inducer, 100 mumol/L acetosyringone (AS). After 2 months of continuous selection, 17 stable hygromycin-resistant, GUS-positive calli were recovered from 364 suspension cell clusters co-cultivated with A. tumefaciens. 10 putative transgenic R0 plants obtained from 8 tansformed calli and their progenies were analyzed for the integration and expression of foreign genes. Southern blot analysis of R0 and R1 generations indicated that foreign genes had been stably integrated in the genome of transgenic rice and sexually transmitted. One of the transgenic lines showed 5 copies of T-DNA integration, while the others had only one copy. Histochemical staining observation and fluorometric assay of GUS activity in transgenic rice cells and plants showed ubiquitin promoter from maize was highly effective in driving the expression of gus reporter gene in transgenic rice cells. GUS protein and its activity were also investigated through ndPAGE-X-Gluc staining assay, and it was found that the GUS protein in transgenic rice cells was smaller in size than the standard GUS protein (Sigma Co. G0786) but as large as that from E.coli HB101 (pBI121). This study suggested that Agrobacterium-mediated transformation of plant is an efficient and reliable method to introduce foreign genes into rice.

  4. Neurologic and motor dysfunctions in APP transgenic mice

    PubMed Central

    Lalonde, Robert; Fukuchi, Ken-ichiro; Strazielle, Catherine

    2012-01-01

    The discovery of gene mutations underlying autosomal dominant Alzheimer’s disease has enabled researchers to reproduce several hallmarks of this disorder in transgenic mice, notably the formation of Aβ plaques in brain and cognitive deficits. APP transgenic mutants have also been investigated with respect to survival rates, neurologic functions, and motor coordination, which are all susceptible to alteration in Alzheimer dementia. Several transgenic lines expressing human mutated or wild-type APP had higher mortality rates than non-transgenic controls with or without the presence of Aβ plaques. Mortality rates were also elevated in APP transgenic mice with vascular amyloid accumulation, thereby implicating cerebrovascular factors in the precocious death observed in all APP transgenic models. In addition, myoclonic jumping has been described in APP mutants, together with seizure activity, abnormal limb-flexion and paw-clasping reflexes, and motor coordination deficits. The neurologic signs resemble the myoclonic movements, epileptic seizures, pathological reflexes, and gait problems observed in late-stage Alzheimer’s disease. PMID:23089603

  5. Estimation of transgene copy number in transformed citrus plants by quantitative multiplex real-time PCR.

    PubMed

    Omar, Ahmad A; Dekkers, Marty G H; Graham, James H; Grosser, Jude W

    2008-01-01

    Quantitative real-time PCR (qRT-PCR) was adapted to estimate transgene copy number of the rice Xa21 gene in transgenic citrus plants. This system used TaqMan qRT-PCR and the endogenous citrus gene encoding for lipid transfer protein (LTP). Transgenic "Hamlin" sweet orange plants were generated using two different protoplast-GFP transformation systems: cotransformation and single plasmid transformation. A dilution series of genomic DNA from one of the transgenic lines was used to generate a standard curve for the endogenous LTP and the transgene Xa21. This standard curve was used for relative quantification of the endogenous gene and the transgene. Copy numbers of the transgene Xa21 detected from qRT-PCR analysis correlated with that from Southern blot analysis (r = 0.834). Thus, qRT-PCR is an efficient means of estimating copy number in transgenic citrus plants. This analysis can be performed at much earlier stages of transgenic plant development than southern blot analysis, which expedites investigation of transgenes in slow-growing woody plants.

  6. FAIR exempting separate T (1) measurement (FAIREST): a novel technique for online quantitative perfusion imaging and multi-contrast fMRI.

    PubMed

    Lai, S; Wang, J; Jahng, G H

    2001-01-01

    A new pulse sequence, dubbed FAIR exempting separate T(1) measurement (FAIREST) in which a slice-selective saturation recovery acquisition is added in addition to the standard FAIR (flow-sensitive alternating inversion recovery) scheme, was developed for quantitative perfusion imaging and multi-contrast fMRI. The technique allows for clean separation between and thus simultaneous assessment of BOLD and perfusion effects, whereas quantitative cerebral blood flow (CBF) and tissue T(1) values are monitored online. Online CBF maps were obtained using the FAIREST technique and the measured CBF values were consistent with the off-line CBF maps obtained from using the FAIR technique in combination with a separate sequence for T(1) measurement. Finger tapping activation studies were carried out to demonstrate the applicability of the FAIREST technique in a typical fMRI setting for multi-contrast fMRI. The relative CBF and BOLD changes induced by finger-tapping were 75.1 +/- 18.3 and 1.8 +/- 0.4%, respectively, and the relative oxygen consumption rate change was 2.5 +/- 7.7%. The results from correlation of the T(1) maps with the activation images on a pixel-by-pixel basis show that the mean T(1) value of the CBF activation pixels is close to the T(1) of gray matter while the mean T(1) value of the BOLD activation pixels is close to the T(1) range of blood and cerebrospinal fluid.

  7. Transgenic horticultural crops in Asia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Modern biotechnology applications, including genetic engineering, are a powerful tool to complement the conventional methods of crop improvement. Asia currently has three countries cultivating biotech/transgenic crops – China, India, and the Philippines, but only China commercially grows a transgen...

  8. Transgenic cloned sheep overexpressing ovine toll-like receptor 4.

    PubMed

    Deng, Shoulong; Li, Guiguan; Zhang, Jinlong; Zhang, Xiaosheng; Cui, Maosheng; Guo, Yong; Liu, Guoshi; Li, Guangpeng; Feng, Jianzhong; Lian, Zhengxing

    2013-07-01

    An ovine fetal fibroblast cell line highly expressing TLR4 was established by inserting TLR4 into a reconstructive p3S-LoxP plasmid. Transgenic sheep overexpressing TLR4 were produced by transferring TLR4-transfected fetal fibroblasts into metaphase (M)II-stage enucleated oocytes (using SCNT). Because reconstructed embryos derived from MII-stage enucleated oocytes matured in vivo using a delayed-activated method had a higher pregnancy rate (18.52%) than that from MII-stage enucleated oocytes matured in vitro, the former procedure was used. Nine TLR4-transgenic live births were confirmed using polymerase chain reaction and Southern blot analysis. Increased expression of TLR4 at mRNA and protein levels in ear tissues of transgenic lambs were verified using reverse transcription polymerase chain reaction and immunohistochemistry, respectively. More toll-like receptor 4 protein was expressed by peripheral blood monocytes and/or macrophages collected from 3-month-old TLR4-transgenic than nontransgenic lambs at 0, 1, and 4 hours after lipopolysaccharide stimulation. Furthermore, interferon-γ and tumor necrosis factor α secreted by monocytes and/or macrophages of TLR4-transgenic lambs were significantly higher at 1 hour. Therefore, lipopolysaccharide-induced inflammatory responses from monocytes and/or macrophages occurred sooner in TLR4-transgenic lambs, consistent with an enhanced host immune response. In conclusion, transgenic sheep overexpressing TLR4 are a primary model to investigate the role of transgenic animals in disease resistance and have potential for breeding sheep with disease resistance.

  9. An inducible transgene reports activation of macrophages in live zebrafish larvae.

    PubMed

    Sanderson, Leslie E; Chien, An-Tzu; Astin, Jonathan W; Crosier, Kathryn E; Crosier, Philip S; Hall, Christopher J

    2015-11-01

    Macrophages are the most functionally heterogenous cells of the hematopoietic system. Given many diseases are underpinned by inappropriate macrophage activation, macrophages have emerged as a therapeutic target to treat disease. A thorough understanding of what controls macrophage activation will likely reveal new pathways that can be manipulated for therapeutic benefit. Live imaging fluorescent macrophages within transgenic zebrafish larvae has provided a valuable window to investigate macrophage behavior in vivo. Here we describe the first transgenic zebrafish line that reports macrophage activation, as evidenced by induced expression of an immunoresponsive gene 1(irg1):EGFP transgene. When combined with existing reporter lines that constitutively mark macrophages, we reveal this unique transgenic line can be used to live image macrophage activation in response to the bacterial endotoxin lipopolysaccharide and xenografted human cancer cells. We anticipate the Tg(irg1:EGFP) line will provide a valuable tool to explore macrophage activation and plasticity in the context of different disease models.

  10. Measurement of T1/T2 relaxation times in overlapped regions from homodecoupled 1H singlet signals

    NASA Astrophysics Data System (ADS)

    Castañar, Laura; Nolis, Pau; Virgili, Albert; Parella, Teodor

    2014-07-01

    The implementation of the HOmodecoupled Band-Selective (HOBS) technique in the conventional Inversion-Recovery and CPMG-based PROJECT experiments is described. The achievement of fully homodecoupled signals allows the distinction of overlapped 1H resonances with small chemical shift differences. It is shown that the corresponding T1 and T2 relaxation times can be individually measured from the resulting singlet lines using conventional exponential curve-fitting methods.

  11. Main-belt Comet P/2012 T1 (PANSTARRS)

    NASA Astrophysics Data System (ADS)

    Hsieh, Henry H.; Kaluna, Heather M.; Novaković, Bojan; Yang, Bin; Haghighipour, Nader; Micheli, Marco; Denneau, Larry; Fitzsimmons, Alan; Jedicke, Robert; Kleyna, Jan; Vereš, Peter; Wainscoat, Richard J.; Ansdell, Megan; Elliott, Garrett T.; Keane, Jacqueline V.; Meech, Karen J.; Moskovitz, Nicholas A.; Riesen, Timm E.; Sheppard, Scott S.; Sonnett, Sarah; Tholen, David J.; Urban, Laurie; Kaiser, Nick; Chambers, K. C.; Burgett, William S.; Magnier, Eugene A.; Morgan, Jeffrey S.; Price, Paul A.

    2013-07-01

    We present initial results from observations and numerical analyses aimed at characterizing the main-belt comet P/2012 T1 (PANSTARRS). Optical monitoring observations were made between 2012 October and 2013 February using the University of Hawaii 2.2 m telescope, the Keck I telescope, the Baade and Clay Magellan telescopes, Faulkes Telescope South, the Perkins Telescope at Lowell Observatory, and the Southern Astrophysical Research Telescope. The object's intrinsic brightness approximately doubles from the time of its discovery in early October until mid-November and then decreases by ~60% between late December and early February, similar to photometric behavior exhibited by several other main-belt comets and unlike that exhibited by disrupted asteroid (596) Scheila. We also used Keck to conduct spectroscopic searches for CN emission as well as absorption at 0.7 μm that could indicate the presence of hydrated minerals, finding an upper limit CN production rate of Q CN < 1.5 × 1023 mol s-1, from which we infer a water production rate of Q_H_2O<5\\times 10^{25} mol s-1, and no evidence of the presence of hydrated minerals. Numerical simulations indicate that P/2012 T1 is largely dynamically stable for >100 Myr and is unlikely to be a recently implanted interloper from the outer solar system, while a search for potential asteroid family associations reveals that it is dynamically linked to the ~155 Myr old Lixiaohua asteroid family. Some of the data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration, and made possible by the generous financial support of the W. M. Keck Foundation, the Magellan Telescopes located at Las Campanas Observatory, Chile, and the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inova

  12. Neutralizing antibodies against rotavirus produced in transgenically labelled purple tomatoes.

    PubMed

    Juárez, Paloma; Presa, Silvia; Espí, Joaquín; Pineda, Benito; Antón, María T; Moreno, Vicente; Buesa, Javier; Granell, Antonio; Orzaez, Diego

    2012-04-01

    Edible fruits are inexpensive biofactories for human health-promoting molecules that can be ingested as crude extracts or partially purified formulations. We show here the production of a model human antibody for passive protection against the enteric pathogen rotavirus in transgenically labelled tomato fruits. Transgenic tomato plants expressing a recombinant human immunoglobulin A (hIgA_2A1) selected against the VP8* peptide of rotavirus SA11 strain were obtained. The amount of hIgA_2A1 protein reached 3.6 ± 0.8% of the total soluble protein in the fruit of the transformed plants. Minimally processed fruit-derived products suitable for oral intake showed anti-VP8* binding activity and strongly inhibited virus infection in an in vitro virus neutralization assay. In order to make tomatoes expressing hIgA_2A1 easily distinguishable from wild-type tomatoes, lines expressing hIgA_2A1 transgenes were sexually crossed with a transgenic tomato line expressing the genes encoding Antirrhinum majus Rosea1 and Delila transcription factors, which confer purple colour to the fruit. Consequently, transgenically labelled purple tomato fruits expressing hIgA_2A1 have been developed. The resulting purple-coloured extracts from these fruits contain high levels of recombinant anti-rotavirus neutralizing human IgA in combination with increased amounts of health-promoting anthocyanins.

  13. Identification and quantification of anthocyanins in transgenic purple tomato.

    PubMed

    Su, Xiaoyu; Xu, Jianteng; Rhodes, Davina; Shen, Yanting; Song, Weixing; Katz, Benjamin; Tomich, John; Wang, Weiqun

    2016-07-01

    Anthocyanins are natural pigments derived from the phenylpropanoid pathway. Most tomatoes produce little anthocyanins, but the transgenic purple tomato biosynthesizes a high level of anthocyanins due to expression of two transcription factors (Del and Ros1). This study was to identify and quantify anthocyanins in this transgenic tomato line. Seven anthocyanins, including two new anthocyanins [malvidin-3-(p-coumaroyl)-rutinoside-5-glucoside and malvidin-3-(feruloyl)-rutinoside-5-glucoside], were identified by LC-MS/MS. Petunidin-3-(trans-coumaroyl)-rutinoside-5-glucoside and delphinidin-3-(trans-coumaroyl)-rutinoside-5-glucoside were the most abundant anthocyanins, making up 86% of the total anthocyanins. Compared to undetectable anthocyanins in the wild type, the contents of anthocyanins in the whole fruit, peel, and flesh of the Del/Ros1-transgenic tomato were 5.2±0.5, 5.1±0.5, and 5.8±0.3g/kg dry matter, respectively. Anthocyanins were undetectable in the seeds of both wide-type and transgenic tomato lines. Such novel and high levels of anthocyanins obtained in this transgenic tomato may provide unique functional products with potential health benefits.

  14. Real-time PCR for the detection of precise transgene copy number in durum wheat.

    PubMed

    Gadaleta, Agata; Giancaspro, Angelica; Cardone, Maria Francesca; Blanco, Antonio

    2011-12-01

    Recent results obtained in various crops indicate that real-time PCR could be a powerful tool for the detection and characterization of transgene locus structures. The determination of transgenic locus number through real-time PCR overcomes the problems linked to phenotypic segregation analysis (i.e. lack of detectable expression even when the transgenes are present) and can analyse hundreds of samples in a day, making it an efficient method for estimating gene copy number. Despite these advantages, many authors speak of "estimating" copy number by real-time PCR, and this is because the detection of a precise number of transgene depends on how well real-time PCR performs.This study was conducted to determine transgene copy number in transgenic wheat lines and to investigate potential variability in sensitivity and resolution of real-time chemistry by TaqMan probes. We have applied real-time PCR to a set of four transgenic durum wheat lines previously obtained. A total of 24 experiments (three experiments for two genes in each transgenic line) were conducted and standard curves were obtained from serial dilutions of the plasmids containing the genes of interest. The correlation coefficients ranged from 0.95 to 0.97. By using TaqMan quantitative real-time PCR we were able to detect 1 to 41 copies of transgenes per haploid genome in the DNA of homozygous T4 transformants. Although a slight variability was observed among PCR experiments, in our study we found real-time PCR to be a fast, sensitive and reliable method for the detection of transgene copy number in durum wheat, and a useful adjunct to Southern blot and FISH analyses to detect the presence of transgenic DNA in plant material.

  15. Overexpression of Ran gene from Lepidium latifolium L. (LlaRan) renders transgenic tobacco plants hypersensitive to cold stress.

    PubMed

    Sinha, Vimlendu Bhushan; Grover, Atul; Singh, Sadhana; Pande, Veena; Ahmed, Zakwan

    2014-09-01

    Ran is a multifunctional small GTPase involved in important cellular activities like nucleocytoplasmic transport, mitotic spindle assembly, nuclear envelope formation, etc., but is also known to be differentially expressed in response to abiotic stress, particularly low temperature. We have over-expressed Lepidium latifolium (Fam. Brassicaceae) Ran gene in tobacco to study the response of the plants to cold stress (24 h; 4 °C). Transformation of the tobacco plants was verified using PCR targeting Ran gene and co-transformed selectable marker gene nptII. Segregation in Mendelian ratios was validated in five transgenic lines by germination of T1 and T2 seeds on moist filter papers containing 150 mg/l kanamycin. Higher levels of electrolyte leakage and lipid peroxidation pointed towards hypersensitivity of plants. Similarly, lesser proline accumulation compared to wild types also indicated susceptibility of plants to death under chilling conditions. Specific activity of antioxidant enzymes superoxide dismutase and glutathione reductase was also measured under stressed and control conditions. A variation was observed across the different lines, and four out of five lines showed lesser specific activity compared to wild type plants, thus indicating reduced capability of scavenging free radicals. In totality, a strong evidence on induced hypersensitivity to cold stress has been collected which may further be helpful in designing appropriate strategies for engineering crop plants for survival under cold stress conditions.

  16. Generation of insulin-producing cells from C3H10T1/2 mesenchymal progenitor cells.

    PubMed

    Jian, Ruo-Lei; Mao, Li-Bin; Xu, Yao; Li, Xiao-Fan; Wang, Feng-Po; Luo, Xue-Gang; Zhou, Hao; He, Hong-Peng; Wang, Nan; Zhang, Tong-Cun

    2015-05-10

    Mesenchymal stem cells (MSCs) have been reported to be an attractive source for the generation of transplantable surrogate β cells. A murine embryonic mesenchymal progenitor cell line C3H10T1/2 has been recognized as a model for MSCs, because of its multi-lineage differentiation potential. The purpose of this study was to explore whether C3H/10T1/2 cells have the potential to differentiate into insulin-producing cells (IPCs). Here, we investigated and compared the in vitro differentiation of rat MSCs and C3H10T1/2 cells into IPCs. After the cells underwent IPC differentiation, the expression of differentiation markers were detected by immunocytochemistry, reverse transcription-polymerase chain reaction (RT-PCR), quantitative real-time RT-PCR (qRT-PCR) and Western blotting. The insulin secretion was evaluated by enzyme-linked immunosorbent assay (ELISA). Furthermore, these differentiated cells were transplanted into streptozotocin-induced diabetic mice and their biological functions were tested in vivo. This study reports a 2-stage method to generate IPCs from C3H10T1/2 cells. Under specific induction conditions for 7-8 days, C3H10T1/2 cells formed three-dimensional spheroid bodies (SBs) and secreted insulin, while generation of IPCs derived from rat MSCs required a long time (more than 2 weeks). Furthermore, these IPCs derived from C3H10T1/2 cells were injected into diabetic mice and improves basal glucose, body weight and exhibited normal glucose tolerance test. The present study provided a simple and faithful in vitro model for further investigating the mechanism underlying IPC differentiation of MSCs and cell replacement therapy for diabetes.

  17. Transgene × Environment Interactions in Genetically Modified Wheat

    PubMed Central

    Zeller, Simon L.; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard

    2010-01-01

    Background The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. Methods and Findings We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Conclusions Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology. PMID:20635001

  18. An increase in melatonin in transgenic rice causes pleiotropic phenotypes, including enhanced seedling growth, delayed flowering, and low grain yield.

    PubMed

    Byeon, Yeong; Back, Kyoungwhan

    2014-05-01

    No previous reports have described the effects of an increase in endogenous melatonin levels on plant yield and reproduction. Here, the phenotypes of melatonin-rich transgenic rice plants overexpressing sheep serotonin N-acetyltransferase were investigated under field conditions. Early seedling growth of melatonin-rich transgenic rice was greatly accelerated, with enhanced biomass relative to the wild type (WT). However, flowering was delayed by 1 wk in the transgenic lines compared with the WT. Grain yields of the melatonin-rich transgenic lines were reduced by 33% on average. Other phenotypes also varied among the transgenic lines. For example, the transgenic line S1 exhibited greater height and biomass than the WT, while the S10 transgenic line showed diminished height and an increase in panicle numbers per plant. The expression levels of Oryza sativa homeobox1 (OSH1) and TEOSINTE BRANCHED1 (TB1) genes, two key regulators of meristem initiation and maintenance, were not altered in the transgenic lines. These data demonstrate that an alteration of endogenous melatonin levels leads to pleiotropic effects such as height, biomass, panicle number, flowering time, and grain yield, indicating that melatonin behaves as a signaling molecule in plant growth and reproduction.

  19. [Transgenics without Manichaeism].

    PubMed

    Valle, S

    2000-01-01

    We live in an era characterized by the hegemony of science and technology, an era fraught with questions awaiting answers which would enable a safe and sustainable future for humankind. The development of agro-industrial processes - food products in particular - through recombinant DNA technology has enhanced the profit prospects of the few big biotechnology companies and of large-scale farmers who have access to the latest technological developments. We thus oppose a moratorium on recombinant DNA technology. Moreover, hasty statements about risk-free transgenics may be misleading in the absence of extensive safety tests. There is a pressing need for the establishment of biosafety policy in this country involving the organized civil society and every government agency responsible for monitoring such matters. There is also the need to put in place a bio-surveillance and a code of ethics regarding genetic manipulation.

  20. Post-mortem re-cloning of a transgenic red fluorescent protein dog.

    PubMed

    Hong, So Gun; Koo, Ok Jae; Oh, Hyun Ju; Park, Jung Eun; Kim, Minjung; Kim, Geon-A; Park, Eun Jung; Jang, Goo; Lee, Byeong-Chun

    2011-12-01

    Recently, the world's first transgenic dogs were produced by somatic cell nuclear transfer. However, cellular senescence is a major limiting factor for producing more advanced transgenic dogs. To overcome this obstacle, we rejuvenated transgenic cells using a re-cloning technique. Fibroblasts from post-mortem red fluorescent protein (RFP) dog were reconstructed with in vivo matured oocytes and transferred into 10 surrogate dogs. One puppy was produced and confirmed as a re-cloned dog. Although the puppy was lost during birth, we successfully established a rejuvenated fibroblast cell line from this animal. The cell line was found to stably express RFP and is ready for additional genetic modification.

  1. Enhanced leaf photosynthesis as a target to increase grain yield: insights from transgenic rice lines with variable Rieske FeS protein content in the cytochrome b6 /f complex.

    PubMed

    Yamori, Wataru; Kondo, Eri; Sugiura, Daisuke; Terashima, Ichiro; Suzuki, Yuji; Makino, Amane

    2016-01-01

    Although photosynthesis is the most important source for biomass and grain yield, a lack of correlation between photosynthesis and plant yield among different genotypes of various crop species has been frequently observed. Such observations contribute to the ongoing debate whether enhancing leaf photosynthesis can improve yield potential. Here, transgenic rice plants that contain variable amounts of the Rieske FeS protein in the cytochrome (cyt) b6 /f complex between 10 and 100% of wild-type levels have been used to investigate the effect of reductions of these proteins on photosynthesis, plant growth and yield. Reductions of the cyt b6 /f complex did not affect the electron transport rates through photosystem I but decreased electron transport rates through photosystem II, leading to concomitant decreases in CO2 assimilation rates. There was a strong control of plant growth and grain yield by the rate of leaf photosynthesis, leading to the conclusion that enhancing photosynthesis at the single-leaf level would be a useful target for improving crop productivity and yield both via conventional breeding and biotechnology. The data here also suggest that changing photosynthetic electron transport rates via manipulation of the cyt b6 /f complex could be a potential target for enhancing photosynthetic capacity in higher plants.

  2. Induction of apoptosis in the LNCaP human prostate carcinoma cell line and prostate adenocarcinomas of SV40T antigen transgenic rats by the Bowman-Birk inhibitor.

    PubMed

    Tang, MingXi; Asamoto, Makoto; Ogawa, Kumiko; Naiki-Ito, Aya; Sato, Shinya; Takahashi, Satoru; Shirai, Tomoyuki

    2009-11-01

    The soybean-derived serine protease inhibitor, Bowman-Birk inhibitor (BBI), has been reported as a potent chemoprevention agent against several types of tumors. The present study was undertaken to evaluate the effects of BBI on androgen-sensitive/dependent prostate cancers using a human prostate cancer cell (LNCaP) and the transgenic rats developing adenocarcinoma of the prostate (TRAP) model. Treatment of LNCaP prostate cancer cells with 500 microg/mL BBI resulted in inhibition of viability measured on WST-1 assays, with induction of connexin 43 (Cx43) and cleaved caspase-3 protein expression. Feeding of 3% roughly prepared BBI (BBIC) to TRAP from the age 3 weeks to 13 weeks resulted in significant reduction of the relative epithelial areas within the acinus and multiplicity of the adenocarcinomas in the lateral prostate lobes. Cx43- and terminal deoxynucleotidyl transferase mediated dUTP-biotin end labeling of fragmented DNA (TUNEL)-positive apoptotic cancer cells were more frequently observed in the lateral prostates treated with BBIC than in the controls. These in vivo and in vitro results suggest that BBI possesses chemopreventive activity associated with induction of Cx43 expression and apoptosis.

  3. RNA-Mediated Virus Resistance: Role of Repeated Transgenes and Delineation of Targeted Regions.

    PubMed Central

    Sijen, T.; Wellink, J.; Hiriart, J. B.; Van Kammen, A.

    1996-01-01

    Resistance to cowpea mosaic virus (CPMV) in transgenic Nicotiana benthamiana plants is RNA mediated. In resistant CPMV movement protein (MP) gene-transformed lines, transgene steady state mRNA levels were low, whereas nuclear transcription rates were high, implying that a post-transcriptional gene-silencing mechanism is at the base of the resistance. The silencing mechanism can also affect potato virus X (PVX) RNAs when they contain CPMV MP gene sequences. In particular, sequences situated in the 3[prime] part of the transcribed region of the MP transgene direct elimination of recombinant PVX genomes. Remarkably, successive portions of this 3[prime] part, which can be as small as 60 nucleotides, all tag PVX genomes for degradation. These observations suggest that the entire 3[prime] part of the MP transgene mRNA is the initial target of the silencing mechanism. The arrangement of transgenes in the plant genome plays an important role in establishing resistance because the frequency of resistant lines increased from 20 to 60% when transformed with a transgene containing a direct repeat of MP sequences rather than a single MP transgene. Interestingly, we detected strong methylation in all of the plants containing directly repeated MP sequences. In sensitive lines, only the promoter region was found to be heavily methylated, whereas in resistant lines, only the transcribed region was strongly methylated. PMID:12239378

  4. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    SciTech Connect

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-08-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expression supports that cells utilize the PiT1 levels to control proliferation, with non-proliferating cells showing the lowest PiT1 mRNA levels. The mechanism behind the role of PiT1 in increased cell proliferation is not known. We, however, found that compared to control cells, cultures of NIH3T3 cells overexpressing PiT1 upon seeding showed increased cell number after 24 h and had shifted more cells from G0/G1 to S+G2/M within 12 h, suggesting that an early event may play a role. We here show that expression of human PiT1 in NIH3T3 cells led to faster cell adhesion; this effect was not cell type specific in that it was also observed when expressing human PiT1 in MC3T3-E1 cells. We also show for NIH3T3 that PiT1 overexpression led to faster cell spreading. The final total numbers of attached cells did, however, not differ between cultures of PiT1 overexpressing cells and control cells of neither cell type. We suggest that the PiT1-mediated fast adhesion potentials allow the cells to go faster out of G0/G1 and thereby contribute to their proliferative advantage within the first 24 h after seeding. - Highlights: • Effects of elevated levels of the inorganic phosphate transporter PiT1 were studied. • The density-inhibited murine cell lines NIH3T3 and MC3T3-E1 showed faster adhesion. • NIH3T3 cells showed faster spreading. • We suggest that the faster adhesion/spreading contributes to faster proliferation.

  5. Development of transgenic animals for optogenetic manipulation of mammalian nervous system function: progress and prospects for behavioral neuroscience.

    PubMed

    Ting, Jonathan T; Feng, Guoping

    2013-10-15

    Here we review the rapidly growing toolbox of transgenic mice and rats that exhibit functional expression of engineered opsins for neuronal activation and silencing with light. Collectively, these transgenic animals are enabling neuroscientists to access and manipulate the many diverse cell types in the mammalian nervous system in order to probe synaptic and circuitry connectivity, function, and dysfunction. The availability of transgenic lines affords important advantages such as stable and heritable transgene expression patterns across experimental cohorts. As such, the use of transgenic lines precludes the need for other costly and labor-intensive procedures to achieve functional transgene expression in each individual experimental animal. This represents an important consideration when large cohorts of experimental animals are desirable as in many common behavioral assays. We describe the diverse strategies that have been implemented for developing transgenic mouse and rat lines and highlight recent advances that have led to dramatic improvements in achieving functional transgene expression of engineered opsins. Furthermore, we discuss considerations and caveats associated with implementing recently developed transgenic lines for optogenetics-based experimentation. Lastly, we propose strategies that can be implemented to develop and refine the next generation of genetically modified animals for behaviorally-focused optogenetics-based applications.

  6. Perspectives on the state of insect transgenics.

    PubMed

    O'Brochta, David A; Handler, Alfred M

    2008-01-01

    Genetic transformation is a critical component to the fundamental genetic analysis of insect species and holds great promise for establishing strains that improve population control and behavior for practical application. This is especially so for insects that are disease vectors, many of which are currently subject to genomic sequence analysis, and intensive population control measures that must be improved for better efficacy and cost-effectiveness. Transposon-mediated germ-line transformation has been the ultimate goal for most fundamental and practical studies, and impressive strides have been made in recent development of transgene vector and marker systems for several mosquito species. This has resulted in rapid advances in functional genomic sequence analysis and new strategies for biological control based on conditional lethality. Importantly, advances have also been made in our ability to use these systems more effectively in terms of enhanced stability and targeting to specific genomic loci. Nevertheless, not all insects are currently amenable to germ-line transformation techniques, and thus advances in transient somatic expression and paratransgenesis have also been critical, if not preferable for some applications. Of particular importance is how this technology will be used for practical application. Early ideas for population replacement of indigenous pests with innocuous transgenic siblings by transposon-vector spread, may require reevaluation in terms of our current knowledge of the behavior of transposons currently available for transformation. The effective implementation of any control program using released transgenics, will also benefit from broadening the perspective of these control measures as being more mainstream than exotic.

  7. Enhanced UV-induced skin carcinogenesis in transgenic mice overexpressing proprotein convertases.

    PubMed

    Fu, Jian; Bassi, Daniel E; Zhang, Jirong; Li, Tianyu; Cai, Kathy Q; Testa, Courtney Lyons; Nicolas, Emmanuelle; Klein-Szanto, Andres J

    2013-02-01

    The proprotein convertases (PCs) furin and PACE4 process numerous substrates involved in tumor growth, invasion, and metastasis. We have previously shown that PCs increase the susceptibility to chemical skin carcinogenesis. Because of the human relevancy of UV radiation in the etiopathogenesis of human skin cancer, we investigated whether or not transgenic mice overexpressing either furin alone or both furin and PACE4 show increased susceptibility to UV carcinogenesis. After backcrossing our previously described furin and PACE4 transgenic lines, targeted to the epidermis, into a SKH-1 background, we exposed both single and double transgenic mice to UV radiation for 34 weeks. The results showed an increase in squamous cell carcinoma (SCC) multiplicity of approximately 70% in the single furin transgenic mouse line SF47 (P < .002) and a 30% increase in the other single transgenic line SF49 when compared to wild-type (WT) SKH-1 mice. Interestingly, there was also an increase in the percentage of high histologic grade SCCs in the transgenic lines compared to the WT mice, i.e., WT = 9%, SF47 = 15%, and SF49 = 26% (P < .02). Targeting both furin and PACE4 to the epidermis in double transgenic mice did not have an additive effect on tumor incidence/multiplicity but did enhance the tumor histopathologic grade, i.e., a significant increase in higher grade SCCs was seen in the bigenic mouse line SPF47 (P < .02). Thus, we observed an increased susceptibility to UV in single furin transgenic mice that was not substantially enhanced in the double furin/PACE4 transgenic mice.

  8. The interplay of T1- and T2-relaxation on T1-weighted MRI of hMSCs induced by Gd-DOTA-peptides.

    PubMed

    Cao, Limin; Li, Binbin; Yi, Peiwei; Zhang, Hailu; Dai, Jianwu; Tan, Bo; Deng, Zongwu

    2014-04-01

    Three Gd-DOTA-peptide complexes with different peptide sequence are synthesized and used as T1 contrast agent to label human mesenchymal stem cells (hMSCs) for magnetic resonance imaging study. The peptides include a universal cell penetrating peptide TAT, a linear MSC-specific peptide EM7, and a cyclic MSC-specific peptide CC9. A significant difference in labeling efficacy is observed between the Gd-DOTA-peptides as well as a control Dotarem. All Gd-DOTA-peptides as well as Dotarem induce significant increase in T1 relaxation rate which is in favor of T1-weighted MR imaging. Gd-DOTA-CC9 yields the maximum labeling efficacy but poor T1 contrast enhancement. Gd-DOTA-EM7 yields the minimum labeling efficacy but better T1 contrast enhancement. Gd-DOTA-TAT yields a similar labeling efficacy as Gd-DOTA-CC9 and similar T1 contrast enhancement as Gd-DOTA-EM7. The underlying mechanism that governs T1 contrast enhancement effect is discussed. Our results suggest that T1 contrast enhancement induced by Gd-DOTA-peptides depends not only on the introduced cellular Gd content, but more importantly on the effect that Gd-DOTA-peptides exert on the T1-relaxation and T2-relaxation processes/rates. Both T1 and particularly T2 relaxation rate have to be taken into account to interpret T1 contrast enhancement. In addition, the interpretation has to be based on cellular instead of aqueous longitudinal and transverse relaxivities of Gd-DOTA-peptides.

  9. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion.

  10. Transgenic maize plants by tissue electroporation.

    PubMed Central

    D'Halluin, K; Bonne, E; Bossut, M; De Beuckeleer, M; Leemans, J

    1992-01-01

    In this paper, we describe the transformation of regenerable maize tissues by electroporation. In many maize lines, immature zygotic embryos can give rise to embryogenic callus cultures from which plants can be regenerated. Immature zygotic embryos or embryogenic type I calli were wounded either enzymatically or mechanically and subsequently electroporated with a chimeric gene encoding neomycin phosphotransferase (neo). Transformed embryogenic calli were selected from electroporated tissues on kanamycin-containing media and fertile transgenic maize plants were regenerated. The neo gene was transmitted to the progeny of kanamycin-resistant transformants in a Mendelian fashion. This showed that all transformants were nonchimeric, suggesting that transformation and regeneration are a single-cell event. The maize transformation procedure presented here does not require the establishment of genotype-dependent embryogenic type II callus or cell suspension cultures and facilitates the engineering of new traits into agronomically relevant maize inbred lines. PMID:1334743

  11. Somatic generation of hybrid antibody H chain genes in transgenic mice via interchromosomal gene conversion

    PubMed Central

    1994-01-01

    We have constructed lines of mice with transgenes containing an antibody heavy (H) chain variable region (VHDJH) gene and various amounts of natural immunoglobulin (Ig) and plasmid flanking DNA. In these lines, recombination of the transgene and the endogenous Igh locus takes place in B cells, leading to the expression of functional H chains partially encoded by the transgenic VHDJH gene. Here, we demonstrate that the transgenic VHDJH gene, and various amounts of flanking sequence are recombined with Igh locus DNA via interchromosomal gene conversion. The structures of the resulting "hybrid" transgene-Igh H chain loci are consistent with the 3' end of the conversion occurring in regions of sequence identity, and the 5' end taking place between regions of little or no homology. This mode of antibody transgene recombination with the Igh locus is fundamentally different from the previously reported "trans H chain class switching" that results in reciprocal translocations. In contrast, this recombination resembles events previously observed in mammalian tissue culture cells between adjacent homologous chromosomal sequences, or transfected DNA and a homologous chromosomal target. Our data indicate that this recombination takes place at a low frequency, and that the frequency is influenced by both the length and extent of homology between the transgene and the Igh locus, but is not greatly affected by transgene copy number. This recombination pathway provides a novel approach for the subtle alteration of the clonal composition of the mouse B cell compartment in vivo using VH genes with defined structures and functions. PMID:8270869

  12. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

    PubMed Central

    2014-01-01

    Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred

  13. Comparison between volatile emissions from transgenic apples and from two representative classically bred apple cultivars.

    PubMed

    Vogler, Ute; Rott, Anja S; Gessler, Cesare; Dorn, Silvia

    2010-02-01

    While most risk assessments contrast a transgenic resistant to its isogenic line, an additional comparison between the transgenic line and a classically bred cultivar with the same resistance gene would be highly desirable. Our approach was to compare headspace volatiles of transgenic scab resistant apple plants with two representative cultivars (the isogenic 'Gala' and the scab resistance gene-containing 'Florina'). As modifications in volatile profiles have been shown to alter plant relationships with non-target insects, we analysed headspace volatiles from apple plants subjected to different infection types by gas chromatography-mass spectrometry. Marked differences were found between healthy and leafminer (Phyllonorycter blancardella) infested genotypes, where emissions between the transgenic scab resistant line and the two cultivars differed quantitatively in four terpenes and an aromatic compound. However, these modified odour emissions were in the range of variability of the emissions recorded for the two standard cultivars that proved to be crucial references.

  14. An improved prognostic model for stage T1a and T1b prostate cancer by assessments of cancer extent

    PubMed Central

    Rajab, Ramzi; Fisher, Gabrielle; Kattan, Michael W; Foster, Christopher S; Møller, Henrik; Oliver, Tim; Reuter, Victor; Scardino, Peter T; Cuzick, Jack; Berney, Daniel M

    2013-01-01

    Treatment decisions on prostate cancer diagnosed by trans-urethral resection (TURP) of the prostate are difficult. The current TNM staging system for pT1 prostate cancer has not been re-evaluated for 25 years. Our objective was to optimise the predictive power of tumor extent measurements in TURP of the prostate specimens. A total of 914 patients diagnosed by TURP of the prostate between 1990 and 1996, managed conservatively were identified. The clinical end point was death from prostate cancer. Diagnostic serum prostate-specific antigen (PSA) and contemporary Gleason grading was available. Cancer extent was measured by the percentage of chips infiltrated by cancer. Death rates were compared by univariate and multivariate proportional hazards models, including baseline PSA and Gleason score. The percentage of positive chips was highly predictive of prostate cancer death when assessed as a continuous variable or as a grouped variable on the basis of and including the quintiles, quartiles, tertiles and median groups. In the univariate model, the most informative variable was a four group-split (≤ 10%, >10–25%, > 25–75% and > 75%); (HR = 2.08, 95% CI = 1.8–2.4, P < 0.0001). The same was true in a multivariate model (ΔX2 (1 d.f.) = 15.0, P = 0.0001). The current cutoff used by TNM (< = 5%) was sub-optimal (ΔX2 (1 d.f.) = 4.8, P = 0.023). The current TNM staging results in substantial loss of information. Staging by a four-group subdivision would substantially improve prognostication in patients with early stage disease and also may help to refine management decisions in patients who would do well with conservative treatments. PMID:20834240

  15. Taste information derived from T1R-expressing taste cells in mice.

    PubMed

    Yoshida, Ryusuke; Ninomiya, Yuzo

    2016-03-01

    The taste system of animals is used to detect valuable nutrients and harmful compounds in foods. In humans and mice, sweet, bitter, salty, sour and umami tastes are considered the five basic taste qualities. Sweet and umami tastes are mediated by G-protein-coupled receptors, belonging to the T1R (taste receptor type 1) family. This family consists of three members (T1R1, T1R2 and T1R3). They function as sweet or umami taste receptors by forming heterodimeric complexes, T1R1+T1R3 (umami) or T1R2+T1R3 (sweet). Receptors for each of the basic tastes are thought to be expressed exclusively in taste bud cells. Sweet (T1R2+T1R3-expressing) taste cells were thought to be segregated from umami (T1R1+T1R3-expressing) taste cells in taste buds. However, recent studies have revealed that a significant portion of taste cells in mice expressed all T1R subunits and responded to both sweet and umami compounds. This suggests that sweet and umami taste cells may not be segregated. Mice are able to discriminate between sweet and umami tastes, and both tastes contribute to behavioural preferences for sweet or umami compounds. There is growing evidence that T1R3 is also involved in behavioural avoidance of calcium tastes in mice, which implies that there may be a further population of T1R-expressing taste cells that mediate aversion to calcium taste. Therefore the simple view of detection and segregation of sweet and umami tastes by T1R-expressing taste cells, in mice, is now open to re-examination.

  16. [Development of a hepatitis B virus carrier transgenic mice model].

    PubMed

    Caner, Müge; Arat, Sezen; Bircan, Rifat

    2008-01-01

    The studies for the development of transgenic mice models which provide important profits for the studies concerning immunopathogenesis of hepatitis B virus (HBV) infections are in progress since 20 years. For this purpose different lineages bearing whole HBV genome or selected viral genes have been developed and their usage in clarifying the HBV replication and pathogenesis mechanisms have been emphasized. The aim of this study was to develop and breed a HBV carrier mice model. In the study the full HBV genome has been transferred to mouse embryos by microinjection procedure. Following transgenic manipulation, the HBV carriers among the daughter mice have been detected by molecular methods in which HBV-DNA replication and expression have been shown. The manipulations for transgene transfers have been performed in TUBITAK Marmara Research Center Transgene Laboratory, Gebze, Istanbul. The HBV-DNA carrier mice have been demonstrated by polymerase chain reaction (PCR) using the DNA samples obtained from tail tissues and also by dot-blot hybridization of the mice sera. Integrated HBV-DNA has been detected by applying in-situ hybridization to the liver tissue sections. HBV-DNA expression has been shown by reverse transcriptase PCR method with total RNA molecules that have been isolated from the liver tissues of the HBV-DNA carrier mice. HBsAg has been detected in the liver by immunohistochemical method, and HBsAg and HBeAg have additionally been demonstrated by ELISA. HBV genome, expression of the genome and the expression products have been determined in approximately 10% of the mice of which HBV-DNA have been transferred. By inbreeding heterozygote carrier mice, homozygote HBV transgenic mice line have been obtained. These HBV transgenic mice are the first lineages developed in our country. It is hopefully thought that this HBV carrier transgenic mouse model may contribute to the studies on the pathogenesis of HBV infections which are important health problems in the

  17. Quantitative T1 mapping under precisely controlled graded hyperoxia at 7T.

    PubMed

    Bhogal, Alex A; Siero, Jeroen Cw; Zwanenburg, Jaco; Luijten, Peter R; Philippens, Marielle Ep; Hoogduin, Hans

    2017-04-01

    Increasing the concentration of oxygen dissolved in water is known to increase the recovery rate (R1 = 1/T1) of longitudinal magnetization (T1 relaxation). Direct T1 changes in response to precise hyperoxic gas challenges have not yet been quantified and the actual effect of increasing arterial oxygen concentration on the T1 of brain parenchyma remains unclear. The aim of this work was to use quantitative T1 mapping to measure tissue T1 changes in response to precisely targeted hyperoxic respiratory challenges ranging from baseline end-tidal oxygen (PetO2) to approximately 500 mmHg. We did not observe measureable T1 changes in either gray matter or white matter parenchymal tissue. The T1 of peripheral cerebrospinal fluid located within the sulci, however, was reduced as a function of PetO2. No significant T1 changes were observed in the ventricular cerebrospinal fluid under hyperoxia. Our results indicate that care should be taken to distinguish actual T1 changes from those which may be related to partial volume effects with cerebrospinal fluid, or regions with increased fluid content such as edema when examining hyperoxia-induced changes in T1 using methods based on T1-weighted imaging.

  18. Elevated production of melatonin in transgenic rice seeds expressing rice tryptophan decarboxylase.

    PubMed

    Byeon, Yeong; Park, Sangkyu; Lee, Hyoung Yool; Kim, Young-Soon; Back, Kyoungwhan

    2014-04-01

    A major goal of plant biotechnology is to improve the nutritional qualities of crop plants through metabolic engineering. Melatonin is a well-known bioactive molecule with an array of health-promoting properties, including potent antioxidant capability. To generate melatonin-rich rice plants, we first independently overexpressed three tryptophan decarboxylase isogenes in the rice genome. Melatonin levels were altered in the transgenic lines through overexpression of TDC1, TDC2, and TDC3; TDC3 transgenic seed (TDC3-1) had melatonin concentrations 31-fold higher than those of wild-type seeds. In TDC3 transgenic seedlings, however, only a doubling of melatonin content occurred over wild-type levels. Thus, a seed-specific accumulation of melatonin appears to occur in TDC3 transgenic lines. In addition to increased melatonin content, TDC3 transgenic lines also had enhanced levels of melatonin intermediates including 5-hydroxytryptophan, tryptamine, serotonin, and N-acetylserotonin. In contrast, expression levels of melatonin biosynthetic mRNA did not increase in TDC3 transgenic lines, indicating that increases in melatonin and its intermediates in these lines are attributable exclusively to overexpression of the TDC3 gene.

  19. High blood pressure in transgenic mice carrying the rat angiotensinogen gene.

    PubMed Central

    Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M

    1992-01-01

    Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785

  20. Bioaccessibility of carotenoids from transgenic provitamin A biofortified sorghum.

    PubMed

    Lipkie, Tristan E; De Moura, Fabiana F; Zhao, Zuo-Yu; Albertsen, Marc C; Che, Ping; Glassman, Kimberly; Ferruzzi, Mario G

    2013-06-19

    Biofortified sorghum (Sorghum bicolor (L.) Moench) lines are being developed to target vitamin A deficiency in Sub-Saharan Africa, but the delivery of provitamin A carotenoids from such diverse germplasms has not been evaluated. The purpose of this study was to screen vectors and independent transgenic events for the bioaccessibility of provitamin A carotenoids using an in vitro digestion model. The germplasm background and transgenic sorghum contained 1.0-1.5 and 3.3-14.0 μg/g β-carotene equivalents on a dry weight basis (DW), respectively. Test porridges made from milled transgenic sorghum contained up to 250 μg of β-carotene equivalents per 100 g of porridge on a fresh weight basis (FW). Micellarization efficiency of all-trans-β-carotene was lower (p < 0.05) from transgenic sorghum (1-5%) than from null/nontransgenic sorghum (6-11%) but not different between vector constructs. Carotenoid bioaccessibility was significantly improved (p < 0.05) by increasing the amount of coformulated lipid in test porridges from 5% w/w to 10% w/w. Transgenic sorghum event Homo188-A contained the greatest bioaccessible β-carotene content, with a 4-8-fold increase from null/nontransgenic sorghum. While the bioavailability and bioconversion of provitamin A carotenoids from these grains must be confirmed in vivo, these data support the notion that biofortification of sorghum can enhance total and bioaccessible provitamin A carotenoid levels.

  1. Design rules for efficient transgene expression in plants.

    PubMed

    Jackson, Mark A; Sternes, Peter R; Mudge, Stephen R; Graham, Michael W; Birch, Robert G

    2014-09-01

    Sustained expression of transgenes in specified developmental patterns is commonly needed in plant biotechnology, but obstructed by transgene silencing. Here, we present a set of gene design rules, tested on the silencing-susceptible beetle luc and bacterial ims genes, expressed in sugarcane. Designs tested independently or in combination included removal of rare codons, removal of RNA instability sequences, blocking of likely endogenous sRNA binding sites and randomization of non-rare codons. Stable transgene expression analyses, on multiple independent lines per construct, showed greatest improvement from the removal of RNA instability sequences, accompanied by greatly reduced transcript degradation evident in northern blot analysis. We provide a set of motifs that readily can be eliminated concurrently with rare codons and undesired structural features such as repeat sequences, using Gene Designer 2.0 software. These design rules yielded 935- and 5-fold increased expression in transgenic callus, relative to the native luc and ims sequences; and gave sustained expression under the control of sugarcane and heterologous promoters over several years in greenhouse and field trials. The rules can be applied easily with codon usage tables from any plant species, providing a simple and effective means to achieve sustained expression of otherwise silencing-prone transgenes in plants.

  2. Transgenic plants for phytoremediation.

    PubMed

    Maestri, Elena; Marmiroli, Nelson

    2011-01-01

    Phytoremediation is a green, sustainable and promising solution to problems of environmental contamination. It entails the use of plants for uptake, sequestration, detoxification or volatilization of inorganic and organic pollutants from soils, water, sediments and possibly air. Phytoremediation was born from the observation that plants possessed physiological properties useful for environmental remediation. This was shortly followed by the application of breeding techniques and artificial selection to genetically improve some of the more promising and interesting species. Now, after nearly 20 years of research, transgenic plants for phytoremediation have been produced, but none have reached commercial existence. Three main approaches have been developed: (1) transformation with genes from other organisms (mammals, bacteria, etc.); (2) transformation with genes from other plant species; and (3) overexpression of genes from the same plant species. Many encouraging results have been reported, even though in some instances results have been contrary to expectations. This review will illustrate the main examples with a critical discussion of what we have learnt from them.

  3. Native T1 Mapping Demonstrating Apical Thrombi in Eosinophilic Myocarditis Associated with Churg-Strauss Syndrome

    PubMed Central

    Beck, Kyongmin Sarah; Jeong, Soh Yong; Lee, Kyo Young; Chang, Kiyuk

    2016-01-01

    Eosinophilic myocarditis is a disease characterized by eosinophilic infiltration of the myocardium, consisting of acute necrotic stage, thrombotic stage, and fibrotic stage. Although T1 mapping has been increasingly used in various cardiac pathologies, there has been no report of T1 mapping in eosinophilic myocarditis. We report a case of 75-year-old female with eosinophilic myocarditis, whose cardiac magnetic resonance imaging included native T1 mapping, in which apical thrombi were distinctly seen as areas with decreased T1 values, next to areas of inflammation seen as increased T1 value in subendocardium. PMID:27826352

  4. Reproducibility and comparison of oxygen-enhanced T1 quantification in COPD and asthma patients

    PubMed Central

    Jobst, Bertram J.; Anjorin, Angela; Sedlaczek, Oliver; Wolf, Ursula; Terekhov, Maxim; Hoffmann, Christian; Ley, Sebastian; Düber, Christoph; Biederer, Jürgen; Kauczor, Hans-Ulrich; Jakob, Peter M.; Wielpütz, Mark O.

    2017-01-01

    T1 maps have been shown to yield useful diagnostic information on lung function in patients with chronic obstructive pulmonary disease (COPD) and asthma, both for native T1 and ΔT1, the relative reduction while breathing pure oxygen. As parameter quantification is particularly interesting for longitudinal studies, the purpose of this work was both to examine the reproducibility of lung T1 mapping and to compare T1 found in COPD and asthma patients using IRSnapShotFLASH embedded in a full MRI protocol. 12 asthma and 12 COPD patients (site 1) and further 15 COPD patients (site 2) were examined on two consecutive days. In each patient, T1 maps were acquired in 8 single breath-hold slices, breathing first room air, then pure oxygen. Maps were partitioned into 12 regions each to calculate average values. In asthma patients, the average T1,RA = 1206ms (room air) was reduced to T1,O2 = 1141ms under oxygen conditions (ΔT1 = 5.3%, p < 5⋅10−4), while in COPD patients both native T1,RA = 1125ms was significantly shorter (p < 10−3) and the relative reduction to T1,O2 = 1081ms on average ΔT1 = 4.2%(p < 10−5). On the second day, with T1,RA = 1186ms in asthma and T1,RA = 1097ms in COPD, observed values were slightly shorter on average in all patient groups. ΔT1 reduction was the least repeatable parameter and varied from day to day by up to 23% in individual asthma and 30% in COPD patients. While for both patient groups T1 was below the values reported for healthy subjects, the T1 and ΔT1 found in asthmatics lies between that of the COPD group and reported values for healthy subjects, suggesting a higher blood volume fraction and better ventilation. However, it could be demonstrated that lung T1 quantification is subject to notable inter-examination variability, which here can be attributed both to remaining contrast agent from the previous day and the increased dependency of lung T1 on perfusion and thus current lung state. PMID:28207845

  5. The Organic Composition of Comet C/1999 T1 (McNaught-Hartley)

    NASA Astrophysics Data System (ADS)

    DiSanti, M. A.; Mumma, M. J.; Dello Russo, N.; Magee-Sauer, K.; Novak, R.

    2001-11-01

    The volatile organic composition of the long-period comet C/1999 T1 (McNaught-Hartley) was studied at infrared wavelengths on several dates post-perihelion using CSHELL at the IRTF and NIRSPEC at Keck 2. The heliocentric distance varied from R= 1.27 AU on UT 2001 January 13 to 1.71 AU on March 05. High-resolution spectra were obtained (lambda / Delta-lambda 15,000 - 20,000), revealing emissions from water, carbon monoxide, ethane, methane, methanol, and hydrogen cyanide, as well as OH prompt emission. Preliminary results indicate a substantial CO mixing ratio (CO:H2O = 0.15 - 0.20). Owing to the relatively small nod distance between A and B beams ( 12 - 15 arc-seconds along slit), this is primarily a measure of the native CO production rate. This CO abundance is similar to the native CO mixing ratio we find for C/1996 B2 (Hyakutake), and somewhat higher than that measured for C/1995 O1 (Hale-Bopp), 0.12. It is substantially higher than that measured for 3 other Oort Cloud comets contained in our sample (C/1999 H1 Lee, C/1999 S4 Linear, and C/2001 A2 Linear), for which CO:H2O was a few percent or less. Mixing ratios measured for other species in C/1999 T1 were more closely in line with those found in the other comets sampled. A summary of production rates, and implications for the formation of C/McNaught-Hartley will be presented. This work was supported by the NASA Planetary Astronomy Program through Grants NAG5-7905 and RTOP 344-32-30-07.

  6. Clinical implications of proliferation activity in T1 or T2 male gastric cancer patients.

    PubMed

    Kim, Young-Woo; Eom, Bang Wool; Kook, Myeong-Cherl; Kim, Han-Seong; Kim, Mi-Kyung; Hwang, Hai-Li; Chandra, Vishal; Poojan, Shiv; Song, Yura; Koh, Jae-Soo; Bae, Chang-Dae; Ro, Jungsil; Hong, Kyeong-Man

    2015-11-06

    Proliferation activity has already been established as a prognostic marker or as a marker for anticancer drug sensitivity. In gastric cancer, however, the prognostic significance of proliferation activity is still being debated. Several studies evaluating proliferation activity using Ki-67 have shown controversial results in terms of the relationship between proliferation activity and overall survival (OS) or drug sensitivity in gastric cancer patients. Because cytoskeleton-associated protein 2 (CKAP2) staining has recently been introduced as a marker of proliferation activity, we analyzed 437 gastric cancer tissues through CKAP2 immunohistochemistry, and we evaluated the chromatin CKAP2-positive cell count (CPCC) for proliferation activity. Although the CPCC did not show any significant correlation with OS in the male, female or total number of cases, it did show a significant correlation in the T1 or T2 male patient subgroup, according to log-rank tests (P=0.001) and univariate analysis (P=0.045). Additionally, multivariate analysis with the Cox proportional hazard regression model showed a significant correlation between the CPCC and OS (P=0.039) for the co-variables of age, gender, T stage, N stage, histology, tumor location, tumor size and adjuvant chemotherapy. In male gastric cancer cell lines, faster-growing cancer cells showed higher sensitivity to cisplatin than slow-growing cells. Thus our study indicates that CPCC-measured proliferation activity demonstrates a significantly worse prognosis in T1 or T2 male gastric cancer patients. The CPCC will help to more precisely classify gastric cancer patients and to select excellent candidates for adjuvant chemotherapy, which in turn will facilitate further clinical chemotherapeutic trials.

  7. Position independent expression and developmental regulation is directed by the beta myosin heavy chain gene's 5' upstream region in transgenic mice.

    PubMed

    Knotts, S; Rindt, H; Robbins, J

    1995-08-25

    Transgenic mice generated with constructs containing 5.6 kb of the beta myosin heavy chain (MyHC) gene's 5' flanking region linked to the cat reporter gene express the transgene at high levels. In all 47 lines analyzed, tissue-specific accumulation of chloramphenicol acetyltransferase was found at levels proportional to the number of integrated transgene copies. Deletion constructs containing only 0.6 kb of 5' upstream region showed position effects in transgenic mice and did not demonstrate copy number dependence although transgene expression remained muscle-specific. The 5.6 kb 5' upstream region conferred appropriate developmental control of the transgene to the cardiac compartment and directs copy number dependent and position independent expression. Lines generated with a construct in which three proximal cis-acting elements were mutated showed reduced levels of transgene expression, but all maintained their position independence and copy number dependence, suggesting the presence of distinct regulatory mechanisms.

  8. Position independent expression and developmental regulation is directed by the beta myosin heavy chain gene's 5' upstream region in transgenic mice.

    PubMed Central

    Knotts, S; Rindt, H; Robbins, J

    1995-01-01

    Transgenic mice generated with constructs containing 5.6 kb of the beta myosin heavy chain (MyHC) gene's 5' flanking region linked to the cat reporter gene express the transgene at high levels. In all 47 lines analyzed, tissue-specific accumulation of chloramphenicol acetyltransferase was found at levels proportional to the number of integrated transgene copies. Deletion constructs containing only 0.6 kb of 5' upstream region showed position effects in transgenic mice and did not demonstrate copy number dependence although transgene expression remained muscle-specific. The 5.6 kb 5' upstream region conferred appropriate developmental control of the transgene to the cardiac compartment and directs copy number dependent and position independent expression. Lines generated with a construct in which three proximal cis-acting elements were mutated showed reduced levels of transgene expression, but all maintained their position independence and copy number dependence, suggesting the presence of distinct regulatory mechanisms. Images PMID:7667107

  9. Expression pattern in retinal photoreceptors of POMGnT1, a protein involved in muscle-eye-brain disease

    PubMed Central

    Uribe, Mary Luz; Haro, Carmen; Campello, Laura; Cruces, Jesús; Martín-Nieto, José

    2016-01-01

    Purpose The POMGNT1 gene, encoding protein O-linked-mannose β-1,2-N-acetylglucosaminyltransferase 1, is associated with muscle-eye-brain disease (MEB) and other dystroglycanopathies. This gene’s lack of function or expression causes hypoglycosylation of α-dystroglycan (α-DG) in the muscle and the central nervous system, including the brain and the retina. The ocular symptoms of patients with MEB include retinal degeneration and detachment, glaucoma, and abnormal electroretinogram. Nevertheless, the POMGnT1 expression pattern in the healthy mammalian retina has not yet been investigated. In this work, we address the expression of the POMGNT1 gene in the healthy retina of a variety of mammals and characterize the distribution pattern of this gene in the adult mouse retina and the 661W photoreceptor cell line. Methods Using reverse transcription (RT)–PCR and immunoblotting, we studied POMGNT1 expression at the mRNA and protein levels in various mammalian species, from rodents to humans. Immunofluorescence confocal microscopy analyses were performed to characterize the distribution profile of its protein product in mouse retinal sections and in 661W cultured cells. The intranuclear distribution of POMT1 and POMT2, the two enzymes preceding POMGnT1 in the α-DG O-mannosyl glycosylation pathway, was also analyzed. Results POMGNT1 mRNA and its encoded protein were expressed in the neural retina of all mammals studied. POMGnT1 was located in the cytoplasmic fraction in the mouse retina and concentrated in the myoid portion of the photoreceptor inner segments, where the protein colocalized with GM130, a Golgi complex marker. The presence of POMGnT1 in the Golgi complex was also evident in 661W cells. However, and in contrast to retinal tissue, POMGnT1 additionally accumulated in the nucleus of the 661W photoreceptors. Colocalization was found within this organelle between POMGnT1 and POMT1/2, the latter associated with euchromatic regions of the nucleus. Conclusions

  10. Ultra-low field T1 vs. T1rho at 3T and 7T: study of rotationally immobilized protein gels and animal brain tissues

    NASA Astrophysics Data System (ADS)

    Dong, Hui; Inglis, Ben; Barr, Ian; Clarke, John

    2015-03-01

    Clinical magnetic resonance imaging (MRI) machines operating in static fields of typically 1.5 T or 3 T can capture information on slow molecular dynamics utilizing the so-called T1rho technique. This technique, in which a radiofrequency (RF) spin-lock field is applied with microtesla amplitude, has been used, for example, to determine the onset time of stroke in studies on rats. The long RF pulse, however, may exceed the specific absorption rate (SAR) limit, putting subjects at risk. Ultra-low-field (ULF) MRI, based on Superconducting Quantum Interference Devices (SQUIDs), directly detects proton signals at a static magnetic field of typically 50-250 μT. Using our ULF MRI system with adjustable static field of typically 55 to 240 μT, we systematically measured the T1 and T2 dispersion profiles of rotationally immobilized protein gels (bovine serum albumin), ex vivo pig brains, and ex vivo rat brains with induced stroke. Comparing the ULF results with T1rho dispersion obtained at 3 T and 7 T, we find that the degree of protein immobilization determines the frequency-dependence of both T1 and T1rho. Furthermore, T1rho and ULF T1 show similar results for stroke, suggesting that ULF MRI may be used to image traumatic brain injury with negligible SAR. This research was supported by the Henry H. Wheeler, Jr. Brain Imaging Center and the Donaldson Trust.

  11. Quantifying Temperature-Dependent T1 Changes in Cortical Bone Using Ultrashort Echo-Time MRI

    PubMed Central

    Han, Misung; Rieke, Viola; Scott, Serena J; Ozhinsky, Eugene; Salgaonkar, Vasant A; Jones, Peter D; Larson, Peder E Z; Diederich, Chris J; Krug, Roland

    2015-01-01

    Purpose To demonstrate the feasibility of using ultrashort echo-time (UTE) MRI to quantify T1 changes in cortical bone due to heating. Methods Variable flip-angle T1 mapping combined with 3D UTE imaging was used to measure T1 in cortical bone. A calibration experiment was performed to detect T1 changes with temperature in ex vivo cortical bone samples from a bovine femur. Ultrasound heating experiments were performed using an interstitial applicator in ex vivo bovine femur specimens, and heat-induced T1 changes were quantified. Results The calibration experiment demonstrated that T1 increases with temperature in cortical bone. We observed a linear relationship between temperature and T1 with a linear coefficient of 0.67–0.84 ms/°C over a range of 25–70°C. The ultrasound heating experiments showed increased T1 changes in the heated regions, and the relationship between the temperature changes and T1 changes was similar to that of the calibration. Conclusion We demonstrated a temperature dependence of T1 in ex vivo cortical bone using a variable flip-angle UTE T1 mapping method. PMID:26390357

  12. T1ρ magnetic resonance: basic physics principles and applications in knee and intervertebral disc imaging

    PubMed Central

    Zhang, Qinwei; Li, Xiaojuan; Chen, Weitian; Ahuja, Anil; Yuan, Jing

    2015-01-01

    T1ρ relaxation time provides a new contrast mechanism that differs from T1- and T2-weighted contrast, and is useful to study low-frequency motional processes and chemical exchange in biological tissues. T1ρ imaging can be performed in the forms of T1ρ-weighted image, T1ρ mapping and T1ρ dispersion. T1ρ imaging, particularly at low spin-lock frequency, is sensitive to B0 and B1 inhomogeneity. Various composite spin-lock pulses have been proposed to alleviate the influence of field inhomogeneity so as to reduce the banding-like spin-lock artifacts. T1ρ imaging could be specific absorption rate (SAR) intensive and time consuming. Efforts to address these issues and speed-up data acquisition are being explored to facilitate wider clinical applications. This paper reviews the T1ρ imaging’s basic physic principles, as well as its application for cartilage imaging and intervertebral disc imaging. Compared to more established T2 relaxation time, it has been shown that T1ρ provides more sensitive detection of proteoglycan (PG) loss at early stages of cartilage degeneration. T1ρ has also been shown to provide more sensitive evaluation of annulus fibrosis (AF) degeneration of the discs. PMID:26807369

  13. T1ρ magnetic resonance: basic physics principles and applications in knee and intervertebral disc imaging.

    PubMed

    Wáng, Yì-Xiáng J; Zhang, Qinwei; Li, Xiaojuan; Chen, Weitian; Ahuja, Anil; Yuan, Jing

    2015-12-01

    T1ρ relaxation time provides a new contrast mechanism that differs from T1- and T2-weighted contrast, and is useful to study low-frequency motional processes and chemical exchange in biological tissues. T1ρ imaging can be performed in the forms of T1ρ-weighted image, T1ρ mapping and T1ρ dispersion. T1ρ imaging, particularly at low spin-lock frequency, is sensitive to B0 and B1 inhomogeneity. Various composite spin-lock pulses have been proposed to alleviate the influence of field inhomogeneity so as to reduce the banding-like spin-lock artifacts. T1ρ imaging could be specific absorption rate (SAR) intensive and time consuming. Efforts to address these issues and speed-up data acquisition are being explored to facilitate wider clinical applications. This paper reviews the T1ρ imaging's basic physic principles, as well as its application for cartilage imaging and intervertebral disc imaging. Compared to more established T2 relaxation time, it has been shown that T1ρ provides more sensitive detection of proteoglycan (PG) loss at early stages of cartilage degeneration. T1ρ has also been shown to provide more sensitive evaluation of annulus fibrosis (AF) degeneration of the discs.

  14. Suppression of intestinal immunity through silencing of TCTP by RNAi in transgenic silkworm, Bombyx mori.

    PubMed

    Hu, Cuimei; Wang, Fei; Ma, Sanyuan; Li, Xianyang; Song, Liang; Hua, Xiaoting; Xia, Qingyou

    2015-12-10

    Intestinal immune response is a front line of host defense. The host factors that participate in intestinal immunity response remain largely unknown. We recently reported that Translationally Controlled Tumor Protein (BmTCTP) was obtained by constructing a phage display cDNA library of the silkworm midgut and carrying out high throughput screening of pathogen binding molecules. To further address the function of BmTCTP in silkworm intestinal immunity, transgenic RNAi silkworms were constructed by microinjection piggBac plasmid to Dazao embryos. The antimicrobial capacity of transgenic silkworm decreased since the expression of gut antimicrobial peptide from transgenic silkworm was not sufficiently induced during oral microbial challenge. Moreover, dynamic ERK phosphorylation from transgenic silkworm midgut was disrupted. Taken together, the innate immunity of intestinal was suppressed through disruption of dynamic ERK phosphorylation after oral microbial infection as a result of RNAi-mediated knockdown of midgut TCTP in transgenic silkworm.

  15. Expression of a fungal glucoamylase in transgenic rice seeds.

    PubMed

    Xu, Xiaoli; Huang, Jinming; Fang, Jun; Lin, Chaoyang; Cheng, Jiaan; Shen, Zhicheng

    2008-10-01

    Glucoamylase, which catalyses the hydrolysis of the alpha-1,4 glycosidic bonds of starch, is an important industrial enzyme used in starch enzymatic saccharification. In this study, a glucoamylase gene from Aspergillus awamori, under the control of the promoter of seed storage protein Gt1, was introduced into rice by Agrobacterium-mediated transformation. Significant glucoamylase activity was detected specifically in the seeds but not other tissues of the transgenic rice lines. The highest enzymatic activity was found in the transgenic line Bg17-2, which was estimated to have about 500 units per gram of seeds (one unit is defined as the amount of enzyme that produces 1 micromol of reducing sugar in 1 min at 60 degrees C using soluble starch as substrate). The optimum pH for the activity of the rice produced enzyme is 5.0-5.5, and the optimum temperature is around 60 degrees C. One part of this transgenic glucoamylase rice seed flour fully converted 25 parts of corn starch pre-liquefied by an alpha-amylase also produced by a transgenic rice into glucose in 16 h incubation. This study suggests that this hydrolysis enzyme may substitute commercial fermentation enzymes for industrial starch conversion.

  16. Effects of sugar beet chitinase IV on root-associated fungal community of transgenic silver birch in a field trial.

    PubMed

    Pasonen, Hanna-Leena; Lu, Jinrong; Niskanen, Anna-Maija; Seppänen, Sanna-Kaisa; Rytkönen, Anna; Raunio, Janne; Pappinen, Ari; Kasanen, Risto; Timonen, Sari

    2009-10-01

    Heterogenous chitinases have been introduced in many plant species with the aim to increase the resistance of plants to fungal diseases. We studied the effects of the heterologous expression of sugar beet chitinase IV on the intensity of ectomycorrhizal (ECM) colonization and the structure of fungal communities in the field trial of 15 transgenic and 8 wild-type silver birch (Betula pendula Roth) genotypes. Fungal sequences were separated in denaturing gradient gel electrophoresis and identified by sequencing the ITS1 region to reveal the operational taxonomic units. ECM colonization was less intense in 7 out of 15 transgenic lines than in the corresponding non-transgenic control plants, but the slight decrease in overall ECM colonization in transgenic lines could not be related to sugar beet chitinase IV expression or total endochitinase activity. One transgenic line showing fairly weak sugar beet chitinase IV expression without significantly increased total endochitinase activity differed significantly from the non-transgenic controls in the structure of fungal community. Five sequences belonging to three different fungal genera (Hebeloma, Inocybe, Laccaria) were indicative of wild-type genotypes, and one sequence (Lactarius) indicated one transgenic line. In cluster analysis, the non-transgenic control grouped together with the transgenic lines indicating that genotype was a more important factor determining the structure of fungal communities than the transgenic status of the plants. With the tested birch lines, no clear evidence for the effect of the heterologous expression of sugar beet chitinase IV on ECM colonization or the structure of fungal community was found.

  17. Detection of Leptomeningeal Metastasis by Contrast-Enhanced 3D T1-SPACE: Comparison with 2D FLAIR and Contrast-Enhanced 2D T1-Weighted Images

    PubMed Central

    Gil, Bomi; Hwang, Eo-Jin; Lee, Song; Jang, Jinhee; Jung, So-Lyung; Ahn, Kook-Jin; Kim, Bum-soo

    2016-01-01

    Introduction To compare the diagnostic accuracy of contrast-enhanced 3D(dimensional) T1-weighted sampling perfection with application-optimized contrasts by using different flip angle evolutions (T1-SPACE), 2D fluid attenuated inversion recovery (FLAIR) images and 2D contrast-enhanced T1-weighted image in detection of leptomeningeal metastasis except for invasive procedures such as a CSF tapping. Materials and Methods Three groups of patients were included retrospectively for 9 months (from 2013-04-01 to 2013-12-31). Group 1 patients with positive malignant cells in CSF cytology (n = 22); group 2, stroke patients with steno-occlusion in ICA or MCA (n = 16); and group 3, patients with negative results on MRI, whose symptom were dizziness or headache (n = 25). A total of 63 sets of MR images are separately collected and randomly arranged: (1) CE 3D T1-SPACE; (2) 2D FLAIR; and (3) CE T1-GRE using a 3-Tesla MR system. A faculty neuroradiologist with 8-year-experience and another 2nd grade trainee in radiology reviewed each MR image- blinded by the results of CSF cytology and coded their observations as positives or negatives of leptomeningeal metastasis. The CSF cytology result was considered as a gold standard. Sensitivity and specificity of each MR images were calculated. Diagnostic accuracy was compared using a McNemar’s test. A Cohen's kappa analysis was performed to assess inter-observer agreements. Results Diagnostic accuracy was not different between 3D T1-SPACE and CSF cytology by both raters. However, the accuracy test of 2D FLAIR and 2D contrast-enhanced T1-weighted GRE was inconsistent by the two raters. The Kappa statistic results were 0.657 (3D T1-SPACE), 0.420 (2D FLAIR), and 0.160 (2D contrast-enhanced T1-weighted GRE). The 3D T1-SPACE images showed the highest inter-observer agreements between the raters. Conclusions Compared to 2D FLAIR and 2D contrast-enhanced T1-weighted GRE, contrast-enhanced 3D T1 SPACE showed a better detection rate of

  18. Development of Hyperplasias, Preneoplasias, and Mammary Tumors in MMTV-c-erbB-2 and MMTV-TGFα Transgenic Rats

    PubMed Central

    Davies, Barry R.; Platt-Higgins, Angela M.; Schmidt, Gunter; Rudland, Philip S.

    1999-01-01

    Human cDNAs corresponding to two epidermal growth factor-related products that are overexpressed in human breast cancers, that for c-erbB-2 (HER-2) and for transforming growth factor α (TGFα), have been cloned downstream of the mouse mammary tumor virus (MMTV) long terminal repeat promoter and injected into the pronucleus of fertilized oocytes of Sprague-Dawley rats to produce transgenic offspring. Expression of the transgenic mRNAs is not detectable in mammary tissue from virgin transgenic rats but is detected in mammary tissue from certain lines of mid-pregnant transgenic rats. When two such lines of either type of transgenic rat are subjected to repeated cycles of pregnancy and lactation, they produce, primarily in the mammary glands, extensive pathologies, whereas virgin transgenic rats produce no such abnormalities. Multiparous transgenic female offspring from c-erbB-2-expressing lines develop a variety of focal hyperplastic and benign lesions that resemble lesions commonly found in human breasts. These lesions include lobular and ductal hyperplasia, fibroadenoma, cystic expansions, and papillary adenomas. More malignant lesions, including ductal carcinoma in situ and carcinoma, also develop stochastically at low frequency. The mammary glands of transgenic females invariably fail to involute fully after lactation. Similar phenotypes are observed in female MMTV-TGFα transgenic rats. In addition, multiparous TGFα-expressing female transgenics frequently develop severe pregnancy-dependent lactating hyperplasias as well as residual lobules of hyperplastic secretory epithelium and genuine lactating adenomas after weaning. These transgenic rat models confirm the conclusions reached in transgenic mice that overexpression of the c-erbB-2 and TGFα genes predisposes the mammary gland to stochastic tumor development. PMID:10393862

  19. Inducible Gene Manipulations in Brain Serotonergic Neurons of Transgenic Rats

    PubMed Central

    Tews, Björn; Bartsch, Dusan

    2011-01-01

    The serotonergic (5-HT) system has been implicated in various physiological processes and neuropsychiatric disorders, but in many aspects its role in normal and pathologic brain function is still unclear. One reason for this might be the lack of appropriate animal models which can address the complexity of physiological and pathophysiological 5-HT functioning. In this respect, rats offer many advantages over mice as they have been the animal of choice for sophisticated neurophysiological and behavioral studies. However, only recently technologies for the targeted and tissue specific modification of rat genes - a prerequisite for a detailed study of the 5-HT system - have been successfully developed. Here, we describe a rat transgenic system for inducible gene manipulations in 5-HT neurons. We generated a Cre driver line consisting of a tamoxifen-inducible CreERT2 recombinase under the control of mouse Tph2 regulatory sequences. Tissue-specific serotonergic Cre recombinase expression was detected in four transgenic TPH2-CreERT2 rat founder lines. For functional analysis of Cre-mediated recombination, we used a rat Cre reporter line (CAG-loxP.EGFP), in which EGFP is expressed after Cre-mediated removal of a loxP-flanked lacZ STOP cassette. We show an in-depth characterisation of this rat Cre reporter line and demonstrate its applicability for monitoring Cre-mediated recombination in all major neuronal subpopulations of the rat brain. Upon tamoxifen induction, double transgenic TPH2-CreERT2/CAG-loxP.EGFP rats show selective and efficient EGFP expression in 5-HT neurons. Without tamoxifen administration, EGFP is only expressed in few 5-HT neurons which confirms minimal background recombination. This 5-HT neuron specific CreERT2 line allows Cre-mediated, inducible gene deletion or gene overexpression in transgenic rats which provides new opportunities to decipher the complex functions of the mammalian serotonergic system. PMID:22140568

  20. PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation.

    PubMed

    Nath, Manoj; Garg, Bharti; Sahoo, Ranjan Kumar; Tuteja, Narendra

    2015-01-01

    Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (Na(+)) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest Na(+) level, respectively. All the varieties and transgenic lines of rice accumulate differential Na(+) ions in root and shoot. However, roots accumulate high Na(+) as compared to the shoots in both tobacco and rice transgenic lines suggesting that the Na(+) transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit Na(+) transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.

  1. Characterization of FLOWERING LOCUS T1 (FT1) gene in Brachypodium and wheat.

    PubMed

    Lv, Bo; Nitcher, Rebecca; Han, Xiuli; Wang, Shuyun; Ni, Fei; Li, Kun; Pearce, Stephen; Wu, Jiajie; Dubcovsky, Jorge; Fu, Daolin

    2014-01-01

    The phase transition from vegetative to reproductive growth is a critical event in the life cycle of flowering plants. FLOWERING LOCUS T (FT) plays a central role in the regulation of this transition by integrating signals from multiple flowering pathways in the leaves and transmitting them to the shoot apical meristem. In this study, we characterized FT homologs in the temperate grasses Brachypodium distachyon and polyploid wheat using transgenic and mutant approaches. Downregulation of FT1 by RNAi was associated with a significant downregulation of the FT-like genes FT2 and FT4 in Brachypodium and FT2 and FT5 in wheat. In a transgenic wheat line carrying a highly-expressed FT1 allele, FT2 and FT3 were upregulated under both long and short days. Overexpression of FT1 caused extremely early flowering during shoot regeneration in both Brachypodium and hexaploid wheat, and resulted in insufficient vegetative tissue to support the production of viable seeds. Downregulation of FT1 transcripts by RNA interference (RNAi) resulted in non-flowering Brachypodium plants and late flowering plants (2-4 weeks delay) in wheat. A similar delay in heading time was observed in tetraploid wheat plants carrying mutations for both FT-A1 and FT-B1. Plants homozygous only for mutations in FT-B1 flowered later than plants homozygous only for mutations in FT-A1, which corresponded with higher transcript levels of FT-B1 relative to FT-A1 in the early stages of development. Taken together, our data indicate that FT1 plays a critical role in the regulation of flowering in Brachypodium and wheat, and that this role is associated with the simultaneous regulation of other FT-like genes. The differential effects of mutations in FT-A1 and FT-B1 on wheat heading time suggest that different allelic combinations of FT1 homoeologs could be used to adjust wheat heading time to improve adaptation to changing environments.

  2. [Biofuels, food security and transgenic crops].

    PubMed

    Acosta, Orlando; Chaparro-Giraldo, Alejandro

    2009-01-01

    Soaring global food prices are threatening to push more poor people back below the poverty line; this will probably become aggravated by the serious challenge that increasing population and climate changes are posing for food security. There is growing evidence that human activities involving fossil fuel consumption and land use are contributing to greenhouse gas emissions and consequently changing the climate worldwide. The finite nature of fossil fuel reserves is causing concern about energy security and there is a growing interest in the use of renewable energy sources such as biofuels. There is growing concern regarding the fact that biofuels are currently produced from food crops, thereby leading to an undesirable competition for their use as food and feed. Nevertheless, biofuels can be produced from other feedstocks such as lingo-cellulose from perennial grasses, forestry and vegetable waste. Biofuel energy content should not be exceeded by that of the fossil fuel invested in its production to ensure that it is energetically sustainable; however, biofuels must also be economically competitive and environmentally acceptable. Climate change and biofuels are challenging FAO efforts aimed at eradicating hunger worldwide by the next decade. Given that current crops used in biofuel production have not been domesticated for this purpose, transgenic technology can offer an enormous contribution towards improving biofuel crops' environmental and economic performance. The present paper critically presents some relevant relationships between biofuels, food security and transgenic plant technology.

  3. Metabolite fingerprinting in transgenic lettuce.

    PubMed

    Garratt, Lee C; Linforth, Robert; Taylor, Andrew J; Lowe, Kenneth C; Power, J Brian; Davey, Michael R

    2005-03-01

    Metabolite fingerprinting has been achieved using direct atmospheric pressure chemical ionization-mass spectrometry (APCI-MS) and linked gas chromatography (GC-APCI/EI-MS) for transgenic lettuce (Lactuca sativa L. cv. Evola) plants expressing an IPT gene under the control of the senescence-specific SAG12 promoter from Arabidopsis thaliana (P(SAG12)-IPT). Mature heads of transgenic lettuce and their azygous controls were maintained under defined conditions to assess their shelf life. Transgenic lettuce plants exhibited delayed senescence and significant increases (up to a maximum of threefold) in the concentrations of three volatile organic compounds (VOCs), corresponding to molecular masses of 45, 47 and 63, when compared with heads from azygous plants. These VOCs were identified as acetaldehyde (45), ethanol (47) and dimethyl sulphide (63). The increase in dimethyl sulphide was paralleled by an accumulation of reactive oxygen species (ROS) in the heads of transgenic plants. These results demonstrate the applicability of metabolic fingerprinting techniques to elucidate the underlying pleiotropic responses of plants to transgene expression.

  4. Size matters: use of YACs, BACs and PACs in transgenic animals.

    PubMed

    Giraldo, P; Montoliu, L

    2001-04-01

    In 1993, several groups, working independently, reported the successful generation of transgenic mice with yeast artificial chromosomes (YACs) using standard techniques. The transfer of these large fragments of cloned genomic DNA correlated with optimal expression levels of the transgenes, irrespective of their location in the host genome. Thereafter, other groups confirmed the advantages of YAC transgenesis and position-independent and copy number-dependent transgene expression were demonstrated in most cases. The transfer of YACs to the germ line of mice has become popular in many transgenic facilities to guarantee faithful expression of transgenes. This technique was rapidly exported to livestock and soon transgenic rabbits, pigs and other mammals were produced with YACs. Transgenic animals were also produced with bacterial or P1-derived artificial chromosomes (BACs/PACs) with similar success. The use of YACs, BACs and PACs in transgenesis has allowed the discovery of new genes by complementation of mutations, the identification of key regulatory sequences within genomic loci that are crucial for the proper expression of genes and the design of improved animal models of human genetic diseases. Transgenesis with artificial chromosomes has proven useful in a variety of biological, medical and biotechnological applications and is considered a major breakthrough in the generation of transgenic animals. In this report, we will review the recent history of YAC/BAC/PAC-transgenic animals indicating their benefits and the potential problems associated with them. In this new era of genomics, the generation and analysis of transgenic animals carrying artificial chromosome-type transgenes will be fundamental to functionally identify and understand the role of new genes, included within large pieces of genomes, by direct complementation of mutations or by observation of their phenotypic consequences.

  5. Distinct Contributions of T1R2 and T1R3 Taste Receptor Subunits to the Detection of Sweet Stimuli

    SciTech Connect

    Nie,Y.; Vigues, S.; Hobbs, J.; Conn, G.; Munger, S.

    2005-01-01

    The molecular mechanisms by which G protein-coupled receptor (GPCR)-type chemosensory receptors of animals selectively interact with their cognate ligands remain poorly understood. There is growing evidence that many chemosensory receptors exist in multimeric complexes, though little is known about the relative contributions of individual subunits to receptor functions. This study showed that each of the two subunits in the mammalian heteromeric T1R2:T1R3 sweet taste receptor binds sweet stimuli, though with distinct affinities and conformational changes. Furthermore, ligand affinities for T1R3 are drastically reduced by the introduction of a single amino acid change associated with decreased sweet taste sensitivity in mice. Thus, individual T1R subunits increase the receptive range of the sweet taste receptor, offering a functional mechanism for phenotypic variations in sweet taste.

  6. Fully automatic detection of deep white matter T1 hypointense lesions in multiple sclerosis.

    PubMed

    Spies, Lothar; Tewes, Anja; Suppa, Per; Opfer, Roland; Buchert, Ralph; Winkler, Gerhard; Raji, Alaleh

    2013-12-07

    A novel method is presented for fully automatic detection of candidate white matter (WM) T1 hypointense lesions in three-dimensional high-resolution T1-weighted magnetic resonance (MR) images. By definition, T1 hypointense lesions have similar intensity as gray matter (GM) and thus appear darker than surrounding normal WM in T1-weighted images. The novel method uses a standard classification algorithm to partition T1-weighted images into GM, WM and cerebrospinal fluid (CSF). As a consequence, T1 hypointense lesions are assigned an increased GM probability by the standard classification algorithm. The GM component image of a patient is then tested voxel-by-voxel against GM component images of a normative database of healthy individuals. Clusters (≥0.1 ml) of significantly increased GM density within a predefined mask of deep WM are defined as lesions. The performance of the algorithm was assessed on voxel level by a simulation study. A maximum dice similarity coefficient of 60% was found for a typical T1 lesion pattern with contrasts ranging from WM to cortical GM, indicating substantial agreement between ground truth and automatic detection. Retrospective application to 10 patients with multiple sclerosis demonstrated that 93 out of 96 T1 hypointense lesions were detected. On average 3.6 false positive T1 hypointense lesions per patient were found. The novel method is promising to support the detection of hypointense lesions in T1-weighted images which warrants further evaluation in larger patient samples.

  7. Fully automatic detection of deep white matter T1 hypointense lesions in multiple sclerosis

    NASA Astrophysics Data System (ADS)

    Spies, Lothar; Tewes, Anja; Suppa, Per; Opfer, Roland; Buchert, Ralph; Winkler, Gerhard; Raji, Alaleh

    2013-12-01

    A novel method is presented for fully automatic detection of candidate white matter (WM) T1 hypointense lesions in three-dimensional high-resolution T1-weighted magnetic resonance (MR) images. By definition, T1 hypointense lesions have similar intensity as gray matter (GM) and thus appear darker than surrounding normal WM in T1-weighted images. The novel method uses a standard classification algorithm to partition T1-weighted images into GM, WM and cerebrospinal fluid (CSF). As a consequence, T1 hypointense lesions are assigned an increased GM probability by the standard classification algorithm. The GM component image of a patient is then tested voxel-by-voxel against GM component images of a normative database of healthy individuals. Clusters (≥0.1 ml) of significantly increased GM density within a predefined mask of deep WM are defined as lesions. The performance of the algorithm was assessed on voxel level by a simulation study. A maximum dice similarity coefficient of 60% was found for a typical T1 lesion pattern with contrasts ranging from WM to cortical GM, indicating substantial agreement between ground truth and automatic detection. Retrospective application to 10 patients with multiple sclerosis demonstrated that 93 out of 96 T1 hypointense lesions were detected. On average 3.6 false positive T1 hypointense lesions per patient were found. The novel method is promising to support the detection of hypointense lesions in T1-weighted images which warrants further evaluation in larger patient samples.

  8. T1/ST2 promotes T helper 2 cell activation and polyfunctionality in bronchopulmonary mycosis.

    PubMed

    Piehler, D; Grahnert, A; Eschke, M; Richter, T; Köhler, G; Stenzel, W; Alber, G

    2013-03-01

    Interleukin (IL)-33 enhances T helper (Th)2 immunity via its receptor T1/ST2. Infection with the yeast-like pathogen Cryptococcus neoformans is usually controlled by a Th1-mediated immune response. The mechanisms responsible for nonprotective Th2 immunity leading to allergic inflammation in pulmonary cryptococcosis are still not fully understood. Using a murine pulmonary model of C. neoformans infection, we report that T1/ST2 expression correlates with the intensity of Th2 activation, as demonstrated by the expression of CD25 and CD44 and downregulation of CD62L. Antigen-specific T1/ST2(+) Th cells are the primary source of the Th2 cytokines IL-5 and IL-13 as compared with wild-type T1/ST2(-) Th cells or Th cells from T1/ST2(-/-) mice. In addition, T1/ST2(+) Th cells almost exclusively contain bi- and trifunctional Th2 cytokine-producing Th cells compared with T1/ST2(-) Th cells or Th cells from T1/ST2(-/-) mice. Finally, T1/ST2-driven Th2 development resulted in defective pulmonary fungal control. These data demonstrate that T1/ST2 directs Th2 cell activation and polyfunctionality in allergic bronchopulmonary mycosis.

  9. High-efficiency Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) and regeneration of insect-resistant transgenic plants.

    PubMed

    Mehrotra, Meenakshi; Sanyal, Indraneel; Amla, D V

    2011-09-01

    To develop an efficient genetic transformation system of chickpea (Cicer arietinum L.), callus derived from mature embryonic axes of variety P-362 was transformed with Agrobacterium tumefaciens strain LBA4404 harboring p35SGUS-INT plasmid containing the uidA gene encoding β-glucuronidase (GUS) and the nptII gene for kanamycin selection. Various factors affecting transformation efficiency were optimized; as Agrobacterium suspension at OD(600) 0.3 with 48 h of co-cultivation period at 20°C was found optimal for transforming 10-day-old MEA-derived callus. Inclusion of 200 μM acetosyringone, sonication for 4 s with vacuum infiltration for 6 min improved the number of GUS foci per responding explant from 1.0 to 38.6, as determined by histochemical GUS assay. For introducing the insect-resistant trait into chickpea, binary vector pRD400-cry1Ac was also transformed under optimized conditions and 18 T(0) transgenic plants were generated, representing 3.6% transformation frequency. T(0) transgenic plants reflected Mendelian inheritance pattern of transgene segregation in T(1) progeny. PCR, RT-PCR, and Southern hybridization analysis of T(0) and T(1) transgenic plants confirmed stable integration of transgenes into the chickpea genome. The expression level of Bt-Cry protein in T(0) and T(1) transgenic chickpea plants was achieved maximum up to 116 ng mg(-1) of soluble protein, which efficiently causes 100% mortality to second instar larvae of Helicoverpa armigera as analyzed by an insect mortality bioassay. Our results demonstrate an efficient and rapid transformation system of chickpea for producing non-chimeric transgenic plants with high frequency. These findings will certainly accelerate the development of chickpea plants with novel traits.

  10. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

    2015-01-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  11. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

    PubMed

    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

    2015-09-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar.

  12. Predictors of associated autoimmune diseases (AAID) in families with type 1 diabetes (T1D). Results from the Type 1 Diabetes Genetics Consortium (T1DGC)

    PubMed Central

    Wägner, Ana M; Santana, Ángelo; Hernández, Marta; Wiebe, Julia C; Nóvoa, Javier; Mauricio, Didac

    2011-01-01

    Background Type 1 diabetes (T1D) is a clinically heterogeneous disease. The presence of associated autoimmune diseases (AAID) may represent a distinct form of autoimmune diabetes, with involvement of specific mechanisms. The aim of this study was to find predictors of AAID in the Type 1 Diabetes Genetics Consortium (T1DGC) data set. Methods 3263 families with at least 2 siblings with T1D were included. Clinical information was obtained using questionnaires, anti-GAD and anti-IA-2 were measured and HLA-genotyping was performed. Siblings with T1D with and without AAID were compared and a multivariate regression analysis was performed to find predictors of AAID. T1D-associated HLA haplotypes were defined as the 4 most susceptible and protective, respectively. Results AAID was present in 14.4% of the T1D affected siblings. Age of diabetes onset, current age and time since diagnosis were higher, and there was a female predominance and more family history of AAID in the group with AAID, as well as more frequent anti-GAD and less frequent anti-IA2 positivity. Risk and protective HLA haplotype distributions were similar, though DRB1*0301-DQA1*0501-DQB1*0201 was more frequent in the group with AAID. In the multivariate analysis, female gender, age of onset, family history of AAID, time since diagnosis and anti-GAD positivity were significantly associated with AAID. Conclusions In patients with T1D, the presence of AAID is associated with female predominance, more frequent family history of AAID, later onset of T1D and more anti-GAD antibodies, despite longer duration of the disease. The predominance of certain HLA haplotypes suggests that specific mechanisms of disease may be involved. PMID:21744463

  13. The Construction and Expression of Lysine-Rich Gene in the Mammary Gland of Transgenic Mice

    PubMed Central

    Ma, Xin; Zhang, Peng; Song, Guangqi; Chen, Yue; Wang, Zhongwei; Yin, Yupeng; Kong, Delong; Zhang, Sheng; Zhao, Zhihui; Ouyang, Hongsheng

    2012-01-01

    Lysine is the limiting amino acid in cereal grains, which represent a major source of human food and animal feed worldwide, and is considered the most important of the essential amino acids. In this study, β-casein, αS2-casein, and lactotransferrin cDNA clone fragments encoding lysine-rich peptides were fused together to generate a lysine-rich (LR) gene and the mammary gland-specific expression vector pBC1-LR-NEOr was constructed. Transgenic mice were generated by pronuclear microinjection of the linearized expression vectors harboring the LR transgene. The transgenic mice and their offspring were examined using multiplex polymerase chain reaction (PCR), Southern blotting, reverse transcriptase–PCR, in situ hybridization, and Western blotting techniques. Our results showed that the LR gene was successfully integrated into the mouse genome and was transmitted stably. The specific LR gene expression was restricted to the mammary gland, active alveoli of the transgenic female mice during lactation. The lysine level of the two transgenic lines was significantly higher than that of nontransgenic controls (p<0.05). In addition, the growth performance of transgenic pups was enhanced by directly feeding them the LR protein-enriched transgenic milk. Our results demonstrated that lysine-rich gene was successfully constructed and expressed in mammary gland of transgenic mice. This study will provide a better understanding of how mammary gland expression systems that increase the lysine content of milk can be applied to other mammals, such as cows. PMID:22577831

  14. Memory deficits correlating with acetylcholinesterase splice shift and amyloid burden in doubly transgenic mice.

    PubMed

    Rees, Tina M; Berson, Amit; Sklan, Ella H; Younkin, Linda; Younkin, Steven; Brimijoin, Stephen; Soreq, Hermona

    2005-07-01

    Current mouse models of Alzheimer's disease show brain pathology that correlates to a degree with memory impairment, but underlying molecular mechanisms remained unknown. Here we report studies with three lines of transgenic mice: animals that doubly express mutated human amyloid precursor protein (APPswe) and human acetylcholinesterase (hAChE); and animals transgenic for only the APPswe or the hAChE. Among these genotypes, variations were observed in expression of mRNA for presenilin-1, which was highest in singly transgenic hAChE mice, and the stress-inducible form of AChE, which was elevated when both transgenes were present. At the age of nine months, both double and single transgenic mice displayed working memory impairment in a radial arm water maze. However, as compared with mice expressing amyloid alone, the double transgenic animals exhibited more numerous plaques and greater amyloid burden in brain (both by histochemistry and by ELISA of amyloid protein). Moreover, the amyloid burden in double transgenics was tightly correlated with memory impairment as measured by total maze errors (r2= 0.78, p = .002). This correlation was markedly stronger than observed in mice with amyloid alone. These new findings support the notion of cholinergic-amyloid interrelationships and highlight the double transgenic mice as a promising alternative for testing Alzheimer's therapies.

  15. The construction and expression of lysine-rich gene in the mammary gland of transgenic mice.

    PubMed

    Ma, Xin; Zhang, Peng; Song, Guangqi; Chen, Yue; Wang, Zhongwei; Yin, Yupeng; Kong, Delong; Zhang, Sheng; Zhao, Zhihui; Ouyang, Hongsheng; Tang, Bo; Li, Ziyi

    2012-08-01

    Lysine is the limiting amino acid in cereal grains, which represent a major source of human food and animal feed worldwide, and is considered the most important of the essential amino acids. In this study, β-casein, αS2-casein, and lactotransferrin cDNA clone fragments encoding lysine-rich peptides were fused together to generate a lysine-rich (LR) gene and the mammary gland-specific expression vector pBC1-LR-NEO(r) was constructed. Transgenic mice were generated by pronuclear microinjection of the linearized expression vectors harboring the LR transgene. The transgenic mice and their offspring were examined using multiplex polymerase chain reaction (PCR), Southern blotting, reverse transcriptase-PCR, in situ hybridization, and Western blotting techniques. Our results showed that the LR gene was successfully integrated into the mouse genome and was transmitted stably. The specific LR gene expression was restricted to the mammary gland, active alveoli of the transgenic female mice during lactation. The lysine level of the two transgenic lines was significantly higher than that of nontransgenic controls (p<0.05). In addition, the growth performance of transgenic pups was enhanced by directly feeding them the LR protein-enriched transgenic milk. Our results demonstrated that lysine-rich gene was successfully constructed and expressed in mammary gland of transgenic mice. This study will provide a better understanding of how mammary gland expression systems that increase the lysine content of milk can be applied to other mammals, such as cows.

  16. How to make tetracycline-regulated transgene expression go on and off.

    PubMed

    Rennel, Emma; Gerwins, Pär

    2002-10-01

    Tetracycline-regulated gene expression systems are widely used to allow temporal and quantitative control of transgene expression in cultured cells and transgenic animals. While working with the Tet-Off system, where tetracycline or the analogue doxycycline suppresses expression, we noted a considerable variability in induced transgene expression after removal of doxycycline. Variable expression of the transgene could not be explained by clonal variation since it was noted when working with clonal cell lines. Instead we found that doxycycline bound nonspecifically to cells and extracellular matrix and was slowly released after it had been removed from tissue culture media. The released doxycycline reached sufficiently high levels to completely suppress transgene expression. The effect was not dependent on cell type or the nature of the transgene. However, robust and rapid transgene expression could be induced if released doxycycline were removed by washing cells 3h after the initial removal of doxycycline. The use of different vector systems, harboring the tetracycline-regulatable components, yielded similar results. These results not only help explain why tetracycline-regulatable transgene expression systems sometimes are variable but also provide simple ways to substantially improve the efficiency, utility, and reliability of these widely used expression systems.

  17. Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

    PubMed

    Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

    2017-02-01

    Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

  18. Gene flow from transgenic rice to red rice (Oryza sativa L.) in the field.

    PubMed

    Busconi, M; Baldi, G; Lorenzoni, C; Fogher, C

    2014-01-01

    In this study, we simulate a transgenic rice crop highly infested with red rice to examine transgene transfer from a transgenic line (A2504) resistant to glufosinate ammonium to cohabitant red rice. The red rice was sown along with the transgenic line at the highest density found in naturally infested crops in the region. Agricultural practices similar to those used to control red rice infestation in northern Italy rice fields were used to reproduce the local rice production system. During the first 2 years, the field was treated with herbicide at the appropriate time; in the first year the dosage of herbicide was three times the recommended amount. In this first year, detectable red rice plants that escaped herbicide treatment were manually removed. Nevertheless, two herbicide-resistant hybrid plants (named 101 and 104) were identified in the experimental field during the second year of cultivation. Phenotypic and molecular characterisation suggests the hybrid nature of these two plants, deriving from crossing events involving A2504, respectively, with red rice (plant 101) and the buffer cultivar Gladio (plant 104). The progeny of two subsequent generations of the two plants were examined and the presence of the transgene detected, indicating stable transfer of the transgene across generations. In conclusion, despite control methods, red rice progeny tolerant to the herbicide can be expected following use of transgenic rice and, consequently, difficulties in controlling this weed with chemicals will emerge in a relatively short time.

  19. Impulsivity trait in the early symptomatic BACHD transgenic rat model of Huntington disease.

    PubMed

    Manfré, Giuseppe; Doyère, Valérie; Bossi, Simon; Riess, Olaf; Nguyen, Huu Phuc; El Massioui, Nicole

    2016-02-15

    Impulsivity trait was characterized in 3-5 months old BACHD rats, a transgenic model of Huntington disease, using (1) the delay discounting task to assess cognitive/choice impulsivity, and (2) the Differential Reinforcement of Low Rate of Responding task to evaluate motor/action impulsivity. Transgenic animals showed a high level of choice impulsivity and, to a lesser extent, action impulsivity. Our results provide the first evidence that the transgenic BACHD rat (TG5 line) displays impulsivity disorder as early as 3 months old, as described in early symptomatic HD patients, thus adding to the face validity of the rat model.

  20. Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

    PubMed Central

    Yuan, Yu-Guo; An, Liyou; Yu, Baoli; Song, Shaozheng; Zhou, Feng; Zhang, Liqing; Gu, Yinyin; Yu, Minghui; Cheng, Yong

    2014-01-01

    To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC) containing a hybrid goat β-lactoglobulin (BLG) promoter/cytomegalovirus (CMV) enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT). Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT) cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2%) from the non-transfected line and five recipients delivered six kids (1.8%) from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P < 0.05). Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats. PMID:24527256

  1. Expression of recombinant human alpha-lactalbumin in the milk of transgenic goats using a hybrid pomoter/enhancer.

    PubMed

    Yuan, Yu-Guo; An, Liyou; Yu, Baoli; Song, Shaozheng; Zhou, Feng; Zhang, Liqing; Gu, Yinyin; Yu, Minghui; Cheng, Yong

    2014-01-01

    To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC) containing a hybrid goat β -lactoglobulin (BLG) promoter/cytomegalovirus (CMV) enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT). Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT) cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2%) from the non-transfected line and five recipients delivered six kids (1.8%) from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P < 0.05). Two transgenic cloned goats expressed rhLA in the milk at 0.1-0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

  2. Evaluation of the yield of abiotic-stress-tolerant AtDREB1A transgenic potato under saline conditions in advance of field trials.

    PubMed

    Shimazaki, Takayoshi; Endo, Tsukasa; Kasuga, Mie; Yamaguchi-Shinozaki, Kazuko; Watanabe, Kazuo N; Kikuchi, Akira

    2016-12-01

    Cultivated potato is a drought-, salinity-, and frost-sensitive species. The transgenic approach is one of the methods used to mitigate abiotic stress. The utility of transgenic potatoes that have abiotic stress tolerance should be judged from their yield under stress conditions. In order to establish transgenic potato lines with the AtDREB1A gene that could be used in practical applications, we screened candidate lines in a growth room with growth profiles under non-stress conditions rather than the expression level of transgene. After identifying better transgenic lines (D163 and D164), yield of those lines under stress conditions was evaluated in the special netted-house. Although the yield was lower than the yield under non-stress conditions, two selected transgenic lines were able to maintain their yield under high saline conditions (EC > 10 mS/cm). In this study, fertilizer was not added beyond what was already contained in the soil mix in order to evaluate the yield of the transgenic lines under saline conditions in as simple a manner as possible. In future studies, it will be necessary to evaluate their yield in a farming context in an isolated field after assessing the environmental biosafety of these transgenic potato lines.

  3. Evaluation of the yield of abiotic-stress-tolerant AtDREB1A transgenic potato under saline conditions in advance of field trials

    PubMed Central

    Shimazaki, Takayoshi; Endo, Tsukasa; Kasuga, Mie; Yamaguchi-Shinozaki, Kazuko; Watanabe, Kazuo N.; Kikuchi, Akira

    2016-01-01

    Cultivated potato is a drought-, salinity-, and frost-sensitive species. The transgenic approach is one of the methods used to mitigate abiotic stress. The utility of transgenic potatoes that have abiotic stress tolerance should be judged from their yield under stress conditions. In order to establish transgenic potato lines with the AtDREB1A gene that could be used in practical applications, we screened candidate lines in a growth room with growth profiles under non-stress conditions rather than the expression level of transgene. After identifying better transgenic lines (D163 and D164), yield of those lines under stress conditions was evaluated in the special netted-house. Although the yield was lower than the yield under non-stress conditions, two selected transgenic lines were able to maintain their yield under high saline conditions (EC > 10 mS/cm). In this study, fertilizer was not added beyond what was already contained in the soil mix in order to evaluate the yield of the transgenic lines under saline conditions in as simple a manner as possible. In future studies, it will be necessary to evaluate their yield in a farming context in an isolated field after assessing the environmental biosafety of these transgenic potato lines. PMID:28163586

  4. Transgenic Sugarcane with a cry1Ac Gene Exhibited Better Phenotypic Traits and Enhanced Resistance against Sugarcane Borer

    PubMed Central

    Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping

    2016-01-01

    We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines. PMID:27093437

  5. Transgenic Sugarcane with a cry1Ac Gene Exhibited Better Phenotypic Traits and Enhanced Resistance against Sugarcane Borer.

    PubMed

    Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping; Que, Youxiong

    2016-01-01

    We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines.

  6. Anticancer Activity of Saponins from Allium chinense against the B16 Melanoma and 4T1 Breast Carcinoma Cell

    PubMed Central

    Yu, Zhihui; Zhang, Tong; Zhou, Fengjuan; Xiao, Xiuqing; Ding, Xuezhi; He, Hao; Rang, Jie; Quan, Meifang; Wang, Ting; Zuo, Mingxing; Xia, Liqiu

    2015-01-01

    The cytotoxic substance of A. chinense saponins (ACSs) was isolated using ethanol extraction and purified with the D101 macroporous adsorption resin approach. We investigated the anticancer activity of ACSs in the B16 melanoma and 4T1 breast carcinoma cell lines. Methylthioninium chloride and hematoxylin-eosin staining with Giemsa dyestuff were used when the cells were treated with ACSs. The results showed that the cells morphologies changed significantly; ACSs induced cell death in B16 and 4T1 cells based on acridine orange/ethidium bromide double fluorescence staining, with the number and degree of apoptotic tumor cells increasing as ACS concentration increased. ACSs inhibited the proliferation of B16 and 4T1 cells in a dose-dependent manner. They also inhibited cell migration and colony formation and exhibited a concentration-dependent effect. In addition, ACSs apparently inhibited the growth of melanoma in vivo. The preliminary antitumor in vivo assay revealed that early medication positively affected tumor inhibition action and effectively protected the liver and spleen of C57 BL/6 mice from injury. This study provides evidence for the cytotoxicity of ACSs and a strong foundation for further research to establish the theoretical basis for cell death and help in the design and development of new anticancer drugs. PMID:26146506

  7. Fructan biosynthesis in transgenic plants.

    PubMed

    Cairns, Andrew J

    2003-01-01

    Data from plants transformed to accumulate fructan are assessed in the context of natural concentrations of reserve carbohydrates and natural fluxes of carbon in primary metabolism: Transgenic fructan accumulation is universally reported as an instantaneous endpoint concentration. In exceptional cases, concentrations of 60-160 mg g(-1) fresh mass were reported and compare favourably with naturally occurring maximal starch and fructan content in leaves and storage organs. Generally, values were less than 20 mg g(-1) for plants transformed with bacterial genes and <9 mg g(-1) for plant-plant transformants. Superficially, the results indicate a marked modification of carbon partitioning. However, transgenic fructan accumulation was generally constitutive and involved accumulation over time-scales of weeks or months. When calculated as a function of accumulation period, fluxes into the transgenic product were low, in the range 0.00002-0.03 nkat g(-1). By comparison with an estimated minimum daily carbohydrate flux in leaves for a natural fructan-accumulating plant in field conditions (37 nkat g(-1)), transgenic fructan accumulation was only 0.00005-0.08% of primary carbohydrate flux and does not indicate radical modification of carbon partitioning, but rather, a quantitatively minor leakage into transgenic fructan. Possible mechanisms for this low fructan accumulation in the transformants are considered and include: (i) rare codon usage in bacterial genes compared with eukaryotes, (ii) low transgene mRNA concentrations caused by low expression and/or high turnover, (iii) resultant low expression of enzyme protein, (iv) resultant low total enzyme activity, (v) inappropriate kinetic properties of the gene products with respect to substrate concentrations in the host, (vi) in situ product hydrolysis, and (vii) levan toxicity. Transformants expressing bacterial fructan synthesis exhibited a number of aberrant phenotypes such as stunting, leaf bleaching, necrosis, reduced

  8. WP1: transgenic opto-animals

    NASA Astrophysics Data System (ADS)

    UŻarowska, E.; Czajkowski, Rafał; Konopka, W.

    2014-11-01

    We aim to create a set of genetic tools where permanent opsin expression (ChR or NpHR) is precisely limited to the population of neurons that express immediate early gene c-fos during a specific temporal window of behavioral training. Since the c-fos gene is only expressed in neurons that form experience-dependent ensemble, this approach will result in specific labeling of a small subset of cells that create memory trace for the learned behavior. To this end we employ two alternative inducible gene expression systems: Tet Expression System and Cre/lox System. In both cases, the temporal window for opsin induction is controlled pharmacologically, by doxycycline or tamoxifen, respectively. Both systems will be used for creating lines of transgenic animals.

  9. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    PubMed

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China.

  10. Increased native T1-values at the interventricular insertion regions in precapillary pulmonary hypertension.

    PubMed

    Spruijt, Onno A; Vissers, Loek; Bogaard, Harm-Jan; Hofman, Mark B M; Vonk-Noordegraaf, Anton; Marcus, J Tim

    2016-03-01

    Cardiac magnetic resonance imaging of the pressure overloaded right ventricle (RV) of precapillary pulmonary hypertension (PH) patients, exhibits late gadolinium enhancement at the interventricular insertion regions, a phenomenon which has been linked to focal fibrosis. Native T1-mapping is an alternative technique to characterize myocardium and has the advantage of not requiring the use of contrast agents. The aim of this study was to characterize the myocardium of idiopathic pulmonary arterial hypertension (IPAH), systemic scleroderma related PH (PAH-Ssc) and chronic thromboembolic PH (CTEPH) patients using native T1-mapping and to see whether native T1-values were related to disease severity. Furthermore, we compared native T1-values between the different precapillary PH categories. Native T1-mapping was performed in 46 IPAH, 14 PAH-SSc and 10 CTEPH patients and 10 control subjects. Native T1-values were assessed using regions of interest at the RV and LV free wall, interventricular septum and interventricular insertion regions. In PH patients, native T1-values of the interventricular insertion regions were significantly higher than the native T1-values of the RV free wall, LV free wall and interventricular septum. Native T1-values at the insertion regions were significantly related to disease severity. Native T1-values were not different between IPAH, PAH-Ssc and CTEPH patients. Native T1-values of the interventricular insertion regions are significantly increased in precapillary PH and are related to disease severity. Native T1-mapping can be developed as an alternative technique for the characterization of the interventricular insertion regions and has the advantage of not requiring the use of contrast agents.

  11. How To Produce and Characterize Transgenic Plants.

    ERIC Educational Resources Information Center

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  12. Aberrant TGFβ/SMAD4 signaling contributes to epigenetic silencing of a putative tumor suppressor, RunX1T1 in ovarian cancer.

    PubMed

    Yeh, Kun-Tu; Chen, Tze-Ho; Yang, Hui-Wen; Chou, Jian-Liang; Chen, Lin-Yu; Yeh, Chia-Ming; Chen, Yu-Hsin; Lin, Ru-Inn; Su, Her-Young; Chen, Gary C W; Deatherage, Daniel E; Huang, Yi-Wen; Yan, Pearlly S; Lin, Huey-Jen; Nephew, Kenneth P; Huang, Tim H-M; Lai, Hung-Cheng; Chan, Michael W Y

    2011-06-01

    Aberrant TGFβ signaling pathway may alter the expression of down-stream targets and promotes ovarian carcinogenesis. However, the mechanism of this impairment is not fully understood. Our previous study has identified RunX1T1 as a putative SMAD4 target in an immortalized ovarian surface epithelial cell line, IOSE. In this study, we report that transcription of RunX1T1 was confirmed to be positively regulated by SMAD4 in IOSE cells and epigenetically silenced in a panel of ovarian cancer cell lines by promoter hypermethylation and histone methylation at H3 lysine 9. SMAD4 depletion increased repressive histone modifications of RunX1T1 promoter without affecting promoter methylation in IOSE cells. Epigenetic treatment can restore RunX1T1 expression by reversing its epigenetic status in MCP3 ovarian cancer cells. When transiently treated with a demethylating agent, the expression of RunX1T1 was partially restored in MCP3 cells, but gradual re-silencing through promoter re-methylation was observed after the treatment. Interestingly, SMAD4 knockdown accelerated this re-silencing process, suggesting that normal TGF-beta signaling is essential for the maintenance of RunX1T1 expression. In vivo analysis confirmed that hypermethylation of RunX1T1 was detected in 35.7% (34/95) of ovarian tumors with high clinical stages (P=0.035) and in 83% (5/6) of primary ovarian cancer-initiating cells. Additionally, concurrent methylation of RunX1T1 and another SMAD4 target, FBXO32 which was previously found to be hypermethylated in ovarian cancer was observed in this same sample cohort (P< 0.05). Restoration of RunX1T1 inhibited cancer cell growth. Taken together, dysregulated TGFβ/SMAD4 signaling may lead to epigenetic silencing of a putative tumor suppressor, RunX1T1, during ovarian carcinogenesis.

  13. Virus-derived transgenes expressing hairpin RNA give immunity to Tobacco mosaic virus and Cucumber mosaic virus

    PubMed Central

    2011-01-01

    Background An effective method for obtaining resistant transgenic plants is to induce RNA silencing by expressing virus-derived dsRNA in plants and this method has been successfully implemented for the generation of different plant lines resistant to many plant viruses. Results Inverted repeats of the partial Tobacco mosaic virus (TMV) movement protein (MP) gene and the partial Cucumber mosaic virus (CMV) replication protein (Rep) gene were introduced into the plant expression vector and the recombinant plasmids were transformed into Agrobacterium tumefaciens. Agrobacterium-mediated transformation was carried out and three transgenic tobacco lines (MP16-17-3, MP16-17-29 and MP16-17-58) immune to TMV infection and three transgenic tobacco lines (Rep15-1-1, Rep15-1-7 and Rep15-1-32) immune to CMV infection were obtained. Virus inoculation assays showed that the resistance of these transgenic plants could inherit and keep stable in T4 progeny. The low temperature (15℃) did not influence the resistance of transgenic plants. There was no significant correlation between the resistance and the copy number of the transgene. CMV infection could not break the resistance to TMV in the transgenic tobacco plants expressing TMV hairpin MP RNA. Conclusions We have demonstrated that transgenic tobacco plants expressed partial TMV movement gene and partial CMV replicase gene in the form of an intermolecular intron-hairpin RNA exhibited complete resistance to TMV or CMV infection. PMID:21269519

  14. The molecular genetic characterization of the 'Bobwhite' bread wheat family using AFLPs and the effect of the T1BL.1RS translocation.

    PubMed

    Warburton, L.; Skovmand, B.; Mujeeb-Kazi, A.

    2002-04-01

    Bobwhite is a generic name that refers to all sister lines derived from the cross CM 33203 with the pedigree Aurora//Kalyan/Bluebird/3/Woodpecker made by the CIMMYT bread wheat program in the early 1970s. Individual sister lines can be distinguished by their unique selection history. One of the parents, Aurora, contains the T1BL.1RS translocation from rye, and approximately 85% of the sister lines have inherited the translocation. The sister lines demonstrate great variability for agronomic traits such as maturity, height, grain color, reaction to leaf rust, stem rust, yellow rust, septoria leaf blotch and powdery mildew. Certain groups of sister lines derived from particular F(1) plants can be distinguished by their phenotype. One hundred and one Bobwhite sister lines were fingerprinted using four AFLP enzyme/primer combinations. Following multivariate analysis, two main and very distinct clusters were found, which reflected the presence or absence of the T1BL.1RS translocation. Within these clusters, lines clustered together, for the most part, with other sister lines sharing a common selection history. Removal of the AFLP markers that were correlated with the presence or absence of the translocation caused lines to cluster based on pedigree alone. Therefore, the presence of translocations in wheat could bias genetic diversity studies using unmapped markers such as AFLPs that are located on the translocated segment(s), with the result that the resulting clusters will not reflect the true degree of relatedness.

  15. Phenoxy herbicides and fibrates potently inhibit the human chemosensory receptor subunit T1R3

    PubMed Central

    Maillet, Emeline L.; Margolskee, Robert F.; Mosinger, Bedrich

    2009-01-01

    We show that phenoxy-auxin herbicides and lipid-lowering fibrates inhibit human but not rodent T1R3. T1R3 as a co-receptor in taste cells responds to sweet compounds and amino-acids; in endocrine cells of gut and pancreas T1R3 contributes to glucose sensing. Thus, certain effects of fibrates in treating hyperlipidemia and type II diabetes may be via actions on T1R3. Likewise, phenoxy-herbicides may have adverse metabolic effects in humans that would have gone undetected in studies on rodents. PMID:19817384

  16. T1rho MRI and CSF biomarkers in diagnosis of Alzheimer's disease.

    PubMed

    Haris, Mohammad; Yadav, Santosh K; Rizwan, Arshi; Singh, Anup; Cai, Kejia; Kaura, Deepak; Wang, Ena; Davatzikos, Christos; Trojanowski, John Q; Melhem, Elias R; Marincola, Francesco M; Borthakur, Arijitt

    2015-01-01

    In the current study, we have evaluated the performance of magnetic resonance (MR) T1rho (T1ρ) imaging and CSF biomarkers (T-tau, P-tau and Aβ-42) in characterization of Alzheimer's disease (AD) patients from mild cognitive impairment (MCI) and control subjects. With informed consent, AD (n = 27), MCI (n = 17) and control (n = 17) subjects underwent a standardized clinical assessment and brain MRI on a 1.5-T clinical-scanner. T1ρ images were obtained at four different spin-lock pulse duration (10, 20, 30 and 40 ms). T1ρ maps were generated by pixel-wise fitting of signal intensity as a function of the spin-lock pulse duration. T1ρ values from gray matter (GM) and white matter (WM) of medial temporal lobe were calculated. The binary logistic regression using T1ρ and CSF biomarkers as variables was performed to classify each group. T1ρ was able to predict 77.3% controls and 40.0% MCI while CSF biomarkers predicted 81.8% controls and 46.7% MCI. T1ρ and CSF biomarkers in combination predicted 86.4% controls and 66.7% MCI. When comparing controls with AD, T1ρ predicted 68.2% controls and 73.9% AD, while CSF biomarkers predicted 77.3% controls and 78.3% for AD. Combination of T1ρ and CSF biomarkers improved the prediction rate to 81.8% for controls and 82.6% for AD. Similarly, on comparing MCI with AD, T1ρ predicted 35.3% MCI and 81.9% AD, whereas CSF biomarkers predicted 53.3% MCI and 83.0% AD. Collectively CSF biomarkers and T1ρ were able to predict 59.3% MCI and 84.6% AD. On receiver operating characteristic analysis T1ρ showed higher sensitivity while CSF biomarkers showed greater specificity in delineating MCI and AD from controls. No significant correlation between T1ρ and CSF biomarkers, between T1ρ and age, and between CSF biomarkers and age was observed. The combined use of T1ρ and CSF biomarkers have promise to improve the early and specific diagnosis of AD. Furthermore, disease progression form MCI to AD might be easily tracked using

  17. Reduced beta 2-microglobulin mRNA levels in transgenic mice expressing a designed hammerhead ribozyme.

    PubMed Central

    Larsson, S; Hotchkiss, G; Andäng, M; Nyholm, T; Inzunza, J; Jansson, I; Ahrlund-Richter, L

    1994-01-01

    We have generated three artificial hammerhead ribozymes, denoted 'Rz-b', 'Rz-c' and 'Rz-d', with different specificities for exon II of the mouse beta-2-microglobulin (beta 2M) mRNA. In this study we tested for ribozyme mediated reduction of beta 2M mRNA in a cell line and in transgenic mice. Transfections of either of the Rz-b, Rz-c or Rz-d plasmids into a mouse cell-line (NIH/3T3) revealed reductions of beta 2M mRNA substrate in each case. Ribozyme expression in individual transfected clones was accompanied with an up to 80% reduction of beta 2M mRNA levels. Rz-c was selected for a transgenic study. Seven Rz-c transgenic founder animals were identified from which three ribozyme expressing families were established and analysed. Expression of the ribozyme transgene was tested for and detected in lung, kidney and spleen. Expression was accompanied with reduction of the beta 2M mRNA levels of heterozygous (Rz+/-) animals compared to non-transgenic litter mates. The effect was most pronounced in lung with more than 90% beta 2M mRNA reduction in individual mice. In summary, expression of our ribozymes in a cell free system, in a cell-line and in transgenic mice were all accompanied with reductions of beta 2M mRNA levels. Images PMID:8036151

  18. Transgenic plant virus resistance mediated by untranslatable sense RNAs: expression, regulation, and fate of nonessential RNAs.

    PubMed Central

    Smith, H A; Swaney, S L; Parks, T D; Wernsman, E A; Dougherty, W G

    1994-01-01

    Haploid leaf tissue of tobacco cultivars K326 and K149 was transformed with several transgenes containing cDNA of the potato virus Y (PVY) coat protein (CP) open reading frame (ORF). The various transgenes containing the PVY CP ORF sequence produced (1) the expected mRNA and CP product, (2) an mRNA rendered untranslatable by introduction of a stop codon immediately after the initiation codon, or (3) an antisense RNA that was untranslatable as a result of the incorrect orientation of the PVY CP ORF behind the transcriptional promoter. Homozygous doubled haploid (DH) (diploid) plants were generated, and selfed progeny from these plants were examined. Resistance was virus specific, functioning only against PVY. An inverse correlation between transgene-derived PVY transcript steady state levels and resistance was generally noted with lines expressing the untranslatable sense version of the PVY CP ORF. A collection of DH lines, derived from a single transformation event of a common haploid plant and isogenic for the PVY transgenes expressing untranslatable sense RNA, displayed different levels of PVY resistance. Lines with actively transcribed, methylated transgene sequences had low steady state levels of transgene transcript and a virus-resistant phenotype. These results are discussed within the context of sense suppression in plants. PMID:7994177

  19. Development and bioassay of transgenic Chinese cabbage expressing potato proteinase inhibitor II gene

    PubMed Central

    Zhang, Junjie; Liu, Fan; Yao, Lei; Luo, Chen; Yin, Yue; Wang, Guixiang; Huang, Yubi

    2012-01-01

    Lepidopteran larvae are the most injurious pests of Chinese cabbage production. We attempted the development of transgenic Chinese cabbage expressing the potato proteinase inhibitor II gene (pinII) and bioassayed the pest-repelling ability of these transgenic plants. Cotyledons with petioles from aseptic seedlings were used as explants for Agrobacterium-mediated in vitro transformation. Agrobacterium tumefaciens C58 contained the binary vector pBBBasta-pinII-bar comprising pinII and bar genes. Plants showing vigorous PPT resistance were obtained by a series concentration selection for PPT resistance and subsequent regeneration of leaf explants dissected from the putative chimera. Transgenic plants were confirmed by PCR and genomic Southern blotting, which showed that the bar and pinII genes were integrated into the plant genome. Double haploid homozygous transgenic plants were obtained by microspore culture. The pinII expression was detected using quantitative real time polymerase chain reaction (qRT-PCR) and detection of PINII protein content in the transgenic homozygous lines. Insect-feeding trials using the larvae of cabbage worm (Pieris rapae) and the larvae of the diamondback moth (Plutella xylostella) showed higher larval mortality, stunted larval development, and lower pupal weights, pupation rates, and eclosion rates in most of the transgenic lines in comparison with the corresponding values in the non-transformed wild-type line. PMID:23136521

  20. Field performance of transgenic citrus trees: Assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics

    PubMed Central

    2012-01-01

    Background The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. Results The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Conclusions Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the

  1. Human health and transgenic crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Under the joint auspices of the Agrochemical and the Agricultural and Food Chemistry Divisions of the American Chemical Society, we organized a short symposium on “Human Health and Transgenic Crops” at the 244th ACS national meeting, held August 19-23, 2012 in Philadelphia, PA, to examine an array o...

  2. DNA methylation in 5-aza-2'-deoxycytidine-resistant variants of C3H 10T1/2 C18 cells.

    PubMed Central

    Flatau, E; Gonzales, F A; Michalowsky, L A; Jones, P A

    1984-01-01

    A cell line (T17) was derived from C3H 10T1/2 C18 cells after 17 treatments with increasing concentrations of 5-aza-2'-deoxycytidine. The T17 cell line was very resistant to the cytotoxic effects of 5-aza-2'-deoxycytidine, and the 50% lethal dose for 5-aza-2'-deoxycytidine was ca. 3 microM, which was 30-fold greater than that of the parental C3H 10T1/2 C18 cells. Increased drug resistance was not due to a failure of the T17 cell line to incorporate 5-aza-2'-deoxycytidine into DNA. The cells were also slightly cross-resistant to 5-azacytidine. The percentage of cytosines modified to 5-methylcytosine in T17 cells was 0.7%, a 78% decrease from the level of 3.22% in C3H 10T1/2 C18 cells. The DNA cytosine methylation levels in several clones isolated from the treated lines were on the order of 0.7%, and clones with methylation levels lower than 0.45% were not obtained even after further drug treatments. These highly decreased methylation levels appeared to be unstable, and DNA modification increased as the cells divided in the absence of further drug treatment. The results suggest that it may not be possible to derive mouse cells with vanishingly low levels of 5-methylcytosine and that considerable de novo methylation can occur in cultured lines. PMID:6209556

  3. Development of transgenic zooplankton Artemia as a bioreactor to produce exogenous protein.

    PubMed

    Chang, Shih-Hung; Lee, Ben-Chang; Chen, Yan-Da; Lee, Yin-Chou; Tsai, Huai-Jen

    2011-10-01

    Although the crustacean Artemia has been commonly used as an experimental organism and served as a live bait feed for aquaculture, gene transfer system on Artemia sp. to generate stable lines is not well developed. In this study, we optimized a condition for cyst-eletroporation and generated stable lines of transgenic A. sinica. Two expression plasmids directed by the hybrid promoters of cytomegalovirus (CMV) and medaka β-actin (Mβ) were co-electroporated on decapsulated cysts: pCMV-Mβ-GFP contained GFP reporter gene and pCMV-Mβ-ypGH contained yellowfin porgy GH (ypGH) cDNA. We examined the GFP shown in the Artemia larvae and found that the expression rate was 13.3% (3,219 out of 24,054 examined). We then chose 200 G0 founders which strongly expressed GFP to generate transgenic lines. Homozygotic strains derived from F4 generation of each transgenic line, A3 and A8, were obtained. We proved that transgenic lines A3 and A8 also harbored pCMV-Mβ-ypGH and produced recombinant ypGH with a concentration of 0.089 and 0.032 μg per 50 homozygotic nauplii, respectively. Ten live Artemia nauplii were fed daily to zebrafish larvae during 25 to 35 days of post-fertilization. The average body length gain rates of zebrafish larvae fed transgenic Artemia were 16-20% greater than those of control group, indicating the exogenous ypGH produced by transgenic Artemia is functional. Therefore, we concluded that the transgenesis on Artemia is developed, and transgenic Artemia might be highly potentially useful as a new bioreactor material for application in aquaculture and biological researches.

  4. Development of transgenic strains for the biological control of the Mexican fruit fly, Anastrepha ludens.

    PubMed

    Meza, J Salvador; Nirmala, Xavier; Zimowska, Grazyna J; Zepeda-Cisneros, C Silvia; Handler, Alfred M

    2011-01-01

    The Mexican fruit fly, Anastrepha ludens, is a highly significant agricultural pest species that has been genetically transformed with a piggyBac-based transposon vector system using independent vector and transposase helper plasmids. Minimum estimated germ-line transformation frequencies were approximately 13-21% per fertile G(0) individual, similar to previously reported frequencies using single vector-helper plasmids. Two vector constructs were tested with potential importance to transgenic strain development for mexfly biological control. The first allows post-integration stabilization of a transposon-vector by deletion of a terminal sequence necessary for mobilization. The complete pB[L1-EGFP-L2-DsRed-R1] vector was integrated into the Chiapas wild type strain with subsequent deletion of the L2-DsRed-R1 sub-vector carrying the piggyBac 3' terminal sequence. Quality control tests for three of the stabilization vector lines (previous to stabilization) assessed viability at all life stages, fertility, adult flight ability, and adult male sexual competitiveness. All three transgenic lines were less fit compared to the wild strain by approximately 5-10% in most tests, however, there was no significant difference in sexual competitiveness which is the major prerequisite for optimal strain release. The second vector, pB[XL-EGFP, Asß2-tub-DsRed.T3], has the DsRed.T3 fluorescent protein reporter gene regulated by the A. suspensa Asß2-tubulin promoter, that resulted in testis and sperm-specific DsRed fluorescence in transgenic male mexflies. Fluorescent sperm bundles were unambiguously observed in the spermathecae of non-transgenic females mated to transgenic males. One transgenic line apparently had a male-specific Y-chromosome insertion, having potential use for sexing by fluorescent-embryo sorting. All transgenic lines expressed easily detectable and stable fluorescence in adults allowing their identification after trapping in the field.

  5. Transgenic plants: from first successes to future applications.

    PubMed

    Van Lijsebettens, Mieke; Angenon, Geert; De Block, Marc

    2013-01-01

    This dialogue was held between the Guest Editors of the Special Issue on "Plant Transgenesis" of the Int. J. Dev. Biol. and Marc De Block. He was one of the first scientists worldwide to obtain transgenic plants transformed with the chimeric selectable marker genes encoding neomycin phosphotransferase and bialaphos that confer resistance against the antibiotic kanamycin and the herbicide Basta®/glufosinate, respectively at the Department of Genetics of Ghent University and, later on, at the spin-off company, Plant Genetic Systems. Today, these two genes are still the most frequently utilized markers in transgene technology. Marc De Block chose to work on the improvement of crops in an industrial environment to help realize the production of superior seeds or products. He was part of the team that developed the male sterility/restorer system in canola (Brassica napus var. napus) that led to the first hybrid lines to be commercialized as successful products of transgene technology. In more than 30 years of research, he developed transformation procedures for numerous crops, designed histochemical, biochemical and physiological assays to monitor plant performance, and made original and innovative contributions to plant biology. Presently, he considers transgenic research part of the toolbox for plant improvement and essential for basic plant research.

  6. Spi-1/PU.1 transgenic mice develop multistep erythroleukemias.

    PubMed Central

    Moreau-Gachelin, F; Wendling, F; Molina, T; Denis, N; Titeux, M; Grimber, G; Briand, P; Vainchenker, W; Tavitian, A

    1996-01-01

    Insertional mutagenesis of the spi-1 gene is associated with the emergence of malignant proerythroblasts during Friend virus-induced acute erythroleukemia. To determine the role of spi-1/PU.1 in the genesis of leukemia, we generated spi-1 transgenic mice. In one founder line the transgene was overexpressed as an unexpected-size transcript in various mouse tissues. Homozygous transgenic animals gave rise to live-born offspring, but 50% of the animals developed a multistep erythroleukemia within 1.5 to 6 months of birth whereas the remainder survived without evidence of disease. At the onset of the disease, mice became severely anemic. Their hematopoietic tissues were massively invaded with nontumorigenic proerythroblasts that express a high level of Spi-1 protein. These transgenic proerythroblasts are partially blocked in differentiation and strictly dependent on erythropoietin for their proliferation both in vivo and in vitro. A complete but transient regression of the disease was observed after erythrocyte transfusion, suggesting that the constitutive expression of spi-1 is related to the block of the differentiation of erythroid precursors. At relapse, erythropoietin-independent malignant proerythroblasts arose. Growth factor autonomy could be partially explained by the autocrine secretion of erythropoietin; however, other genetic events appear to be necessary to confer the full malignant phenotype. These results reveal that overexpression of spi-1 is essential for malignant erythropoiesis and does not alter other hematopoietic lineages. PMID:8628313

  7. Influence of Nitrogen Availability on Growth of Two Transgenic Birch Species Carrying the Pine GS1a Gene.

    PubMed

    Lebedev, Vadim G; Kovalenko, Nina P; Shestibratov, Konstantin A

    2017-01-06

    An alternative way to increase plant productivity through the use of nitrogen fertilizers is to improve the efficiency of nitrogen utilization via genetic engineering. The effects of overexpression of pine glutamine synthetase (GS) gene and nitrogen availability on growth and leaf pigment levels of two Betula species were studied. Untransformed and transgenic plants of downy birch (B. pubescens) and silver birch (B. pendula) were grown under open-air conditions at three nitrogen regimes (0, 1, or 10 mM) for one growing season. The transfer of the GS1a gene led to a significant increase in the height of only two transgenic lines of nine B. pubescens, but three of five B. pendula transgenic lines were higher than the controls. In general, nitrogen supply reduced the positive effect of the GS gene on the growth of transgenic birch plants. No differences in leaf pigment levels between control and transgenic plants were found. Nitrogen fertilization increased leaf chlorophyll content in untransformed plants but its effect on most of the transgenic lines was insignificant. The results suggest that birch plants carrying the GS gene use nitrogen more efficiently, especially when growing in nitrogen deficient soil. Transgenic lines were less responsive to nitrogen supply in comparison to wild-type plants.

  8. Influence of Nitrogen Availability on Growth of Two Transgenic Birch Species Carrying the Pine GS1a Gene

    PubMed Central

    Lebedev, Vadim G.; Kovalenko, Nina P.; Shestibratov, Konstantin A.

    2017-01-01

    An alternative way to increase plant productivity through the use of nitrogen fertilizers is to improve the efficiency of nitrogen utilization via genetic engineering. The effects of overexpression of pine glutamine synthetase (GS) gene and nitrogen availability on growth and leaf pigment levels of two Betula species were studied. Untransformed and transgenic plants of downy birch (B. pubescens) and silver birch (B. pendula) were grown under open-air conditions at three nitrogen regimes (0, 1, or 10 mM) for one growing season. The transfer of the GS1a gene led to a significant increase in the height of only two transgenic lines of nine B. pubescens, but three of five B. pendula transgenic lines were higher than the controls. In general, nitrogen supply reduced the positive effect of the GS gene on the growth of transgenic birch plants. No differences in leaf pigment levels between control and transgenic plants were found. Nitrogen fertilization increased leaf chlorophyll content in untransformed plants but its effect on most of the transgenic lines was insignificant. The results suggest that birch plants carrying the GS gene use nitrogen more efficiently, especially when growing in nitrogen deficient soil. Transgenic lines were less responsive to nitrogen supply in comparison to wild-type plants. PMID:28067821

  9. Effects of water stress on antioxidant enzymes of leaves and nodules of transgenic alfalfa overexpressing superoxide dismutases.

    PubMed

    Rubio, Maria C; González, Esther M; Minchin, Frank R; Webb, K. Judith; Arrese-Igor, Cesar; Ramos, Javier; Becana, Manuel

    2002-08-01

    The antioxidant composition and relative water stress tolerance of nodulated alfalfa plants (Medicago sativa L. x Sinorhizobium meliloti 102F78) of the elite genotype N4 and three derived transgenic lines have been studied in detail. These transgenic lines overproduced, respectively, Mn-containing superoxide dismutase (SOD) in the mitochondria of leaves and nodules, MnSOD in the chloroplasts, and FeSOD in the chloroplasts. In general for all lines, water stress caused moderate decreases in MnSOD and FeSOD activities in both leaves and nodules, but had distinct tissue-dependent effects on the activities of the peroxide-scavenging enzymes. During water stress, with a few exceptions, ascorbate peroxidase and catalase activities increased moderately in leaves but decreased in nodules. At mild water stress, transgenic lines showed, on average, 20% higher photosynthetic activity than the parental line, which suggests a superior tolerance of transgenic plants under these conditions. However, the untransformed and the transgenic plants performed similarly during moderate and severe water stress and recovery with respect to important markers of metabolic activity and of oxidative stress in leaves and nodules. We conclude that the base genotype used for transformation and the background SOD isozymic composition may have a profound effect on the relative tolerance of the transgenic lines to abiotic stress.

  10. DETERMINATION OF AN UPPER LIMIT FOR THE WATER OUTGASSING RATE OF MAIN-BELT COMET P/2012 T1 (PANSTARRS)

    SciTech Connect

    O'Rourke, L.; Teyssier, D.; Kueppers, M.; Snodgrass, C.; De Val-Borro, M.; Hartogh, P.; Biver, N.; Bockelee-Morvan, D.; Hsieh, H.; Micheli, M.; Fernandez, Y.

    2013-09-01

    A new Main-Belt Comet (MBC) P/2012 T1 (PANSTARRS) was discovered on 2012 October 6, approximately one month after its perihelion, by the Pan-STARRS1 survey based in Hawaii. It displayed cometary activity upon its discovery with one hypothesis being that the activity was driven by sublimation of ices; as a result, we searched for emission assumed to be driven by the sublimation of subsurface ices. Our search was of the H{sub 2}O 1{sub 10}-1{sub 01} ground state rotational line at 557 GHz from P/2012 T1 (PANSTARRS) with the Heterodyne Instrument for the Far Infrared on board the Herschel Space Observatory on 2013 January 16, when the object was at a heliocentric distance of 2.504 AU and a geocentric distance of 2.064 AU. Perihelion was in early 2012 September at a distance of 2.411 AU. While no H{sub 2}O line emission was detected in our observations, we were able to derive sensitive 3{sigma} upper limits for the water production rate and column density of <7.63 Multiplication-Sign 10{sup 25} molecules s{sup -1} and of <1.61 Multiplication-Sign 10{sup 11} cm{sup -2}, respectively. An observation taken on 2013 January 15 using the Very Large Telescope found the MBC to be active during the Herschel observation, suggesting that any ongoing sublimation due to subsurface ice was lower than our upper limit.

  11. Joint Brain Parametric T1-Map Segmentation and RF Inhomogeneity Calibration

    PubMed Central

    Chen, Ping-Feng; Steen, R. Grant; Yezzi, Anthony; Krim, Hamid

    2009-01-01

    We propose a constrained version of Mumford and Shah's (1989) segmentation model with an information-theoretic point of view in order to devise a systematic procedure to segment brain magnetic resonance imaging (MRI) data for parametric T1-Map and T1-weighted images, in both 2-D and 3D settings. Incorporation of a tuning weight in particular adds a probabilistic flavor to our segmentation method, and makes the 3-tissue segmentation possible. Moreover, we proposed a novel method to jointly segment the T1-Map and calibrate RF Inhomogeneity (JSRIC). This method assumes the average T1 value of white matter is the same across transverse slices in the central brain region, and JSRIC is able to rectify the flip angles to generate calibrated T1-Maps. In order to generate an accurate T1-Map, the determination of optimal flip-angles and the registration of flip-angle images are examined. Our JSRIC method is validated on two human subjects in the 2D T1-Map modality and our segmentation method is validated by two public databases, BrainWeb and IBSR, of T1-weighted modality in the 3D setting. PMID:19710938

  12. Transgenic engineering of male-specific muscular hypertrophy.

    PubMed

    Pirottin, Dimitri; Grobet, Luc; Adamantidis, Antoine; Farnir, Frédéric; Herens, Christian; Schrøder, Henrik Daa; Georges, Michel

    2005-05-03

    Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 enhancer from the TSPY locus on the Y chromosome. Males of the corresponding lines are characterized by a 5-20% increase in skeletal muscle mass. This experiment demonstrates the feasibility of a more efficient cattle production system combining superior beef production abilities for bulls and dairy abilities for cows.

  13. Loss of PiT-1 results in abnormal endocytosis in the yolk sac visceral endoderm.

    PubMed

    Wallingford, Mary C; Giachelli, Cecilia M

    2014-08-01

    PiT-1 protein is a transmembrane sodium-dependent phosphate (Pi) transporter. PiT-1 knock out (KO) embryos die from largely unknown causes by embryonic day (E) 12.5. We tested the hypothesis that PiT-1 is required for endocytosis in the embryonic yolk sac (YS) visceral endoderm (VE). Here we present data supporting that PiT-1 KO results in a YS remodeling defect and decreased endocytosis in the YS VE. The remodeling defect is not due to an upstream cardiomyocyte requirement for PiT-1, as SM22αCre-specific KO of PiT-1 in the developing heart and the YS mesodermal layer (ME) does not recapitulate the PiT-1 global KO phenotype. Furthermore, we find that high levels of PiT-1 protein localize to the YS VE apical membrane. Together these data support that PiT-1 is likely required in YS VE. During normal development maternal immunoglobulin (IgG) is endocytosed into YS VE and accumulates in the apical side of the VE in a specialized lysosome termed the apical vacuole (AV). We have identified a reduction in PiT-1 KO VE cell height and a striking loss of IgG accumulation in the PiT-1 KO VE. The endocytosis genes Tfeb, Lamtor2 and Snx2 are increased at the RNA level. Lysotracker Red staining reveals a loss of distinct AVs, and yolk sacs incubated ex vivo with phRODO Green Dextran for Endocytosis demonstrate a functional loss of endocytosis. As yolk sac endocytosis is controlled in part by microautophagy, but expression of LC3 had not been examined, we investigated LC3 expression during yolk sac development and found stage-specific LC3 RNA expression that is predominantly from the YS VE layer at E9.5. Normalized LC3-II protein levels are decreased in the PiT-1 KO YS, supporting a requirement for PiT-1 in autophagy in the YS. Therefore, we propose the novel idea that PiT-1 is central to the regulation of endocytosis and autophagy in the YS VE.

  14. Morphological transformation of C3H/10T1/2 CL8 cells by procarcinogens

    SciTech Connect

    Oshiro, Y.; Balwierz, P.S.

    1982-01-01

    In order to increase the sensitivity of the C3H/10T1/2 CL8 (10T1/2) cell transformation system, the chemical exposure period was increased to a total of 6 days (two consecutive 3-day exposures). Using this modified procedure, we transformed 10T1/2 cells with procarcinogens such as aflatoxin B/sub 1/, benz(a)anthracene, and 4-nitroquinoline-1-oxide which have been negative in the standard 10T1/2 cell transformation assay. However, ..beta..-naphthylamine was inconclusive and 2-acetylaminofluorine was negative in this modified assay system. Results demonstrate that a simple modification of the 10T1/2 cell transformation method can increase the sensitivity to some procarcinogens that require metabolic activation.

  15. T 1 Relaxation Measurement of Ex-Vivo Breast Cancer Tissues at Ultralow Magnetic Fields

    PubMed Central

    Lee, Seong-Joo; Shim, Jeong Hyun; Kim, Kiwoong; Hwang, Seong-min; Yu, Kwon Kyu; Lim, Sanghyun; Han, Jae Ho; Yim, Hyunee; Kim, Jang-Hee; Jung, Yong Sik; Kim, Ku Sang

    2015-01-01

    We investigated T1 relaxations of ex-vivo cancer tissues at low magnetic fields in order to check the possibility of achieving a T1 contrast higher than those obtained at high fields. The T1 relaxations of fifteen pairs (normal and cancerous) of breast tissue samples were measured at three magnetic fields, 37, 62, and 122 μT, using our superconducting quantum interference device-based ultralow field nuclear magnetic resonance setup, optimally developed for ex-vivo tissue studies. A signal reconstruction based on Bayesian statistics for noise reduction was exploited to overcome the low signal-to-noise ratio. The ductal and lobular-type tissues did not exhibit meaningful T1 contrast values between normal and cancerous tissues at the three different fields. On the other hand, an enhanced T1 contrast was obtained for the mucinous cancer tissue. PMID:25705658

  16. SirT1 Regulates Energy Metabolism and Response to Caloric Restriction in Mice

    PubMed Central

    Boily, Gino; Seifert, Erin L.; Bevilacqua, Lisa; He, Xiao Hong; Sabourin, Guillaume; Estey, Carmen; Moffat, Cynthia; Crawford, Sean; Saliba, Sarah; Jardine, Karen; Xuan, Jian; Evans, Meredith; Harper, Mary-Ellen; McBurney, Michael W.

    2008-01-01

    The yeast sir2 gene and its orthologues in Drosophila and C. elegans have well-established roles in lifespan determination and response to caloric restriction. We have studied mice carrying two null alleles for SirT1, the mammalian orthologue of sir2, and found that these animals inefficiently utilize ingested food. These mice are hypermetabolic, contain inefficient liver mitochondria, and have elevated rates of lipid oxidation. When challenged with a 40% reduction in caloric intake, normal mice maintained their metabolic rate and increased their physical activity while the metabolic rate of SirT1-null mice dropped and their activity did not increase. Moreover, CR did not extend lifespan of SirT1-null mice. Thus, SirT1 is an important regulator of energy metabolism and, like its orthologues from simpler eukaryotes, the SirT1 protein appears to be required for a normal response to caloric restriction. PMID:18335035

  17. Measurement of diffuse ventricular fibrosis with myocardial T1 in patients with atrial fibrillation

    PubMed Central

    Montgomery, Jay A.; Abdallah, Wissam; Yoneda, Zachary T.; Brittain, Evan; Aznaurov, Sam G.; Parvez, Babar; Adkins, Keith; Whalen, S. Patrick; Estrada, J.C.; Shen, Sharon; Crossley, George H.; Kanagasundram, Arvindh; Saavedra, Pablo; Ellis, Christopher R.; Lawson, Mark; Darbar, Dawood; Shoemaker, M. Benjamin

    2015-01-01

    Background Atrial fibrillation (AF) is associated with cardiac fibrosis, which can now be measured noninvasively using T1-mapping with cardiac magnetic resonance imaging (CMRI). This study aimed to assess the impact of AF on ventricular T1 at the time of CMRI. Methods Subjects with AF scheduled for AF ablation underwent CMRI with standard electrocardiography gating and breath-hold protocols on a 1.5 T scanner with post-contrast ventricular T1 recorded from 6 regions of interest at the mid-ventricle. Baseline demographic, clinical, and imaging characteristics were examined using univariate and multivariable linear regression modeling for an association with myocardial T1. Results One hundred fifty-seven patients were studied (32% women; median age, 61 years [interquartile range {IQR}, 55–67], 50% persistent AF [episodes>7 days or requiring electrical or pharmacologic cardioversion], 30% in AF at the time of the CMRI). The median global T1 was 404 ms (IQR, 381–428). AF at the time of CMRI was associated with a 4.4% shorter T1 (p=0.000) compared to sinus rhythm when adjusted for age, sex, persistent AF, body mass index, congestive heart failure, and renal dysfunction (estimated glomerular filtration rate<60). A post-hoc multivariate model adjusted for heart rate suggested that heart rate elevation (p=0.009) contributes to the reduction in T1 observed in patients with AF at the time of CMRI. No association between ventricular T1 and AF recurrence after ablation was demonstrated. Conclusion AF at the time of CMRI was associated with lower post-contrast ventricular T1 compared with sinus rhythm. This effect was at least partly due to elevated heart rate. T1 was not associated with the recurrence of AF after ablation. PMID:26949431

  18. T1BT* structural study of an anti-plasmodial peptide through NMR and molecular dynamics

    PubMed Central

    2013-01-01

    Background T1BT* is a peptide construct containing the T1 and B epitopes located in the 5’ minor repeat and the 3’ major repeat of the central repeat region of the Plasmodium falciparum circumsporozoite protein (CSP), respectively, and the universal T* epitope located in the C-terminus of the same protein. This peptide construct, with B = (NANP)3, has been found to elicit antisporozoite antibodies and gamma-interferon-screening T-cell responses in inbred strains of mice and in outbred nonhuman primates. On the other hand, NMR and CD spectroscopies have identified the peptide B’ = (NPNA)3 as the structural unit of the major repeat in the CSP, rather than the more commonly quoted NANP. With the goal of assessing the structural impact of the NPNA cadence on a proven anti-plasmodial peptide, the solution structures of T1BT* and T1B’T* were determined in this work. Methods NMR spectroscopy and molecular dynamics calculations were used to determine the solution structures of T1BT* and T1B’T*. These structures were compared to determine the main differences and similarities between them. Results Both peptides exhibit radically different structures, with the T1B’T* showing strong helical tendencies. NMR and CD data, in conjunction with molecular modelling, provide additional information about the topologies of T1BT* and T1B’T*. Knowing the peptide structures required to elicit the proper immunogenic response can help in the design of more effective, conformationally defined malaria vaccine candidates. If peptides derived from the CSP are required to have helical structures to interact efficiently with their corresponding antibodies, a vaccine based on the T1B’T* construct should show higher efficiency as a pre-erythrocyte vaccine that would prevent infection of hepatocytes by sporozoites. PMID:23506240

  19. Evaluation of the pituitary gland using magnetic resonance imaging: T1-weighted vs. VIBE imaging.

    PubMed

    Davis, M A; Castillo, M

    2013-06-01

    Volumetric interpolated breath-hold examination (VIBE) is used for abdominal imaging as a fast and efficient modality. Evaluation of brain lesions using VIBE is not common and its use for the pituitary gland has not yet been addressed. Our goal was to compare coronal T1-weighted (T1W) and VIBE images in patients undergoing studies of the pituitary gland. We hypothesized that, for this purpose, VIBE is superior to T1W images. T1W and VIBE images of the pituitary gland in 32 patients were evaluated. The two sequences were compared with specific attention to: contrast enhancement (gland and cavernous sinuses) and ability to view the anatomy of the cavernous sinuses. In patients with macroadenomas, visualization of the optic chiasm was also assessed. Images were rated as: VIBE being better, equal, or worse in comparison to T1W images. We also compared VIBE and T1W images specifically looking at micro/macro-adenomas and post-surgical patients. Statistical analysis was performed using chi-square statistics. Of the 32 patients, the VIBE sequence showed superior contrast enhancement in 18 patients, six were found as being equal to T1W, and in eight instances VIBE was found to be worse than T1W. These results were statistically significant (p=.02). When looking at micro/macro-adenomas and post-surgical patients specifically, there was a trend to VIBE being superior to T1W but these data were not statistically significant. Visualization of chiasm in macroadenomas was similar for both techniques. VIBE was significantly superior to T1W with respect to pituitary and cavernous sinus contrast enhancement and cavernous sinus anatomy. A trend towards VIBE being superior in the evaluation of adenomas (pre- and post-operative) was seen, but it was not statistically significant. This is likely due to the small population size.

  20. Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

    PubMed

    Cao, Xiuling; Lu, Yingui; Di, Dianping; Zhang, Zhiyan; Liu, He; Tian, Lanzhi; Zhang, Aihong; Zhang, Yanjing; Shi, Lindan; Guo, Bihong; Xu, Jin; Duan, Xifei; Wang, Xianbing; Han, Chenggui; Miao, Hongqin; Yu, Jialin; Li, Dawei

    2013-01-01

    Maize rough dwarf disease (MRDD), caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV), the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

  1. Promoting scopolamine biosynthesis in transgenic Atropa belladonna plants with pmt and h6h overexpression under field conditions.

    PubMed

    Xia, Ke; Liu, Xiaoqiang; Zhang, Qiaozhuo; Qiang, Wei; Guo, Jianjun; Lan, Xiaozhong; Chen, Min; Liao, Zhihua

    2016-09-01

    Atropa belladonna is one of the most important plant sources for producing pharmaceutical tropane alkaloids (TAs). T1 progeny of transgenic A. belladonna, in which putrescine N-methyltransferase (EC. 2.1.1.53) from Nicotiana tabacum (NtPMT) and hyoscyamine 6β-hydroxylase (EC. 1.14.11.14) from Hyoscyamus niger (HnH6H) were overexpressed, were established to investigate TA biosynthesis and distribution in ripe fruits, leaves, stems, primary roots and secondary roots under field conditions. Both NtPMT and HnH6H were detected at the transcriptional level in transgenic plants, whereas they were not detected in wild-type plants. The transgenes did not influence the root-specific expression patterns of endogenous TA biosynthetic genes in A. belladonna. All four endogenous TA biosynthetic genes (AbPMT, AbTRI, AbCYP80F1 and AbH6H) had the highest/exclusive expression levels in secondary roots, suggesting that TAs were mainly synthesized in secondary roots. T1 progeny of transgenic A. belladonna showed an impressive scopolamine-rich chemotype that greatly improved the pharmaceutical value of A. belladonna. The higher efficiency of hyoscyamine conversion was found in aerial than in underground parts. In aerial parts of transgenic plants, hyoscyamine was totally converted to downstream alkaloids, especially scopolamine. Hyoscyamine, anisodamine and scopolamine were detected in underground parts, but scopolamine and anisodamine were more abundant than hyoscyamine. The exclusively higher levels of anisodamine in roots suggested that it might be difficult for its translocation from root to aerial organs. T1 progeny of transgenic A. belladonna, which produces scopolamine at very high levels (2.94-5.13 mg g(-1)) in field conditions, can provide more valuable plant materials for scopolamine production.

  2. Stacking of antimicrobial genes in potato transgenic plants confers increased resistance to bacterial and fungal pathogens.

    PubMed

    Rivero, Mercedes; Furman, Nicolás; Mencacci, Nicolás; Picca, Pablo; Toum, Laila; Lentz, Ezequiel; Bravo-Almonacid, Fernando; Mentaberry, Alejandro

    2012-01-20

    Solanum tuberosum plants were transformed with three genetic constructions expressing the Nicotiana tabacum AP24 osmotine, Phyllomedusa sauvagii dermaseptin and Gallus gallus lysozyme, and with a double-transgene construction expressing the AP24 and lysozyme sequences. Re-transformation of dermaseptin-transformed plants with the AP24/lysozyme construction allowed selection of plants simultaneously expressing the three transgenes. Potato lines expressing individual transgenes or double- and triple-transgene combinations were assayed for resistance to Erwinia carotovora using whole-plant and tuber infection assays. Resistance levels for both infection tests compared consistently for most potato lines and allowed selection of highly resistant phenotypes. Higher resistance levels were found in lines carrying the dermaseptin and lysozyme sequences, indicating that theses proteins are the major contributors to antibacterial activity. Similar results were obtained in tuber infection tests conducted with Streptomyces scabies. Plant lines showing the higher resistance to bacterial infections were challenged with Phytophthora infestans, Rhizoctonia solani and Fusarium solani. Considerable levels of resistance to each of these pathogens were evidenced employing semi-quantitative tests based in detached-leaf inoculation, fungal growth inhibition and in vitro plant inoculation. On the basis of these results, we propose that stacking of these transgenes is a promising approach to achieve resistance to both bacterial and fungal pathogens.

  3. Production of Green Fluorescent Protein Transgenic Embryonic Stem Cells Using the GENSAT Bacterial Artificial Chromosome Library

    PubMed Central

    Tomishima, Mark J.; Hadjantonakis, Anna-Katerina; Gong, Shiaoching; Studer, Lorenz

    2010-01-01

    Transgenic green fluorescent protein (GFP) reporter embryonic stem (ES) cells are powerful tools for studying gene regulation and lineage choice during development. Here we present a rapid method for the generation of ES cells expressing GFP under the control of selected genes. Bacterial artificial chromosomes (BACs) from a previously constructed GFP transcriptional fusion library (Gene Expression Nervous System Atlas [GENSAT]) were modified for use in ES cells, and multiple BAC transgenic ES cell lines were generated. Specific GFP expression in transgenic cell lines was confirmed during neural differentiation marking neural stem cells, neuronal precursors, and glial progeny by Hes5, Dll1, and GFAP, respectively. GFP was dynamically regulated in ES cell progeny in response to soluble factors that inhibit Notch signaling and a factor that directs astroglial fate choice. Our protocols provide a simple and efficient strategy to utilize the whole GENSAT BAC library to create hundreds of novel fluorescent cell lines for use in ES cell biology. PMID:16990587

  4. Production of green fluorescent protein transgenic embryonic stem cells using the GENSAT bacterial artificial chromosome library.

    PubMed

    Tomishima, Mark J; Hadjantonakis, Anna-Katerina; Gong, Shiaoching; Studer, Lorenz

    2007-01-01

    Transgenic green fluorescent protein (GFP) reporter embryonic stem (ES) cells are powerful tools for studying gene regulation and lineage choice during development. Here we present a rapid method for the generation of ES cells expressing GFP under the control of selected genes. Bacterial artificial chromosomes (BACs) from a previously constructed GFP transcriptional fusion library (Gene Expression Nervous System Atlas [GENSAT]) were modified for use in ES cells, and multiple BAC transgenic ES cell lines were generated. Specific GFP expression in transgenic cell lines was confirmed during neural differentiation marking neural stem cells, neuronal precursors, and glial progeny by Hes5, Dll1, and GFAP, respectively. GFP was dynamically regulated in ES cell progeny in response to soluble factors that inhibit Notch signaling and a factor that directs astroglial fate choice. Our protocols provide a simple and efficient strategy to utilize the whole GENSAT BAC library to create hundreds of novel fluorescent cell lines for use in ES cell biology.

  5. Origin and Spread of Bos taurus: New Clues from Mitochondrial Genomes Belonging to Haplogroup T1

    PubMed Central

    Bonfiglio, Silvia; Ginja, Catarina; De Gaetano, Anna; Achilli, Alessandro; Olivieri, Anna; Colli, Licia; Tesfaye, Kassahun; Agha, Saif Hassan; Gama, Luis T.; Cattonaro, Federica; Penedo, M. Cecilia T; Ajmone-Marsan, Paolo; Torroni, Antonio; Ferretti, Luca

    2012-01-01

    Background Most genetic studies on modern cattle have established a common origin for all taurine breeds in the Near East, during the Neolithic transition about 10 thousand years (ka) ago. Yet, the possibility of independent and/or secondary domestication events is still debated and is fostered by the finding of rare mitochondrial DNA (mtDNA) haplogroups like P, Q and R. Haplogroup T1, because of its geographic distribution, has been the subject of several investigations pointing to a possible independent domestication event in Africa and suggesting a genetic contribution of African cattle to the formation of Iberian and Creole cattle. Whole mitochondrial genome sequence analysis, with its proven effectiveness in improving the resolution of phylogeographic studies, is the most appropriate tool to investigate the origin and structure of haplogroup T1. Methodology A survey of >2200 bovine mtDNA control regions representing 28 breeds (15 European, 10 African, 3 American) identified 281 subjects belonging to haplogroup T1. Fifty-four were selected for whole mtDNA genome sequencing, and combined with ten T1 complete sequences from previous studies into the most detailed T1 phylogenetic tree available to date. Conclusions Phylogenetic analysis of the 64 T1 mitochondrial complete genomes revealed six distinct sub-haplogroups (T1a–T1f). Our data support the overall scenario of a Near Eastern origin of the T1 sub-haplogroups from as much as eight founding T1 haplotypes. However, the possibility that one sub-haplogroup (T1d) arose in North Africa, in domesticated stocks, shortly after their arrival from the Near East, can not be ruled out. Finally, the previously identified “African-derived American" (AA) haplotype turned out to be a sub-clade of T1c (T1c1a1). This haplotype was found here for the first time in Africa (Egypt), indicating that it probably originated in North Africa, reached the Iberian Peninsula and sailed to America, with the first European settlers

  6. Expression of human protamine P1 in sperm of transgenic mice

    SciTech Connect

    Wyrobek, A.J.; Keith, C.; Stilwell, J.; Lowe, X.; Anderson, G.

    1994-12-31

    Transgenic mice were produced by pronuclear injection with DNA constructs containing human protamine P1 cDNA recombined with a murine protamine P1 promoter, and were identified by PCR. Expression of human P1 was investigated using huplm, a monoclonal antibody specific for human P1, applied to murine testicular cells, smears of epididymal sperm, and smears of detergent-isolated sperm nuclei. Various antibodies and nontransgenic littermates were used as controls. Two male founders (T3 and T7) sired more than five generations of transgenic offspring each with continued expression of human P1 in their sperm. Transgenic animals appear of normal fertility with sperm of typical nuclear morphology. The human P1 transgene was expressed postmeioticly in both lines, as expected. Nearly 100% of sperm of T3 and T7 hemizygotes labeled with huplm, consistent with complete diffusion of human P1 protein through the intercellular bridge of spermatogenic cells. Human P1 labeling of sperm nuclei was not visibly affected by sonication or by treatment with the detergent MATAB or the reducing agent DTT. A third founder female (T5) showed a transmission pattern consistent with insertion of the transgene into an X chromosome; her transgenic offspring expressed human P1 in only a small fraction of sperm. Human P1 transgenes may serve as efficient targets for germinal mutations and transgenicmice may provide promising models for investigating the DNA complexes.

  7. A new transgenic mouse model for conditional overexpression of the Polycomb Group protein EZH2.

    PubMed

    Koppens, Martijn A J; Tanger, Ellen; Nacerddine, Karim; Westerman, Bart; Song, Ji-Ying; van Lohuizen, Maarten

    2017-04-01

    The Polycomb Group protein EZH2 is upregulated in most prostate cancers, and its overexpression is associated with poor prognosis. Most insights into the functional role of EZH2 in prostate cancer have been gained using cell lines and EZH2 inactivation studies. However, the question remains whether overexpression of EZH2 can initiate prostate tumourigenesis or drive tumour progression. Appropriate transgenic mouse models that are required to answer such questions are lacking. We developed one such transgenic mouse model for conditional overexpression of Ezh2. In this transgene, Ezh2 and Luciferase are transcribed from a single open reading frame. The latter gene enables intravital bioluminescent imaging of tissues expressing this transgene, allowing the detection of tumour outgrowth and potential metastatic progression over time. Prostate-specific Ezh2 overexpression by crossbreeding with Probasin-Cre mice led to neoplastic prostate lesions at low incidence and with a long latency. Compounding a previously described Bmi1-transgene and Pten-deficiency prostate cancer mouse model with the Ezh2 transgene did not enhance tumour progression or drive metastasis formation. In conclusion, we here report the generation of a wildtype Ezh2 overexpression mouse model that allows for intravital surveillance of tissues with activated transgene. This model will be an invaluable tool for further unravelling the role of EZH2 in cancer.

  8. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    PubMed Central

    2002-01-01

    Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C), is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57) of transgenic pigs (F0 generation). Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species. PMID:11964188

  9. Phytoremediation of the organic Xenobiotic simazine by p450-1a2 transgenic Arabidopsis thaliana plants.

    PubMed

    Azab, Ehab; Hegazy, Ahmad K; El-Sharnouby, Moh