U.S. EPA, Pesticide Product Label, MR. HOLIDAY CALCIUM HYPOCHLORITE, 09/03/1985

EPA Pesticide Factsheets

2011-04-19

... QrdICfR- IIfT'r (')'rt.~>W!: ~i!"W- \\l'" It(I t,e 1lII\\IICI \\II., De hUI t1 s.~ ,), r, oec 11\\ flitS ~ ~tI ct ~ !"'- iIIl'31:J~ ~!Jet \\.'Id\\I lAd rI/JI:I. ~ ~~~ Ut .... " M:!.t ...

Can T1 w/T2 w ratio be used as a myelin-specific measure in subcortical structures? Comparisons between FSE-based T1 w/T2 w ratios, GRASE-based T1 w/T2 w ratios and multi-echo GRASE-based myelin water fractions.

PubMed

Uddin, Md Nasir; Figley, Teresa D; Marrie, Ruth Ann; Figley, Chase R

2018-03-01

Given the growing popularity of T 1 -weighted/T 2 -weighted (T 1 w/T 2 w) ratio measurements, the objective of the current study was to evaluate the concordance between T 1 w/T 2 w ratios obtained using conventional fast spin echo (FSE) versus combined gradient and spin echo (GRASE) sequences for T 2 w image acquisition, and to compare the resulting T 1 w/T 2 w ratios with histologically validated myelin water fraction (MWF) measurements in several subcortical brain structures. In order to compare these measurements across a relatively wide range of myelin concentrations, whole-brain T 1 w magnetization prepared rapid acquisition gradient echo (MPRAGE), T 2 w FSE and three-dimensional multi-echo GRASE data were acquired from 10 participants with multiple sclerosis at 3 T. Then, after high-dimensional, non-linear warping, region of interest (ROI) analyses were performed to compare T 1 w/T 2 w ratios and MWF estimates (across participants and brain regions) in 11 bilateral white matter (WM) and four bilateral subcortical grey matter (SGM) structures extracted from the JHU_MNI_SS 'Eve' atlas. Although the GRASE sequence systematically underestimated T 1 w/T 2 w values compared to the FSE sequence (revealed by Bland-Altman and mountain plots), linear regressions across participants and ROIs revealed consistently high correlations between the two methods (r 2 = 0.62 for all ROIs, r 2 = 0.62 for WM structures and r 2 = 0.73 for SGM structures). However, correlations between either FSE-based or GRASE-based T 1 w/T 2 w ratios and MWFs were extremely low in WM structures (FSE-based, r 2 = 0.000020; GRASE-based, r 2 = 0.0014), low across all ROIs (FSE-based, r 2 = 0.053; GRASE-based, r 2 = 0.029) and moderate in SGM structures (FSE-based, r 2 = 0.20; GRASE-based, r 2 = 0.17). Overall, our findings indicated a high degree of correlation (but not equivalence) between FSE-based and GRASE-based T 1 w/T 2 w ratios, and low correlations between T 1 w/T 2 w ratios and MWFs. This

Sulphurisation of homohopanoids: Effects on carbon number distribution, speciation, and 22 S/22 R epimer ratios

NASA Astrophysics Data System (ADS)

Köster, Jürgen; Van Kaam-Peters, Heidy M. E.; Koopmans, Martin P.; De Leeuw, Jan W.; Sinninghe Damsté, Jaap S.

1997-06-01

Sulphurisation has been recognised as the most important diagenetic pathway acting on hopanoids in the organic-rich limestones, marlstone, and dolomite investigated. The qualitative and quantitative analysis of free and S-bound hopanoid moieties revealed that the incorporation of sulphur has a major impact on the carbon number distribution, the speciation and on the 22 S/(22S+22 R) ratio of the hopanoids. C 35 carbon skeletons are preferentially preserved by sulphur incorporation at the end of the side chain. Hopanoid sulphides, with the sulphur atom attached to one carbon atom of ring D or E and to one carbon atom of the side chain (condensed-type), are predominantly formed from precursors with a partially degraded side chain. In all samples the degree of sulphurisation of hopanoids increases with increasing carbon number. The carbon skeleton speciation changes with maturation in favour of hopanoid thiophenes, which are evidently the most stable hopanoid sulphur compounds, and hopanes. Hopanes are mainly formed via a sulphurisation/desulphurisation pathway and increase in concentration with maturity. Their original carbon number distribution is strongly shifted towards the lower homologues. With increasing maturity only a slight dominance of the C 35 members emerges. The most abundant series of condensed-type hopanoid sulphides have a 22R homohopane carbon skeleton that is not isomerised during maturation. The generation of hopanes from these condensed-type hopanoid sulphides during maturation leads to 22 S/(22S+22 R) ratios which increase with carbon number (e.g., from about 0.2 for C 31 to 0.5 for C 35 homologues). Data acquired from the sedimentary rock samples are supported by those obtained from artificial maturation experiments of a limestone by hydrous pyrolysis at different temperatures. The data show that generally accepted molecular maturation parameters have to be applied with caution.

Progress towards mapping the constitutional t(11:22) breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnoski, B.L.; Emanuel, B.S.; Bell, C.J.

1994-09-01

The reciprocal t(11;22)(q23;q11) is the most frequent, recurrent, non-Robertsonian, constitutional translocation in humans. Balanced carriers of this rearrangement are phenotypically normal, but are at risk for producing abnormal offspring with the Supernumerary der(22)t(11;22) Syndrome. Further, a recent report of association between t(11;22) balanced translocation carriers and breast cancer, suggests the involvement of genes on 11q and/or 22q in breast cancer tumorigenesis. Studies are in progress to examine the similarity between 11q23 and 22q11 breakpoints in multiple families with the constitutional t(11;22). A 750 kb YAC, which contains markers known to flank the 11q23 breakpoint, was identified in CEPH/Genethon database. FISHmore » with this YAC to two independent t(11;22) cell lines demonstrates signal on both derivative chromosomes. Numerous YACs containing BCRL2, the closest marker proximal to the breakpoint, were identified. Analysis of these YACs to determine which contain the actual breakpoint sequences is complicated by the presence of a duplicated segment of 22q11 which contains a GGTL and a BCRL locus. Sequences homologous to these loci are present at several other locations in 22q11. The BCRL positive YACs were analyzed by Southern hybridization under conditions which distinguish the four members of the BCR/BCRL family. FISH of total yeast DNA plus YAC DNA labeled by nick translation, or biotin-labeled inter-Alu PCR products confirmed the localization of these YACs to 22q11. Additional FISH with these YACS to metaphase spreads prepared from balanced t(11;22) carriers confirm that these clones span the breakpoint, and will allow rapid isolation and definition of the genetic region adjacent to the t(11;22) breakpoint.« less

Synthesis of the new quaternary sulfides K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaLnAgS[sub 3] (Ln = Er, Y, Gd) and the structures of K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaErAgS[sub 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Ping; Ibers, J.A.

1994-05-01

Several new quarternary sulfides, K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaLnAgS[sub 3] (Ln = Er, Y, Gd), have been synthesized by the reaction of the constituent binary chalcogenides and elements at 1000[degrees]C. The crystal structures of K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaErAgS[sub 3] have been determined by single-crystal X-ray diffraction techniques. Crystal data: K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11]-space group D[sup 8][sub 4h] - P4/ncc, M = 1023.88, Z = 4, a = 8.587(1), c = 27.892(4) [angstrom] (T = 115 K), V = 2056.7(4) [angstrom][sup 3], R[sub W](F[sup 2]) = 0.093 for 1965 observations having F[sup 2][sub 0] >more » 2[sigma](F[sup 2][sub 0]); BaEr AgS[sub 3]-space group C[sup 3][sub 2H] - C2/m, M = 508.65, Z = 4, a = 17.340(4), b = 4.014(1), x = 8.509(2) [angstrom], [beta] = 103.23(3)[degrees], (T = 115 K), V = 576.5(2) [angstrom][sup 3], R[sub W](F[sup 2]) = 0.049 for 1404 observations and 48 variables, R(F) = 0.018 for 1299 observations having F[sup 2][sub 0] > 2[sigma](F[sup 2][sub 0]). In both structures, the rare-earth atoms have octahedral coordination and the octahedra form slabs through edge- and corner-sharing. These slabs are separated by K[sup +] Ba[sup 2+] cations, and are crosslinked into three-dimensional frameworks by Sn[sub 2]S[sub 6] units as edge-sharing SnS[sub 4] tetrahedral pairs in K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11], and by Ag[sub 2]S[sub 9] units as corner-sharing trigonal-bipyramidal AgS[sub 5] pairs in BaEr AgS[sub 3]. From their powder diffraction patterns, BaYAgS[sub 3] and Ba GdAgS[sub 3] appear to be isostructural with BaErAgS[sub 3].« less

Characterization of a novel 8R,11S-linoleate diol synthase from Penicillium chrysogenum by identification of its enzymatic products[S

PubMed Central

Shin, Kyung-Chul; Seo, Min-Ju; Oh, Deok-Kun

2016-01-01

To identify novel fatty acid diol synthases, putative candidate sequences from Penicillium species were analyzed, and hydroxy fatty acid production by crude Penicillium enzyme extracts was assessed. Penicillium chrysogenum was found to produce an unknown dihydroxy fatty acid, a candidate gene implicated in this production was cloned and expressed, and the expressed enzyme was purified. The product obtained by the reaction of the purified enzyme with linoleic acid was identified as 8R,11S-dihydroxy-9,12(Z,Z)-octadecadienoic acid (8R,11S-DiHODE). The catalytic efficiency of this enzyme toward linoleic acid was the highest among the unsaturated fatty acids tested, indicating that this enzyme was a novel 8R,11S-linoleate diol synthase (8R,11S-LDS). A sexual stage in the life cycle of P. chrysogenum has recently been discovered, and 8R,11S-DiHODE produced by 8R,11S-LDS may constitute a precocious sexual inducer factor, responsible for regulating the sexual and asexual cycles of this fungus. PMID:26681780

U.S. EPA, Pesticide Product Label, VETERINARIAN TYPE DISINFECTANT, 10/22/1980

EPA Pesticide Factsheets

2011-04-14

nlR[< I Itl'\\S fOJ;: !'S! GENER,\\l CI ,\\SSl F IrATI,·" i t ',j 3 It is ;1 viol"t{"l' tf r .. rl"ral ,.~". fl' ., .. pl'~duct in aI I9I11:nnf"r in.''1l ... • . t.·:1t '.·It" It l.ht"'liny. L ...

Search for W' →> t$$\\bar{b}$$ in p$$\\bar{p}$$Collisions at √(s)=1.96 TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cully, James Clark

2009-01-01

We present a search for a narrow resonance in the tmore » $$\\bar{b}$$ mass spectrum using 1.9 fb -1 of p$$\\bar{p}$$ collisions at √s = 1.96 TeV recorded with the CDF II detector at the Fermilab Tevatron. We select events with a lepton, neutrino candidate, and two or three jets from which to construct the t$$\\bar{b}$$ mass. We quantify the result using the model of a massive Standard Model-like charged-boson (W') decaying to t$$\\bar{b}$$, but we are generally sensitive to the presence of any narrow state decaying to the third generation. For a purely right-handed W' with Standard Model couplings, we set a new limit at 95% confidence of σ(p$$\\bar{p}$$ → W' R) x BR(W' R → t$$\\bar{b}$$) < 0.28 pb and M W'R > 800 GeV/c 2. The limit increases to M W' R > 825 GeV/c 2 if decay to right-handed neutrinos is forbidden. These results are shown in Table 7 and plotted in Figure 7.1. The best prior search found M W' Ge 768 GeV/c 2 if leptonic decays are forbidden [16]. For a simple W' model with effective coupling g W', the cross-section is proportional to g W' 4. Relaxing the assumption of the universal weak coupling (g W' = g W), our cross-section limits can be rewritten as upper limits on g W', as a function of M W'. This is relevant to both the right-handed W' model as well as a left-handed W' model in which the W' L-W interference is negligible. The excluded region of the g W'-M W' plane is shown in Figure 7.2, with g W' in units of g W. At M W' = 300 GeV/c 2, we limit (95% C.L.) the effective coupling to be less than 0.40 of the standard weak coupling.« less

Comprehensive Occupational Data Analysis Programs 80 (CODAP80) User’s Manual.

DTIC Science & Technology

1984-01-01

8217 -____ ____ ___ - -- -- -~--- - PA"m: 84/006a 5, -(,0 i 4. TH IkdmS. lbne ISCOMlPREHENS IVE OCCUPATIONAL DATA ANALYSIS PROGRAMS 80 (CODAP80) JAUARY 1984 User s Manua 7. Auw...AD-A144 125 COMPEHIENSIVE OCCUPATIONAL DATA ANALYSIS PROGRAMS 80 ’i (CODAP8OI USES MANUAtfUD NAVY OCCUPATIONAL DEVELOPMENT AND ANALYSIS CENTER...e COMPREVENSIVE OCCUPATIONAL DATA ANALYSIS PROGRAMS 80 (CODAP80) JANUARY 1984Uer s Manual 7. Author(s) L. pt, t wis ONapetion ft.p No. N/A 9

Structures of exocyclic R,R- and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine adducts induced by 1,2,3,4-diepoxybutane.

PubMed

Kowal, Ewa A; Seneviratne, Uthpala; Wickramaratne, Susith; Doherty, Kathleen E; Cao, Xiangkun; Tretyakova, Natalia; Stone, Michael P

2014-05-19

1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N(6) position of adenine in DNA. Two enantiomers of bis-N(6)-dA adducts of DEB have been identified: R,R-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (R,R-DHB-dA), and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (S,S-DHB-dA) [ Seneviratne , U. , Antsypovich , S. , Dorr , D. Q. , Dissanayake , T. , Kotapati , S. , and Tretyakova , N. ( 2010 ) Chem. Res. Toxicol. 23 , 1556 -1567 ]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5'-d(C(1)G(2)G(3)A(4)C(5)X(6)A(7)G(8)A(9)A(10)G(11))-3':5'-d(C(12)T(13)T(14)C(15)T(16)T(17)G(18)T(19)C(20)C(21)G(22))-3' duplex [X(6) = R,R-DHB-dA (R(6)) or S,S-DHB-dA (S(6))]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N(6) bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N(6) bond, allows the complementary thymine, T(17), to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T(17) N3H imino proton. The loss of the second Watson-Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as

[Expression of miR-22 and miR-150 in type 1 diabetes mellitus: Possible relationship with autoimmunity and clinical characteristics].

PubMed

Estrella, Santiago; Garcia-Diaz, Diego F; Codner, Ethel; Camacho-Guillén, Patricia; Pérez-Bravo, Francisco

2016-09-16

Type 1 diabetes (T1D) is an autoimmune disease of complex aetiology. Several microRNAs (miR) have been linked to the pathogenesis of autoimmune diseases. To analyze the possible association of miR-22 and miR-150 with autoimmunity and clinical severity of T1D. The study was performed in peripheral blood mononuclear cells of 20 patients with T1D and 20 control subjects. The expression of miR-22 and miR-150 was performed in peripheral blood mononuclear cells using TaqMan probes to different glucose concentrations (baseline, 11mm, 25mm). Our results suggest that the expression of miR-22 is increased in T1D patients compared to the controls. This effect was observed in baseline glucose conditions and decreased in 11 and 25mM of glucose. The expression of miR-150 was lower in T1D patients versus the controls. There was no correlation between the autoimmune profile and the two studied miRNAs. miR-22 (baseline condition) and miR-150 (11mM condition) or the ketoacidosis component. miR-22 and 150 were not associated with the autoimmune component present in T1D patients. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

U.S. EPA, Pesticide Product Label, , 11/23/1966

EPA Pesticide Factsheets

2011-04-14

... r ~ ~,1]l~ ~ ~{Ql1! !IINK( I ~~~.~itt~~~I~~ 11 l ~~~~~ t· --' L . . ~_".... ___ . __ . ..--J ' . • t ) IL " t~S .. 50· Formulating Information! ...

U.S. EPA, Pesticide Product Label, 7.5% SEVIN 1.8% METHYL PARATHION, 12/11/1969

EPA Pesticide Factsheets

2011-04-14

... sa!}. :\\f.\\S'fElt BH\\'" J)u"t mOl) h., apillit'd aft"r hllils op.'n .. \\lIow i da'- hl'l""·'' 1.1,·1 ;'i):>ii(.,~i'l!l .wJ j.('ol/.in~ 1,·" .. 1('0 ti.·ids or hanl'sli'!K crill' ft',,:duI' fur u ...

Structures of Exocyclic R,R- and S,S-N6,N6-(2,3-Dihydroxybutan-1,4-diyl)-2′-Deoxyadenosine Adducts Induced by 1,2,3,4-Diepoxybutane

PubMed Central

2015-01-01

1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N6 position of adenine in DNA. Two enantiomers of bis-N6-dA adducts of DEB have been identified: R,R-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (R,R-DHB-dA), and S,S-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (S,S-DHB-dA) [SeneviratneU., AntsypovichS., DorrD. Q., DissanayakeT., KotapatiS., and TretyakovaN. (2010) Chem. Res. Toxicol.23, 1556−156720873715]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5′-d(C1G2G3A4C5X6A7G8A9A10G11)-3′:5′-d(C12T13T14C15T16T17G18T19C20C21G22)-3′ duplex [X6 = R,R-DHB-dA (R6) or S,S-DHB-dA (S6)]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N6 bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N6 bond, allows the complementary thymine, T17, to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T17 N3H imino proton. The loss of the second Watson–Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as compared to the corresponding unmodified duplex. The reduced base stacking at the

Lusztig symmetries and Poincare-Birkhoff-Witt basis for wU{sub r,s}{sup d}(osp(1|2n))

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Junli; College of Applied Sciences, Beijing University of Technology, Beijing 100124; Yang, Shilin

2013-12-15

We investigate a new kind of two-parameter weak quantized superalgebra wU{sub r,s}{sup d}(osp(1|2n)), which is a weak Hopf superalgebra. It has a homomorphic image which is isomorphic to the usual two-parameter quantum superalgebra U{sub r,s}(osp(1|2n)) of osp(1|2n). We also discuss the basis of wU{sub r,s}{sup d}(osp(1|2n)) by Lusztig's symmetries.

Competencies of Organizational Effectiveness Consultants in the U.S. Army

DTIC Science & Technology

1981-05-01

through OD. Management Review, 1978, 67(2), 52-56. Huse, E. F. Organization development and change. St. Paul , MN: West Publishing, 1975. Huse, E. F...11(4), 457-474. Paul , W. J., Robertson, K. B., & Herzberg, F. Job enrichment pays off. Harvard Business Review, 1969, 47, 61-78. Pedalino, E... Neubert , S. F., & Hulswit, F. T. How one R&D department increased productivity. International Journal of Research Management, 1974, 17(5), 17-22

Renal cell carcinoma and a constitutional t(11;22)(q23;q11.2): case report and review of the potential link between the constitutional t(11;22) and cancer.

PubMed

Doyen, Jérôme; Carpentier, Xavier; Haudebourg, Juliette; Hoch, Benjamin; Karmous-Benailly, Houda; Ambrosetti, Damien; Fabas, Thibault; Amiel, Jean; Lambert, Jean-Claude; Pedeutour, Florence

2012-11-01

We observed a t(11;22)(q23-24;q11.2-12) and monosomy 3 in renal tumor cells from a 72-year-old man. The hypothesis of a primitive peripheral neuroectodermal tumor (PPNET) located in the kidney was promptly excluded: Histologically, the tumor was a clear cell renal cell carcinoma (RCC) and we did not observe an EWSR1 gene rearrangement. The constitutional origin of this alteration was established. We report on the second case of RCC in a patient with a constitutional t(11;22). The t(11;22)(q23;q11.2) is the main recurrent germline translocation in humans. Unbalanced translocation can be transmitted to the progeny and can cause Emanuel syndrome. Our observation alerts cancer cytogeneticists to the fortuitous discovery of the constitutional t(11;22) in tumor cells. This translocation appears grossly similar to the t(11;22)(q24;q12) of PPNET and should be evoked if present in all cells of a tumor other than PPNET. This is important when providing appropriate genetic counseling. Moreover, the potential oncogenic role of the t(11;22) and its predisposing risk of cancer are under debate. The family history of the patient revealed a disabled brother who died at an early age from colon cancer and a sister with breast cancer. This observation reopens the issue of a link between the constitutional t(11;22) and cancer, and the utility of cancer prevention workups for t(11;22) carriers. Copyright © 2012 Elsevier Inc. All rights reserved.

Measurement of the 1s Hyperfine Transition of Two Tl^80+ Isotopes

NASA Astrophysics Data System (ADS)

Beiersdorfer, P.; Utter, S. B.; Wong, K. L.; Crespo López-Urrutia, J. R.; Britten, J. A.; Chen, H.; Thoe, R. S.; Thorn, D. B.; Träbert, E.; Gustavsson, M. G. H.; Forssén, C.; Mårtenson-Pendrill, A.-M.; Harris, C. L.

2001-05-01

The hyperfine splitting of the 1s ground state has been measured for the two stable isotopes of hydrogen-like Tl using emission spectroscopy in the SuperEBIT electron beam ion trap. The results are 3858.22± 0.30 Åfor ^203Tl^80+ and 3821.84± 0.34 Åfor ^205Tl^80+. These differ by about 60 Å from recent and about 19 Å from very recent calculations, illustrating unsolved issues affecting these transitions in hydrogen-like ions. The wavelength difference Δλ = 36.38± 0.35 Å is consistent with estimates based on hyperfine anomaly data for neutral Tl. By using previously determined nuclear magnetic moments and applying appropriate corrections for the nuclear charge distribution and radiative effects, the experimental splittings can be interpreted in terms of nuclear magnetization radii < r^2_m>^1/2= 5.83(14) fm for ^203Tl and < r^2_m>^1/2= 5.89(14) fm for ^205Tl. These values are 10% larger than derived from single-particle nuclear magnetization models, and are slightly larger than the corresponding charge distributions. *Work performed under the auspices of DOE by UCLLNL under contract W-7405-ENG-48 and supported by the Office of Basic Energy Sciences.

U.S. EPA, Pesticide Product Label, PROKIL DIURON 80W, 05/26/1971

EPA Pesticide Factsheets

2011-04-21

... itt' \\H'!.\\.h ,.1''':' dr,}livrJ intll t!;;· 'flttill~; pC'l'l,d hy \\,:l1ltlll,li pr.I\\.'ti\\.:I..: ,l}lp. ... U";,' ~ 11,::, P'.'! .tl.'l't'. 1'\\ \\;1· ly 1'1;1;'" .• In.1,. lit I,l:l:-r, Itt Ihv ;'.1' ... , ...

Interaction mechanism exploration of R-bicalutamide/S-1 with WT/W741L AR using molecular dynamics simulations.

PubMed

Liu, Hongli; An, Xiaoli; Li, Shuyan; Wang, Yuwei; Li, Jiazhong; Liu, Huanxiang

2015-12-01

R-Bicalutamide is a first generation antiandrogen used to treat prostate cancer, which inhibits androgen action by competitively binding to the androgen receptor (AR). However, R-bicalutamide was discovered to exhibit some agonistic properties in clinical application. According to reports, the W741L AR mutation may lead to resistance towards R-bicalutamide. But the mechanism of the R-bicalutamide switch from an antagonist to an agonist due to the mutation of AR W741L is still not so clear. Another molecule, S-1, owing to a very similar structure to R-bicalutamide, is always agonistic to both the wild type and W741L AR. The main difference between these two chemicals is that S-1 has an ether linkage while R-bicalutamide has a sulfonyl group. To study the drug-resistant mechanism caused by W741L mutation and the opposite effects arising from subtle structure differences, molecular dynamics (MD) simulations and molecular mechanics generalized Born surface area (MM-GBSA) calculations were employed to explore the interaction mechanisms between R-bicalutamide/S-1 and WT/W741L AR. The calculated binding free energies are in accordance with the reported experimental values. The obtained results indicate that M895 and W741 are vital amino acids in the antagonism of R-bicalutamide. The bulkier substitution of sulfonyl and tryptophan push aside M895, together with helix 12 (H12), to expose the ligand-binding domain resulting in the antagonistic conformation of the AR. If W741 is mutated to L741, the B-ring of these two chemicals would shift toward L741. At the same time, M895 dragging helix H12, would also move closer to L741. So H12 tends to cover the AR ligand-binding domain to a certain degree, changing the androgen receptor from an antagonistic to an agonistic conformation, which may explain the agonism of R-bicalutamide to the mutant W741L AR.

Electron excitation cross sections for the 2s(2)2p(3)4S(O) -- 2s(2)2p(3)2D(O) (forbidden) and 4S(O) -- 2s2p(4) 4P (resonance) transitions in O II

NASA Technical Reports Server (NTRS)

Zuo, M.; Smith, Steven J.; Chutjian, A.; Williams, I. D.; Tayal, S. S.; Mclaughlin, Brendan M.

1995-01-01

Experimental and theoretical excitation cross sections are reported for the first forbidden transition 4S(O) -- 2S(2)2p(3) 2D(O) (lambda-lambda 3726, 3729) and the first allowed (resonance) transition 4S(O) -- 2s2p(4) 4P(lambda-833) in O II. Use is made of electron energy loss and merged-beams methods. The electron energy range covered is 3.33 (threshold) to 15 eV for the S -- D transition, and 14.9 (threshold) to 40 eV for the S -- P transition. Care was taken to assess and minimize the metastable fraction of the O II beam. An electron mirror was designed and tested to reflect inelastically backscattered electrons into the forward direction to account for the full range of polar scattering angles. Comparisons are made between present experiments and 11-state R-matrix calculations. Calculations are also presented for the 4S(O) -- 2s(2)2p(3)2P(O) (lambda-2470) transition.

U.S. EPA, Pesticide Product Label, D.Z.N DIAZINON 50W INSECTICIDE, 04/11/1988

EPA Pesticide Factsheets

2011-04-13

... i\\ll!Jl'i 1'; I flllt:n.lilt ;:)rl,/ 1 It). I: ;Je,:-n ,Ji 1/.1 f):)!) J~'; ,J\\'~' ;1)·;. j')r-:;ldrd (>11 <)[ ,~ J.l1';. ;\\I;,"T l'lT t '/1)" ()II :"'t l()(j '11: ()f 'vI,lt ··r. j , \\j , -10- ...

5S rRNA-derived and tRNA-derived SINEs in fruit bats.

PubMed

Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

2009-05-01

Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

The pharmacokinetics and pharmacodynamics of single dose (R)- and (S)-warfarin administered separately and together: relationship to VKORC1 genotype

PubMed Central

Maddison, John; Somogyi, Andrew A; Jensen, Berit P; James, Heather M; Gentgall, Melanie; Rolan, Paul E

2013-01-01

AIMS 1) To determine the pharmacokinetics and pharmacodynamics of (R)- and (S)-warfarin given alone and in combination and 2) to determine whether the relative potency of (R)- and (S)-warfarin is dependent on VKORC1 genotype. METHODS A three way crossover study was conducted in which 17 healthy male subjects stratified by VKORC1 1173 C>T genotype and all CYP2C9 1*/1* received (R)-warfarin 80 mg, (S)-warfarin 12.5 mg and rac-warfarin sodium 25 mg. Plasma (R)- and (S)-warfarin unbound and total concentrations and prothrombin time were determined at multiple time points to 168 h. RESULTS Pharmacokinetic parameters for (R)- and (S)-warfarin were similar to the literature. (R)-warfarin 80 mg alone resulted in a mean AUCPT (0,168 h) of 3550 s h (95% CI 3220, 3880). Rac-warfarin sodium 25 mg containing (S)-warfarin 11.7 mg produced a greater effect on AUCPT (0,168 h) than (S)-warfarin 12.5 mg (mean difference 250 s.h, 95% CI 110, 380, P < 0.002) given alone. In a mixed effects model the ratio of response between (R)- and (S)-warfarin (AUCPT((R)-warfarin) : AUCPT((S)-warfarin)) was 1.21 fold higher (95% CI 1.05, 1.41, P < 0.02) in subjects of VKORC1 TT genotype compared with the CC genotype. CONCLUSIONS (R)-warfarin has a clear PD effect and contributes to the hypoprothrombinaemic effect of rac-warfarin. VKORC1 genotype is a covariate of the relative R/S potency relationship. Prediction of drug interactions with warfarin needs to consider effects on (R)-warfarin PK and VKORC1 genotype. PMID:22616655

The S.M.A.R.T. Strategy to Recruiting and Retaining High School Coaches

ERIC Educational Resources Information Center

Lubisco, Robyn; Birren, Genevieve F. E.

2017-01-01

This article discusses the S.M.A.R.T. strategy for recruiting and retaining quality high school coaches. S.M.A.R.T. stands for Scouting, Mentoring and Coaching, Appreciation, Rating, and Time. Scouting addresses how one goes about locating and hiring quality coaches. Mentoring and Coaching addresses how to develop the coach within the specific…

Structural insights into the roles of the IcmS-IcmW complex in the type IVb secretion system of Legionella pneumophila.

PubMed

Xu, Jianpo; Xu, Dandan; Wan, Muyang; Yin, Li; Wang, Xiaofei; Wu, Lijie; Liu, Yanhua; Liu, Xiaoyun; Zhou, Yan; Zhu, Yongqun

2017-12-19

The type IVb secretion system (T4BSS) of Legionella pneumophila is a multiple-component apparatus that delivers ∼300 virulent effector proteins into host cells. The injected effectors modulate host cellular processes to promote bacterial infection and proliferation. IcmS and IcmW are two conserved small, acidic adaptor proteins that form a binary complex to interact with many effectors and facilitate their translocation. IcmS and IcmW can also interact with DotL, an ATPase of the type IV coupling protein complex (T4CP). However, how IcmS-IcmW recognizes effectors, and what the roles of IcmS-IcmW are in T4BSSs are unclear. In this study, we found that IcmS and IcmW form a 1:1 heterodimeric complex to bind effector substrates. Both IcmS and IcmW adopt new structural folds and have no structural similarities with known effector chaperones. IcmS has a compact global structure with an α/β fold, while IcmW adopts a fully α-folded, relatively loose architecture. IcmS stabilizes IcmW by binding to its two C-terminal α-helices. Photocrosslinking assays revealed that the IcmS-IcmW complex binds its cognate effectors via an extended hydrophobic surface, which can also interact with the C terminus of DotL. A crystal structure of the DotL-IcmS-IcmW complex reveals extensive and highly stable interactions between DotL and IcmS-IcmW. Moreover, IcmS-IcmW recruits LvgA to DotL and assembles a unique T4CP. These data suggest that IcmS-IcmW also functions as an inseparable integral component of the DotL-T4CP complex in the bacterial inner membrane. This study provides molecular insights into the dual roles of the IcmS-IcmW complex in T4BSSs.

22. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

22. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1926. Vol. I, Narrative and Photographs, RG 75, Entry 655, Box 29, National Archives, Washington, DC.) Photographer unknown. SACATON DAM, SOUTH END WITH CANAL AND ROADWAY, 8/29/25 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

Synthesis, characterization, structural and biological aspects of copper(II) dithiocarbamate complexes - Part II, [Cu{S2CN(Me)(R1)}2], [Cu{S2CN(Me)(R2)}2] and [Cu{S2CN(R3)(R4)}2] {R1 = CH2CH(OMe)2, R2 = 2-methyl-1,3-dioxolane, R3 = CH2(CH2)2NCHPhOCH2Ph and R4 = CH2CH2OH}

NASA Astrophysics Data System (ADS)

Ferreira, Isabella P.; de Lima, Geraldo M.; Paniago, Eucler B.; Takahashi, Jacqueline A.; Krambrock, Klaus; Pinheiro, Carlos B.; Wardell, James L.; Visentin, Lorenzo C.

2013-09-01

Three new copper(II) dithiocarbamates (DTC), [Cu{S2CN(Me)(R1)}2] (1), [Cu{S2CN(Me)(R2)}2] (2) and [Cu{S2CN(R3)(R4)}2] (3) with R1 = CH2CH(OMe)2, R2 = 2-methyl-1,3-dioxolane, R3 = CH2(CH2)2NCHPhOCH2Ph and R4 = CH2CH2OH, have been synthesized and characterized by different spectroscopic techniques. Complexes (1) and (2) display typical EPR spectra for separated Cu(II) centers, and the spectrum of (3) is characteristic of two magnetically coupled Cu(II) ions with S = 1. The X-ray crystallographic determination has shown that complexes (1) and (2) crystallise in the triclinic and monoclinic systems. In addition both complexes are monomers in which the geometry at each Cu(II) is square planar. The in vitro antimicrobial activity of the sodium salts of ligands, and of the Cu(II)-DTC complexes have been screened against Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Penicillium citrinum and Curvularia senegalensis, as well as Gram positive and Gram negative bacteria. Finally, the toxic effects of complexes (1)-(3) were performed using Chlorella vulgaris.

10. Photographic copy of copy of original construction drawing, dated ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

10. Photographic copy of copy of original construction drawing, dated 1899?. Original in possession of Twin Lakes Reservoir and Canal Company, Ordway, Colorado. PLAN OF DAM AND HEAD GATES FOR THE TWIN LAKES RESERVOIR. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

1. GENERAL VIEW OF THE LOWER END OF TWIN LAKES ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. GENERAL VIEW OF THE LOWER END OF TWIN LAKES SHOWING THE HISTORIC OUTLET WORKS AT THE EDGE OF THE WATER NEAR CENTER OF THE PHOTO WITH THE NEW TWIN LAKES DAM JUST BEHIND. VIEW LOOKING SOUTHEAST. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

Psychopathology and cognition in children with 22q11.2 deletion syndrome

PubMed Central

Niarchou, Maria; Zammit, Stanley; van Goozen, Stephanie H. M.; Thapar, Anita; Tierling, Hayley M.; Owen, Michael J.; van den Bree, Marianne B. M.

2014-01-01

Background Children with 22q11.2 deletion syndrome (22q11.2DS) have been reported to have high rates of cognitive and psychiatric problems. Aims To establish the nature and prevalence of psychiatric disorder and neurocognitive impairment in children with 22q11.2DS and test whether risk of psychopathology is mediated by the children’s intellectual impairment. Method Neurocognition and psychopathology were assessed in 80 children with 22q11.2DS (mean age 10.2 years, s.d. = 2.1) and 39 sibling controls (mean age 10.9 years, s.d. = 2.0). Results More than half (54%) of children with 22q11.2DS met diagnostic criteria for one or more DSM-IV-TR psychiatric disorder. These children had lower IQ (mean 76.8, s.d. = 13.0) than controls (mean 108.6, s.d. = 15.2) (P<0.001) and showed a range of neurocognitive impairments. Increased risk of psychopathology was not mediated by intellectual impairment. Conclusions 22q11.2DS is not related to a specific psychiatric phenotype in children. Moreover, the deletion has largely independent effects on IQ and risk of psychopathology, indicating that psychopathology in 22q11.2DS is not a non-specific consequence of generalised cognitive impairment. PMID:24115343

Understanding the Delay in Onset of Paget’s Disease of Bone

DTIC Science & Technology

2014-09-01

Virol 2011;85:3162-3171. 6. Indoh T , Yokota S, Okabayashi T , Yokosawa N, Fujii N. Suppression of NF-kappaB and AP-1 activation in monocytic cells...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Annual Progress Report, FY 1980 (U.S. Army Medical Research Institute of Infectious Diseases, Frederick, MD)

DTIC Science & Technology

1980-10-01

Detrick, MD 21701 Fort Detrick, MD 21701 PW 44.p UW ~$" TOM r,ý 8i It V &. A ý 0.00"UAL wmwo* Anderson, A. 0. Barquist, R. F. IWLEPMgo: 301 663-7211 S301...Antiviral Agent (R. A. Smith and W. Kirkpatrick, eds). Academic Press, New York. 10i RESIAMO A14D TECNOOGY W=~ UW SUMAMY DA 0G6427 80 10 01 DOD96Z&(AR)OJ6 L...Defense; 010100 Microbiology 77 10 80 0Q*..... C. In-house I, a* 010WOA a"Isb-Ws ?A I5T V -WLAL 8 1.0 121 VONA We"J lo of 444 C UW S". 0MY 0 S USA

Trauma simulation in bilingual Canada: Insurmountable barrier or unexpected strength? Insights from the first bilingual S.T.A.R.T.T. course.

PubMed

Gillman, Lawrence M; Widder, Sandy; Clément, Julien; Engels, Paul T; Paton-Gay, John Damian; Brindley, Peter G

2016-04-01

The Standardized Trauma and Resuscitation Team Training (S.T.A.R.T.T.) course focuses on training multidisciplinary trauma teams: surgeons/physicians, registered nurses (RNs), respiratory therapists (RTs) and, most recently, prehospital personnel. The S.T.A.R.T.T. curriculum highlights crisis management (CRM) skills: communication, teamwork, leadership, situational awareness and resource utilization. This commentary outlines the modifications made to the course curriculum in order to satisfy the learning needs of a bilingual audience. The results suggest that bilingual multidisciplinary CRM courses are feasible, are associated with high participant satisfaction and have no clear detriments.

11. Photocopy of photograph, U.S. Army, ca. 1943 (original print ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Photocopy of photograph, U.S. Army, ca. 1943 (original print located at Rocky Mountain Arsenal, Commerce City, Colorado). R.M.A. - 243 - COMPRESSOR BLDG. 1st FL. LOOKING N.W. - Rocky Mountain Arsenal, Chlorine Production Cell Building, 405 feet South of December Seventh Avenue; 330 feet West of D Street, Commerce City, Adams County, CO

Parieto-occipital lobe epilepsy caused by a POLG1 compound heterozygous A467T/W748S genotype.

PubMed

Roshal, David; Glosser, David; Zangaladze, Andro

2011-06-01

We describe a 16-year-old woman with a rare POLG1 A467T/W748S genotype, with a wide range of neurological manifestations, including focal parieto-occipital lobe seizures, migraine headaches, cerebellar ataxia, sensory-motor axonal neuropathy, and impairment of visual perception and cognitive function. Treatment of epilepsy in patients with a POLG1 compound heterozygous A467T/W748S genotype is very challenging; the epilepsy may preferentially respond to sodium channel blockers. The POLG1-related syndrome has a variable clinical course, and disease morbidity and mortality may be correlated with the genotype. Copyright © 2011 Elsevier Inc. All rights reserved.

Potential tuning in the S-W system. (i) Bringing T c,2 to ambient pressure, and (ii) colliding T c,2 with the liquid-vapor spinodal

NASA Astrophysics Data System (ADS)

Angell, C. Austen; Kapko, Vitaliy

2016-09-01

Following Vasisht et al’s identification of the second critical point (T c2, P c2) for liquid silicon in the Stillinger-Weber (S-W) model for silicon, we study the variation of T c2, P c2 with tetrahedral repulsion parameter in an extension of the earlier ‘potential tuning’ study of this system. We use the simple isochore crossing approach to identify the location of the second critical point (before any crystallization can occur) as a function of the ‘tuning’ or ‘tetrahedrality’, parameter λ, and identify two phenomena of high interest content. The first is that the second critical point pressure P c2, becomes less negative as λ decreases from the silicon value (meaning the drive to high tetrahedrality is decreased) and reaches zero pressure at the same value of lambda found to mark the onset of glassforming ability in an earlier study of this tunable system. The second is that, as the T c,2 approaches the temperature of the liquid-gas spinodal, λ  >  22, the behavior of the temperature of maximum density (TMD) switches from the behavior seen in most current water pair potential models (locus of TMDs has a maximum), to the behavior seen in empirical engineering multiparameter equations of state (EoS) (and also by two parameter Speedy isothermal expansion EoS) for water, according to which the locus of TMDs of HDL phase has no maximum, and the EoS for HDL has no second critical point. At λ  =  23 the behavior is isomorphic with that of the mW model of water, which is now seen to conform, at least closely, to the ‘critical point free’ scenario for water.

Measurement of the angular distribution of the electron from W {r_arrow} e = {nu} decay, in p pbar at {radical}s = 1.8 TeV, as function of P{sub T}{sup W}

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-06-01

The goal of this work is to study the behavior of the angular distribution of the electron from the decay of the W boson in a specific rest frame of the W, the Collins-Soper frame. More specifically, the parameter {alpha}{sub 2} from the expression d{sigma}/d(P{sub T}{sup W}){sup 2} d cos {theta}* = k(1 + {alpha}{sub 2} cos {theta}* + {alpha}{sup 2}(cos {theta}*){sup 2}), corresponding to the distribution of cos {theta}* in the Collins-Soper frame, was measured. The experimental value of {alpha}P{sub 2} was compared with the predictions made by E. Mirkes [11] who included the radiative QCD perturbations in themore » weak-interaction B{sub boson} {r_arrow} lepton + lepton. This experimental value was extracted for the first time using knowledge about how the radiative QCD perturbations will modify the predictions given by the Electro-Weak process only.« less

Evaluation of Gasohol in U.S. Army Administrative and Tactical Vehicles.

DTIC Science & Technology

1982-11-01

maximum extent possible. To implement the Act, the U.S. Army was *assigned the lead role for alcohol fuels within DOD. Nobility Equipment Re- . search...M4AVERICK SEDAN S1 //S 82b80 S4904’ iasb 07qi A~n%T 7b, FORD) kAVERICk SEDAN a/ b/81 1211k. *,q4B.o I4 081*b 7b FOReD MAVERICK W~rAN 9/ b/sI 1ag47

PCSK 9 gain-of-function mutations (R496W and D374Y) and clinical cardiovascular characteristics in a cohort of Turkish patients with familial hypercholesterolemia.

PubMed

Kaya, Esra; Kayıkçıoğlu, Meral; Tetik Vardarlı, Aslı; Eroğlu, Zuhal; Payzın, Serdar; Can, Levent

2017-10-01

The molecular basis of the mutations in the PCSK9 gene that produces familial hypercholesterolemia (FH) in the Turkish population is unknown. This study was conducted to determine the presence of four different PCSK9 gain-of-function (GOF) mutations (F216L, R496W, S127R, and D374Y) in a group of patients with FH. A total of 80 consecutive patients with FH (mean age: 56±11 years; mean maximum LDL cholesterol: 251±76 mg/dL) were included in the study. Patients with FH were diagnosed according to the Dutch Lipid Clinic Network criteria based on serum cholesterol levels, personal and family histories of cardiovascular disease, tendon xanthomas, and genetic analysis. To identify F216L, R496W, S127R, and D374Y mutations of the PCSK9 gene, high-resolution melting analysis was performed on isolated DNAs. Of the 80 patients, there were 11 patients (13.8%) with PCSK9 GOF mutations. Detected mutations were D374Y mutation in four (5.0%) patients and R496W in seven patients (8.7%). Only one patient was homozygous for R496W mutation. The other two GOF mutations (S127R and F216 variants) were not detected. There was no significant difference with regard to demographic characteristics and CV disease risk factors and clinical course of the disease between the PCSK9 mutation-positive and PCSK9 mutation-negative groups. This is the first study from a Turkish FH cohort, revealing a higher frequency (approximately 14%) of two PCSK9 GOF mutations (D374Y and R496W) and a different disease course compared to the world literature.

Enantioselective separation and online affinity chromatographic characterization of R,R- and S,S-fenoterol.

PubMed

Beigi, Farideh; Bertucci, Carlo; Zhu, Weizhong; Chakir, Khalid; Wainer, Irving W; Xiao, Rui-Ping; Abernethy, Darrell R

2006-11-01

rac-Fenoterol is a beta2-adrenoceptor agonist (beta2-AR) used in the treatment of asthma. It has two chiral centers and is marketed as a racemic mixture of R,R'- and S,S'-fenoterol (R-F and S-F). Here we report the separation of the R-F and S-F enantiomers and the evaluation of their binding to and activation of the beta2-AR. R-F and S-F were separated from the enantiomeric mixture by chiral chromatography and absolute configuration determined by circular dichroism. Beta2-AR binding was evaluated using frontal affinity chromatography with a stationary phase containing immobilized membranes from HEK-293 cells that express human beta2-AR and standard membrane binding studies using the same membranes. The effect of R-F and S-F on cardiomyocyte contractility was also investigated using freshly isolated adult rat cardiomyocytes. Chiral chromatography of rac-fenoterol yielded separated peaks with an enantioselectivity factor of 1.21. The less retained peak was assigned the absolute configuration of S-F and the more retained peak R-F. Frontal chromatography using membrane-bound beta2-AR as the stationary phase and rac-3H-fenoterol as a marker ligand showed that addition of increasing concentrations of R-F to the mobile phase produced concentration-dependent decreases in rac-3H-fenoterol retention, while similar addition of S-F produced no change in rac-3H-fenoterol retention. The calculated dissociation constant of R-F was 472 nM and the number of available binding sites 176 pmol/column, which was consistent with the results from the membrane binding study 460 +/- 55 nM (R-F) and 109,000 +/- 10,400 nM (S-F). In the cardiomyocytes, R-F increased maximum contractile response from (265 +/- 11.6)% to (306 +/- 11.8)% of resting cell length (P < 0.05) and reduced EC50 from -7.0 +/- 0.270 to -7.1 +/- 0.2 log[M] (P < 0.05), while S-F had no significant effect. Previous studies have shown that rac-fenoterol acts as an apparent beta2-AR/G(s) selective agonist and fully restores

78 FR 14352 - Filing of Plats of Survey: Oregon/Washington

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-05

... date of this publication. Willamette Meridian Oregon T. 22 S., R. 10 E., accepted January 18, 2013 T. 8 S., R. 19 E., accepted February 22, 2013 T. 39 S., R. 6 W., accepted February 22, 2013 T. 33 S., R. 5 W., accepted February 22, 2013 T. 22 S., R. 6 W., accepted February 22, 2013 T. 22 S., R. 10 E...

Position Data Analysis Job Aid (PDAT-JA) Prototype Software (Version 2. 0), User’s Manual

DTIC Science & Technology

1993-08-01

am I II£3 10111 1 1IUmmii INmuFT 11 4325L5 10454 11616 01475 0l a Mi DIy 1ŕ 3?9 TAWi 1411R11 14 41110 I am1 I I 13 UD momiii mullw1t 4301 maIM...mist 51 43201 M5400 91616 01675 0 o War 11 s 5w 43 i cm mAW w a auto I 611 I 1 Tor V. mmii SmaiS 91 43201 MaiA 90160146170 COMY 09i D t 44 " 01011 a

A subset of walnut allergic adults is sensitized to walnut 11S globulin Jug r 4.

PubMed

Blankestijn, Mark A; den Hartog Jager, Constance F; Blom, W Marty; Otten, Henny G; de Jong, G Aard H; Gaspari, Marco; Houben, Geert F; Knulst, André C; Verhoeckx, Kitty C M

2018-06-15

The role of sensitization to commercially available allergens of English walnut (Juglans regia) Jug r 1, 2 and 3 in walnut allergy has been previously investigated in walnut allergic adults and was unable to explain allcases of walnut allergy. Identify recognized walnut allergens, other than the ones previously investigated (Jug r 1-3), in walnut allergic adults and determine the sensitization frequency and diagnostic value. Three different in-house walnut extracts were prepared and analysed on SDS-PAGE blots to identify allergenic walnut proteins. Immunoblots and immunoprecipitation, followed by LC-MS analysis, were performed to screen for, and confirm, IgE binding to walnut allergens in selected walnut allergic adults. In a cohort of 55 walnut challenged adults, including 33 allergic and 22 tolerant, sensitization to native and recombinant walnut allergen Jug r 4 was assessed using immunoblotting and immuno-line blot (EUROLINE), respectively. Screening of sera of eight walnut allergic adults identified Jug r 4 as an allergen in our population. In the total cohort of 55 subjects, five were positive for Jug r 4 on immunoblot and 10 on EUROLINE. All but one EUROLINE positive subject had a positive food challenge (sensitivity 27%, specificity 95%, PPV 90%, NPV 47%). All five subjects positive on immunoblot were also positive on EUROLINE. LC-MS analysis showed a lack of Jug r 4 in the ImmunoCAP extract. Co-sensitization to other 11S albumins (e.g. hazelnut Cor a 9) was common in Jug r 4 sensitized subjects, potentially due to cross-reactivity. Walnut 11S globulin Jug r 4 is a relevant minor allergen, recognized by 27% of walnut allergic adults. It has a high positive predictive value of 90% for walnut allergy. Specific IgE against Jug r 4 occurred mostly with concomitant sensitization to other walnut components, mainly Jug r 1. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

12. Photographic copy of copy of Twin Lakes Outlet Works ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-50, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF DISCHARGE BASIN. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

Smithsonian’s Manpower Research and Advisory Services: a 22-Year Partnership with the Office of Naval Research

DTIC Science & Technology

1994-04-01

AD-A278 487 /-,I1111il~11 11 11 h Illlll SMITHSONIAN’S MANPOWER RESEARCH AND ADVISORY SERVICES: A 22-YEAR PARTNERSHIP WITH THE OFFICE OF NAVAL...Manpower, Personnel and Training R&D Program of the Office of Naval Research under Contract N00014-93- C-0129. Approved for public release; distribution...SMITHSONIAN’S MANPOWER RESEARCH AND ADVISORY SERVICES: A 22-YEAR PARTNERSHIP WITH THE OFFICE OF NAVAL RESEARCH H. Wallace Sinaiko Final Report April

Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

PubMed

Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

2010-06-12

For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

Wind and Wave Summaries for Selected U.S. Coast Guard Operating Areas. Addendum,

DTIC Science & Technology

1984-05-01

tD t L. 2...s񓑷 -- -. . .. --+ -..- - ’ -- td --’+s :95-- Z24 .32 1 3 .11 0.is 14$ is4 86 itt o -- "-- .’ to _ Is h 26r s1 L49.,M 5p434~t 0 1 ~ 201S94I...4-’ 4-. - - ,o; - ~ - S$ - 50 P-so • 0 .𔃺, l.2 .. ... ... ..0Tho𔃾.. 5_’.. W- td Sp.ed oto tBo 6t!!gO 9 46012 0. " o . No Occurrences rr 04 01 1.0

75 FR 21344 - Filing of Plats of Survey: Oregon/Washington

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-23

... publication. Willamette Meridian Oregon T. 14 S., R. 7 W., accepted March 9, 2010. T. 26 S., R. 7 W., accepted March 9, 2010. T. 22 S., R. 10 E., accepted March 22, 2010. T. 31 S., R. 14 W., accepted March 22, 2010.... 10 W., accepted April 2, 2010. T. 31 S., R. 13 W., accepted April 2, 2010. T. 21 S., R. 8 W...

R&W Club Frederick Raises $1,500 for The Children’s Inn at Annual Golf Tournament | Poster

Cancer.gov

Forty-four government and contractor employees, along with their friends and family members, took to the Maryland National Golf Club course this fall for a cause. The R&W Club Frederick held its third annual golf tournament at the Middletown, Md., golf course on Sept. 14 to raise funds for The Children’s Inn at NIH, which celebrated its 25th anniversary this year. The Inn provides support and a home away from home for seriously ill children and their families receiving treatment at the NIH Clinical Center. Through the tournament, the club raised approximately $1,500 for The Children’s Inn, according to Tanya Ransom, biologist, NCI Center for Cancer Research, and secretary of the R&W Club Frederick. She also coordinated the golf tournament. After the tournament, a silent auction of sports memorabilia and collectibles, sponsored by Great Moments, Frederick, was held, and a portion of the proceeds also went to the Inn.

Fires. A Joint Publication for U.S. Artillery Professionals. July - August 2011

DTIC Science & Technology

2011-07-01

fundamentalism was diametrically opposed to the democratic capitalist system and the Western conception of freedom and liberalism. The religion of Islam...The process of dismantling and inactivating the F i n a l l y , w e w e r e s t a r t i n g t o s e e s i g n s o f a n o r g a n i z a t i o...with the number of hostile attacks that the system has intercepted. (Photo courtesy of Task Force C-RAM) A l l t h a t w e d o a s m i l i t a r y

Sublocalization of an Ataxia-Telangiectasia Gene Distal to D11S384 by Ancestral Haplotyping In Costa Rican Families

PubMed Central

Uhrhammer, Nancy; Lange, Ethan; Porras, Oscar; Naeim, Arash; Chen, Xiaoguang; Sheikhavandi, Sepideh; Chiplunkar, Sujata; Yang, Lan; Dandekar, Sugandha; Liang, Teresa; Patel, Nima; Teraoka, Sharon; Udar, Nitin; Calvo, Nidia; Concannon, Patrick; Lange, Kenneth; Gatti, Richard A.

1995-01-01

In an effort to localize a gene for ataxia-telangiectasia (A-T), we have genotyped 27 affected Costa Rican families, with 13 markers, in the chromosome 11q22-23 region. Significant linkage disequilibrium was detected for 9/13 markers between D11S1816 and D11S1391. Recombination events observed in these pedigrees places A-T between D11S1819 and D11S1960. One ancestral haplotype is common to 24/54 affected chromosomes and roughly two-thirds of the families. Inferred (ancestral) recombination events involving this common haplotype in earlier generations suggest that A-T is distal to D11S384 and proximal to D11S1960. Several other common haplotypes were identified, consistent with multiple mutations in a single gene. When considered together with all other evidence, this study further sublocalizes the major A-T locus to ≈200 kb, between markers S384 and S535. ImagesFigure 5 PMID:7611278

R&W Club Frederick Hosts 4th Annual Golf Tournament Benefiting The Children’s Inn at NIH | Poster

Cancer.gov

The R&W Club Frederick’s 4th Annual Golf Tournament to benefit the Children’s Inn at NIH teed off on time despite cloudy weather and scattered showers. Employees from NCI at Frederick, the main NIH campus, and Leidos Biomed, along with family and friends, came to enjoy an afternoon at the beautiful Maryland National Golf Club in Middletown and to support a wonderful charity.

32. SPILLWAY CHANNEL WALLS REINF. DETAILS; MONOLITHS E22, E23, W22, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

32. SPILLWAY CHANNEL WALLS REINF. DETAILS; MONOLITHS E-22, E-23, W-22, AND W-23. Sheet S-46, May, 1940. File no. 342/59. - Prado Dam, Spillway, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

Building bridges: an interpretive phenomenological analysis of nurse educators' clinical experience using the T.R.U.S.T. Model for inclusive spiritual care.

PubMed

Scott Barss, Karen

2012-04-30

Educating nurses to provide evidence-based, non-intrusive spiritual care in today's pluralistic context is both daunting and essential. Qualitative research is needed to investigate what helps nurse educators feel more prepared to meet this challenge. This paper presents findings from an interpretive phenomenological analysis of the experience of nurse educators who used the T.R.U.S.T. Model for Inclusive Spiritual Care in their clinical teaching. The T.R.U.S.T. Model is an evidence-based, non-linear resource developed by the author and piloted in the undergraduate nursing program in which she teaches. Three themes are presented: "The T.R.U.S.T. Model as a bridge to spiritual exploration"; "blockades to the bridge"; and "unblocking the bridge". T.R.U.S.T. was found to have a positive influence on nurse educators' comfort and confidence in the teaching of spiritual care. Recommendations for maximizing the model's positive impact are provided, along with "embodied" resources to support holistic teaching and learning about spiritual care.

22 CFR 120.27 - U.S. criminal statutes.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 22 Foreign Relations 1 2013-04-01 2013-04-01 false U.S. criminal statutes. 120.27 Section 120.27 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS... means: (1) Section 38 of the Arms Export Control Act (22 U.S.C. 2778); (2) Section 11 of the Export...

22 CFR 120.27 - U.S. criminal statutes.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 22 Foreign Relations 1 2011-04-01 2011-04-01 false U.S. criminal statutes. 120.27 Section 120.27 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS... means: (1) Section 38 of the Arms Export Control Act (22 U.S.C. 2778); (2) Section 11 of the Export...

22 CFR 120.27 - U.S. criminal statutes.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 22 Foreign Relations 1 2012-04-01 2012-04-01 false U.S. criminal statutes. 120.27 Section 120.27 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS... means: (1) Section 38 of the Arms Export Control Act (22 U.S.C. 2778); (2) Section 11 of the Export...

Sequence, assembly and annotation of the maize W22 genome

USDA-ARS?s Scientific Manuscript database

Since its adoption by Brink and colleagues in the 1950s and 60s, the maize W22 inbred has been utilized extensively to understand fundamental genetic and epigenetic processes such recombination, transposition and paramutation. To maximize the utility of W22 in gene discovery, we have Illumina sequen...

1.2V, 24mW/ch, 10bit, 80MSample/s Pipelined A/D Converters

NASA Astrophysics Data System (ADS)

Ueno, Takeshi; Ito, Tomohiko; Kurose, Daisuke; Yamaji, Takafumi; Itakura, Tetsuro

This paper describes 10-bit, 80-MSample/s pipelined A/D converters for wireless-communication terminals. To reduce power consumption, we employed the I/Q amplifier sharing technique [1] in which an amplifier is used for both I and Q channels. In addition, common-source, pseudo-differential (PD) amplifiers are used in all the conversion stages for further power reduction. Common-mode disturbances are removed by the proposed common-mode feedforward (CMFF) technique without using fully differential (FD) amplifiers. The converter was implemented in a 90-nm CMOS technology, and it consumes only 24mW/ch from a 1.2V power supply. The measured SNR and SNDR are 58.6dB and 52.2dB, respectively.

Oxothiomolybdenum derivatives of the superlacunary crown heteropolyanion {P8W48}: structure of [K4{Mo4O4S4(H2O)3(OH)2}2(WO2)(P8W48O184)]30– and studies in solution.

PubMed

Korenev, Vladimir S; Floquet, Sébastien; Marrot, Jérôme; Haouas, Mohamed; Mbomekallé, Israël-Martyr; Taulelle, Francis; Sokolov, Maxim N; Fedin, Vladimir P; Cadot, Emmanuel

2012-02-20

Reaction of the cyclic lacunary [H(7)P(8)W(48)O(184)](33-) anion (noted P(8)W(48)) with the [Mo(2)S(2)O(2)(H(2)O)(6)](2+) oxothiocation led to two compounds, namely, [K(4){Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(WO(2))(P(8)W(48)O(184))](30-) (denoted 1) and [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) (denoted 2), which were characterized in the solid state and solution. In the solid state, the structure of [K(4){Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(WO(2))(P(8)W(48)O(184))](30-) reveals the presence of two disordered {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) "handles" connected on both sides of the P(8)W(48) ring. Such a disorder is consistent with the presence of two geometrical isomers where the relative disposition of the two {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) handles are arranged in a perpendicular or parallel mode. Such an interpretation is fully supported by (31)P and (183)W NMR solution studies. The relative stability of both geometrical isomers appears to be dependent upon the nature of the internal alkali cations, i.e., Na(+) vs K(+), and increased lability of the two {Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2+) handles, compared to the oxo analogous, was clearly identified by significant broadening of the (31)P and (183)W NMR lines. Solution studies carried out by UV-vis spectroscopy showed that formation of the adduct [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) occurs in the 1.5-4.7 pH range and corresponds to a fast and quantitative condensation process. Furthermore, (31)P NMR titrations in solution reveal formation of the "monohandle" derivative [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(P(8)W(48)O(184))](38-) as an intermediate prior to formation of the "bishandle" derivatives. Furthermore, the electrochemical behavior of [{Mo(4)O(4)S(4)(H(2)O)(3)(OH)(2)}(2)(P(8)W(48)O(184))](36-) was studied in aqueous medium and compared with the parent anion P(8)W(48).

The S.T.o.R.M. (tm): Air transport system design simulation

NASA Technical Reports Server (NTRS)

1992-01-01

The members of Team Asylum have proposed a helicopter design concept, called the S.T.o.R.M., in order to meet the market demands for an aircraft to perform overnight package delivery services in Aeroworld. The helicopter concept was chosen over a fixed wing aircraft design to fulfill the mission requirements for a variety of reasons, all of which will be discussed later. However, many critical design areas needed to be investigated as part of the helicopter concept's selection. One of the most significant design factors was the weight of the aircraft. This determined the selection of the propulsion system necessary to get the S.T.o.R.M. off the ground, and maintain flight once airborne. Another significant factor that went hand in hand with the motor selection was the choice of the main rotor. Since the main rotor is the primary source of lift for the helicopter, its proper selection became increasingly important.

78 FR 28627 - TA-W-80,340; TA-W-80,340A; TA-W-80,340B

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-15

...] Bush Industries, Inc., Mason Drive Facility, Including On-Site Leased Workers From Morris Security...., Mason Drive Facility, Jamestown, New York (TA-W-80,340) and Bush Industries, Inc., Allen Street Facility... applicable to TA-W-80,340 is hereby issued as follows: All workers of Bush Industries, Inc., Mason Drive...

11. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. SACATON DAM AND BRIDGE SITE FROM QUARRY HILL, 10/1/24 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

Large NLO corrections in t\\overline{t}{W}^{± } and t\\overline{t}t\\overline{t} hadroproduction from supposedly subleading EW contributions

NASA Astrophysics Data System (ADS)

Frederix, Rikkert; Pagani, Davide; Zaro, Marco

2018-02-01

We calculate the complete-NLO predictions for t\\overline{t}{W}^{± } and t\\overline{t}t\\overline{t} production in proton-proton collisions at 13 and 100 TeV. All the non-vanishing contributions of O({α}_s^i{α}^j) with i + j = 3 , 4 for t\\overline{t}{W}^{± } and i + j = 4 , 5 for t\\overline{t}t\\overline{t} are evaluated without any approximation. For t\\overline{t}{W}^{± } we find that, due to the presence of tW → tW scattering, at 13(100) TeV the O({α}_s{α}^3) contribution is about 12(70)% of the LO, i.e., it is larger than the so-called NLO EW corrections (the O({α}_s^2{α}^2) terms) and has opposite sign. In the case of t\\overline{t}t\\overline{t} production, large contributions from electroweak tt → tt scattering are already present at LO in the O({α}_s^3α ) and O({α}_s^2{α}^2) terms. For the same reason we find that both NLO terms of O({α}_s^4α ) , i.e., the NLO EW corrections, and O({α}_s^3{α}^2) are large (±15% of the LO) and their relative contributions strongly depend on the values of the renormalisation and factorisation scales. However, large accidental cancellations are present (away from the threshold region) between these two contributions. Moreover, the NLO corrections strongly depend on the kinematics and are particularly large at the threshold, where even the relative contribution from O({α}_s^2{α}^3) terms amounts to tens of percents.

U.S. EPA, Pesticide Product Label, AGWAY BETASAN 12.5G, 11/29/1979

EPA Pesticide Factsheets

2011-04-21

... i"'n"'rtl'll' ',',l,-jIf)I,,'; N;If""""' 1"'"11'" Mflll1,f'''''V t:vl't."." M,II'If'''''V Pm,. M~,'I,. f'nvt" f'hvp,.n'·jll" It,. !"I;ml r" raf"l'v"""d,;l rlnd ;'WI,,.t I'. 1 W."lllrlfl, .... 71111111' ...

[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].

PubMed

Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G

2007-01-01

The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.

11. Detail of Bed Plate Showing Name of Manufacturer (T.W. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Detail of Bed Plate Showing Name of Manufacturer (T.W. Phillips Manufacturing Co.), Looking Southwest - Heckert Oil Pumping Jack, 0.6 mile North of Connoquenessing Creek, 0.15 mile East of Powder Mill Creek, Renfrew, Butler County, PA

Transport and thermoelectric properties of Sr{sub 3}(Ti{sub 0.95}R{sub 0.05}){sub 2}O{sub 7} (R = Ta, Nb, W) oxides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, R. R.; Qin, X. Y.; Li, L. L.

2012-12-15

The Sr{sub 3}(Ti{sub 0.95}R{sub 0.05}){sub 2}O{sub 7} (R = Ta, Nb, W) polycrystalline compounds were fabricated, and their transport and thermoelectric properties were investigated. The results indicate that at T > 300 K electrical resistivity {rho} for all the doped compounds increases monotonically with temperature, and basically can be described by a relation {rho}{proportional_to}T{sup M} at T > {approx}650 K, with M = 1.39, 1.66, and 1.77 for R = Ta, Nb, and W, respectively, implying that at the high temperatures the acoustic phonon scattering dominates the scattering process. Although the resistivity {rho} of Sr{sub 3}(Ti{sub 0.95}Ta{sub 0.05}){sub 2}O{sub 7}more » exhibits a metallic-like behavior at the temperature as low as 5 K, a transition from metallic state (d{rho}/dT > 0) to semiconductor-like state (d{rho}/dT < 0) was observed at a critical low temperature {approx}41 K and {approx}79 K for R = Nb and W, respectively. At T < {approx}22 K, {approx}57 K, and {approx}80 K, a relation of {sigma}{proportional_to}T{sup 1/2} (here conductivity {sigma} = 1/{rho}) holds for the doped compounds with R = Nb, Ta, and W, respectively, suggesting that at the low temperatures the main transport mechanism is electron-electron interaction due to the presence of disorder induced by the dopants. The thermoelectric figure of merit (ZT) for Ta-doped compound increases more steeply with increasing temperature among the three compounds and reaches 0.066 at 1000 K.« less

U.S. EPA, Pesticide Product Label, T-CHLOR, 02/21/1990

EPA Pesticide Factsheets

2011-04-21

... t, tI'.;r:;";~I, SII";' ;; cf ttu ;:;r;::IlIn 'Itt 10 s.llor.s,' ,,;tH t; ,rO,'I'" ,;;r;lll.jtE1J t:: ,;a "iili!:lt CtlOrlJ;1 II wtiS:;:. ... h;:) ,n~ rlr.Sf 5,U,:fCj Ir~I~'lr.t .Itt ;::."1' .,', far .u, ...

Ada Compiler Validation Summary Report: Certificate Number: 891201S1. 10215 U.S. Navy Ada/M, Version 2.0 (/No Optimize Option) VAX 8550 and VAX 11/785 Host and AN/AYK-14 Target

DTIC Science & Technology

1990-01-12

NIST89USN555 7 1.10 DATE VSR CPIIED BEFORE ON-SITE: 08-11-89 DATE VSR COMPI=E AFTER ON-SITE: 12-04-89 DATE VSR MODIFIED PER AVO COMMENS: 12-29-89 DATE...AD-A223 579I I Final 12 Jan 89 to 12 Jan 90 4WPUASS1TTL Ada Compler Validation Summary Report: U.S. Navy.~ Gaithersburg, E1D A USA 7 . PEXNX&M...0Rl3Wfl4 NUADACAMSO) R. A flff om4oN National Institute of Standards and Technology = & National Computer Systew± !.boratory N/S T U W6�- 7 /0 Bldg. 255, Em

17 CFR 240.11a2-2(T) - Transactions effected by exchange members through other members.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Transactions effected by exchange members through other members. 240.11a2-2(T) Section 240.11a2-2(T) Commodity and Securities... Regulation (rule 11a-1) § 240.11a2-2(T) Transactions effected by exchange members through other members. (a...

17 CFR 240.11a2-2(T) - Transactions effected by exchange members through other members.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Transactions effected by exchange members through other members. 240.11a2-2(T) Section 240.11a2-2(T) Commodity and Securities... Regulation (rule 11a-1) § 240.11a2-2(T) Transactions effected by exchange members through other members. (a...

U.S., U.S.S.R. Marine Expedition

NASA Astrophysics Data System (ADS)

Wainger, Lisa A.

An historic expedition involving U.S. and U.S.S.R. scientists may open a new era of cooperation in marine research. A University of California, San Diego/Scripps Institution of Oceanography ship carrying a team that includes two Soviet scientists is on an expedition that will take the R/V Thomas Washington into the Exclusive Economic Zone (EEZ) of the U.S.S.R. For the first time in a decade a U.S. research vessel has been given permission to operate in the Soviet Union's EEZ, according to Department of State representative Tom Cocke, who worked with Scripps on this project. The ship will also operate in the U.S. EEZ and international waters.

Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

PubMed

Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

2015-01-01

Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

R&W Club Frederick Raises $1,500 for The Children’s Inn at Annual Golf Tournament | Poster

Cancer.gov

Forty-four government and contractor employees, along with their friends and family members, took to the Maryland National Golf Club course this fall for a cause. The R&W Club Frederick held its third annual golf tournament at the Middletown, Md., golf course on Sept. 14 to raise funds for The Children’s Inn at NIH, which celebrated its 25th anniversary this year. The Inn

Biotransformation of (-)-(1R,4S)-Menthone and (+)-(1S,4R)-Menthone by the Common Cutworm Spodoptera litura Larvae.

PubMed

Marumoto, Shinsuke; Okuno, Yoshiharu; Hagiwara, Yuki; Miyazawa, Mitsuo

2017-08-01

Using biotransformation as a biocatalytic process has the advantage of being able to proceed under mild conditions and with high regio- and enantioselectivity. This study investigated the biotransformation of (-)-(1R,4S)-menthone (1) and (+)-(1S,4R)-menthone (2) by Spodoptera litura larvae. Compound 1 was converted to (-)-(1R,4S)-7-hydroxymenthone (1-1), (+)-(1R,3S,4S)-7-hydroxyneomenthol (1-2) and (-)-(1R,4S,8R)-p-menth-3-one-9-oic acid (1-3). The metabolism of substrate 2 generated three enantiomers of the above metabolites, designated as 2-1 to 2-3, respectively. The C-9 position of (-)-menthone and (+)-menthone was oxidized to carboxylic acid by S. litura, which is a metabolic pathway not observed in any other example of biocatalysis.

Recipient’s Genetic R702W NOD2 Variant Is Associated with an Increased Risk of Bacterial Infections after Orthotopic Liver Transplantation

PubMed Central

van Hoek, Bart; van den Berg, Arie P.; Porte, Robert J.; Blokzijl, Hans; Coenraad, Minneke J.; Hepkema, Bouke G.; Schaapherder, Alexander F.; Ringers, Jan; Weersma, Rinse K.; Verspaget, Hein W.

2013-01-01

Introduction Orthotopic liver transplantation (OLT) is accompanied by a significant postoperative infection risk. Immunosuppression to prevent rejection increases the susceptibility to infections, mainly by impairing the adaptive immune system. Genetic polymorphisms in the lectin complement pathway of the donor have recently been identified as important risk determinants of clinically significant bacterial infection (CSI) after OLT. Another genetic factor involved in innate immunity is NOD2, which was reported to be associated with increased risk of spontaneous bacterial peritonitis in cirrhotic patients. Methods We assessed association of three genetic NOD2 variants (R702W, G908R and 3020insC) with increased risk of CSI after OLT. 288 OLT recipient-donor pairs from two tertiary referral centers were genotyped for the three NOD2 variants. The probability of CSI in relation to NOD2 gene variants was determined with cumulative incidence curves and log-rank analysis. Results The R702W NOD2 variant in the recipient was associated with CSI after OLT. Eight out of 15 (53.3%) individuals with a mutated genotype compared to 80/273 (29.3%) with wild type genotype developed CSI (p=0.027, univariate cox regression), illustrated by a higher frequency of CSI after OLT over time (p=0.0003, log rank analysis). Multivariate analysis (including the donor lectin complement pathway profile) showed independence of this R702W NOD2 association from other risk factors (HR 2.0; p=0.04). The other NOD2 variants, G908R and 3020insC, in the recipient were not associated with CSI. There was no association with CSI after OLT for any of the NOD2 variants in the donor. Conclusion The mutated NOD2 R702W genotype in the recipient is independently associated with an increased risk of bacterial infections after liver transplantation, indicating a predisposing role for this genetic factor impairing the recipient’s innate immune system. PMID:23977330

Eastern equatorial Pacific Ocean T-S variations with El Nino

NASA Technical Reports Server (NTRS)

Wang, O.; Fukumori, I.; Lee, T.; Johnson, G. C.

2004-01-01

Temperature-Salinity (T-S) relationship variability in the pycnocline of the eastern equatorial Pacific Ocean (NINO3 region, 5 degrees S ??degrees N, 150 degrees W ?? degrees W) over the last two decades is investigated using observational data and model simulation.

Meiotic Recombination and Spatial Proximity in the Etiology of the Recurrent t(11;22)

PubMed Central

Ashley, Terry; Gaeth, Ann P.; Inagaki, Hidehito; Seftel, Allen; Cohen, Maimon M.; Anderson, Lorinda K.; Kurahashi, Hiroki; Emanuel, Beverly S.

2006-01-01

Although balanced translocations are among the most common human chromosomal aberrations, the constitutional t(11;22)(q23;q11) is the only known recurrent non-Robertsonian translocation. Evidence indicates that de novo formation of the t(11;22) occurs during meiosis. To test the hypothesis that spatial proximity of chromosomes 11 and 22 in meiotic prophase oocytes and spermatocytes plays a role in the rearrangement, the positions of the 11q23 and 22q11 translocation breakpoints were examined. Fluorescence in situ hybridization with use of DNA probes for these sites demonstrates that 11q23 is closer to 22q11 in meiosis than to a control at 6q26. Although chromosome 21p11, another control, often lies as close to 11q23 as does 22q11 during meiosis, chromosome 21 rarely rearranges with 11q23, and the DNA sequence of chromosome 21 appears to be less susceptible than 22q11 to double-strand breaks (DSBs). It has been suggested that the rearrangement recurs as a result of the palindromic AT-rich repeats at both 11q23 and 22q11, which extrude hairpin structures that are susceptible to DSBs. To determine whether the DSBs at these sites coincide with normal hotspots of meiotic recombination, immunocytochemical mapping of MLH1, a protein involved in crossing over, was employed. The results indicate that the translocation breakpoints do not coincide with recombination hotspots and therefore are unlikely to be the result of meiotic programmed DSBs, although MRE11 is likely to be involved. Previous analysis indicated that the DSBs appear to be repaired by a mechanism similar to nonhomologous end joining (NHEJ), although NHEJ is normally suppressed during meiosis. Taken together, these studies support the hypothesis that physical proximity between 11q23 and 22q11—but not typical meiotic recombinational activity in meiotic prophase—plays an important role in the generation of the constitutional t(11;22) rearrangement. PMID:16909390

mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.

PubMed

Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G

2006-07-01

Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.

Atomic radii for atoms with the 6s shell outermost: The effective atomic radius and the van der Waals radius from {sub 55}Cs to {sub 80}Hg

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tatewaki, Hiroshi, E-mail: htatewak@nsc.nagoya-cu.ac.jp; Institute of Advanced Studies in Artificial Intelligence, Chukyo University, Toyota, Aichi 470-0393; Hatano, Yasuyo

We consider, for atoms from {sub 55}Cs to {sub 80}Hg, the effective atomic radius (r{sub ear}), which is defined as the distance from the nucleus at which the magnitude of the electric field is equal to that in He at one half of the equilibrium bond length of He{sub 2}. The values of r{sub ear} are about 50% larger than the mean radius of the outermost occupied orbital of 6s, . The value of r{sub ear} decreases from {sub 55}Cs to {sub 56}Ba and undergoes increases and decreases with rising nuclear charge from {sub 57}La to {sub 70}Y b. Inmore » fact r{sub ear} is understood as comprising two interlaced sequences; one consists of {sub 57}La, {sub 58}Ce, and {sub 64}Gd, which have electronic configuration (4f{sup n−1})(5d{sup 1})(6s{sup 2}), and the remaining atoms have configuration (4f{sup n})(6s{sup 2}). The sphere defined by r{sub ear} contains 85%–90% of the 6s electrons. From {sub 71}Lu to {sub 80}Hg the radius r{sub ear} also involves two sequences, corresponding to the two configurations 5d{sup n+1}6s{sup 1} and 5d{sup n}6s{sup 2}. The radius r{sub ear} according to the present methodology is considerably larger than r{sub vdW} obtained by other investigators, some of who have found values of r{sub vdW} close to .« less

Renal F4/80+CD11c+ Mononuclear Phagocytes Display Phenotypic and Functional Characteristics of Macrophages in Health and in Adriamycin Nephropathy

PubMed Central

Wang, Yiping; Wang, Xin Maggie; Lu, Junyu; Lee, Vincent W.S.; Ye, Qianling; Nguyen, Hanh; Zheng, Guoping; Zhao, Ye; Alexander, Stephen I.; Harris, David C.H.

2015-01-01

Conventional markers of macrophages (Mфs) and dendritic cells (DCs) lack specificity and often overlap, leading to confusion and controversy regarding the precise function of these cells in kidney and other diseases. This study aimed to identify the phenotype and function of renal mononuclear phagocytes (rMPs) expressing key markers of both Mфs and DCs. F4/80+CD11c+ cells accounted for 45% of total rMPs in normal kidneys and in those from mice with Adriamycin nephropathy (AN). Despite expression of the DC marker CD11c, these double-positive rMPs displayed the features of Mфs, including Mф-like morphology, high expression of CD68, CD204, and CD206, and high phagocytic ability but low antigen-presenting ability. F4/80+CD11c+ cells were found in the cortex but not in the medulla of the kidney. In AN, F4/80+CD11c+ cells displayed an M1 Mф phenotype with high expression of inflammatory mediators and costimulatory factors. Adoptive transfer of F4/80+CD11c+ cells separated from diseased kidney aggravated renal injury in AN mice. Furthermore, adoptive transfer of common progenitors revealed that kidney F4/80+CD11c+ cells were derived predominantly from monocytes, but not from pre-DCs. In conclusion, renal F4/80+CD11c+ cells are a major subset of rMPs and display Mф-like phenotypic and functional characteristics in health and in AN. PMID:25012165

U.S. EPA, Pesticide Product Label, T-H THIODAN MISCIBLE INSECTICIDE, 06/18/1969

EPA Pesticide Factsheets

2011-04-13

... a:.,.! l,y nll,,,h"r 11'1';,"'11th"sis f"llowin~ ('1'''1'. FEI.II-:I1 U){;:- Hark B.·,·tl.·." (Iyt:d "11t' .. i,·sl :! ... hark is ,·s'<'lItial. . TOIL\\('('O (:i): FI"a B",··I,·. 11"nlw"nll. ...

Measurement of the 1s2s ^1S0 - 1s2p ^3P1 interval in helium-like silicon.

NASA Astrophysics Data System (ADS)

Redshaw, M.; Harry, R.; Myers, E. G.; Weatherford, C. A.

2001-05-01

Accurate calculation of the energy levels of helium-like ions is a basic problem in relativistic atomic theory. For the n=3D2 levels at moderate Z, published calculations give all ``structure'' but not all explicit QED contributions to order (Zα)^4 a.u.(D.R. Plante, W.R. Johnson and J. Sapirstein, Phys. Rev. A 49), 3519 (1994).^, (K.T. Cheng, M.H. Chen, W.R. Johnson and J. Sapirstein, Phys. Rev. A 50), 247 (1994).. Measurements of the 1s2p ^3P - 1s2s ^3S transitions, which lie in the vacuum ultra-violet, are barely precise enough to challenge the theory. However, the intercombination 1s2s ^1S0 - 1s2p ^3P1 interval lies in the infra-red for Z<40 and enables precision measurements using laser spectroscopy(E.G. Myers, J.K. Thompson, E.P. Gavathas, N.R. Claussen, J.D. Silver and D.J.H. Howie, Phys. Rev. Lett. 75), 3637 (1995).. We aim to measure this interval in Si^12+ using a foil-stripped 1 MeV/u ion beam from the Florida State Van de Graaff accelerator and a single-mode c.w. Nd:YAG laser at 1.319 μm. To obtain a sufficient transition probability, the Si^12+ beam is merged co-linearly with the laser light inside an ultra-high finesse build-up cavity. The results should provide a clear test of current and developing calculations of QED contributions in two-electron ions.

Pressure-induced topological insulator-to-metal transition and superconductivity in Sn-doped B i1.1S b0.9T e2S

NASA Astrophysics Data System (ADS)

An, Chao; Chen, Xuliang; Wu, Bin; Zhou, Yonghui; Zhou, Ying; Zhang, Ranran; Park, Changyong; Song, Fengqi; Yang, Zhaorong

2018-05-01

Tetradymite-type topological insulator Sn-doped B i1.1S b0.9T e2S (Sn-BSTS), with a surface state Dirac point energy well isolated from the bulk valence and conduction bands, is an ideal platform for studying the topological transport phenomena. Here, we present high-pressure transport studies on single-crystal Sn-BSTS, combined with Raman scattering and synchrotron x-ray diffraction measurements. Over the studied pressure range of 0.7-37.2 GPa, three critical pressure points can be observed: (i) At ˜9 GPa, a pressure-induced topological insulator-to-metal transition is revealed due to closure of the bulk band gap, which is accompanied by changes in slope of the Raman frequencies and a minimum in c /a within the pristine rhombohedral structure (R -3 m ); (ii) at ˜13 GPa, superconductivity is observed to emerge, along with the R -3 m to a C 2 /c (monoclinic) structural transition; (iii) at ˜24 GPa, the superconducting transition onset temperature TC reaches a maximum of ˜12 K , accompanied by a second structural transition from the C 2 /c to a body-centered cubic I m -3 m phase.

I. T. - R. O. C. K. S. Comet Nuclei Sample Return Mission

NASA Astrophysics Data System (ADS)

Dalcher, N.

2009-04-01

Fadden L.A., Sunshine J., Wellnitz D., Lisse C., Schultz P., Meech K. J., Delamere W. A. Icarus 187,4-15 (2007). [4] Simon S.B., Joswiak D.J., Ishii H.A., Bradley J.P., Chi M., Grossman L., Aléon J., Brownlee D.E., Fallon S., Hutcheon I.D., Matrajt G., Mckeegan K.D.: Refractory Inclusion Returned by Stardust from Comet P81/Wild 2. Meteoritics and Planetary Science (2007). [5] George D. Cody, Harald Ade, Conel M. O'D. Alexander, Tohru Araki, Anna Butterworth, Holger Fleckenstein, George Flynn, Mary K. Gilles, Chris Jacobsen, A.L. D. Kilcoyne, Keiko Messenger, Scott A. Sandford, Tolek Tyliszczak, Andrew J.Westphal4, Susan Wirick, and Hikaru Yabuta. Quantitative Organic and Light Element analysis of Comet 81P/Wild 2 particles using C-, N-, and O- µ-XANES, Meteoretics and Planetary Science: In Press. [6] Stern, S. et al. Alice: The Rosetta Ultraviolet Imaging Spectrograph. Space Science Reviews 128, 507-527 (2007). [7] Balsiger, H. et al. Rosina-Rosetta Orbiter Spectrometer for Ion and Neutral Analysis. Space Science Reviews 128, 745-801 (2007). [8] Colangeli, L. et al. The Grain Impact Analyser and Dust Accumulator (GIADA) Experiment for the Rosetta Mission: Design, Performances and First Results. Space Science Reviews 128, 803-821 (2007). [9] Yoshimitsu, T., Kubota, T., Nakatani, I., Adachi, T. & Saito, H. Micro-hopping robot for asteroid exploration. Acta Astronautica 52, 441-446 (2003). [10] Lorenz, R. et al. Demonstration of comet sample collection by penetrator. ESA SP-542, 387-393 (2003). [11] Küppers et al. Triple F—a comet nucleus sample return mission. Experimental Astronomy, Online First (2008).

Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

PubMed Central

Ngugi, David Kamanda; Stingl, Ulrich

2012-01-01

Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

Renal F4/80+ CD11c+ mononuclear phagocytes display phenotypic and functional characteristics of macrophages in health and in adriamycin nephropathy.

PubMed

Cao, Qi; Wang, Yiping; Wang, Xin Maggie; Lu, Junyu; Lee, Vincent W S; Ye, Qianling; Nguyen, Hanh; Zheng, Guoping; Zhao, Ye; Alexander, Stephen I; Harris, David C H

2015-02-01

Conventional markers of macrophages (Mфs) and dendritic cells (DCs) lack specificity and often overlap, leading to confusion and controversy regarding the precise function of these cells in kidney and other diseases. This study aimed to identify the phenotype and function of renal mononuclear phagocytes (rMPs) expressing key markers of both Mфs and DCs. F4/80(+)CD11c(+) cells accounted for 45% of total rMPs in normal kidneys and in those from mice with Adriamycin nephropathy (AN). Despite expression of the DC marker CD11c, these double-positive rMPs displayed the features of Mфs, including Mф-like morphology, high expression of CD68, CD204, and CD206, and high phagocytic ability but low antigen-presenting ability. F4/80(+)CD11c(+) cells were found in the cortex but not in the medulla of the kidney. In AN, F4/80(+)CD11c(+) cells displayed an M1 Mф phenotype with high expression of inflammatory mediators and costimulatory factors. Adoptive transfer of F4/80(+)CD11c(+) cells separated from diseased kidney aggravated renal injury in AN mice. Furthermore, adoptive transfer of common progenitors revealed that kidney F4/80(+)CD11c(+) cells were derived predominantly from monocytes, but not from pre-DCs. In conclusion, renal F4/80(+)CD11c(+) cells are a major subset of rMPs and display Mф-like phenotypic and functional characteristics in health and in AN. Copyright © 2015 by the American Society of Nephrology.

Study of Hot-Electron Effects, Breakdown and Reliability in FETS, HEMTS, and HBT’S

DTIC Science & Technology

1998-08-01

10-20 V ) have been demonstrated, with power added efficiencies between 10% (around 1 W) and 50% (around 20 mW) at 60 GHz. For higher frequencies...IEDM98, pp. 695-698, S. Francisco, CA, December 6-9, 1998. G. Meneghesso, A. Neviani , R. Oesterholt, M. Matloubian, T. Liu, J. Brown, C. Canali and...8217 / / ’ ’ / / " / s / collector-to-emitter voltage VCE ( V ) Figure 1.1: Collector current, Ic vs. the collector to emitter voltage VCE at

R34D1NG W0RD5 W1TH NUMB3R5.

PubMed

Perea, Manuel; Duñabeitia, Jon Andoni; Carreiras, Manuel

2008-02-01

Letter identities and number identities are usually thought to imply different cortical mechanisms. Specifically, the left fusiform gyrus responds more to letters than to digits (T. A. Polk et al., 2002). However, a widely circulated statement on the internet illustrates that it is possible to use numbers (leet digits) as parts of words, 4ND TH3 R35ULT1NG S3NT3NC3 C4N B3 R34D W1TH0UT GR34T 3FF0RT. Two masked priming lexical decision experiments were conducted to determine whether leet digits produce (automatic) lexical activation. Results showed that words are identified substantially faster when they are preceded by a masked leet word (M4T3R14L-MATERIAL) than when they are preceded by a control condition with other letters or digits. In addition, there was only a negligible advantage of the identity condition over the related leet condition. This leet-priming effect is not specific to numbers: A prime in which leet digits are replaced by letter-like symbols (M(Delta symbol)T(euro symbol)R!(Delta symbol)L - MATERIAL) facilitates word processing to the same degree as an identity prime. Therefore, the cognitive system regularizes the shape of the leet digits and letter-like symbols embedded in words with very little cost.

High-efficiency L-band T/R Module: Development Results

NASA Technical Reports Server (NTRS)

Edelstein, Wendy N.; Andricos, Constantine; Wang, Feiyu; Rutled, David B.

2005-01-01

Future interferometric synthetic aperture radar (InSAR) systems require electronically scanned phased-array antennas, where the transmit/receive (T/R) module is a key component. The T/R module efficiency is a critical figure of merit and has direct implications on the power dissipation and power generation requirements of the system. Significant improvements in the efficiency of the T/R module will make SAR missions more feasible and affordable. The results of two high-efficiency T/R modules are presented, each based on different power amplifier technologies. One module uses a 30W GaAs Class-AlB power amplifier and the second module uses a 70W LD-MOS Class-ElF power amplifier, where both modules use a common low power section. Each module operates over an 80MHz bandwidth at L-band (1.2GHz) with an overall module efficiency greater than 58%. We will present the results of these two T/R modules that have been designed, built and tested.

Elevated Plasma Levels of sIL-2R in Complex Regional Pain Syndrome: A Pathogenic Role for T-Lymphocytes?

PubMed Central

Stronks, Dirk L.; Dik, Willem A.; Schreurs, Marco W. J.

2017-01-01

The immune system has long been thought to be involved in the pathophysiology of complex regional pain syndrome (CRPS). However, not much is known about the role of the immune system and specifically T-cells in the onset and maintenance of this disease. In this study, we aimed to evaluate T-cell activity in CRPS by comparing blood soluble interleukin-2 receptor (sIL-2R) levels between CRPS patients and healthy controls. CRPS patients had statistically significant elevated levels of sIL-2R as compared to healthy controls (median sIL-2R levels: 4151 pg/ml (Q3 − Q1 = 5731 pg/ml − 3546 pg/ml) versus 1907 pg/ml (Q3 − Q1: 2206 pg/ml − 1374 pg/ml), p < 0.001, resp.). Furthermore, sIL-2R level seems to be a good discriminator between CRPS patients and healthy controls with a high sensitivity (90%) and specificity (89.5%). Our finding indicates increased T-cell activity in patients with CRPS. This finding is of considerable relevance as it could point towards a T-cell-mediated inflammatory process in this disease. This could pave the way for new anti-inflammatory therapies in the treatment of CRPS. Furthermore, sIL-2R could be a promising new marker for determining inflammatory disease activity in CRPS. PMID:28634419

Prise en charge des orbitopathies dysthyroidiennes modérées et sévères: à propos de 22 cas

PubMed Central

Daldoul, Nadia; Knani, Leila; Gatfaoui, Faten; Mahjoub, Hechmi

2017-01-01

Décrire la prise en charge thérapeutique des orbitopathies dysthyroidiennes modérées et sévères et évaluer par une étude statistique les facteurs associés à la neuropathie optique ainsi que les facteurs de mauvais pronostic visuel. Nous avons mené une étude rétrospective sur 22 patients présentant une ophtalmopathie dysthyroidienne modérée à sévère sur au moins un oeil, hospitalisés au service d'ophtalmologie du CHU Farhat Hached Sousse, sur une période s'étalant de 1998 à 2015. Les indications thérapeutiques sont basées sur les critères d'activité et de sévérité de l'Eugogo ainsi que l'évaluation des facteurs de mauvais pronostic visuel. L'âge moyen de nos patients était de 40 ans avec une légère prédominance masculine (54.5%). 68.2% des patients étaient en euthyroidie, 18.2% étaient tabagique. Le facteur le plus associé significativement à la neuropathie est la compression au niveau de l'apex orbitaire (P = 0.03). Le traitement était basé sur la corticothérapie intraveineuse et/ou la décompression orbitaire en fonction de l'activité et la sévérité de la maladie. L'évolution globale après traitement a été marquée par une amélioration des signes inflammatoires, réduction de l'exophtalmie. Le pronostic visuel était plus mauvais chez les patients plus âgés (P = 0.0001), de sexe masculin (P = 0.03) et traités par irathérapie (P = 0.04). Dans les limites d'une étude rétrospective, nos résultats étaient globalement concordants avec la littérature. L'orbitopathie dysthyroidienne reste une maladie dont l'évaluation et la prise en charge thérapeutique sont non encore bien élucidées. Des études de cohortes, probablement multicentriques, sont à envisager pour améliorer la prise en charge. PMID:29187926

78 FR 56921 - South Bay Salt Pond Restoration Project, Phase 2 (Ponds R3, R4, R5, S5, A1, A2W, A8, A8S, A19...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-16

...We, the U.S. Fish and Wildlife Service (USFWS), in coordination with the California State Coastal Conservancy, are preparing a joint environmental impact statement/environmental impact report (EIS/EIR) for the proposed restoration of ponds R3, R4, R5, S5, A1, A2W, A8, A8S, A19, A20, and A21 at the Don Edwards National Wildlife Refuge (Refuge) in Alameda, Santa Clara and San Mateo Counties, California. The proposed project is Phase 2 of the South Bay Salt Pond Restoration Project and consists of restoring and enhancing over 2,000 acres of tidal wetlands and managed pond habitats in the South San Francisco Bay. It would also include storage and use of upland fill and dredged material in one or more of the seasonal ponds in the Refuge or on the levees that surround them. Phase 2 may also include collaborative restoration and/or flood management activities with non- USFWS landowners or managers of public infrastructure on adjacent properties. This notice advises the public that we intend to gather information necessary to prepare an EIS pursuant to the National Environmental Policy Act (NEPA). We encourage the public and other agencies to participate in the NEPA scoping process by attending the public scoping meeting and/or by sending written suggestions and information on the issues and concerns that should be addressed in the draft EIS/EIR, including the range of alternatives, appropriate mitigation measures, and the nature and extent of potential environmental impacts.

Axial Fatigue Tests at Zero Mean Stress of 24S-T and 75S-T Aluminum-alloy Strips with a Central Circular Hole

NASA Technical Reports Server (NTRS)

Brueggeman, W C; Mayer, M JR

1948-01-01

Axial fatigue tests at zero mean stress have been made on 0.032- and 0.064-inch 24S-T and 0.032-inch 75S-T sheet-metal specimens 1/4, 1/2, 1, and 2 inches wide without a hole and with central holes giving a range of hole diameter D to specimen width W from 0.01 to 0.95. No systematic difference was noted between the results for the 0.032-inch and the 0.064-inch specimens although the latter seemed the more consistent. In general the fatigue strength based on the minimum section dropped sharply as the ration D/W was increased from zero to about 0.25. The plain specimens showed quite a pronounced decrease in fatigue strength with increasing width. The holed specimens showed only slight and rather inconclusive evidence of this size effect. The fatigue stress-concentration factor was higher for 75S-T than for 24S-T alloy. Evidence was found that a very small hole would not cause any reduction in fatigue strength.

Definition of (so MIScalled) ``Complexity" as UTTER-SIMPLICITY!!!(sMciUS!!!) Versus Deviations From( sMciUS!!!): ``COMPLICATEDNESS" Definition(s) and MEASURE(S)!!!

NASA Astrophysics Data System (ADS)

Young, F.; Siegel, E.

2010-03-01

(so MIScalled) ``complexity''(sMc) associated BOTH SCALE- INVARIANCE Symmetry-RESTORING(S-I S-R) [vs. S-I S-B!!!], AND X (w) P(w ) 1/w^(1.000...) ``pink''/Zipf/Archimedes-HYPERBOLICITY INEVITABILITY CONNECTION is by simple-calculus SISR's logarithm- function derivative: (d/dw)ln(w)=1/w=1/w^(1.000...), hence: (d/dw) [SISR](w)=1/w=1/w^(1.000...)=(via Noether-theorem relating continuous-(SISR)-symmetries to conservation-laws)=(d/dw)[4-DIV (J(INTER-SCALE)=0](w)=1/w =1/w^(1.000...). Hence sMc is information inter-scale conservation [as Anderson-Mandell, Fractals of Brain; Fractals of Mind(1994)-experimental- psychology!!!], i.e. sMciUS!!!, VERSUS ``COMPLICATEDNESS", is sMcciUS!!!: EITHER: PLUS (Additive: Murphy's-law absence) OR TIMES (Multiplicative: Murphy's-law dominance) various disparate system-specificity ``COMPLICATIONS". ``COMPLICATEDNESS" MEASURES: DEVIATIONS FROM sMciUS!!!: EITHER [S-I S-B] MINUS [S- I S-R] AND/OR [``red"/Pareto X(w) P(w) 1/w^(#=/=1.000...)] MINUS [X(w) P(w) 1/w^(1.000...) ``pink"/Zipf/Archimedes-HYPERBOLICITY INEVITABILITY] = [1/w^(#=/=1.000...)] MINUS [1/w^(1.000...)]; almost but not exactly a fractals Hurst-exponent-like [# - 1.000...]!!!

Crystal structures of the diastereomeric salt pair of the prostaglandin intermediate 1 R, 2 S(+)- cis-2-hydroxycyclopent-4-enylacetic acid with S- and R- 1-phenylethylamine

NASA Astrophysics Data System (ADS)

Czugler, Mátyás; Csöregh, Ingeborg; Kálmán, Alajos; Faigl, Ferenc; Ács, Mária

1989-05-01

Crystal structures of an enantiomeric salt pair formed between 1 R,2 S- cis-2-hydroxycyclopent-4-enylacetic acid ( S-HCA) and R(+)-1-phenylethylamine ( R-PEA) and the corresponding S-PEA salt have been determined by X-ray crystallography. The S-HCA: R-PEA 1:1 salt ( R-HCA-PEA hereafter) is orthorhombic, P2 12 12 1, with the unit-cell parameters a = 5.806(1), b = 9.261(1), c = 27.624(2) Å and R = 0.056 for 1162 reflections at ambient temperature. The S-HCA: S-PEA 1:1 salt ( S-HCAPEA) is also orthorhombic, P2 12 12 1, with the unit-cell data a = 6.034(2), b = 11.840(7), c = 20.198(11) Å at 170 K, R = 0.082 for 1196 data measured at low temperatures (170 K). The R-HCAPEA salt has its two components assembled into an elongated rod-like shape via two-dimensional hydrogen bonding between cations and anions thus forming a well-ordered crystal. In contrast, the cation and anion in the S-HCAPEA salt forms a more globular aggregate and displays orientation disorder in the five-membered ring part of the anion and maintains an essentially one-dimensional hydrogen-bond network, while the total number of hydrogen bonds between cationic and anionic species remains three in both crystals.

Preparation of Single-Layer MoS 2xSe 2(1-x) and Mo xW 1-xS 2 Nanosheets with High-Concentration Metallic 1T Phase

DOE PAGES

Tan, Chaoliang; Zhao, Wei; Chaturvedi, Apoorva; ...

2016-02-24

The high-yield and scalable production of single-layer ternary transition metal dichalcogenide nanosheets with ≈66% of metallic 1T phase, including MoS 2xSe 2(1-x) and Mo xW 1-xS 2 is here achieved via electrochemical Li-intercalation and the exfoliation method. Thin film MoS 2xSe 2(1-x) nanosheets drop-cast on a fluorine-doped tin oxide substrate are used as an efficient electrocatalyst on the counter electrode for the tri-iodide reduction in a dye-sensitized solar cell.

S+T+R+O+N+G Kids Life Skills Program: Levels K-5.

ERIC Educational Resources Information Center

Silbert, Linda Bress; Silbert, Alvin J.

Strong kids have the fortitude to resist drug/alcohol abuse and other tendencies towards anti-social behavior. Research has shown that strong kids have attained a high level of development in six crucial areas. The S+T+R+O+N+G Kids Program builds upon each of these areas: (1) Self-Esteem; (2) Trust; (3) Responsibility; (4) Options; (5) Needs; (6)…

Measurement of the W boson polarisation in $$t\\bar{t}$$ events from pp collisions at $$\\sqrt{s} = 8$$ TeV in the lepton + jets channel with ATLAS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aaboud, M.; Aad, G.; Abbott, B.

This paper presents a measurement of the polarisation of W bosons from tt¯ decays, reconstructed in events with one high-p T lepton and at least four jets. Data from pp collisions at the LHC were collected at √s = 8 TeV and correspond to an integrated luminosity of 20.2 fb –1. The angle θ* between the b-quark from the top quark decay and a direct W boson decay product in the W boson rest frame is sensitive to the W boson polarisation. Two different W decay products are used as polarisation analysers: the charged lepton and the down-type quark formore » the leptonically and hadronically decaying W boson, respectively. The most precise measurement of the W boson polarisation via the distribution of cosθ* is obtained using the leptonic analyser and events in which at least two of the jets are tagged as b-quark jets. The fitted fractions of longitudinal, left- and right-handed polarisation states are F 0 = 0.709 ± 0.019, F L = 0.299 ± 0.015 and F R = –0.008 ± 0.014, and are the most precisely measured W boson polarisation fractions to date. Limits on anomalous couplings of the Wtb vertex are set.« less

Measurement of the W boson polarisation in $$t\\bar{t}$$ events from pp collisions at $$\\sqrt{s} = 8$$ TeV in the lepton + jets channel with ATLAS

DOE PAGES

Aaboud, M.; Aad, G.; Abbott, B.; ...

2017-04-26

This paper presents a measurement of the polarisation of W bosons from tt¯ decays, reconstructed in events with one high-p T lepton and at least four jets. Data from pp collisions at the LHC were collected at √s = 8 TeV and correspond to an integrated luminosity of 20.2 fb –1. The angle θ* between the b-quark from the top quark decay and a direct W boson decay product in the W boson rest frame is sensitive to the W boson polarisation. Two different W decay products are used as polarisation analysers: the charged lepton and the down-type quark formore » the leptonically and hadronically decaying W boson, respectively. The most precise measurement of the W boson polarisation via the distribution of cosθ* is obtained using the leptonic analyser and events in which at least two of the jets are tagged as b-quark jets. The fitted fractions of longitudinal, left- and right-handed polarisation states are F 0 = 0.709 ± 0.019, F L = 0.299 ± 0.015 and F R = –0.008 ± 0.014, and are the most precisely measured W boson polarisation fractions to date. Limits on anomalous couplings of the Wtb vertex are set.« less

NeuroD1 A45T and PAX4 R121W polymorphisms are associated with plasma glucose level of repaglinide monotherapy in Chinese patients with type 2 diabetes

PubMed Central

Gong, Zhi-Cheng; Huang, Qiong; Dai, Xing-Ping; Lei, Guang-Hua; Lu, Hong-Bin; Yin, Ji-Ye; Xu, Xiao-Jing; Qu, Jian; Pei, Qi; Dong, Min; Zhou, Bo-Ting; Shen, Jie; Zhou, Gan; Zhou, Hong-Hao; Liu, Zhao-Qian

2012-01-01

AIMS We aimed to determine whether NeuroD1/BETA2 and PAX4 polymorphisms were associated with the therapeutic efficacy of repaglinide in Chinese type 2 diabetes mellitus (T2DM) patients. METHODS Three hundred and sixty-eight T2DM patients and 132 healthy control subjects were genotyped by restriction fragment length polymorphism. Forty-three patients with various genotypes were randomly selected to undergo 8 weeks of repaglinide treatment (3 mg day−1). Fasting plasma glucose, postprandial plasma glucose, glycated haemoglobin, fasting and postprandial serum insulin (FINS, PINS), homeostasis model assessment for insulin resistance, serum triglyceride, total cholesterol, low-density lipoprotein-cholesterol and high-density lipoprotein-cholesterol were determined before and after repaglinide treatment. RESULTS The allelic frequency of NeuroD1/BETA2 T45 was higher in T2DM patients than in the control subjects [13.45 vs. 6.82%, P < 0.01, odds ratios = 2.342 (1.365, 4.019), P= 0.002]. Type 2 diabetes mellitus patients with the mutated allele of NeuroD1/BETA2 A45T polymorphism showed higher FINS (13.46 ± 12.57 vs. 10.04 ± 7.09 mU l−1, P < 0.05) (11.67, 14.83 vs. 8.38, 11.37) and PINS (52.11 ± 40.93 vs. 68.66 ± 43.87 mU l−1, P < 0.05) (44.89, 58.35 vs. 55.35, 88.87) than individuals with the T allele. The PAX4 R121W R allele carriers had higher PINS (52.11 ± 40.93 vs. 68.66 ± 43.87 mU l−1, P < 0.05) (44.89, 58.35 vs. 55.35, 88.87) than subjects with the W allele. After repaglinide treatment, patients with the T allele of NeuroD1/BETA2 A45T polymorphisms had attenuated efficacy on fasting plasma glucose (−2.79 ± 2.14 vs.−0.99 ± 1.80 mmol l−1, P < 0.01) (−3.53, −1.84 vs.−1.99, −0.13) and postprandial plasma glucose (−6.71 ± 5.90 vs.−2.54 ± 3.39 mmol l−1, P < 0.01) (−9.28, −4.62 vs.−4.34, −0.84). Patients with the RR genotype of PAX4 R121W showed better efficacy with respect to the level of postprandial plasma glucose than R/W

NeuroD1 A45T and PAX4 R121W polymorphisms are associated with plasma glucose level of repaglinide monotherapy in Chinese patients with type 2 diabetes.

PubMed

Gong, Zhi-Cheng; Huang, Qiong; Dai, Xing-Ping; Lei, Guang-Hua; Lu, Hong-Bin; Yin, Ji-Ye; Xu, Xiao-Jing; Qu, Jian; Pei, Qi; Dong, Min; Zhou, Bo-Ting; Shen, Jie; Zhou, Gan; Zhou, Hong-Hao; Liu, Zhao-Qian

2012-09-01

We aimed to determine whether NeuroD1/BETA2 and PAX4 polymorphisms were associated with the therapeutic efficacy of repaglinide in Chinese type 2 diabetes mellitus (T2DM) patients. Three hundred and sixty-eight T2DM patients and 132 healthy control subjects were genotyped by restriction fragment length polymorphism. Forty-three patients with various genotypes were randomly selected to undergo 8 weeks of repaglinide treatment (3 mg day(-1)). Fasting plasma glucose, postprandial plasma glucose, glycated haemoglobin, fasting and postprandial serum insulin (FINS, PINS), homeostasis model assessment for insulin resistance, serum triglyceride, total cholesterol, low-density lipoprotein-cholesterol and high-density lipoprotein-cholesterol were determined before and after repaglinide treatment. The allelic frequency of NeuroD1/BETA2 T45 was higher in T2DM patients than in the control subjects [13.45 vs. 6.82%, P < 0.01, odds ratios = 2.342 (1.365, 4.019), P= 0.002]. Type 2 diabetes mellitus patients with the mutated allele of NeuroD1/BETA2 A45T polymorphism showed higher FINS (13.46 ± 12.57 vs. 10.04 ± 7.09 mU l(-1) , P < 0.05) (11.67, 14.83 vs. 8.38, 11.37) and PINS (52.11 ± 40.93 vs. 68.66 ± 43.87 mU l(-1), P < 0.05) (44.89, 58.35 vs. 55.35, 88.87) than individuals with the T allele. The PAX4 R121W R allele carriers had higher PINS (52.11 ± 40.93 vs. 68.66 ± 43.87 mU l(-1), P < 0.05) (44.89, 58.35 vs. 55.35, 88.87) than subjects with the W allele. After repaglinide treatment, patients with the T allele of NeuroD1/BETA2 A45T polymorphisms had attenuated efficacy on fasting plasma glucose (-2.79 ± 2.14 vs.-0.99 ± 1.80 mmol l(-1), P < 0.01) (-3.53, -1.84 vs.-1.99, -0.13) and postprandial plasma glucose (-6.71 ± 5.90 vs.-2.54 ± 3.39 mmol l(-1), P < 0.01) (-9.28, -4.62 vs.-4.34, -0.84). Patients with the RR genotype of PAX4 R121W showed better efficacy with respect to the level of postprandial plasma glucose than R/W genotypes (-6.53 ± 6.52 vs.-2.95 ± 1.17 mmol l

S-2-hydroxyglutarate regulates CD8+ T-lymphocyte fate.

PubMed

Tyrakis, Petros A; Palazon, Asis; Macias, David; Lee, Kian L; Phan, Anthony T; Veliça, Pedro; You, Jia; Chia, Grace S; Sim, Jingwei; Doedens, Andrew; Abelanet, Alice; Evans, Colin E; Griffiths, John R; Poellinger, Lorenz; Goldrath, Ananda W; Johnson, Randall S

2016-12-08

R-2-hydroxyglutarate accumulates to millimolar levels in cancer cells with gain-of-function isocitrate dehydrogenase 1/2 mutations. These levels of R-2-hydroxyglutarate affect 2-oxoglutarate-dependent dioxygenases. Both metabolite enantiomers, R- and S-2-hydroxyglutarate, are detectible in healthy individuals, yet their physiological function remains elusive. Here we show that 2-hydroxyglutarate accumulates in mouse CD8 + T cells in response to T-cell receptor triggering, and accumulates to millimolar levels in physiological oxygen conditions through a hypoxia-inducible factor 1-alpha (HIF-1α)-dependent mechanism. S-2-hydroxyglutarate predominates over R-2-hydroxyglutarate in activated T cells, and we demonstrate alterations in markers of CD8 + T-cell differentiation in response to this metabolite. Modulation of histone and DNA demethylation, as well as HIF-1α stability, mediate these effects. S-2-hydroxyglutarate treatment greatly enhances the in vivo proliferation, persistence and anti-tumour capacity of adoptively transferred CD8 + T cells. Thus, S-2-hydroxyglutarate acts as an immunometabolite that links environmental context, through a metabolic-epigenetic axis, to immune fate and function.

Ada Compiler Validation Summary Report: Certificate Number 891201S1. 10213 U.S. Navy Ada/M Version 2.0 (/NO Optimize Option) VAX 8550 and VAX 11/785 Hosts and AN/UYK-44 Target

DTIC Science & Technology

1989-12-01

T~IC F LE COK _"_ "NTATION PAGE I r070O18- AD-A223 693 M w-__wow_=ORT DATE ILREPORT TYP ND DATES CM RID I Dec 89 to I Dec 90 Final 4.1LE frMlTWLE...target), 891201.10213 LAVUTORS) National Institute of Standards and Technology Gaithersburg, MD USA 7 . PEWOOMWOPAA AT HW M S) L PEVodM ORGANIZATION 7 ...DATE VSR CCLPIETED BEFORE CN-SITE: 08-11-89 DATE VSR CPEIED AFE ON-SITE: 12-04-89 DATE VSR MODIFIED PER AVO CCMKENTS: 12-29-89 DATE VSR MODIFIED PER AVO

A User’s Guide to CERC’s Field Research Facility.

DTIC Science & Technology

1981-10-01

Fam,~ ~~~ 11 sIqldca Walter Mtlae iMi r,t Torrey Paintl le aceaec it Mattfmld and [att iv 1tera , Pi ,ot tloellI A’S’~ ~~ ~~ . n2K’t’ L trw: a ( Macha

Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

PubMed

Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

2009-01-01

Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved. Copyright 2009 S. Karger AG, Basel.

113Gb/s (10 x 11.3Gb/s) ultra-low power EAM driver array.

PubMed

Vaernewyck, Renato; Bauwelinck, Johan; Yin, Xin; Pierco, Ramses; Verbrugghe, Jochen; Torfs, Guy; Li, Zhisheng; Qiu, Xing-Zhi; Vandewege, Jan; Cronin, Richard; Borghesani, Anna; Moodie, David

2013-01-14

This paper presents an ultra-low power SiGe BiCMOS IC for driving a 10 channel electro-absorption modulator (EAM) array at 113Gb/s for wavelength division multiplexing passive optical network (WDM-PON) applications. With an output swing of 2.5V(pp), the EAM driver array consumes only 2.2W or 220mW per channel, 50% below the state of the art. Both the output swing and bias are configurable between 1.5 and 3.0V(pp) and 0.75-2.15V respectively.

U.S./U.S.S.R. SYMPOSIUM ON PARTICULATE CONTROL (3RD) HELD AT SUZDAL, U.S.S.R. ON SEPTEMBER 10-12, 1979

EPA Science Inventory

The proceedings document the Third U.S./U.S.S.R. Symposium on Particulate Control, September 10-12, 1979, in Suzdal, U.S.S.R. Papers covered such topics as: predicting back-corona formation and fly ash resistivity, improved electrostatic precipitator (ESP) mathematical modeling, ...

Speech Optimization at 9600 Bits/Second. Volume 2. Real-Time Software and Hardware.

DTIC Science & Technology

1980-09-30

resumed as follows: q s A r c ACCA -- S rUP > When resumed, the task closes the MAP and exits. If a complete, two MAP system is desired, the process...A r - C 2 #1 L. II V. It 1, x It -- C C cr t9-tr it 2 - 9C--99 .I. 11 1 16 f6 .~ 4 2t V V t6 M W C It It 22~ ~~ .20 2 r2-~. z-. C22 z C Z ~ 2 O s~ 9

Evolution post-opératoire des séquelles de tuberculose pulmonaire chez les séropositifs VIH

PubMed Central

Grégoire, Ayegnon Kouakou; Flavien, Kendja Hypolite; Raphaël, Ouédé; Démine, Blaise; Christophe, Ménéas Gueu; Marie, Ano Kounangui; Hervé, Yangni-Angaté Koffi; Yves, Tanauh

2014-01-01

Cette étude rapporte les aspects cliniques et évolutifs des séquelles pulmonaires tuberculeuses (SPT) opérées chez les séropositifs (VIH+). Il s'agit d'une étude prospective transversale réalisée entre Novembre 2005 et Octobre 2012. Elle a porté sur 20 patients VIH+, ayant dans leurs antécédents, une tuberculose pulmonaire (TP) traitée et déclarée guérie, et admise dans ladite période pour une chirurgie de la SPT secondaire. Une enquête sérologique VIH a été réalisée systématiquement au cours du bilan pré-opératoire. Le diagnostic pré-opératoire de la SPT, la mortalité, les complications post- opératoires (CPOP), le séjour hospitalier, le suivi à moyen terme des STP opérées ont été évalués. Les séropositifs étaient VIH1+ (n = 12; 60%), VIH1&2+ (n = 4; 20%) et VIH2+ (n = 4; 20%). La durée moyenne d’évolution des STP était de 26,22 ± 21,3 mois. Les STP étaient les pyothorax ou pleurésies enkystées (n = 16; 80%), le poumon détruit (n = 2;10%) et les dilatations de bronches (n = 2;10%). Les VIH+ ne présentaient pas d'aspergillome pulmonaire. Le séjour hospitalier moyen était 13,1 ± 10,2 jours. Le suivi total était de 82 patients-année avec une moyenne de suivi de 4,2 ± 2,3 ans (extrêmes: 1 et 7 ans). Le taux de mortalité à court et moyen terme était nul. Aucun décès post-opératoire immédiat n'a été noté. Les CPOP immédiates étaient les bullages prolongés chez 75% des immunodéprimés. Les CPOP tardives (n = 3) étaient un syndrome restrictif pulmonaire, un pyothorax persistant et une pachypleurite résiduelle restrictive. A court terme, le taux de guérison radiologique était de 80% (n = 16). PMID:24932331

An examination of the thermodynamics of fusion, vaporization, and sublimation of (R,S)- and (R)-flurbiprofen by correlation gas chromatography.

PubMed

Umnahanant, Patamaporn; Hasty, Darrell; Chickos, James

2012-06-01

The vaporization, fusion, and sublimation enthalpies of (R,S)- and (R)-flurbiprofen at T = 298.15 K are reported and compared with literature values when available. Correlation gas chromatography experiments were first performed to identify appropriate standards that could be used for materials containing a single fluorine substituent. Subsequent correlations resulted in a vaporization enthalpy for (R,S)-flurbiprofen and (R)-flurbiprofen, ΔH(vap) (298.15 K), of (127.5 ± 5.5) and (127.4 ± 4.7) kJ mol, respectively. Fusion enthalpies, ΔH(fus) (387 K), of (28.2 ± and, ΔH(fus) (381 K), (22.8 ± kJ mol(-1) were also measured by differential scanning calorimetry for the racemic and chiral forms of flurbiprofen. Adjusted to T = 298.15 K and combined with the vaporization enthalpy resulted in sublimation enthalpies, ΔH(sub) (298.15 K), of (155.6 ± 5.8) and (145.1 ± 5.7) kJ mol(-1) for (R,S)- and (R)-flurbiprofen, respectively. The fusion enthalpy measured for the racemic form was in excellent agreement with the literature value, while the sublimation enthalpy varies substantially from previous work. Two weak solid-solid phase transitions were also observed for (R)-flurbiprofen at T = 353.9 K (0.30 ± 0.1) and 363.2 K (0.21 ± 0.03) kJ · mol(-1). Copyright © 2012 Wiley Periodicals, Inc.

Validation of the βeta-s.t.a.r. 1 + 1 for rapid screening of residues of β-lactam antibiotics in milk

PubMed Central

Reybroeck, W.; Ooghe, S.; De Brabander, H.F.; Daeseleire, E.

2010-01-01

The 2-min protocol (1 + 1) for the βeta-s.t.a.r. (manufactured by Neogen Corporation, Lansing, MI, USA) was validated at the Technology and Food Science Unit of the Institute for Agricultural and Fisheries Research according to Commission Decision 2002/657/EC. The test was very selective for the group of β-lactam compounds: the only interference found was by clavulanic acid at 2500 μg kg−1 and above. The modified protocol (βeta-s.t.a.r. 1 + 1) detected all β-lactams with a maximum residue limit (MRL) in milk, but not all these compounds were detected at their respective MRL. The detection of cefalexin (detection capability = 6000 μg kg−1; MRL = 100 μg kg−1) and penethamate (detection capability = 80 μg kg−1; MRL = 4 μg kg−1) was especially poor, and also ceftiofur was only detected from 500 μg kg−1 (MRL = 100 μg kg−1). The repeatability of the reader and of the test was very good. The test was very robust: test results were not significantly influenced by small changes in the test protocol, by the milk composition or by the type of milk. The test was also suitable to test the milk of animal species other than cow. Favourable results were obtained in testing monitoring samples, in two national ring trials, and in an international proficiency test. The βeta-s.t.a.r. 1 + 1 is a very fast, simple, and reliable test that could be used at the farm level to prevent tanker milk contamination by β-lactams. PMID:20512709

Role of IL-22– and TNF-α–Producing Th22 Cells in Uveitis Patients with Behçet’s Disease

PubMed Central

Kawazoe, Yuko; Imai, Ayano; Kawaguchi, Tatsushi; Horie, Shintaro; Keino, Hiroshi; Takahashi, Masayo; Mochizuki, Manabu

2013-01-01

Behçet’s disease is a systemic inflammatory disorder with recurrent episodes of oral ulceration, skin lesions, genital ulceration, and intraocular inflammation (uveitis). The intraocular inflammation is strictly associated with Th effector cells. IL-22 is a member of the IL-10 cytokine family that is involved in inflammatory processes. Recently, Th22 cells were identified as a Th cell population that produces IL-22 and TNF-α and are distinct from Th1, Th2, and Th17 cells. In this study, we established Th22-type T cell clones from ocular samples taken from Behçet’s disease patients with active uveitis. These clones produced large amounts of IL-22 and TNF-α but not the Th1 cytokine IFN-γ and the Th17 cytokine IL-17. CD4+ T cells from the peripheral blood of Behçet’s disease patients differentiated into Th22 cells in the presence of IL-6 and TNF-α in vitro. The polarized Th22 cell lines produced large amounts of IL-22, and the polarized Th1 and Th17 cells also produced IL-22. In the presence of anti–TNF-α– and anti–IL-6–blocking Abs, Behçet’s disease Th22-type T cells failed to produce IL-22. In addition, infliximab-pretreated Th22 cells and Th22-type ocular T cells produced less IL-22 and TNF-α. Moreover, IL-22–producing T cells were isolated from mice with experimental autoimmune uveitis, an animal model of Behçet’s disease, and the intraocular T cells from uveitis models produced large amounts of IL-22 in the presence of retinal Ags. Our results suggest that inflammatory cytokines IL-22 and TNF-α may play a key role in the ocular immune response in Behçet’s disease. PMID:23630362

U.S. Coast Guard Cutter KAW - WYT-61 Outboard Profile.

DTIC Science & Technology

1977-10-01

NUMBER if 4 ’. TYPE OF REPORT A PERIOD COVERED l " " 6. PERFORMING ORG, REPORT NUMBER 7. AUTHOR(*) 8 . CONTRACT OR GRANT NUMBER(#) 00S. PERFORMING...34y % 04 FINNT OF DW5&Wkt4wE. Oft PILoT WOUSE TOP OCLICT90 CENTIM SOW TOWWAi LIGICr AV40 VtP ^*r8W*A. AS9CO P*KeOf LW4rT. On MAIM MAs- CaLeTs . IMA L...uwr AM wLc^Tu* wmina. ~ L4VAT. ^DIM* AMOMEfTlER, frv.. AwTals4A AND . OCLTD ATCK Viticp-s".A on ao a s D@oc, AsggD *wTIMww A COW’IiU AwvES C. 4 . wwmSLuA

Crystal structure of EGFR T790 M/C797S/V948R in complex with EAI045.

PubMed

Zhao, Peng; Yao, Ming-Yu; Zhu, Su-Jie; Chen, Ji-Yun; Yun, Cai-Hong

2018-05-23

Lung cancer is the leading cause of cancer deaths. Epidermal growth factor receptor (EGFR) kinase domain mutations are a common cause of non-small cell lung cancers (NSCLCs), a major subtype of lung cancers. Patients harboring most of these mutations respond well to the anti-EGFR tyrosine kinase inhibitors (TKIs) gefitinib and erlotinib initially, but soon develop resistance to them in about half of the cases due to the emergence of the gatekeeper mutation T790 M. The third-generation TKIs such as AZD9291, HM61713, CO-1686 and WZ4002 can overcome T790 M through covalent binding to the EGFR kinase through Cys 797, but ultimately lose their efficacy upon emergence of the C797S mutation that abolishes the covalent bonding. Therefore to develop new TKIs to overcome EGFR drug-resistant mutants harboring T790 M/C797S is urgently demanded. EAI001 and EAI045 are a new type of EGFR TKIs that bind to EGFR reversibly and not relying on Cys 797. EAI045 in combination with cetuximab is effective in mouse models of lung cancer driven by EGFR L858 R/T790 M and L858 R/T790 M/C797S. Here we report the crystal structure of EGFR T790 M/C797S/V948R in complex with EAI045, and compare it to EGFR T790 M/V948R in complex with EAI001. The complex structure reveals why EAI045 binds tighter to EGFR than does EAI001, and why EAI001 and EAI045 prefer binding to EGFR T790 M. The knowledge may facilitate future drug development studies targeting this very important cancer target. Copyright © 2018. Published by Elsevier Inc.

Pratt & Whitney Advanced Ducted Propulsor (ADP) Engine Test in 40x80ft w.t.: Engineers Peter

NASA Technical Reports Server (NTRS)

1993-01-01

Pratt & Whitney Advanced Ducted Propulsor (ADP) Engine Test in 40x80ft w.t.: Engineers Peter Zell (left) and Dr Clifton Horne (right) are shown preparing a laser light sheet for a flow visualization test. Shown standing in the nacelle of the ADP is John Girvin, senior test engineer for Pratt & Whitney.

[(S)-1-Carbamoylethyl]bis(dimethylglyoximato-kappa2N,N')[(S)-1-phenylethylamine]cobalt(III) and bis(dimethylglyoximato-kappa2N,N')[(R)-1-(N-methylcarbamoyl)ethyl][(R)-1-phenylethylamine]cobalt(III) monohydrate.

PubMed

Orisaku, Keiko Komori; Hagiwara, Mieko; Ohgo, Yoshiki; Arai, Yoshifusa; Ohgo, Yoshiaki

2005-04-01

The title complexes, [Co(C3H6NO)(C4H7N2O2)2(C8H11N)] and [Co(C4H8NO)(C4H7N2O2)2(C8H11N)].H2O, were resolved from [(RS)-1-carbamoylethyl]bis(dimethylglyoximato)[(S)-1-phenylethylamine]cobalt(III) and bis(dimethylglyoximato)[(RS)-1-(N-methylcarbamoyl)ethyl][(R)-1-phenylethylamine]cobalt(III), respectively, and their crystal structures were determined in order to reveal the absolute configuration of the major enantiomer produced in the photoisomerization of each series of 2-carbamoylethyl and 2-(N-methylcarbamoyl)ethyl cobaloxime complexes.

Synthesis and X-ray structures of dilithium complexes of the phosphonate anions [PhP(E)(N(t)Bu)(2)](2-) (E = O, S, Se, Te) and dimethylaluminum derivatives of [PhP(E)(N(t)Bu)(NH(t)Bu)](-) (E = S, Se).

PubMed

Briand, Glen G; Chivers, Tristram; Krahn, Mark; Parvez, Masood

2002-12-16

The dilithium salts of the phosphonate dianions [PhP(E)(N(t)Bu)(2)](2-) (E = O, S, Se) are generated by the lithiation of [PhP(E)(NH(t)Bu)(2)] with n-butyllithium. The formation of the corresponding telluride (E = Te) is achieved by oxidation of [Li(2)[PhP(N(t)Bu)(2)

Measures and Trends U.S. and U.S.S.R. Strategic Force Effectiveness. (Sanitized)

DTIC Science & Technology

1978-07-01

is limited by the uncer- tainties and inaccracies present in the data which are used to develop the moasure. In the main body of the text the...alplizan1e to the prvostwu noas;urO5 arc ar;ici~to tn; ~~z~ ’i.r 2ctwo mt- azurer i-rmores tne fact that t Cftl4t.0 av’curacy -f I tnk~ atv :a;r le... azured in aitica1 nilios, of all thv straregic nuclear weaorjzf in CaC!. forCe iS CO c~aztd. V. (U) in order to utlijZe .he stanl1ard qra:pl.ic re

INT6 May Influence Breast Cancer Formation by Regulating the 26S Proteasome

DTIC Science & Technology

2007-04-01

to res- cue the growth defects were discarded. The final cDNA clones were sequenced u s i n g t w o p r i m e r s : 5 ’ - CAATCTCATTCTCACTTTCTGAC-3...polyclonal rab- b i t a n t i b o d y u s i n g CIVKEIQDEKEAEAARKKGR as a pep- tide antigen. The confirmation of this an- tibody (1: 2,000) is shown...J. W. (1997) J. Biol. Chem. 272, 23477- 23480 12. Bandyopadhyay, A., Lakshmanan, V., Matsumoto, T ., Chang, E. C., and Maitra, U. (2002) J. Biol. Chem

The orbits of satellites of (22) Kalliope and (317) Roxane

NASA Astrophysics Data System (ADS)

Drummond, Jack D.; Reynolds, Odell; Buckman, Miles; Eickhoff, Mark

2017-10-01

Between October 2016 and February 2017 we imaged asteroid (22) Kalliope (10.3W lasers to produce a 40 w laser guide star in order to provide high order adaptive optics corrections for our 3.5 m telescope. The apparent orbits of both satellites carried them in and out of the asteroids’ point spread function over this period, and from just this one apparition we are able to derive true orbits for both.For Kalliope’s satellite we find the following orbit and compare it to one derived from years of 8-10 m telescope observations (Vachier, Berthier, and Marchis (2012), A&A 543, A68):Linus (here) a=1099+/-6 km;P=3.595606+/-0.000375 d;T0=2457751.021+/-0.004;Pole [RADec]=[194.3-4.2]e=0Vachier et al. a=1082+/-11 km;P=3.595712+/-0.000068 d;T0=2452215.141+/-0.022;Pole [RADec]=[195.1-4.2]e=0.007+/-0.010ω=150+/-2We provide the first-ever orbit for Roxane’s moon, but it is not clear if the orbit is retrograde (R) or prograde (P), circular (C) or eccentric (E):Roxane S/1 (RC) a=243+/-6 km; P=11.5265+/-0.0204 d; T0=2457725.137+/-0.050; Pole[RA;Dec]=[ 96.2;-68.3]; e=0Roxane S/1 (PC) a=245+/-6 km; P=11.5858+/-0.0203 d; T0=2457721.631+/-0.051; Pole[RA;Dec]=[275.7;+68.8]; e= 0Roxane S/1 (RE) a=251+/-8 km; P=11.4927+/-0.0215 d; T0=2457717.730+/-0.126; Pole[RA;Dec]=[ 95.3; -67.8]; e=0.178+/-0.061ω=124+/-4Roxane S/1 (PE) a=249+/-7 km; P=11.5594+/-0.0190 d; T0=2457717.603+/-0.162; Pole[RADec]=[276.6+69.2]e=0.133+/-0.038ω= 230+/-5Roxane’s moon’s orbital pole is less than 4 degrees from the Ecliptic pole or Roxane’s orbital pole, but more than 22 degrees from Roxane’s rotational pole. Perhaps this indicates that the moon was captured from the Ecliptic plane rather than spun into Roxanne’s equatorial plane.The Starfire Optical Range’s 3.5 m telescope is the smallest ground based

Resolution of enantiopure (S)-1-(1-napthyl) ethanol from racemic mixture by a novel Bacillus cereus isolate.

PubMed

Ranjan, Preeti; Pandey, Ashok; Binod, Parameswaran

2017-09-01

Chiral intermediates have wide application and high demand in pharmaceutical, agricultural, and other biotechnological industries for the preparation of bulk drug substances or fine chemicals. (S)-1-(1-napthyl) ethanol is an important synthetic intermediate of mevinic acid analog and a potential inhibitor of 3-hydroxy methyl glutaryl coenzyme A reductase enzymes which is rate limiting for cholesterol synthesis. The present study focuses on the resolution of (RS)-1-(1-napthyl) ethanol using whole cell biotransformation approach. The screening of microbial strains for the specific conversion were performed by the enrichment techniques using (RS)-1-(1-napthyl) ethanol. Evaluation of resolution, i.e., the enantioselective conversion of (R)-1-(1-napthyl) ethanol into 1-acetonapthone and production of (S)-1-(1-napthyl) ethanol with high purity were carried out. Among the isolates, a novel strain Bacillus cereus WG3 was found to be potent for the resolution and conversion of (S)-1-(1-napthyl) ethanol. This strain showed 86% conversion of (R)-1-(1-napthyl) ethanol and 95% yield of S-1-(1-napthyl) ethanol with 80% ee after 24 h. Further, the optimization of biotransformation reactions was carried out and the optimal parameters were found to be pH 7.0 and temperature 30 °C. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

32 CFR 728.80 - U.S. Government employees.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 5 2014-07-01 2014-07-01 false U.S. Government employees. 728.80 Section 728.80... FOR ELIGIBLE PERSONS AT NAVY MEDICAL DEPARTMENT FACILITIES Other Persons § 728.80 U.S. Government... Government who sustain injuries while in the performance of duty, including diseases proximately caused by...

Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

PubMed

Chun, J; Huq, A; Colwell, R R

1999-05-01

Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

Pratt & Whitney Advanced Ducted Propulsor (ADP) Engine Test in 40x80ft w.t.: Engineers Peter

NASA Technical Reports Server (NTRS)

1993-01-01

Pratt & Whitney Advanced Ducted Propulsor (ADP) Engine Test in 40x80ft w.t.: Engineers Peter Zell (left) and Dr Clifton Horne (right) are shown preparing for a laser light sheet for a flow visualization test. Shown standing in the nacelle of the ADP is John Girvin, senior test engineer for Pratt & Whitney.

Cognitive Changes in Presymptomatic Parkinson’s Disease

DTIC Science & Technology

2006-09-01

Education and the CVLT 5-trial total T -score ( r = 0.23, p = 0.048) achieved significance. With the exception of the correlation with Serial Order...International Neuropsychological Society 1996; 2: 383-91. Sprengelmeyer R , Young AW, Mahn K, Schroeder U, Woitalla D, Büttner T , Kuhn W, Przuntek H... R ., Grande, L., Womack, K., Riestra, A., Okun, M.S., Bowers, D., & Heilman, K.M. Memory in Parkinson’s Disease: A step-wise analysis. Poster

22 CFR 120.27 - U.S. criminal statutes.

Code of Federal Regulations, 2014 CFR

2014-04-01

... Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS... means: (1) Section 38 of the Arms Export Control Act (22 U.S.C. 2778); (2) Section 11 of the Export... underlying offense involves a defense article, including technical data, or violations related to the Arms...

11 CFR 2.2 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 11 Federal Elections 1 2011-01-01 2011-01-01 false Definitions. 2.2 Section 2.2 Federal Elections FEDERAL ELECTION COMMISSION SUNSHINE REGULATIONS; MEETINGS § 2.2 Definitions. (a) Commission. Commission... to 2 U.S.C. 437c(a), but does not include a proxy or other designated representative of a...

11 CFR 2.2 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 11 Federal Elections 1 2013-01-01 2012-01-01 true Definitions. 2.2 Section 2.2 Federal Elections FEDERAL ELECTION COMMISSION SUNSHINE REGULATIONS; MEETINGS § 2.2 Definitions. (a) Commission. Commission... to 2 U.S.C. 437c(a), but does not include a proxy or other designated representative of a...

11 CFR 2.2 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 11 Federal Elections 1 2014-01-01 2014-01-01 false Definitions. 2.2 Section 2.2 Federal Elections FEDERAL ELECTION COMMISSION SUNSHINE REGULATIONS; MEETINGS § 2.2 Definitions. (a) Commission. Commission... to 2 U.S.C. 437c(a), but does not include a proxy or other designated representative of a...

11 CFR 2.2 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 11 Federal Elections 1 2012-01-01 2012-01-01 false Definitions. 2.2 Section 2.2 Federal Elections FEDERAL ELECTION COMMISSION SUNSHINE REGULATIONS; MEETINGS § 2.2 Definitions. (a) Commission. Commission... to 2 U.S.C. 437c(a), but does not include a proxy or other designated representative of a...

Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

PubMed

Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

2015-12-21

5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Upper Mississippi River System, Environment Management Program, Definite Project Report with Integrated Environmental Assessment (R-8). Bay Island, Missouri Rehabilitation and Enhancement. Pool 22, Mississippi River Miles 311 through 312, Marion County, Missouri

DTIC Science & Technology

1990-03-01

rare in Missouri. The record is from 1987. Red berried elder ( Sambucus pubens) occurs within 1.0 miles of the project area. This plant is endangered...hIALLARD IYPIACTS AAHU’x r U rr PLAN Figure 1- Plan Comparisons A-19 Note that Plan C (sediment deflection) would provide essentially no benefits to...S TA.T$ OIL UTAILS jfy 9.LE.CTtICA.l. 0 BasMW6 WORN Mfaiss wo1nu SYSTEM ,mW30mmoRALummAnuGiWEN PinOain =1~ POOL sIKIrval wLI $11 t PLATE I 44 D ~SAY8

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

U.S. EPA, Pesticide Product Label, , 11/03/1981

EPA Pesticide Factsheets

2011-04-21

... '" ;Iq, t ..... JILt''':' Ul',t! I;~ ,h, " •• ( W' ·,.1··.·\\ I;"'1i ". ,1"'.'' II), It· HIQt'1I, • 1t·,1·'~.f·'1 t.·" "I' ',',1 ,,~ ".JIlt··" ,;11'1, 'I .. : (, Il~,,, ' of' l' .., . ...

Orientations and Proximities of the Extracellular Ends of Transmembrane Helices S0 and S4 in Open and Closed BK Potassium Channels

PubMed Central

Wu, Roland S.; Chudasama, Neelesh; Zakharov, Sergey I.; Karlin, Arthur; Marx, Steven O.

2013-01-01

The large-conductance potassium channel (BK) α subunit contains a transmembrane (TM) helix S0 preceding the canonical TM helices S1 through S6. S0 lies between S4 and the TM2 helix of the regulatory β1 subunit. Pairs of Cys were substituted in the first helical turns in the membrane of BK α S0 and S4 and in β1 TM2. One such pair, W22C in S0 and W203C in S4, was 95% crosslinked endogenously. Under voltage-clamp conditions in outside-out patches, this crosslink was reduced by DTT and reoxidized by a membrane-impermeant bis-quaternary ammonium derivative of diamide. The rate constants for this reoxidation were not significantly different in the open and closed states of the channel. Thus, these two residues are approximately equally close in the two states. In addition, 90% crosslinking of a second pair, R20C in S0 and W203C in S4, had no effect on the V50 for opening. Taken together, these findings indicate that separation between residues at the extracellular ends of S0 and S4 is not required for voltage-sensor activation. On the contrary, even though W22C and W203C were equally likely to form a disulfide in the activated and deactivated states, relative immobilization by crosslinking of these two residues favored the activated state. Furthermore, the efficiency of recrosslinking of W22C and W203C on the cell surface was greater in the presence of the β1 subunit than in its absence, consistent with β1 acting through S0 to stabilize its immobilization relative to α S4. PMID:23472181

Redescription of two species of Thaparocleidus (Monogenea: Dactylogyridae), with the description of T. armillatus sp. n. from Wallago attu and a phylogenetic analysis based on 18S rDNA sequences.

PubMed

Verma, Chandni; Chaudhary, Anshu; Shanker Singh, Hridaya

2017-09-26

The phylogenetic studies on monogeneans of the genus Thaparocleidus parasitizing W. attu in India was inferred from 18S rDNA gene data. Out of species of Thaparocleidus, one new, T. armillatus sp. n., is described herein which distinguished from its congener species in the shapes and sizes of sclerotized structures and rest of the two species, T. indicus and T. wallagonius are redescribed morphologically as well as validated and confirmed by molecular means also. Besides the above, T. gangus was also included in the molecular analysis as it is recently described on the basis of morphology only. The phylogenetic tree was also reconstructed in order to elucidate the taxonomic status of Thaparocleidus armillatus sp. n., T. indicus, T. wallagonius and T. gangus. This research reports for the first time, the molecular phylogenetic analysis of 18S rDNA gene for four species belonging to the genus Thaparocleidus from W. attu collected off the River Ganga in India. In phylogram, all four species of Thapaocleidus come in a single clade that confirmed their monophyletic status. A very low interspecific variability was observed in T. armillatus sp. n. and T. wallagonius suggesting that these species are highly similar in morphology. Correspondingly, T. indicus and T. gangus also showed low interspecific variability which too signifies their morphological similarities in their sclerotized structures. Our result suggested that all four species taken in the present investigation from India are monophyletic and it is also observed that morphological similarities in the sclerotized structures are well correlated with phylogeny.

Tungsten phosphanylarylthiolato complexes [W{PhP(2-SC6H4)2-kappa3S,S',P} 2] and [W{P(2-SC6H4)3-kappa4S,S',S",P}2]: synthesis, structures and redox chemistry.

PubMed

Hildebrand, Alexandra; Lönnecke, Peter; Silaghi-Dumitrescu, Luminita; Hey-Hawkins, Evamarie

2008-09-14

PhP(2-SHC6H4)2 (PS2H2) reacts with WCl6 with reduction of tungsten to give the air-sensitive tungsten(IV) complex [W{PhP(2-SC6H4)2-kappa(3)S,S',P}2] (1). 1 is oxidised in air to [WO{PhPO(2-SC6H4)2-kappa(3)S,S',O}{PhP(2-SC6H4)2-kappa(3)S,S',P}] (2). The attempted synthesis of 2 by reaction of 1 with iodosobenzene as oxidising agent was unsuccessful. [W{P(2-SC6H4)3-kappa(4)S,S',S",P}2] (3) was formed in the reaction of P(2-SHC6H4)3 (PS3H3) with WCl6. The W(VI) complex 3 contains two PS3(3-) ligands, each coordinated in a tetradentate fashion resulting in a tungsten coordination number of eight. The reaction of 3 with AgBF4 yields the dinuclear tungsten complex [W2{P(2-SC6H4)3-kappa(4)S,S',S",P}3]BF4 (4). Complexes 1-4 were characterised by spectral methods and X-ray structure determination.

A Domain Independent Framework for Extracting Linked Semantic Data from Tables

DTIC Science & Technology

2012-01-01

Evidence - based medicine , the essential role of systematic reviews, and the need for automated text mining tools. In: Proc. 1st ACM Int. Health... based medicine : what it is and what it isn’t. Bmj 312(7023), 71 (1996) 23. Sahoo, S.S., Halb, W., Hellmann, S., Idehen, K., Thibodeau Jr, T., Auer, S., Se...Journal of Artificial Intelligence Research 11(1), 95–130 (1999) 22. Sackett, D., Rosenberg, W., Gray, J., Haynes, R., Richardson, W.: Evidence

Antitumoral Activity of (20R)- and (20S)-Ginsenoside Rh2 on Transplanted Hepatocellular Carcinoma in Mice.

PubMed

Lv, Qun; Rong, Na; Liu, Li-Jia; Xu, Xiao-Lin; Liu, Jian-Ting; Jin, Feng-Xie; Wang, Chun-Mei

2016-05-01

Hepatocellular carcinoma is one of the leading causes of malignancy-related death in China. Its therapy in clinics is a big challenge. Ginsenoside Rh2 is one of the most notable cancer-preventing components from red ginseng and it has been reported that ginsenoside Rh2 exhibited potent cytotoxicity against human hepatoma cells. Rh2 exists as two different stereoisomeric forms, (20S)-ginsenoside Rh2 and (20R)-ginsenoside Rh2. Previous reports showed that the Rh2 epimers demonstrated different pharmacological activities and only (20S)-ginsenoside Rh2 showed potent proliferation inhibition on cancer cells in vitro. However, the in vivo anti-hepatoma activity of (20R)-ginsenoside Rh2 and (20S)-ginsenoside Rh2 has not been reported yet. This work assessed and compared the anti-hepatoma activities of (20S)-ginsenoside Rh2 and (20R)-ginsenoside Rh2 using H22 a hepatoma-bearing mouse model in vivo. In addition, hematoxylin and eosin staining, the deoxynucleotidyl transferase dUTP nick-end labeling assay, and the semiquantitative reverse transcriptase polymerase chain reaction method were used to further study the apoptosis of the tumors. The results showed that both (20S)-ginsenoside Rh2 and (20R)-ginsenoside Rh2 suppressed the growth of H22 transplanted tumors in vivo, and the highest inhibition rate could be up to 42.2 and 46.8 %, respectively (p < 0.05). Further, hematoxylin/eosin staining and the deoxynucleotidyl transferase dUTP nick-end labeling assay indicated that both (20R)-ginsenoside Rh2 and (20S)-ginsenoside Rh2 could induce H22 hepatoma tumor cell apoptosis, with apoptosis indexes of 3.87 %, and 3.80 %, respectively (p < 0.05). Moreover, this effect was accompanied by downregulating the level of Bcl-2 mRNA. In conclusion, both (20S)-ginsenoside Rh2 and (20R)-ginsenoside Rh2 can suppress the growth of H22 hepatomas without causing severe side effects, and this effect is associated with the induction of apoptosis. Georg Thieme Verlag KG Stuttgart �

Measurement of the polarisation of W bosons produced with large transverse momentum in pp collisions at $$\\sqrt{s} = 7\\ \\mbox{TeV}$$ with the ATLAS experiment

DOE PAGES

Aad, G.; Abbott, B.; Abdallah, J.; ...

2012-05-08

This paper describes an analysis of the angular distribution of W→eν and W→μν decays, using data from pp collisions at √s =7 TeV recorded with the ATLAS detector at the LHC in 2010, corresponding to an integrated luminosity of about 35 pb -1. Using the decay lepton transverse momentum and the missing transverse momentum, the W decay angular distribution projected onto the transverse plane is obtained and analysed in terms of helicity fractions f 0,f L and f R over two ranges of W transverse momentum (pmore » $$W\\atop{T}$$): 35 < p$$W\\atop{T}$$ < 50 GeV and p$$W\\atop{T}$$ > 50 GeV. Good agreement is found with theoretical predictions. For p W T > 50 GeV, the values of f 0 and f L-f R, averaged over charge and lepton flavour, are measured to be: f 0 =0.127±0.030±0.108 and f L-f R =0.252±0.017±0.030, where the first uncertainties are statistical, and the second include all systematic effects.« less

802.11s Wireless Mesh Network Visualization Application

NASA Technical Reports Server (NTRS)

Mauldin, James Alexander

2014-01-01

Results of past experimentation at NASA Johnson Space Center showed that the IEEE 802.11s standard has better performance than the widely implemented alternative protocol B.A.T.M.A.N (Better Approach to Mobile Ad hoc Networking). 802.11s is now formally incorporated into the Wi- Fi 802.11-2012 standard, which specifies a hybrid wireless mesh networking protocol (HWMP). In order to quickly analyze changes to the routing algorithm and to support optimizing the mesh network behavior for our intended application a visualization tool was developed by modifying and integrating open source tools.

CRISPR-Cas-Mediated Gene Silencing Reveals RacR To Be a Negative Regulator of YdaS and YdaT Toxins in Escherichia coli K-12.

PubMed

Bindal, Gargi; Krishnamurthi, Revathy; Seshasayee, Aswin Sai Narain; Rath, Devashish

2017-01-01

Bacterial genomes are rich in horizontally acquired prophages. racR is an essential gene located in the rac prophage that is resident in many Escherichia coli genomes. Employing a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas-based gene silencing approach, we show that RacR is a negative regulator of the divergently transcribed and adjacent ydaS-ydaT operon in Escherichia coli K-12. Overexpression of YdaS and YdaT due to RacR depletion leads to cell division defects and decrease in survival. We further show that both YdaS and YdaT can act independently as toxins and that RacR serves to counteract the toxicity by tightly downregulating the expression of these toxins. IMPORTANCE racR is an essential gene and one of the many poorly studied genes found on the rac prophage element that is present in many Escherichia coli genomes. Employing a CRISPR-based approach, we have silenced racR expression to various levels and elucidated its physiological consequences. We show that the downregulation of racR leads to upregulation of the adjacent ydaS-ydaT operon. Both YdaS and YdaT act as toxins by perturbing the cell division resulting in enhanced cell killing. This work establishes a physiological role for RacR, which is to keep the toxic effects of YdaS and YdaT in check and promote cell survival. We, thus, provide a rationale for the essentiality of racR in Escherichia coli K-12 strains.

CRISPR-Cas-Mediated Gene Silencing Reveals RacR To Be a Negative Regulator of YdaS and YdaT Toxins in Escherichia coli K-12

PubMed Central

Bindal, Gargi; Krishnamurthi, Revathy; Seshasayee, Aswin Sai Narain

2017-01-01

ABSTRACT Bacterial genomes are rich in horizontally acquired prophages. racR is an essential gene located in the rac prophage that is resident in many Escherichia coli genomes. Employing a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas-based gene silencing approach, we show that RacR is a negative regulator of the divergently transcribed and adjacent ydaS-ydaT operon in Escherichia coli K-12. Overexpression of YdaS and YdaT due to RacR depletion leads to cell division defects and decrease in survival. We further show that both YdaS and YdaT can act independently as toxins and that RacR serves to counteract the toxicity by tightly downregulating the expression of these toxins. IMPORTANCE racR is an essential gene and one of the many poorly studied genes found on the rac prophage element that is present in many Escherichia coli genomes. Employing a CRISPR-based approach, we have silenced racR expression to various levels and elucidated its physiological consequences. We show that the downregulation of racR leads to upregulation of the adjacent ydaS-ydaT operon. Both YdaS and YdaT act as toxins by perturbing the cell division resulting in enhanced cell killing. This work establishes a physiological role for RacR, which is to keep the toxic effects of YdaS and YdaT in check and promote cell survival. We, thus, provide a rationale for the essentiality of racR in Escherichia coli K-12 strains. PMID:29205229

Andrew W. S. In

ERIC Educational Resources Information Center

Nishimoto, Warren

2007-01-01

This article presents an interview with Andrew W. S. In, professor and dean in the University of Hawai'i's College of Education from 1951 to 1984. Born and raised in Honolulu, In attended Royal Elementary, Central Junior High, and McKinley High schools, graduating from McKinley in 1938. He then attended the University of Hawai'i Teachers College…

U.S.-U.S.S.R. Rail Inspection Information Exchange

DOT National Transportation Integrated Search

1977-06-01

This trip report describes the results and conclusions of the U.S. delegation resulting from the U.S.-U.S.S.R. Rail Inspection Information exchange tour of the Soviet Union, August 24 through September 1, 1975. This information exchange was conducted...

Scrutiny of the Core of the Galactic Center by H_3^+ and Co: Gcirs 3 and Gcirs 1W

NASA Astrophysics Data System (ADS)

Goto, M.; Usuda, T.; Geballe, T. R.; Indriolo, N.; McCall, B. J.; Oka, T.

2011-06-01

Out of the over two dozen sightlines toward the Central Molecular Zone of the Galactic center so far observed by infrared spectra of H_3^+ and CO, sightlines toward GCIRS 3 and Iota stand out as exceptional since they show cloud components with clear R(2,2)^l absorption indicating that their unstable (J,K) = (2,2) levels are well populated. Those two sightlines toward the Galactic core and Sgr B, respectively, must pass through hot and dense gas. The cloud component at ˜ 60 km S-1 toward GCIRS 3 is particularly intriguing since GCIRS 1W, which is separated from it only by 5".8 (0.23 pc if the same distance to the Galactic center of 8 k pc is assumed), barely shows the R(2,2)^l absorption. The cloud must be compact and this calls for a high ionization rate. To further study this problem the sightlines toward GCIRS 3 and GCIRS 1W have been observed by VLT under high spectral resolution. The observed R(3,3)^l absorption is extraordinarily deep and the R(2,2)^l absorption is clearly observable at ˜ 60 km S-1 for GCIRS 3 indicating unusually high temperature and high density of the cloud. In contrast, toward GCIRS 1W, the R(3,3)^l absorption is of ordinary depth and the R(2,2)^l absorptions is marginal if any indicating the well known warm and diffuse gas observed toward other regions of the Central Molecular Zone. Their analysis and comparison with radio HCN emission observed in the area will be discussed. M. Goto, T. Usuda, T. Nagata, T. R. Geballe, B. J. McCall, N. Indriolo, H. Suto, Th. Henning, C. P. Morong, and T. Oka, ApJ, 688, 306 (2008). Goto, Usuda, Geballe, Indriolo, McCall, Henning, Oka, PASJ (2011) in press.

Pakistan’s Nuclear Future: Worries Beyond War

DTIC Science & Technology

2008-01-01

sources such as cobalt irradiation sources , neutron sources , etc. that could be utilized by experienced...Kh an AQ K ha n o ffe r t o I ra q Pr es sle r s an cti on s ( Oc t.) 19 91 Gh ula m Ish aq K ha n Na wa z S ha rif Mi rza A sla m Be g ( Ja nu...or th Ko re a ( De c.) 19 94 Fa ro oq Le gh ar i Be na zir B hu tto Ab du l W ah id Ka ka r Se

Identification of the 1s2s2p 4P5/2-->1s22s 2S1/2 magnetic quadrupole inner-shell satellite line in the Ar16+ K-shell x-ray spectrum

NASA Astrophysics Data System (ADS)

Beiersdorfer, P.; Bitter, M.; Hey, D.; Reed, K. J.

2002-09-01

We have identified the dipole-forbidden 1s2s2p 4P5/2-->1s22s 2S1/2 transition in lithiumlike Ar15+ in high-resolution K-shell x-ray emission spectra recorded at the Livermore EBIT-II electron-beam ion trap and the Princeton National Spherical Tokamak Experiment. Unlike other Ar15+ satellite lines, which can be excited by dielectronic recombination, the line is exclusively excited by electron-impact excitation. Its predicted radiative rate is comparable to that of the well-known 1s2p 3P1-->1s2 1S0 magnetic quadrupole transition in heliumlike Ar16+. As a result, it can also only be observed in low-density plasma. We present calculations of the electron-impact excitation cross sections of the innershell excited Ar15+ satellite lines, including the magnetic sublevels needed for calculating the linear line polarization. We compare these calculations to the relative magnitudes of the observed 1s2s2p-->1s22s transitions and find good agreement, confirming the identification of the lithiumlike 1s2s2p 4P5/2-->1s22s 2S1/2 magnetic quadrupole line.

27 CFR 9.179 - Southern Oregon.

Code of Federal Regulations, 2011 CFR

2011-04-01

... township line T22S-T23S; then (4) Proceed southeast approximately 8.5 miles along a straight line to the intersection of township line T23S-T24S with range line R7W-R8W; then south along the R7W-R8W range line... a straight line approximately 3.5 miles toward the intersection of township line T25S-T26S with...

27 CFR 9.179 - Southern Oregon.

Code of Federal Regulations, 2010 CFR

2010-04-01

... township line T22S-T23S; then (4) Proceed southeast approximately 8.5 miles along a straight line to the intersection of township line T23S-T24S with range line R7W-R8W; then south along the R7W-R8W range line... a straight line approximately 3.5 miles toward the intersection of township line T25S-T26S with...

Investigation on Mo1‑ x W x S2 fabricated by co-sputtering and post-deposition sulfurization with (t-C4H9)2S2

NASA Astrophysics Data System (ADS)

Hibino, Yusuke; Ishihara, Seiya; Sawamoto, Naomi; Ohashi, Takumi; Matsuura, Kentarou; Machida, Hideaki; Ishikawa, Masato; Sudoh, Hiroshi; Wakabayashi, Hitoshi; Ogura, Atsushi

2018-06-01

Transition metal dichalcogenides are gathering increasing attention owing to their unique physical properties and wide variety of application possibilities. In our study, Mo1‑ x W x S2, an alloy of MoS2 and WS2, was fabricated by the co-sputtering deposition of MoS2 and W, followed by post-deposition sulfurization. The resulting film exhibited a W concentration of up to 23%, relative to the Mo and W added. The alloy exhibited the characteristic behaviors, when subjected to Raman spectroscopy and X-ray photoelectron spectroscopy. It was confirmed that the bandgap shifted as the W concentration increased. By evaluating the bandgap and valence band edge energy, it was confirmed that W incorporation tuned the band structure.

Five seconds of 50-60 W radio frequency atrial ablations were transmural and safe: an in vitro mechanistic assessment and force-controlled in vivo validation.

PubMed

Bhaskaran, Abhishek; Chik, William; Pouliopoulos, Jim; Nalliah, Chrishan; Qian, Pierre; Barry, Tony; Nadri, Fazlur; Samanta, Rahul; Tran, Ying; Thomas, Stuart; Kovoor, Pramesh; Thiagalingam, Aravinda

2017-05-01

Longer procedural time is associated with complications in radiofrequency atrial fibrillation ablation. We sought to reduce ablation time and thereby potentially reduce complications. The aim was to compare the dimensions and complications of 40 W/30 s setting to that of high-power ablations (50-80 W) for 5 s in the in vitro and in vivo models. In vitro ablations-40 W/30 s were compared with 40-80 W powers for 5 s. In vivo ablations-40 W/30 s were compared with 50-80 W powers for 5 s. All in vivo ablations were performed with 10 g contact force and 30 mL/min irrigation rate. Steam pops and depth of lung lesions identified post-mortem were noted as complications. A total of 72 lesions on the non-trabeculated part of right atrium were performed in 10 Ovine. All in vitro ablations except for the 40 W/5 s setting achieved the critical lesion depth of 2 mm. For in vivo ablations, all lesions were transmural, and the lesion depths for the settings of 40 W/30 s, 50 W/5 s, 60 W/5 s, 70 W/5 s, and 80 W/5 s were 2.2 ± 0.5, 2.3 ± 0.5, 2.1 ± 0.4, 2.0 ± 0.3, and 2.3 ± 0.7 mm, respectively. The lesion depths of short-duration ablations were similar to that of the conventional ablation. Steam pops occurred in the ablation settings of 40 W/30 s and 80 W/5 s in 8 and 11% of ablations, respectively. Complications were absent in short-duration ablations of 50 and 60 W. High-power, short-duration atrial ablation was as safe and effective as the conventional ablation. Compared with the conventional 40 W/30 s setting, 50 and 60 W ablation for 5 s achieved transmurality and had fewer complications. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2016. For permissions please email: journals.permissions@oup.com.

U.S. EPA, Pesticide Product Label, , 12/11/1986

EPA Pesticide Factsheets

2011-04-21

... (lI",/ .. r 1110' F, ,f,-r." In'(-. ,I,,, F""(;I( ufo'. ,,/1./ f.:,,, 11/" ,d. ,\\, I ..... lfl.' IId"d) /. ', 1'. r .:! t":'- 01 -,' ",j~.'" ' l)i"l ~\\ll'l ,"~ ~I'·';' If:. "Ii Yilli '1,11' ~ ...

The immunometabolite S-2-hydroxyglutarate regulates CD8+ T-lymphocyte fate

PubMed Central

Tyrakis, Petros A.; Palazon, Asis; Macias, David; Lee, Kian. L.; Phan, Anthony. T.; Veliça, Pedro; You, Jia; Chia, Grace S.; Sim, Jingwei; Doedens, Andrew; Abelanet, Alice; Evans, Colin E.; Griffiths, John R.; Poellinger, Lorenz; Goldrath, Ananda. W.; Johnson, Randall S.

2016-01-01

R-2-hydroxyglutarate accumulates to millimolar levels in cancers with gain-of-function isocitrate dehydrogenase 1/2 mutations. These levels of R-2-hydroxyglutarate affect 2-oxoglutarate-dependent dioxygenases. Both R- and S-2-hydroxyglutarate, the other enantiomer of this metabolite, are detectible in healthy individuals, yet their physiological function remains elusive. Here we show that CD8+ T-lymphocytes accumulate 2-hydroxyglutarate in response to T-cell receptor triggering. This increases to millimolar levels in physiological oxygen conditions, via a hypoxia inducible factor 1 alpha-dependent mechanism. S-2-hydroxyglutarate predominates over R-2-hydroxyglutarate in activated T cells, and we demonstrate alterations in markers of CD8+ T-lymphocyte differentiation in response to this metabolite. Modulation of histone and DNA demethylation as well as hypoxia inducible factor 1 alpha stability mediate these effects. S-2-hydroxyglutarate treatment greatly enhances the in vivo proliferation, persistence and anti-tumour capacity of adoptively transferred CD8+ T-lymphocytes. Thus S-2-hydroxyglutarate acts as an immunometabolite that links environmental context, via a metabolic-epigenetic axis, to immune fate and function. PMID:27798602

U.S. EPA, Pesticide Product Label, , 11/13/1987

EPA Pesticide Factsheets

2011-04-14

... r'r~-::)pir'ati()ll by !J'o(.rll.th-·-I:o···mrouth (H" othl~r mC'·)frS:· \\1t \\·r ... 'f·qhqI.3ti~ nr::~1n r::au~ji:.~ tl.l.ng et:ir:.'rna

Crystal structure and absolute configuration of (3aS,4S,5R,7aR)-2,2,7-trimethyl-3a,4,5,7a-tetra-hydro-1,3-benzodioxole-4,5-diol.

PubMed

Macías, Mario A; Suescun, Leopoldo; Pandolfi, Enrique; Schapiro, Valeria; Tibhe, Gaurao D; Mombrú, Álvaro W

2015-09-01

The absolute configuration of the title compound, C10H16O4, determined as 3aS,4S,5R,7aR on the basis of the synthetic pathway, was confirmed by X-ray diffraction. The mol-ecule contains a five- and a six-membered ring that adopt twisted and envelope conformations, respectively. The dihedral angle between the mean planes of the rings is 76.80 (11)° as a result of their cis-fusion. In the crystal, mol-ecules are linked by two pairs of O-H⋯O hydrogen bonds, forming chains along [010]. These chains are further connected by weaker C-H⋯O inter-actions along [100], creating (001) sheets that inter-act only by weak van der Waals forces.

Remedial Investigations Report, Phase 2. Volume 4. Appendices Sites P11/P13 and A12/P36/P37, Fort Devens Sudbury Training Annex, Maynard, Massachusetts

DTIC Science & Technology

1995-12-01

Geotechnical Data D Geophysical Surveys E Analysis of QA/QC Program F Aquifer Hydraulic Characterization (Slug Testing) G Groundwater Model Report H...M " f ; Soil/Rock ~ Dataii~ 2!Desc~lpliOn ccl - -GR OUND SURFACE- -~~ MMJrb OMOE U)IF ’G gm~ * t -iG O p& 11 i 1 ’ w //* I M E - F .51"’/j H5As o4 2-e...o fS A D 11tL IN SNE,7f ’(;v ,* , F * It~ .-. 4 1I4O WLD ~*’h4,Ft , T6.r,17,L ’DIULLe8ING NOTa 4 14.6@AO 0w- IUL W 33s - reyce pae A-, 7 1= amd n 01r0r

Emergence of novel and dominant acquired EGFR solvent-front mutations at Gly796 (G796S/R) together with C797S/R and L792F/H mutations in one EGFR (L858R/T790M) NSCLC patient who progressed on osimertinib.

PubMed

Ou, Sai-Hong Ignatius; Cui, Jean; Schrock, Alexa B; Goldberg, Michael E; Zhu, Viola W; Albacker, Lee; Stephens, Philip J; Miller, Vincent A; Ali, Siraj M

2017-06-01

Acquired epidermal growth factor receptor (EGFR) resistance mutations to osimertinib are common, including the EGFR C797S that abolishes the covalent binding of osimertinib to EGFR. Here we report the emergence of novel EGFR solvent front mutations at Gly796 (G796S/R) in addition to a hinge pocket L792F/H mutations, and C797S/G all in cis with T790M in a single patient on progression on osimertinib as detected by plasma circulating tumor DNA (ctDNA) assay in the course of clinical care. A 69-year-old Caucasian female former light-smoker presented with stage IV EGFR L858R positive adenocarcinoma who developed EGFR T790M mutation after 8 month treatment of erlotinib. The patient was initiated on osimertinib with disease shrinkage after 2 months, but tumor regrowth was observed after 5 months of osimertinib treatment. Assay of plasma ctDNA at this time revealed these different secondary resistance mutations all in trans with each other including distinct mutations at the same codon producing different amino acid changes: G796S/R (mutant allele frequency [MAF]; 14.4%), C797S/G (MAF: 2.26%), L792F/H (MAF: 0.36%), and V802F (MAF: 0.40%), in addition to the pre-existing L858R (MAF:17.9%) and T790M (MAF:18.2%) but all in cis with T790M. The G796S/R mutations are homologous with known reported solvent front mutations in ALK G1202R, ROS1 G2032R, TrkA G595R and TrkC G623R, all of which are associated with acquired resistance to type I TKIs. In silico modeling revealed mutation at G796 interferes with osimertinib binding to the EGFR kinase domain at the phenyl aromatic ring position as this residue forms a narrow "hydrophobic sandwich" with L718, while L792F/H mutation interferes with osimertinib binding at the methoxyl group on the phenyl ring. Multiple resistance mutations at differing allele frequencies including novel EGFR solvent front mutations can emerge in a single patient with progression on osimertinib potentially due to tumor hetereogeneity and definitely present a

RpoS induces expression of the Vibrio anguillarum quorum-sensing regulator VanT.

PubMed

Weber, Barbara; Croxatto, Antony; Chen, Chang; Milton, Debra L

2008-03-01

In vibrios, regulation of the Vibrio harveyi-like LuxR transcriptional activators occurs post-transcriptionally via small regulatory RNAs (sRNAs) that destabilize the luxR mRNA at a low cell population, eliminating expression of LuxR. Expression of the sRNAs is modulated by the vibrio quorum-sensing phosphorelay systems. However, vanT mRNA, which encodes a LuxR homologue in Vibrio anguillarum, is abundant at low and high cell density, indicating that VanT expression may be regulated via additional mechanisms. In this study, Western analyses showed that VanT was expressed throughout growth with a peak of expression during late exponential growth. VanO induced partial destabilization of vanT mRNA via activation of at least one Qrr sRNA. Interestingly, the sigma factor RpoS significantly stabilized vanT mRNA and induced VanT expression during late exponential growth. This induction was in part due to RpoS repressing expression of Hfq, an RNA chaperone. RpoS is not part of the quorum-sensing regulatory cascade since RpoS did not regulate expression or activity of VanO, and RpoS was not regulated by VanO or VanT. VanT and RpoS were needed for survival following UV irradiation and for pigment and metalloprotease production, suggesting that RpoS works with the quorum-sensing systems to modulate expression of VanT, which regulates survival and stress responses.

Technology Insertion-Engineering Services Process Characterization Task Order No. 1. Book 2 of 3. Database Documentation Book. OO-ALC MANPGP (Wheels - WCD’S)

DTIC Science & Technology

1989-12-15

RElOVE MASKINE TAPE .00!91 .002 000 Al RCB-OH-W2 1.00 REMY WHL HLF F/PAINT CONVYOR .00833 .010 0040 E RWr- BBP -0 1.00 BALPOCE WEEL HALF .0773 .093 0050 5...16S601-819 16W6-35-3-2 15 ART SHE 160 PULTIPLE LA-10 L"L R/H AIM 9 1441--1-M -36A 7 472-M 1L--11. z.I-- PARK AN)E 161814, LEf-N sE. r& ffA t- 1450-00-. b

Operations and Maintenance Costs for New Major U.S. Coast Guard Platforms: Projected Versus Actual Costs

DTIC Science & Technology

1989-06-01

It-r S 55 t--- -~( i i t- VDO mooC 0 r . SUSD C)o"~ S0 0 81Cs!,t 0 0 0( hi V .( . ( . ,C ) . ( C) 4WN 07 4 (UC -0) mm ) ODC4U W I- m 0 0NO8:8 W0T...Publishing Co., 1987. 174 INITIAL DISTRIBUTION LIST 1. Defense Technical Information Center 2 Cameron Station Alexandria, Virginia 22304-6145 2. Library , Code

Pretest analysis document for Test S-FS-11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hall, D.G.; Shaw, R.A.

This report documents the pretest calculations completed for Semiscale Test S-FS-11. This test will simulate a transient initiated by a 50% break in a steam generator bottom feedwater line downstream of the check valve. The initial conditions represents normal operating conditions for a C-E System 80 nuclear plant. Prediction of transients resulting from feedwater line breaks in these plants have indicated that significant primary system overpressurization may occur. The results of a RELAP5/MOD2/CY21 code calculation indicate that the test objectives for Test S-FS-11 can be achieved. The primary system overpressurization will occur but pose no threat to personnel or plantmore » integrity. 3 refs., 15 figs., 5 tabs.« less

A de novo atypical ring sSMC(22) characterized by array CGH in a boy with cat-eye syndrome.

PubMed

Haltrich, Irén; Pikó, Henriett; Kiss, Eszter; Tóth, Zsuzsa; Karcagi, Veronika; Fekete, György

2014-01-01

Microduplications 22q11 have been characterized as a genomic duplication syndrome mediated by nonallelic homologous recombination between region-specific low-copy repeats. Here we report on a 19 years old boy with intellectual disability having an unexpected structurally complex ring small supernumerary marker chromosome (sSMC) originated from a larger trisomy and a smaller tetrasomy of proximal 22q11 harboring additional copies of cat eye syndrome critical regions genes. PRINCIPAL CLINICAL FEATURES WERE: anorectal and urogenital malformations, total anomalous pulmonary venous return with secundum ASD, hearing defect, preauricular pits, seizure and eczema. The proband also presented some rare or so far not reported clinical findings such as hyperinsulinaemia, severe immunodeficiency and grave cognitive deficits. Chromosome analysis revealed a mosaic karyotype with the presence of a small ring-like marker in 60% of cells. Array CGH detected approximately an 1,2 Mb single and a 0,2 Mb double copy gain of the proximal long arm of chromosome 22. The 1,3 Mb intervening region of chromosome 22 from centromere to the breakpoints showed no copy alteration. The karyotype of the patient was defined as 47,XY,+mar[60]/46,XY[40].ish idic r(22)(q11.1.q11.21) × 4.arr 22q11(17,435, 645-18,656,678) × 3,(17,598,642-17,799,783) × 4 dn. The present report is the first one with a detailed description of clinical presentation in a patient carrying an atypical size ring sSMC (22) analyzed by array CGH. The specialty of the finding is emphasized by the fact that although the patient had a mosaic sSMC and the amplified region was smaller than in typical cat eye syndrome cases, the clinical presentation was severe.

Clash of the Titans: Booker T. Washington and W. E. B. Du Bois. Curriculum Based Education Program, Grade 11.

ERIC Educational Resources Information Center

National Park Service (Dept. of Interior), Washington, DC.

The Booker T. Washington National Monument preserves and protects the birth site and childhood home of Booker T. Washington while interpreting his life experiences and significance in U.S. history as the most powerful African American between 1895 and 1915. The programs and activities included in this guide about the Booker T. Washington and W. E.…

(2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-Mono(di,tri)fluoromethylcyclopropyl]alanines and their incorporation into hormaomycin analogues

PubMed Central

Kozhushkov, Sergei I; Yufit, Dmitrii S; Grosse, Christian; Kaiser, Marcel

2014-01-01

Summary Efficient and scalable syntheses of enantiomerically pure (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-mono(di,tri)fluoromethylcyclopropyl]alanines 9a–c, as well as allo-D-threonine (4) and (2S,3R)-β-methylphenylalanine (3), using the Belokon' approach with (S)- and (R)-2-[(N-benzylprolyl)amino]benzophenone [(S)- and (R)-10] as reusable chiral auxiliaries have been developed. Three new fluoromethyl analogues of the naturally occurring octadepsipeptide hormaomycin (1) with (fluoromethylcyclopropyl)alanine moieties have been synthesized and subjected to preliminary tests of their antibiotic activity. PMID:25550751

11. Historic American Buildings Survey W. N. Manning, Photographer, July ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Historic American Buildings Survey W. N. Manning, Photographer, July 18, 1935 DOOR TREATMENT IN PARLOR, S. W. ROOM - Crowell-Cantey-Alexander House, State Road 165, Fort Mitchell, Russell County, AL

Logical recoding of S-R rules can reverse the effects of spatial S-R correspondence.

PubMed

Wühr, Peter; Biebl, Rupert

2009-02-01

Two experiments investigated competing explanations for the reversal of spatial stimulus-response (S-R) correspondence effects (i.e., Simon effects) with an incompatible S-R mapping on the relevant, nonspatial dimension. Competing explanations were based on generalized S-R rules (logical-recoding account) or referred to display-control arrangement correspondence or to S-S congruity. In Experiment 1, compatible responses to finger-name stimuli presented at left/right locations produced normal Simon effects, whereas incompatible responses to finger-name stimuli produced an inverted Simon effect. This finding supports the logical-recoding account. In Experiment 2, spatial S-R correspondence and color S-R correspondence were varied independently, and main effects of these variables were observed. The lack of an interaction between these variables, however, disconfirms a prediction of the display-control arrangement correspondence account. Together, the results provide converging evidence for the logical-recoding account. This account claims that participants derive generalized response selection rules (e.g., the identity or reversal rule) from specific S-R rules and inadvertently apply the generalized rules to the irrelevant (spatial) S-R dimension when selecting their response.

Seasonal variation of wave activities near the mesopause region observed at King Sejong Station (62.22°S, 58.78°W), Antarctica

NASA Astrophysics Data System (ADS)

Lee, Changsup; Kim, Yong Ha; Kim, Jeong-Han; Jee, Geonhwa; Won, Young-In; Wu, Dong L.

2013-12-01

We analyzed the neutral wind data at altitudes of 80-100 km obtained from a VHF meteor radar at King Sejong Station (KSS, 62.22°S, 58.78°W), a key location to study wave activities above the stratospheric vortex near the Antarctic Peninsula. The seasonal behavior of the semidiurnal tides is generally consistent with the prediction of Global Scale Wave Model (GSWM02) except in the altitude region above ~96 km. Gravity wave (GW) activities inferred from the neutral wind variances show a seasonal variation very similar to the semidiurnal tide amplitudes, suggesting a strong interaction between gravity waves and the tide. Despite the consistent seasonal variations of the GW wind variances observed at the adjacent Rothera station, the magnitudes of the wind variance obtained at KSS are much larger than those at Rothera, especially during May-September. The enhanced GW activity at KSS is also observed by Aura Microwave Limb Sounder (MLS) from space in its temperature variance. The observed large wind variances at KSS imply that the Antarctic vortex in the stratosphere may act as an effective filter and source for the GWs in the upper atmosphere.

Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

PubMed

Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

2016-12-01

Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

Photo - Apollo/Saturn (A/S)-11 - Water w/Helo Hovering Overhead

NASA Image and Video Library

1969-01-01

S69-27919 (13 March 1969) --- Immediately after splashdown a recovery helicopter from the USS Guadalcanal hovers over the Apollo 9 spacecraft. Still inside the Command Module (CM) are astronauts James A. McDivitt, David R. Scott, and Russell L. Schweickart. Splashdown occurred at 12:00:53 p.m. (EST), March 13, 1969, only 4.5 nautical miles from the USS Guadalcanal, the prime recovery ship, to conclude a successful 10-day Earth-orbital mission in space.

U.S. EPA, Pesticide Product Label, MONTEDISON ZIRAM TECHNICAL, 10/04/1979

EPA Pesticide Factsheets

2011-04-21

... I I -~ I ~~.' c -"c= > ~ • t: g .o,&A. !III~Sr! () W·~O:!T ~ . n n. _. ( () 2S$.~"I .. Po.-8.~ I:'Ij ~ ~ • w ~ ffa. v-, "O~r ~ "tI ~ ~H ~ ~ \\ n:-e; t1j ..... t " fI ~ • -. . r --- - ...

Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

U.S. EPA, Pesticide Product Label, KELTHANE 4F, 09/22/1981

EPA Pesticide Factsheets

2011-04-14

... i)t'~" :t' "t 'r,Hlt" "t·, .. , f', ." I', .j" rI~ 11<;,',1 I", ~':J~ In <. d·,r,n"" ... t' ·RITO(>..~ B ll.j:,h .<, f,>(, " r·· •• "j<.. t~·f', '1'• d<." "~dr 't' ,:>t" l'1t f <':"_10(" ...

Physical mapping of 18S-25S rDNA and 5S rDNA in Lupinus via fluorescent in situ hybridization.

PubMed

Naganowska, Barbara; Zielińska, Anna

2002-01-01

Double-target fluorescent in situ hybridization (FISH) was used to determine the genomic distribution of ribosomal RNA genes in five Lupinus species: L. cosentinii (2n=32), L. pilosus (2n=42), L. angustifolius (2n=40), L. luteus (2n=52) and L. mutabilis (2n=48). 18S-25S rDNA and 5S rDNA were used as probes. Some interspecific variation was observed in the number and size of the 18S-25S rDNA loci. All the studied species had one chromosome pair carrying 5S rDNA.

Local S100A8 Levels Correlate With Recurrence of Experimental Autoimmune Uveitis and Promote Pathogenic T Cell Activity

PubMed Central

Yun, Juan; Xiao, Tong; Zhou, Lei; Beuerman, Roger W.; Li, Juanjuan; Zhao, Yuan; Hadayer, Amir; Zhang, Xiaomin; Sun, Deming; Kaplan, Henry J.

2018-01-01

Purpose To investigate the role of damage-associated molecular patterns (DAMPs) in recurrent experimental autoimmune uveitis (EAU). Methods Recurrent EAU was induced in Lewis rats by interphotoreceptor retinoid-binding protein (IRBP) R16-peptide specific T cells (tEAU). Aqueous humor and serum samples were kinetically collected and DAMPs examined by quantitative proteomics, Western blot analysis, and ELISA. tEAU rats were treated with S100 inhibitor paquinimod followed by disease evaluation. The functions of T effector cells and T regulatory cells (Tregs) were compared between treated and nontreated groups. The expression of costimulatory molecules on antigen-presenting cells was examined by flow cytometry. Results S100A8, but not high mobility group box 1 (HMGB1), in the eye was found to be correlated with intraocular inflammatory episodes. Administration of paquinimod significantly protected tEAU rats from recurrence. Treated tEAU rats had fewer R16-specific Th1 and Th17 cells, but increased numbers of Tregs. R16-specific T cells from treated tEAU rats into naïve recipients prevented induction of tEAU by R16-specific T cells from nontreated tEAU rats. Moreover, APCs from treated tEAU rats expressed higher levels of a negative costimulatory molecule, CD200R, and lower levels of CD80, CD86, and MHC class II molecules compared to APCs from nontreated tEAU rats. An opposite pattern of expression of these molecules was observed on APCs incubated in vitro with recombinant S100A8. Conclusions Our data demonstrate a link between local expression of DAMPs and autoimmune responses, and suggest that complete S100A8/A9 blockade may be a new therapeutic target in recurrent autoimmune uveitis. PMID:29625456

U.S. and U.S.S.R agree on ocean research

NASA Astrophysics Data System (ADS)

Ostenso, Ned A.

On June 1, 1990, George Bush and Mikhail S. Gorbachev signed a renegotiated bilateral agreement for cooperation in oceanographic research. The original agreement for “Studies of the World Ocean,” signed in 1972, did not provide for the protection of intellectual property. The new agreement is administered by executive secretaries from both countries working under the U.S.-U.S.S.R. Joint Committee on Cooperation in Ocean Studies. The committee held its first meeting in Moscow September 14-17, 1990, at the headquarters of the U.S.S.R. State Committee for Science and Technology (GKNT).The U.S. delegation was led by John A. Knauss, undersecretary of commerce for oceans and atmosphere and administrator of the National Oceanic and Atmospheric Administration (NOAA), and included Ned A. Ostenso, executive secretary of the agreement; Thomas E. Murray, NOAA; M. Grant Gross, National Science Foundation; Robert S. Winokur, U.S. Navy; Bonnie McGregor Stubblefield, U.S. Geological Survey; William S. Busch, Office of Science and Technology Policy; and William A. Erb, Eric Green, and Sidney Smith, Department of State.

Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

PubMed Central

Lill, R; Robertson, J M; Wintermeyer, W

1989-01-01

A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. #2 TRANSMISSION LINES, MARCH 7, 1916. SCE drawing no. 4932. - Santa Ana River Hydroelectric System, Transmission Lines, Redlands, San Bernardino County, CA

Measurement of the ratio $$B(t \\to Wb)/B(t \\to Wq)$$ in pp collisions at $$\\sqrt{s}$$ = 8 TeV

DOE PAGES

Khachatryan, Vardan

2014-07-03

The ratio of the top-quark branching fractions R=B(t to Wb)/B(t to Wq), where the denominator includes the sum over all down-type quarks (q = b, s, d), is measured in the t t-bar dilepton final state with proton-proton collision data at sqrt(s)=8 TeV from an integrated luminosity of 19.7 inverse femtobarns, collected with the CMS detector. In order to quantify the purity of the signal sample, the cross section is measured by fitting the observed jet multiplicity, thereby constraining the signal and background contributions. By counting the number of b jets per event, an unconstrained value of R=1.014 +/- 0.003more » (stat.) +/- 0.032 (syst.) is measured, in good agreement with the standard model prediction. A lower limit R > 0.955 at the 95% confidence level is obtained after requiring R <;=1, and a lower limit on the Cabibbo-Kobayashi-Maskawa matrix element abs(V[tb]) > 0.975 is set at 95% confidence level. The result is combined with a previous CMS measurement of the t-channel single-top-quark cross section to determine the top-quark total decay width, Gamma[t]=1.36 +/- 0.02 (stat.) +0.14/-0.11 (syst.) GeV.« less

Therapeutic Discourse and ACOA Films of the '80s and '90s.

ERIC Educational Resources Information Center

Lynch, Joan Driscoll

2000-01-01

Argues that many family melodramas in films of the '80s and '90s focus their narrative on the negative dynamics of the parental relationship. Identifies underlying generic patterns and ideas found in these films. Explores representations of mothers, fathers, and children; gender representation and codependency; and familial dysfunction. Broadens…

U.S. EPA, Pesticide Product Label, , 11/05/1985

EPA Pesticide Factsheets

2011-04-21

... Ap,l, ., p,.-~I... •• 1 ~I ••• "ra". Us. 0.75 I. I p •••• , r 100 ,.II •• s •• ,.ndiA, 00 dis •• s. ,.v.rily. ",y •• IS.. it lOountnh sp,.ys .t •• uiulnl nhs. fll' it,"1 .ppli,.tion II. ...

Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser.

PubMed

Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

2018-06-01

In this work, we fabricate the Mo 0.5 W 0.5 S 2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo 0.5 W 0.5 S 2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm -2 . The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo 0.5 W 0.5 S 2 SAs.

Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser

NASA Astrophysics Data System (ADS)

Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

2018-06-01

In this work, we fabricate the Mo0.5W0.5S2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo0.5W0.5S2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm‑2. The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo0.5W0.5S2 SAs.

22 CFR 191.11 - Applicable benefits.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et seq...

22 CFR 191.11 - Applicable benefits.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et seq...

22 CFR 191.11 - Applicable benefits.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et seq...

22 CFR 191.11 - Applicable benefits.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et seq...

22 CFR 191.11 - Applicable benefits.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et seq...

Proposed standard-weight (W(s)) equations for kokanee, golden trout and bull trout

USGS Publications Warehouse

Hyatt, M.H.; Hubert, W.A.

2000-01-01

We developed standard-weight (W(s)) equations for kokanee (lacustrine Oncorhynchus nerka), golden trout (O. aguabonita), and bull trout (Salvelinus confluentus) using the regression-line-percentile technique. The W(s) equation for kokanee of 120-550 mm TL is log10 W(s) = -5.062 + 3.033 log10 TL, when W(s) is in grams and TL is total length in millimeters; the English-unit equivalent is log10 W(s) = -3.458 + 3.033 log10 TL, when W(s) is in pounds and TL is total length in inches. The W(s) equation for golden trout of 120-530 mm TL is log10 W(s) = -5.088 + 3.041 log10 TL, with the English-unit equivalent being log10 W(s) = -3.473 + 3.041 log10 TL. The W(s) equation for bull trout of 120-850 mm TL is log10 W(s) = -5.327 + 3.115 log10 TL, with the English-unit equivalent being log10 W(s) = -3.608 + 3.115 log10 TL.

Thalamic miR-338-3p mediates auditory thalamocortical disruption and its late onset in 22q11.2 microdeletion models

PubMed Central

Chun, Sungkun; Du, Fei; Westmoreland, Joby J.; Han, Seung Baek; Wang, Yong-Dong; Eddins, Donnie; Bayazitov, Ildar T.; Devaraju, Prakash; Yu, Jing; Mellado Lagarde, Marcia M.; Anderson, Kara; Zakharenko, Stanislav S.

2016-01-01

Although 22q11.2 deletion syndrome (22q11DS) is associated with early-life behavioral abnormalities, affected individuals are also at high risk for the development of schizophrenia symptoms, including psychosis, later in life. Auditory thalamocortical projections recently emerged as a neural circuit specifically disrupted in 22q11DS mouse models, in which haploinsufficiency of the microRNA-processing gene Dgcr8 resulted in the elevation of the dopamine receptor Drd2 in the auditory thalamus, an abnormal sensitivity of thalamocortical projections to antipsychotics, and an abnormal acoustic-startle response. Here we show that these auditory thalamocortical phenotypes have a delayed onset in 22q11DS mouse models and are associated with an age-dependent reduction of the microRNA miR-338-3p, which targets Drd2 and is enriched in the thalamus of both humans and mice. Replenishing depleted miR-338-3p in mature 22q11DS mice rescued the thalamocortical abnormalities, and miR-338-3p deletion/knockdown mimicked thalamocortical and behavioral deficits and eliminated their age dependence. Therefore, miR-338-3p depletion is necessary and sufficient to disrupt auditory thalamocortical signaling in 22q11DS mouse models and may mediate the pathogenic mechanism of 22q11DS-related psychosis and control its late onset. PMID:27892953

Glasses of the As/sub 2/S/sub 3/-T1/sub 2/S system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gutenev, M.S.

1986-08-01

A dielcometric study of (AsS /SUB 1.5/ ) /SUB 1-x/ (TiS /SUB 0.5/ ) /SUB x/ (0 is less than or equal to x is less than or equal to 0.61) glasses was carried out. Glassforming alloys were prepared in thin-walled quartz ampules by rapid cooling from 700 C in air. The methods of determination of permittivity, refractive index, and density, the values of which are shown here, have been previously discussed. The molar infrared polarizability is calculated from the experimental data previously gathered, and the concentration dependence is shown. In this paper, the presence of chemical atomic order inmore » T1AsS/sub 2/ glass described by TISAsS /SUB 2/2/ structural units was experimentally proved. An assumption was made of strong mutual influence of T1AsS/sub 2/ and AsS /SUB 1.5/ complexes caused by coordination of thallium with bridging sulfur atoms.« less

Simultaneous measurements of the t t ¯ , W + W - , and Z / γ * → τ τ production cross-sections in p p collisions at s = 7 TeV with the ATLAS detector

DOE PAGES

Aad, G.; Aad, G.; Abbott, B.; ...

2015-03-06

Simultaneous measurements of the tt¯, W +W –, and Z/γ*→ττ production cross-sections using an integrated luminosity of 4.6 fb –1 of pp collisions at √s=7 TeV collected by the ATLAS detector at the LHC are presented. Events are selected with two high transverse momentum leptons consisting of an oppositely charged electron and muon pair. The three processes are separated using the distributions of the missing transverse momentum of events with zero and greater than zero jet multiplicities. Measurements of the fiducial cross-section are presented along with results that quantify for the first time the underlying correlations in the predicted andmore » measured cross-sections due to proton parton distribution functions. Results indicate that the correlated next-to-leading-order predictions for tt¯ and Z/γ*→ττ underestimate the data, while those at next-to-next-to-leading-order generally describe the data well. The full cross-sections are measured to be σ(tt¯)=181.2 ± 2.8 +9.7 –9.5 ± 3.3 ± 3.3 pb, σ(W +W –) = 53.3 ± 2.7 +7.3 –8.0 ± 1.0 ± 0.5 pb, and σ(Z/γ*→ττ) = 1174 ± 24 +72 –87 ± 21 ± 9 pb, where the cited uncertainties are due to statistics, systematic effects, luminosity and the LHC beam energy measurement, respectively. The W +W – measurement includes the small contribution from Higgs boson decays, H → W +W –.« less

U.S. EPA, Pesticide Product Label, INSECTICIDE CONCENTRATE, 02/11/1985

EPA Pesticide Factsheets

2011-04-21

... ". ... w ••• 11 dft ... ln- .... el ..... wi" .... 4 h., • .. 0 .... . cil eft ..... If I"'tet'''' ,11'1. If ••• 111."- • "I' •• Alee -.ltI"._ C.II. ",11.:1 ... 1_ ... ,tI,. ...

U.S. EPA, Pesticide Product Label, ISOTOX INSECT KILLER FORMULA IV, 11/19/1992

EPA Pesticide Factsheets

2011-04-13

... StIr.bs ,"'1 "" f ,lpl\\ ] T: s II ' : I ,';' T • j' , •• , S; 'do ... ~t" '''stCII 0' /fI,tn II, plfler~ oriel-jon" ~.-t;, \\ "~l "~' -td R'.-Ul,t 'f''''nlahon occur, For Mfilybul~"IOw.' ...

U.S.-U.S.S.R. Seminar on Access to Library Resources through Technology and Preservation (Washington, D.C., July 5-8, 1988). Papers by U.S.S.R. Participants.

ERIC Educational Resources Information Center

International Research and Exchange Board, New York, NY.

This document contains 13 papers by Soviet participants in the U.S.-U.S.S.R. Seminar on Access to Library Resources through Technology and Preservation: (1) "Automation of Information-Library Work at Scientific and Technical Libraries of the U.S.S.R." (A. S. Sorokin and V. M. Rostovtsev); (2) "Automated Information Systems for…

U.S. EPA, Pesticide Product Label, METHYL PARATHION TOXAPHENE 3-6, 04/11/1975

EPA Pesticide Factsheets

2011-04-14

... '. ttt'f ~),'fl)r .. , .. r~ll.k,I~ll}, ",Itlf'lq (Ir (irlrlk.lf)\\-lc .\\fTtH WUR!<., I I"" I~t .Iii 'N,'f'" l I"t""'" II,d ..... h~,t, .... S~I~:V"¥'t'r, ~; ,Ul~~ :.,tJ.i,-> tnd "'.,)t+'f. ...

China in Africa: America’s Soft Power Challenge

DTIC Science & Technology

2011-05-01

22 MCU/CSC/Merrill, T.E./ A Y11 BffiLIOGRAPHY Bergsten, C. Fred, Bates Gill, Nicholas R. Lardy, and Derek Mitchell. China: The Balance Sheet: What...Tiyambe Zeleza. "Africa." World Book Advanced. World Book, 2011. Web. 5 Mar. 2011. Eisenman, Joshua, Eric Heginbotham, and Derek Mitchell, eds. China...docLib/20070726 WhatAfricomMeansforAfrica.pdf. Nye, JosephS. Bound to Lead: The Changing Nature of American Power. New York: Basic Books, 1990. Ong

COSAGE (Concepts Analysis Agency’s Combat Sample Generator) Analysis and Design Report. Volume 1.

DTIC Science & Technology

1984-04-29

CM. C4UT.TI ON 12 5..j FUNCTION m2-. WLr 12 j -1 ---VUTINE w-fA.NEPT 112 5 3 ; CUTINE CA S. =V3L 1 1 5- P JU T loE z- 4 L 0Y.L C T FR S 11 55 P;ICESS... CUTINE PLAT.COUNT 5 -7 1 1 OUT I N PROX.CHiEOK 5 * 14ROUTINE Sw IT CH FrO 5 Figu, .- Modules Ranked by Functional IF Tests Conti nued 3-30 -SCIENCE...2 ; CUTIN -" ...CR T=CT 231 ;OUTI- = Kv .Ir UT T 232 UuTIN.-- Mi 3s.I~d3UT , 2 3 Z Ru T iiM d:’ 3 N-l 2". OUT:N .44 1’ ,1 L3i R OUT INE %4 l Nk 0 (3o

t {r_arrow} cWW and WW {r_arrow} {anti t}c + t{anti c} in extended models

DOE Office of Scientific and Technical Information (OSTI.GOV)

David Atwood; Marc Sher

Jenkins has pointed out that the process t {r_arrow} cW{sup +}W{sup {minus}}is GIM suppressed in the standard model. In this note, the authors calculate the branching ratio for a wide range of models, in which the decay occurs at tree level through exchange of a scalar, fermion or vector. In the case of scalar exchange, a scalar mass between 2m{sub W} and 200 GeV leads to a resonant enhancement, giving a branching ratio as high as a few tenths of a percent. They then note that all of these models will also allow W{sup +}W{sup {minus}} {r_arrow} {anti t}c +more » t{anti c}, and they calculate the single-top/single-charm production rate at the LHC. The rates aren't negligibly small, but the background from single-top/single-bottom production will probably swamp the signal.« less

[Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

PubMed

Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

2005-01-01

Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

Niobium in R And (S6, 6e) and HR 1105 (S5, 3). [S star abundance

NASA Technical Reports Server (NTRS)

Davis, D. N.

1985-01-01

Lines of the first multiplet of niobium are strong in R And and HR 1105. These lines are also present in other S stars: HR 8714, R Cam, V Cnc, R CMi, and T Sgr. They are also visible in the M stars, Beta-Peg and Mu-UMa. An approximation to the abundance ratio, Nb/Fe, has been deduced from pairs of lines having nearly equal intensity. In R And, the ratio is about 200 times the solar value. It is hoped that good plates will soon be obtained for the near infrared region, so that the significant Nb/Rb abundance ratio may be determined.

27 CFR 9.89 - Umpqua Valley.

Code of Federal Regulations, 2010 CFR

2010-04-01

... in Township 21 South (T21S), Range 4 West (R4W) on the “Roseburg” map. (1) From the beginning point... range line R8W/R9W approximately 3.5 miles to its intersection with township line T22S/T23S; (4) Thence southeast approximately 8.5 miles along a straight line to the intersection of township line T23S/T24S with...

27 CFR 9.89 - Umpqua Valley.

Code of Federal Regulations, 2011 CFR

2011-04-01

... in Township 21 South (T21S), Range 4 West (R4W) on the “Roseburg” map. (1) From the beginning point... range line R8W/R9W approximately 3.5 miles to its intersection with township line T22S/T23S; (4) Thence southeast approximately 8.5 miles along a straight line to the intersection of township line T23S/T24S with...

Compressive strain induced dynamical stability of monolayer 1T-MX2 (M  =  Mo, W; X  =  S, Se)

NASA Astrophysics Data System (ADS)

Li, Xiaoyong; Wu, Musheng; Xu, Bo; Liu, Ruifan; Ouyang, Chuying

2017-11-01

The lattice dynamical properties of 1T-MX2 (M  =  Mo, W; X  =  S, Se) under different strains were studied by using density functional perturbation theory method. Our results show that all MX2 with 1T phase in our calculations are dynamical instable under zero strain or tensile strain as obvious imaginary frequencies (soft modes) exist. When 3% biaxial compressive strains are applied, the imaginary frequencies remain except that the absolute values of maximum imaginary frequency decrease. With the increase of compressive strain to be 6%, 1T-MoS2, 1T-MoSe2, 1T-WS2 become stable, whereas 1T-WSe2 has small imaginary frequencies. When biaxial compressive strain reaches 9%, all 1T-MX2 are dynamical stable without imaginary frequencies in the phonon dispersion curves. Energy band structures show that all 1T-MX2 are metallic, regardless of zero strain or compressive strain. Therefore, compressive strain could be a practical approach to enhance the stability of 1T-MX2 while maintaining the metallic property.

The Army’s Wireless Communications Programs

DTIC Science & Technology

2009-02-11

20Plans%20First%20AEHF% 20Launch%20Early%20Next%20Year&channel= awst .9 CBO Other Strategic Wireless Communications Programs The Army invests in a number...O N G R E SS O F T H E U N IT E D ST AT E S C O N G R E SSIO N A L B U D G E T O FFIC E W A SH IN G T O N , D C 20515

Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

NASA Technical Reports Server (NTRS)

Gutell, R. R.; Larsen, N.; Woese, C. R.

1994-01-01

The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

Do cosmological data rule out f (R ) with w ≠-1 ?

NASA Astrophysics Data System (ADS)

Battye, Richard A.; Bolliet, Boris; Pace, Francesco

2018-05-01

We review the equation of state (EoS) approach to dark sector perturbations and apply it to f (R ) gravity models of dark energy. We show that the EoS approach is numerically stable and use it to set observational constraints on designer models. Within the EoS approach we build an analytical understanding of the dynamics of cosmological perturbations for the designer class of f (R ) gravity models, characterized by the parameter B0 and the background equation of state of dark energy w . When we use the Planck cosmic microwave background temperature anisotropy, polarization, and lensing data as well as the baryonic acoustic oscillation data from SDSS and WiggleZ, we find B0<0.006 (95% C.L.) for the designer models with w =-1 . Furthermore, we find B0<0.0045 and |w +1 |<0.002 (95% C.L.) for the designer models with w ≠-1 . Previous analyses found similar results for designer and Hu-Sawicki f (R ) gravity models using the effective field theory approach [Raveri et al., Phys. Rev. D 90, 043513 (2014), 10.1103/PhysRevD.90.043513; Hu et al., Mon. Not. R. Astron. Soc. 459, 3880 (2016), 10.1093/mnras/stw775]; therefore this hints for the fact that generic f (R ) models with w ≠-1 can be tightly constrained by current cosmological data, complementary to solar system tests [Brax et al., Phys. Rev. D 78, 104021 (2008), 10.1103/PhysRevD.78.104021; Faulkner et al., Phys. Rev. D 76, 063505 (2007), 10.1103/PhysRevD.76.063505]. When compared to a w CDM fluid with the same sound speed, we find that the equation of state for f (R ) models is better constrained to be close to -1 by about an order of magnitude, due to the strong dependence of the perturbations on w .

22 CFR 226.11 - Pre-award policies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Pre-award policies. 226.11 Section 226.11 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS Pre-award Requirements § 226.11 Pre-award policies. (a) Use of grants and...

Maritime Security. Coast Guard Inspections Identify and Correct Facility Deficiencies, but More Analysis Needed of Program’s Staffing, Practices, and Data

DTIC Science & Technology

2008-02-01

to the process to increase security may have economic consequences.7 Actions to improve security are undertaken with the knowledge that total ...inspections, and improve its facility compliance data. The Department of Homeland Security agreed with GAO’s recommendations. W r f e i o c r U p d w...A c U i s a c c g c r T p u w o a d c i T S To view the full product , including the scope and methodology, click on GAO-08-12. For more

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

U.S. EPA, Pesticide Product Label, , 08/11/1975

EPA Pesticide Factsheets

2011-04-21

: l i. -, Hif,'." , dlllllt.-fd.l!.1 ~~d!~_ /;[11:' !h;· :ltn!!dtlt uf di>n, ,j m r f,·· C')).! t'L' ,-'l!'--' hitt \\\\'ili L(· ll,"If'd in)n)pdintt I.\\" "'l--.tl ·,ff Ll" (l\\;t.r !Ii, ...

Phylogeny and classification of Naucleeae s.l. (Rubiaceae) inferred from molecular (ITS, rBCL, and tRNT-F) and morphological data.

PubMed

Razafimandimbison, Sylvain G; Bremer, Birgitta

2002-07-01

Parsimony analyses of the tribe Naucleeae sensu lato (s.l.) using the noncoding internal transcribed spacer (ITS) regions of nuclear rDNA, the protein-coding rbcL and noncoding trnT-F regions of chloroplast DNA, and morphological data were performed to construct new intratribal classification, test the monophyly of previous subtribal circumscriptions, and evaluate the generic status of Naucleeae s.l. Fifty-two ITS, 45 rbcL, and 55 trnT-F new sequences are published here. Our study supports the monophyly of the subtribes Anthocephalidae, Mitragynae, Uncariae all sensu Haviland and Naucleinae sensu Ridsdale. There was no support for Cephalanthidae sensu Haviland and Adininae sensu Ridsdale. Naucleeae can be subdivided into six highly supported and morphologically distinct subtribes, Breoniinae, Cephalanthinae, Corynantheinae, Naucleinae, and Mitragyninae, Uncarinae, plus one, Adininae, which is poorly supported. The relationships among these subtribes were largely unresolved. We maintain the following 22 genera: Adina, Adinauclea, Breonadia, Breonia, Burttdavya, Cephalanthus, Gyrostipula, Haldina, Janotia, Ludekia, Metadina, Mitragyna, Myrmeconauclea, Nauclea, Neolamarckia, Neonauclea, Ochreinauclea, Pausinystalia, Pertusadina, Sarcocephalus, Sinoadina, and Uncaria. Pseudocinchona is reestablished. Corynanthe is restricted to C. paniculata and Hallea is reincluded in Mitragyna. Our results were inconclusive for assessing the relationships among Adina, Adinauclea, Metadina, and Pertusadina due to lack of resolution.

U.S. EPA, Pesticide Product Label, , 10/17/1985

EPA Pesticide Factsheets

2011-04-14

... I(lu(h,rl'l t',11 10 (,I HHIJ.l! 'III,", t,·, ,,f [," . 'l" ,. vnrnillflq /,f q'vf' "tf1.,ltlllllj tJ, fI"\\~I!I\\ Ir, r",()f\\ If On Slcln' W.'1'·tJ w,tt\\ I,!"fll., f'~ ',"ll' ,p.rl ..... ...

Novel thioarsenates {[Mn(2,2'-bipy)2(SCN)][Mn(2,2'-bipy)](As(V)S4)}2 and {[Mn(2,2'-bipy)2(SCN)]2[As(III)2(S2)2S2]}: introducing an anionic second ligand to modify MnII complex cations of 2,2'-bipyridine.

PubMed

Liu, Guang-Ning; Guo, Guo-Cong; Wang, Ming-Sheng; Huang, Jin-Shun

2014-03-14

Two novel manganese thioarsenates, {[Mn(2,2'-bipy)2(SCN)][Mn(2,2'-bipy)](As(V)S4)}2 (1, 2,2'-bipy = 2,2'-bipyridine) and {[Mn(2,2'-bipy)2(SCN)]2[As(III)2(S2)2S2]} (2), containing thiocyanate-modified Mn-2,2'-bipy complex cations were synthesized. They feature two terminal [Mn(2,2'-bipy)2(SCN)](+) complex cations bridged by a polyanion {[Mn(2,2'-bipy)]2(As(V)S4)2}(2-) for 1 and a cyclic thioarsenate anion (As(III)2S6)(2-) for 2. In 2, the [As(III)2(S2)2S2](2-) anion can be described as two (As(III)S3)(3-) trigonal-pyramids interlinked through S-S bonds. The method to obtain new metal complex cations shown here, introducing an anionic second ligand to modify the number of coordination sites and the charges of the metal complex cations simultaneously, is different from the traditional methods, varying either the TM center or the organic ligand or employing mixed neutral organic ligands, and may open up a new route for preparing novel chalcogenidometalates. Compounds 1 and 2 exhibit wide optical gaps of 2.20 and 2.67 eV, respectively, and photoluminescence with the emission maxima occurring around 440 nm. Magnetic measurements show the presence of antiferromagnetic interactions between Mn(II) centers in the two compounds.

De novo direct duplication of chromosome segment 22q11.2-q13.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujimoto, Atsuko; Lin, Ming S.

Lindsay et al. [1995] reported a case of de novo duplication of the segment 22q11-q12. Molecular cytogenetics studies showed that the segment includes the regions responsible for the {open_quotes}cat eye,{close_quotes} DiGeorge, and velo-cardio-facial syndrome, and extends distal to the breakpoint cluster region. The phenotype was milder than that of complete trisomy 22 and der(22)t(11;22) (q23;q11) syndrome and was similar in type and severity to that of {open_quotes}cat eye{close_quotes} syndrome (CES). They suggested that trisomy of gene(s) responsible for the CES might have a predominant phenotypic effect over other genes present in the region duplicated in their patient. 3 refs., 2more » figs.« less

Scale invariance of the η-deformed AdS5 × S5 superstring, T-duality and modified type II equations

NASA Astrophysics Data System (ADS)

Arutyunov, G.; Frolov, S.; Hoare, B.; Roiban, R.; Tseytlin, A. A.

2016-02-01

We consider the ABF background underlying the η-deformed AdS5 ×S5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that has 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R-R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R-R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS3 ×S3 ×T4and AdS2 ×S2 ×T6models.

High phase-purity 1T'-MoS2- and 1T'-MoSe2-layered crystals

NASA Astrophysics Data System (ADS)

Yu, Yifu; Nam, Gwang-Hyeon; He, Qiyuan; Wu, Xue-Jun; Zhang, Kang; Yang, Zhenzhong; Chen, Junze; Ma, Qinglang; Zhao, Meiting; Liu, Zhengqing; Ran, Fei-Rong; Wang, Xingzhi; Li, Hai; Huang, Xiao; Li, Bing; Xiong, Qihua; Zhang, Qing; Liu, Zheng; Gu, Lin; Du, Yonghua; Huang, Wei; Zhang, Hua

2018-06-01

Phase control plays an important role in the precise synthesis of inorganic materials, as the phase structure has a profound influence on properties such as conductivity and chemical stability. Phase-controlled preparation has been challenging for the metallic-phase group-VI transition metal dichalcogenides (the transition metals are Mo and W, and the chalcogens are S, Se and Te), which show better performance in electrocatalysis than their semiconducting counterparts. Here, we report the large-scale preparation of micrometre-sized metallic-phase 1T'-MoX2 (X = S, Se)-layered bulk crystals in high purity. We reveal that 1T'-MoS2 crystals feature a distorted octahedral coordination structure and are convertible to 2H-MoS2 following thermal annealing or laser irradiation. Electrochemical measurements show that the basal plane of 1T'-MoS2 is much more active than that of 2H-MoS2 for the electrocatalytic hydrogen evolution reaction in an acidic medium.

An Analysis of DOD’s Standards of Conduct Applicable to Personnel Assigned to the Contracting Arena.

DTIC Science & Technology

1980-12-01

THIS PAS Mw bas aem, REPOIR DOCUM NTATION PAGE RED NMIucLrlTWs . NEPORT NUVOW .GOVT ACcSmow e 3. NECIPg~wTS CATALOG NUMMERa 4. TITLe (ad 1,N.J 1. TYPE...SnAnfards on CNui-t4haR boon- DO ~ 1473 EmalOm e e 6.OSŕ Vill 0802-014. 501 1 10 , TO P 1 , - woono-o--- - - a s fi developed for use by procurement...ASSUMPTIONS---------------------------------------- 11 E . LIMITATIONS---------------------------------------- 11 F. METHODOLOGY

Measurement of the jet mass in highly boosted {t}\\overline{t} events from pp collisions at √{s}=8 {TeV}

NASA Astrophysics Data System (ADS)

Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Waltenberger, W.; Wulz, C.-E.; Dvornikov, O.; Makarenko, V.; Mossolov, V.; Suarez Gonzalez, J.; Zykunov, V.; Shumeiko, N.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Bakhshiansohi, H.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Torres Da Silva De Araujo, F.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Ruan, M.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Susa, T.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Tsiakkouri, D.; Finger, M.; Finger, M., Jr.; Carrera Jarrin, E.; Abdelalim, A. A.; Mohammed, Y.; Salama, E.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Miné, P.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Stahl Leiton, A. G.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Le Bihan, A.-C.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fay, J.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sabes, D.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Albert, A.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bin Anuar, A. A.; Borras, K.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Dolinska, G.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hoffmann, M.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Baus, C.; Berger, J.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Fink, S.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Goldenzweig, P.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Filipovic, N.; Pasztor, G.; Bencze, G.; Hajdu, C.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Choudhury, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, R.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Kole, G.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Dewanjee, R. K.; Ganguly, S.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; De Nardo, G.; Di Guida, S.; Esposito, M.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Lanza, G.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes de Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Fallavollita, F.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Del Re, D.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, S.; Lee, S. W.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Brochero Cifuentes, J. A.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Lee, H.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Magaña Villalba, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Carpinteyro, S.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Calpas, B.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Chtchipounov, L.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Murzin, V.; Oreshkin, V.; Sulimov, V.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chistov, R.; Polikarpov, S.; Zhemchugov, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Klyukhin, V.; Korneeva, N.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Perfilov, M.; Savrin, V.; Volkov, P.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vischia, P.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Baillon, P.; Ball, A. H.; Barney, D.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fartoukh, S.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Girone, M.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Kousouris, K.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Morovic, S.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Sauvan, J. B.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Sphicas, P.; Steggemann, J.; Stoye, M.; Takahashi, Y.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Verweij, M.; Wardle, N.; Wöhri, H. K.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lustermann, W.; Mangano, B.; Marionneau, M.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Yang, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Asavapibhop, B.; Singh, G.; Sri manobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Eskut, E.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Sunar Cerci, D.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Dunne, P.; Elwood, A.; Futyan, D.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Nash, J.; Nikitenko, A.; Pela, J.; Penning, B.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Jesus, O.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Spencer, E.; Syarif, R.; Breedon, R.; Burns, D.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Squires, M.; Stolp, D.; Tos, K.; Tripathi, M.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Weber, M.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Negrete, M. Olmedo; Paneva, M. I.; Shrinivas, A.; Si, W.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Holzner, A.; Klein, D.; Krutelyov, V.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Wood, J.; Würthwein, F.; Yagil, A.; Della Porta, G. Zevi; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Bunn, J.; Duarte, J.; Lawhorn, J. M.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Winn, D.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Cremonesi, M.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Wu, Y.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Low, J. F.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Shchutska, L.; Sperka, D.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Bein, S.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Prosper, H.; Santra, A.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Jung, K.; Sandoval Gonzalez, I. D.; Varelas, N.; Wang, H.; Wu, Z.; Zakaria, M.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Forthomme, L.; Kenny, R. P., III; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Apyan, A.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Krajczar, K.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Suarez, R. Gonzalez; Kamalieddin, R.; Kravchenko, I.; Rodrigues, A. Malta; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Kumar, A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Rupprecht, N.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Lange, D.; Luo, J.; Marlow, D.; Medvedeva, T.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Svyatkovskiy, A.; Tully, C.; Malik, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Schulte, J. F.; Shi, X.; Sun, J.; Wang, F.; Xie, W.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Juska, E.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; De Guio, F.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Sturdy, J.; Belknap, D. A.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.

2017-07-01

The first measurement of the jet mass m_{ {jet}} of top quark jets produced in {t}\\overline{t} events from pp collisions at √{s}=8 {TeV} is reported for the jet with the largest transverse momentum pT in highly boosted hadronic top quark decays. The data sample, collected with the CMS detector, corresponds to an integrated luminosity of 19.7 {fb}^{-1}. The measurement is performed in the lepton+jets channel in which the products of the semileptonic decay {t} → b W with W→ ℓ ν where ℓ is an electron or muon, are used to select {t}\\overline{t} events with large Lorentz boosts. The products of the fully hadronic decay {t} → b W with W→ q \\overline{q} ' are reconstructed using a single Cambridge-Aachen jet with distance parameter R=1.2, and pT >400 {GeV}. The {t}\\overline{t} cross section as a function of m_{ {jet}} is unfolded at the particle level and is used to test the modelling of highly boosted top quark production. The peak position of the m_{ {jet}} distribution is sensitive to the top quark mass m_{{t}}, and the data are used to extract a value of m_{{t}} to assess this sensitivity.

A Characterization of t/s-Diagnosability and Sequential t-Diagnosability in Designs

DTIC Science & Technology

1990-10-01

41 151 161 171 181 r91 1101 REFERENCES K.-Y. Chwa and S. L. Hakimi, “On fault identification in diagnosable systems,” ZEEE Tmns. Comput...1975, pp. 167-170. S. L. Hakimi and A. T. Amin, “Characterization of the connection assignment problem of diagnosable systems,” ZEEE Trans. Comput...S. Karunanithi and A. D. Friedman, “Analysis of digital systems using a new measure of system diagnosis,” ZEEE Trans. Cornput., vol. C- A

Proposals for revival of Streptomyces setonii and reclassification of S. fimicarius as a later synonym of S. setonii and S. albovinaceus as a later synonym of S. globisporus based on combined 16S rRNA-gyrB gene analysis

USDA-ARS?s Scientific Manuscript database

The 16S rRNA and gyrB genes of 22 Streptomyces species belonging to the Streptomyces griseus cluster were sequenced, and their taxonomic positions were re-evaluated. For correct analysis, all of the publicly available sequences of the species were collected and compared with those obtained in this s...

Using spin-label W-band EPR to study membrane fluidity profiles in samples of small volume

NASA Astrophysics Data System (ADS)

Mainali, Laxman; Hyde, James S.; Subczynski, Witold K.

2013-01-01

Conventional and saturation-recovery (SR) EPR at W-band (94 GHz) using phosphatidylcholine spin labels (labeled at the alkyl chain [n-PC] and headgroup [T-PC]) to obtain profiles of membrane fluidity has been demonstrated. Dimyristoylphosphatidylcholine (DMPC) membranes with and without 50 mol% cholesterol have been studied, and the results have been compared with similar studies at X-band (9.4 GHz) (L. Mainali, J.B. Feix, J.S. Hyde, W.K. Subczynski, J. Magn. Reson. 212 (2011) 418-425). Profiles of the spin-lattice relaxation rate (T1-1) obtained from SR EPR measurements for n-PCs and T-PC were used as a convenient quantitative measure of membrane fluidity. Additionally, spectral analysis using Freed's MOMD (microscopic-order macroscopic-disorder) model (E. Meirovitch, J.H. Freed J. Phys. Chem. 88 (1984) 4995-5004) provided rotational diffusion coefficients (R⊥ and R||) and order parameters (S0). Spectral analysis at X-band provided one rotational diffusion coefficient, R⊥. T1-1, R⊥, and R|| profiles reflect local membrane dynamics of the lipid alkyl chain, while the order parameter shows only the amplitude of the wobbling motion of the lipid alkyl chain. Using these dynamic parameters, namely T1-1, R⊥, and R||, one can discriminate the different effects of cholesterol at different depths, showing that cholesterol has a rigidifying effect on alkyl chains to the depth occupied by the rigid steroid ring structure and a fluidizing effect at deeper locations. The nondynamic parameter, S0, shows that cholesterol has an ordering effect on alkyl chains at all depths. Conventional and SR EPR measurements with T-PC indicate that cholesterol has a fluidizing effect on phospholipid headgroups. EPR at W-band provides more detailed information about the depth-dependent dynamic organization of the membrane compared with information obtained at X-band. EPR at W-band has the potential to be a powerful tool for studying membrane fluidity in samples of small volume, ˜30 n

Hole-assisted fiber based fiber fuse terminator supporting 22 W input

NASA Astrophysics Data System (ADS)

Tsujikawa, Kyozo; Kurokawa, Kenji; Hanzawa, Nobutomo; Nozoe, Saki; Matsui, Takashi; Nakajima, Kazuhide

2018-05-01

We investigated the air hole structure in hole-assisted fiber (HAF) with the aim of terminating fiber fuse propagation. We focused on two structural parameters c/MFD and S1/S2, which are related respectively to the position and area of the air holes, and mapped their appropriate values for terminating fiber fuse propagation. Here, MFD is the mode field diameter, c is the diameter of an inscribed circle linking the air holes, S1 is the total area of the air holes, and S2 is the area of a circumscribed circle linking the air holes. On the basis of these results, we successfully realized a compact fiber fuse terminator consisting of a 1.35 mm-long HAF, which can terminate fiber fuse propagation even with a 22 W input. In addition, we observed fiber fuse termination using a high-speed camera. We additionally confirmed that the HAF-based fiber fuse terminator is effective under various input power conditions. The penetration length of the optical discharge in the HAF was only less than 300 μm when the input power was from 2 to 22 W.

11. Photocopy of photograph, U.S. Army, ca. 1943 (original print ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Photocopy of photograph, U.S. Army, ca. 1943 (original print located at Rocky Mountain Arsenal, Commerce City, Colorado). R.M.A. - 412 - H.S. MFG. & FILLING LOOKING E. - Rocky Mountain Arsenal, Mustard Manufacturing-Filling Building, December Seventh Avenue & D Street, Commerce City, Adams County, CO

Absolute structure and structure-function relationships of 4R,2‧R and 4S,2‧S Pidotimod®

NASA Astrophysics Data System (ADS)

Sarno, Simone; Manzo, Angelo M.; Ferraris, Davide M.; Miggiano, Riccardo; Rizzi, Menico; Palin, Luca; Boccaleri, Enrico; Milanesio, Marco

2017-11-01

Pidotimod® is a dipeptide with widely recognized immunomodulatory properties and with particularly beneficial effects for the treatment of acute respiratory and urinary tract infections. Pidotimod® presents two chiral centres which originate four stereoisomers. (4R,2‧S, 4S,2‧R, 4R,2‧R and 4S,2‧S). To date, only the 4R,2‧S and 4S,2‧R stereoisomers are reported in the literature. We report here the absolute crystal structure of the 4R,2‧R and 4S,2‧S diastereoisomers of Pidotimod®, obtained by crystals grown by slow evaporation of a mixture of water and ethanol. The analysis of the crystal structures revealed the key role of a solvent water molecule in the crystal packing engaged in an extended hydrogen bonds network. This water-assisted H-bond network explained the recalcitrance of 4R,2‧R and 4S,2‧S Pidotimod® to crystallize in pure ethanol, despite their high solubility, and the growth of well-diffracting crystals only in presence of water. Hence, Pidotimod®4R,2‧R and 4S,2‧S stereoisomers markedly differ from the 4R,2‧S and 4S,2‧R ones, which crystallize in absence of water. The molecular and crystal structures of the 4R,2‧R and 4S,2‧S Pidotimod® stereoisomers here presented gave some hints on the differences in bioactivity with respect to the 4R,2‧S stereoisomer. In fact, beyond an expected different dispositions of hydrophilic ligands, 4R,2‧R and 4S,2‧S showed an incremented tendency to intermolecular H-bonds with water.

Methodologies Used by Warsaw Pact Countries (Except U.S.S.R.) in Obtaining U.S. Technologies

DTIC Science & Technology

1987-04-01

SOURCE OF FUNDING NUMBERS PROGRAM ELEMENT NO. PROJECT NO. TASK NO WORK UNIT ACCESSION NO. 11. TITLE (Include Security Classification...in March 196’/. In 1970 he attended Southwest Texas State University under the Airman Education and Commissioning Program CAF1T). Major Cheeseman...critical U. S. technologies. Chapter One INTRODUCTION THE THREAT-AN OVERVIEV The United States is faced with loss of its technologies to the Warsaw

Theoretical evaluation of two plausible routes for bioactivation of S-(1,1-difluoro-2,2-dihaloethyl)-L-cysteine conjugates: thiirane vs thionoacyl fluoride pathway.

PubMed

Shim, J Y; Richard, A M

1997-01-01

The selective nephrotoxicity of halogenated alkenes has been attributed to a glutathione (GSH) S-conjugate pathway involving enzymatic hydrolysis to the cysteine S-conjugate and beta-lyase bioactivation to thiolates, which are presumed to give rise to the ultimate mutagenic or cytotoxic reactive species. Studies have shown that the brominated S-(2,2-dihalo-1,1-difluoroethyl)-L-cysteine conjugates are mutagenic in the Ames test, whereas the nonbrominated analogues are nonmutagenic. While careful experimentation has contributed much to current understanding, the ultimate reactive species responsible for the differing mutagenic effects remain unknown. Computational methods were applied to the investigation of two proposed metabolic pathways leading from the thiolate to either a thiirane or thionoacyl fluoride intermediate, both electrophilic species presumed capable of binding to proteins or DNA. Studied were six F-, Cl-, and Br-substituted 2,2-dihalo-1,1-difluoroethane-1-thiolates (2,2-dihalo-DFETs). Pathway preference was determined for each thiolate by comparison of reaction energy profiles and activation energies. At all but the lowest level of ab initio theory, a thionoacyl fluoride pathway was predicted for 2,2-difluoro-DFET, while a thiirane pathway was energetically preferred for the brominated 2,2-dihalo-DFETs. These results offer a clear mechanism-based rationale for distinguishing 2,2-difluoro-DFET from the brominated 2,2-dihalo-DFETs, while the results are less clear for the 2,2-dichloro and 2-chloro-2-fluoro-DFETs, which at the highest level of ab initio treatment had a relatively small energy preference (2.4 kcal/mol) for the thiirane pathway. The predicted clear preference for a thiirane pathway for the brominated 2,2-dihalo-DFETs is not consistent with a recently proposed pathway involving alpha-thiolactone formation through a thionoacyl fluoride intermediate [Finkelstein, M. B., et al. (1995) J. Am. Chem. Soc. 117, 9590-9591], but is supported by

Regular series of doubly excited states inside two-electron continua: Application to 2s2-hole states in neon above the Ne2+1s22s22p4 and 1s22s2p5 thresholds

NASA Astrophysics Data System (ADS)

Komninos, Yannis; Mercouris, Theodoros; Nicolaides, Cleanthes A.

2011-02-01

We report results of many-electron calculations that predict the presence of a regular series of autoionizing doubly excited states (DESs) of 1Posymmetry embedded inside one- as well as two-electron continua of neon, in the range of excitation 105.9-121.9 eV above the ground state. The limit of 121.9 eV represents the two-electron ionization threshold (TEIT) labeled by Ne2+ 1s22p6 1S. The wave functions of these unstable states and their properties are computed according to the theoretical framework, which is explained and justified in the text. Their formal structure is (ψcore)1S⊗Φ(r1→,r2→)1Po, where both ψcore and Φ(r⃗1,r⃗2) are correlated wave functions, the latter being represented reasonably accurately by a self-consistently obtained superposition of nsnp and np(n+1)d configurations n=3-7. By fitting the calculated lowest energies at each value of n, (five states), an effective hydrogenic formula is obtained, which gives the whole energy spectrum up to the TEIT. The autoionization widths are small and decrease with excitation energy. Oscillator strengths for the excitation of these narrow resonance states by absorption of one photon are also small. Because of their electronic structure, these states are compared to 1Po DESs in He, which were found in the 1980s to constitute a regular ladder with wave-function characteristics that tend to those of the so-called Wannier state at threshold. In the present case, the presence of the core and the concomitant interactions do not permit the emergence of such geometrical features.

Tumor cell-released TLR4 ligands stimulate Gr-1+CD11b+F4/80+ cells to induce apoptosis of activated T cells.

PubMed

Liu, Yan-Yan; Sun, Ling-Cong; Wei, Jing-Jing; Li, Dong; Yuan, Ye; Yan, Bin; Liang, Zhi-Hui; Zhu, Hui-Fen; Xu, Yong; Li, Bo; Song, Chuan-Wang; Liao, Sheng-Jun; Lei, Zhang; Zhang, Gui-Mei; Feng, Zuo-Hua

2010-09-01

Gr-1(+)CD11b(+)F4/80(+) cells play important roles in tumor development and have a negative effect on tumor immunotherapy. So far, the mechanisms underlying the regulation of their immunosuppressive phenotype by classical and alternative macrophage activation stimuli are not well elucidated. In this study, we found that molecules from necrotic tumor cells (NTC-Ms) stimulated Gr-1(+)CD11b(+)F4/80(+) cells to induce apoptosis of activated T cells but not nonstimulated T cells. The apoptosis-inducing capacity was determined by higher expression levels of arginase I and IL-10 relative to those of NO synthase 2 and IL-12 in Gr-1(+)CD11b(+)F4/80(+) cells, which were induced by NTC-Ms through TLR4 signaling. The apoptosis-inducing capacity of NTC-Ms-stimulated Gr-1(+)CD11b(+)F4/80(+) cells could be enhanced by IL-10. IFN-gamma may reduce the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells only if their response to IFN-gamma was not attenuated. However, the potential of Gr-1(+)CD11b(+)F4/80(+) cells to express IL-12 in response to IFN-gamma could be attenuated by tumor, partially due to the existence of active STAT3 in Gr-1(+)CD11b(+)F4/80(+) cells and NTC-Ms from tumor. In this situation, IFN-gamma could not effectively reduce the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells. Tumor immunotherapy with 4-1BBL/soluble programmed death-1 may significantly reduce, but not abolish the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells in local microenvironment. Blockade of TLR4 signaling could further reduce the apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells and enhance the suppressive effect of 4-1BBL/soluble form of programmed death-1 on tumor growth. These findings indicate the relationship of distinct signaling pathways with apoptosis-inducing capacity of Gr-1(+)CD11b(+)F4/80(+) cells and emphasize the importance of blocking TLR4 signaling to prevent the induction of T cell apoptosis by Gr-1(+)CD11b(+)F4/80(+) cells.

The supernova remnant W49B as seen with H.E.S.S. and Fermi-LAT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdalla, H.; Abramowski, A.; Aharonian, F.

The supernova remnant (SNR) W49B originated from a core-collapse supernova that occurred between one and four thousand years ago, and subsequently evolved into a mixed-morphology remnant, which is interacting with molecular clouds (MC). Gamma-ray observations of SNR-MC associations are a powerful tool to constrain the origin of Galactic cosmic rays, as they can probe the acceleration of hadrons through their interaction with the surrounding medium and subsequent emission of non-thermal photons. Here, we report the detection of a γ-ray source coincident with W49B at very high energies (VHE; E > 100 GeV) with the H.E.S.S. Cherenkov telescopes together with amore » study of the source with five years of Fermi-LAT high-energy γ-ray (0.06–300 GeV) data. The smoothly connected, combined source spectrum, measured from 60 MeV to multi-TeV energies, shows two significant spectral breaks at 304 ± 20 MeV and 8.4 -2.5 +2.2 GeV; the latter is constrained by the joint fit from the two instruments. The detected spectral features are similar to those observed in several other SNR-MC associations and are found to be indicative of γ-ray emission produced through neutral-pion decay.« less

The supernova remnant W49B as seen with H.E.S.S. and Fermi-LAT

DOE PAGES

Abdalla, H.; Abramowski, A.; Aharonian, F.; ...

2018-04-01

The supernova remnant (SNR) W49B originated from a core-collapse supernova that occurred between one and four thousand years ago, and subsequently evolved into a mixed-morphology remnant, which is interacting with molecular clouds (MC). Gamma-ray observations of SNR-MC associations are a powerful tool to constrain the origin of Galactic cosmic rays, as they can probe the acceleration of hadrons through their interaction with the surrounding medium and subsequent emission of non-thermal photons. Here, we report the detection of a γ-ray source coincident with W49B at very high energies (VHE; E > 100 GeV) with the H.E.S.S. Cherenkov telescopes together with amore » study of the source with five years of Fermi-LAT high-energy γ-ray (0.06–300 GeV) data. The smoothly connected, combined source spectrum, measured from 60 MeV to multi-TeV energies, shows two significant spectral breaks at 304 ± 20 MeV and 8.4 -2.5 +2.2 GeV; the latter is constrained by the joint fit from the two instruments. The detected spectral features are similar to those observed in several other SNR-MC associations and are found to be indicative of γ-ray emission produced through neutral-pion decay.« less

État de santé des nouveaux réfugiés à Toronto, en Ontario

PubMed Central

Redditt, Vanessa J.; Graziano, Daniela; Janakiram, Praseedha; Rashid, Meb

2015-01-01

Résumé Objectif Déterminer la prévalence de certaines maladies chroniques parmi les nouveaux réfugiés et la présence ou non d’une variation en fonction de facteurs démographiques clés. Conception Revue rétrospective de dossiers. Contexte Clinique de soins primaires pour patients réfugiés à Toronto, en Ontario. Participants Au total, 1063 patients réfugiés inscrits à la clinique entre décembre 2011 et juin 2014. Principaux paramètres à l’étude Données démographiques (âge, sexe et pays de naissance); prévalence de résultats anormaux au test Pap, d’anémie, d’élévation de la tension artérielle (TA) et de présence de marqueurs de prédiabète ou de diabète (glycémie aléatoire, glycémie à jeun ou taux d’hémoglobine A1c élevés). Résultats Plus de la moitié de nos patients étaient des femmes (56 %) et l’âge médian était de 29 ans. Les réfugiés étaient nés dans 87 pays différents. Les pays d’origine du plus grand nombre de réfugiés étaient la Hongrie (210 patients), la Corée du Nord (119 patients) et le Nigéria (93 patients). La plupart des patients sont arrivés à titre de demandeurs d’asile (92 %) plutôt qu’à titre de réfugiés pris en charge par le gouvernement (5 %). Dans l’ensemble, 11 % des patientes ayant subi un test Pap ont obtenu des résultats de cytologie cervicale anormaux, ce taux étant le plus élevé parmi les patientes originaires d’Asie (26 %; p = 0,028). La prévalence d’anémie parmi les enfants de moins de 15 ans était de 11 %; et elle était de 14 % parmi les enfants de moins de 5 ans. Environ 25 % des femmes de plus de 15 ans étaient anémiques, ce taux était le plus élevé parmi les patientes originaires d’Afrique (37 %; p < 0,001). L’élévation de la TA a été observée chez 30 % des adultes de plus de 15 ans, ce taux étant supérieur parmi les patients de sexe masculin (38 %; p < 0,001) et originaires d’Europe (42 %; p < 0,001). Les marqueurs biologiques

CTC Sentinel. Volume 3, Issue 1, January 2010. The Facade of Allegiance: Bin Ladin’s Dubious Pledge to Mullah Omar

DTIC Science & Technology

2010-01-01

Academy, the Department of the Army, or any other agency of the U.s. Government. C o M B A T I n G T E R R o R I s M C E n T E R A T W E s T...p o I n T o B j E C T I V E . R E L E V A n T . R I G o R o U s CTC SeNTiNeL Usama bin Ladin explains why he declared jihad against the United...Taliban professed today by al- Qa`ida and its Pakistan-based allies— including the Haqqani network and Tehrik- i -Taliban Pakistan (TTP)—is more a

31P T2s of phosphomonoesters, phosphodiesters, and inorganic phosphate in the human brain at 7T

PubMed Central

Klomp, Dennis W.J.; Wijnen, Jannie P.

2017-01-01

Purpose To determine the phosphorus‐31 T2s of phosphomonoesters, phosphodiesters, and inorganic phosphate in the healthy human brain at 7T. Methods A 3D chemical shift imaging multi‐echo sequence with composite block pulses for refocusing was used to measure one free induction decay (FID) and seven full echoes with an echo spacing of 45 ms on the brain of nine healthy volunteers (age range 22–45 years; average age 27 ± 8 years). Spectral fitting was used to determine the change in metabolic signal amplitude with echo time. Results The average apparent T2s with their standard deviation were 202 ± 6 ms, 129 ± 6 ms, 86 ± 2 ms, 214 ± 10 ms, and 213 ± 11 ms for phosphoethanolamine, phosphocholine, inorganic phosphate, glycerophosphoethanolamine, and glycerophosphocholine, respectively. Conclusion The determined apparent T2 for phosphoethanolamine, glycerophosphocholine, and glycerophosphoethanolamine is approximately 200 ms. The lower apparent T2 value for phosphocholine is attributed to the overlap of this resonance with the 3‐phosphorous resonance of 2,3‐diphosphoglycerate from blood, with an apparent shorter T2. Omitting the FID signal and the first echo of phosphocholine leads to a T2 of 182 ± 7 ms, whereas a biexponential analysis leads to 203 ± 4 ms. These values are more in line with phosphoethanolamine and the phosphodiesters. The short T2 of inorganic phosphate is subscribed to the fast reversible exchange with γ‐adenosine triphosphate, which is mediated by glyceraldehyde‐3‐phosphate dehydrogenase and phosphoglycerate kinase within the glycolytic pathway. Magn Reson Med 80:29–35, 2018. © 2017 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution NonCommercial License, which permits use, distribution and reproduction in any

Statistics on Aircraft Gas Turbine Engine Rotor Failures That Occurred in U.S Commercial Aviation During 1988.

DTIC Science & Technology

1992-03-01

1.7 5.1 RB211 384 1.2638 3 0 8 11 2.4 0.0 6.3 8.7 PW2037/2040 192 0.4090 7 1 3 11 17.1 2.4 7.3 26.8 SPEY 860 0.2774 1 1 2 4 63.6 3.6 7.2 14.4 TFE731 ...L382 501D22 T N 3 N 4 S-881017278 MRKA L382 501D22 C N 3 N 3 S-890207092 MRKA L382 501D22 C N 3 N 10 S-880112116 WP15 HS1257 TFE731 T B 7 C 4 S...880211030 EA21 LEAR35 TFE731 T B 7 C 5 S-880411043 EA21 LEAR36 TFE731 T B 7 C 1 S-880628013 EA17 BAE128 TFE731 T B 7 C 4 S-880906154 GL23 FALCON50 TFE731 T B

America’s Air Force, The Future Calls: An Evidentiary and Theoretical Analysis Of The Roles And Missions Of A USAF Astronaut Corps

DTIC Science & Technology

2016-06-01

wT0S8qQLCOqh. ; Keith Wagstaff, “ Elon Musk Says SpaceX Will Send People to Mars By 2025,” NBC News, 29 January 2016, Accessed 22 February 2016...http://www.nbcnews.com/tech/tech-news/ elon - musk -says-spacex-will-send-people- mars-2025-n506891. 76. “About Mars One,” Mars-One.com, 2016, Accessed 22...January 2014. Accessed 22 February 2016. https://www.stratcom.mil/factsheets/11/Space_Control_and_Space_Surveillan ce/. Wagstaff, Keith. “ Elon Musk Says

U.S. EPA, Pesticide Product Label, LONZA BARDAC - 205M, 05/22/1990

EPA Pesticide Factsheets

2011-04-14

... If s.illo .... i"".di.hly ,i •• 3-4 ,hHts .f .ilt; if ..... ... O. lOt ;nduCI .'MiliA,. CH I • "ys ic i ••. ... It is •• i,liti'l ,I ftdtril liN t, .St t'is ,r,d.ct il • • , •• r inc •• sist.,t Kit' itl 1 ••• li.,. ...

E-selectin S128R polymorphism and severe coronary artery disease in Arabs

PubMed Central

Abu-Amero, Khaled K; Al-Boudari, Olayan M; Mohamed, Gamal H; Dzimiri, Nduna

2006-01-01

Background The E-selectin p. S128R (g. A561C) polymorphism has been associated with the presence of angiographic coronary artery disease (CAD) in some populations, but no data is currently available on its association with CAD in Arabs. Methods In the present study, we determined the potential relevance of the E-selectin S128R polymorphism for severe CAD and its associated risk factors among Arabs. We genotyped Saudi Arabs for this polymorphism by PCR, followed by restriction enzyme digestion. Results The polymorphism was determined in 556 angiographically confirmed severe CAD patients and 237 control subjects with no CAD as established angiographically (CON). Frequencies of the S/S, S/R and R/R genotypes were found as 81.1%, 16.6% and 2.3% in CAD patients and 87.8%, 11.8%, and 0.4% in CON subjects, respectively. The frequency of the mutant 128R allele was higher among CAD patients compared to CON group (11% vs. 6%; odds ratio = 1.76; 95% CI 1.14 – 2.72; p = .007), thus indicating a significant association of the 128R allele with CAD among our population. However, the stepwise logistic regression for the 128R allele and different CAD risk factors showed no significant association. Conclusion Among the Saudi population, The E-selectin p. S128R (g. A561C) polymorphism was associated with angiographic CAD in Univariate analysis, but lost its association in multivariate analysis. PMID:16756647

Photo - Apollo/Saturn (A/S)-11 w/Flotation Collar Secured - Ship's Hoist

NASA Image and Video Library

1969-01-01

S69-20086 (13 March 1969) --- The Apollo 9 Command Module (CM), with flotation collar still attached, is hoisted aboard the prime recovery ship, USS Guadalcanal, during recovery operations. The Apollo 9 crew, astronauts James A. McDivitt, David R. Scott, and Russell L. Schweickart, had already been picked up earlier by helicopter and flown to the dock of the carrier. Splashdown occurred at 12:00:53 p.m. (EST), March 13, 1969, only 4.5 nautical miles from the aircraft carrier, to conclude a successful 10-day Earth-orbital space mission.

11. Photocopy of photograph, U.S. Army, ca. 1943 (original print ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Photocopy of photograph, U.S. Army, ca. 1943 (original print located at Rocky Mountain Arsenal, Commerce City, Colorado). R.M.A. - 433 - ETHYLENE GENERATOR BLDG. LOOKING EAST. - Rocky Mountain Arsenal, Ethylene Generator-R & D Laboratory, December Seventh Avenue & D Street, Commerce City, Adams County, CO

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

14818A Lance Missile Number 4587, Round Number 390 APL, 22 September 1983.

DTIC Science & Technology

1983-09-22

CLASS. (of *1,1. repe) US Army Electronics Research and Development Cmd Adeiphi, MD 20783 UNCLASSIFIED I[Ck. DCASFICATION/ODOWNGRADING IS. OISTRIBUT10ON...STATEMENT (of dhii Repoil 17. DISTRIBUTION STATEMENT (olth bsrn.bocl ente,.d i Block S.If efl .,i~ lai, Xope Approved for public release; distribution...W 0-.O w a. z zA z 0 .z0 . -4 4NA w0 o o ?o ?II nf "pvos r- 0 -t 17. .4 o Dmn a L1 .J N0 f 4 .oyp A-nN 01 , ;< jOiZ 0 , -r -r 43, a. A If co 6n Ox -0AJ

Niobium in R And (S6, 6e) and HR 1105 (S5, 3)

NASA Astrophysics Data System (ADS)

Davis, D. N.

Lines of the first multiplet of niobium are strong in R And and HR 1105. These lines are also present in other S stars: HR 8714, R Cam, V Cnc, R CMi, and T Sgr. They are also visible in the M stars, Beta-Peg and Mu-UMa. An approximation to the abundance ratio, Nb/Fe, has been deduced from pairs of lines having nearly equal intensity. In R And, the ratio is about 200 times the solar value. It is hoped that good plates will soon be obtained for the near infrared region, so that the significant Nb/Rb abundance ratio may be determined.

T. S. Eliot: A Collection of Critical Essays. Twentieth Century Views Series.

ERIC Educational Resources Information Center

Kenner, Hugh, Ed.

One of a series of works aimed at presenting contemporary critical opinion on major authors, this collection includes essays by Arthur Mizener, Wyndham Lewis, Hugh Kenner, R. P. Blackmur, Elizabeth Sewell, S. Musgrove, George L. K. Morris, F. R. Leavis, D. W. Harding, Allen Tate, Ezra Pound, William Empson, John Peter, Denis Donoghue, and Donald…

11 CFR 111.22 - Ex parte communications.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Ex parte communications. 111.22 Section 111.22 Federal Elections FEDERAL ELECTION COMMISSION GENERAL COMPLIANCE PROCEDURE (2 U.S.C. 437g, 437d(a... and any attorney or staff member of the Office of General Counsel in the course of representing the...

China’s ASAT Test: Motivations and Implications

DTIC Science & Technology

2007-01-01

h i l l i P c . S a u n D e r S and c h a r l e S D . l u t e S Dr. Phillip C. saunders and Colonel Charles D. Lutes, UsaF, are senior Research...at <www.aviationweek.com/aw/generic/story_generic. jsp?channel= awst &id=news/aw012207p2.xml>. 11 Chris Buckley, “China confirms satellite test, says

Differences in the Mechanism of the Allosteric L-Rhamnose Responses of the AraC/XylS Family Transcription Activators RhaS and RhaR

PubMed Central

Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.

2008-01-01

SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439

The constitutional t(11;22): implications for a novel mechanism responsible for gross chromosomal rearrangements

PubMed Central

Kurahashi, H; Inagaki, H; Ohye, T; Kogo, H; Tsutsumi, M; Kato, T; Tong, M; Emanuel, BS

2012-01-01

The constitutional t(11;22)(q23;q11) is the most common recurrent non-Robertsonian translocation in humans. The breakpoint sequences of both chromosomes are characterized by several hundred base pairs of palindromic AT-rich repeats (PATRRs). Similar PATRRs have also been identified at the breakpoints of other nonrecurrent translocations, suggesting that PATRR-mediated chromosomal translocation represents one of the universal pathways for gross chromosomal rearrangement in the human genome. We propose that PATRRs have the potential to form cruciform structures through intrastrand-base pairing in single-stranded DNA, creating a source of genomic instability and leading to translocations. Indeed, de novo examples of the t(11;22) are detected at a high frequency in sperm from normal healthy males. This review synthesizes recent data illustrating a novel paradigm for an apparent spermatogenesis-specific translocation mechanism. This observation has important implications pertaining to the predominantly paternal origin of de novo gross chromosomal rearrangements in humans. PMID:20507342

Cloning and characterization of an 11S legumin, Car i 4, a major allergen in pecan.

PubMed

Sharma, Girdhari M; Irsigler, Andre; Dhanarajan, Pushparani; Ayuso, Rosalia; Bardina, Luda; Sampson, Hugh A; Roux, Kenneth H; Sathe, Shridhar K

2011-09-14

Among tree nut allergens, pecan allergens remain to be identified and characterized. The objective was to demonstrate the IgE-binding ability of pecan 11S legumin and characterize its sequential IgE-binding epitopes. The 11S legumin gene was amplified from a pecan cDNA library and expressed as a fusion protein in Escherichia coli. The native 11S legumin in pecan extract was identified by mass spectrometry/mass spectrometry (MS/MS). Sequential epitopes were determined by probing the overlapping peptides with three serum pools prepared from different patients' sera. A three-dimensional model was generated using almond legumin as a template and compared with known sequential epitopes on other allergenic tree nut homologues. Of 28 patients tested by dot blot, 16 (57%) bound to 11S legumin, designated Car i 4. MS/MS sequencing of native 11S legumin identified 33 kDa acidic and 20-22 kDa basic subunits. Both pecan and walnut seed protein extracts inhibited IgE binding to recombinant Car i 4, suggesting cross-reactivity with Jug r 4. Sequential epitope mapping results of Car i 4 revealed weak, moderate, and strong reactivity of serum pools against 10, 5, and 4 peptides, respectively. Seven peptides were recognized by all three serum pools, of which two were strongly reactive. The strongly reactive peptides were located in three discrete regions of the Car i 4 acidic subunit sequence (residues 118-132, 208-219, and 238-249). Homology modeling of Car i 4 revealed significant overlapping regions shared in common with other tree nut legumins.

"D.L.&W. R.R. New Bergen Tunnel...Detail of Portal Masonry..." Plan Sheet. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

"D.L.&W. R.R. New Bergen Tunnel...Detail of Portal Masonry..." Plan Sheet. Revised December 22, 1906. On file at New Jersey Transit Corporation Headquarters, Newark, New Jersey - Delaware, Lackawanna & Western Railroad, South Bergen Tunnel, Jersey City, Hudson County, NJ

16S-23S rRNA gene internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Porphyromonas.

PubMed

Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C

2005-03-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.

Calorimetric Measurements of Laser Energy and Power- 1975 Supplement

DTIC Science & Technology

1975-07-30

Institute of Electrical Engineers, London, 1964), Paper 40, pp. 1-7. 22. D.E. Killick, D.A. Bateman, D.R. Brown, T.S. Moss, and E.T. de la Perrelle...J.L. Macqueron and A. Nouailhat, Les Developpements Recents de la Microcalorimetrie et de la Thermogenese (Centre National de la Recherche...Abstr. 11, 33 (1974). 181. W.R. Blevin and W.J. Brown, Metrologia 7, 15 (1971). -20- 182. R.J. von Gutfeld, Appl. Phys. Lett. 23, 206 (1973). 183

Voices of Chinese Post-­80s Students in English Academic Writing

ERIC Educational Resources Information Center

Que, Hua; Li, Xuemei

2015-01-01

This study looks into the changing voice of Chinese Post-80s' students in English academic writing. Data were collected qualitatively through interviews with four Chinese Post-80s overseas graduate students and through an examination of their English essays with a focus on discursive features. Findings indicate that Chinese Post-80s' voice is…

Complex rearranged small supernumerary marker chromosomes (sSMC), three new cases; evidence for an underestimated entity?

PubMed Central

Trifonov, Vladimir; Fluri, Simon; Binkert, Franz; Nandini, Adayapalam; Anderson, Jasen; Rodriguez, Laura; Gross, Madeleine; Kosyakova, Nadezda; Mkrtchyan, Hasmik; Ewers, Elisabeth; Reich, Daniela; Weise, Anja; Liehr, Thomas

2008-01-01

Background Small supernumerary marker chromosomes (sSMC) are present ~2.6 × 106 human worldwide. sSMC are a heterogeneous group of derivative chromosomes concerning their clinical consequences as well as their chromosomal origin and shape. Besides the sSMC present in Emanuel syndrome, i.e. der(22)t(11;22)(q23;q11), only few so-called complex sSMC are reported. Results Here we report three new cases of unique complex sSMC. One was a de novo case with a dic(13 or 21;22) and two were maternally derived: a der(18)t(8;18) and a der(13 or 21)t(13 or 21;18). Thus, in summary, now 22 cases of unique complex sSMC are available in the literature. However, this special kind of sSMC might be under-diagnosed among sSMC-carriers. Conclusion More comprehensive characterization of sSMC and approaches like reverse fluorescence in situ hybridization (FISH) or array based comparative genomic hybridization (array-CGH) might identify them to be more frequent than only ~0.9% among all sSMC. PMID:18471318

Status and Future of the Naval R&D Establishment

DTIC Science & Technology

2010-09-23

Market mostly here C u w e s t c o s t Global Allies Quadrant...Becoming more important and threatening L o w Free Market • Requires new mechanisms to handle 17 Framework for Assessment Implications S li Bupp er ase...t c o s t B a s e Corner: • Use sparingly Other US military US H i g u s t o m e r B • Prioritize rigorously Government US Market C u

75 FR 7044 - T&S Hardwoods, Inc., Sylva, NC; Notice of Negative Determination Regarding Application for...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-16

... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,783] T&S Hardwoods, Inc., Sylva, NC; Notice of Negative Determination Regarding Application for Reconsideration By application... production of hardwood lumber from the subject facility to a foreign country. T&S Hardwoods, Inc. did not...

75 FR 41237 - Public Land Order No. 7746; Withdrawal of Public Lands, South Fork of the American River; California

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-15

... the American River: Mount Diablo Meridian T. 11 N., R. 9 E., Sec. 10, NW\\1/4\\NW\\1/4\\ and S\\1/2\\; Sec...\\,SW\\1/4\\, and SE\\1/4\\; Sec. 32, N\\1/2\\NE\\1/4\\, SW\\1/4\\NE\\1/4\\, W\\1/2\\, and S\\1/2\\SE\\1/ 4\\. T. 11 N., R. 10 E., Sec. 18, lots 5, 6, and 7, and NW\\1/4\\NE\\1/4\\NW\\1/4\\; Sec. 22, NW\\1/4\\SE\\1/4\\SW\\1/4\\, and that...

Texturation à froid sous contraintes triaxiales de phase à haute T_c de Bi(Pb)SrCaCuO préréagie

NASA Astrophysics Data System (ADS)

Langlois, P.; Massat, H.; Suryanarayanan, R.

1994-11-01

The alignment of grains in isostatically precompacted samples of prereacted Bi{1,8}Pb{0,4}Sr{2,0}Ca{2,2}Cu{3,0}O{10,3 + x} powder has been achieved by compressive plastic deformation under isostatic pressure at room temperature. Isostatic pressures were in the range 0.1 to 1 GPa and deformation rates were led up to 57 %. Prior to sintering, X-ray diffraction measurements corroborate an expected high- T_c phase purity of nearly 85 % and indicate that the as-deformed samples have been textured with the (c-axes parallel to the pressing direction whilst a.c. susceptibility measurements ascertain a high transition temperature around 107 K. Intergranular connection does not occur until sintering at 850 ^{circ}C for 80 h and measurements indicate then that the texture has been retained. Superconducting properties themselves show sensitivity to texture through anisotropy-related distinctive irreversibility lines. L'alignement de grains de poudre Bi{1,8}Pb{0,4}Sr{2,0}Ca{2,2}Cu{3,0}O{10,3 + x} préréagie a été réalisé par déformation plastique à température ambiante d'échantillons précompactés isostatiquement et comprimés sous pression isostatique, la gamme des pressions isostatiques allant de 0,1 à 1 GPa et les taux de déformation atteignant 57 %. Les mesures de diffraction de rayons X corroborent la pureté de phase à haute T_c proche de 85 % attendue et indiquent que les échantillons ainsi déformés ont été texturés avec les plans ab perpendiculaires à la direction de compression. Les mesures de susceptibilité alternative avèrent une température élevée de transition à environ 107 K mais la connexion intergranulaire n'est assurée qu'après un frittage à 850 ^{circ}C pendant 80 h dont on vérifie qu'il conserve la texture. Enfin, la sensibilité des propriétés supraconductrices à la texturation est évaluée par le biais de lignes d'irréversibilité distinctes en fonction de l'anisotropie.

"D.L.&W. R.R. New Bergen Tunnel...Detail of Open Cut Masonry..." Plan ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

"D.L.&W. R.R. New Bergen Tunnel...Detail of Open Cut Masonry..." Plan Sheet. Revised December 22, 1906. On file at New Jersey Transit Corporation Headquarters, Newark, New Jersey - Delaware, Lackawanna & Western Railroad, South Bergen Tunnel, Jersey City, Hudson County, NJ

U.S. EPA, Pesticide Product Label, MBC CONCENTRATE SOIL FUMIGANT, 08/25/1998

EPA Pesticide Factsheets

2011-04-21

... (,,10011 eqlllpl\\\\elll rnll~1 w{)lkt'l& 01 .lIIIHI','.,ull""'" "IILi j>1{!\\'I ... r u""W,h!)(\\ 11);\\y 1!'(\\\\pnl~lI\\y 1.11'>t\\ Ihe IIwl'l 01 ammG!l(a I'\\I\\fogel'\\ 900 r ...

Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

PubMed

Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

2004-07-16

In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

U.S. EPA, Pesticide Product Label, SEVIN 5% DUST, 11/19/1981

EPA Pesticide Factsheets

2011-04-21

... "e;;t~~i~:i'·:,~r:.;~. eT~;:': i:, .O~~~:~J It;;;'"lh~''I~;.rP:~,~: t;~~ ';JI.~~ n>nl~ .nd "',"'nlll frU'1 m"lh KPI>I .. d( 1',",41 r.11 and .""rv II) to 14 ...

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

PubMed

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

Purification, characterization and crystallization of the human 80S ribosome

PubMed Central

Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

2014-01-01

Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

U.S. EPA, Pesticide Product Label, DACAMINE 2D/2T, 10/22/1971

EPA Pesticide Factsheets

2011-04-14

... tt.di ... _ .. ___ It is J ·s oM .. c.MeI ..... oM..,,. II j1:.~ .. oec" •• _n." .• . _ ' •. II .... , Ii' .. • . ef'""" III'" 'ItJill'I' ,..llbi.1 ..... t _ II II ..... tIIue .... . ...

Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

ERIC Educational Resources Information Center

Guan, Min-Xin

2005-01-01

The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

North-South S and T gap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moghadam, A.A.

1985-01-01

The objectives of this study were (1) to demonstrate the existence of the science and technology (S and T) gap between developed countries (DCs) or the north, and less developed countries (LDCs) or the south; (2) to test the hypothesis that there exists a critical mass with respect to population, gross domestic product (GDP), per capita income, and literacy rate below which S and T development is insignificant; and (3) to recommend possible remedial actions for reducing this gap. The research comprises a thorough review of the existing literature, and an extensive analysis of 1976-78 and 1980-82 statistics for 66more » countries, presenting a global picture of the S and T gap in the free world. A comprehensive account was given of the S and T status for Britain, Germany, United States, Japan, Brazil, Mexico, South Korea, Hong Kong, Singapore, Taiwan, Egypt, and Nigeria. A plot of S and T indicators versus independent variables for the 66 counties clearly indicated the existence of the North-South S and T gap. The test of the critical hypothesis, using t distribution, revealed that population size does not have a significant impact on the development or deployment of S and T. This test with respect to GDP indicated that greater GDPs would facilitate the progress of S and T. The results for per capita income were similar. Adequate infrastructure had the greatest impact on absorption, deployment, and maintenance of S and T for development. It was also indicated that with literacy rates below 40% no significant S and T activity can be expected.« less

75 FR 41104 - Airworthiness Directives; Robinson Helicopter Company (Robinson) Model R22, R22 Alpha, R22 Beta...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-15

...-0711; Directorate Identifier 2008-SW-25-AD] RIN 2120-AA64 Airworthiness Directives; Robinson Helicopter Company (Robinson) Model R22, R22 Alpha, R22 Beta, and R22 Mariner Helicopters, and Model R44, and R44 II...). SUMMARY: This document proposes adopting a new airworthiness directive (AD) for Robinson Model R22, R22...

Tryptophan W207 in transducin T alpha is the fluorescence sensor of the G protein activation switch and is involved in the effector binding.

PubMed Central

Faurobert, E; Otto-Bruc, A; Chardin, P; Chabre, M

1993-01-01

We have produced a recombinant transducin alpha subunit (rT alpha) in sf9 cells, using a baculovirus system. Deletion of the myristoylation site near the N-terminal increased the solubility and allowed the purification of rT alpha. When reconstituted with excess T beta gamma on retinal membrane, rT alpha displayed functional characteristics of wild-type T alpha vis à vis its coupled receptor, rhodopsin and its effector, cGMP phosphodiesterase (PDE). We further mutated a tryptophan, W207, which is conserved in all G proteins and is suspected to elicit the fluorescence change correlated to their activation upon GDP/GTP exchange or aluminofluoride (AlFx) binding. [W207F]T alpha mutant displayed high affinity receptor binding and underwent a conformational switch upon receptor-catalysed GTP gamma S binding or upon AlFx binding, but this did not elicit any fluorescence change. Thus W207 is the only fluorescence sensor of the switch. Upon the switch the mutant remained unable to activate the PDE. To characterize better its effector-activating interaction we measured the affinity of [W207F]T alpha GDP-AlFx for PDE gamma, the effector subunit that binds most tightly to T alpha. [W207F]T alpha still bound in an activation-dependent way to PDE gamma, but with a 100-fold lower affinity than rT alpha. This suggests that W207 contributes to the G protein effector binding. Images PMID:8223434

The Tetrahedral Zamolodchikov Algebra and the {AdS_5× S^5} S-matrix

NASA Astrophysics Data System (ADS)

Mitev, Vladimir; Staudacher, Matthias; Tsuboi, Zengo

2017-08-01

The S-matrix of the {AdS_5× S^5} string theory is a tensor product of two centrally extended su{(2|2)\\ltimes R^2 S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the {AdS_5× S^5} S-matrix.

Andromeda’s Parachute: A Bright Quadruply Lensed Quasar at z = 2.377

NASA Astrophysics Data System (ADS)

Rubin, Kate H. R.; O’Meara, John M.; Cooksey, Kathy L.; Matuszewski, Mateusz; Rizzi, Luca; Doppmann, Greg; Kwok, Shui; Martin, D. Christopher; Moore, Anna M.; Morrissey, Patrick; Neill, James D.

2018-06-01

We present Keck Cosmic Web Imager spectroscopy of the four putative images of the lensed quasar candidate J014710+463040 recently discovered by Berghea et al. The data verify the source as a quadruply lensed, broad absorption-line quasar having {z}{{S}}=2.377 +/- 0.007. We detect intervening absorption in the Fe II λλ2586, 2600, Mg II λλ2796, 2803, and/or C IV λλ1548, 1550 transitions in eight foreground systems, three of which have redshifts consistent with the photometric-redshift estimate reported for the lensing galaxy (z L ≈ 0.57). The source images probe these absorbers over transverse physical scales of ≈0.3–22 kpc, permitting assessment of the variation in metal-line equivalent width {W}{{r}} as a function of sight-line separation. We measure differences in {W}{{r},2796} of <40% across most of the sight-line pairs subtending 8–22 kpc, suggestive of a high degree of spatial coherence for the Mg II-absorbing material. {W}{{r},2600} varies by >50% over the same scales across the majority of sight-line pairs, while C IV absorption exhibits a wide range in {W}{{r},1548} differences of ≈5%–80% within transverse distances of ≲3 kpc. These spatial variations are consistent with those measured in intervening absorbers detected toward lensed quasars drawn from the literature, in which {W}{{r},2796} and {W}{{r},1548} vary by ≤20% in 35 ± 7% and 47 ± 6% of sight lines separated by <10 kpc, respectively. J014710+463040 is one of only a handful of z > 2 quadruply lensed systems for which all four source images are very bright (r = 15.4–17.7 mag) and are easily separated in ground-based seeing conditions. As such, it is an ideal candidate for higher-resolution spectroscopy probing the spatial variation in the kinematic structure and physical state of intervening absorbers.

Construction of halide-bridged tungsten-copper-sulfide double cubanelike clusters from a new precursor [(Tp*WS2)2(μ-S2)].

PubMed

Wei, Li-Pei; Ren, Zhi-Gang; Zhu, Lian-Wen; Yan, Wen-Yan; Sun, Sha; Wang, Hui-Fang; Lang, Jian-Ping; Sun, Zhen-Rong

2011-05-16

Treatment of [Et(4)N][Tp*WS(3)] (1) (Tp* = hydridotris(3,5-dimethylpyrazol-1-yl)borate) with 2 equiv of AgSCN in MeCN afforded a novel neutral compound [(Tp*WS(2))(2)(μ-S(2))] (2). Reactions of 2 with excess CuX (X = Cl, Br, I) in MeCN and CH(2)Cl(2) or CHCl(3) formed three neutral W/Cu/S clusters [{Tp*W(μ(3)-S)(3)Cu(3)(μ-Cl)}(2)Cu(μ-Cl)(2)(μ(7)-Cl)(MeCN)](2) (3), [{Tp*W(μ(3)-S)(3)Cu(3)}(2)Br(μ-Br)(2)(μ(4)-Br)(MeCN)] (4), and [{Tp*W(μ(3)-S)(3)Cu(3)}(2){Cu(2)(μ-I)(4)(μ(3)-I)(2)}] (5), respectively. On the other hand, treatment of 2 with CuX (X = Cl, Br) in the presence of Et(4)NX (X = Cl, Br) produced two anionic W/Cu/S clusters [Et(4)N][{Tp*W(μ(3)-S)(3)Cu(3)X}(2)(μ-X)(2)(μ(4)-X)] (6: X = Cl; 7 X = Br). Compounds 2-7 were characterized by elemental analysis, IR, UV-vis, (1)H NMR, electrospray ionization (ESI) mass spectra, and single-crystal X-ray crystallography. The dimeric structure of 2 can be viewed as two [Tp*WS(2)] fragments in which two W atoms are connected by one S(2)(2-) dianion. Compounds 3-7 all possess unique halide-bridged double cubanelike frameworks. For 3, two [Tp*W(μ(3)-S)(3)Cu(3)](2+) dications are linked via a μ(7)-Cl(-) bridge, two μ-Cl(-) bridges, and a [Cu(MeCN)(μ-Cl)(2)](+) bridge. For 4, one [Tp*W(μ(3)-S)(3)Cu(3)(MeCN)](2+) dication and one [Tp*W(μ(3)-S)(3)Cu(3)Br](+) cation are linked via a μ(4)-Br(-) and two μ-Br(-) bridges. For 5, the two [Tp*W(μ(3)-S)(3)Cu(3)](2+) dications are bridged by a linear [(μ-I)(2)Cu(μ(3)-I)(2)Cu(μ-I)(2)](4+) species. For 6 and 7, two [Tp*W(μ(3)-S)(3)Cu(3)X](+) cations are linked by a μ(4)-X(-) and two μ-X(-) bridges (X = Cl, Br). In addition, the third-order nonlinear optical (NLO) properties of 2-7 in MeCN/CH(2)Cl(2) were investigated by using femtosecond degenerate four-wave mixing (DFWM) technique.

11 CFR 100.11 - State (2 U.S.C. 431(12)).

Code of Federal Regulations, 2010 CFR

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false State (2 U.S.C. 431(12)). 100.11 Section 100.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) General Definitions § 100.11 State (2 U.S.C. 431(12)). State means each State of the United States, the District of...

The lipodystrophic hotspot lamin A p.R482W mutation deregulates the mesodermal inducer T/Brachyury and early vascular differentiation gene networks.

PubMed

Briand, Nolwenn; Guénantin, Anne-Claire; Jeziorowska, Dorota; Shah, Akshay; Mantecon, Matthieu; Capel, Emilie; Garcia, Marie; Oldenburg, Anja; Paulsen, Jonas; Hulot, Jean-Sebastien; Vigouroux, Corinne; Collas, Philippe

2018-04-15

The p.R482W hotspot mutation in A-type nuclear lamins causes familial partial lipodystrophy of Dunnigan-type (FPLD2), a lipodystrophic syndrome complicated by early onset atherosclerosis. Molecular mechanisms underlying endothelial cell dysfunction conferred by the lamin A mutation remain elusive. However, lamin A regulates epigenetic developmental pathways and mutations could perturb these functions. Here, we demonstrate that lamin A R482W elicits endothelial differentiation defects in a developmental model of FPLD2. Genome modeling in fibroblasts from patients with FPLD2 caused by the lamin A R482W mutation reveals repositioning of the mesodermal regulator T/Brachyury locus towards the nuclear center relative to normal fibroblasts, suggesting enhanced activation propensity of the locus in a developmental model of FPLD2. Addressing this issue, we report phenotypic and transcriptional alterations in mesodermal and endothelial differentiation of induced pluripotent stem cells we generated from a patient with R482W-associated FPLD2. Correction of the LMNA mutation ameliorates R482W-associated phenotypes and gene expression. Transcriptomics links endothelial differentiation defects to decreased Polycomb-mediated repression of the T/Brachyury locus and over-activation of T target genes. Binding of the Polycomb repressor complex 2 to T/Brachyury is impaired by the mutated lamin A network, which is unable to properly associate with the locus. This leads to a deregulation of vascular gene expression over time. By connecting a lipodystrophic hotspot lamin A mutation to a disruption of early mesodermal gene expression and defective endothelial differentiation, we propose that the mutation rewires the fate of several lineages, resulting in multi-tissue pathogenic phenotypes.

75 FR 71532 - Airworthiness Directives; Robinson Helicopter Company (Robinson) Model R22, R22 Alpha, R22 Beta...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-24

... Airworthiness Directives; Robinson Helicopter Company (Robinson) Model R22, R22 Alpha, R22 Beta, and R22 Mariner... rule. SUMMARY: This amendment adopts a new airworthiness directive (AD) for Robinson Model R22, R22... Robinson Helicopter Company, 2901 Airport Drive, Torrance, California 90505, telephone (310) 539-0508, fax...

Single-step synthesis of a new series of meso di-Mannich bases from the cyclic aminal (2S,7R,11S,16R)-1,8,10,17-tetraazapentacyclo[8.8.1.1.8,170.2,7011,16]icosane and p-substituted phenols

PubMed Central

2013-01-01

Background The results presented herein show that the cyclic aminal (2S,7R,11S,16R)-1,8,10,17-tetraazapentacyclo[8.8.1.1.8,170.2,7011,16]icosane (6), derived from cis-(meso)-1,2-diaminocyclohexane and formaldehyde, is a suitable substrate for the preption of a series of cis-meso Mannich bases such as 8a-l by reaction with p-substituted phenols 7a-l in basic media. These compounds are valuable synthetic products and may find application in asymmetric catalysis. Results The products were characterized principally by NMR and IR spectroscopy. Both the benzylic and aminalic protons of the perhydrobenzimidazolidine moiety were diastereotopic due to the presence of stereogenic nitrogen centers. The occurrence of intramolecular hydrogen bonding interactions was confirmed by the broad OH stretching vibration band in the IR spectra. Vibrational spectra were calculated using B3LYP at 6-31G(d,p) level, and the calculated frequencies for the νOH vibrations were compared to those of the experimental spectra. Hydrogen bonding interactions in the solid state were observed through the X-ray crystallography of 8j. Additionally, Mulliken charges and Fukui indices for 6 were calculated as theoretical descriptors of electrophilicity. Conclusion A new series of meso Mannich bases called 4,4′-disubstituted-2,2′-{[(3aR,7aS)-2,3,3a,4,5,6,7,7a-octahydro-1H-1,3-benzimidazole-1,3-diyl]bis(methylene)} diphenols (8a-l) which are derived from cis-(meso)-1,2-diaminocyclohexane, were obtained from cyclic aminal 6. These results confirmed the behavior of 6 as an electrophilic preformed reagent in Mannich reactions in basic media. PMID:23758899

A de novo sSMC(22) Characterized by High-Resolution Arrays in a Girl with Cat-Eye Syndrome without Coloboma.

PubMed

Córdova-Fletes, C; Domínguez, M G; Vázquez-Cárdenas, A; Figuera, L E; Neira, V A; Rojas-Martínez, A; Ortiz-López, R

2012-09-01

Cat-eye syndrome (CES) results from trisomy or tetrasomy of proximal 22q originated by a small supernumerary marker chromosome (sSMC). Two critical regions for the major clinical features of CES (CESCRs) have been suggested; however, CES clinical presentation often does not correlate with the sSMC genetic content. We report here a CES girl without coloboma and carrier of a de novo type I sSMC(22) as determined by G- and C-banding, NOR staining and microarrays. This sSMC included 6 distal genes outside the original CESCR and led to a tetrasomy for 22q11.1-22q11.21. The patient's final karyotype was 47,XX,+psu dic(22)(q11.21).arr 22q11.1q11.21(15,250,000-17,035,860)×4 dn. The amplified region outside of CESCR included some genes that may be related to neurologic, heart and renal abnormalities. Conversely, even though the amplification included the CECR2 gene, a major candidate for eye features, there was no coloboma in the patient. The genetic delineation of the present sSMC further strengthens that the CES clinical presentation does not fit completely with the duplicated genetic content and that CES is actually a genomic disorder. Furthermore, since we observed no mosaicism, we believe that other mechanisms might be behind the variability of CES phenotypes as well, mainly those related with functional interactions among amplified genes.

IL-23 Receptor (IL-23R) Gene Protects Against Pediatric Crohn’s Disease

PubMed Central

Dubinsky, Marla C.; Wang, Dai; Picornell, Yoana; Wrobel, Iwona; Katzir, Lirona; Quiros, Antonio; Dutridge, Debra; Wahbeh, Ghassan; Silber, Gary; Bahar, Ron; Mengesha, Emebet; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.

2007-01-01

Background The IL-23 receptor (IL-23R) has been found to be associated with small bowel Crohn’s disease (CD) in a whole genome association study. Specifically, the rare allele of the R381Q single nucleotide polymorphism (SNP) conferred protection against CD. It is unknown whether IL-23R is associated with IBD in children. The aim was to examine the association of IL-23R with susceptibility to IBD in pediatric patients. Methods DNA was collected from 609 subjects (151 CD and 52 ulcerative colitis [UC] trios). Trios were genotyped for the R381Q SNP of the IL-23R gene and SNP8, SNP12, SNP13, of the CARD15 gene using Taqman. The transmission disequilibrium test (TDT) was used for association to disease using GENEHUNTER 2.0. Results The rare allele of R381Q SNP was present in 2.7% of CD and 2.9% UC probands. The CARD15 frequency was 31.5% (CD) and 18% (UC). The IL-23R allele was negatively associated with inflammatory bowel disease (IBD): the R381Q SNP was undertransmitted in children with IBD (8 transmitted [T] versus 27 untransmitted [UT]; P = 0.001). This association was significant for all CD patients (6 T versus 19 UT; P = 0.009), especially for non-Jewish CD patients (2 T versus 17 UT; P = 0.0006). TDT showed a borderline association for UC (2 T versus 8 UT; P = 0.06). As expected, CARD15 was associated with CD in children by the TDT (58 T versus 22 UT P = 0.00006), but not with UC. Conclusions The protective IL-23R R381Q variant was particularly associated with CD in non-Jewish children. Thus, the initial whole genome association study based on ileal CD in adults has been extended to the pediatric population and beyond small bowel CD. PMID:17309073

Elektroninės cigaretės: naujas būdas mesti rūkyti ar nauja grėsmė?

PubMed Central

Aleknaitė, Aistė; Andrijauskaitė, Monika; Latauskienė, Justė; Andrejevaitė, Viktorija

2016-01-01

Nuo 2010 m. tarp suaugusiųjų ir paauglių išaugo elektroninių cigarečių vartojimas. Dauguma el. cigarečių vartotojų anksčiau yra rūkę tradicinius tabako gaminius. Didžioji dalis žmonių el. cigaretes suvokia kaip priemonę, padėsiančią mesti rūkyti ar sumažinti surūkomų įprastinių cigarečių kiekį. Elektroninės cigaretės yra prietaisas, susidedantis iš skysčiu užpildytos kasetės, kaitiklio bei baterijos. Nuspaudus mygtuką įjungiamas kaitiklis, kuris šildo skystį, o, šiam tapus garais, jie įkvepiami. Visų rūšių el. skysčių pagrindinės sudedamosios dalys yra glicerolis arba propileno glikolis, papildomai gali būti pridedama nikotino ir / ar aromatų. Skysčiuose taip pat nustatyta įvairių kitų cheminių medžiagų. Ilgalaikio el. cigarečių vartojimo pasekmės sveikatai nėra išaiškintos, manoma, kad jos turėtų būti saugesnės nei rūkyti įprastines cigaretes. Nėra pakankamai ištirtas el. cigarečių skysčiuose esančių medžiagų toksiškumas. Trūksta duomenų apie el. cigarečių, kaip pagalbinės priemonės norint mesti rūkyti, veiksmingumą ir saugumą. Gydytojas norinčiam mesti rūkyti pacientui pirmiausia turėtų pasiūlyti patvirtintas pakaitinės nikotino terapijos ar kitas pagalbines priemones ir užtikrinti, kad pacientas gautų informaciją apie naujausius medikamentus, galinčius jam padėti. Jei pacientas atsisako šių priemonių ir renkasi el. cigaretes, gydytojas turėtų informuoti apie abejotiną jų saugumą ir veiksmingumą. Visuomenėje kyla susirūpinimas, kad el. cigarečių rūkymas gali paskatinti priklausomybę nikotinui ir padidinti norą išbandyti įprastines cigaretes. Nerimą kelia ir neapribotas el. cigarečių vartojimas viešosiose vietose. Nėra žinoma, kokią įtaką aplinkinių sveikatai gali turėti pasyvus garinimas. El. cigarečių reglamentavimas visame pasaulyje skiriasi ir laikui bėgant kinta. PMID:28356791

Measurement of the t $$\\bar{t}$$ Cross-Section Using the Dimuon Channel in p$$\\bar{p}$$ Collisions at √s = 1.96-TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCroskey, Robert Crampton

2004-01-01

The author has measured the tmore » $$\\bar{t}$$ production cross section at √s = 1.96 TeV using data collected by the D0 experiment at Fermilab. The integrated luminosity of the data set is 140 pb -1 and a total of four candidate events are seen, with an expected background of 2.61 events. The measured cross section of σ t$$\\bar{t}$$ = 11.1$$+22.1\\atop{-9.3}$$(stat.)$$+4.3\\atop{-4.5}$$(sys.) pb is in agreement with a NNLO calculation of 6.77 pb.« less

[Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia].

PubMed

Dzhemileva, L U; Posukh, O L; Tazetdinov, A M; Barashkov, N A; Zhuravskiĭ, S G; Ponidelko, S N; Markova, T G; Tadinova, V N; Fedorova, S A; Maksimova, N R; Khusnutdinova, E K

2009-07-01

Mitochondrial DNA (mtDNA) mutations play an important role in etiology of hereditary hearing loss. In various regions of the world, patients suffer from nonsyndromic sensorineural hearing loss initiated by aminoglycoside antibiotics. Mutations that had been shown as pathogenetically important for hearing function disturbance were identified in mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes while pathogenic role of several DNA sequences requires additional studies. This work presents the results of studying the spectrum of mutations and polymorphic variations in mtDNA genes 12S rRNA and tRNA(Ser(UGN)) in 410 patients with nonsyndromal sensoneural hearing impairment/loss from the Volga Ural region, St Petersburg, Yakutia, and Altai and in 520 individuals with normal hearing, which represent several ethnic groups (Russians, Tatars, Bashkirs, Yakuts, Altaians) residing in the Russian Federation. Pathogenetically significant mutation A1555G (12S rRNA) was found in two families (from Yakutia and St Peresburg) with hearing loss, probably caused by treatment with aminoglucosides, and in the population sample of Yakuts with a frequency of 0.83%. Further research is needed to confirm the role in hearing impairment of mutations 961insC, 961insC(n), 961delTinsC(n), T961G, T1095C (12S rRNA) and G7444A, A7445C (tRNA(Ser(UGN revealed in the patients. In addition, in the patients and the population groups, polymorphic mt DNA variants were detected, which are characteristic also of other Eurasian populations both in spectrum and frequency.

Neuroprotective Activity of (1S,2E,4R,6R,-7E,11E)-2,7,11-cembratriene-4,6-diol (4R) in vitro and in vivo in Rodent Models of Brain Ischemia

PubMed Central

Xu, Zhenfeng; Mu, Chaofeng; Alvarez, Paloma; Ford, Byron D.; El Sayed, Khalid; Eterovic, Vesna A.; Ferchmin, Pedro A.; Hao, Jiukuan

2015-01-01

(1S,2E,4R,6R,-7E,11E)-2,7,11-cembratriene-4,6-diol (4R) is a precursor to key flavor ingredients in leaves of Nicotiana species. The present study shows 4R decreased brain damage in rodent ischemic stroke models. The 4R-pretreated mice had lower infarct volume (26.2±9.7 mm3) than those in control groups (untreated: 63.4±4.2 mm3, DMSO: 60.2±14.2 mm3). The 4R-posttreated rats also had less infarct volume (120±65 mm3) than those in the rats of DMSO group (291±95 mm3). The results from in vitro experiments indicate that 4R decreased neuro2a cells (neuroblastoma cells) apoptosis induced by oxygen glucose deprivation (OGD), and improved the population spikes (PSs) recovery in rat acute hippocampal slices under OGD; a phosphatidylinositol 3-kinase (PI3K) inhibitor, wortmannin, abolished the effect of 4R on PSs recovery. Furthermore, 4R also inhibited monocyte adhesion to bEND5 cells (murine brain-derived endothelial cells) and upregulation of intercellular adhesion molecule-1(ICAM-1) induced by OGD/reoxygenation (OGD/R), and restored the p-Akt level to pre-OGD/R values in bEND5 cells. In conclusion, the present study indicates that 4R has a protective effect in rodent ischemic stroke models. Inhibition of ICAM-1 expression and restoration of Akt phosphorylation are the possible mechanisms involved in cellular protection by 4R. PMID:25677097

Assessing the relative potency of (S)- and (R)-warfarin with a new PK-PD model, in relation to VKORC1 genotypes.

PubMed

Ferrari, Myriam; Pengo, Vittorio; Barolo, Massimiliano; Bezzo, Fabrizio; Padrini, Roberto

2017-06-01

The purpose of this study is to develop a new pharmacokinetic-pharmacodynamic (PK-PD) model to characterise the contribution of (S)- and (R)-warfarin to the anticoagulant effect on patients in treatment with rac-warfarin. Fifty-seven patients starting warfarin (W) therapy were studied, from the first dose and during chronic treatment at INR stabilization. Plasma concentrations of (S)- and (R)-W and INRs were measured 12, 36 and 60 h after the first dose and at steady state 12-14 h after dosing. Patients were also genotyped for the G>A VKORC1 polymorphism. The PK-PD model assumed a linear relationship between W enantiomer concentration and INR and included a scaling factor k to account for a different potency of (R)-W. Two parallel compartment chains with different transit times (MTT 1 and MTT 2 ) were used to model the delay in the W effect. PD parameters were estimated with the maximum likelihood approach. The model satisfactorily described the mean time-course of INR, both after the initial dose and during long-term treatment. (R)-W contributed to the rac-W anticoagulant effect with a potency of about 27% that of (S)-W. This effect was independent of VKORC1 genotype. As expected, the slope of the PK/PD linear correlation increased stepwise from GG to GA and from GA to AA VKORC1 genotype (0.71, 0.90 and 1.49, respectively). Our PK-PD linear model can quantify the partial pharmacodynamic activity of (R)-W in patients contemporaneously exposed to therapeutic (S)-W plasma levels. This concept may be useful in improving the performance of future algorithms aiming at identifying the most appropriate W maintenance dose.

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Narrowing the DiGeorge Region (DGCR) using DGS-VCFS associated translocation breakpoints

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, M.; Budarf, M.L.; Sellinger, B.

1994-09-01

The initial evidence linking 22q11 with DiGeorge syndrome (DGS) came from identification of DGS patients with unbalanced translocations resulting in loss of 22pter{r_arrow}q11. Molecular detection of 22q11.2 deletions in over 85% of our DGS and VCFS patient population confirms the role of 22q11 haploinsufficiency in the etiology of these two disorders. In the present study, DGS/VCFS-associated translocations are used to further refine the DGS minimal critical region. We obtained previously described cell lines: GM5878 [t(10;22)], GM5401 [t(4;22)], GM0980 [t(11;22)], and LGL6012 [t(20;22)]. Lymphoblastoid cell lines were established from two new unbalanced translocations, [t(15;22)(p11;q11)] and [t(12;22)(p13.31;q11.2)] and from a family withmore » balanced and unbalanced forms of a t(X;22)(p22.31;q11). All probands are missing 22pter{r_arrow}q11 and have mild dysmorphia, short stature, frequent infections and developmental delay. Cleft palate was also seen in the two sibs resulting from malsegregation of the t(X;22)mat. These seven breakpoints were positioned by FISH utilizing cosmids from 22q11.2. The cosmids include the loci D22S75 (N25), D22S66 (160b), and D22S259 (R32) which we have previously used to define the DGS/VCFS commonly deleted region. The t(12;22) and t(20;22) breakpoints map distal to R32. Four translocation breakpoints map between N25 and R32: CEN - N25 - t(15;22) - t(11;22) - t(10;22) - 160b - t(4;22) - R32 - TEL. The t(X;22) breakpoint lies between the proximal flanking locus D22S36 (pH11) and N25, suggesting that genes critical to the phenotype may lie between these markers. However, the der(X) is inactivated in both sibs, raising the possibility that spreading of inactivation to the translocated, 22-derived segment may silence gene(s) distal to the breakpoint. Thus, the DGCR has been narrowed to a region between D22S36 and the t(15;22) breakpoint. This enables us to narrow the search for the critical gene(s) deleted in patients with DGS and

Addendum 1, to Resource Conservation and Recovery Act (RCRA) Facility Investigation R Report for IRP Sites Number’s 17, 18, 19 and 21. Volume 2. Appendices A-L. 148th Fighter Group, Minnesota Air National Guard Duluth Air National Guard Base, Duluth, Minnesota.

DTIC Science & Technology

1996-03-01

1224 1-3:8 AMLSSa IS j 57D .J.q IN1TE~RNAL rEriP 31 OL’LL’Tr, RNGS 2.1- 2.3 us PH0P HOTOU9n POOUl ST’lF3. -ý ED= rAwiAE SEr T .2Er.t SAM’PLE LISR !ARr...I JUL 23 133,2 12:22 IN TERNA5L Tr • ? 𔃽 OULU T , ir1Q4G G I g (M L LIRRYIImrPLE LIBRARY I JUL 22 1.1-, 12,12 ARNILE LISR /RT 2 JUL 221 2-3. 1211.3...0 =UP ACI i-ITrEN 1 31212. 2 rI𔃼 aS,~~ -102.5 100.2 rro SAMLE LISR PRY I JUL 23 ISlt 19252 PNL SIs a 2 1 J BYRD, JR. 1r•T RNAL TEIP 235 PULUTM RriGs

DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kellner, Markus; Rohrmoser, Michaela; Forné, Ignasi

PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extendedmore » form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.« less

Mycobacterium tuberculosis PstS1 amplifies IFN-γ and induces IL-17/IL-22 responses by unrelated memory CD4+ T cells via dendritic cell activation.

PubMed

Palma, Carla; Schiavoni, Giovanna; Abalsamo, Laura; Mattei, Fabrizio; Piccaro, Giovanni; Sanchez, Massimo; Fernandez, Carmen; Singh, Mahavir; Gabriele, Lucia

2013-09-01

The immunological mechanisms that modulate protection during Mycobacterium tuberculosis (Mtb) infection or vaccination are not fully understood. Secretion of IFN-γ and, to a lesser extent, of IL-17 by CD4(+) T cells plays a major role both in protection and immunopathology. Few Mtb Ags interacting with DCs affect priming, activation, and regulation of Ag-unrelated CD4(+) T-cell responses. Here we demonstrate that PstS1, a 38 kDa-lipoprotein of Mtb, promotes Ag-independent activation of memory T lymphocytes specific for Ag85B or Ag85A, two immunodominant protective Ags of Mtb. PstS1 expands CD4(+) and CD8(+) memory T cells, amplifies secretion of IFN-γ and IL-22 and induces IL-17 production by effector memory cells in an Ag-unrelated manner in vitro and in vivo. These effects were mediated through the stimulation of DCs, particularly of the CD8α(-) subtype, which respond to PstS1 by undergoing phenotypic maturation and by secreting IL-6, IL-1β and, to a lower extent, IL-23. IL-6 secretion by PstS1-stimulated DCs was required for IFN-γ, and to a lesser extent for IL-22 responses by Ag85B-specific memory T cells. These results may open new perspectives for immunotherapeutic strategies to control Th1/Th17 immune responses in Mtb infections and in vaccinations against tuberculosis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Determination of Breit-Wigner features of the S{sub 11}(1535), S{sub 11}(1650), and P{sub 11}(1710) nucleon resonances

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balandina, E. V., E-mail: lena@kiraton.sinp.msu.ru; Leikin, E. M.; Yudin, N. P.

2008-01-15

Basic Breit-Wigner features of the S{sub 11}(1535), S{sub 11}(1650), and P{sub 11}(1710) nucleon resonances are evaluated in a model-independent way on the basis of the results obtained previously from a partial-wave analysis of eta-meson photoproduction on protons.

33 CFR 80.1495 - U.S. Pacific Island Possessions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Island Possessions of American Samoa, Baker, Howland, Jarvis, Johnson, Palmyra, Swains and Wake Islands... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false U.S. Pacific Island Possessions... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Islands § 80.1495 U.S. Pacific Island...

33 CFR 80.1495 - U.S. Pacific Island Possessions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Island Possessions of American Samoa, Baker, Howland, Jarvis, Johnson, Palmyra, Swains and Wake Islands... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false U.S. Pacific Island Possessions... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Islands § 80.1495 U.S. Pacific Island...

33 CFR 80.1495 - U.S. Pacific Island Possessions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Island Possessions of American Samoa, Baker, Howland, Jarvis, Johnson, Palmyra, Swains and Wake Islands... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false U.S. Pacific Island Possessions... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Islands § 80.1495 U.S. Pacific Island...

33 CFR 80.1495 - U.S. Pacific Island Possessions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Island Possessions of American Samoa, Baker, Howland, Jarvis, Johnson, Palmyra, Swains and Wake Islands... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false U.S. Pacific Island Possessions... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Islands § 80.1495 U.S. Pacific Island...

33 CFR 80.1495 - U.S. Pacific Island Possessions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Island Possessions of American Samoa, Baker, Howland, Jarvis, Johnson, Palmyra, Swains and Wake Islands... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false U.S. Pacific Island Possessions... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Islands § 80.1495 U.S. Pacific Island...

Report of the Hydrographic Service, Royal Australian Navy for the Year Ended 30th June 1987, Issue Number 23.

DTIC Science & Technology

1987-01-01

0- 67°30"S aa S..we1 Rocks HYDROGRAPHIC OFFICE DETACHED SURVEY UNIT APPROACHES TO MAWSON FEBRUARY 1967 Welch I$Lwl 1 25000 1 10000 PLATE XVII / J 0 0i...AD-A19S 765 REPOROF THE HYJRGJAPHIC ’ERICE AOYAl AUSTRALIAN 1/1 NAIJ H N ( VAL A SgALIAN NYY NY NO ElAR1989 DA- t_ u rADE ~, j 111.0IIW~=~ ’ W 22 Z.1...Services Chart Production and Maintenance In Chart Distribution II Records and Libra. .............. .. . ......... . I S u rv e y S u p p o r t

R1 in the Shaker S4 occupies the gating charge transfer center in the resting state

PubMed Central

Lin, Meng-chin A.; Hsieh, Jui-Yi; Mock, Allan F.

2011-01-01

During voltage-dependent activation in Shaker channels, four arginine residues in the S4 segment (R1–R4) cross the transmembrane electric field. It has been proposed that R1–R4 movement is facilitated by a “gating charge transfer center” comprising a phenylalanine (F290) in S2 plus two acidic residues, one each in S2 and S3. According to this proposal, R1 occupies the charge transfer center in the resting state, defined as the conformation in which S4 is maximally retracted toward the cytoplasm. However, other evidence suggests that R1 is located extracellular to the charge transfer center, near I287 in S2, in the resting state. To investigate the resting position of R1, we mutated I287 to histidine (I287H), paired it with histidine mutations of key voltage sensor residues, and determined the effect of extracellular Zn2+ on channel activity. In I287H+R1H, Zn2+ generated a slow component of activation with a maximum amplitude (Aslow,max) of ∼56%, indicating that only a fraction of voltage sensors can bind Zn2+ at a holding potential of −80 mV. Aslow,max decreased after applying either depolarizing or hyperpolarizing prepulses from −80 mV. The decline of Aslow,max after negative prepulses indicates that R1 moves inward to abolish ion binding, going beyond the point where reorientation of the I287H and R1H side chains would reestablish a binding site. These data support the proposal that R1 occupies the charge transfer center upon hyperpolarization. Consistent with this, pairing I287H with A359H in the S3–S4 loop generated a Zn2+-binding site. At saturating concentrations, Aslow,max reached 100%, indicating that Zn2+ traps the I287H+A359H voltage sensor in an absorbing conformation. Transferring I287H+A359H into a mutant background that stabilizes the resting state significantly enhanced Zn2+ binding at −80 mV. Our results strongly support the conclusion that R1 occupies the gating charge transfer center in the resting conformation. PMID:21788609

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda