In silico identification of novel kinase inhibitors targeting wild-type and T315I mutant ABL1 from FDA-approved drugs.

PubMed

Xu, Huai-long; Wang, Zi-jie; Liang, Xiao-meng; Li, Xin; Shi, Zheng; Zhou, Nan; Bao, Jin-ku

2014-06-01

The constitutively active fusion protein BCR-ABL1 is the major cause of chronic myeloid leukemia (CML), and selective inhibition of ABL1 is a promising approach for the treatment of CML. Reported drugs worked well in clinical practice, such as imatinib, dasatinib, nilotinib and bosutinib. However, resistance arises due to ABL1 mutation in patients, especially the T315I gate-keeper mutation. Thus, wide spectrum drugs targeting ABL1 are urgently needed. In order to screen potential drugs targeting wild-type ABL1 and T315I mutant ABL1, 1408 FDA approved small molecule drugs were subjected to molecular docking. With subsequent molecular dynamic (MD) simulation and MM/GBSA binding free energy calculation and energy decomposition, we identified chlorhexidine and sorafenib as potential "new use" drugs targeting wild-type ABL1, while nicergoline and plerixafor targeted T315I ABL1. Meanwhile, we also found that residues located in the ATP-binding site and A-loop motif played key roles in drug discovery towards ABL1. These findings may not only serve as a paradigm for the repositioning of existing approved drugs, but also instill new vitality to ABL1-targeted anti-CML therapeutics.

The use of Imatinib resistance mutation analysis to direct therapy in Philadelphia chromosome/BCR-ABL1 positive chronic myeloid leukaemia patients failing Imatinib treatment, in Patan Hospital, Nepal.

PubMed

Kayastha, Gyan K; Ranjitkar, Nora; Gurung, Radha; Kc, Raj Kumar; Karki, Sanjit; Shrestha, Roshan; Rajbhandari, Piyush; Thapa, Raj K; Poudyal, Buddhi; Acharya, Paras; Roberts, David J; Hayes, Bruce; Zimmerman, Mark; Basnyat, Buddha

2017-06-01

Philadelphia chromosome/BCR-ABL1 positive chronic myeloid leukaemia (CML) can be successfully treated with Glivec (Imatinib), which is available free of cost through the Glivec International Patient Assistance programme (GIPAP) to patients with proven CML without means to pay for the drug. We review the acquired mutations in the tyrosine kinase encoded by the BCR-ABL1 gene underlying Glivec failure or resistance in a cohort of 388 imatinib-treated CML patients (149 Female and 239 male) registered between February 2003 and June 2016 in Nepal. Forty-five patients (11 female 34 male) were studied; 18 different BCR-ABL1 mutations were seen in 33 patients. P-loop mutation, Kinase domain and A-loop mutations were seen in 9, 16 and 4 patients respectively. Other mutations were seen in five patients. A T315I mutation was the most common mutation, followed by F359V and M244V. Sixteen mutations showed intermediate activity to complete resistance to Glivec. Among the 45 patients evaluated for BCR-ABL1 mutations, 4 were lost to follow-up, 14 died and 27 are still alive. Among the surviving patients, 16 are receiving Nilotinib, 5 Dasatinib and 3 Ponatinib, while 3 patients were referred to India, one of who received allogenic bone marrow transplantation. Understanding the spectrum of further acquired mutations in BCR-ABL1 may help to choose more specific targeted tyrosine kinase inhibitors that can be provided by GIPAP. © 2017 John Wiley & Sons Ltd.

BCR-ABL1 mutation development during first-line treatment with dasatinib or imatinib for chronic myeloid leukemia in chronic phase.

PubMed

Hughes, T P; Saglio, G; Quintás-Cardama, A; Mauro, M J; Kim, D-W; Lipton, J H; Bradley-Garelik, M B; Ukropec, J; Hochhaus, A

2015-09-01

BCR-ABL1 mutations are a common, well-characterized mechanism of resistance to imatinib as first-line treatment of chronic myeloid leukemia in chronic phase (CML-CP). Less is known about mutation development during first-line treatment with dasatinib and nilotinib, despite increased use because of higher response rates compared with imatinib. Retrospective analyses were conducted to characterize mutation development in patients with newly diagnosed CML-CP treated with dasatinib (n=259) or imatinib (n=260) in DASISION (Dasatinib versus Imatinib Study in Treatment-Naive CML-CP), with 3-year minimum follow-up. Mutation screening, including patients who discontinued treatment and patients who had a clinically relevant on-treatment event (no confirmed complete cytogenetic response (cCCyR) and no major molecular response (MMR) within 12 months; fivefold increase in BCR-ABL1 with loss of MMR; loss of CCyR), yielded a small number of patients with mutations (dasatinib, n=17; imatinib, n=18). Dasatinib patients had a narrower spectrum of mutations (4 vs 12 sites for dasatinib vs imatinib), fewer phosphate-binding loop mutations (1 vs 9 mutations), fewer multiple mutations (1 vs 6 patients) and greater occurrence of T315I (11 vs 0 patients). This trial was registered at www.clinicaltrials.gov as NCT00481247.

Identification of Bisindolylmaleimide IX as a potential agent to treat drug-resistant BCR-ABL positive leukemia

PubMed Central

Liu, Huijuan; Zang, Yi; Azam, Mohammad; Habib, Samy L.; Li, Jia; Ruan, Xinsen; Jia, Hao; Wang, Xueying; Li, Baojie

2016-01-01

Chronic myeloid leukemia (CML) treatment with BCR-ABL inhibitors is often hampered by development of drug resistance. In a screen for novel chemotherapeutic drug candidates with genotoxic activity, we identified a bisindolylmaleimide derivative, IX, as a small molecule compound with therapeutic potential against CML including drug-resistant CML. We show that Bisindolylmaleimide IX inhibits DNA topoisomerase, generates DNA breaks, activates the Atm-p53 and Atm-Chk2 pathways, and induces cell cycle arrest and cell death. Interestingly, Bisindolylmaleimide IX is highly effective in targeting cells positive for BCR-ABL. BCR-ABL positive cells display enhanced DNA damage and increased cell cycle arrest in response to Bisindolylmaleimide IX due to decreased expression of topoisomerases. Cells positive for BCR-ABL or drug-resistant T315I BCR-ABL also display increased cytotoxicity since Bisindolylmaleimide IX inhibits B-Raf and the downstream oncogene addiction pathway. Mouse cancer model experiments showed that Bisindolylmaleimide IX, at doses that show little side effect, was effective in treating leukemia-like disorders induced by BCR-ABL or T315I BCR-ABL, and prolonged the lifespan of these model mice. Thus, Bisindolylmaleimide IX presents a novel drug candidate to treat drug-resistant CML via activating BCR-ABL-dependent genotoxic stress response and inhibiting the oncogene addiction pathway activated by BCR-ABL. PMID:27564101

Combined inhibition of β-catenin and Bcr-Abl synergistically targets tyrosine kinase inhibitor-resistant blast crisis chronic myeloid leukemia blasts and progenitors in vitro and in vivo.

PubMed

Zhou, H; Mak, P Y; Mu, H; Mak, D H; Zeng, Z; Cortes, J; Liu, Q; Andreeff, M; Carter, B Z

2017-10-01

Tyrosine kinase inhibitor (TKI) resistance and progression to blast crisis (BC), both related to persistent β-catenin activation, remain formidable challenges for chronic myeloid leukemia (CML). We observed overexpression of β-catenin in BC-CML stem/progenitor cells, particularly in granulocyte-macrophage progenitors, and highest among a novel CD34 + CD38 + CD123 hi Tim-3 hi subset as determined by CyTOF analysis. Co-culture with mesenchymal stromal cells (MSCs) induced the expression of β-catenin and its target CD44 in CML cells. A novel Wnt/β-catenin signaling modulator, C82, and nilotinib synergistically killed KBM5 T315I and TKI-resistant primary BC-CML cells with or without BCR-ABL kinase mutations even under leukemia/MSC co-culture conditions. Silencing of β-catenin by short interfering RNA restored sensitivity of primary BCR-ABL T315I/E255V BC-CML cells to nilotinib. Combining the C82 pro-drug, PRI-724, with nilotinib significantly prolonged the survival of NOD/SCID/IL2Rγ null mice injected with primary BCR-ABL T315I/E255V BC-CML cells. The combined treatment selectively targeted CML progenitors and inhibited CD44, c-Myc, survivin, p-CRKL and p-STAT5 expression. In addition, pretreating primary BC-CML cells with C82, or the combination, but not with nilotinib alone, significantly impaired their engraftment potential in NOD/SCID/IL2Rγ-null-3/GM/SF mice and significantly prolonged survival. Our data suggest potential benefit of concomitant β-catenin and Bcr-Abl inhibition to prevent or overcome Bcr-Abl kinase-dependent or -independent TKI resistance in BC-CML.

The transcription factor IRF8 counteracts BCR-ABL to rescue dendritic cell development in chronic myelogenous leukemia.

PubMed

Watanabe, Tomoya; Hotta, Chie; Koizumi, Shin-ichi; Miyashita, Kazuho; Nakabayashi, Jun; Kurotaki, Daisuke; Sato, Go R; Yamamoto, Michio; Nakazawa, Masatoshi; Fujita, Hiroyuki; Sakai, Rika; Fujisawa, Shin; Nishiyama, Akira; Ikezawa, Zenro; Aihara, Michiko; Ishigatsubo, Yoshiaki; Tamura, Tomohiko

2013-11-15

BCR-ABL tyrosine kinase inhibitors (TKI) have dramatically improved therapy for chronic myelogenous leukemia (CML). However, several problems leading to TKI resistance still impede a complete cure of this disease. IFN regulatory factor-8 (IRF8) is a transcription factor essential for the development and functions of immune cells, including dendritic cells. Irf8(-/-) mice develop a CML-like disease and IRF8 expression is downregulated in patients with CML, suggesting that IRF8 is involved in the pathogenesis of CML. In this study, by using a murine CML model, we show that BCR-ABL strongly inhibits a generation of dendritic cells from an early stage of their differentiation in vivo, concomitant with suppression of Irf8 expression. Forced expression of IRF8 overrode BCR-ABL (both wild-type and T315I-mutated) to rescue dendritic cell development in vitro, indicating that the suppression of Irf8 causes dendritic cell deficiency. Gene expression profiling revealed that IRF8 restored the expression of a significant portion of BCR-ABL-dysregulated genes and predicted that BCR-ABL has immune-stimulatory potential. Indeed, IRF8-rescued BCR-ABL-expressing dendritic cells were capable of inducing CTLs more efficiently than control dendritic cells. Altogether, our findings suggest that IRF8 is an attractive target in next-generation therapies for CML. ©2013 AACR

Ascorbate/menadione-induced oxidative stress kills cancer cells that express normal or mutated forms of the oncogenic protein Bcr-Abl. An in vitro and in vivo mechanistic study.

PubMed

Beck, Raphaël; Pedrosa, Rozangela Curi; Dejeans, Nicolas; Glorieux, Christophe; Levêque, Philippe; Gallez, Bernard; Taper, Henryk; Eeckhoudt, Stéphane; Knoops, Laurent; Calderon, Pedro Buc; Verrax, Julien

2011-10-01

Numerous studies suggest that generation of oxidative stress could be useful in cancer treatment. In this study, we evaluated, in vitro and in vivo, the antitumor potential of oxidative stress induced by ascorbate/menadione (asc/men). This combination of a reducing agent (ascorbate) and a redox active quinone (menadione) generates redox cycling leading to formation of reactive oxygen species (ROS). Asc/men was tested in several cell types including K562 cells (a stable human-derived leukemia cell line), freshly isolated leukocytes from patients with chronic myeloid leukemia, BaF3 cells (a murine pro-B cell line) transfected with Bcr-Abl and peripheral blood leukocytes derived from healthy donors. Although these latter cells were resistant to asc/men, survival of all the other cell lines was markedly reduced, including the BaF3 cells expressing either wild-type or mutated Bcr-Abl. In a standard in vivo model of subcutaneous tumor transplantation, asc/men provoked a significant delay in the proliferation of K562 and BaF3 cells expressing the T315I mutated form of Bcr-Abl. No effect of asc/men was observed when these latter cells were injected into blood of mice most probably because of the high antioxidant potential of red blood cells, as shown by in vitro experiments. We postulate that cancer cells are more sensitive to asc/men than healthy cells because of their lack of antioxidant enzymes, mainly catalase. The mechanism underlying this cytotoxicity involves the oxidative cleavage of Hsp90 with a subsequent loss of its chaperone function thus leading to degradation of wild-type and mutated Bcr-Abl protein.

The Functional Interplay Between the t(9;22)-Associated Fusion Proteins BCR/ABL and ABL/BCR in Philadelphia Chromosome-Positive Acute Lymphatic Leukemia

PubMed Central

Rafiei, Anahita; Mian, Afsar Ali; Döring, Claudia; Metodieva, Anna; Oancea, Claudia; Thalheimer, Frederic B.; Hansmann, Martin Leo; Ottmann, Oliver Gerhard; Ruthardt, Martin

2015-01-01

The hallmark of Philadelphia chromosome positive (Ph+) leukemia is the BCR/ABL kinase, which is successfully targeted by selective ATP competitors. However, inhibition of BCR/ABL alone is unable to eradicate Ph+ leukemia. The t(9;22) is a reciprocal translocation which encodes not only for the der22 (Philadelphia chromosome) related BCR/ABL, but also for der9 related ABL/BCR fusion proteins, which can be detected in 65% of patients with chronic myeloid leukemia (CML) and 100% of patients with Ph+ acute lymphatic leukemia (ALL). ABL/BCRs are oncogenes able to influence the lineage commitment of hematopoietic progenitors. Aim of this study was to further disclose the role of p96ABL/BCR for the pathogenesis of Ph+ ALL. The co-expression of p96ABL/BCR enhanced the kinase activity and as a consequence, the transformation potential of p185BCR/ABL. Targeting p96ABL/BCR by RNAi inhibited growth of Ph+ ALL cell lines and Ph+ ALL patient-derived long-term cultures (PD-LTCs). Our in vitro and in vivo stem cell studies further revealed a functional hierarchy of p96ABL/BCR and p185BCR/ABL in hematopoietic stem cells. Co-expression of p96ABL/BCR abolished the capacity of p185BCR/ABL to induce a CML-like disease and led to the induction of ALL. Taken together our here presented data reveal an important role of p96ABL/BCR for the pathogenesis of Ph+ ALL. PMID:25919613

Molecular dynamics reveal BCR-ABL1 polymutants as a unique mechanism of resistance to PAN-BCR-ABL1 kinase inhibitor therapy

PubMed Central

Gibbons, Don L.; Pricl, Sabrina; Posocco, Paola; Laurini, Erik; Fermeglia, Maurizio; Sun, Hanshi; Talpaz, Moshe; Donato, Nicholas; Quintás-Cardama, Alfonso

2014-01-01

The acquisition of mutations within the BCR-ABL1 kinase domain is frequently associated with tyrosine kinase inhibitor (TKI) failure in chronic myeloid leukemia. Sensitive sequencing techniques have revealed a high prevalence of compound BCR-ABL1 mutations (polymutants) in patients failing TKI therapy. To investigate the molecular consequences of such complex mutant proteins with regards to TKI resistance, we determined by cloning techniques the presence of polymutants in a cohort of chronic-phase patients receiving imatinib followed by dasatinib therapy. The analysis revealed a high frequency of polymutant BCR-ABL1 alleles even after failure of frontline imatinib, and also the progressive exhaustion of the pool of unmutated BCR-ABL1 alleles over the course of sequential TKI therapy. Molecular dynamics analyses of the most frequent polymutants in complex with TKIs revealed the basis of TKI resistance. Modeling of BCR-ABL1 in complex with the potent pan-BCR-ABL1 TKI ponatinib highlighted potentially effective therapeutic strategies for patients carrying these recalcitrant and complex BCR-ABL1 mutant proteins while unveiling unique mechanisms of escape to ponatinib therapy. PMID:24550512

Influence of BCR/ABL fusion proteins on the course of Ph leukemias.

PubMed

Telegeev, Gennady D; Dubrovska, Anna N; Dybkov, Mykhaylo V; Maliuta, Stanislav S

2004-01-01

The hallmark of chronic myeloid leukemia (CML) and a subset of acute lymphoblastic leukemia (ALL) is the presence of the Philadelphia chromosome as a result of the t(9;22) translocation. This gene rearrangement results in the production of a novel oncoprotein, BCR/ABL, a constitutively active tyrosine kinase. There is compelling evidence that the malignant transformation by BCR/ABL is critically dependent on its Abl tyrosine kinase activity. Also the bcr part of the hybrid gene takes part in realization of the malignant phenotype. We supposed that additional mutations accumulate in this region of the BCR/ABL oncogene during the development of the malignant blast crisis in CML patients. In ALL patients having p210 fusion protein the mutations were supposed to be preexisting. Sequencing of PCR product of the BCR/ABL gene (Dbl, PH region) showed that along with single-nucleotide substitutions other mutations, mostly deletions, had occurred. In an ALL patient a deletion of the 5th exon was detected. The size of the deletions varied from 36 to 220 amino acids. For one case of blast crisis of CML changes in the character of actin organization were observed. Taking into account the functional role of these domains in the cell an etiological role of such mutations on the disease phenotype and leukemia progression is plausible.

Critical roles for mTORC2- and rapamycin-insensitive mTORC1-complexes in growth and survival of BCR-ABL-expressing leukemic cells

PubMed Central

Carayol, Nathalie; Vakana, Eliza; Sassano, Antonella; Kaur, Surinder; Goussetis, Dennis J.; Glaser, Heather; Druker, Brian J.; Donato, Nicholas J.; Altman, Jessica K.; Barr, Sharon; Platanias, Leonidas C.

2010-01-01

mTOR-generated signals play critical roles in growth of leukemic cells by controlling mRNA translation of genes that promote mitogenic responses. Despite extensive work on the functional relevance of rapamycin-sensitive mTORC1 complexes, much less is known on the roles of rapamycin-insensitive (RI) complexes, including mTORC2 and RI-mTORC1, in BCR-ABL-leukemogenesis. We provide evidence for the presence of mTORC2 complexes in BCR-ABL-transformed cells and identify phosphorylation of 4E-BP1 on Thr37/46 and Ser65 as RI-mTORC1 signals in primary chronic myelogenous leukemia (CML) cells. Our studies establish that a unique dual mTORC2/mTORC1 inhibitor, OSI-027, induces potent suppressive effects on primitive leukemic progenitors from CML patients and generates antileukemic responses in cells expressing the T315I-BCR-ABL mutation, which is refractory to all BCR-ABL kinase inhibitors currently in clinical use. Induction of apoptosis by OSI-027 appears to negatively correlate with induction of autophagy in some types of BCR-ABL transformed cells, as shown by the induction of autophagy during OSI-027-treatment and the potentiation of apoptosis by concomitant inhibition of such autophagy. Altogether, our studies establish critical roles for mTORC2 and RI-mTORC1 complexes in survival and growth of BCR-ABL cells and suggest that dual therapeutic targeting of such complexes may provide an approach to overcome leukemic cell resistance in CML and Ph+ ALL. PMID:20616057

CT-721, a Potent Bcr-Abl Inhibitor, Exhibits Excellent In Vitro and In Vivo Efficacy in the Treatment of Chronic Myeloid Leukemia

PubMed Central

Sun, Yinghui; Zhao, Na; Wang, Huan; Wu, Qiong; Han, Yunqi; Liu, Qichao; Wu, Mangang; Liu, Yuliang; Kong, Fansheng; Wang, He; Sun, Ying; Sun, Deguang; Jing, Lutao; Tang, Guojing; Hu, Yuandong; Xiao, Dengming; Luo, Hong; Han, Yongxin; Peng, Yong

2017-01-01

Kinase inhibitors that target Bcr-Abl are highly effective in the treatment of chronic myeloid leukemia (CML). However, these inhibitors are often invalidated due to the drug resistance. Therefore, the discovery and development of novel Bcr-Abl inhibitors is required to overwhelm the drug resistance in the treatment of CML resistant to the currently used first-line Bcr-Abl inhibitors. Herein we have described a newly developed Bcr-Abl inhibitor CT-721, which displayed potent inhibitory effects on wild-type and T315I mutant Bcr-Abl. It functioned as a typically ATP-competitive inhibitor, superior to other existing Bcr-Abl inhibitors. CT-721 also demonstrated time-dependent inhibition of Bcr-Abl activation and the resultant downstream signaling transduction pathways in Bcr-Abl positive cells. Furthermore, CT-721 induced cell apoptosis and cell cycle arrest, and efficaciously inhibited tumor growth in Bcr-Abl-expressed K562 and KU812 xenograft models in a mechanism-based manner. Further PK/PD studies revealed a positive in vivo correlation between the compound concentration and inhibition of Bcr-Abl activity. Taken together, CT-721 is a potent and time-dependent Bcr-Abl kinase inhibitor, and has shown strong in vitro and in vivo anti-CML activities with a favorable pharmacokinetic profile, differentiating it from other Bcr-Abl kinase inhibitors already approved and current in development for the treatment of CML. PMID:28928866

Targeting BCR-ABL-Independent TKI Resistance in Chronic Myeloid Leukemia by mTOR and Autophagy Inhibition.

PubMed

Mitchell, Rebecca; Hopcroft, Lisa E M; Baquero, Pablo; Allan, Elaine K; Hewit, Kay; James, Daniel; Hamilton, Graham; Mukhopadhyay, Arunima; O'Prey, Jim; Hair, Alan; Melo, Junia V; Chan, Edmond; Ryan, Kevin M; Maguer-Satta, Véronique; Druker, Brian J; Clark, Richard E; Mitra, Subir; Herzyk, Pawel; Nicolini, Franck E; Salomoni, Paolo; Shanks, Emma; Calabretta, Bruno; Holyoake, Tessa L; Helgason, G Vignir

2018-05-01

Imatinib and second-generation tyrosine kinase inhibitors (TKIs) nilotinib and dasatinib have statistically significantly improved the life expectancy of chronic myeloid leukemia (CML) patients; however, resistance to TKIs remains a major clinical challenge. Although ponatinib, a third-generation TKI, improves outcomes for patients with BCR-ABL-dependent mechanisms of resistance, including the T315I mutation, a proportion of patients may have or develop BCR-ABL-independent resistance and fail ponatinib treatment. By modeling ponatinib resistance and testing samples from these CML patients, it is hoped that an alternative drug target can be identified and inhibited with a novel compound. Two CML cell lines with acquired BCR-ABL-independent resistance were generated following culture in ponatinib. RNA sequencing and gene ontology (GO) enrichment were used to detect aberrant transcriptional response in ponatinib-resistant cells. A validated oncogene drug library was used to identify US Food and Drug Administration-approved drugs with activity against TKI-resistant cells. Validation was performed using bone marrow (BM)-derived cells from TKI-resistant patients (n = 4) and a human xenograft mouse model (n = 4-6 mice per group). All statistical tests were two-sided. We show that ponatinib-resistant CML cells can acquire BCR-ABL-independent resistance mediated through alternative activation of mTOR. Following transcriptomic analysis and drug screening, we highlight mTOR inhibition as an alternative therapeutic approach in TKI-resistant CML cells. Additionally, we show that catalytic mTOR inhibitors induce autophagy and demonstrate that genetic or pharmacological inhibition of autophagy sensitizes ponatinib-resistant CML cells to death induced by mTOR inhibition in vitro (% number of colonies of control[SD], NVP-BEZ235 vs NVP-BEZ235+HCQ: 45.0[17.9]% vs 24.0[8.4]%, P = .002) and in vivo (median survival of NVP-BEZ235- vs NVP-BEZ235+HCQ-treated mice: 38.5 days vs 47

Structural Analysis of DFG-in and DFG-out Dual Src-Abl Inhibitors Sharing a Common Vinyl Purine Template

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Tianjun; Commodore, Lois; Huang, Wei-Sheng

2010-09-30

Bcr-Abl is the oncogenic protein tyrosine kinase responsible for chronic myeloid leukemia (CML). Treatment of the disease with imatinib (Gleevec) often results in drug resistance via kinase mutations at the advanced phases of the disease, which has necessitated the development of new mutation-resistant inhibitors, notably against the T315I gatekeeper mutation. As part of our efforts to discover such mutation resistant Abl inhibitors, we have focused on optimizing purine template kinase inhibitors, leading to the discovery of potent DFG-in and DFG-out series of Abl inhibitors that are also potent Src inhibitors. Here we present crystal structures of Abl bound by twomore » such inhibitors, based on a common N9-arenyl purine, and that represent both DFG-in and -out binding modes. In each structure the purine template is bound deeply in the adenine pocket and the novel vinyl linker forms a non-classical hydrogen bond to the gatekeeper residue, Thr315. Specific template substitutions promote either a DFG-in or -out binding mode, with the kinase binding site adjusting to optimize molecular recognition. Bcr-Abl T315I mutant kinase is resistant to all currently marketed Abl inhibitors, and is the focus of intense drug discovery efforts. Notably, our DFG-out inhibitor, AP24163, exhibits modest activity against this mutant, illustrating that this kinase mutant can be inhibited by DFG-out class inhibitors. Furthermore our DFG-out inhibitor exhibits dual Src-Abl activity, absent from the prototypical DFG-out inhibitor, imatinib as well as its analog, nilotinib. The data presented here provides structural guidance for the further design of novel potent DFG-out class inhibitors against Src, Abl and Abl T315I mutant kinases.« less

CALR, JAK2 and MPL mutation status in Argentinean patients with BCR-ABL1- negative myeloproliferative neoplasms.

PubMed

Ojeda, Mara Jorgelina; Bragós, Irma Margarita; Calvo, Karina Lucrecia; Williams, Gladis Marcela; Carbonell, María Magdalena; Pratti, Arianna Flavia

2018-05-01

To establish the frequency of JAK2, MPL and CALR mutations in Argentinean patients with BCR-ABL1-negative  myeloproliferative neoplasms (MPN) and to compare their clinical and haematological features. Mutations of JAK2V617F, JAK2 exon 12, MPL W515L/K and CALR were analysed in 439 Argentinean patients with BCR-ABL1-negative MPN, including 176 polycythemia vera (PV), 214 essential thrombocythemia (ET) and 49 primary myelofibrosis (PMF). In 94.9% of PV, 85.5% ET and 85.2% PMF, we found mutations in JAK2, MPL or CALR. 74.9% carried JAK2V617F, 12.3% CALR mutations, 2.1% MPL mutations and 10.7% were triple negative. In ET, nine types of CALR mutations were identified, four of which were novel. PMF patients were limited to types 1 and 2, type 2 being more frequent. In ET, patients with CALR mutation were younger and had higher platelet counts than those with JAK2V617F and triple negative. In addition, JAK2V617F patients had high leucocyte and haemoglobin values compared with CALR-mutated and triple-negative patients. In PMF, patients with mutant CALR were associated with higher platelet counts. Our study underscores the importance of JAK2, MPL and CALR genotyping for accurate diagnosis of patients with BCR-ABL1-negative MPN.

BCR-ABL fusion regions as a source of multiple leukemia-specific CD8+ T-cell epitopes.

PubMed

Kessler, J H; Bres-Vloemans, S A; van Veelen, P A; de Ru, A; Huijbers, I J G; Camps, M; Mulder, A; Offringa, R; Drijfhout, J W; Leeksma, O C; Ossendorp, F; Melief, C J M

2006-10-01

For immunotherapy of residual disease in patients with Philadelphia-positive leukemias, the BCR-ABL fusion regions are attractive disease-specific T-cell targets. We analyzed these regions for the prevalence of cytotoxic T lymphocyte (CTL) epitopes by an advanced reverse immunology procedure. Seventeen novel BCR-ABL fusion peptides were identified to bind efficiently to the human lymphocyte antigen (HLA)-A68, HLA-B51, HLA-B61 or HLA-Cw4 HLA class I molecules. Comprehensive enzymatic digestion analysis showed that 10 out of the 28 HLA class I binding fusion peptides were efficiently excised after their C-terminus by the proteasome, which is an essential requirement for efficient cell surface expression. Therefore, these peptides are prime vaccine candidates. The other peptides either completely lacked C-terminal liberation or were only inefficiently excised by the proteasome, rendering them inappropriate or less suitable for inclusion in a vaccine. CTL raised against the properly processed HLA-B61 epitope AEALQRPVA from the BCR-ABL e1a2 fusion region, expressed in acute lymphoblastic leukemia (ALL), specifically recognized ALL tumor cells, proving cell surface presentation of this epitope, its applicability for immunotherapy and underlining the accuracy of our epitope identification strategy. Our study provides a reliable basis for the selection of optimal peptides to be included in immunotherapeutic BCR-ABL vaccines against leukemia.

Computational dissection of allosteric inhibition of the SH2 domain of Bcr-Abl kinase by the monobody inhibitor AS25.

PubMed

Ji, Mingfei; Zheng, Guodong; Li, Xiaolong; Zhang, Zhongqin; Jv, Guanqun; Wang, Xiaowei; Wang, Jialin

2017-06-01

The deregulated breakpoint cluster region (Bcr)-Abelson tyrosine kinase (Abl) fusion protein represents an attractive pharmacological target for the treatment of chronic myeloid leukemia (CML). The high affinity of monobody AS25 was designed to target the Src homology 2 (SH2) domain of Bcr-Abl, leading to allosteric inhibition of Bcr-Abl through formation of protein-protein interactions. An I164E mutation in the SH2 domain disrupts AS25 binding to the SH2 domain of Bcr-Abl. The detailed mechanisms, however, remain to be unresolved. Here, molecular dynamics (MD) simulations and binding free energy calculations were performed to explore the conformational and energetic differences between the wild-type (WT) complexes of Bcr-Abl SH2 domain and AS25 (SH2 WT -AS25) as well as the mutated complexes (SH2 I164E -AS25). The results revealed that I164E mutation not only caused an increase in the conformational flexibility of SH2-AS25 complexes, but also weakened the binding affinity of AS25 to SH2. The comparative binding modes of SH2-AS25 complexes between WT and the I164E mutant were comprehensively analyzed to unravel the disruption of hydrophobic and hydrogen bonding interactions in the interface of the SH2-AS25 complex triggered by the I164E mutation. The results obtained may help to design the next generation of higher affinity Bcr-Abl SH2-specific peptide inhibitors.

Presence of novel compound BCR-ABL mutations in late chronic and advanced phase imatinib sensitive CML patients indicates their possible role in CML progression.

PubMed

Akram, Afia Muhammad; Iqbal, Zafar; Akhtar, Tanveer; Khalid, Ahmed Mukhtar; Sabar, Muhammad Farooq; Qazi, Mahmood Hussain; Aziz, Zeba; Sajid, Nadia; Aleem, Aamer; Rasool, Mahmood; Asif, Muhammad; Aloraibi, Saleh; Aljamaan, Khaled; Iqbal, Mudassar

2017-04-03

BCR-ABL kinase domain (K D ) mutations are well known for causing resistance against tyrosine kinase inhibitors (TKIs) and disease progression in chronic myeloid leukemia (CML). In recent years, compound BCR-ABL mutations have emerged as a new threat to CML patients by causing higher degrees of resistance involving multiple TKIs, including ponatinib. However, there are limited reports about association of compound BCR-ABL mutations with disease progression in imatinib (IM) sensitive CML patients. Therefore, we investigated presence of ABL-K D mutations in chronic phase (n = 41), late chronic phase (n = 33) and accelerated phase (n = 16) imatinib responders. Direct sequencing analysis was used for this purpose. Eleven patients (12.22%) in late-CP CML were detected having total 24 types of point mutations, out of which 8 (72.72%) harbored compound mutated sites. SH2 contact site mutations were dominant in our study cohort, with E355G (3.33%) being the most prevalent. Five patients (45%) all having compound mutated sites, progressed to advanced phases of disease during follow up studies. Two novel silent mutations G208G and E292E/E were detected in combination with other mutants, indicating limited tolerance for BCR-ABL1 kinase domain for missense mutations. However, no patient in early CP of disease manifested mutated ABL-K D . Occurrence of mutations was found associated with elevated platelet count (p = 0.037) and patients of male sex (p = 0.049). The median overall survival and event free survival of CML patients (n = 90) was 6.98 and 5.8 y respectively. The compound missense mutations in BCR-ABL kinase domain responsible to elicit disease progression, drug resistance or disease relapse in CML, can be present in yet Imatinib sensitive patients. Disease progression observed here, emphasizes the need of ABL-K D mutation screening in late chronic phase CML patients for improved clinical management of disease.

[Detection of bcr/abl fusion gene and its derivative chromosome 9 deletions in CML by using home-made bcr/abl extra-signal probe].

PubMed

Lai, Yue-Yun; Feng, Lin; Wang, Zheng; Lü, Shan; Dang, Hui; Shi, Yan; He, Qi; Huang, Xiao-Jun

2010-02-01

This study was aimed to verify the efficacy of home-made LSI bcr/abl ES probe for detection of bcr/abl fusion gene and derivative chromosome 9 deletions in chronic myeloid leukemia (CML). Fluorescence in situ hybridization (FISH) was carried out with dual color bcr/abl extra signal (ES) probe in 97 cases of CML based on morphology and cytogenetic karyotype and 129 cases of non-hematological malignancies/non-myeloproliferative diseases with normal cytogenetic karyotype. For the patients with signals of 1R1G1F indicating der(9) deletions, FISH were done using ASS DNA probe. The results showed that 91 cases with standard t(9;22) and 6 cases with variant translocation of t(9;22) were detected by conventional G banding technique. All of the 97 patients displayed bcr/abl fusion gene by ES-FISH, including 16 cases with signal patterns of 1R1G1F showing der(9) deletions. Among the 16 cases with der(9) deletions, 13 cases were detected to have deletions of ASS gene. Meanwhile, none of the 129 cases of negative control showed bcr/abl fusion gene by ES-FISH. It is concluded that home-made LSI bcr/abl ES probe is effective to identify the bcr/abl fusion gene and der(9) deletions in CML, and the ES-FISH results are consistent with conventional cytogenetic karyotype.

Beneficial effects of combining nilotinib and imatinib in preclinical models of BCR-ABL+ leukemias

PubMed Central

Weisberg, Ellen; Catley, Laurie; Wright, Renee D.; Moreno, Daisy; Banerji, Lolita; Ray, Arghya; Manley, Paul W.; Mestan, Juergen; Fabbro, Doriano; Jiang, Jingrui; Hall-Meyers, Elizabeth; Callahan, Linda; DellaGatta, Jamie L.; Kung, Andrew L.

2007-01-01

Drug resistance resulting from emergence of imatinib-resistant BCR-ABL point mutations is a significant problem in advanced-stage chronic myelogenous leukemia (CML). The BCR-ABL inhibitor, nilotinib (AMN107), is significantly more potent against BCR-ABL than imatinib, and is active against many imatinib-resistant BCR-ABL mutants. Phase 1/2 clinical trials show that nilotinib can induce remissions in patients who have previously failed imatinib, indicating that sequential therapy with these 2 agents has clinical value. However, simultaneous, rather than sequential, administration of 2 BCR-ABL kinase inhibitors is attractive for many reasons, including the theoretical possibility that this could reduce emergence of drug-resistant clones. Here, we show that exposure of a variety of BCR-ABL+ cell lines to imatinib and nilotinib results in additive or synergistic cytotoxicity, including testing of a large panel of cells expressing BCR-ABL point mutations causing resistance to imatinib in patients. Further, using a highly quantifiable bioluminescent in vivo model, drug combinations were at least additive in antileukemic activity, compared with each drug alone. These results suggest that despite binding to the same site in the same target kinase, the combination of imatinib and nilotinib is highly efficacious in these models, indicating that clinical testing of combinations of BCR-ABL kinase inhibitors is warranted. PMID:17068153

The Prevalence of JAK2, MPL, and CALR Mutations in Chinese Patients With BCR-ABL1-Negative Myeloproliferative Neoplasms.

PubMed

Lin, Yani; Liu, Enbin; Sun, Qi; Ma, Jiao; Li, QingHua; Cao, Zeng; Wang, Jun; Jia, Yujiao; Zhang, Hongju; Song, Zhen; Ai, Xiaofei; Shi, Lihui; Feng, Xiaofang; Li, Chenwei; Wang, Jianxiang; Ru, Kun

2015-07-01

To evaluate the mutation frequency of JAK2 V617F, JAK2 exon 12, MPL exon 10, and CALR exon 9 and the value of the combined tests in the diagnosis of BCR-ABL1-negative myeloproliferative neoplasms (MPNs). In the current study, mutations of JAK2 V617F, JAK2 exon 12, MPL exon 10, and CALR exon 9 were analyzed in 929 Chinese patients with BCR-ABL1-negative MPN, including 234 cases of polycythemia vera (PV), 428 ETs, 187 PMFs, and 80 unclassifiable MPNs (MPN-Us). Our result showed that the positive rate of any of four mutations in patients with PV, ET, PMF, and MPN-U was 89.3%, 83.4%, 87.2%, and 77.5%, respectively, which significantly improved the diagnostic rate, especially in ET and PMF. Meanwhile, we also found that the patients without any of four mutations were younger than those with one or more mutations. Unexpectedly, the coexistence of JAK2 V617F and CALR exon 9 was identified in six (0.6%) patients, and JAK2 V617F and MPL exon 10 were present simultaneously in two (0.2%) patients. In addition, we also identified several novel mutation types in CALR exon 9. The combined genetic tests of JAK2 V617F, JAK2 exon 12, MPL exon 10, and CALR exon 9 help improve the diagnostic rate for BCR-ABL1-negative MPN. Copyright© by the American Society for Clinical Pathology.

A role for FOXO1 in BCR-ABL1-independent tyrosine kinase inhibitor resistance in chronic myeloid leukemia.

PubMed

Wagle, M; Eiring, A M; Wongchenko, M; Lu, S; Guan, Y; Wang, Y; Lackner, M; Amler, L; Hampton, G; Deininger, M W; O'Hare, T; Yan, Y

2016-07-01

Chronic myeloid leukemia (CML) patients who relapse on imatinib due to acquired ABL1 kinase domain mutations are successfully treated with second-generation ABL1-tyrosine kinase inhibitors (ABL-TKIs) such as dasatinib, nilotinib or ponatinib. However, ~40% of relapsed patients have uncharacterized BCR-ABL1 kinase-independent mechanisms of resistance. To identify these mechanisms of resistance and potential treatment options, we generated ABL-TKI-resistant K562 cells through prolonged sequential exposure to imatinib and dasatinib. Dual-resistant K562 cells lacked BCR-ABL1 kinase domain mutations, but acquired other genomic aberrations that were characterized by next-generation sequencing and copy number analyses. Proteomics showed that dual-resistant cells had elevated levels of FOXO1, phospho-ERK and BCL-2, and that dasatinib no longer inhibited substrates of the PI3K/AKT pathway. In contrast to parental cells, resistant cells were sensitive to growth inhibition and apoptosis induced by the class I PI3K inhibitor, GDC-0941 (pictilisib), which also induced FOXO1 nuclear translocation. FOXO1 was elevated in a subset of primary specimens from relapsed CML patients lacking BCR-ABL1 kinase domain mutations, and these samples were responsive to GDC-0941 treatment ex vivo. We conclude that elevated FOXO1 contributes to BCR-ABL1 kinase-independent resistance experienced by these CML patients and that PI3K inhibition coupled with BCR-ABL1 inhibition may represent a novel therapeutic approach.

The proto-oncogene product p120CBL and the adaptor proteins CRKL and c-CRK link c-ABL, p190BCR/ABL and p210BCR/ABL to the phosphatidylinositol-3' kinase pathway.

PubMed

Sattler, M; Salgia, R; Okuda, K; Uemura, N; Durstin, M A; Pisick, E; Xu, G; Li, J L; Prasad, K V; Griffin, J D

1996-02-15

Chronic myelogenous leukemia (CML) and some acute lymphoblastic leukemias (ALL) are caused by the t(9;22) chromosome translocation, which produces the constitutively activated BCR/ABL tyrosine kinase. When introduced into factor dependent hematopoietic cell lines, BCR/ABL induces the tyrosine phosphorylation of many cellular proteins. One prominent BCR/ABL substrate is p120CBL, the cellular homolog of the v-Cbl oncoprotein. In an effort to understand the possible contribution of p120CBL to transformation by BCR/ABL, we looked for cellular proteins which associate with p120CBL in hematopoietic cell lines transformed by BCR/ABL. In addition to p210BCR/ABL and c-ABL, p120CBL coprecipitated with an 85 kDa phosphoprotein, which was identified as the p85 subunit of PI3K. Anti-p120CBL immunoprecipitates from BCR/ABL-transformed, but not from untransformed, cell lines contained PI3K lipid kinase activity. Interestingly, the adaptor proteins CRKL and c-CRK were also found in these complexes. In vitro binding studies indicated that the SH2 domains of CRKL and c-CRK bound directly to p120CBL, while the SH3 domains of c-CRK and CRKL bound to BCR/ABL and c-ABL. The N-terminal and the C-terminal SH2 and the SH3 domain of p85PI3K bound directly in vitro to p120CBL. The ABL-SH2, but not ABL-SH3, could also bind to p120CBL. These data suggest that BCR/ABL may induce the formation of multimeric complexes of signaling proteins which include p120CBL, PI3K, c-CRK or CRKL, c-ABL and BCR/ABL itself.

Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia

PubMed Central

Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.

2017-01-01

Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077

Combined targeting of STAT3 and STAT5: a novel approach to overcome drug resistance in chronic myeloid leukemia.

PubMed

Gleixner, Karoline V; Schneeweiss, Mathias; Eisenwort, Gregor; Berger, Daniela; Herrmann, Harald; Blatt, Katharina; Greiner, Georg; Byrgazov, Konstantin; Hoermann, Gregor; Konopleva, Marina; Waliul, Islam; Cumaraswamy, Abbarna A; Gunning, Patrick T; Maeda, Hiroshi; Moriggl, Richard; Deininger, Michael; Lion, Thomas; Andreeff, Michael; Valent, Peter

2017-09-01

In chronic myeloid leukemia, resistance against BCR-ABL1 tyrosine kinase inhibitors can develop because of BCR-ABL1 mutations, activation of additional pro-oncogenic pathways, and stem cell resistance. Drug combinations covering a broad range of targets may overcome resistance. CDDO-Me (bardoxolone methyl) is a drug that inhibits the survival of leukemic cells by targeting different pro-survival molecules, including STAT3. We found that CDDO-Me inhibits proliferation and survival of tyrosine kinase inhibitor-resistant BCR-ABL1 + cell lines and primary leukemic cells, including cells harboring BCR-ABL1 T315I or T315I + compound mutations. Furthermore, CDDO-Me was found to block growth and survival of CD34 + /CD38 - leukemic stem cells (LSC). Moreover, CDDO-Me was found to produce synergistic growth-inhibitory effects when combined with BCR-ABL1 tyrosine kinase inhibitors. These drug-combinations were found to block multiple signaling cascades and molecules, including STAT3 and STAT5. Furthermore, combined targeting of STAT3 and STAT5 by shRNA and STAT5-targeting drugs also resulted in synergistic growth-inhibition, pointing to a new efficient concept of combinatorial STAT3 and STAT5 inhibition. However, CDDO-Me was also found to increase the expression of heme-oxygenase-1, a heat-shock-protein that triggers drug resistance and cell survival. We therefore combined CDDO-Me with the heme-oxygenase-1 inhibitor SMA-ZnPP, which also resulted in synergistic growth-inhibitory effects. Moreover, SMA-ZnPP was found to sensitize BCR-ABL1 + cells against the combination 'CDDO-Me+ tyrosine kinase inhibitor'. Together, combined targeting of STAT3, STAT5, and heme-oxygenase-1 overcomes resistance in BCR-ABL1 + cells, including stem cells and highly resistant sub-clones expressing BCR-ABL1 T315I or T315I-compound mutations. Whether such drug-combinations are effective in tyrosine kinase inhibitor-resistant patients with chronic myeloid leukemia remains to be elucidated. Copyright

Clinical characteristics of patients with central nervous system relapse in BCR-ABL1-positive acute lymphoblastic leukemia: the importance of characterizing ABL1 mutations in cerebrospinal fluid.

PubMed

Sanchez, Ricardo; Ayala, Rosa; Alonso, Rafael Alberto; Martínez, María Pilar; Ribera, Jordi; García, Olga; Sanchez-Pina, José; Mercadal, Santiago; Montesinos, Pau; Martino, Rodrigo; Barba, Pere; González-Campos, José; Barrios, Manuel; Lavilla, Esperanza; Gil, Cristina; Bernal, Teresa; Escoda, Lourdes; Abella, Eugenia; Amigo, Ma Luz; Moreno, Ma José; Bravo, Pilar; Guàrdia, Ramón; Hernández-Rivas, Jesús-María; García-Guiñón, Antoni; Piernas, Sonia; Ribera, José-María; Martínez-López, Joaquín

2017-07-01

We investigated the frequency, predictors, and evolution of acute lymphoblastic leukemia (ALL) in patients with CNS relapse and introduced a novel method for studying BCR-ABL1 protein variants in cDNA from bone marrow (BM) and cerebrospinal fluid (CSF) blast cells. A total of 128 patients were analyzed in two PETHEMA clinical trials. All achieved complete remission after imatinib treatment. Of these, 30 (23%) experienced a relapse after achieving complete remission, and 13 (10%) had an isolated CNS relapse or combined CNS and BM relapses. We compared the characteristics of patients with and without CNS relapse and further analyzed CSF and BM samples from two of the 13 patients with CNS relapse. In both patients, classical sequencing analysis of the kinase domain of BCR-ABL1 from the cDNA of CSF blasts revealed the pathogenic variant p.L387M. We also performed ultra-deep next-generation sequencing (NGS) in three samples from one of the relapsed patients. We did not find the mutation in the BM sample, but we did find it in CSF blasts with 45% of reads at the time of relapse. These data demonstrate the feasibility of detecting BCR-ABL1 mutations in CSF blasts by NGS and highlight the importance of monitoring clonal evolution over time.

Novel Combined Ato-C Treatment Synergistically Suppresses Proliferation of Bcr-Abl-Positive Leukemic Cells In Vitro and In Vivo.

PubMed

Wahiduzzaman, Md; Ota, Akinobu; Karnan, Sivasundaram; Hanamura, Ichiro; Mizuno, Shohei; Kanasugi, Jo; Rahman, Md Lutfur; Hyodo, Toshinori; Konishi, Hiroyuki; Tsuzuki, Shinobu; Takami, Akiyoshi; Hosokawa, Yoshitaka

2018-06-23

Chronic myelogenous leukemia (CML) accounts for 15-20% of all leukemias affecting adults. Despite recent advances in the development of specific Bcr-Abl tyrosine kinase inhibitors (TKIs), some CML patients suffer from relapse due to TKI resistance. Here, we assessed the efficacy of a novel combinatorial arsenic trioxide (ATO) and cisplatin (CDDP) treatment (Ato-C) in human Bcr-Abl-positive leukemic cells. Combination index analyses revealed that a synergistic interaction of ATO and CDDP elicits a wide range of effects in K562, KU-812, MEG-A2, and KCL-22 cells. Notably, Ato-C synergistically enhanced apoptosis and decreased the survival of both acquired TKI-resistant CML cells and the cells expressing mutant Bcr-Abl T315I . In addition, Ato-C dramatically decreased the phosphorylation level of forkhead transcription factor FOXO1/3a and STAT5 as well as c-Myc protein level. Interestingly, results of gene set enrichment analysis showed that Ato-C significantly downregulates the expression of MYC- and/or E2F1-targets genes. Furthermore, Ato-C significantly suppressed the proliferation of MEG-A2-derived tumor when compared with that following monotherapy in vivo. Collectively, these results suggest that combined Ato-C treatment could be a promising alternative to the current therapeutic regime in CML. Copyright © 2018. Published by Elsevier B.V.

BCR-ABL1 promotes leukemia by converting p27 into a cytoplasmic oncoprotein

PubMed Central

Mackenzie, Ryan J.; Besson, Arnaud; Jeng, Sophia; Carey, Alyssa; LaTocha, Dorian H.; Fleischman, Angela G.; Duquesnes, Nicolas; Eide, Christopher A.; Vasudevan, Kavin B.; Loriaux, Marc M.; Firpo, Eduardo; Cortes, Jorge E.; McWeeney, Shannon; O’Hare, Thomas; Roberts, James M.; Druker, Brian J.; Deininger, Michael W.

2014-01-01

Recent studies have revealed that p27, a nuclear cyclin-dependent kinase (Cdk) inhibitor and tumor suppressor, can acquire oncogenic activities upon mislocalization to the cytoplasm. To understand how these antagonistic activities influence oncogenesis, we dissected the nuclear and cytoplasmic functions of p27 in chronic myeloid leukemia (CML), a well-characterized malignancy caused by the BCR-ABL1 tyrosine kinase. p27 is predominantly cytoplasmic in CML and nuclear in normal cells. BCR-ABL1 regulates nuclear and cytoplasmic p27 abundance by kinase-dependent and -independent mechanisms, respectively. p27 knockdown in CML cell lines with predominantly cytoplasmic p27 induces apoptosis, consistent with a leukemogenic role of cytoplasmic p27. Accordingly, a p27 mutant (p27CK−) devoid of Cdk inhibitory nuclear functions enhances leukemogenesis in a murine CML model compared with complete absence of p27. In contrast, p27 mutations that enhance its stability (p27T187A) or nuclear retention (p27S10A) attenuate leukemogenesis over wild-type p27, validating the tumor-suppressor function of nuclear p27 in CML. We conclude that BCR-ABL1 kinase-dependent and -independent mechanisms convert p27 from a nuclear tumor suppressor to a cytoplasmic oncogene. These findings suggest that cytoplasmic mislocalization of p27 despite BCR-ABL1 inhibition by tyrosine kinase inhibitors may contribute to drug resistance, and effective therapeutic strategies to stabilize nuclear p27 must also prevent cytoplasmic mislocalization. PMID:25293778

Bcr-Abl induces abnormal cytoskeleton remodeling, beta1 integrin clustering and increased cell adhesion to fibronectin through the Abl interactor 1 pathway.

PubMed

Li, Yingzhu; Clough, Nancy; Sun, Xiaolin; Yu, Weidong; Abbott, Brian L; Hogan, Christopher J; Dai, Zonghan

2007-04-15

Hematopoietic cells isolated from patients with Bcr-Abl-positive leukemia exhibit multiple abnormalities of cytoskeletal and integrin function. These abnormalities are thought to play a role in the pathogenesis of leukemia; however, the molecular events leading to these abnormalities are not fully understood. We show here that the Abi1 pathway is required for Bcr-Abl to stimulate actin cytoskeleton remodeling, integrin clustering and cell adhesion. Expression of Bcr-Abl induces tyrosine phosphorylation of Abi1. This is accompanied by a subcellular translocation of Abi1/WAVE2 to a site adjacent to membrane, where an F-actin-enriched structure containing the adhesion molecules such as beta1-integrin, paxillin and vinculin is assembled. Bcr-Abl-induced membrane translocation of Abi1/WAVE2 requires direct interaction between Abi1 and Bcr-Abl, but is independent of the phosphoinositide 3-kinase pathway. Formation of the F-actin-rich complex correlates with an increased cell adhesion to fibronectin. More importantly, disruption of the interaction between Bcr-Abl and Abi1 by mutations either in Bcr-Abl or Abi1 not only abolished tyrosine phosphorylation of Abi1 and membrane translocation of Abi1/WAVE2, but also inhibited Bcr-Abl-stimulated actin cytoskeleton remodeling, integrin clustering and cell adhesion to fibronectin. Together, these data define Abi1/WAVE2 as a downstream pathway that contributes to Bcr-Abl-induced abnormalities of cytoskeletal and integrin function.

Molecular detection of BCR/ABL fusion gene in Saudi acute lymphoblastic leukemia patients.

PubMed

El-Sissy, Azza; El-Mashari, May; Bassuni, Wafaa; El-Swaayed, Aziza

2006-06-01

Molecular cytogenetics is becoming one of the most useful tools targeting some genes which are generally considered to lead to leukemic transformation (as well as for numerical abnormalities). A fraction of acute lymphoblastic leukemia (ALL) cases carry the translocation t(9;22) (q34;q11.2) which juxtaposes the ABL proto-oncogene to the BCR gene generating a chimeric gene, BCR/ABL. This aberration is more frequent in adult ALL (20%-40%) than in pediatric ALL (<5%), and predicts poor clinical outcome. AIM OF OUR WORK: Is to study BCR/ABL fusion gene in ALL cases using fluorescent in situ hybridization. Twenty newly diagnosed ALL patients, 16 adult and 4 paediatric cases, were included in the study, 11 cases (55%) were of precursor B phenotype, 8 cases (40%) belonged to T lineage, while one case was biphenotypic expressing mainly precursor B cell markers tether with CD13, CD33, CD117, Detection of BCR/ABL fusion gene was done using interphase FISH technique and was confirmed molecularly using the RT-PCR technique. BCR/ABL fusion gene was negative in all the examined cases, yet abnormality involving 9q34, ABL gene, either by addition or deletion was detected in three cases (15%). Two of these cases were associated with BCR gene extra copies (three and four copies, respectively). This may reflect the frequency of association of ABL gene and BCR gene abnormality in our cases, and that absence of fusion gene BCR/ABL does not exclude their role in the leukomogenic process, yet a larger study is required to confirm and detect the prevalence of these gene disturbances in ALL and their association.

Choosing the best treatment strategy for chronic myeloid leukemia patients resistant to imatinib: weighing the efficacy and safety of individual drugs with BCR-ABL mutations and patient history.

PubMed

Jabbour, E; Hochhaus, A; Cortes, J; La Rosée, P; Kantarjian, H M

2010-01-01

For patients with chronic myeloid leukemia who become or are inherently resistant to imatinib therapy, including dose escalation, several important factors must be considered when deciding which strategy to attempt next. The second-generation tyrosine kinase inhibitors (TKIs) dasatinib and nilotinib offer improved potency and a high likelihood of success for these patients. Overall, the efficacy data are comparable for these two agents, and so physicians should consider the BCR-ABL mutation profile and the patient's history to make an educated decision on the best choice. Only a few BCR-ABL mutations seem to be less responsive to either nilotinib or dasatinib and it is recommended to choose the second-line TKI that has shown clinical activity against the specific mutation in these cases. For patients with all other mutations, and for patients with no mutations, it is recommended to choose the second-generation TKI based on the patient's disease history. It is important to choose an agent that minimizes the likelihood of exacerbating the patient's past tolerability issues to imatinib, or comorbid conditions. Here, we propose a treatment algorithm for imatinib-resistant patients based on BCR-ABL mutation status and patient history.

Heterogeneity of BCR-ABL rearrangement in patients with chronic myeloid leukemia in Pakistan.

PubMed

Tabassum, Najia; Saboor, Mohammad; Ghani, Rubina; Moinuddin, Moinuddin

2014-07-01

Breakpoint cluster region-Abelson (BCR-ABL) rearrangement or Philadelphia (Ph) chromosome in Chronic Myeloid Leukemia (CML) is derived from a reciprocal chromosomal translocation between ABL gene on chromosome 9 and BCR gene on chromosome 22. This chimeric protein has various sizes and therefore different clinical behaviour. The purpose of this study was to determine the heterogeneity of BCR-ABL rearrangement in patients with Ph(+)CML in Pakistan. The study was conducted at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed to identify various BCR-ABL transcripts. All 25 samples showed BCR-ABL rearrangements. Out of these, 24 (96%) patients expressed p210 BCR-ABL rearrangements i.e. 60% (n=15) had b3a2 and 32% (n=8) had b2a2 rearrangements. Co-expression of b3a2 /b2a2 rearrangement and p190 (e1a3) rearrangement was also identified in two patients. It is apparent that majority of the patients had p210 BCR-ABL rearrangements. Frequency of co-expression and rare fusion transcripts was very low.

A novel mechanism for Bcr-Abl action: Bcr-Abl-mediated induction of the eIF4F translation initiation complex and mRNA translation.

PubMed

Prabhu, S; Saadat, D; Zhang, M; Halbur, L; Fruehauf, J P; Ong, S T

2007-02-22

The oncogenic kinase Bcr-Abl is thought to cause chronic myelogenous leukemia (CML) by altering the transcription of specific genes with growth- and survival-promoting functions. Recently, Bcr-Abl has also been shown to activate an important regulator of protein synthesis, the mammalian target of rapamycin (mTOR), which suggests that dysregulated translation may also contribute to CML pathogenesis. In this study, we found that both Bcr-Abl and the rapamycin-sensitive mTORC1 complex contribute to the phosphorylation (inactivation) of 4E-BP1, an inhibitor of the eIF4E translation initiation factor. Experiments with rapamycin and the Bcr-Abl inhibitor, imatinib mesylate, in Bcr-Abl-expressing cell lines and primary CML cells indicated that Bcr-Abl and mTORC1 induced formation of the translation initiation complex, eIF4F. This was characterized by reduced 4E-BP1 binding and increased eIF4G binding to eIF4E, two events that lead to the assembly of eIF4F. One target transcript is cyclin D3, which is regulated in Bcr-Abl-expressing cells by both Bcr-Abl and mTORC1 in a translational manner. In addition, the combination of imatinib and rapamycin was found to act synergistically against committed CML progenitors from chronic and blast phase patients. These experiments establish a novel mechanism of action for Bcr-Abl, and they provide insights into the modes of action of imatinib mesylate and rapamycin in treatment of CML. They also suggest that aberrant cap-dependent mRNA translation may be a therapeutic target in Bcr-Abl-driven malignancies.

Heterogeneity of BCR-ABL rearrangement in patients with chronic myeloid leukemia in Pakistan

PubMed Central

Tabassum, Najia; Saboor, Mohammad; Ghani, Rubina; Moinuddin, Moinuddin

2014-01-01

Background and Objective: Breakpoint cluster region-Abelson (BCR-ABL) rearrangement or Philadelphia (Ph) chromosome in Chronic Myeloid Leukemia (CML) is derived from a reciprocal chromosomal translocation between ABL gene on chromosome 9 and BCR gene on chromosome 22. This chimeric protein has various sizes and therefore different clinical behaviour. The purpose of this study was to determine the heterogeneity of BCR-ABL rearrangement in patients with Ph+CML in Pakistan. Methods: The study was conducted at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed to identify various BCR-ABL transcripts. Results: All 25 samples showed BCR-ABL rearrangements. Out of these, 24 (96%) patients expressed p210 BCR-ABL rearrangements i.e. 60% (n=15) had b3a2 and 32% (n=8) had b2a2 rearrangements. Co-expression of b3a2 /b2a2 rearrangement and p190 (e1a3) rearrangement was also identified in two patients. Conclusion: It is apparent that majority of the patients had p210 BCR-ABL rearrangements. Frequency of co-expression and rare fusion transcripts was very low. PMID:25097530

Monitoring of childhood ALL using BCR-ABL1 genomic breakpoints identifies a subgroup with CML-like biology.

PubMed

Hovorkova, Lenka; Zaliova, Marketa; Venn, Nicola C; Bleckmann, Kirsten; Trkova, Marie; Potuckova, Eliska; Vaskova, Martina; Linhartova, Jana; Machova Polakova, Katerina; Fronkova, Eva; Muskovic, Walter; Giles, Jodie E; Shaw, Peter J; Cario, Gunnar; Sutton, Rosemary; Stary, Jan; Trka, Jan; Zuna, Jan

2017-05-18

We used the genomic breakpoint between BCR and ABL1 genes for the DNA-based monitoring of minimal residual disease (MRD) in 48 patients with childhood acute lymphoblastic leukemia (ALL). Comparing the results with standard MRD monitoring based on immunoglobulin/T-cell receptor (Ig/TCR) gene rearrangements and with quantification of IKZF1 deletion, we observed very good correlation for the methods in a majority of patients; however, >20% of children (25% [8/32] with minor and 12.5% [1/8] with major- BCR-ABL1 variants in the consecutive cohorts) had significantly (>1 log) higher levels of BCR-ABL1 fusion than Ig/TCR rearrangements and/or IKZF1 deletion. We performed cell sorting of the diagnostic material and assessed the frequency of BCR-ABL1 -positive cells in various hematopoietic subpopulations; 12% to 83% of non-ALL B lymphocytes, T cells, and/or myeloid cells harbored the BCR-ABL1 fusion in patients with discrepant MRD results. The multilineage involvement of the BCR-ABL1 -positive clone demonstrates that in some patients diagnosed with BCR-ABL1 -positive ALL, a multipotent hematopoietic progenitor is affected by the BCR-ABL1 fusion. These patients have BCR-ABL1 -positive clonal hematopoiesis resembling a chronic myeloid leukemia (CML)-like disease manifesting in "lymphoid blast crisis." The biological heterogeneity of BCR-ABL1 -positive ALL may impact the patient outcomes and optimal treatment (early stem cell transplantation vs long-term administration of tyrosine-kinase inhibitors) as well as on MRD testing. Therefore, we recommend further investigations on CML-like BCR-ABL1 -positive ALL. © 2017 by The American Society of Hematology.

SHP2 Is Required for BCR-ABL1-Induced Hematologic Neoplasia

PubMed Central

Gu, Shengqing; Sayad, Azin; Chan, Gordon; Yang, Wentian; Lu, Zhibin; Virtanen, Carl; Van Etten, Richard A.; Neel, Benjamin G.

2017-01-01

BCR-ABL1-targeting tyrosine kinase inhibitors (TKIs) have revolutionized treatment of Philadelphia chromosome-positive (Ph+) hematologic neoplasms. Nevertheless, acquired TKI resistance remains a major problem in chronic myeloid leukemia (CML), and TKIs are less effective against Ph+ B-cell acute lymphoblastic leukemia (B-ALL). GAB2, a scaffolding adaptor that binds and activates SHP2, is essential for leukemogenesis by BCR-ABL1, and a GAB2 mutant lacking SHP2 binding cannot mediate leukemogenesis. Using a genetic loss-of-function approach and bone marrow transplantation (BMT) models for CML and BCR-ABL1+ B-ALL, we show that SHP2 is required for BCR-ABL1-evoked myeloid and lymphoid neoplasia. Ptpn11 deletion impairs initiation and maintenance of CML-like myeloproliferative neoplasm, and compromises induction of BCR-ABL1+ B-ALL. SHP2, and specifically, its SH2 domains, PTP activity and C-terminal tyrosines, is essential for BCR-ABL1+, but not WT, pre-B cell proliferation. The MEK/ERK pathway is regulated by SHP2 in WT and BCR-ABL1+ pre-B cells, but is only required for the proliferation of BCR-ABL1+ cells. SHP2 is required for SRC family kinase (SFK) activation only in BCR-ABL1+ pre-B cells. RNAseq reveals distinct SHP2-dependent transcriptional programs in BCR-ABL1+ and WT pre-B cells. Our results suggest that SHP2, via SFKs and ERK, represses MXD3/4 to facilitate a MYC-dependent proliferation program in BCR-ABL1-transformed pre-B cells. PMID:28804122

BCR-ABL enhances differentiation of long-term repopulating hematopoietic stem cells

PubMed Central

Schemionek, Mirle; Elling, Christian; Steidl, Ulrich; Bäumer, Nicole; Hamilton, Ashley; Spieker, Tilmann; Göthert, Joachim R.; Stehling, Martin; Wagers, Amy; Huettner, Claudia S.; Tenen, Daniel G.; Tickenbrock, Lara; Berdel, Wolfgang E.; Serve, Hubert; Holyoake, Tessa L.; Müller-Tidow, Carsten

2010-01-01

In a previously developed inducible transgenic mouse model of chronic myeloid leukemia, we now demonstrate that the disease is transplantable using BCR-ABL+ Lin−Sca-1+c-kit+ (LSK) cells. Interestingly, the phenotype is more severe when unfractionated bone marrow cells are transplanted, yet neither progenitor cells (Lin−Sca-1−c-kit+), nor mature granulocytes (CD11b+Gr-1+), nor potential stem cell niche cells (CD45−Ter119−) are able to transmit the disease or alter the phenotype. The phenotype is largely independent of BCR-ABL priming before transplantation. However, prolonged BCR-ABL expression abrogates the potential of LSK cells to induce full-blown disease in secondary recipients and increases the fraction of multipotent progenitor cells at the expense of long-term hematopoietic stem cells (LT-HSCs) in the bone marrow. BCR-ABL alters the expression of genes involved in proliferation, survival, and hematopoietic development, probably contributing to the reduced LT-HSC frequency within BCR-ABL+ LSK cells. Reversion of BCR-ABL, or treatment with imatinib, eradicates mature cells, whereas leukemic stem cells persist, giving rise to relapsed chronic myeloid leukemia on reinduction of BCR-ABL, or imatinib withdrawal. Our results suggest that BCR-ABL induces differentiation of LT-HSCs and decreases their self-renewal capacity. PMID:20053753

MEK-Dependent Negative Feedback Underlies BCR-ABL-Mediated Oncogene Addiction

PubMed Central

Asmussen, Jennifer; Lasater, Elisabeth A.; Tajon, Cheryl; Oses-Prieto, Juan; Jun, Young-wook; Taylor, Barry S.; Burlingame, Alma; Craik, Charles S.; Shah, Neil P.

2014-01-01

The clinical experience with BCR-ABL tyrosine kinase inhibitors (TKIs) for the treatment of chronic myeloid leukemia (CML) provides compelling evidence for oncogene addiction. Yet, the molecular basis of oncogene addiction remains elusive. Through unbiased quantitative phosphoproteomic analyses of CML cells transiently exposed to BCR-ABL TKI, we identified persistent downregulation of growth factor receptor (GF-R) signaling pathways. We then established and validated a tissue-relevant isogenic model of BCR-ABL-mediated addiction, and found evidence for myeloid GF-R signaling pathway rewiring that profoundly and persistently dampens physiologic pathway activation. We demonstrate that eventual restoration of ligand-mediated GF-R pathway activation is insufficient to fully rescue cells from a competing apoptotic fate. In contrast to previous work with BRAFV600E in melanoma cells, feedback inhibition following BCR-ABL TKI treatment is markedly prolonged, extending beyond the time required to initiate apoptosis. Mechanistically, BCR-ABL-mediated oncogene addiction is facilitated by persistent high levels of MEK-dependent negative feedback. PMID:24362263

Expression of BCR-ABL1 oncogene relative to ABL1 gene changes overtime in chronic myeloid leukemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Manu; Milani, Lili; Hermansson, Monica

Using a quantitative single nucleotide polymorphism (SNP) assay we have investigated the changes in the expression of the BCR-ABL1 oncogene relative to the wild-type ABL1 and BCR alleles in cells from chronic myeloid leukemia (CML) patients not responding to therapy. The results show a progressive increase in the BCR-ABL1 oncogene expression at the expense of decreased expression of the ABL1 allele, not involved in the fusion. No relative changes in the expression of the two BCR alleles were found. These results demonstrate that allele-specific changes in gene expression, with selective, progressive silencing of the wild-type ABL1 allele in favor ofmore » the oncogenic BCR-ABL1 allele occur in CML patients with therapy-resistant disease.« less

Four-channel asymmetric Real-Time PCR hybridization probe assay: a rapid pre-screening method for critical BCR-ABL kinase domain mutations.

PubMed

Martinez-Serra, Jordi; Gutiérrez, Antonio; Marcús, Toni F; Soverini, Simona; Amat, Juan Carlos; Navarro-Palou, María; Ros, Teresa; Bex, Teresa; Ballester, Carmen; Bauça, Josep Miquel; SanFelix, Sara; Novo, Andrés; Vidal, Carmen; Santos, Carmen; Besalduch, Joan

2012-03-01

Within the laboratory protocols, used for the study of BCR-ABL resistance mutations in chronic myeloid leukemia patients treated with Imatinib, direct sequencing remains the reference method. Since the incidence of patients with a mutation-related loss of response is not very high, it is very useful in the routine laboratory to perform a fast pre-screening method. With this in mind, we have designed a new technique, based on a single Real-Time FRET-based PCR, followed by a study of melting peaks. This new tool, developed in a LightCycler 2.0, combines four different fluorescence channels for the simultaneous detection, in a single close tube, of critical mutations within the ABL kinase domain. Assay evaluation performed on 33 samples, previously genotyped by sequentiation, resulted in full concordance of results. This new methodology detects in a few steps the presence of critical mutations associated to Imatinib resistance. Copyright © 2012 Elsevier Inc. All rights reserved.

Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results

PubMed Central

Hughes, Timothy; Deininger, Michael; Hochhaus, Andreas; Branford, Susan; Radich, Jerald; Kaeda, Jaspal; Baccarani, Michele; Cortes, Jorge; Cross, Nicholas C. P.; Druker, Brian J.; Gabert, Jean; Grimwade, David; Hehlmann, Rüdiger; Kamel-Reid, Suzanne; Lipton, Jeffrey H.; Longtine, Janina; Martinelli, Giovanni; Saglio, Giuseppe; Soverini, Simona; Stock, Wendy; Goldman, John M.

2006-01-01

The introduction in 1998 of imatinib mesylate (IM) revolutionized management of patients with chronic myeloid leukemia (CML) and the second generation of tyrosine kinase inhibitors may prove superior to IM. Real-time quantitative polymerase chain reaction (RQ-PCR) provides an accurate measure of the total leukemiacell mass and the degree to which BCR-ABL transcripts are reduced by therapy correlates with progression-free survival. Because a rising level of BCR-ABL is an early indication of loss of response and thus the need to reassess therapeutic strategy, regular molecular monitoring of individual patients is clearly desirable. Here we summarize the results of a consensus meeting that took place at the National Institutes of Health (NIH) in Bethesda in October 2005. We make suggestions for (1) harmonizing the differing methodologies for measuring BCR-ABL transcripts in patients with CML undergoing treatment and using a conversion factor whereby individual laboratories can express BCR-ABL transcript levels on an internationally agreed scale; (2) using serial RQ-PCR results rather than bone marrow cytogenetics or fluorescence in situ hybridization (FISH) for the BCR-ABL gene to monitor individual patients responding to treatment; and (3) detecting and reporting Philadelphia (Ph) chromosome-positive subpopulations bearing BCR-ABL kinase domain mutations. We recognize that our recommendations are provisional and will require revision as new evidence emerges. (Blood. 2006;108:28-37) PMID:16522812

Targeting the SH2-Kinase Interface in Bcr-Abl Inhibits Leukemogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grebien, Florian; Hantschel, Oliver; Wojcik, John

2012-10-25

Chronic myelogenous leukemia (CML) is caused by the constitutively active tyrosine kinase Bcr-Abl and treated with the tyrosine kinase inhibitor (TKI) imatinib. However, emerging TKI resistance prevents complete cure. Therefore, alternative strategies targeting regulatory modules of Bcr-Abl in addition to the kinase active site are strongly desirable. Here, we show that an intramolecular interaction between the SH2 and kinase domains in Bcr-Abl is both necessary and sufficient for high catalytic activity of the enzyme. Disruption of this interface led to inhibition of downstream events critical for CML signaling and, importantly, completely abolished leukemia formation in mice. Furthermore, disruption of themore » SH2-kinase interface increased sensitivity of imatinib-resistant Bcr-Abl mutants to TKI inhibition. An engineered Abl SH2-binding fibronectin type III monobody inhibited Bcr-Abl kinase activity both in vitro and in primary CML cells, where it induced apoptosis. This work validates the SH2-kinase interface as an allosteric target for therapeutic intervention.« less

Targeting the SH2-kinase interface in Bcr-Abl inhibits leukemogenesis.

PubMed

Grebien, Florian; Hantschel, Oliver; Wojcik, John; Kaupe, Ines; Kovacic, Boris; Wyrzucki, Arkadiusz M; Gish, Gerald D; Cerny-Reiterer, Sabine; Koide, Akiko; Beug, Hartmut; Pawson, Tony; Valent, Peter; Koide, Shohei; Superti-Furga, Giulio

2011-10-14

Chronic myelogenous leukemia (CML) is caused by the constitutively active tyrosine kinase Bcr-Abl and treated with the tyrosine kinase inhibitor (TKI) imatinib. However, emerging TKI resistance prevents complete cure. Therefore, alternative strategies targeting regulatory modules of Bcr-Abl in addition to the kinase active site are strongly desirable. Here, we show that an intramolecular interaction between the SH2 and kinase domains in Bcr-Abl is both necessary and sufficient for high catalytic activity of the enzyme. Disruption of this interface led to inhibition of downstream events critical for CML signaling and, importantly, completely abolished leukemia formation in mice. Furthermore, disruption of the SH2-kinase interface increased sensitivity of imatinib-resistant Bcr-Abl mutants to TKI inhibition. An engineered Abl SH2-binding fibronectin type III monobody inhibited Bcr-Abl kinase activity both in vitro and in primary CML cells, where it induced apoptosis. This work validates the SH2-kinase interface as an allosteric target for therapeutic intervention. Copyright © 2011 Elsevier Inc. All rights reserved.

Targeting the SH2-Kinase Interface in Bcr-Abl Inhibits Leukemogenesis

PubMed Central

Grebien, Florian; Hantschel, Oliver; Wojcik, John; Kaupe, Ines; Kovacic, Boris; Wyrzucki, Arkadiusz M.; Gish, Gerald D.; Cerny-Reiterer, Sabine; Koide, Akiko; Beug, Hartmut; Pawson, Tony; Valent, Peter; Koide, Shohei; Superti-Furga, Giulio

2011-01-01

Summary Chronic myelogenous leukemia (CML) is caused by the constitutively active tyrosine kinase Bcr-Abl and treated with the tyrosine kinase inhibitor (TKI) imatinib. However, emerging TKI resistance prevents complete cure. Therefore, alternative strategies targeting regulatory modules of Bcr-Abl in addition to the kinase active site are strongly desirable. Here, we show that an intramolecular interaction between the SH2 and kinase domains in Bcr-Abl is both necessary and sufficient for high catalytic activity of the enzyme. Disruption of this interface led to inhibition of downstream events critical for CML signaling and, importantly, completely abolished leukemia formation in mice. Furthermore, disruption of the SH2-kinase interface increased sensitivity of imatinib-resistant Bcr-Abl mutants to TKI inhibition. An engineered Abl SH2-binding fibronectin type III monobody inhibited Bcr-Abl kinase activity both in vitro and in primary CML cells, where it induced apoptosis. This work validates the SH2-kinase interface as an allosteric target for therapeutic intervention. PaperFlick PMID:22000011

Molecular analysis of the BCR-ABL1 kinase domain in chronic-phase chronic myelogenous leukemia treated with tyrosine kinase inhibitors in practice: study by the Nagasaki CML Study Group.

PubMed

Itonaga, Hidehiro; Tsushima, Hideki; Imanishi, Daisuke; Hata, Tomoko; Doi, Yuko; Mori, Sayaka; Sasaki, Daisuke; Hasegawa, Hiroo; Matsuo, Emi; Nakashima, Jun; Kato, Takeharu; Horai, Makiko; Taguchi, Masataka; Matsuo, Masatoshi; Taniguchi, Hiroaki; Makiyama, Junnya; Sato, Shinya; Horio, Kensuke; Ando, Koji; Moriwaki, Yuji; Sawayama, Yasushi; Ogawa, Daisuke; Yamasaki, Reishi; Takasaki, Yumi; Imaizumi, Yoshitaka; Taguchi, Jun; Kawaguchi, Yasuhisa; Yoshida, Shinichiro; Joh, Tatsuro; Moriuchi, Yukiyoshi; Nonaka, Hiroaki; Soda, Hisashi; Fukushima, Takuya; Nagai, Kazuhiro; Kamihira, Shimeru; Tomonaga, Masao; Yanagihara, Katsunori; Miyazaki, Yasushi

2014-01-01

An appropriate trigger for BCR-ABL1 mutation analysis has not yet been established in unselected cohorts of chronic-phase chronic myelogenous leukemia patients. We examined 92 patients after 12 months of tyrosine kinase inhibitor (TKI) treatment in Nagasaki Prefecture, Japan. Univariate analysis revealed that significant factors associated with not attaining a major molecular response (MMR) were the presence of the minor BCR-ABL1 fusion gene, a low daily dose of TKI, and the emergence of BCR-ABL1 kinase domain mutations conferring resistance to imatinib. Factors associated with the loss of sustained MMR were a low daily dose of TKI and the emergence of alternatively spliced BCR-ABL1 mRNA with a 35-nucleotide insertion. Taken together, our results suggest that the search for BCR-ABL1 mutations should be initiated if patients have not achieved MMR following 12 months of TKI treatment. Copyright © 2013 Elsevier Ltd. All rights reserved.

Dual Drug Targeting of Mutant Bcr-Abl Induces Inactive Conformation: New Strategy for the Treatment of Chronic Myeloid Leukemia and Overcoming Monotherapy Resistance.

PubMed

El Rashedy, Ahmed A; Olotu, Fisayo A; Soliman, Mahmoud E S

2018-03-01

Bcr-Abl is an oncogenic fusion protein which expression enhances tumorigenesis, and has been highly associated with chronic myeloid leukemia (CML). Acquired drug resistance in mutant Bcr-Abl has enhanced pathogenesis with the use of single therapy agents such as nilotinib. Moreover, allosteric targeting has been identified to consequentially inhibit Bcr-Abl activity, which led to the recent development of ABL-001 (asciminib) that selectively binds the myristoyl pocket. Experimental studies have revealed that the combination of nilotinib and ABL-001 induced a 'bent' conformation in the C-terminal helix of Bcr-Abl; a benchmark of inhibition, thereby exhibiting a greater potency in the treatment of CML, surmounting the setbacks of drug resistance, disease regression and relapse. Therefore, we report the first account of the dynamics and conformational analysis of oncogenic T334I Bcr-Abl by dual targeting. Our findings revealed that unlike in the Bcr-Abl-Nilotinib complex, dual targeting by both inhibitors induced the bent conformation in the C-terminal helix that varied with time. This was coupled with significant alteration in Bcr-Abl stability, flexibility, and compactness and an overall structural re-orientation inwards towards the hydrophobic core, which reduced the solvent-exposed residues indicative of protein folding. This study will facilitate allosteric targeting and the design of more potent allosteric inhibitors for resistive target proteins in cancer. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

Transposon-mediated generation of BCR-ABL1-expressing transgenic cell lines for unbiased sensitivity testing of tyrosine kinase inhibitors.

PubMed

Byrgazov, Konstantin; Lucini, Chantal Blanche; Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A; Hoermann, Gregor; Valent, Peter; Lion, Thomas

2016-11-22

Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance.

Transposon-mediated generation of BCR-ABL1-expressing transgenic cell lines for unbiased sensitivity testing of tyrosine kinase inhibitors

PubMed Central

Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A.; Hoermann, Gregor; Valent, Peter; Lion, Thomas

2016-01-01

Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance. PMID:27801667

Evaluation of deoxyhypusine synthase inhibitors targeting BCR-ABL positive leukemias.

PubMed

Ziegler, Patrick; Chahoud, Tuhama; Wilhelm, Thomas; Pällman, Nora; Braig, Melanie; Wiehle, Valeska; Ziegler, Susanne; Schröder, Marcus; Meier, Chris; Kolodzik, Adrian; Rarey, Matthias; Panse, Jens; Hauber, Joachim; Balabanov, Stefan; Brümmendorf, Tim H

2012-12-01

Effective inhibition of BCR-ABL tyrosine kinase activity with Imatinib represents a breakthrough in the treatment of patients with chronic myeloid leukemia (CML). However, more than 30 % of patients with CML in chronic phase do not respond adequately to Imatinib and the drug seems not to affect the quiescent pool of BCR-ABL positive leukemic stem and progenitor cells. Therefore, despite encouraging clinical results, Imatinib can still not be considered a curative treatment option in CML. We recently reported downregulation of eukaryotic initiation factor 5A (eIF5A) in Imatinib treated K562 cells. Furthermore, the inhibition of eIF5A by siRNA in combination with Imatinib has been shown to exert synergistic cytotoxic effects on BCR-ABL positive cell lines. Based on the structure of known deoxyhypusine synthase (DHS) inhibitors such as CNI-1493, a drug design approach was applied to develop potential compounds targeting DHS. Here we report the biological evaluation of selected novel (DHSI-15) as compared to established (CNI-1493, deoxyspergualin) DHS inhibitors. We show that upon the compounds tested, DHSI-15 and deoxyspergualin exert strongest antiproliferative effects on BCR-ABL cells including Imatinib resistant mutants. However, this effect did not seem to be restricted to BCR-ABL positive cell lines or primary cells. Both compounds are able to induce apoptosis/necrosis during long term incubation of BCR-ABL positive BA/F3 derivates. Pharmacological synergism can be observed for deoxyspergualin and Imatinib, but not for DHSI-15 and Imatinib. Finally we show that deoxyspergualin is able to inhibit proliferation of CD34+ progenitor cells from CML patients. We conclude that inhibition of deoxyhypusine synthase (DHS) can be supportive for the anti-proliferative treatment of leukemia and merits further investigation including other cancers.

Development of protein degradation inducers of oncogenic BCR-ABL protein by conjugation of ABL kinase inhibitors and IAP ligands.

PubMed

Shibata, Norihito; Miyamoto, Naoki; Nagai, Katsunori; Shimokawa, Kenichiro; Sameshima, Tomoya; Ohoka, Nobumichi; Hattori, Takayuki; Imaeda, Yasuhiro; Nara, Hiroshi; Cho, Nobuo; Naito, Mikihiko

2017-08-01

Chromosomal translocation occurs in some cancer cells, which results in the expression of aberrant oncogenic fusion proteins that include BCR-ABL in chronic myelogenous leukemia (CML). Inhibitors of ABL tyrosine kinase, such as imatinib and dasatinib, exhibit remarkable therapeutic effects, although emergence of drug resistance hampers the therapy during long-term treatment. An alternative approach to treat CML is to downregulate the BCR-ABL protein. We have devised a protein knockdown system by hybrid molecules named Specific and Non-genetic inhibitor of apoptosis protein [IAP]-dependent Protein Erasers (SNIPER), which is designed to induce IAP-mediated ubiquitylation and proteasomal degradation of target proteins, and a couple of SNIPER(ABL) against BCR-ABL protein have been developed recently. In this study, we tested various combinations of ABL inhibitors and IAP ligands, and the linker was optimized for protein knockdown activity of SNIPER(ABL). The resulting SNIPER(ABL)-39, in which dasatinib is conjugated to an IAP ligand LCL161 derivative by polyethylene glycol (PEG) × 3 linker, shows a potent activity to degrade the BCR-ABL protein. Mechanistic analysis suggested that both cellular inhibitor of apoptosis protein 1 (cIAP1) and X-linked inhibitor of apoptosis protein (XIAP) play a role in the degradation of BCR-ABL protein. Consistent with the degradation of BCR-ABL protein, the SNIPER(ABL)-39 inhibited the phosphorylation of signal transducer and activator of transcription 5 (STAT5) and Crk like proto-oncogene (CrkL), and suppressed the growth of BCR-ABL-positive CML cells. These results suggest that SNIPER(ABL)-39 could be a candidate for a degradation-based novel anti-cancer drug against BCR-ABL-positive CML. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

α-bisabolol Is an Effective Proapoptotic Agent against BCR-ABL+ Cells in Synergism with Imatinib and Nilotinib

PubMed Central

Bonifacio, Massimiliano; Rigo, Antonella; Guardalben, Emanuele; Bergamini, Christian; Cavalieri, Elisabetta; Fato, Romana; Pizzolo, Giovanni; Vinante, Fabrizio

2012-01-01

We showed that α-bisabolol is active against primary acute leukemia cells, including BCR-ABL+ acute lymphoblastic leukemias (ALL). Here we studied the activity of α-bisabolol against BCR-ABL+ cells using 3 cell lines (K562, LAMA-84, CML-T1) and 10 primary BCR-ABL+ ALL samples. We found that: (a) α-bisabolol was effective in reducing BCR-ABL+ cell viabilty at concentrations ranging from 53 to 73 µM; (b) α-bisabolol concentrations in BCR-ABL+ cellular compartments were 4- to 12-fold higher than in normal cells, thus indicating a preferential intake in neoplastic cells; (c) α-bisabolol displayed a slight to strong synergism with the Tyrosine Kinase Inhibitors (TKI) imatinib and nilotinib: the combination of α-bisabolol+imatinib allowed a dose reduction of each compound up to 7.2 and 9.4-fold respectively, while the combination of α-bisabolol+nilotinib up to 6.7 and 5-fold respectively; (d) α-bisabolol-induced apoptosis was associated with loss of plasma membrane integrity, irreversible opening of mitochondrial transition pore, disruption of mitochondrial potential, inhibition of oxygen consumption and increase of intracellular reactive oxygen species. These data indicate α-bisabolol as a candidate for treatment of BCR-ABL+ leukemias to overcome resistance to TKI alone and to target leukemic cells through BCR-ABL-independent pathways. PMID:23056396

Identification of novel posttranscriptional targets of the BCR/ABL oncoprotein by ribonomics: requirement of E2F3 for BCR/ABL leukemogenesis

PubMed Central

Eiring, Anna M.; Neviani, Paolo; Santhanam, Ramasamy; Oaks, Joshua J.; Chang, Ji Suk; Notari, Mario; Willis, William; Gambacorti-Passerini, Carlo; Volinia, Stefano; Marcucci, Guido; Caligiuri, Michael A.; Leone, Gustavo W.

2008-01-01

Several RNA binding proteins (RBPs) have been implicated in the progression of chronic myelogenous leukemia (CML) from the indolent chronic phase to the aggressively fatal blast crisis. In the latter phase, expression and function of specific RBPs are aberrantly regulated at transcriptional or posttranslational levels by the constitutive kinase activity of the BCR/ABL oncoprotein. As a result, altered expression/function of RBPs leads to increased resistance to apoptotic stimuli, enhanced survival, growth advantage, and differentiation arrest of CD34+ progenitors from patients in CML blast crisis. Here, we identify the mRNAs bound to the hnRNP-A1, hnRNP-E2, hnRNP-K, and La/SSB RBPs in BCR/ABLtransformed myeloid cells. Interestingly, we found that the mRNA encoding the transcription factor E2F3 associates to hnRNP-A1 through a conserved binding site located in the E2F3 3′ untranslated region (UTR). E2F3 levels were up-regulated in CML-BCCD34+ in a BCR/ABL kinase– and hnRNP-A1 shuttling–dependent manner. Moreover, by using shRNA-mediated E2F3 knock-down and BCR/ABL-transduced lineage-negative bone marrow cells from E2F3+/+ and E2F3−/− mice, we show that E2F3 expression is important for BCR/ABL clonogenic activity and in vivo leukemogenic potential. Thus, the complexity of the mRNA/RBP network, together with the discovery of E2F3 as an hnRNP-A1–regulated factor, outlines the relevant role played by RBPs in posttranscriptional regulation of CML development and progression. PMID:17925491

Activation of tyrosine kinases by mutation of the gatekeeper threonine

PubMed Central

Azam, Mohammad; Seeliger, Markus A; Gray, Nathanael S; Kuriyan, John; Daley, George Q

2008-01-01

Protein kinases targeted by small-molecule inhibitors develop resistance through mutation of the ‘gatekeeper’ threonine residue of the active site. Here we show that the gatekeeper mutation in the cellular forms of c-ABL, c-SRC, platelet-derived growth factor receptor-α and -β, and epidermal growth factor receptor activates the kinase and promotes malignant transformation of BaF3 cells. Structural analysis reveals that a network of hydrophobic interactions—the hydrophobic spine—characteristic of the active kinase conformation is stabilized by the gatekeeper substitution. Substitution of glycine for the residues constituting the spine disrupts the hydrophobic connectivity and inactivates the kinase. Furthermore, a small-molecule inhibitor that maximizes complementarity with the dismantled spine (compound 14) inhibits the gatekeeper mutation of BCR-ABL-T315I. These results demonstrate that mutation of the gatekeeper threonine is a common mechanism of activation for tyrosine kinases and provide structural insights to guide the development of next-generation inhibitors. PMID:18794843

Identification of e6a2 BCR-ABL fusion in a Philadelphia-positive CML with marked basophilia: implications for treatment strategy.

PubMed

Rohon, Peter; Divoka, Martina; Calabkova, Lenka; Mojzikova, Renata; Katrincsakova, Beata; Rusinakova, Zuzana; Lapcikova, Anna; Raida, Ludek; Faber, Edgar; Jarosova, Marie; Divoky, Vladimir; Indrak, Karel

2011-06-01

This is a case report of a 51 year old male with marked splenomegaly, basophilia, severe thrombocytopenia, anemia and high SFKL phosphorylation downstream of Bcr-Abl, investigated for association of the e6a2 BCR-ABL fusion gene and marked basophilia. The treatment strategy implications in patients with Philadelphia positive CML are described. RT-PCR and sequencing were carried out on the peripheral blood leukocytes to detect the type of BCR-ABL transcript. The BCR-ABL mutational status was assessed using sequencing of the RT-PCR products. The in vitro test of sensitivity to TKIs was based on detecting inhibited phosphorylation of the Crkl and Phospho-Src family kinases (SFK, Tyr416) using immunodetection. The cytogenetics revealed 90% of Ph+ (Philadelphia) cells in the bone marrow aspirate with no additional clonal chromosomal abnormalities at diagnosis. This correlated with an accelerated phase of the CML. Sequencing analysis of reverse transcribed and PCR amplified BCR-ABL transcript revealed a rare e6a2 fusion, with no evidence for Bcr-Abl kinase domain mutation. Western blot analysis showed high phosphorylation (activation) of Crkl and the Src family of kinases (P-SFK). In vitro test of sensitivity of the patients' leukemic cells to imatinib demonstrated sensitivity of Bcr-Abl tyrosine kinase to imatinib, as assessed by a decrease in phosphorylated Crkl and the disappearance of P-SFK, suggesting that P-Src reflects only the Bcr-Abl-dependent Src activity. The initial treatment strategy was reduced imatinib and search for an unrelated hematopoietic stem cell donor (according to the ELN recommendations). The patient was allografted with peripheral stem cells from an HLA- identical male donor but on day +70 graft failure occurred. He was allografted again with the peripheral stem cells from an HLA-identical female donor, engrafted on day +15 and showed 100% donor chimerism with no evidence of the e6a2 BCR-ABL fusion transcript on day +30. The clinical disease

Low expression of Abelson interactor-1 is linked to acquired drug resistance in Bcr-Abl induced leukemia

PubMed Central

Chorzalska, Anna; Salloum, Ibrahem; Shafqat, Hammad; Khan, Saad; Marjon, Philip; Treaba, Diana; Schorl, Christoph; Morgan, John; Bryke, Christine R.; Falanga, Vincent; Zhao, Thing C.; Reagan, John; Winer, Eric; Olszewski, Adam; Al-Homsi, Samer; Kouttab, Nicola; Dubielecka, Patrycja M.

2014-01-01

The basis for persistence of leukemic stem cells in the bone marrow microenvironment (BMME) remains poorly understood. We present evidence that signaling crosstalk between α4 integrin and Abelson interactor-1 (Abi-1) is involved in acquisition of an anchorage-dependent phenotype and drug resistance in Bcr-Abl positive leukemia cells. Comparison of Abi-1 (ABI-1) and α4 integrin (ITGA4) gene expression in relapsing Bcr-Abl positive CD34+ progenitor cells demonstrated a reduction in Abi-1 and an increase in α4 integrin mRNA in the absence of Bcr-Abl mutations. This inverse correlation between Abi-1 and α4 integrin expression, as well as linkage to elevated phospho-Akt and phospho-Erk signaling, was confirmed in imatinib mesylate (IM) resistant leukemic cells. These results indicate that the α4-Abi-1 signaling pathway may mediate acquisition of the drug resistant phenotype of leukemic cells. PMID:24699303

A BCR-ABL Kinase Activity-Independent Signaling Pathway in Chronic Myelogenous Leukemia

DTIC Science & Technology

2008-02-01

myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood. 1998;92:3780-3792. 17. Zhang X, Ren R. Bcr-Abl efficiently induces a... myeloproliferative disease and production of excess interleukin-3 and granulocyte-macrophage colony-stimulating factor in mice: a novel model for chronic...Xu L, et al. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced

Wnt/Ca2+/NFAT signaling maintains survival of Ph+ leukemia cells upon inhibition of Bcr-Abl

PubMed Central

Gregory, Mark A.; Phang, Tzu L.; Neviani, Paolo; Alvarez-Calderon, Francesca; Eide, Christopher A.; O’Hare, Thomas; Zaberezhnyy, Vadym; Williams, Richard T.; Druker, Brian J.; Perrotti, Danilo; DeGregori, James

2010-01-01

Summary Although Bcr-Abl kinase inhibitors have proven effective in the treatment of chronic myeloid leukemia (CML), they generally fail to completely eradicate Bcr-Abl+ leukemia cells. To identify genes whose inhibition sensitizes Bcr-Abl+ leukemias to killing by Bcr-Abl inhibitors, we performed an RNAi-based synthetic lethal screen with imatinib in CML cells. This screen identified numerous components of a Wnt/Ca2+/NFAT signaling pathway. Antagonism of this pathway led to impaired NFAT activity, decreased cytokine production and enhanced sensitivity to Bcr-Abl inhibition. Furthermore, NFAT inhibition with cyclosporin A facilitated leukemia cell elimination by the Bcr-Abl inhibitor dasatinib and markedly improved survival in a mouse model of Bcr-Abl+ acute lymphoblastic leukemia (ALL). Targeting this pathway in combination with Bcr-Abl inhibition could improve treatment of Bcr-Abl+ leukemias. PMID:20609354

Coexistence of inversion 16 and the Philadelphia chromosome comprising P190 BCR/ABL in chronic myeloid leukemia blast crisis.

PubMed

Ninomiya, Soranobu; Kanemura, Nobuhiro; Tsurumi, Hisashi; Kasahara, Senji; Hara, Takeshi; Yamada, Toshiki; Moriwaki, Hisataka

2011-06-01

A 63-year-old woman presented with leukocytosis (278 × 10(9)/L) with 72% blasts. Bone marrow blast cells showed cytogenetic abnormality with 46,XX, t(9;22), inv(16). Despite achievement of hematological remission by induction chemotherapy, Philadelphia chromosome did not disappear; chronic myeloid leukemia (CML) in blast crisis (BC) was thus diagnosed. The P190 BCR/ABL fusion transcript was detected. Imatinib mesylate introduced a hematological remission of short duration; however, infiltration into the central nervous system occurred, and the patient died 7 months after presentation. Coexistence of inv(16) and t(9:22) has been described in CML-BC and de novo AML, and CML-BC patients always carry P210 BCR/ABL, while de novo AML patients usually have P190 BCR/ABL. To the best of our knowledge, this is the first report of CML-BC with inv(16) and P190 BCR/ABL. We discuss this case with reference to the literature.

Disrupting BCR-ABL in combination with secondary leukemia-specific pathways in CML cells leads to enhanced apoptosis and decreased proliferation.

PubMed

Woessner, David W; Lim, Carol S

2013-01-07

Chronic myeloid leukemia (CML) is a myeloproliferative disorder caused by expression of the fusion gene BCR-ABL following a chromosomal translocation in the hematopoietic stem cell. Therapeutic management of CML uses tyrosine kinase inhibitors (TKIs), which block ABL-signaling and effectively kill peripheral cells with BCR-ABL. However, TKIs are not curative, and chronic use is required in order to treat CML. The primary failure for TKIs is through the development of a resistant population due to mutations in the TKI binding regions. This led us to develop the mutant coiled-coil, CC(mut2), an alternative method for BCR-ABL signaling inhibition by targeting the N-terminal oligomerization domain of BCR, necessary for ABL activation. In this article, we explore additional pathways that are important for leukemic stem cell survival in K562 cells. Using a candidate-based approach, we test the combination of CC(mut2) and inhibitors of unique secondary pathways in leukemic cells. Transformative potential was reduced following silencing of the leukemic stem cell factor Alox5 by RNA interference. Furthermore, blockade of the oncogenic protein MUC-1 by the novel peptide GO-201 yielded reductions in proliferation and increased cell death. Finally, we found that inhibiting macroautophagy using chloroquine in addition to blocking BCR-ABL signaling with the CC(mut2) was most effective in limiting cell survival and proliferation. This study has elucidated possible combination therapies for CML using novel blockade of BCR-ABL and secondary leukemia-specific pathways.

Growth of chronic myeloid leukemia cells is inhibited by infection with Ad-SH2-HA adenovirus that disrupts Grb2-Bcr-Abl complexes.

PubMed

Peng, Zhi; Luo, Hong-Wei; Yuan, Ying; Shi, Jing; Huang, Shi-Feng; Li, Chun-Li; Cao, Wei-Xi; Huang, Zong-Gan; Feng, Wen-Li

2011-05-01

The persistence of Bcr-Abl-positive cells in patients on imatinib therapy indicates that inhibition of the Bcr-Abl kinase activity alone might not be sufficient to eradicate the leukemia cells. Many downstream effectors of Bcr-Abl have been described, including activation of both the Grb2-SoS-Ras-MAPK and Grb2-Gab2-PI3K-Akt pathways. The Bcr-Abl-Grb2 interaction, which is mediated by the direct interaction of the Grb2 SH2 domain with the phospho-Bcr-Abl Y177, is required for activation of these signaling pathways. Therefore, disrupting their interaction represents a potential therapeutic strategy for inhibiting the oncogenic downstream signals of Bcr-Abl. Adenovirus Ad-SH2-HA expressing the Grb2 SH2 domain was constructed and applied in this study. As expected, Ad-SH2-HA efficiently infected CML cells and functioned by binding to the phospho-Bcr-Abl Y177 site, competitively disrupting the Grb2 SH2-phospho-Bcr-Abl Y177 complex. They induced potent anti-proliferation and apoptosis-inducing effects in CML cell lines. Moreover, the Ras, MAPK and Akt activities were significantly reduced in the Ad-SH2-HA treated cells. These were not observed with the point-mutated control adenovirus Ad-Sm-HA with abolished phospho-Bcr-Abl Y177 binding sites. These data indicate that, in addition to the direct targeting of Bcr-Abl, selective inhibition of its downstream signaling pathways may be a therapeutic option for CML, and the Ad-SH2-HA-mediated killing strategy could be explored as a promising anti-leukemia agent in CML.

Current and future management of Ph/BCR-ABL positive ALL.

PubMed

Maino, Elena; Sancetta, Rosaria; Viero, Piera; Imbergamo, Silvia; Scattolin, Anna Maria; Vespignani, Michele; Bassan, Renato

2014-06-01

Following the introduction of targeted therapy with tyrosine kinase inhibitors (TKI) at the beginning of the past decade, the outcome of patients with Philadelphia-chromosome positive acute lymphoblastic leukemia (Ph+ ALL) has dramatically improved. Presently, the use of refined programs with first/second generation TKI's and chemotherapy together with allogeneic stem cell transplantation allow up to 50% of all patients to be cured. Further progress is expected with the new TKI ponatinib, overcoming resistance caused by T315I point mutation, other targeted therapies, autologous transplantation in molecularly negative patients, therapeutic monoclonal antibodies like inotuzumab ozogamicin and blinatumomab, and chimeric antigen receptor-modified T cells. Ph+ ALL could become curable in the near future even without allogeneic stem cell transplantation, minimizing the risk of therapy-related death and improving greatly the quality of patients' life.

Hydroxychavicol, a Piper betle leaf component, induces apoptosis of CML cells through mitochondrial reactive oxygen species-dependent JNK and endothelial nitric oxide synthase activation and overrides imatinib resistance.

PubMed

Chakraborty, Jayashree B; Mahato, Sanjit K; Joshi, Kalpana; Shinde, Vaibhav; Rakshit, Srabanti; Biswas, Nabendu; Choudhury Mukherjee, Indrani; Mandal, Labanya; Ganguly, Dipyaman; Chowdhury, Avik A; Chaudhuri, Jaydeep; Paul, Kausik; Pal, Bikas C; Vinayagam, Jayaraman; Pal, Churala; Manna, Anirban; Jaisankar, Parasuraman; Chaudhuri, Utpal; Konar, Aditya; Roy, Siddhartha; Bandyopadhyay, Santu

2012-01-01

Alcoholic extract of Piper betle (Piper betle L.) leaves was recently found to induce apoptosis of CML cells expressing wild type and mutated Bcr-Abl with imatinib resistance phenotype. Hydroxy-chavicol (HCH), a constituent of the alcoholic extract of Piper betle leaves, was evaluated for anti-CML activity. Here, we report that HCH and its analogues induce killing of primary cells in CML patients and leukemic cell lines expressing wild type and mutated Bcr-Abl, including the T315I mutation, with minimal toxicity to normal human peripheral blood mononuclear cells. HCH causes early but transient increase of mitochondria-derived reactive oxygen species. Reactive oxygen species-dependent persistent activation of JNK leads to an increase in endothelial nitric oxide synthase-mediated nitric oxide generation. This causes loss of mitochondrial membrane potential, release of cytochrome c from mitochondria, cleavage of caspase 9, 3 and poly-adenosine diphosphate-ribose polymerase leading to apoptosis. One HCH analogue was also effective in vivo in SCID mice against grafts expressing the T315I mutation, although to a lesser extent than grafts expressing wild type Bcr-Abl, without showing significant bodyweight loss. Our data describe the role of JNK-dependent endothelial nitric oxide synthase-mediated nitric oxide for anti-CML activity of HCH and this molecule merits further testing in pre-clinical and clinical settings. © 2011 Japanese Cancer Association.

Co-expression of HoxA9 and bcr-abl genes in chronic myeloid leukemia.

PubMed

Tedeschi, Fabián A; Cardozo, Maria A; Valentini, Rosanna; Zalazar, Fabián E

2010-05-01

We have analyzed the co-expression of the bcr-abl and HoxA9 genes in the follow-up of patients with chronic myeloid leukemia (CML). In the present work we measured the HoxA9 and bcr-abl gene expression in sequential samples. In all patients, bcr-abl and HoxA9 were expressed at detectable levels in every sample. When the results were expressed in relation to abl, two different situations were found: (a) patients clinically stable at second sampling, with low relative risk at diagnosis (low Sokal's score), did not show significant differences in both bcr-abl and HoxA9 levels in the sequential samples analyzed, and (b) patients with poor prognosis (showing intermediate or high Sokal's score at diagnosis) had increased expression of bcr-abl as well as HoxA9 genes (p < 0.05). Since HoxA9 gene expression remains at relatively constant levels throughout adult life, our results could reflect actual changes in the expression rate of this gene associated with bcr-abl during the progression of CML.

In chronic myeloid leukemia patients on second-line tyrosine kinase inhibitor therapy, deep sequencing of BCR-ABL1 at the time of warning may allow sensitive detection of emerging drug-resistant mutants.

PubMed

Soverini, Simona; De Benedittis, Caterina; Castagnetti, Fausto; Gugliotta, Gabriele; Mancini, Manuela; Bavaro, Luana; Machova Polakova, Katerina; Linhartova, Jana; Iurlo, Alessandra; Russo, Domenico; Pane, Fabrizio; Saglio, Giuseppe; Rosti, Gianantonio; Cavo, Michele; Baccarani, Michele; Martinelli, Giovanni

2016-08-02

Imatinib-resistant chronic myeloid leukemia (CML) patients receiving second-line tyrosine kinase inhibitor (TKI) therapy with dasatinib or nilotinib have a higher risk of disease relapse and progression and not infrequently BCR-ABL1 kinase domain (KD) mutations are implicated in therapeutic failure. In this setting, earlier detection of emerging BCR-ABL1 KD mutations would offer greater chances of efficacy for subsequent salvage therapy and limit the biological consequences of full BCR-ABL1 kinase reactivation. Taking advantage of an already set up and validated next-generation deep amplicon sequencing (DS) assay, we aimed to assess whether DS may allow a larger window of detection of emerging BCR-ABL1 KD mutants predicting for an impending relapse. a total of 125 longitudinal samples from 51 CML patients who had acquired dasatinib- or nilotinib-resistant mutations during second-line therapy were analyzed by DS from the time of failure and mutation detection by conventional sequencing backwards. BCR-ABL1/ABL1%(IS) transcript levels were used to define whether the patient had 'optimal response', 'warning' or 'failure' at the time of first mutation detection by DS. DS was able to backtrack dasatinib- or nilotinib-resistant mutations to the previous sample(s) in 23/51 (45 %) pts. Median mutation burden at the time of first detection by DS was 5.5 % (range, 1.5-17.5 %); median interval between detection by DS and detection by conventional sequencing was 3 months (range, 1-9 months). In 5 cases, the mutations were detectable at baseline. In the remaining cases, response level at the time mutations were first detected by DS could be defined as 'Warning' (according to the 2013 ELN definitions of response to 2nd-line therapy) in 13 cases, as 'Optimal response' in one case, as 'Failure' in 4 cases. No dasatinib- or nilotinib-resistant mutations were detected by DS in 15 randomly selected patients with 'warning' at various timepoints, that later turned into optimal

Interphase FISH for BCR-ABL1 rearrangement on neutrophils: A decisive tool to discriminate a lymphoid blast crisis of chronic myeloid leukemia from a de novo BCR-ABL1 positive acute lymphoblastic leukemia.

PubMed

Balducci, Estelle; Loosveld, Marie; Rahal, Ilhem; Boudjarane, John; Alazard, Emilie; Missirian, Chantal; Lafage-Pochitaloff, Marina; Michel, Gérard; Zattara, Hélène

2018-02-01

Discrimination between lymphoid blast crisis of chronic myeloid leukemia (CML) and de novo BCR-ABL1 positive acute lymphoblastic leukemia (ALL) represents a diagnostic challenge because this distinction has a major incidence on the management of patients. Here, we report an uncommon pediatric case of ALL with cryptic ins(22;9)(q11;q34q34) and p190-type BCR-ABL1 transcript. We performed interphase fluorescence in situ hybridization (FISH) for BCR-ABL1 rearrangement on blood neutrophils, which was positive consistent with the diagnosis of lymphoid blast crisis of CML. This case illustrates the major interest of interphase FISH for BCR-ABL1 rearrangement on blood neutrophils as a decisive method to discriminate a lymphoid blast crisis of CML from a de novo BCR-ABL1 positive ALL. Copyright © 2017 John Wiley & Sons, Ltd.

[JAK2 V617F and exon 12 genetic variations in Korean patients with BCR/ABL1-negative myeloproliferative neoplasms].

PubMed

Kim, Jeong Tae; Cho, Yong Gon; Choi, Sam Im; Lee, Young Jin; Kim, Hye Ran; Jang, Sook Jin; Moon, Dae Soo; Park, Young Jin; Park, Geon

2010-12-01

JAK2 genetic variations have been described in a high proportion of patients with BCR/ABL1-negative myeloproliferative neoplasms (MPN). This study was designed to analyze the frequencies of JAK2 V617F and exon 12 variations, and their correlations with clinical characteristics of Korean patients with BCR/ABL1-negative MPN. We examined a total of 154 patients with BCR/ABL1-negative MPN that included 24, 26, 89, and 15 patients with polycythemia vera (PV), primary myelofibrosis (PMF), essential thrombocythemia (ET), and unclassified myeloproliferative neoplasms (MPNU), respectively. We performed allele-specific PCR to detect V617F in all BCR/ABL1-negative patients, and performed direct sequencing to detect exon 12 variations in 47 V617F-negative MPN patients. JAK2 c.1641+179_183del5 variation was detected by restriction fragment length polymorphism assay in 176 healthy subjects. JAK2 V617F was detected in 91 patients (59.1%): PV (91.6%), PMF (46.2%), ET (52.8%), and MPNU (66.7%). In V617F-negative MPN patients, no mutations were found in exon 12. The c.1641+179_183del5 was detected in 68.1% of V617F-negative MPN patients and 45.4% of healthy subjects (P=0.008). JAK2 V617F was closely correlated with age and leukocytosis in BCR/ABL1-negative MPN patients (P<0.05). However, c.1641+179_183del5 was not related to age, sex, or complete blood cell count parameters in V617F-negative MPN patients and healthy subjects. The c.1641+179_183del5 was associated with an increased odds ratio for MPN (odds ratio, 2.6; 95% confidences interval, 1.3-5.1; P=0.007). Frequencies of V617F are similar to reported results. JAK2 exon 12 mutations may be rare and c.1641+179_183del5 may influence the occurrence of MPN in Korean patients with V6 17F-negative MPN.

Ponatinib in the leukemia world: why a reevaluation is necessary for Philadelphia chromosome-positive patients with T315I mutation.

PubMed

Goodrich, Angelina Daisy

2014-10-01

Strategic drug design is used to meet the needs of numerous diseases for which there is no other recourse. Take the T315I mutation, for example, which occurs in Philadelphia chromosome-positive leukemias and renders all currently available tissue kinase inhibitors useless. The US FDA therefore saw it fit to avail ponatinib, the therapeutic result of careful drug design, to patients based on early data. However, its sales and marketing were later suspended due to emerging safety concerns. This drug has now returned to market albeit with tighter labeling. While the lesson for early approvals may be to restrict the drug to as narrow a patient population as possible, the potential benefits of this drug for the target population must not be lost amidst the controversy.

Clinical roundtable monograph: Emerging treatment options for TKI-resistant chronic myelogenous leukemia.

PubMed

Cortes, Jorge; Radich, Jerald; Mauro, Michael J

2012-10-01

The development of tyrosine kinase inhibitors (TKIs) that inhibit signaling of the constitutive BCR-ABL protein revolutionized the treatment of chronic myelogenous leukemia (CML). These agents have dramatically changed the treatment landscape for CML, shifting the use of allogeneic stem cell transplantation to selected patients in the salvage setting. Four BCR-ABL TKIs are now commercially available for the treatment of CML: the first-generation TKI imatinib, and the second-generation TKIs dasatinib, nilotinib, and bosutinib. Continuous treatment with these agents induces durable responses in a high proportion of patients with chronic-phase CML. Research is focused on identifying which patients can discontinue therapy without a recurrence of disease. For the group of patients with resistance to TKIs, multiple alternative therapies are being evaluated. The third-generation TKI ponatinib is a BCR-ABL inhibitor that has demonstrated significant activity, including in patients with the TKI resistance mutation T315I. The homoharringtonine derivative omacetaxine mepesuccinate, which inhibits protein synthesis, has also demonstrated clinical activity in CML, including in patients with TKI resistance due to T315I and in patients who have TKI resistance despite no evidence of ABL mutations. It is essential that clinicians implement these new agents with care and change therapies only when appropriate in order to preserve as many options as possible for future use if needed.

BCR-ABL1-like acute lymphoblastic leukaemia: From bench to bedside.

PubMed

Boer, Judith M; den Boer, Monique L

2017-09-01

Acute lymphoblastic leukaemia (ALL) occurs in approximately 1:1500 children and is less frequently found in adults. The most common immunophenotype of ALL is the B cell lineage and within B cell precursor ALL, specific genetic aberrations define subtypes with distinct biological and clinical characteristics. With more advanced genetic analysis methods such as whole genome and transcriptome sequencing, novel genetic subtypes have recently been discovered. One novel class of genetic aberrations comprises tyrosine kinase-activating lesions, including translocations and rearrangements of tyrosine kinase and cytokine receptor genes. These newly discovered genetic aberrations are harder to detect by standard diagnostic methods such as karyotyping, fluorescent in situ hybridisation (FISH) or polymerase chain reaction (PCR) because they are diverse and often cryptic. These lesions involve one of several tyrosine kinase genes (among others, v-abl Abelson murine leukaemia viral oncogene homologue 1 (ABL1), v-abl Abelson murine leukaemia viral oncogene homologue 2 (ABL2), platelet-derived growth factor receptor beta polypeptide (PDGFRB)), each of which can be fused to up to 15 partner genes. Together, they compose 2-3% of B cell precursor ALL (BCP-ALL), which is similar in size to the well-known fusion gene BCR-ABL1 subtype. These so-called BCR-ABL1-like fusions are mutually exclusive with the sentinel translocations in BCP-ALL (BCR-ABL1, ETV6-RUNX1, TCF3-PBX1, and KMT2A (MLL) rearrangements) and have the promising prospect to be sensitive to tyrosine kinase inhibitors similar to BCR-ABL1. In this review, we discuss the types of tyrosine kinase-activating lesions discovered, and the preclinical and clinical evidence for the use of tyrosine kinase inhibitors in the treatment of this novel subtype of ALL. Copyright © 2017 Elsevier Ltd. All rights reserved.

Long-term remission in BCR/ABL-positive AML-M6 patient treated with Imatinib Mesylate.

PubMed

Pompetti, Franca; Spadano, Antonio; Sau, Antonella; Mennucci, Antonio; Russo, Rosa; Catinella, Virginia; Franchi, Paolo Guanciali; Calabrese, Giuseppe; Palka, Giandomenico; Fioritoni, Giuseppe; Iacone, Antonio

2007-04-01

BCR/ABL-positive acute myeloid leukemia (AML) is a rare disease, characterized by a poor prognosis, with resistance to induction chemotherapy and frequent relapses in responsive patients. Here we report a case of BCR/ABL-positive AML-M6 who, after relapse, was treated with Imatinib Mesylate (600 mg/die) and within 4 months achieved a cytogenetic and molecular complete response. After more than 4 years of continuous Imatinib therapy, nested RT-PCR for BCR/ABL is persistently negative. The case reported shows that the response obtained with Imatinib Mesylate in BCR/ABL-positive AML may be long lasting, offering a chance of successful treatment for this poor prognosis group of patients.

Deregulated expression of Cdc6 as BCR/ABL-dependent survival factor in chronic myeloid leukemia cells.

PubMed

Zhang, Jia-Hua; He, Yan-Li; Zhu, Rui; Du, Wen; Xiao, Jun-Hua

2017-06-01

Chronic myeloid leukemia is characterized by the presence of the reciprocal translocation t(9;22) and the BCR/ABL oncogene. The BCR/ABL oncogene activates multiple signaling pathways and involves the dysregulation of oncogenes during the progression of chronic myeloid leukemia. The cell division cycle protein 6, an essential regulator of DNA replication, is elevated in some human cancer cells. However, the expression of cell division cycle protein 6 in chronic myeloid leukemia and the underlying regulatory mechanism remain to be elucidated. In this study, our data showed that cell division cycle protein 6 expression was significantly upregulated in primary chronic myeloid leukemia cells and the chronic myeloid leukemia cell line K562 cells, as compared to the normal bone marrow mononuclear cells. BCR/ABL kinase inhibitor STI571 or BCR/ABL small interfering RNA could significantly downregulate cell division cycle protein 6 messenger RNA expression in K562 cells. Moreover, phosphoinositide 3-kinase/AKT pathway inhibitor LY294002 and Janus kinase/signal transducer and activator of transcription pathway inhibitor AG490 could downregulate cell division cycle protein 6 expression in K562 cells, but not RAS/mitogen-activated protein kinase pathway inhibitor PD98059 had such effect. Cell division cycle protein 6 gene silencing by small interfering RNA effectively resulted in decrease of proliferation, increase of apoptosis, and arrest of cell cycle in K562 cells. These findings have demonstrated that cell division cycle protein 6 overexpression may contribute to the high proliferation and low apoptosis in chronic myeloid leukemia cells and can be regulated by BCR/ABL signal transduction through downstream phosphoinositide 3-kinase/Akt and Janus kinase/signal transducer and activator of transcription pathways, suggesting cell division cycle protein 6 as a potential therapeutic target in chronic myeloid leukemia.

Estimations of BCR-ABL/ABL transcripts by quantitative PCR in chronic myeloid leukaemia after allogeneic bone marrow transplantation and donor lymphocyte infusion.

PubMed

Otazú, Ivone B; Tavares, Rita de Cassia B; Hassan, Rocío; Zalcberg, Ilana; Tabak, Daniel G; Seuánez, Héctor N

2002-02-01

Serial assays of qualitative (multiplex and nested) and quantitative PCR were carried out for detecting and estimating the level of BCR-ABL transcripts in 39 CML patients following bone marrow transplantation. Seven of these patients, who received donor lymphocyte infusions (DLIs) following to relapse, were also monitored. Quantitative estimates of BCR-ABL transcripts were obtained by co-amplification with a competitor sequence. Estimates of ABL transcripts were used, an internal control and the ratio BCR-ABL/ABL was thus estimated for evaluating the kinetics of residual clones. Twenty four patients were followed shortly after BMT; two of these patients were in cytogenetic relapse coexisting with very high BCR-ABL levels while other 22 were in clinical, haematologic and cytogenetic remission 2-42 months after BMT. In this latter group, seven patients showed a favourable clinical-haematological progression in association with molecular remission while in 14 patients quantitative PCR assays indicated molecular relapse that was not associated with an early cytogenetic-haematologic relapse. BCR-ABL/ABL levels could not be correlated with presence of GVHD in 24 patients after BMT. In all seven patients treated with DLI, high levels of transcripts were detected at least 4 months before the appearance of clinical haematological relapse. Following DLI, five of these patients showed decreasing transcript levels from 2 to 5 logs between 4 and 12 months. In eight other patients studied long after BMT, five showed molecular relapse up to 117 months post-BMT and only one showed cytogenetic relapse. Our findings indicated that quantitative estimates of BCR-ABL transcripts were valuable for monitoring minimal residual disease in each patient.

Flow Cytometric Immunobead Assay for Detection of BCR-ABL1 Fusion Proteins in Chronic Myleoid Leukemia: Comparison with FISH and PCR Techniques

PubMed Central

Recchia, Anna Grazia; Caruso, Nadia; Bossio, Sabrina; Pellicanò, Mariavaleria; De Stefano, Laura; Franzese, Stefania; Palummo, Angela; Abbadessa, Vincenzo; Lucia, Eugenio; Gentile, Massimo; Vigna, Ernesto; Caracciolo, Clementina; Agostino, Antolino; Galimberti, Sara; Levato, Luciano; Stagno, Fabio; Molica, Stefano; Martino, Bruno; Vigneri, Paolo; Di Raimondo, Francesco; Morabito, Fortunato

2015-01-01

Chronic Myeloid Leukemia (CML) is characterized by a balanced translocation juxtaposing the Abelson (ABL) and breakpoint cluster region (BCR) genes. The resulting BCR-ABL1 oncogene leads to increased proliferation and survival of leukemic cells. Successful treatment of CML has been accompanied by steady improvements in our capacity to accurately and sensitively monitor therapy response. Currently, measurement of BCR-ABL1 mRNA transcript levels by real-time quantitative PCR (RQ-PCR) defines critical response endpoints. An antibody-based technique for BCR-ABL1 protein recognition could be an attractive alternative to RQ-PCR. To date, there have been no studies evaluating whether flow-cytometry based assays could be of clinical utility in evaluating residual disease in CML patients. Here we describe a flow-cytometry assay that detects the presence of BCR-ABL1 fusion proteins in CML lysates to determine the applicability, reliability, and specificity of this method for both diagnosis and monitoring of CML patients for initial response to therapy. We show that: i) CML can be properly diagnosed at onset, (ii) follow-up assessments show detectable fusion protein (i.e. relative mean fluorescent intensity, rMFI%>1) when BCR-ABL1IS transcripts are between 1–10%, and (iii) rMFI% levels predict CCyR as defined by FISH analysis. Overall, the FCBA assay is a rapid technique, fully translatable to the routine management of CML patients. PMID:26111048

Myeloproliferative neoplasms with concurrent BCR-ABL1 translocation and JAK2 V617F mutation: a multi-institutional study from the bone marrow pathology group.

PubMed

Soderquist, Craig R; Ewalt, Mark D; Czuchlewski, David R; Geyer, Julia T; Rogers, Heesun J; Hsi, Eric D; Wang, Sa A; Bueso-Ramos, Carlos E; Orazi, Attilio; Arber, Daniel A; Hexner, Elizabeth O; Babushok, Daria V; Bagg, Adam

2018-05-01

Myeloproliferative neoplasms arise from hematopoietic stem cells with somatically altered tyrosine kinase signaling. Classification of myeloproliferative neoplasms is based on hematologic, histopathologic and molecular characteristics including the presence of the BCR-ABL1 and JAK2 V617F. Although thought to be mutually exclusive, a number of cases with co-occurring BCR-ABL1 and JAK2 V617F have been identified. To characterize the clinicopathologic features of myeloproliferative neoplasms with concomitant BCR-ABL1 and JAK2 V617F, and define the frequency of co-occurrence, we conducted a retrospective multi-institutional study. Cases were identified using a search of electronic databases over a decade at six major institutions. Of 1570 patients who were tested for both BCR-ABL1 and JAK2 V617F, six were positive for both. An additional five patients were identified via clinical records providing a total of 11 cases for detailed evaluation. For each case, clinical variables, hematologic and genetic data, and bone marrow histomorphologic features were analyzed. The sequence of identification of the genetic abnormalities varied: five patients were initially diagnosed with a JAK2 V617F+ myeloproliferative neoplasm, one patient initially had BCR-ABL1+ chronic myeloid leukemia, while both alterations were identified simultaneously in five patients. Classification of the BCR-ABL1-negative myeloproliferative neoplasms varied, and in some cases, features only became apparent following tyrosine kinase inhibitor therapy. Seven of the 11 patients showed myelofibrosis, in some cases before identification of the second genetic alteration. Our data, reflecting the largest reported study comprehensively detailing clinicopathologic features and response to therapy, show that the co-occurrence of BCR-ABL1 and JAK2 V617F is rare, with an estimated frequency of 0.4%, and most often reflects two distinct ('composite') myeloproliferative neoplasms. Although uncommon, it is important to be

Targeting of the N-terminal coiled coil oligomerization interface of BCR interferes with the transformation potential of BCR-ABL and increases sensitivity to STI571.

PubMed

Beissert, Tim; Puccetti, Elena; Bianchini, Andrea; Güller, Saskia; Boehrer, Simone; Hoelzer, Dieter; Ottmann, Oliver Gerhard; Nervi, Clara; Ruthardt, Martin

2003-10-15

Translocations involving the abl locus on chromosome 9 fuses the tyrosine kinase c-ABL to proteins harboring oligomerization interfaces such as BCR or TEL, enabling these ABL-fusion proteins (X-ABL) to transform cells and to induce leukemia. The ABL kinase activity is blocked by the ABL kinase inhibitor STI571 which abrogates transformation by X-ABL. To investigate the role of oligomerization for the transformation potential of X-ABL and for the sensitivity to STI571, we constructed ABL chimeras with oligomerization interfaces of proteins involved in leukemia-associated translocations such as BCR, TEL, PML, and PLZF. We assessed the capacity of these chimeras to form high molecular weight (HMW) complexes as compared with p185(BCR-ABL). There was a direct relationship between the size of HMW complexes formed by these chimeras and their capacity to induce factor independence in Ba/F3 cells, whereas there was an inverse relationship between the size of the HMW complexes and the sensitivity to STI571. The targeting of the oligomerization interface of p185(BCR-ABL) by a peptide representing the coiled coil region of BCR reduced its potential to transform fibroblasts and increased sensitivity to STI571. Our results indicate that targeting of the oligomerization interfaces of the X-ABL enhances the effects of STI571 in the treatment of leukemia caused by X-ABL.

Bcr-Abl and inhibition of apoptosis in chronic myelogenous leukemia cells.

PubMed

Fernandez-Luna, J L

2000-10-01

Chronic myelogenous leukemia (CML) cells are highly resistant to apoptosis induced by chemotherapeutic drugs. The observation that production of Bcr-Abl is the initiating event in CML has focussed attention on the survival signals triggered by this oncogene. A number of signal transducers and transcription factors have been associated with the antiapoptotic phenotype of CML cells, some of which lead to the expression and/or activation of members of the Bcl-2 family of apoptosis modulators, such as Bcl-xL and Bad. In this article, recent advances in understanding the antiapoptotic pathways triggered by Bcr-Abl in CML cells, are discussed.

Activation of stress response gene SIRT1 by BCR-ABL promotes leukemogenesis

PubMed Central

Yuan, Hongfeng; Wang, Zhiqiang; Li, Ling; Zhang, Hao; Modi, Hardik; Horne, David

2012-01-01

The tyrosine kinase inhibitor imatinib is highly effective in the treatment of chronic myelogenous leukemia (CML), but primary and acquired resistance of CML cells to the drug offset its efficacy. Molecular mechanisms for resistance of CML to tyrosine kinase inhibitors are not fully understood. In the present study, we show that BCR-ABL activates the expression of the mammalian stress response gene SIRT1 in hematopoietic progenitor cells and that this involves STAT5 signaling. SIRT1 activation promotes CML cell survival and proliferation associated with deacetylation of multiple SIRT1 substrates, including FOXO1, p53, and Ku70. Imatinib-mediated inhibition of BCR-ABL kinase activity partially reduces SIRT1 expression and SIRT1 inhibition further sensitizes CML cells to imatinib-induced apoptosis. Knockout of SIRT1 suppresses BCR-ABL transformation of mouse BM cells and the development of a CML-like myeloproliferative disease, and treatment of mice with the SIRT1 inhibitor tenovin-6 deters disease progression. The combination of SIRT1 gene knockout and imatinib treatment further extends the survival of CML mice. Our results suggest that SIRT1 is a novel survival pathway activated by BCR-ABL expression in hematopoietic progenitor cells, which promotes oncogenic transformation and leukemogenesis. Our findings suggest further exploration of SIRT1 as a therapeutic target for CML treatment to overcome resistance. PMID:22207735

Differential signaling through p190 and p210 BCR-ABL fusion proteins revealed by interactome and phosphoproteome analysis.

PubMed

Cutler, J A; Tahir, R; Sreenivasamurthy, S K; Mitchell, C; Renuse, S; Nirujogi, R S; Patil, A H; Heydarian, M; Wong, X; Wu, X; Huang, T-C; Kim, M-S; Reddy, K L; Pandey, A

2017-07-01

Two major types of leukemogenic BCR-ABL fusion proteins are p190 BCR-ABL and p210 BCR-ABL . Although the two fusion proteins are closely related, they can lead to different clinical outcomes. A thorough understanding of the signaling programs employed by these two fusion proteins is necessary to explain these clinical differences. We took an integrated approach by coupling protein-protein interaction analysis using biotinylation identification with global phosphorylation analysis to investigate the differences in signaling between these two fusion proteins. Our findings suggest that p190 BCR-ABL and p210 BCR-ABL differentially activate important signaling pathways, such as JAK-STAT, and engage with molecules that indicate interaction with different subcellular compartments. In the case of p210 BCR-ABL , we observed an increased engagement of molecules active proximal to the membrane and in the case of p190 BCR-ABL , an engagement of molecules of the cytoskeleton. These differences in signaling could underlie the distinct leukemogenic process induced by these two protein variants.

The Bcr-Abl kinase regulates the actin cytoskeleton via a GADS/Slp-76/Nck1 adaptor protein pathway.

PubMed

Preisinger, Christian; Kolch, Walter

2010-05-01

Bcr-Abl is the transforming principle underlying chronic myelogenous leukaemia (CML). Here, we use a functional interaction proteomics approach to map pathways by which Bcr-Abl regulates defined cellular processes. The results show that Bcr-Abl regulates the actin cytoskeleton and non-apoptotic membrane blebbing via a GADS/Slp-76/Nck1 adaptor protein pathway. The binding of GADS to Bcr-Abl requires Bcr-Abl tyrosine kinase activity and is sensitive to the Bcr-Abl inhibitor imatinib, while the GADS/Slp-76 and Slp-76/Nck interactions are tyrosine phosphorylation independent. All three adaptor proteins co-localize with cortical actin in membrane blebs. Downregulation of each adaptor protein disrupts the actin cytoskeleton and membrane blebbing in a similar fashion and similar to imatinib. These findings highlight the importance of protein interaction dependent adaptor protein pathways in oncogenic kinase signaling. 2010 Elsevier Inc. All rights reserved.

Dasatinib and low-intensity chemotherapy in elderly patients with Philadelphia chromosome–positive ALL

PubMed Central

Coudé, Marie Magdelaine; Gokbuget, Nicola; Gambacorti Passerini, Carlo; Hayette, Sandrine; Cayuela, Jean-Michel; Huguet, Françoise; Leguay, Thibaut; Chevallier, Patrice; Salanoubat, Celia; Bonmati, Caroline; Alexis, Magda; Hunault, Mathilde; Glaisner, Sylvie; Agape, Philippe; Berthou, Christian; Jourdan, Eric; Fernandes, José; Sutton, Laurent; Banos, Anne; Reman, Oumedaly; Lioure, Bruno; Thomas, Xavier; Ifrah, Norbert; Lafage-Pochitaloff, Marina; Bornand, Anne; Morisset, Laure; Robin, Valérie; Pfeifer, Heike; Delannoy, Andre; Ribera, Josep; Bassan, Renato; Delord, Marc; Hoelzer, Dieter; Dombret, Herve; Ottmann, Oliver G.

2016-01-01

Prognosis of Philadelphia-positive (Ph+) acute lymphoblastic leukemia (ALL) in the elderly has improved during the imatinib era. We investigated dasatinib, another potent tyrosine kinase inhibitor, in combination with low-intensity chemotherapy. Patients older than age 55 years were included in the European Working Group on Adult ALL (EWALL) study number 01 for Ph+ ALL (EWALL-PH-01 international study) and were treated with dasatinib 140 mg/day (100 mg/day over 70 years) with intrathecal chemotherapy, vincristine, and dexamethasone during induction. Patients in complete remission continued consolidation with dasatinib, sequentially with cytarabine, asparaginase, and methotrexate for 6 months. Maintenance therapy was dasatinib and vincristine/dexamethasone reinductions for 18 months followed by dasatinib until relapse or death. Seventy-one patients with a median age of 69 years were enrolled; 77% had a high comorbidity score. Complete remission rate was 96% and 65% of patients achieved a 3-log reduction in BCR-ABL1 transcript levels during consolidation. Only 7 patients underwent allogeneic hematopoietic stem cell transplantation. At 5 years, overall survival was 36% and up to 45% taking into account deaths unrelated to disease or treatment as competitors. Thirty-six patients relapsed, 24 were tested for mutation by Sanger sequencing, and 75% were T315I-positive. BCR-ABL1T315I was tested by allele-specific oligonucleotide reverse transcription–quantitative polymerase chain reaction in 43 patients and detection was associated with short-term relapses. Ten patients (23%) were positive before any therapy and 8 relapsed, all with this mutation. In conclusion, dasatinib combined with low-intensity chemotherapy was well-tolerated and gave long-term survival in 36% of elderly patients with Ph+ ALL. Monitoring of BCR-ABL1T315I from diagnosis identified patients with at high risk of early relapse and may help to personalize therapy. PMID:27121472

How is the relationship between TWIST-1 and BCR-ABL1 gene expressions in chronic myeloid leukaemia patients?

PubMed

Heidari, Nazanin; Vosoughi, Tina; Mohammadi Asl, Javad; Saki Malehi, Amal; Saki, Najmaldin

2018-01-12

The activation and increased expression of BCR-ABL1 lead to malignant chronic myelogenous leukaemia (CML) cells, as well as the resistance to antitumour agents and apoptosis inducers. Moreover, TWIST-1 protein is a prognostic factor of leukemogenesis, and its level is raised in CML patients with cytogenetic resistance to imatinib. So, there is a likely relationship between BCR-ABL1 and TWIST-1 genes. The aim of the study was to assess the relationship between TWIST-1 and BCR-ABL1 expressions. Peripheral blood samples were obtained from 44 CML patients under treatment and also from ten healthy subjects as normal controls. The expression of TWIST-1 and BCR-ABL1 genes was measured using real-time PCR, and ABL1 was used as the reference gene. The gene expression was evaluated by REST software. The expression levels of TWIST-1 and BCR-ABL1 genes in CML patients was changed 40.23 ± 177.75-fold and 6 ± 18-fold, respectively. No significant relationship was observed between the expressions of TWIST-1 and BCR-ABL1 genes. All patients with TWIST-1 expression levels ≥100-fold had failure of response to treatment. The probability of the relationship between BCR-ABL1 and TWIST-1 is still debatable, and the average of TWIST-1 expression has been higher in patients without response to treatment. Definitive conclusion needs further investigations.

Heat shock protein-70 neutralizes apoptosis inducing factor in Bcr/Abl expressing cells.

PubMed

Wang, Fang; Dai, An-Ya; Tao, Kun; Xiao, Qing; Huang, Zheng-Lan; Gao, Miao; Li, Hui; Wang, Xin; Cao, Wei-Xi; Feng, Wen-Li

2015-10-01

Bcr/Abl fusion protein is a hallmark of human chronic myeloid leukemia (CML). The protein can activate various signaling pathways to make normal cells transform malignantly and thus to facilitate tumorigenesis. It has been reported that heat shock protein-70 (HSP-70) can be served as an anti-apoptotic protein that suppresses Bax and Apo-2L/TRAIL. But it is unclear whether HSP-70 affects AIF-initiated apoptosis in Bcr/Abl expressing cells considering that HSP-70 is coincidentally over-regulated in these cells. Our findings supported that abundant HSP-70 in Bcr/Abl cells neutralizes AIF by segregating it from nucleus via direct interaction, leading to the failure of AIF initiating cell death and the silence of caspase-independent apoptotic pathway upon apoptotic induction. Moderate inhibition of HSP-70 expression by siRNA leads to Vp-16 triggered re-distribution of AIF in nucleus. In addition, AIF bears a HSP-70 binding domain allowing association with HSP-70. Therefore, disruption of the association using an AIF mutant lacking this domain can restore the potential of AIF importing into nucleus, and finally triggers cell death in a time dependent manner. Copyright © 2015 Elsevier Inc. All rights reserved.

Targeting the Allosteric Site of Oncoprotein BCR-ABL as an Alternative Strategy for Effective Target Protein Degradation.

PubMed

Shimokawa, Kenichiro; Shibata, Norihito; Sameshima, Tomoya; Miyamoto, Naoki; Ujikawa, Osamu; Nara, Hiroshi; Ohoka, Nobumichi; Hattori, Takayuki; Cho, Nobuo; Naito, Mikihiko

2017-10-12

Protein degradation technology based on hybrid small molecules is an emerging drug modality that has significant potential in drug discovery and as a unique method of post-translational protein knockdown in the field of chemical biology. Here, we report the first example of a novel and potent protein degradation inducer that binds to an allosteric site of the oncogenic BCR-ABL protein. BCR-ABL allosteric ligands were incorporated into the SNIPER (Specific and Nongenetic inhibitor of apoptosis protein [IAP]-dependent Protein Erasers) platform, and a series of in vitro biological assays of binding affinity, target protein modulation, signal transduction, and growth inhibition were carried out. One of the designed compounds, 6 (SNIPER(ABL)-062), showed desirable binding affinities against ABL1, cIAP1/2, and XIAP and consequently caused potent BCR-ABL degradation.

Essential role for Stat5a/b in myeloproliferative neoplasms induced by BCR-ABL1 and JAK2V617F in mice

PubMed Central

Walz, Christoph; Ahmed, Wesam; Lazarides, Katherine; Betancur, Monica; Patel, Nihal; Hennighausen, Lothar; Zaleskas, Virginia M.

2012-01-01

STAT5 proteins are constitutively activated in malignant cells from many patients with leukemia, including the myeloproliferative neoplasms (MPNs) chronic myeloid leukemia (CML) and polycythemia vera (PV), but whether STAT5 is essential for the pathogenesis of these diseases is not known. In the present study, we used mice with a conditional null mutation in the Stat5a/b gene locus to determine the requirement for STAT5 in MPNs induced by BCR-ABL1 and JAK2V617F in retroviral transplantation models of CML and PV. Loss of one Stat5a/b allele resulted in a decrease in BCR-ABL1–induced CML-like MPN and the appearance of B-cell acute lymphoblastic leukemia, whereas complete deletion of Stat5a/b prevented the development of leukemia in primary recipients. However, BCR-ABL1 was expressed and active in Stat5-null leukemic stem cells, and Stat5 deletion did not prevent progression to lymphoid blast crisis or abolish established B-cell acute lymphoblastic leukemia. JAK2V617F failed to induce polycythemia in recipients after deletion of Stat5a/b, although the loss of STAT5 did not prevent the development of myelofibrosis. These results demonstrate that STAT5a/b is essential for the induction of CML-like leukemia by BCR-ABL1 and of polycythemia by JAK2V617F, and validate STAT5a/b and the genes they regulate as targets for therapy in these MPNs. PMID:22234689

Proteomic-based identification of Apg-2 as a therapeutic target for chronic myeloid leukemia.

PubMed

Li, Yajuan; Chen, Xi; Shi, Meng; Wang, Haixia; Cao, Weixi; Wang, Xiaozhong; Li, Chunli; Feng, Wenli

2013-12-01

The oncogenic BCR/ABL tyrosine kinase induces constitutive enhanced "spontaneous" DNA damage and unfaithful repair in Philadelphia chromosome positive leukemia cells. Here, we investigated the changes of protein profile in H2O2-induced DNA damage/repair in BaF3-MIGR1 and BaF3-BCR/ABL cells through a proteomic strategy consisting of two-dimensional gel electrophoresis (2-DE) coupled with MALDI-TOF mass spectrometry. In total, 41 spots were differentially expressed and 13 proteins were identified with further MS analysis. Two essential proteins, Proto-oncogene tyrosine-protein kinase ABL1 (c-ABL) and Heat shock 70kDa protein 4 (Apg-2), were confirmed by Western blot and showed consistent changes with proteomic results. Moreover, functional analysis demonstrated that inhibition of Apg-2 not only decreased cell proliferation, but also induced cell apoptosis in BCR/ABL positive cells (BaF3-BCR/ABL, BaF3-BCR/ABL(T315I)). We also proved that Apg-2 inhibition aggravated H2O2 induced damage in BCR/ABL positive cells, and enhanced the sensitivity of BaF3-BCR/ABL(T315I) to STI571. Taken together, the findings in this work provide us with some clues to a better understanding of the molecular mechanisms underlying BCR/ABL in the DNA damage/repair processes and demonstrated that Apg-2 would be a valid target for anti-leukemia drug development. © 2013.

Genetic analysis of Ikaros target genes and tumor suppressor function in BCR-ABL1+ pre–B ALL

PubMed Central

Aghajanirefah, Ali; McLaughlin, Jami; Cheng, Donghui; Geng, Huimin; Eggesbø, Linn M.; Smale, Stephen T.; Müschen, Markus

2017-01-01

Inactivation of the tumor suppressor gene encoding the transcriptional regulator Ikaros (IKZF1) is a hallmark of BCR-ABL1+ precursor B cell acute lymphoblastic leukemia (pre–B ALL). However, the mechanisms by which Ikaros functions as a tumor suppressor in pre–B ALL remain poorly understood. Here, we analyzed a mouse model of BCR-ABL1+ pre–B ALL together with a new model of inducible expression of wild-type Ikaros in IKZF1 mutant human BCR-ABL1+ pre–B ALL. We performed integrated genome-wide chromatin and expression analyses and identified Ikaros target genes in mouse and human BCR-ABL1+ pre–B ALL, revealing novel conserved gene pathways associated with Ikaros tumor suppressor function. Notably, genetic depletion of different Ikaros targets, including CTNND1 and the early hematopoietic cell surface marker CD34, resulted in reduced leukemic growth. Our results suggest that Ikaros mediates tumor suppressor function by enforcing proper developmental stage–specific expression of multiple genes through chromatin compaction at its target genes. PMID:28190001

BCR/ABL downregulates DNA-PK(CS)-dependent and upregulates backup non-homologous end joining in leukemic cells.

PubMed

Poplawski, Tomasz; Blasiak, Janusz

2010-06-01

Non-homologous end joining (NHEJ) and homologous recombination repair (HRR) are the main mechanisms involved in the processing of DNA double strand breaks (DSBs) in humans. We showed previously that the oncogenic tyrosine kinase BCR/ABL stimulated DSBs repair by HRR. To evaluate the role of BCR/ABL in DSBs repair by NHEJ we examined the ability of leukemic BCR/ABL-expressing cell line BV173 to repair DNA damage induced by two DNA topoisomerase II inhibitors: etoposide and sobuzoxane. DNA lesions induced by sobuzoxane are repaired by a NHEJ pathway which is dependent on the catalytic subunit of protein kinase dependent on DNA (DNA-PK(CS); D-NHEJ), whereas damage evoked by etoposide are repaired by two distinct NHEJ pathways, dependent on or independent of DNA-PK(CS) (backup NHEJ, B-NHEJ). Cells incubated with STI571, a highly specific inhibitor of BCR/ABL, displayed resistance to these agents associated with an accelerated kinetics of DSBs repair, as measured by the neutral comet assay and pulsed field gel electrophoresis. However, in a functional NHEJ assay, cells preincubated with STI571 repaired DSBs induced by a restriction enzyme with a lower efficacy than without the preincubation and addition of wortmannin, a specific inhibitor of DNA-PK(CS), did not change efficacy of the NHEJ reaction. We suggest that BCR/ABL switch on B-NHEJ which is more error-prone then D-NHEJ and in such manner contribute to the increase of the genomic instability of leukemic cells.

Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface*

PubMed Central

Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

2016-01-01

Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. PMID:26912659

Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface.

PubMed

Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

2016-04-15

Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterization of a reference material for BCR-ABL (M-BCR) mRNA quantitation by real-time amplification assays: towards new standards for gene expression measurements.

PubMed

Saldanha, J; Silvy, M; Beaufils, N; Arlinghaus, R; Barbany, G; Branford, S; Cayuela, J-M; Cazzaniga, G; Gonzalez, M; Grimwade, D; Kairisto, V; Miyamura, K; Lawler, M; Lion, T; Macintyre, E; Mahon, F-X; Muller, M C; Ostergaard, M; Pfeifer, H; Saglio, G; Sawyers, C; Spinelli, O; van der Velden, V H J; Wang, J Q; Zoi, K; Patel, V; Phillips, P; Matejtschuk, P; Gabert, J

2007-07-01

Monitoring of BCR-ABL transcripts has become established practice in the management of chronic myeloid leukemia. However, nucleic acid amplification techniques are prone to variations which limit the reliability of real-time quantitative PCR (RQ-PCR) for clinical decision making, highlighting the need for standardization of assays and reporting of minimal residual disease (MRD) data. We evaluated a lyophilized preparation of a leukemic cell line (K562) as a potential quality control reagent. This was found to be relatively stable, yielding comparable respective levels of ABL, GUS and BCR-ABL transcripts as determined by RQ-PCR before and after accelerated degradation experiments as well as following 5 years storage at -20 degrees C. Vials of freeze-dried cells were sent at ambient temperature to 22 laboratories on four continents, with RQ-PCR analyses detecting BCR-ABL transcripts at levels comparable to those observed in primary patient samples. Our results suggest that freeze-dried cells can be used as quality control reagents with a range of analytical instrumentations and could enable the development of urgently needed international standards simulating clinically relevant levels of MRD.

Therapy of chronic myeloid leukemia: twilight of the imatinib era?

PubMed

Trela, Ewelina; Glowacki, Sylwester; Błasiak, Janusz

2014-01-01

Chronic myeloid leukemia (CML) results from the clonal expansion of pluripotent hematopoietic stem cells containing the active BCR/ABL fusion gene produced by a reciprocal translocation of the ABL1 gene to the BCR gene. The BCR/ABL protein displays a constitutive tyrosine kinase activity and confers on leukemic cells growth and proliferation advantage and resistance to apoptosis. Introduction of imatinib (IM) and other tyrosine kinase inhibitors (TKIs) has radically improved the outcome of patients with CML and some other diseases with BCR/ABL expression. However, a fraction of CML patients presents with resistance to this drug. Regardless of clinical profits of IM, there are several drawbacks associated with its use, including lack of eradication of the malignant clone and increasing relapse rate resulting from long-term therapy, resistance, and intolerance. Second and third generations of TKIs have been developed to break IM resistance. Clinical studies revealed that the introduction of second-generation TKIs has improved the overall survival of CML patients; however, some with specific mutations such as T315I remain resistant. Second-generation TKIs may completely replace imatinib in perspective CML therapy, and addition of third-generation inhibitors may overcome resistance induced by every form of point mutations.

Bcr/Abl interferes with the Fanconi anemia/BRCA pathway: implications in the chromosomal instability of chronic myeloid leukemia cells.

PubMed

Valeri, Antonio; Alonso-Ferrero, Maria Eugenia; Río, Paula; Pujol, María Roser; Casado, José A; Pérez, Laura; Jacome, Ariana; Agirre, Xabier; Calasanz, Maria José; Hanenberg, Helmut; Surrallés, Jordi; Prosper, Felipe; Albella, Beatriz; Bueren, Juan A

2010-12-28

Chronic myeloid leukemia (CML) is a malignant clonal disorder of the hematopoietic system caused by the expression of the BCR/ABL fusion oncogene. Although it is well known that CML cells are genetically unstable, the mechanisms accounting for this genomic instability are still poorly understood. Because the Fanconi anemia (FA) pathway is believed to control several mechanisms of DNA repair, we investigated whether this pathway was disrupted in CML cells. Our data show that CML cells have a defective capacity to generate FANCD2 nuclear foci, either in dividing cells or after DNA damage. Similarly, human cord blood CD34(+) cells transduced with BCR/ABL retroviral vectors showed impaired FANCD2 foci formation, whereas FANCD2 monoubiquitination in these cells was unaffected. Soon after the transduction of CD34(+) cells with BCR/ABL retroviral vectors a high proportion of cells with supernumerary centrosomes was observed. Similarly, BCR/ABL induced a high proportion of chromosomal abnormalities, while mediated a cell survival advantage after exposure to DNA cross-linking agents. Significantly, both the impaired formation of FANCD2 nuclear foci, and also the predisposition of BCR/ABL cells to develop centrosomal and chromosomal aberrations were reverted by the ectopic expression of BRCA1. Taken together, our data show for the first time a disruption of the FA/BRCA pathway in BCR/ABL cells, suggesting that this defective pathway should play an important role in the genomic instability of CML by the co-occurrence of centrosomal amplification and DNA repair deficiencies.

Overexpression of Apg-2 increases cell proliferation and protects from oxidative damage in BaF3-BCR/ABL cells.

PubMed

Li, Chunli; Liu, Dingbin; Yuan, Ying; Huang, Shifeng; Shi, Meng; Tao, Kun; Feng, Wenli

2010-04-01

Apg-2, a mammalian heat-shock protein belonging to the heat-shock protein 110 (Hsp110) family, was previously found to be overexpressed in BaF3-BCR/ABL cells that were treated with hydrogen peroxide (H2O2) through our comparative proteomics study. The expression of Apg-2 in chronic myelogenous leukemia (CML) cells and its role have not been investigated, forming the basis for this study. BaF3-MIGR1 and BaF3-BCR/ABL cell lines stably overexpressing Apg-2 were established and exposed to 50 microM H2O2 for 10 min. Western blot analysis of Apg-2 expression confirmed that H2O2 treatment significantly up-regulated Apg-2 expression. Apg-2 overexpression elevated BaF3-BCR/ABL cell proportions in S and G2/M phase, increased cell proliferation and colony formation in vitro. Moreover, BaF3-MIGR1 and BaF3-BCR/ABL cells were exposed to 50 microM H2O2 in the absence or presence of Apg-2 overexpression and induction of H2AX phosphorylation, the reporters of DNA damage were assessed by Western blot and immunofluorescence. Results showed that exposure to H2O2 induced H2AX phosphorylation in BaF3-MIGR1 cells, but no increase was observed in BaF3-BCR/ABL cells. Together, the data indicate that Apg-2 is overexpressed and overexpression of Apg-2 in BaF3-BCR/ABL cells increases cell proliferation and protects cells from oxidative damage, which may play an important role in CML carcinogenesis and progression.

Nilotinib: optimal therapy for patients with chronic myeloid leukemia and resistance or intolerance to imatinib.

PubMed

Swords, Ronan; Mahalingam, Devalingam; Padmanabhan, Swaminathan; Carew, Jennifer; Giles, Francis

2009-09-21

Chronic myeloid leukemia (CML) is the consequence of a single balanced translocation that produces the BCR-ABL fusion oncogene which is detectable in over 90% of patients at presentation. The BCR-ABL inhibitor imatinib mesylate (IM) has improved survival in all phases of CML and is the standard of care for newly diagnosed patients in chronic phase. Despite the very significant therapeutic benefits of IM, a small minority of patients with early stage disease do not benefit optimally while IM therapy in patients with advanced disease is of modest benefit in many. Diverse mechanisms may be responsible for IM failures, with point mutations within the Bcr-Abl kinase domain being amongst the most common resistance mechanisms described in patients with advanced CML. The development of novel agents designed to overcome IM resistance, while still primarily targeted on BCR-ABL, led to the creation of the high affinity aminopyrimidine inhibitor, nilotinib. Nilotinib is much more potent as a BCR-ABL inhibitor than IM and inhibits both wild type and IM-resistant BCR-ABL with significant clinical activity across the entire spectrum of BCR-ABL mutants with the exception of T315I. The selection of a second generation tyrosine kinase inhibitor to rescue patients with imatinib failure will be based on several factors including age, co-morbid medical problems and ABL kinase mutational profile. It should be noted that while the use of targeted BCR-ABL kinase inhibitors in CML represents a paradigm shift in CML management these agents are not likely to have activity against the quiescent CML stem cell pool. The purpose of this review is to summarize the pre-clinical and clinical data on nilotinib in patients with CML who have failed prior therapy with IM or dasatinib.

Role of flow-cytometric immunophenotyping in prediction of BCR/ABL1 gene rearrangement in adult B-cell acute lymphoblastic leukemia.

PubMed

Corrente, Francesco; Bellesi, Silvia; Metafuni, Elisabetta; Puggioni, Pier Luigi; Marietti, Sara; Ciminello, Angela Maria; Za, Tommaso; Sorà, Federica; Fianchi, Luana; Sica, Simona; De Stefano, Valerio; Chiusolo, Patrizia

2018-05-01

We performed a retrospective analysis of 88 adult patients with B-ALL diagnosed in our center by a flow-cytometric assessment. Immunophenotypic expression of leukemic cells was explored by simultaneous evaluation of positivity, percentage of expressing cells and median fluorescence intensity (MFI). BCR/ABL1 fusion transcripts were assessed by RT-PCR analysis and were identified in 36 patients (40.9%). CD10 and CD34 were positive in the totality of BCR/ABL1-positive cases. Patients with gene rearrangement had a greater frequency of CD66c, CD13 and CD33 positivity compared with BCR/ABL1-negative cases. Moreover, BCR/ABL1-positive cases exhibited a greater median percentage and MFI values of CD13, CD33, CD66c, CD10, CD34 and CD25 expressions, but a lower median percentage and MFI values of CD38 and CD22 expressions than patients without gene rearrangement. Multivariate logistic regression analysis showed that CD10, CD38 and CD13 expressions were independent predictors for the presence of BCR/ABL1 rearrangement. Predictive probabilities of molecular occurrence based on these markers are proposed. © 2017 International Clinical Cytometry Society. © 2017 International Clinical Cytometry Society.

Establishment and validation of analytical reference panels for the standardization of quantitative BCR-ABL1 measurements on the international scale.

PubMed

White, Helen E; Hedges, John; Bendit, Israel; Branford, Susan; Colomer, Dolors; Hochhaus, Andreas; Hughes, Timothy; Kamel-Reid, Suzanne; Kim, Dong-Wook; Modur, Vijay; Müller, Martin C; Pagnano, Katia B; Pane, Fabrizio; Radich, Jerry; Cross, Nicholas C P; Labourier, Emmanuel

2013-06-01

Current guidelines for managing Philadelphia-positive chronic myeloid leukemia include monitoring the expression of the BCR-ABL1 (breakpoint cluster region/c-abl oncogene 1, non-receptor tyrosine kinase) fusion gene by quantitative reverse-transcription PCR (RT-qPCR). Our goal was to establish and validate reference panels to mitigate the interlaboratory imprecision of quantitative BCR-ABL1 measurements and to facilitate global standardization on the international scale (IS). Four-level secondary reference panels were manufactured under controlled and validated processes with synthetic Armored RNA Quant molecules (Asuragen) calibrated to reference standards from the WHO and the NIST. Performance was evaluated in IS reference laboratories and with non-IS-standardized RT-qPCR methods. For most methods, percent ratios for BCR-ABL1 e13a2 and e14a2 relative to ABL1 or BCR were robust at 4 different levels and linear over 3 logarithms, from 10% to 0.01% on the IS. The intraassay and interassay imprecision was <2-fold overall. Performance was stable across 3 consecutive lots, in multiple laboratories, and over a period of 18 months to date. International field trials demonstrated the commutability of the reagents and their accurate alignment to the IS within the intra- and interlaboratory imprecision of IS-standardized methods. The synthetic calibrator panels are robust, reproducibly manufactured, analytically calibrated to the WHO primary standards, and compatible with most BCR-ABL1 RT-qPCR assay designs. The broad availability of secondary reference reagents will further facilitate interlaboratory comparative studies and independent quality assessment programs, which are of paramount importance for worldwide standardization of BCR-ABL1 monitoring results and the optimization of current and new therapeutic approaches for chronic myeloid leukemia. © 2013 American Association for Clinical Chemistry.

EFFECT OF THAI SARAPHI FLOWER EXTRACTS ON WT1 AND BCR/ABL PROTEIN EXPRESSION IN LEUKEMIC CELL LINES.

PubMed

Sangkaruk, Rungkarn; Rungrojsakul, Methee; Tima, Singkome; Anuchapreeda, Songyot

2017-01-01

Saraphi (Mammea siamensis) is a Thai traditional herb. In this study, the cytotoxic effects of crude ethanolic and fractional extracts including hexane, ethyl acetate, and methanol fractions from M. siamensis flowers were investigated in order to determine their effect on WT1 expression in Molt4 and K562 cells and Bcr/Abl expression in K562 cells. The flowers of M. siamensis were extracted using ethanol. The ethanol flower extract was further fractionated with hexane, ethyl acetate, and methanol. Cytotoxic effects were measured by the MTT assay. Bcr/Abl and WT1 protein levels after treatments were determined by Western blotting. The total cell number was determined via the typan blue exclusion method. The hexane fraction showed the strongest cytotoxic activity on Molt4 and K562 cells, with IC 50 values of 2.6 and 77.6 μg/ml, respectively. The hexane extract decreased Bcr/Abl protein expression in K562 cells by 74.6% and WT1 protein expressions in Molt4 and K562 cells by 68.4 and 72.1%, respectively. Total cell numbers were decreased by 66.2 and 48.7% in Molt4 and K562 cells, respectively. Mammea E/BB (main active compound) significantly decreased both Bcr/Abl and WTlprotein expressions by 75 and 49.5%, respectively when compared to vehicle control. The hexane fraction from M. siamensis flowers inhibited cell proliferation via the suppression of WT1 expression in Molt4 and K562 cells and Bcr/Abl expression in K562 cells. The active compound may be mammea E/BB. Extracts from M. siamensis flowers show promise as naturally occurring anti-cancer drugs.

Imatinib discontinuation in chronic myeloid leukaemia patients with undetectable BCR-ABL transcript level: A systematic review and a meta-analysis.

PubMed

Campiotti, Leonardo; Suter, Matteo Basilio; Guasti, Luigina; Piazza, Rocco; Gambacorti-Passerini, Carlo; Grandi, Anna Maria; Squizzato, Alessandro

2017-05-01

Tyrosine kinase inhibitors (TKIs) are the cornerstones of treatment for patients with chronic myeloid leukaemia (CML). In recent years, several studies were conducted to evaluate the safety of TKIs discontinuation. We performed a systematic review of the literature to determine the incidence of CML relapse, to identify possible factors relapse rates and to evaluate the long-term safety in CML patients with stable undetectable BCR-ABL transcript level who discontinued TKIs. Studies evaluating TKIs discontinuation in CML patients with undetectable BCR-ABL transcript level were identified by electronic search of MEDLINE and EMBASE database until May 2015. Weighted mean proportion and 95% confidence intervals (CIs) of CML relapse was calculated using a fixed-effects and a random-effects model. Statistical heterogeneity was evaluated using the I 2 statistic. Fifteen cohort studies, for a total of 509 patients, were included. Nine studies were at low-risk of bias. All 15 studies included only patients on imatinib. Overall weighted mean molecular relapse rate of CML was 51% (95% CI 44-58%; I 2  = 55). Weighted mean molecular relapse rate at 6-month follow-up was 41% (95% CI 32-51%; I 2  = 78). Eighty percent of molecular relapses occurred in the first 6 months. All 509 patients were alive at 2-year follow-up and only one patient (0.8%, 95% CI 0.2-1.8%; I 2  = 0) has progressed to a blastic crisis. Our findings suggest that imatinib discontinuation is feasible for the majority of CML patients with stable undetectable BCR-ABL transcript level. Approximately 50% of patients remain therapy-free after imatinib discontinuation. Restarting TKIs therapy was followed by a very high rate of molecular response, with no deaths 2 years after discontinuation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hsp90 N- and C-terminal double inhibition synergistically suppresses Bcr-Abl-positive human leukemia cells

PubMed Central

Chen, Xianling; Chen, Xiaole; Li, Ding; Fan, Yingjuan; Xu, Jianhua; Chen, Yuanzhong; Wu, Lixian

2017-01-01

Heat shock protein 90 (Hsp90) contains amino (N)–terminal domain, carboxyl(C)-terminal domain, and middle domains, which activate Hsp90 chaperone function cooperatively in tumor cells. One terminal occupancy might influence another terminal binding with inhibitor. The Bcr-Abl kinase is one of the Hsp90 clients implicated in the pathogenesis of chronic myeloid leukemia (CML). Present studies demonstrate that double inhibition of the N- and C-terminal termini can disrupt Hsp90 chaperone function synergistically, but not antagonistically, in Bcr-Abl-positive human leukemia cells. Furthermore, both the N-terminal inhibitor 17-AAG and the C-terminal inhibitor cisplatin (CP) have the capacity to suppress progenitor cells; however, only CP is able to inhibit leukemia stem cells (LSCs) significantly, which implies that the combinational treatment is able to suppress human leukemia in different mature states. PMID:28036294

Quality assurance in RT-PCR-based BCR/ABL diagnostics--results of an interlaboratory test and a standardization approach.

PubMed

Burmeister, T; Maurer, J; Aivado, M; Elmaagacli, A H; Grünebach, F; Held, K R; Hess, G; Hochhaus, A; Höppner, W; Lentes, K U; Lübbert, M; Schäfer, K L; Schafhausen, P; Schmidt, C A; Schüler, F; Seeger, K; Seelig, R; Thiede, C; Viehmann, S; Weber, C; Wilhelm, S; Christmann, A; Clement, J H; Ebener, U; Enczmann, J; Leo, R; Schleuning, M; Schoch, R; Thiel, E

2000-10-01

Here we describe the results of an interlaboratory test for RT-PCR-based BCR/ABL analysis. The test was organized in two parts. The number of participating laboratories in the first and second part was 27 and 20, respectively. In the first part samples containing various concentrations of plasmids with the ela2, b2a2 or b3a2 BCR/ABL transcripts were analyzed by PCR. In the second part of the test, cell samples containing various concentrations of BCR/ABL-positive cells were analyzed by RT-PCR. Overall PCR sensitivity was sufficient in approximately 90% of the tests, but a significant number of false positive results were obtained. There were significant differences in sensitivity in the cell-based analysis between the various participants. The results are discussed, and proposals are made regarding the choice of primers, controls, conditions for RNA extraction and reverse transcription.

A multiple reaction monitoring (MRM) method to detect Bcr-Abl kinase activity in CML using a peptide biosensor.

PubMed

Yang, Tzu-Yi; Eissler, Christie L; Hall, Mark C; Parker, Laurie L

2013-01-01

The protein kinase Bcr-Abl plays a major role in the pathogenesis of chronic myelogenous leukemia (CML), and is the target of the breakthrough drug imatinib (Gleevec™). While most patients respond well to imatinib, approximately 30% never achieve remission or develop resistance within 1-5 years of starting imatinib treatment. Evidence from clinical studies suggests that achieving at least 50% inhibition of a patient's Bcr-Abl kinase activity (relative to their level at diagnosis) is associated with improved patient outcomes, including reduced occurrence of resistance and longer maintenance of remission. Accordingly, sensitive assays for detecting Bcr-Abl kinase activity compatible with small amounts of patient material are desirable as potential companion diagnostics for imatinib. Here we report the detection of Bcr-Abl activity and inhibition by imatinib in the human CML cell line K562 using a cell-penetrating peptide biosensor and multiple reaction monitoring (MRM) on a triple quadrupole mass spectrometer. MRM enabled reproducible, selective detection of the peptide biosensor at fmol levels from aliquots of cell lysate equivalent to ~15,000 cells. This degree of sensitivity will facilitate the miniaturization of the entire assay procedure down to cell numbers approaching 15,000, making it practical for translational applications in patient cells in which the limited amount of available patient material often presents a major challenge.

A Multiple Reaction Monitoring (MRM) Method to Detect Bcr-Abl Kinase Activity in CML Using a Peptide Biosensor

PubMed Central

Yang, Tzu-Yi; Eissler, Christie L.; Hall, Mark C.; Parker, Laurie L.

2013-01-01

The protein kinase Bcr-Abl plays a major role in the pathogenesis of chronic myelogenous leukemia (CML), and is the target of the breakthrough drug imatinib (Gleevec™). While most patients respond well to imatinib, approximately 30% never achieve remission or develop resistance within 1–5 years of starting imatinib treatment. Evidence from clinical studies suggests that achieving at least 50% inhibition of a patient’s Bcr-Abl kinase activity (relative to their level at diagnosis) is associated with improved patient outcomes, including reduced occurrence of resistance and longer maintenance of remission. Accordingly, sensitive assays for detecting Bcr-Abl kinase activity compatible with small amounts of patient material are desirable as potential companion diagnostics for imatinib. Here we report the detection of Bcr-Abl activity and inhibition by imatinib in the human CML cell line K562 using a cell-penetrating peptide biosensor and multiple reaction monitoring (MRM) on a triple quadrupole mass spectrometer. MRM enabled reproducible, selective detection of the peptide biosensor at fmol levels from aliquots of cell lysate equivalent to ∼15,000 cells. This degree of sensitivity will facilitate the miniaturization of the entire assay procedure down to cell numbers approaching 15,000, making it practical for translational applications in patient cells in which the limited amount of available patient material often presents a major challenge. PMID:23437189

Blockade of Y177 and Nuclear Translocation of Bcr-Abl Inhibits Proliferation and Promotes Apoptosis in Chronic Myeloid Leukemia Cells.

PubMed

Li, Qianyin; Huang, Zhenglan; Gao, Miao; Cao, Weixi; Xiao, Qin; Luo, Hongwei; Feng, Wenli

2017-03-02

The gradual emerging of resistance to imatinib urgently calls for the development of new therapy for chronic myeloid leukemia (CML). The fusion protein Bcr-Abl, which promotes the malignant transformation of CML cells, is mainly located in the cytoplasm, while the c-Abl protein which is expressed in the nucleus can induce apoptosis. Based on the hetero-dimerization of FKBP (the 12-kDa FK506- and rapamycin-binding protein) and FRB (the FKBP-rapamycin binding domain of the protein kinase, mTOR) mediated by AP21967, we constructed a nuclear transport system to induce cytoplasmic Bcr-Abl into nuclear. In this study, we reported the construction of the nuclear transport system, and we demonstrated that FN3R (three nuclear localization signals were fused to FRBT2098L with a FLAG tag), HF2S (two FKBP domains were in tandem and fused to the SH2 domain of Grb2 with an HA tag) and Bcr-Abl form a complexus upon AP21967. Bcr-Abl was imported into the nucleus successfully by the nuclear transport system. The nuclear transport system inhibited CML cell proliferation through mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 5 (STAT5) pathways mainly by HF2S. It was proven that nuclear located Bcr-Abl induced CML cell (including imatinib-resistant K562G01 cells) apoptosis by activation of p73 and its downstream molecules. In summary, our study provides a new targeted therapy for the CML patients even with Tyrosine Kinase Inhibitor (TKI)-resistance.

Hierarchical Modeling of Activation Mechanisms in the ABL and EGFR Kinase Domains: Thermodynamic and Mechanistic Catalysts of Kinase Activation by Cancer Mutations

PubMed Central

Dixit, Anshuman; Verkhivker, Gennady M.

2009-01-01

Structural and functional studies of the ABL and EGFR kinase domains have recently suggested a common mechanism of activation by cancer-causing mutations. However, dynamics and mechanistic aspects of kinase activation by cancer mutations that stimulate conformational transitions and thermodynamic stabilization of the constitutively active kinase form remain elusive. We present a large-scale computational investigation of activation mechanisms in the ABL and EGFR kinase domains by a panel of clinically important cancer mutants ABL-T315I, ABL-L387M, EGFR-T790M, and EGFR-L858R. We have also simulated the activating effect of the gatekeeper mutation on conformational dynamics and allosteric interactions in functional states of the ABL-SH2-SH3 regulatory complexes. A comprehensive analysis was conducted using a hierarchy of computational approaches that included homology modeling, molecular dynamics simulations, protein stability analysis, targeted molecular dynamics, and molecular docking. Collectively, the results of this study have revealed thermodynamic and mechanistic catalysts of kinase activation by major cancer-causing mutations in the ABL and EGFR kinase domains. By using multiple crystallographic states of ABL and EGFR, computer simulations have allowed one to map dynamics of conformational fluctuations and transitions in the normal (wild-type) and oncogenic kinase forms. A proposed multi-stage mechanistic model of activation involves a series of cooperative transitions between different conformational states, including assembly of the hydrophobic spine, the formation of the Src-like intermediate structure, and a cooperative breakage and formation of characteristic salt bridges, which signify transition to the active kinase form. We suggest that molecular mechanisms of activation by cancer mutations could mimic the activation process of the normal kinase, yet exploiting conserved structural catalysts to accelerate a conformational transition and the enhanced

PAX5 mutations occur frequently in adult B-cell progenitor acute lymphoblastic leukemia and PAX5 haploinsufficiency is associated with BCR-ABL1 and TCF3-PBX1 fusion genes: a GRAALL study.

PubMed

Familiades, J; Bousquet, M; Lafage-Pochitaloff, M; Béné, M-C; Beldjord, K; De Vos, J; Dastugue, N; Coyaud, E; Struski, S; Quelen, C; Prade-Houdellier, N; Dobbelstein, S; Cayuela, J-M; Soulier, J; Grardel, N; Preudhomme, C; Cavé, H; Blanchet, O; Lhéritier, V; Delannoy, A; Chalandon, Y; Ifrah, N; Pigneux, A; Brousset, P; Macintyre, E A; Huguet, F; Dombret, H; Broccardo, C; Delabesse, E

2009-11-01

Adult and child B-cell progenitor acute lymphoblastic leukemia (BCP-ALL) differ in terms of incidence and prognosis. These disparities are mainly due to the molecular abnormalities associated with these two clinical entities. A genome-wide analysis using oligo SNP arrays recently demonstrated that PAX5 (paired-box domain 5) is the main target of somatic mutations in childhood BCP-ALL being altered in 38.9% of the cases. We report here the most extensive analysis of alterations of PAX5 coding sequence in 117 adult BCP-ALL patients in the unique clinical protocol GRAALL-2003/GRAAPH-2003. Our study demonstrates that PAX5 is mutated in 34% of adult BCP-ALL, mutations being partial or complete deletion, partial or complete amplification, point mutation or fusion gene. PAX5 alterations are heterogeneous consisting in complete loss in 17%, focal deletions in 10%, point mutations in 7% and translocations in 1% of the cases. PAX5 complete loss and PAX5 point mutations differ. PAX5 complete loss seems to be a secondary event and is significantly associated with BCR-ABL1 or TCF3-PBX1 fusion genes and a lower white blood cell count.

Combined Targeting of BCL-2 and BCR-ABL Tyrosine Kinase Eradicates Chronic Myeloid Leukemia Stem Cells

PubMed Central

Mak, Po Yee; Mu, Hong; Zhou, Hongsheng; Mak, Duncan H.; Schober, Wendy; Leverson, Joel D.; Zhang, Bin; Bhatia, Ravi; Huang, Xuelin; Cortes, Jorge; Kantarjian, Hagop; Konopleva, Marina

2016-01-01

BCR-ABL tyrosine kinase inhibitors (TKIs) are effective against chronic myeloid leukemia (CML), but they rarely eliminate CML stem cells. Disease relapse is common upon therapy cessation, even in patients with complete molecular responses. Furthermore, once CML progresses to blast crisis (BC), treatment outcomes are dismal. We hypothesized that concomitant targeting of BCL-2 and BCR-ABL tyrosine kinase could overcome these limitations. We demonstrate increased BCL-2 expression at the protein level in bone marrow cells, particularly in Lin−Sca-1+cKit+ cells of inducible CML in mice as determined by CyTOF mass cytometry. Further, selective inhibition of BCL-2, aided by TKI-mediated MCL-1 and BCL-XL inhibition, markedly decreased leukemic Lin−Sca-1+cKit+ cell numbers and long-term stem cell frequency, and prolonged survival in a murine CML model. Additionally, this combination effectively eradicated CD34+CD38−, CD34+CD38+, and quiescent stem/progenitor CD34+ cells from BC CML patient samples. Our results suggest that BCL-2 is a key survival factor for CML stem/progenitor cells and that combined inhibition of BCL-2 and BCR-ABL tyrosine kinase has the potential to significantly improve depth of response and cure rates of chronic phase and BC CML. PMID:27605552

Concomitant presence of JAK2V617F mutation and BCR‑ABL translocation in two patients: A new entity or a variant of myeloproliferative neoplasms (Case report).

PubMed

Mousinho, Filipa; Azevedo, Ana P; Mendes, Tatiana; Santos, Paula Sousa E; Cerqueira, Rita; Matos, Sónia; Santos, Sónia; Ramos, Sância; Viana, João Faro; Lima, Fernando

2018-05-17

Myeloproliferative neoplasms (MPNs) are classically divided into BCR RhoGEF and GTPase activating protein (BCR)-ABL proto‑oncogene 1 non‑receptor tyrosine kinase (ABL) positive chronic myeloid leukemia (CML) and BCR‑ABL negative MPNs, including essential thrombocythemia (ET). One of the major diagnostic criteria for ET is the absence of the philadelphia chromosome, thus when present it is almost indicative of CML. ET and CML are considered to be mutually exclusive; however, there are rare situations in which patients with ET present positive BCR‑ABL without the features of CML. Although from the literature review, the frequency of JAK2V617F mutation and BCR‑ABL translocation coexistence in MPNs is low, it may be higher than expected. The current study reported cases of two patients with an initial diagnosis of ET in the presence of JAK2V617F mutation and BCR‑ABL translocation by fluorescent in situ hybridization. Both patients presented with a heterozygous BCR‑ABL translocation, and absence of p190 and p210 transcripts, seemingly a der(9) in the background of an ET JAK2V617F mutation.

Bleeding complications in BCR-ABL negative myeloproliferative neoplasms: prevalence, type, and risk factors in a single-center cohort.

PubMed

Kander, Elizabeth M; Raza, Sania; Zhou, Zheng; Gao, Juehua; Zakarija, Anaadriana; McMahon, Brandon J; Stein, Brady L

2015-11-01

The BCR-ABL1-negative myeloproliferative neoplasms (MPN) share an increased risk of thrombotic and hemorrhagic complications. Risk factors for hemorrhage are less well defined than those for thrombosis. Because patients with CALR mutations have higher platelet counts compared to JAK2 V617F-mutated patients, bleeding rates may be increased in this group. Our aim was to retrospectively evaluate whether acquired von Willebrand disease (AvWD), thrombocytosis, mutational status, or treatment history are associated with bleeding in a cohort of MPN patients. Using an electronic database, MPN patients seen between 2005 and 2013 were retrospectively identified using ICD-9 codes and billing records. A bleeding event was defined as one that was identified in the medical record and graded based on the Common Terminology Criteria for Adverse Event (CTCAE) version 4.0. Among 351 MPN patients, 15.6 % experienced 64 bleeding event types. There was no association of bleeding with mutational status, gender, MPN subtype, aspirin use, prior thrombosis, or platelet count at presentation. There was an association between bleeding and older age at diagnosis. aVWD was identified in six patients. In this single-center retrospective study, bleeding events were identified in 15 % of patients, and associated with older age at diagnosis. aVWD was rarely tested for in this cohort.

Amplification of the BCR/ABL fusion gene clustered on a masked Philadelphia chromosome in a patient with myeloblastic crisis of chronic myelocytic leukemia.

PubMed

Gargallo, Patricia M; Cuello, Maria Teresa; Aranguren, Pedro Negri; Larripa, Irene B

2003-06-01

Although the chronic phase of chronic myelocytic leukemia (CML) is characterized by the Philadelphia (Ph) chromosome creating a hybrid BCR/ABL gene, additional genetic changes involved in blast crisis are poorly understood. We report a 4-8-fold amplification by tandem duplication of the BCR/ABL fusion gene clustered on a masked Ph chromosome in a 61-year-old male patient with CML in myeloblastic crisis. Our finding suggests that the BCR/ABL amplification may play a role as a novel mechanism in the progression to an aggressive blast transformation in some cases of Ph-positive CML.

Coupling between p210bcr-abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits growth factor receptor-independent link to ras activation pathway.

PubMed

Tauchi, T; Boswell, H S; Leibowitz, D; Broxmeyer, H E

1994-01-01

Enforced expression of p210bcr-abl transforms interleukin 3 (IL-3)-dependent hematopoietic cell lines to growth factor-independent proliferation. It has been demonstrated that nonreceptor tyrosine kinase oncogenes may couple to the p21ras pathway to exert their transforming effect. In particular, p210bcr-abl was recently found to effect p21ras activation in hematopoietic cells. In this context, experiments were performed to evaluate a protein signaling pathway by which p210bcr-abl might regulate p21ras. It was asked whether Shc p46/p52, a protein containing a src-homology region 2 (SH2) domain, and known to function upstream from p21ras, might form specific complexes with p210bcr-abl and thus, possibly alter p21ras activity by coupling to the guanine nucleotide exchange factor (Sos/CDC25) through the Grb2 protein-Sos complex. This latter complex has been previously demonstrated to occur ubiquitously. We found that p210bcr-abl formed a specific complex with Shc and with Grb2 in three different murine cell lines transfected with a p210bcr-abl expression vector. There appeared to be a higher order complex containing Shc, Grb2, and bcr-abl proteins. In contrast to p210bcr-abl transformed cells, in which there was constitutive tight association between Grb2 and Shc, binding between Grb2 and Shc was Steel factor (SLF)-dependent in a SLF-responsive, nontransformed parental cell line. The SLF-dependent association between Grb2 and Shc in nontransformed cells involved formation of a complex of Grb2 with c-kit receptor after SLF treatment. Thus, p210bcr-abl appears to function in a hematopoietic p21ras activation pathway to allow growth factor-independent coupling between Grb2, which exists in a complex with the guanine nucleotide exchange factor (Sos), and p21ras. Shc may not be required for Grb2-c-kit interaction, because it fails to bind strongly to c-kit.

Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

NASA Astrophysics Data System (ADS)

Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

2016-10-01

In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

Prolonged treatment with imatinib mesylate in patients with advanced chronic myeloid leukemia causes a reduction of bcr/abl mRNA levels independent of cytogenetic response.

PubMed

Cariani, E; Capucci, M; Micheletti, M; Spalenza, F; Zanella, I; Albertini, A; Rossi, G

2003-06-01

Bcr/abl mRNA levels were monitored in 13 patients with chronic myeloid leukemia receiving imatinib mesylate over a period of 78 weeks. During treatment median bcr/abl mRNA levels progressively declined from 77.2 normalized dose (nD) at baseline to 11.28 nD after 13 weeks ( P<0.05) and to 1.28 nD after 78 weeks ( P<0.05). After 13 weeks, bcr/abl mRNA levels were significantly lower in cytogenetic responders compared to nonresponders ( P<0.05), but subsequent decrease in the transcript levels caused the loss of any correlation to the cytogenetic status. These results suggest that bcr/abl mRNA levels may reflect cytogenetic response only during the early phases of imatinib therapy.

The effect of Bcr-Abl protein tyrosine kinase on maturation and proliferation of primitive haematopoietic cells.

PubMed Central

Buckle, A. M.; Mottram, R.; Pierce, A.; Lucas, G. S.; Russell, N.; Miyan, J. A.; Whetton, A. D.

2000-01-01

BACKGROUND: Chronic Myeloid Leukaemia (CML) is characterised by the chromosomal translocation resulting in expression of the Bcr-Abl protein tyrosine kinase (PTK) in early stem cells and their progeny. However the precise nature of Bcr-Abl effects in primitive CML stem cells remains a matter of active debate. MATERIALS AND METHODS: Extremely primitive Bcr-Abl fusion positive cells were purified from patients with CML using multiparameter flow cytometric analysis of CD34, Thy, and lineage marker (Lin) expression, plus rhodamine-123 (Rh-123) brightness. Progenitor cells of increasing maturity were examined for cycling status by flow cytometry and their proliferative status directly correlated with cell phenotype. The activation status of a key transcription factor, signal transducers and activators of transcription (STAT-5), was also analyzed by immunocytochemistry. RESULTS: The most primitive stem cells currently defined (CD34+Lin-Thy+ Rh-1231o) were present as a lower proportion of the stem cell compartment (CD34+Lin-) of CML patients at presentation than of normal individuals (2.3% +/- 0.4 compared with 5.1% +/- 0.6 respectively). Conversely there was a significantly higher proportion of the more mature cells (CD34+Lin-Thy-Rh-123 hi) in CML patients than in normal individuals (79.3 +/- 1.8 compared with 70.9 +/- 3.3). No primitive subpopulation of CML CD34+Lin- cells was cycling to a significantly greater degree than cells from normal donors, in fact, late progenitor cells (CD34+Lin+) were cycling significantly less in CML samples than normal samples. STAT5, however, was observed to be activated in CML cells. CONCLUSIONS: We conclude that no subpopulation of CML stem cells displays significantly increased cell cycling. Thus, increased cycling cannot be a direct consequence of Bcr-Abl PTK acquisition in highly enriched stem cells from patients with CML. In vivo CML need not be considered a disease of unbridled stem cell proliferation, but a subtle defect in the

Genetic Polymorphisms of Hemostatic Factors and Thrombotic Risk in Non BCR-ABL Myeloproliferative Neoplasms: A Pilot Study

PubMed Central

Dambrauskienė, R; Gerbutavičius, R; Ugenskienė, R; Jankauskaitė, R; Savukaitytė, A; Šimoliūnienė, R; Rudžianskienė, M; Gerbutavičienė, R; Juozaitytė, E

2017-01-01

Abstract The most important complications of Philadelphianegagive (non BCR-ABL) myeloproliferative neoplasms (MPNs) are vascular events. Our aim was to evaluate the effects of single nucleotide polymorphisms (SNPs), platelet glycoproteins (GPs) (Ia/IIa, Ibα, IIb/IIIa and VI), von Willebrand factor (vWF), coagulation factor VII (FVII), β-fibrinogen, and the risk of thrombosis in patients with non BCR-ABL MPNs at the Lithuanian University of Health Sciences. Kaunas, Lithuania. Genotyping was done for 108 patients. The TT genotype of the GP Ia/IIa c.807C>T polymorphism was more frequently found in the group of MPN patients with arterial thrombosis compared to MPN patients who were thrombosis-free [26.5 vs. 11.5%, p = 0.049; odds ratio (OR) 2.68; 95% confidence interval (95% CI) 1.01-7.38]. The CT genotype of the β-fibrinogen c.-148C>T polymorphism occurred more frequently in MPN patients with arterial, and total thrombosis compared to the wild or homozygous genotype (57.7 vs. 40.0 vs. 12.5%; p = 0.027), (64.7 vs. 44.4 vs. 25%; p = 0.032), respectively. The carrier state for the c.-323P10 variant of FVII SNP (summation of P10/10 and P0/10) was more frequent in MPN patients with thrombosis compared to the wild-type genotype carriers (71.4 vs. 43.4%; p = 0.049; OR 3.26; 95% CI 1.01-11.31). The coexistence of heterozygous β-fibrinogen c.-148C>T and FVII c.-323P0/10 SNP, increased the risk of arterial thrombosis (21.1 vs. 3.7%, p = 0.008; OR 6.93; 95% CI 1.38-34.80). The TT genotype of GP Ia/IIa c.807C>T, the CT genotype of β-fibrinogen c.-148C>T and FVII c.-323P0/10 SNP could be associated with risk of thrombosis in MPN patients. PMID:28924539

BCR-ABL1 expression, RT-qPCR and treatment decisions in chronic myeloid leukaemia.

PubMed

Latham, Susan; Bartley, Paul A; Budgen, Bradley; Ross, David M; Hughes, Elizabeth; Branford, Susan; White, Deborah; Hughes, Timothy P; Morley, Alexander A

2016-09-01

RT-qPCR is used to quantify minimal residual disease (MRD) in chronic myeloid leukaemia (CML) in order to make decisions on treatment, but its results depend on the level of BCR-ABL1 expression as well as leukaemic cell number. The aims of the study were to quantify inter-individual differences in expression level, to determine the relationship between expression level and response to treatment, and to investigate the effect of expression level on interpretation of the RT-qPCR result. BCR-ABL1 expression was studied in 248 samples from 65 patients with CML by determining the difference between MRD quantified by RT-qPCR and DNA-qPCR. The results were analysed statistically and by simple indicative modelling. Inter-individual levels of expression approximated a normal distribution with an SD of 0.36 log. Expression at diagnosis correlated with expression during treatment. Response to treatment, as measured by the number of leukaemic cells after 3, 6 or 12 months of treatment, was not related to the level of expression. Indicative modelling suggested that interpretation of RT-qPCR results in relation to treatment guidelines could be affected by variation in expression when MRD was around 10% at 3 months and by both expression variation and Poisson variation when MRD was around or below the limit of detection of RT-qPCR. Variation between individuals in expression of BCR-ABL1 can materially affect interpretation of the RT-qPCR when this test is used to make decisions on treatment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

SNP array analysis of tyrosine kinase inhibitor-resistant chronic myeloid leukemia identifies heterogeneous secondary genomic alterations

PubMed Central

Müschen, Markus; Kato, Motohiro; Kawamata, Norihiko; Meixel, Antonie; Nowak, Verena; Kim, Han S.; Kang, Sharon; Paquette, Ronald; Chang, Mi-Sook; Thoenissen, Nils H.; Mossner, Max; Hofmann, Wolf-Karsten; Kohlmann, Alexander; Weiss, Tamara; Haferlach, Torsten; Haferlach, Claudia; Koeffler, H. Phillip

2010-01-01

To elucidate whether tyrosine kinase inhibitor (TKI) resistance in chronic myeloid leukemia is associated with characteristic genomic alterations, we analyzed DNA samples from 45 TKI-resistant chronic myeloid leukemia patients with 250K single nucleotide polymorphism arrays. From 20 patients, matched serial samples of pretreatment and TKI resistance time points were available. Eleven of the 45 TKI-resistant patients had mutations of BCR-ABL1, including 2 T315I mutations. Besides known TKI resistance-associated genomic lesions, such as duplication of the BCR-ABL1 gene (n = 8) and trisomy 8 (n = 3), recurrent submicroscopic alterations, including acquired uniparental disomy, were detectable on chromosomes 1, 8, 9, 17, 19, and 22. On chromosome 22, newly acquired and recurrent deletions of the IGLC1 locus were detected in 3 patients, who had previously presented with lymphoid or myeloid blast crisis. This may support a hypothesis of TKI-induced selection of subclones differentiating into immature B-cell progenitors as a mechanism of disease progression and evasion of TKI sensitivity. PMID:19965645

A Virtual Screening Approach for the Identification of High Affinity Small Molecules Targeting BCR-ABL1 Inhibitors for the Treatment of Chronic Myeloid Leukemia.

PubMed

Sharda, Saphy; Sarmandal, Palash; Cherukommu, Shirisha; Dindhoria, Kiran; Yadav, Manisha; Bandaru, Srinivas; Sharma, Anudeep; Sakhi, Aditi; Vyas, Tanmay; Hussain, Tajamul; Nayarisseri, Anuraj; Singh, Sanjeev Kumar

2017-01-01

CML originates due to reciprocal translocation in Philadelphia chromosome leading to the formation of fusion product BCR-ABL which constitutively activates tyrosine kinase signaling pathways eventually leading to abnormal proliferation of granulocytic cells. As a therapeutic strategy, BCR-ABL inhibitors have been clinically approved which terminates its phosphorylation activity and retards cancer progression. However, a number of patients develop resistance to inhibitors which demand for the discovery of new inhibitors. Given the drawbacks of present inhibitors, by high throughput virtual screening approaches, present study pursues to identify high affinity compounds targeting BCR-ABL1 anticipated to have safer pharmacological profiles. Five established BCR-ABL inhibitors formed the query compounds for identification of structurally similar compounds by Tanimoto coefficient based linear fingerprint search with a threshold of 95% against PubChemdatabase. Assisted by MolDock algorithm all compounds were docked against BCR-ABL protein in order to retrieve high affinity compounds. The parents and similars were further tested for their ADMET propertiesand bioactivity. Rebastinib formed higher affinity inhibitor than rest of the four established compound investigated in the study. Interestingly, Rebastinib similar compound with Pubchem ID: 67254402 was also shown to have highest affinity than other similars including the similars of respective five parents. In terms of ADMET properties Pubchem ID: 67254402 had appreciable ADMET profile and bioactivity. However, Rebastinib still stood as the best inhibitor in terms of binding affinity and ADMET properties than Pubchem ID: 67254402. Nevertheless, owing to the similar pharmacological properties with Rebastinib, Pubchem ID: 67254402 can be expected to form potential BCR-ABL inhibitor. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Molecular analyses of 15,542 patients with suspected BCR-ABL1-negative myeloproliferative disorders allow to develop a stepwise diagnostic workflow

PubMed Central

Schnittger, Susanne; Bacher, Ulrike; Eder, Christiane; Dicker, Frank; Alpermann, Tamara; Grossmann, Vera; Kohlmann, Alexander; Kern, Wolfgang; Haferlach, Claudia; Haferlach, Torsten

2012-01-01

We investigated 15,542 patients with suspected BCR-ABL1- negative myeloproliferative or myelodysplastic/myeloproliferative neoplasm (including 359 chronic myelomonocytic leukemia) by a molecular marker set. JAK2V617F was detected in the suspected categories as follows: polycythemia vera 88.3%, primary myelofibrosis 53.8%, essential thrombocythemia 50.2%, and not further classifiable myeloproliferative neoplasms 38.0%. JAK2 exon 12 mutations were detected in 40.0% JAK2V617F-negative suspected polycythemia vera, MPLW515 mutations in 13.2%JAK2V617F-negative primary myelofibrosis and 7.1% JAK2V617F-negative essential thrombocythemia. TET2 mutations were distributed across all entities but were most frequent in suspected chronic myelomonocytic leukemia (77.8%). CBL mutations were identified in suspected chronic myelomonocytic leukemia (13.9%), primary myelofibrosis (8.0%), and not further classifiable myeloproliferative neoplasm (7.0%). This leads to a stepwise workflow for suspected myeloproliferative neoplasms starting with JAK2V617F and investigating JAK2V617F-negative patients for JAK2 exon 12 or MPL mutations, respectively. In cases in which a myeloproliferative neoplasm cannot be established, analysis for TET2, CBL and EZH2 mutations may be indicated. PMID:22511494

Molecular genetic tests for JAK2V617F, Exon12_JAK2 and MPLW515K/L are highly informative in the evaluation of patients suspected to have BCR-ABL1-negative myeloproliferative neoplasms.

PubMed

dos Santos, Marcos Tadeu; Mitne-Neto, Miguel; Miyashiro, Kozue; Chauffaille, Maria de Lourdes L Ferrari; Rizzatti, Edgar Gil

2014-02-01

Polycythaemia vera (PV), essential thrombocythemia (ET) and idiopathic myelofibrosis (MF), are the most common myeloproliferative neoplasms (MPN) in patients without the BCR-ABL1 gene rearrangement. They are caused by clonal expansion of haematopoietic stem cells and share, as a diagnostic criterion, the identification of JAK2V617F mutation. Classically, when other clinical criteria are present, a JAK2V617F negative case requires the analysis of Exon12_JAK2 for the diagnosis of PV, and of MPL515K/L mutations for the diagnosis of ET and MF. Here, we evaluated 78 samples from Brazilian patients suspected to have MPN, without stratification for PV, ET or MF. We found that 28 (35.9%) are JAK2V617F carriers; from the 50 remaining samples, one (2%) showed an Exon12_JAK2 mutation, and another (2%) was positive for MPLW515L mutation. In summary, the investigation of JAK2V617F, Exon12_JAK2 and MPLW515K/L was relevant for the diagnosis of 38.4% of patients suspected to have BCR-ABL1-negative MPN, suggesting that molecular genetic tests are useful for a quick and unequivocal diagnosis of MPN.

Molecular genetic tests for JAK2V617F, Exon12_JAK2 and MPLW515K/L are highly informative in the evaluation of patients suspected to have BCR-ABL1-negative myeloproliferative neoplasms

PubMed Central

dos Santos, Marcos Tadeu; Mitne-Neto, Miguel; Miyashiro, Kozue; Chauffaille, Maria de Lourdes L Ferrari; Rizzatti, Edgar Gil

2014-01-01

Polycythaemia vera (PV), essential thrombocythemia (ET) and idiopathic myelofibrosis (MF), are the most common myeloproliferative neoplasms (MPN) in patients without the BCR-ABL1 gene rearrangement. They are caused by clonal expansion of haematopoietic stem cells and share, as a diagnostic criterion, the identification of JAK2V617F mutation. Classically, when other clinical criteria are present, a JAK2V617F negative case requires the analysis of Exon12_JAK2 for the diagnosis of PV, and of MPL515K/L mutations for the diagnosis of ET and MF. Here, we evaluated 78 samples from Brazilian patients suspected to have MPN, without stratification for PV, ET or MF. We found that 28 (35.9%) are JAK2V617F carriers; from the 50 remaining samples, one (2%) showed an Exon12_JAK2 mutation, and another (2%) was positive for MPLW515L mutation. In summary, the investigation of JAK2V617F, Exon12_JAK2 and MPLW515K/L was relevant for the diagnosis of 38.4% of patients suspected to have BCR-ABL1-negative MPN, suggesting that molecular genetic tests are useful for a quick and unequivocal diagnosis of MPN. PMID:23986553

Germline mutations in ABL1 cause an autosomal dominant syndrome characterized by congenital heart defects and skeletal malformations.

PubMed

Wang, Xia; Charng, Wu-Lin; Chen, Chun-An; Rosenfeld, Jill A; Al Shamsi, Aisha; Al-Gazali, Lihadh; McGuire, Marianne; Mew, Nicholas Ah; Arnold, Georgianne L; Qu, Chunjing; Ding, Yan; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Walkiewicz, Magdalena; Xia, Fan; Plon, Sharon E; Lupski, James R; Schaaf, Christian P; Yang, Yaping

2017-04-01

ABL1 is a proto-oncogene well known as part of the fusion gene BCR-ABL1 in the Philadelphia chromosome of leukemia cancer cells. Inherited germline ABL1 changes have not been associated with genetic disorders. Here we report ABL1 germline variants cosegregating with an autosomal dominant disorder characterized by congenital heart disease, skeletal abnormalities, and failure to thrive. The variant c.734A>G (p.Tyr245Cys) was found to occur de novo or cosegregate with disease in five individuals (families 1-3). Additionally, a de novo c.1066G>A (p.Ala356Thr) variant was identified in a sixth individual (family 4). We overexpressed the mutant constructs in HEK 293T cells and observed increased tyrosine phosphorylation, suggesting increased ABL1 kinase activities associated with both the p.Tyr245Cys and p.Ala356Thr substitutions. Our clinical and experimental findings, together with previously reported teratogenic effects of selective BCR-ABL inhibitors in humans and developmental defects in Abl1 knockout mice, suggest that ABL1 has an important role during organismal development.

A Non-ATP Competitive Inhibitor of BCR-ABL for the Therapy of Imatinib-Resistant Cmls

DTIC Science & Technology

2008-05-01

HSP90 members (e.g. HSP70 and HSP27 ) help maintain the macromolecular complex that assembled the Bcr-Abl/Jak2 signaling Network. Our published papers 4...kinase, Akt and GSK3 beta. Our recent findings suggest that the HSP90/HSP70/ HSP27 chaperone proteins are also part of this Network, and may play a

Successful treatment with allogeneic stem cell transplantation followed by DLI and TKIs for e6a2 BCR-ABL-positive acute myeloid leukaemia

PubMed Central

Harada, Yasuhiko; Nishiwaki, Satoshi; Sugimoto, Takumi; Onodera, Koichi; Goto, Tatsunori; Sato, Takahiko; Kamoshita, Sonoko; Kawashima, Naomi; Seto, Aika; Okuno, Shingo; Yamamoto, Satomi; Iwasaki, Toshihiro; Ozawa, Yukiyasu; Miyamura, Koichi; Akatsuka, Yoshiki; Sugiura, Isamu

2017-01-01

Abstract Rationale: Patients with the e6a2 BCR-ABL transcript, 1 of the atypical transcripts, have been reported to have a poor prognosis, and allogeneic stem cell transplantation (ASCT) can be considered as additional therapy. However, long-term survival after ASCT for this disease is rare. Patient concerns: This report concerns a 55-year-old female patient with e6a2 BCR-ABL-positive acute myeloid leukemia including the outcome of ASCT followed by donor lymphocyte infusion (DLI). Diagnoses: The breakpoint was confirmed by direct sequencing. Her minimal residual disease could be detected by nested reverse-transcription polymerase chain reaction using primers for the minor BCR-ABL (e1a2) transcript. Interventions: Treatment with tyrosine kinase inhibitors (TKIs) and ASCT followed by DLI. Outcomes: Despite multiple cytogenetic and molecular relapses after ASCT, she remains in molecular remission at 46 months after ASCT. Lessons: This case indicates the efficacy of the combination of the graft-versus-leukemia effect and TKIs for e6a2 BCR-ABL-positive acute leukemia. When the Philadelphia chromosome with an unusual chromosomal breakpoint is suggested, we should clarify the breakpoint because that information can aid molecular assessments and decisions to provide an additional or alternative therapy. PMID:29390324

miR-29b suppresses CML cell proliferation and induces apoptosis via regulation of BCR/ABL1 protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yajuan; Wang, Haixia; Tao, Kun

MicroRNAs (miRNAs) are small RNAs that regulate gene expression posttranscriptionally and are critical for many cellular pathways. Recent evidence has shown that aberrant miRNA expression profiles and unique miRNA signaling pathways are present in many cancers. Here, we demonstrate that miR-29b is markedly lower expressed in CML patient samples. Bioinformatics analysis reveals a conserved target site for miR-29b in the 3′-untranslated region (UTR) of ABL1. miR-29b significantly suppresses the activity of a luciferase reporter containing ABL1-3′UTR and this activity is not observed in cells transfected with mutated ABL1-3′UTR. Enforced expression of miR-29b in K562 cells inhibits cell growth and colonymore » formation ability thereby inducing apoptosis through cleavage of procaspase 3 and PARP. Furthermore, K562 cells transfected with a siRNA targeting ABL1 show similar growth and apoptosis phenotypes as cells overexpression of miR-29b. Collectively, our results suggest that miR-29b may function as a tumor suppressor by targeting ABL1 and BCR/ABL1. - Highlights: ► miR-29b expression was downregulated in CML patients. ► ABL1 was identified as a direct target gene of miR-29b. ► Enforced expression of miR-29b inhibits cell proliferation and induces apoptosis. ► miR-29b might be a therapeutic target to CML.« less

Structural and Spectroscopic Analysis of the Kinase Inhibitor Bosutinib and an Isomer of Bosutinib Binding to the Abl Tyrosine Kinase Domain

PubMed Central

Levinson, Nicholas M.; Boxer, Steven G.

2012-01-01

Chronic myeloid leukemia (CML) is caused by the kinase activity of the BCR-Abl fusion protein. The Abl inhibitors imatinib, nilotinib and dasatinib are currently used to treat CML, but resistance to these inhibitors is a significant clinical problem. The kinase inhibitor bosutinib has shown efficacy in clinical trials for imatinib-resistant CML, but its binding mode is unknown. We present the 2.4 Å structure of bosutinib bound to the kinase domain of Abl, which explains the inhibitor's activity against several imatinib-resistant mutants, and reveals that similar inhibitors that lack a nitrile moiety could be effective against the common T315I mutant. We also report that two distinct chemical compounds are currently being sold under the name “bosutinib”, and report spectroscopic and structural characterizations of both. We show that the fluorescence properties of these compounds allow inhibitor binding to be measured quantitatively, and that the infrared absorption of the nitrile group reveals a different electrostatic environment in the conserved ATP-binding sites of Abl and Src kinases. Exploiting such differences could lead to inhibitors with improved selectivity. PMID:22493660

Profile of bosutinib and its clinical potential in the treatment of chronic myeloid leukemia

PubMed Central

Amsberg, Gunhild Keller-von; Koschmieder, Steffen

2013-01-01

Bosutinib (SKI-606) is an orally available, once-daily, dual Src and Abl kinase inhibitor with promising clinical potential in first-, second-, and third-line treatment of chronic myeloid leukemia (CML). Bosutinib effectively inhibits wild-type BCR-ABL and most imatinib-resistant BCR-ABL mutations except for V299L and T315I. Low hematologic toxicity is a remarkable characteristic of this novel second-generation tyrosine kinase inhibitor, and this has been ascribed to its minimal activity against the platelet-derived growth factor receptor and KIT. Low-grade, typically self-limiting diarrhea, which usually appears within the first few weeks after treatment initiation, represents the predominant toxicity of bosutinib. Other treatment-associated adverse events are mostly mild to moderate. Bosutinib has been approved by the US Food and Drug Administration for the treatment of chronic, accelerated, or blast phase Philadelphia chromosome-positive CML in adult patients with resistance or intolerance to prior therapy. This review summarizes the main properties of bosutinib and the currently available data on its clinical potential in the treatment of CML. PMID:23493838

Coupling a universal DNA circuit with graphene sheets/polyaniline/AuNPs nanocomposites for the detection of BCR/ABL fusion gene.

PubMed

Chen, Xueping; Wang, Li; Sheng, Shangchun; Wang, Teng; Yang, Juan; Xie, Guoming; Feng, Wenli

2015-08-19

This article described a novel method by coupling a universal DNA circuit with graphene sheets/polyaniline/AuNPs nanocomposites (GS/PANI/AuNPs) for highly sensitive and specific detection of BCR/ABL fusion gene (bcr/abl) in chronic myeloid leukemia (CML). DNA circuit known as catalyzed hairpin assembly (CHA) is enzyme-free and can be simply operated to achieve exponential amplification, which has been widely employed in biosensing. However, application of CHA has been hindered by the need of specially redesigned sequences for each single-stranded DNA input. Herein, a transducer hairpin (HP) was designed to obtain a universal DNA circuit with favorable signal-to-background ratio. To further improve signal amplification, GS/PANI/AuNPs with excellent conductivity and enlarged effective area were introduced into this DNA circuit. Consequently, by combining the advantages of CHA and GS/PANI/AuNPs, bcr/abl could be detected in a linear range from 10 pM to 20 nM with a detection limit of 1.05 pM. Moreover, this protocol showed excellent specificity, good stability and was successfully applied for the detection of real sample, which demonstrated its great potential in clinical application. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

PubMed

Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

2017-07-01

Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

BCR-ABL1 tyrosine kinase inhibitors for the treatment of chronic myeloid leukemia.

PubMed

Cuellar, Sandra; Vozniak, Michael; Rhodes, Jill; Forcello, Nicholas; Olszta, Daniel

2017-01-01

The management of chronic myeloid leukemia with BCR-ABL1 tyrosine kinase inhibitors has evolved chronic myeloid leukemia into a chronic, manageable disease. A patient-centered approach is important for the appropriate management of chronic myeloid leukemia and optimization of long-term treatment outcomes. The pharmacist plays a key role in treatment selection, monitoring drug-drug interactions, identification and management of adverse events, and educating patients on adherence. The combination of tyrosine kinase inhibitors with unique safety profiles and individual patients with unique medical histories can make managing treatment difficult. This review will provide up-to-date information regarding tyrosine kinase inhibitor-based treatment of patients with chronic myeloid leukemia. Management strategies for adverse events and considerations for drug-drug interactions will not only vary among patients but also across tyrosine kinase inhibitors. Drug-drug interactions can be mild to severe. In instances where co-administration of concomitant medications cannot be avoided, it is critical to understand how drug levels are impacted and how subsequent dose modifications ensure therapeutic drug levels are maintained. An important component of patient-centered management of chronic myeloid leukemia also includes educating patients on the significance of early and regular monitoring of therapeutic milestones, emphasizing the importance of adhering to treatment in achieving these targets, and appropriately modifying treatment if these clinical goals are not being met. Overall, staying apprised of current research, utilizing the close pharmacist-patient relationship, and having regular interactions with patients, will help achieve successful long-term treatment of chronic myeloid leukemia in the age of BCR-ABL1 tyrosine kinase inhibitors.

Dasatinib rapidly induces deep molecular response in chronic-phase chronic myeloid leukemia patients who achieved major molecular response with detectable levels of BCR-ABL1 transcripts by imatinib therapy.

PubMed

Shiseki, Masayuki; Yoshida, Chikashi; Takezako, Naoki; Ohwada, Akira; Kumagai, Takashi; Nishiwaki, Kaichi; Horikoshi, Akira; Fukuda, Tetsuya; Takano, Hina; Kouzai, Yasuji; Tanaka, Junji; Morita, Satoshi; Sakamoto, Junichi; Sakamaki, Hisashi; Inokuchi, Koiti

2017-10-01

With the introduction of imatinib, a first-generation tyrosine kinase inhibitor (TKI) to inhibit BCR-ABL1 kinase, the outcome of chronic-phase chronic myeloid leukemia (CP-CML) has improved dramatically. However, only a small proportion of CP-CML patients subsequently achieve a deep molecular response (DMR) with imatinib. Dasatinib, a second-generation TKI, is more potent than imatinib in the inhibition of BCR-ABL1 tyrosine kinase in vitro and more effective in CP-CML patients who do not achieve an optimal response with imatinib treatment. In the present study, we attempted to investigate whether switching the treatment from imatinib to dasatinib can induce DMR in 16 CP-CML patients treated with imatinib for at least two years who achieved a major molecular response (MMR) with detectable levels of BCR-ABL1 transcripts. The rates of achievement of DMR at 1, 3, 6 and 12 months after switching to dasatinib treatment in the 16 patients were 44% (7/16), 56% (9/16), 63% (10/16) and 75% (12/16), respectively. The cumulative rate of achieving DMR at 12 months from initiation of dasatinib therapy was 93.8% (15/16). The proportion of natural killer cells and cytotoxic T cells in peripheral lymphocytes increased after switching to dasatinib. In contrast, the proportion of regulatory T cells decreased during treatment. The safety profile of dasatinib was consistent with previous studies. Switching to dasatinib would be a therapeutic option for CP-CML patients who achieved MMR but not DMR by imatinib, especially for patients who wish to discontinue TKI therapy.

EGFR T790M mutation testing within the osimertinib AURA Phase I study.

PubMed

Dearden, Simon; Brown, Helen; Jenkins, Suzanne; Thress, Kenneth S; Cantarini, Mireille; Cole, Rebecca; Ranson, Malcolm; Jänne, Pasi A

2017-07-01

Reliable epidermal growth factor receptor (EGFR) mutation testing techniques are required to identify eligible patients with EGFR mutation/T790M positive advanced non-small cell lung cancer (NSCLC), for treatment with osimertinib (AZD9291), an oral, potent, irreversible EGFR tyrosine kinase inhibitor (TKI) selective for EGFR-TKI-sensitizing and T790M resistance mutations over wild-type EGFR. There is no current consensus regarding the best method to detect EGFR T790M mutations. The aim of this study was to describe the concordance between local testing, which used a variety of methods, and central testing, using the cobas ® EGFR Mutation Test, for EGFR-sensitizing mutations and the T790M resistance mutation. Tumor samples were obtained from all patients screened for inclusion onto the osimertinib Phase I expansion component of the AURA Phase I/II study (NCT01802632). Samples underwent central laboratory testing for EGFR-sensitizing mutations and T790M resistance mutation using the cobas ® EGFR Mutation Test. Results were compared with local laboratory test results, based on other testing methodologies including Sanger sequencing, therascreen ® , PNAClamp™, and Sequenom MassARRAY ® . Central laboratory testing was successful in 99% of samples passing histopathology review and testing success rates were comparable across the three central laboratories. Concordance between central and local testing for common sensitizing mutations was high (>98%) and concordance for the T790M mutation was also high (>90%). Tumor heterogeneity, along with other technical factors may have influenced this result. Within the osimertinib AURA Phase I study, EGFR mutation testing across three centralized laboratories using the cobas ® EGFR Mutation Test was feasible and successful, with strong concordance between local and central laboratory results, including for T790M. The cobas ® EGFR Mutation Test has subsequently been approved as the companion diagnostic test for osimertinib in

BCR-ABL1 transcript at 3 months predicts long-term outcomes following second generation tyrosine kinase inhibitor therapy in the patients with chronic myeloid leukaemia in chronic phase who failed Imatinib.

PubMed

Kim, Dennis D; Lee, Honggi; Kamel-Reid, Suzanne; Lipton, Jeffrey H

2013-03-01

The BCR-ABL1 transcript level at 3 months can predict long-term outcomes following frontline therapy with Imatinib or Dasatinib in chronic myeloid leukaemia (CML) patients. However, data is lacking for second-generation tyrosine kinase inhibitor (2GTKI) therapy after Imatinib failure. A total of 112 patients with CML in chronic phase receiving 2GTKI after Imatinib failure were reviewed. Treatment outcomes including complete cytogenetic (CCyR), major molecular (MMR) and molecular response 4.5 (4.5 log reduction of BCR-ABL1 transcript level, MR(4.5) ), treatment failure, progression-free and overall survival (OS) were compared according to BCR-ABL1 transcript levels at 3 or 6 months, divided into <1%(IS) , 1-10%(IS) and ≥ 10%(IS) . BCR-ABL1 transcript level at 3 months showed better correlation with OS (P < 0.001) than that at 6 months (P = 0.147). Better OS was also observed in the patients achieving <1%(IS) (100%) and 1-10%(IS) (100%) than those with ≥ 10%(IS) at 3 months (70.6%, P < 0.001). Those with <1%(IS) showed the best CCyR, MMR and MR(4.5) rates; 1-10%(IS) , intermediate; and ≥ 10%(IS) , the lowest CCyR, MMR and MR(4.5) rates. The group with <1%(IS) at 3 months maintained significantly lower BCR-ABL1 transcript level compared to other two groups. In conclusion, the BCR-ABL1 transcript level at 3 months is the most relevant surrogate for outcomes following 2GTKI therapy after Imatinib failure. © 2012 Blackwell Publishing Ltd.

Predictive value of minimal residual disease in Philadelphia-chromosome-positive acute lymphoblastic leukemia treated with imatinib in the European intergroup study of post-induction treatment of Philadelphia-chromosome-positive acute lymphoblastic leukemia, based on immunoglobulin/T-cell receptor and BCR/ABL1 methodologies

PubMed Central

Cazzaniga, Giovanni; De Lorenzo, Paola; Alten, Julia; Röttgers, Silja; Hancock, Jeremy; Saha, Vaskar; Castor, Anders; Madsen, Hans O.; Gandemer, Virginie; Cavé, Hélène; Leoni, Veronica; Köhler, Rolf; Ferrari, Giulia M.; Bleckmann, Kirsten; Pieters, Rob; van der Velden, Vincent; Stary, Jan; Zuna, Jan; Escherich, Gabriele; zur Stadt, Udo; Aricò, Maurizio; Conter, Valentino; Schrappe, Martin; Valsecchi, Maria Grazia; Biondi, Andrea

2018-01-01

The prognostic value of minimal residual disease (MRD) in Philadelphia-chromosome-positive (Ph+) childhood acute lymphoblastic leukemia (ALL) treated with tyrosine kinase inhibitors is not fully established. We detected MRD by real-time quantitative polymerase chain reaction (RQ-PCR) of rearranged immunoglobulin/T-cell receptor genes (IG/TR) and/or BCR/ABL1 fusion transcript to investigate its predictive value in patients receiving Berlin-Frankfurt-Münster (BFM) high-risk (HR) therapy and post-induction intermittent imatinib (the European intergroup study of post-induction treatment of Philadelphia-chromosome-positive acute lymphoblastic leukemia (EsPhALL) study). MRD was monitored after induction (time point (TP)1), consolidation Phase IB (TP2), HR Blocks, reinductions, and at the end of therapy. MRD negativity progressively increased over time, both by IG/TR and BCR/ABL1. Of 90 patients with IG/TR MRD at TP1, nine were negative and none relapsed, while 11 with MRD<5×10−4 and 70 with MRD≥5×10−4 had a comparable 5-year cumulative incidence of relapse of 36.4 (15.4) and 35.2 (5.9), respectively. Patients who achieved MRD negativity at TP2 had a low relapse risk (5-yr cumulative incidence of relapse (CIR)=14.3[9.8]), whereas those who attained MRD negativity at a later date showed higher CIR, comparable to patients with positive MRD at any level. BCR/ABL1 MRD negative patients at TP1 had a relapse risk similar to those who were IG/TR MRD negative (1/8 relapses). The overall concordance between the two methods is 69%, with significantly higher positivity by BCR/ABL1. In conclusion, MRD monitoring by both methods may be functional not only for measuring response but also for guiding biological studies aimed at investigating causes for discrepancies, although from our data IG/TR MRD monitoring appears to be more reliable. Early MRD negativity is highly predictive of favorable outcome. The earlier MRD negativity is achieved, the better the prognosis. PMID

The Colony-Stimulating Factor 3 Receptor T640N Mutation Is Oncogenic, Sensitive to JAK Inhibition, and Mimics T618I.

PubMed

Maxson, Julia E; Luty, Samuel B; MacManiman, Jason D; Paik, Jason C; Gotlib, Jason; Greenberg, Peter; Bahamadi, Swaleh; Savage, Samantha L; Abel, Melissa L; Eide, Christopher A; Loriaux, Marc M; Stevens, Emily A; Tyner, Jeffrey W

2016-02-01

Colony-stimulating factor 3 receptor (CSF3R) mutations have been identified in the majority of chronic neutrophilic leukemia (CNL) and a smaller percentage of atypical chronic myeloid leukemia (aCML) cases. Although CSF3R point mutations (e.g., T618I) are emerging as key players in CNL/aCML, the significance of rarer CSF3R mutations is unknown. In this study, we assess the importance of the CSF3R T640N mutation as a marker of CNL/aCML and potential therapeutic target. Sanger sequencing of leukemia samples was performed to identify CSF3R mutations in CNL and aCML. The oncogenicity of the CSF3R T640N mutation relative to the T618I mutation was assessed by cytokine independent growth assays and by mouse bone marrow transplant. Receptor dimerization and O-glycosylation of the mutants was assessed by Western blot, and JAK inhibitor sensitivity was assessed by colony assay. Here, we identify a CSF3R T640N mutation in two patients with CNL/aCML, one of whom was originally diagnosed with MDS and acquired the T640N mutation upon evolution of disease to aCML. The T640N mutation is oncogenic in cellular transformation assays and an in vivo mouse bone marrow transplantation model. It exhibits many similar phenotypic features to T618I, including ligand independence and altered patterns of O-glycosylation--despite the transmembrane location of T640 preventing access by GalNAc transferase enzymes. Cells transformed by the T640N mutation are sensitive to JAK kinase inhibition to a similar degree as cells transformed by CSF3R T618I. Because of its similarities to CSF3R T618I, the T640N mutation likely has diagnostic and therapeutic relevance in CNL/aCML. ©2015 American Association for Cancer Research.

Efficacy and Pharmacologic Data of Second-Generation Tyrosine Kinase Inhibitor Nilotinib in BCR-ABL-Positive Leukemia Patients with Central Nervous System Relapse after Allogeneic Stem Cell Transplantation

PubMed Central

Reinwald, Mark; Schleyer, Eberhard; Kiewe, Philipp; Blau, Igor Wolfgang; Burmeister, Thomas; Pursche, Stefan; Neumann, Martin; Notter, Michael; Thiel, Eckhard; Hofmann, Wolf-Karsten; Kolb, Hans-Jochem; Burdach, Stefan; Bender, Hans-Ulrich

2014-01-01

Central nervous system (CNS) involvement is a severe complication of BCR-ABL-positive leukemia after allogenic stem cell transplantation (alloSCT) associated with fatal outcome. Although second-generation tyrosine-kinase inhibitors (TKI) such as nilotinib have shown activity in systemic BCR-ABL+ disease, little data exists on their penetration and efficacy within the CNS. Four patients (3 male, 1 female; age 15–49) with meningeal relapse after alloSCT and subsequent treatment with nilotinib were identified. A total of 17 cerebrospinal fluid (csf) and serum samples were assessed for nilotinib concentration and patient outcome was recorded. Nilotinib concentrations showed a low median csf/plasma ratio of 0.53% (range 0.23–1.5%), yet pronounced clinical efficacy was observed with long-lasting responses (>1 year) in three patients. Comparison with historical data showed a trend towards superior efficacy of nilotinib versus imatinib. Despite poor csf penetration, nilotinib showed significant clinical activity in CNS relapse of BCR-ABL+ leukemias. As nilotinib has a high protein-binding affinity, the low-protein concentration in csf could translate into a relatively higher amount of free and therefore active nilotinib in csf as compared to blood, possibly explaining the observed efficacy. Thus, treatment with a 2nd generation TKI warrants further investigation and should be considered in cases of CNS relapse of BCR-ABL-positive leukemia after alloSCT. PMID:25025064

Dissection of the BCR-ABL signaling network using highly specific monobody inhibitors to the SHP2 SH2 domains.

PubMed

Sha, Fern; Gencer, Emel Basak; Georgeon, Sandrine; Koide, Akiko; Yasui, Norihisa; Koide, Shohei; Hantschel, Oliver

2013-09-10

The dysregulated tyrosine kinase BCR-ABL causes chronic myelogenous leukemia in humans and forms a large multiprotein complex that includes the Src-homology 2 (SH2) domain-containing phosphatase 2 (SHP2). The expression of SHP2 is necessary for BCR-ABL-dependent oncogenic transformation, but the precise signaling mechanisms of SHP2 are not well understood. We have developed binding proteins, termed monobodies, for the N- and C-terminal SH2 domains of SHP2. Intracellular expression followed by interactome analysis showed that the monobodies are essentially monospecific to SHP2. Two crystal structures revealed that the monobodies occupy the phosphopeptide-binding sites of the SH2 domains and thus can serve as competitors of SH2-phosphotyrosine interactions. Surprisingly, the segments of both monobodies that bind to the peptide-binding grooves run in the opposite direction to that of canonical phosphotyrosine peptides, which may contribute to their exquisite specificity. When expressed in cells, monobodies targeting the N-SH2 domain disrupted the interaction of SHP2 with its upstream activator, the Grb2-associated binder 2 adaptor protein, suggesting decoupling of SHP2 from the BCR-ABL protein complex. Inhibition of either N-SH2 or C-SH2 was sufficient to inhibit two tyrosine phosphorylation events that are critical for SHP2 catalytic activity and to block ERK activation. In contrast, targeting the N-SH2 or C-SH2 revealed distinct roles of the two SH2 domains in downstream signaling, such as the phosphorylation of paxillin and signal transducer and activator of transcription 5. Our results delineate a hierarchy of function for the SH2 domains of SHP2 and validate monobodies as potent and specific antagonists of protein-protein interactions in cancer cells.

Biodegradable charged polyester-based vectors (BCPVs) as an efficient non-viral transfection nanoagent for gene knockdown of the BCR-ABL hybrid oncogene in a human chronic myeloid leukemia cell line

NASA Astrophysics Data System (ADS)

Yang, Chengbin; Panwar, Nishtha; Wang, Yucheng; Zhang, Butian; Liu, Maixian; Toh, Huiting; Yoon, Ho Sup; Tjin, Swee Chuan; Chong, Peter Han Joo; Law, Wing-Cheung; Chen, Chih-Kuang; Yong, Ken-Tye

2016-04-01

First-line therapy of chronic myelogenous leukemia (CML) has always involved the use of BCR-ABL tyrosine-kinase inhibitors which is associated with an abnormal chromosome called Philadelphia chromosome. Although the overall survival rate has been improved by the current therapeutic regime, the presence of resistance has resulted in limited efficacy. In this study, an RNA interference (RNAi)-based therapeutic regime is proposed with the aim to knockdown the BCR-ABL hybrid oncogene using small interfering RNA (siRNA). The siRNA transfection rates have usually been limited due to the declining contact probability among polyplexes and the non-adherent nature of leukemic cells. Our work aims at addressing this limitation by using a biodegradable charged polyester-based vector (BCPV) as a nanocarrier for the delivery of BCR-ABL-specific siRNA to the suspension culture of a K562 CML cell line. BCR-ABL siRNAs were encapsulated in the BCPVs by electrostatic force. Cell internalization was facilitated by the BCPV and assessed by confocal microscopy and flow cytometry. The regulation of the BCR-ABL level in K562 cells as a result of RNAi was analyzed by real-time polymerase chain reaction (RT-PCR). We observed that BCPV was able to form stable nanoplexes with siRNA molecules, even in the presence of fetal bovine serum (FBS), and successfully assisted in vitro siRNA transfection in the non-adherent K562 cells. As a consequence of downregulation of BCR-ABL, BCPV-siRNA nanoplexes inhibited cell proliferation and promoted cell apoptosis. All results were compared with a commercial transfection reagent, Lipofectamine2000™, which served as a positive control. More importantly, this class of non-viral vector exhibits biodegradable features and negligible cytotoxicity, thus providing a versatile platform to deliver siRNA to non-adherent leukemia cells with high transfection efficiency by effectively overcoming extra- and intra-cellular barriers. Due to the excellent in vitro

A derivative of epigallocatechin-3-gallate induces apoptosis via SHP-1-mediated suppression of BCR-ABL and STAT3 signalling in chronic myelogenous leukaemia

PubMed Central

Jung, Ji Hoon; Yun, Miyong; Choo, Eun-Jeong; Kim, Sun-Hee; Jeong, Myoung-Seok; Jung, Deok-Beom; Lee, Hyemin; Kim, Eun-Ok; Kato, Nobuo; Kim, Bonglee; Srivastava, Sanjay K; Kaihatsu, Kunihiro; Kim, Sung-Hoon

2015-01-01

Background and Purpose Epigallocatechin-3-gallate (EGCG) is a component of green tea known to have chemo-preventative effects on several cancers. However, EGCG has limited clinical application, which necessitates the development of a more effective EGCG prodrug as an anticancer agent. Experimental Approach Derivatives of EGCG were evaluated for their stability and anti-tumour activity in human chronic myeloid leukaemia (CML) K562 and KBM5 cells. Key Results EGCG-mono-palmitate (EGCG-MP) showed most prolonged stability compared with other EGCG derivatives. EGCG-MP exerted greater cytotoxicity and apoptosis in K562 and KBM5 cells than the other EGCG derivatives. EGCG-MP induced Src-homology 2 domain-containing tyrosine phosphatase 1 (SHP-1) leading decreased oncogenic protein BCR-ABL and STAT3 phosphorylation in CML cells, compared with treatment with EGCG. Furthermore, EGCG-MP reduced phosphorylation of STAT3 and survival genes in K562 cells, compared with EGCG. Conversely, depletion of SHP-1 or application of the tyrosine phosphatase inhibitor pervanadate blocked the ability of EGCG-MP to suppress phosphorylation of BCR-ABL and STAT3, and the expression of survival genes downstream of STAT3. In addition, EGCG-MP treatment more effectively suppressed tumour growth in BALB/c athymic nude mice compared with untreated controls or EGCG treatment. Immunohistochemistry revealed increased caspase 3 and SHP-1 activity and decreased phosphorylation of BCR-ABL in the EGCG-MP-treated group relative to that in the EGCG-treated group. Conclusions and Implications EGCG-MP induced SHP-1-mediated inhibition of BCR-ABL and STAT3 signalling in vitro and in vivo more effectively than EGCG. This derivative may be a potent chemotherapeutic agent for CML treatment. PMID:25825203

Attomolar electrochemical detection of the BCR/ABL fusion gene based on an amplifying self-signal metal nanoparticle-conducting polymer hybrid composite.

PubMed

Avelino, Karen Y P S; Frias, Isaac A M; Lucena-Silva, Norma; Gomes, Renan G; de Melo, Celso P; Oliveira, Maria D L; Andrade, César A S

2016-12-01

In the last ten years, conjugated polymers started to be used in the immobilization of nucleic acids via non-covalent interactions. In the present study, we describe the construction and use of an electrochemical DNA biosensor based on a nanostructured polyaniline-gold composite, specifically developed for the detection of the BCR/ABL chimeric oncogene. This chromosome translocation is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). The working principle of the biosensor rests on measuring the conductivity resulting from the non-covalent interactions between the hybrid nanocomposite and the DNA probe. The nanostructured platform exhibits a large surface area that enhances the conductivity. Positive cases, which result from the hybridization between DNA probe and targeted gene, induce changes in the amperometric current and in the charge transfer resistance (R CT ) responses. Atomic force microscopy (AFM) images showed changes in the genosensor surface after exposure to cDNA sample of patient with leukemia, evidencing the hybridization process. This new hybrid sensing-platform displayed high specificity and selectivity, and its detection limit is estimated to be as low as 69.4 aM. The biosensor showed excellent analytical performance for the detection of the BCR/ABL oncogene in clinical samples of patients with leukemia. Hence, this electrochemical sensor appears as a simple and attractive tool for the molecular diagnosis of the BCR/ABL oncogene even in early-stage cases of leukemia and for the monitoring of minimum levels of residual disease. Copyright © 2016 Elsevier B.V. All rights reserved.

β-Catenin is required for intrinsic but not extrinsic BCR-ABL1 kinase-independent resistance to tyrosine kinase inhibitors in chronic myeloid leukemia.

PubMed

Eiring, A M; Khorashad, J S; Anderson, D J; Yu, F; Redwine, H M; Mason, C C; Reynolds, K R; Clair, P M; Gantz, K C; Zhang, T Y; Pomicter, A D; Kraft, I L; Bowler, A D; Johnson, K; Partlin, M Mac; O'Hare, T; Deininger, M W

2015-12-01

Activation of nuclear β-catenin and expression of its transcriptional targets promotes chronic myeloid leukemia (CML) progression, tyrosine kinase inhibitor (TKI) resistance, and leukemic stem cell self-renewal. We report that nuclear β-catenin has a role in leukemia cell-intrinsic but not -extrinsic BCR-ABL1 kinase-independent TKI resistance. Upon imatinib inhibition of BCR-ABL1 kinase activity, β-catenin expression was maintained in intrinsically resistant cells grown in suspension culture and sensitive cells cultured in direct contact (DC) with bone marrow (BM) stromal cells. Thus, TKI resistance uncouples β-catenin expression from BCR-ABL1 kinase activity. In β-catenin reporter assays, intrinsically resistant cells showed increased transcriptional activity versus parental TKI-sensitive controls, and this was associated with restored expression of β-catenin target genes. In contrast, DC with BM stromal cells promoted TKI resistance, but had little effects on Lef/Tcf reporter activity and no consistent effects on cytoplasmic β-catenin levels, arguing against a role for β-catenin in extrinsic TKI resistance. N-cadherin or H-cadherin blocking antibodies abrogated DC-based resistance despite increasing Lef/Tcf reporter activity, suggesting that factors other than β-catenin contribute to extrinsic, BM-derived TKI resistance. Our data indicate that, while nuclear β-catenin enhances survival of intrinsically TKI-resistant CML progenitors, it is not required for extrinsic resistance mediated by the BM microenvironment.

Frequency of JAK2 V617F mutation in patients with Philadelphia positive Chronic Myeloid Leukemia in Pakistan.

PubMed

Tabassum, Najia; Saboor, Mohammed; Ghani, Rubina; Moinuddin, Moinuddin

2014-01-01

Co-existence of myeloproliferative disorders (MPD) and Janus associated kinase 2 mutation (JAK2 V617F) is a well-established fact. Only few case reports are available showing presence of JAK2 V617F mutation in chronic myeloid leukemia (CML). Purpose of this study was to determine the frequency of JAK2 V617F mutation in Philadelphia Chromosome positive (Ph (+)) CML patients in Pakistan. The study was conducted from August 2009 to July 2010 at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed for Breakpoint Cluster Region - Abelson (BCR-ABL) rearrangement. Conventional PCR was performed for JAK2 V617F mutation on BCR-ABL positive samples. All 25 samples showed BCR-ABL rearrangement. Out of these 11 samples (44%) had JAK2 V617F mutation; the remaining 14 (56%) cases showed JAK2 617V wild type. It is concluded that the co-existence of Ph (+)CML and JAK2 V617F mutation is possible.

Modeling the ferrochelatase c.315-48C modifier mutation for erythropoietic protoporphyria (EPP) in mice

PubMed Central

Bansode, Vijay B.; Koentgen, Frank; Trüb, Judith; Pelczar, Pawel; Schneider-Yin, Xiaoye; Minder, Elisabeth I.

2017-01-01

ABSTRACT Erythropoietic protoporphyria (EPP) is caused by deficiency of ferrochelatase (FECH), which incorporates iron into protoporphyrin IX (PPIX) to form heme. Excitation of accumulated PPIX by light generates oxygen radicals that evoke excessive pain and, after longer light exposure, cause ulcerations in exposed skin areas of individuals with EPP. Moreover, ∼5% of the patients develop a liver dysfunction as a result of PPIX accumulation. Most patients (∼97%) have a severe FECH mutation (Mut) in trans to an intronic polymorphism (c.315-48C), which reduces ferrochelatase synthesis by stimulating the use of an aberrant 3′ splice site 63 nt upstream of the normal site for exon 4. In contrast, with the predominant c.315-48T allele, the correct splice site is mostly used, and individuals with a T/Mut genotype do not develop EPP symptoms. Thus, the C allele is a potential target for therapeutic approaches that modify this splicing decision. To provide a model for pre-clinical studies of such approaches, we engineered a mouse containing a partly humanized Fech gene with the c.315-48C polymorphism. F1 hybrids obtained by crossing these mice with another inbred line carrying a severe Fech mutation (named m1Pas) show a very strong EPP phenotype that includes elevated PPIX in the blood, enlargement of liver and spleen, anemia, as well as strong pain reactions and skin lesions after a short period of light exposure. In addition to the expected use of the aberrant splice site, the mice also show a strong skipping of the partly humanized exon 3. This will limit the use of this model for certain applications and illustrates that engineering of a hybrid gene may have unforeseeable consequences on its splicing. PMID:28093505

(124)I-iodopyridopyrimidinone for PET of Abl kinase-expressing tumors in vivo.

PubMed

Doubrovin, Mikhail; Kochetkova, Tatiana; Santos, Elmer; Veach, Darren R; Smith-Jones, Peter; Pillarsetty, Nagavarakishore; Balatoni, Julius; Bornmann, William; Gelovani, Juri; Larson, Steven M

2010-01-01

Because of the recent development of an iodopyridopyrimidinone Abl protein kinase inhibitor (PKI), (124)I-SKI-212230 ((124)I-SKI230), we investigated the feasibility of a PET-based molecular imaging method for the direct visualization of Abl kinase expression and PKI treatment. In vitro pharmacokinetic properties, including specific and nonspecific binding of (124)I-SKI230 to its Abl kinase target and interaction with other PKIs, were assessed in cell-free medium and chronic myelogenous leukemia (CML) cells overexpressing BCR-Abl (K562), in comparison with BT-474 cells that are low in Abl expression. In a xenograft tumor model, we assessed the in vivo pharmacokinetics of (124)I-SKI230 using PET and postmortem tissue sampling. We also tested a paradigm of (124)I-SKI230 PET after treatment of the animal with a dose of Abl-specific PKI for the monitoring of the tumor response. In vitro studies confirmed that SKI230 binds to Abl kinase with nanomolar affinity, that selective uptake occurs in cell lines known to express Abl kinase, that RNAi knock-down supports specificity of cellular uptake due to Abl kinase, and that imatinib, an archetype Abl PKI, completely displaces SKI230. With SKI230, we obtained successful in vivo PET of Abl-expressing human tumors in a nude rat. We were also able to demonstrate evidence of substrate inhibition of in vivo radiotracer uptake in the xenograft tumor after treatment of the animal as a model of PKI treatment monitoring. These results support the hypothesis that molecular imaging using PET will be useful for the study of in vivo pharmacodynamics of Abl PKI molecular therapy in humans.

Efficacy of ponatinib against ABL tyrosine kinase inhibitor-resistant leukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okabe, Seiichi, E-mail: okabe@tokyo-med.ac.jp; Tauchi, Tetsuzo; Tanaka, Yuko

2013-06-07

Highlights: •Efficacy of ponatinib against ABL tyrosine kinase inhibitor-resistant leukemia cells okabe et al. •Imatinib or nilotinib resistance was involved Src family kinase. •The BCR-ABL point mutation (E334V) was highly resistant to imatinib or nilotinib. •Ponatinib was a powerful strategy against imatinib or nilotinib resistant Ph-positive cells. -- Abstract: Because a substantial number of patients with chronic myeloid leukemia acquire resistance to ABL tyrosine kinase inhibitors (TKIs), their management remains a challenge. Ponatinib, also known as AP24534, is an oral multi-targeted TKI. Ponatinib is currently being investigated in a pivotal phase 2 clinical trial. In the present study, we analyzedmore » the molecular and functional consequences of ponatinib against imatinib- or nilotinib-resistant (R) K562 and Ba/F3 cells. The proliferation of imatinib- or nilotinib-resistant K562 cells did not decrease after treatment with imatinib or nilotinib. Src family kinase Lyn was activated. Point mutation Ba/F3 cells (E334 V) were also highly resistant to imatinib and nilotinib. Treatment with ponatinib for 72 h inhibited the growth of imatinib- and nilotinib-resistant cells. The phosphorylation of BCR-ABL, Lyn, and Crk-L was reduced. This study demonstrates that ponatinib has an anti-leukemia effect by reducing ABL and Lyn kinase activity and this information may be of therapeutic relevance.« less

Prevalence of the BCR/ABL1 transcripts in Mexican patients with chronic myelogenous leukemia.

PubMed

Meza-Espinoza, Juan Pablo; Gutiérrez-Angulo, Melva; Vázquez-Cárdenas, Alejandra; Delgado-Lamas, José Luis; Esparza-Flores, María Amparo; González-García, Juan Ramón

2007-01-01

RT-PCR studies in 93 patients with chronic myelogenous leukemia from the Mexican West were done in order to know the proportion of b2a2 and b3a2 BCR/ABL1 transcripts. Forty-five patients showed the b3a2 transcript (48%), 37 (40%) displayed the b2a2 and in 11 cases (12%) both transcripts were detected. Statistical analyses showed that these figures are in accordance with two of three similar studies realized in Mexican population. Moreover, significant differences were found among Mexican people and patients from other countries, namely Ecuador, England, Italy, Poland, Japan, and Thailand. Ecuadorian patients showed differences with all the populations analyzed. These variations could be due to a different genetic background.

Towards a Molecular Understanding of the Link between Imatinib Resistance and Kinase Conformational Dynamics

PubMed Central

Lovera, Silvia; Morando, Maria; Pucheta-Martinez, Encarna; Martinez-Torrecuadrada, Jorge L.; Saladino, Giorgio; Gervasio, Francesco L.

2015-01-01

Due to its inhibition of the Abl kinase domain in the BCR-ABL fusion protein, imatinib is strikingly effective in the initial stage of chronic myeloid leukemia with more than 90% of the patients showing complete remission. However, as in the case of most targeted anti-cancer therapies, the emergence of drug resistance is a serious concern. Several drug-resistant mutations affecting the catalytic domain of Abl and other tyrosine kinases are now known. But, despite their importance and the adverse effect that they have on the prognosis of the cancer patients harboring them, the molecular mechanism of these mutations is still debated. Here by using long molecular dynamics simulations and large-scale free energy calculations complemented by in vitro mutagenesis and microcalorimetry experiments, we model the effect of several widespread drug-resistant mutations of Abl. By comparing the conformational free energy landscape of the mutants with those of the wild-type tyrosine kinases we clarify their mode of action. It involves significant and complex changes in the inactive-to-active dynamics and entropy/enthalpy balance of two functional elements: the activation-loop and the conserved DFG motif. What is more the T315I gatekeeper mutant has a significant impact on the binding mechanism itself and on the binding kinetics. PMID:26606374

BCR-ABL PCR testing in chronic myelogenous leukemia: molecular diagnosis for targeted cancer therapy and monitoring.

PubMed

Luu, Martin H; Press, Richard D

2013-09-01

The use of tyrosine kinase inhibitors (TKIs) to treat chronic myeloid leukemia (CML) represents the paradigm for modern targeted cancer therapy. Importantly, molecular monitoring using BCR-ABL real-time quantitative reverse transcription polymerase chain reaction (RQ-PCR) for assessing treatment efficacy and quantitating minimal residual disease is a major determinate of practical therapeutic decision-making in the long-term management of this now chronic disease. Herein, we present an overview of CML and the use of TKIs for targeted CML therapy, with an emphasis on the role, application and future aspects of PCR-based molecular monitoring.

Frequency of JAK2 V617F mutation in patients with Philadelphia positive Chronic Myeloid Leukemia in Pakistan

PubMed Central

Tabassum, Najia; Saboor, Mohammed; Ghani, Rubina; Moinuddin, Moinuddin

2014-01-01

Background and Objective: Co-existence of myeloproliferative disorders (MPD) and Janus associated kinase 2 mutation (JAK2 V617F) is a well-established fact. Only few case reports are available showing presence of JAK2 V617F mutation in chronic myeloid leukemia (CML). Purpose of this study was to determine the frequency of JAK2 V617F mutation in Philadelphia Chromosome positive (Ph +) CML patients in Pakistan. Methods: The study was conducted from August 2009 to July 2010 at Civil Hospital and Baqai Institute of Hematology (BIH) Karachi. Blood samples from 25 patients with CML were collected. Multiplex reverse transcription polymerase chain reaction (RT-PCR) was performed for Breakpoint Cluster Region – Abelson (BCR-ABL) rearrangement. Conventional PCR was performed for JAK2 V617F mutation on BCR-ABL positive samples. Results: All 25 samples showed BCR-ABL rearrangement. Out of these 11 samples (44%) had JAK2 V617F mutation; the remaining 14 (56%) cases showed JAK2 617V wild type. Conclusion: It is concluded that the co-existence of Ph +CML and JAK2 V617F mutation is possible. PMID:24639858

Suppression of bcr-abl synthesis by siRNAs or tyrosine kinase activity by Glivec alters different oncogenes, apoptotic/antiapoptotic genes and cell proliferation factors (microarray study).

PubMed

Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki; Ewis, Ashraf; Ishikawa, Mitsuru; Shinohara, Yasuo; Baba, Yoshinobu

2004-07-16

Short 21-mer double-stranded/small-interfering RNAs (ds/siRNAs) were designed to target bcr-abl mRNA in chronic myelogenous leukemia. The ds/siRNAs were transfected into bcr-abl-positive K-562 (derived from blast crisis chronic myelogenous leukemia), using lipofectamine. Penetrating of ds/siRNAs into the cells was detected by fluorescent confocal microscopy, using fluorescein-labeled ds/siRNAs. The cells were treated with mix of three siRNA sequences (3 x 60 nM) during 6 days with three repetitive transfections. The siRNA-treatment was accompanied with significant reduction of bcr-abl mRNA, p210, protein tyrosine kinase activity and cell proliferation index. Treatment of cells with Glivec (during 8 days with four repetitive doses, 180 nM single dose) resulted in analogous reduction of cell proliferation activity, stronger suppression of protein tyrosine kinase activity, and very low reduction of p210. siRNA-mix and Glivec did not affect significantly the viability of normal lymphocytes. Microarray analysis of siRNA- and Glivec-treated K-562 cells demonstrated that both pathways of bcr-abl suppression were accompanied with overexpression and suppression of many different oncogenes, apoptotic/antiapoptotic and cell proliferation factors. The following genes of interest were found to decrease in relatively equal degree in both siRNA- and Glivec-treated cells: Bcd orf1 and orf2 proto-oncogene, chromatin-specific transcription elongation factor FACT 140-kDa subunit mRNA, gene encoding splicing factor SF1, and mRNA for Tec protein tyrosine kinase. siRNA-mix and Glivec provoked overexpression of the following common genes: c-jun proto-oncogene, protein kinase C-alpha, pvt-1 oncogene homologue (myc activator), interleukin-6, 1-8D gene from interferon-inducible gene family, tumor necrosis factor receptor superfamily (10b), and STAT-induced STAT inhibitor.

Digital PCR (dPCR) analysis reveals that the homozygous c.315-48T>C variant in the FECH gene might cause erythropoietic protoporphyria (EPP).

PubMed

Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena

2018-06-13

Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.

[The establishment and application of internal quality control system for real-time quantitative PCR detection of BCR-ABL (P210) transcript levels].

PubMed

Zhong, C Q; He, N; Hua, M Q; Wei, X D; Ma, D X; Ji, C Y

2016-09-14

Objective: To set internal quality control system of BCR-ABL (P210) transcript levels for real-time quantitative PCR (RQ-PCR). Methods: Using K562 cells and HL-60 cells, we prepared high- and low-level BCR-ABL internal quality control substance. The BCR-ABL (P210) transcript levels of internal quality control substance have been determined for 184 times together with clinical samples from August 2013 to October 2015. The slope rate, intercept and correlation coefficient of standard curve were calculated according to different reagent lots (lots number 20130303, 20131212, 20140411 and 20150327 are called R1、R2、R3 and R4 for short respectively), and the detection results of quality control substance were calculated according to different reagent lots and quality control substance lots (lots number 20130725, 20140611 are called Q1、Q2 for short respectively). Then the results were analyzed by Levey-Jennings quality control chart combined with Westgard multi-rules theory. Results: ①We analyzed the slope rate and intercept of standard curve. Fifty-three times of the R1 reagent detection, 80 times of the R3 reagent detection and 14 times of the R4 reagent detection were all under control. For 37 times detection of R2 reagent, the slope rate was out of control for 6 times. It was lower than x - s for the 2-8 tests and upper the average for the 12-37 tests. The intercept was out of control for 9 times, upper the x + s for the 1-8 tests and lower the average for the 12-37 tests. ② According to the detection results of quality control substance, for Q1 quality control substance, 49 tests by R1 reagent were under control, and 1 out of 23 tests by R2 reagent was out of control. For Q2 quality control substance, 14 tests by R2 reagent detection, 72 tests by R3 reagent detection and 14 tests by R4 reagent were all under control. Conclusion: The preparation of high- and low-level quality control substance using K562 and HL-60 cells was convenient and the detection

Mapping of four distinct BCR-related loci to chromosome region 22q11: order of BCR loci relative to chronic myelogenous leukemia and acute lymphoblastic leukemia breakpoints

DOE Office of Scientific and Technical Information (OSTI.GOV)

Croce, C.M.; Huebner, K.; Isobe, M.

1987-10-01

A probe derived from the 3' region of the BCR gene (breakpoint cluster region gene) detects four distinct loci in the human genome. One of the loci corresponds to the complete BCR gene, whereas the other contain a 3' segment of the gene. After HindIII cleavage of human DNA, these four loci are detected as 23-, 19-, 13-, and 9-kikobase-pair fragments, designated BCR4, BCR3, BCR2, and BCR1, respectively, with BCR1 deriving from the original complete BCR gene. All four BCR loci segregate 100% concordantly with human chromosome 22 in a rodent-human somatic cell hybrid panel and are located at chromosomemore » region 22q11.2 by chromosomal in situ hybridization. The BCR2 and BCR4 loci are amplified in leukemia cell line K562 cells, indicating that they fall within the amplification unit that includes immunoglobulin lambda light chain locus (IGL) and ABL locus on the K562 Philadelphia chromosome (Ph/sup 1/). Similarly, in mouse-human hybrids retaining a Ph/sup 1/ chromosome derived from an acute lymphoblastic leukemia-in the absence of the 9q/sup +/ and 22, only BCR2 and BCR4 loci are retained. Thus, the order of loci on chromosome 22 is centromere ..-->.. BCR2, BCR4, and IGL ..-->.. BCR1 ..-->.. BCR3 ..-->.. SIS, possibly eliminating BCR2 and BCR4 loci as candidate targets for juxtaposition to the ABL gene in the acute lymphoblastic leukemia Ph/sup 1/ chromosome.« less

Chemopreventive Effects of Dietary Eicosapentaenoic Acid Supplementation in Experimental Myeloid Leukemia.

PubMed

Finch, Emily R; Kudva, Avinash K; Quickel, Michael D; Goodfield, Laura L; Kennett, Mary J; Whelan, Jay; Paulson, Robert F; Prabhu, K Sandeep

2015-10-01

Current therapies for treatment of myeloid leukemia do not eliminate leukemia stem cells (LSC), leading to disease relapse. In this study, we supplemented mice with eicosapentaenoic acid (EPA, C20:5), a polyunsaturated omega-3 fatty acid, at pharmacologic levels, to examine whether the endogenous metabolite, cyclopentenone prostaglandin delta-12 PGJ3 (Δ(12)-PGJ3), was effective in targeting LSCs in experimental leukemia. EPA supplementation for 8 weeks resulted in enhanced endogenous production of Δ(12)-PGJ3 that was blocked by indomethacin, a cyclooxygenase (COX) inhibitor. Using a murine model of chronic myelogenous leukemia (CML) induced by bone marrow transplantation of BCR-ABL-expressing hematopoietic stem cells, mice supplemented with EPA showed a decrease in the LSC population, and reduced splenomegaly and leukocytosis, when compared with mice on an oleic acid diet. Supplementation of CML mice carrying the T315I mutation (in BCR-ABL) with EPA resulted in a similar effect. Indomethacin blocked the EPA effect and increased the severity of BCR-ABL-induced CML and decreased apoptosis. Δ(12)-PGJ3 rescued indomethacin-treated BCR-ABL mice and decreased LSCs. Inhibition of hematopoietic-prostaglandin D synthase (H-PGDS) by HQL-79 in EPA-supplemented CML mice also blocked the effect of EPA. In addition, EPA supplementation was effective in a murine model of acute myeloid leukemia. EPA-supplemented mice exhibited a decrease in leukemia burden and a decrease in the LSC colony-forming unit (LSC-CFU). The decrease in LSCs was confirmed through serial transplantation assays in all disease models. The results support a chemopreventive role for EPA in myeloid leukemia, which is dependent on the ability to efficiently convert EPA to endogenous COX-derived prostanoids, including Δ(12)-PGJ3. ©2015 American Association for Cancer Research.

Generation of gene-corrected iPSC line from Parkinson's disease patient iPSC line with alpha-SNCA A53T mutation.

PubMed

Lee, Seo-Young; Jeong, SangKyun; Kim, Janghwan; Chung, Sun-Ku

2018-06-09

Parkinson's disease (PD) is the second most common age-related neurodegenerative disorder. PD can result from a mutation of alpha-synuclein (α-SNCA), such as α-SNCA A53T. Using episomal vectors, induced pluripotent stem cells (iPSCs) were generated from skin fibroblasts with the α-SNCA A53T mutation. A huge bacterial artificial chromosome (BAC) harboring the normal α-SNCA gene successfully corrected the α-SNCA A53T-mutant iPSCs. Melting curve analysis for allelic composition indicated that the BAC DNA was precisely targeted to the α-SNCA A53T mutation allele, without random integration. The corrected PD-iPSCs displayed the normal karyotype and pluripotency, with the capability to differentiate to any cell type. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

Molecular drug targets in myeloproliferative neoplasms: mutant ABL1, JAK2, MPL, KIT, PDGFRA, PDGFRB and FGFR1

PubMed Central

Tefferi, Ayalew

2009-01-01

Abstract Therapeutically validated oncoproteins in myeloproliferative neoplasms (MPN) include BCR-ABL1 and rearranged PDGFR proteins. The latter are products of intra- (e.g. FIP1L1-PDGFRA) or inter-chromosomal (e.g.ETV6-PDGFRB) gene fusions. BCR-ABL1 is associated with chronic myelogenous leukaemia (CML) and mutant PDGFR with an MPN phenotype characterized by eosinophilia and in addition, in case of FIP1L1-PDGFRA, bone marrow mastocytosis. These genotype-phenotype associations have been effectively exploited in the development of highly accurate diagnostic assays and molecular targeted therapy. It is hoped that the same will happen in other MPN with specific genetic alterations: polycythemia vera (JAK2V617F and other JAK2 mutations), essential thrombocythemia (JAK2V617F and MPL515 mutations), primary myelofibrosis (JAK2V617F and MPL515 mutations), systemic mastocytosis (KITD816V and other KIT mutations) and stem cell leukaemia/lymphoma (ZNF198-FGFR1 and other FGFR1 fusion genes). The current review discusses the above-listed mutant molecules in the context of their value as drug targets. PMID:19175693

[Development of Ph negative acute myeloid leukemia in a patient with minor-BCR/ABL positive chronic myeloid leukemia achieving a partial cytogenetic response during tyrosine kinase inhibitor treatment].

PubMed

Fujii, Soichiro; Miura, Ikuo; Tanaka, Hideo

2015-06-01

A 78-year-old male, who had CKD and chronic heart failure, was referred to our hospital for evaluation of leukocytosis. His bone marrow contained 12% blast cells and chromosome analysis showed the Ph chromosome as well as other changes. The patient was diagnosed with the accelerated-phase CML because FISH and RT-PCR disclosed BCR/ABL fusion signals and minor BCR/ABL, respectively. Imatinib was administered, but the CML was resistant to this treatment. We gave him nilotinib employing a reduced and intermittent administration protocol because of the progression of anemia and heart failure. The patient achieved PCyR in 8 months, but, 12 months later, his WBC count increased and 83% of the cells were blasts. Because the probable diagnosis was the blast crisis of CML, we switched from nilotinib to dasatinib. However, leukocytosis worsened and he died of pneumonia. It was later revealed that he had a normal karyotype and both FISH and RT-PCR analysis of BCR/ABL were negative. His final diagnosis was Ph negative AML developing from Ph positive CML in PCyR. Since there were no dysplastic changes indicative of MDS, it was assumed that the AML was not secondary leukemia caused by the tyrosine kinase inhibitor but, rather, de novo AML.

aCGH Local Copy Number Aberrations Associated with Overall Copy Number Genomic Instability in Colorectal Cancer: Coordinate Involvement of the Regions Including BCR and ABL

PubMed Central

Bartos, Jeremy D.; Gaile, Daniel P.; McQuaid, Devin E.; Conroy, Jeffrey M.; Darbary, Huferesh; Nowak, Norma J.; Block, Annemarie; Petrelli, Nicholas J.; Mittelman, Arnold; Stoler, Daniel L.; Anderson, Garth R.

2007-01-01

In order to identify small regions of the genome whose specific copy number alteration is associated with high genomic instability in the form of overall genome-wide copy number aberrations, we have analyzed array-based comparative genomic hybridization (aCGH) data from 33 sporadic colorectal carcinomas. Copy number changes of a small number of specific regions were significantly correlated with elevated overall amplifications and deletions scattered throughout the entire genome. One significant region at 9q34 includes the c-ABL gene Another region spanning 22q11–13 includes the breakpoint cluster region (BCR) of the Philadelphia chromosome Coordinate 22q11–13 alterations were observed in nine of eleven tumors with the 9q34 alteration Additional regions on 1q and 14q were associated with overall genome-wide copy number changes, while copy number aberrations on chromosome 7p, 7q, and 13q21.1–31.3 were found associated with this instability only in tumors from patients with a smoking history Our analysis demonstrates there are a small number of regions of the genome where gain or loss is commonly associated with a tumor’s overall level of copy number aberrations Our finding BCR and ABL located within two of the instability-associated regions, and the involvement of these two regions occurring coordinately, suggests a system akin to the BCR-ABL translocation of CML may be involved in genomic instability in about one-third of human colorectal carcinomas. PMID:17196995

Droplet Digital PCR for BCR/ABL(P210) Detecting of CML: A High Sensitive Method of the Minimal Residual Disease& Disease Progression.

PubMed

Wang, Wen-Jun; Zheng, Chao-Feng; Liu, Zhuang; Tan, Yan-Hong; Chen, Xiu-Hua; Zhao, Bin-Liang; Li, Guo-Xia; Xu, Zhi-Fang; Ren, Fang-Gang; Zhang, Yao-Fang; Chang, Jian-Mei; Wang, Hong-Wei

2018-04-25

The present study intended to establish a droplet digital PCR (dd-PCR) for monitoring minimal residual disease (MRD) in patients with BCR/ABL (P210)-positive CML, thereby achieving deep-level monitoring of tumor load and determining the efficacy for guided clinically individualized treatment. Using dd-PCR and RT-qPCR, two cell suspensions were obtained from K562 cells and normal peripheral blood mononuclear cells by gradient dilution and were measured at the cellular level. At peripheral blood(PB) level, 61 cases with CML-chronic phase (CML-CP) were obtained after tyrosine kinase inhibitors (TKIs) treatment and regular follow-ups. By RT-qPCR, BCR/ABL (P210) fusion gene was undetectable in PB after three successive analyses, which were performed once every three months. At the same time, dd-PCR was performed simultaneously with the last equal amount of cDNA. Ten CML patients with MR4.5 were followed up by the two methods. At the cellular level, consistency of results of dd-PCR and RT-qPCR reached R 2 ≥0.99, with conversion equation of Y=33.148X 1.222 (Y: dd-PCR results; X: RT-qPCR results). In the dd-PCR test, 11 of the 61 CML patients (18.03%) tested positive and showed statistically significant difference (P<0.01). In the follow-up of 10 CML patients who were in MR4.5, 10 patients loss of MR4.0, and 4 were tested positive by dd-PCR 3 months earlier than by RT-qPCR. In contrast with RT-qPCR, dd-PCR is more sensitive, thus enabling accurate conversion of dd-PCR results into internationally standard RT-qPCR results by conversion equation, to achieve a deeper molecular biology-based stratification of BCR/ABL(P210) MRD. It has some reference value to monitor disease progression in clinic. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The p.M292T NDUFS2 mutation causes complex I-deficient Leigh syndrome in multiple families.

PubMed

Tuppen, Helen A L; Hogan, Vanessa E; He, Langping; Blakely, Emma L; Worgan, Lisa; Al-Dosary, Mazhor; Saretzki, Gabriele; Alston, Charlotte L; Morris, Andrew A; Clarke, Michael; Jones, Simon; Devlin, Anita M; Mansour, Sahar; Chrzanowska-Lightowlers, Zofia M A; Thorburn, David R; McFarland, Robert; Taylor, Robert W

2010-10-01

Isolated complex I deficiency is the most frequently observed oxidative phosphorylation defect in children with mitochondrial disease, leading to a diverse range of clinical presentations, including Leigh syndrome. For most patients the genetic cause of the biochemical defect remains unknown due to incomplete understanding of the complex I assembly process. Nonetheless, a plethora of pathogenic mutations have been described to date in the seven mitochondrial-encoded subunits of complex I as well as in 12 of the nuclear-encoded subunits and in six assembly factors. Whilst several mitochondrial DNA mutations are recurrent, the majority of these mutations are reported in single families. We have sequenced core structural and functional nuclear-encoded subunits of complex I in a cohort of 34 paediatric patients with isolated complex I deficiency, identifying pathogenic mutations in 6 patients. These included a novel homozygous NDUFS1 mutation in an Asian child with Leigh syndrome, a previously identified NDUFS8 mutation (c.236C>T, p.P79L) in a second Asian child with Leigh-like syndrome and six novel, compound heterozygous NDUFS2 mutations in four white Caucasian patients with Leigh or Leigh-like syndrome. Three of these children harboured an identical NDUFS2 mutation (c.875T>C, p.M292T), which was also identified in conjunction with a novel NDUFS2 splice site mutation (c.866+4A>G) in a fourth Caucasian child who presented to a different diagnostic centre, with microsatellite and single nucleotide polymorphism analyses indicating that this was due to an ancient common founder event. Our results confirm that NDUFS2 is a mutational hotspot in Caucasian children with isolated complex I deficiency and recommend the routine diagnostic investigation of this gene in patients with Leigh or Leigh-like phenotypes.

Characterization of leukemias with ETV6-ABL1 fusion

PubMed Central

Zaliova, Marketa; Moorman, Anthony V.; Cazzaniga, Giovanni; Stanulla, Martin; Harvey, Richard C.; Roberts, Kathryn G.; Heatley, Sue L.; Loh, Mignon L.; Konopleva, Marina; Chen, I-Ming; Zimmermannova, Olga; Schwab, Claire; Smith, Owen; Mozziconacci, Marie-Joelle; Chabannon, Christian; Kim, Myungshin; Frederik Falkenburg, J. H.; Norton, Alice; Marshall, Karen; Haas, Oskar A.; Starkova, Julia; Stuchly, Jan; Hunger, Stephen P.; White, Deborah; Mullighan, Charles G.; Willman, Cheryl L.; Stary, Jan; Trka, Jan; Zuna, Jan

2016-01-01

To characterize the incidence, clinical features and genetics of ETV6-ABL1 leukemias, representing targetable kinase-activating lesions, we analyzed 44 new and published cases of ETV6-ABL1-positive hematologic malignancies [22 cases of acute lymphoblastic leukemia (13 children, 9 adults) and 22 myeloid malignancies (18 myeloproliferative neoplasms, 4 acute myeloid leukemias)]. The presence of the ETV6-ABL1 fusion was ascertained by cytogenetics, fluorescence in-situ hybridization, reverse transcriptase-polymerase chain reaction and RNA sequencing. Genomic and gene expression profiling was performed by single nucleotide polymorphism and expression arrays. Systematic screening of more than 4,500 cases revealed that in acute lymphoblastic leukemia ETV6-ABL1 is rare in childhood (0.17% cases) and slightly more common in adults (0.38%). There is no systematic screening of myeloproliferative neoplasms; however, the number of ETV6-ABL1-positive cases and the relative incidence of acute lymphoblastic leukemia and myeloproliferative neoplasms suggest that in adulthood ETV6-ABL1 is more common in BCR-ABL1-negative chronic myeloid leukemia-like myeloproliferations than in acute lymphoblastic leukemia. The genomic profile of ETV6-ABL1 acute lymphoblastic leukemia resembled that of BCR-ABL1 and BCR-ABL1-like cases with 80% of patients having concurrent CDKN2A/B and IKZF1 deletions. In the gene expression profiling all the ETV6-ABL1-positive samples clustered in close vicinity to BCR-ABL1 cases. All but one of the cases of ETV6-ABL1 acute lymphoblastic leukemia were classified as BCR-ABL1-like by a standardized assay. Over 60% of patients died, irrespectively of the disease or age subgroup examined. In conclusion, ETV6-ABL1 fusion occurs in both lymphoid and myeloid leukemias; the genomic profile and clinical behavior resemble BCR-ABL1-positive malignancies, including the unfavorable prognosis, particularly of acute leukemias. The poor outcome suggests that treatment with

Characterization of leukemias with ETV6-ABL1 fusion.

PubMed

Zaliova, Marketa; Moorman, Anthony V; Cazzaniga, Giovanni; Stanulla, Martin; Harvey, Richard C; Roberts, Kathryn G; Heatley, Sue L; Loh, Mignon L; Konopleva, Marina; Chen, I-Ming; Zimmermannova, Olga; Schwab, Claire; Smith, Owen; Mozziconacci, Marie-Joelle; Chabannon, Christian; Kim, Myungshin; Frederik Falkenburg, J H; Norton, Alice; Marshall, Karen; Haas, Oskar A; Starkova, Julia; Stuchly, Jan; Hunger, Stephen P; White, Deborah; Mullighan, Charles G; Willman, Cheryl L; Stary, Jan; Trka, Jan; Zuna, Jan

2016-09-01

To characterize the incidence, clinical features and genetics of ETV6-ABL1 leukemias, representing targetable kinase-activating lesions, we analyzed 44 new and published cases of ETV6-ABL1-positive hematologic malignancies [22 cases of acute lymphoblastic leukemia (13 children, 9 adults) and 22 myeloid malignancies (18 myeloproliferative neoplasms, 4 acute myeloid leukemias)]. The presence of the ETV6-ABL1 fusion was ascertained by cytogenetics, fluorescence in-situ hybridization, reverse transcriptase-polymerase chain reaction and RNA sequencing. Genomic and gene expression profiling was performed by single nucleotide polymorphism and expression arrays. Systematic screening of more than 4,500 cases revealed that in acute lymphoblastic leukemia ETV6-ABL1 is rare in childhood (0.17% cases) and slightly more common in adults (0.38%). There is no systematic screening of myeloproliferative neoplasms; however, the number of ETV6-ABL1-positive cases and the relative incidence of acute lymphoblastic leukemia and myeloproliferative neoplasms suggest that in adulthood ETV6-ABL1 is more common in BCR-ABL1-negative chronic myeloid leukemia-like myeloproliferations than in acute lymphoblastic leukemia. The genomic profile of ETV6-ABL1 acute lymphoblastic leukemia resembled that of BCR-ABL1 and BCR-ABL1-like cases with 80% of patients having concurrent CDKN2A/B and IKZF1 deletions. In the gene expression profiling all the ETV6-ABL1-positive samples clustered in close vicinity to BCR-ABL1 cases. All but one of the cases of ETV6-ABL1 acute lymphoblastic leukemia were classified as BCR-ABL1-like by a standardized assay. Over 60% of patients died, irrespectively of the disease or age subgroup examined. In conclusion, ETV6-ABL1 fusion occurs in both lymphoid and myeloid leukemias; the genomic profile and clinical behavior resemble BCR-ABL1-positive malignancies, including the unfavorable prognosis, particularly of acute leukemias. The poor outcome suggests that treatment with

The co-occurrence of driver mutations in chronic myeloproliferative neoplasms.

PubMed

Boddu, Prajwal; Chihara, Dai; Masarova, Lucia; Pemmaraju, Naveen; Patel, Keyur P; Verstovsek, Srdan

2018-06-27

Myeloproliferative neoplasms (MPNs) are clonal disorders characterized by proliferation of one or more elements of the myeloid lineage. Key genetic aberrations include the BCR-ABL1 gene rearrangement in Philadelphia chromosome-positive chronic myelogenous leukemia (CML) and JAK2/MPL/CALR aberrations in Philadelphia chromosome-negative MPNs. While thought to be mutually exclusive, occasional isolated reports of coexistence of BCR-ABL1 and JAK2, and JAK2 with MPL or CALR aberrations have been described. Given the paucity of data, clinical characteristics and outcome of patients harboring concurrent Philadelphia-positive and Philadelphia-negative mutations or dual Philadelphia-negative driver mutations have not been systematically evaluated, and their clinical relevance is largely unknown. It is difficult to determine the true relevance of co-existing driver mutations on outcomes given the rarity of its occurrence. In this case series, we describe those patients who had dual driver mutations detected at any point during the course of their disease and characterized their clinical and laboratory features, bone marrow pathology, and overall disease course.

Combined inhibition of β-catenin and Bcr–Abl synergistically targets tyrosine kinase inhibitor-resistant blast crisis chronic myeloid leukemia blasts and progenitors in vitro and in vivo

PubMed Central

Zhou, H; Mak, P Y; Mu, H; Mak, D H; Zeng, Z; Cortes, J; Liu, Q; Andreeff, M; Carter, B Z

2017-01-01

Tyrosine kinase inhibitor (TKI) resistance and progression to blast crisis (BC), both related to persistent β-catenin activation, remain formidable challenges for chronic myeloid leukemia (CML). We observed overexpression of β-catenin in BC-CML stem/progenitor cells, particularly in granulocyte–macrophage progenitors, and highest among a novel CD34+CD38+CD123hiTim-3hi subset as determined by CyTOF analysis. Co-culture with mesenchymal stromal cells (MSCs) induced the expression of β-catenin and its target CD44 in CML cells. A novel Wnt/β-catenin signaling modulator, C82, and nilotinib synergistically killed KBM5T315I and TKI-resistant primary BC-CML cells with or without BCR–ABL kinase mutations even under leukemia/MSC co-culture conditions. Silencing of β-catenin by short interfering RNA restored sensitivity of primary BCR–ABLT315I/E255V BC-CML cells to nilotinib. Combining the C82 pro-drug, PRI-724, with nilotinib significantly prolonged the survival of NOD/SCID/IL2Rγ null mice injected with primary BCR–ABLT315I/E255V BC-CML cells. The combined treatment selectively targeted CML progenitors and inhibited CD44, c-Myc, survivin, p-CRKL and p-STAT5 expression. In addition, pretreating primary BC-CML cells with C82, or the combination, but not with nilotinib alone, significantly impaired their engraftment potential in NOD/SCID/IL2Rγ-null-3/GM/SF mice and significantly prolonged survival. Our data suggest potential benefit of concomitant β-catenin and Bcr–Abl inhibition to prevent or overcome Bcr–Abl kinase-dependent or -independent TKI resistance in BC-CML. PMID:28321124

Phase 1 dose-finding study of rebastinib (DCC-2036) in patients with relapsed chronic myeloid leukemia and acute myeloid leukemia

PubMed Central

Cortes, Jorge; Talpaz, Moshe; Smith, Hedy P.; Snyder, David S.; Khoury, Jean; Bhalla, Kapil N.; Pinilla-Ibarz, Javier; Larson, Richard; Mitchell, David; Wise, Scott C.; Rutkoski, Thomas J.; Smith, Bryan D.; Flynn, Daniel L.; Kantarjian, Hagop M.; Rosen, Oliver; Van Etten, Richard A.

2017-01-01

A vailable tyrosine kinase inhibitors for chronic myeloid leukemia bind in an adenosine 5′-triphosphate-binding pocket and are affected by evolving mutations that confer resistance. Rebastinib was identified as a switch control inhibitor of BCR-ABL1 and FLT3 and may be active against resistant mutations. A Phase 1, first-in-human, single-agent study investigated rebastinib in relapsed or refractory chronic or acute myeloid leukemia. The primary objectives were to investigate the safety of rebastinib and establish the maximum tolerated dose and recommended Phase 2 dose. Fifty-seven patients received treatment with rebastinib. Sixteen patients were treated using powder-in-capsule preparations at doses from 57 mg to 1200 mg daily, and 41 received tablet preparations at doses of 100 mg to 400 mg daily. Dose-limiting toxicities were dysarthria, muscle weakness, and peripheral neuropathy. The maximum tolerated dose was 150 mg tablets administered twice daily. Rebastinib was rapidly absorbed. Bioavailability was 3- to 4-fold greater with formulated tablets compared to unformulated capsules. Eight complete hematologic responses were achieved in 40 evaluable chronic myeloid leukemia patients, 4 of which had a T315I mutation. None of the 5 patients with acute myeloid leukemia responded. Pharmacodynamic analysis showed inhibition of phosphorylation of substrates of BCR-ABL1 or FLT3 by rebastinib. Although clinical activity was observed, clinical benefit was insufficient to justify continued development in chronic or acute myeloid leukemia. Pharmacodynamic analyses suggest that other kinases inhibited by rebastinib, such as TIE2, may be more relevant targets for the clinical development of rebastinib (clinicaltrials.gov Identifier:00827138). PMID:27927766

Phase 1 dose-finding study of rebastinib (DCC-2036) in patients with relapsed chronic myeloid leukemia and acute myeloid leukemia.

PubMed

Cortes, Jorge; Talpaz, Moshe; Smith, Hedy P; Snyder, David S; Khoury, Jean; Bhalla, Kapil N; Pinilla-Ibarz, Javier; Larson, Richard; Mitchell, David; Wise, Scott C; Rutkoski, Thomas J; Smith, Bryan D; Flynn, Daniel L; Kantarjian, Hagop M; Rosen, Oliver; Van Etten, Richard A

2017-03-01

A vailable tyrosine kinase inhibitors for chronic myeloid leukemia bind in an adenosine 5'-triphosphate-binding pocket and are affected by evolving mutations that confer resistance. Rebastinib was identified as a switch control inhibitor of BCR-ABL1 and FLT3 and may be active against resistant mutations. A Phase 1, first-in-human, single-agent study investigated rebastinib in relapsed or refractory chronic or acute myeloid leukemia. The primary objectives were to investigate the safety of rebastinib and establish the maximum tolerated dose and recommended Phase 2 dose. Fifty-seven patients received treatment with rebastinib. Sixteen patients were treated using powder-in-capsule preparations at doses from 57 mg to 1200 mg daily, and 41 received tablet preparations at doses of 100 mg to 400 mg daily. Dose-limiting toxicities were dysarthria, muscle weakness, and peripheral neuropathy. The maximum tolerated dose was 150 mg tablets administered twice daily. Rebastinib was rapidly absorbed. Bioavailability was 3- to 4-fold greater with formulated tablets compared to unformulated capsules. Eight complete hematologic responses were achieved in 40 evaluable chronic myeloid leukemia patients, 4 of which had a T315I mutation. None of the 5 patients with acute myeloid leukemia responded. Pharmacodynamic analysis showed inhibition of phosphorylation of substrates of BCR-ABL1 or FLT3 by rebastinib. Although clinical activity was observed, clinical benefit was insufficient to justify continued development in chronic or acute myeloid leukemia. Pharmacodynamic analyses suggest that other kinases inhibited by rebastinib, such as TIE2, may be more relevant targets for the clinical development of rebastinib ( clinicaltrials.gov Identifier:00827138 ). Copyright© Ferrata Storti Foundation.

Hypertrophic cardiomyopathy-linked mutation in troponin T causes myofibrillar disarray and pro-arrhythmic action potential changes in human iPSC cardiomyocytes.

PubMed

Wang, Lili; Kim, Kyungsoo; Parikh, Shan; Cadar, Adrian Gabriel; Bersell, Kevin R; He, Huan; Pinto, Jose R; Kryshtal, Dmytro O; Knollmann, Bjorn C

2018-01-01

Mutations in cardiac troponin T (TnT) are linked to increased risk of ventricular arrhythmia and sudden death despite causing little to no cardiac hypertrophy. Studies in mice suggest that the hypertrophic cardiomyopathy (HCM)-associated TnT-I79N mutation increases myofilament Ca sensitivity and is arrhythmogenic, but whether findings from mice translate to human cardiomyocyte electrophysiology is not known. To study the effects of the TnT-I79N mutation in human cardiomyocytes. Using CRISPR/Cas9, the TnT-I79N mutation was introduced into human induced pluripotent stem cells (hiPSCs). We then used the matrigel mattress method to generate single rod-shaped cardiomyocytes (CMs) and studied contractility, Ca handling and electrophysiology. Compared to isogenic control hiPSC-CMs, TnT-I79N hiPSC-CMs exhibited sarcomere disorganization, increased systolic function and impaired relaxation. The Ca-dependence of contractility was leftward shifted in mutation containing cardiomyocytes, demonstrating increased myofilament Ca sensitivity. In voltage-clamped hiPSC-CMs, TnT-I79N reduced intracellular Ca transients by enhancing cytosolic Ca buffering. These changes in Ca handling resulted in beat-to-beat instability and triangulation of the cardiac action potential, which are predictors of arrhythmia risk. The myofilament Ca sensitizer EMD57033 produced similar action potential triangulation in control hiPSC-CMs. The TnT-I79N hiPSC-CM model not only reproduces key cellular features of TnT-linked HCM such as myofilament disarray, hypercontractility and diastolic dysfunction, but also suggests that this TnT mutation causes pro-arrhythmic changes of the human ventricular action potential. Copyright © 2017 Elsevier Ltd. All rights reserved.

Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

PubMed

Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

2017-06-01

Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

Relatively favorable outcome after allogeneic stem cell transplantation for BCR-ABL1-positive AML: A survey from the acute leukemia working party of the European Society for blood and marrow transplantation (EBMT).

PubMed

Lazarevic, Vladimir Lj; Labopin, Myriam; Depei, Wu; Yakoub-Agha, Ibrahim; Huynh, Anne; Ljungman, Per; Schaap, Nicolaas; Cornelissen, Jan J; Maillard, Natacha; Pioltelli, Pietro; Gedde-Dahl, Tobias; Lenhoff, Stig; Houhou, Mohamed; Esteve, Jordi; Mohty, Mohamad; Nagler, Arnon

2018-01-01

The aim of the study was to assess the role of allogeneic stem cell transplantation (SCT) in patients diagnosed with BCR-ABL1-positive acute myeloid leukemia (AML). Fifty-seven patients (median age, 48 years, range: 19-67) with BCR-ABL1 positive AML undergoing SCT were identified. The majority of the patients (70%) received a TKI before the transplant. At SCT 48 patients were in CR (45 in CR1), while 9 patients were transplanted in a more advanced stage of the disease. MRD was negative (BCR-ABL1/ABL < 10 4 ) at time of SCT in 36.1% (14/40). After SCT, 16 (61.5%) out of 26 patients with MRD positive at transplantation reached MRD negativity. After a median follow-up of 6.3 years (0.7-14.2), NRM, RI, LFS, OS, and GRFS at 5 years were 18.1%, 37%, 44.2%, 53.8%, and 32.1%, respectively. The cumulative incidence of acute GvHD grade II-IV was 16.4%, incidence of chronic GvHD 24.9%, and of extensive cGvHD 21.4%, respectively. In patients who received SCT in CR1, 5-yr NRM, RI, LFS, OS, and GRFS were 15.9%, 36.4%, 46.5%, 59.4%, and 34.9%, respectively. Univariate analysis showed that age (<50 vs. ≥50 years) was associated with RI (5-yr: 22.7 vs. 50%), LFS (5-yr: 61.9 vs. 31.8%), and GRFS (5-yr: 52.4 vs. 18.2%), whereas MRD-negative status before SCT was associated with an improved GRFS (38.9 vs. 16.7%). We conclude that the outcome of patients <50 years of age with BCR-ABL1-positive AML receiving allogeneic SCT in CR is relatively favorable, possibly reflecting the beneficial effect of the use of TKI. © 2017 Wiley Periodicals, Inc.

Structure and Dynamic Regulation of Abl Kinases*

PubMed Central

Panjarian, Shoghag; Iacob, Roxana E.; Chen, Shugui; Engen, John R.; Smithgall, Thomas E.

2013-01-01

The c-abl proto-oncogene encodes a unique protein-tyrosine kinase (Abl) distinct from c-Src, c-Fes, and other cytoplasmic tyrosine kinases. In normal cells, Abl plays prominent roles in cellular responses to genotoxic stress as well as in the regulation of the actin cytoskeleton. Abl is also well known in the context of Bcr-Abl, the oncogenic fusion protein characteristic of chronic myelogenous leukemia. Selective inhibitors of Bcr-Abl, of which imatinib is the prototype, have had a tremendous impact on clinical outcomes in chronic myelogenous leukemia and revolutionized the field of targeted cancer therapy. In this minireview, we focus on the structural organization and dynamics of Abl kinases and how these features influence inhibitor sensitivity. PMID:23316053

FTY720, a new alternative for treating blast crisis chronic myelogenous leukemia and Philadelphia chromosome–positive acute lymphocytic leukemia

PubMed Central

Neviani, Paolo; Santhanam, Ramasamy; Oaks, Joshua J.; Eiring, Anna M.; Notari, Mario; Blaser, Bradley W.; Liu, Shujun; Trotta, Rossana; Muthusamy, Natarajan; Gambacorti-Passerini, Carlo; Druker, Brian J.; Cortes, Jorge; Marcucci, Guido; Chen, Ching-Shih; Verrills, Nicole M.; Roy, Denis C.; Caligiuri, Michael A.; Bloomfield, Clara D.; Byrd, John C.; Perrotti, Danilo

2007-01-01

Blast crisis chronic myelogenous leukemia (CML-BC) and Philadelphia chromosome–positive (Ph1-positive) acute lymphocytic leukemia (ALL) are 2 fatal BCR/ABL-driven leukemias against which Abl kinase inhibitors fail to induce a long-term response. We recently reported that functional loss of protein phosphatase 2A (PP2A) activity is important for CML blastic transformation. We assessed the therapeutic potential of the PP2A activator FTY720 (2-amino-2-[2-(4-octylphenyl)ethyl]-1,3-propanediol hydrochloride), an immunomodulator in Phase III trials for patients with multiple sclerosis or undergoing organ transplantation, in CML-BC and Ph1 ALL patient cells and in in vitro and in vivo models of these BCR/ABL+ leukemias. Our data indicate that FTY720 induces apoptosis and impairs clonogenicity of imatinib/dasatinib-sensitive and -resistant p210/p190BCR/ABL myeloid and lymphoid cell lines and CML-BCCD34+ and Ph1 ALLCD34+/CD19+ progenitors but not of normal CD34+ and CD34+/CD19+ bone marrow cells. Furthermore, pharmacologic doses of FTY720 remarkably suppress in vivo p210/p190BCR/ABL-driven [including p210/p190BCR/ABL (T315I)] leukemogenesis without exerting any toxicity. Altogether, these results highlight the therapeutic relevance of rescuing PP2A tumor suppressor activity in Ph1 leukemias and strongly support the introduction of the PP2A activator FTY720 in the treatment of CML-BC and Ph1 ALL patients. PMID:17717597

Atypical generalized lipoatrophy and severe insulin resistance due to a heterozygous LMNA p.T10I mutation.

PubMed

Mory, Patricia B; Crispim, Felipe; Kasamatsu, Teresa; Gabbay, Monica A L; Dib, Sergio A; Moisés, Regina S

2008-11-01

Lipodystrophies are a group of heterogeneous disorders characterized by the loss of adipose tissue and metabolic complications. The main familial forms of lipodystrophy are Congenital Generalized Lipodystrophy and Familial Partial Lipodystrophy (FPLD). FPLD may result from mutations in the LMNA gene. Besides FPLD, mutations in LMNA have been shown to be responsible for other inherited diseases called laminopathies. Here we describe the case of a 15-year-old girl who was referred to our service due to diabetes mellitus and severe hypertriglyceridemia. Physical examination revealed generalized loss of subcutaneous fat, confirmed by DEXA (total body fat 8.6%). As the patient presented with pubertal-onset of generalized lipodystrophy and insulin resistance, molecular analysis of the LMNA gene was performed. We identified a heterozygous substitution in exon 1 (c.29C>T) predicting a p.T10I mutation. In summary, we describe an atypical phenotype of lipodistrophy associated with a de novo appearance of the p.T10I mutation in LMNA gene.

Laboratory practice guidelines for detecting and reporting JAK2 and MPL mutations in myeloproliferative neoplasms: a report of the Association for Molecular Pathology.

PubMed

Gong, Jerald Z; Cook, James R; Greiner, Timothy C; Hedvat, Cyrus; Hill, Charles E; Lim, Megan S; Longtine, Janina A; Sabath, Daniel; Wang, Y Lynn

2013-11-01

Recurrent mutations in JAK2 and MPL genes are genetic hallmarks of BCR-ABL1-negative myeloproliferative neoplasms. Detection of JAK2 and MPL mutations has been incorporated into routine diagnostic algorithms for these diseases. This Special Article summarizes results from a nationwide laboratory survey of JAK2 and MPL mutation analysis. Based on the current practice pattern and the literature, this Special Article provides recommendations and guidelines for laboratory practice for detection of mutations in the JAK2 and MPL genes, including clinical manifestations for prompting the mutation analysis, current and recommended methodologies for testing the mutations, and standardization for reporting the test results. This Special Article also points to future directions for genomic testing in BCR-ABL1-negative myeloproliferative neoplasms. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Mechanisms of genesis of variant translocation in chronic myeloid leukemia are not correlated with ABL1 or BCR deletion status or response to imatinib therapy.

PubMed

Richebourg, Steven; Eclache, Virginie; Perot, Christine; Portnoi, Marie-France; Van den Akker, Jacqueline; Terré, Christine; Maareck, Odile; Soenen, Valérie; Viguié, Franck; Laï, Jean-Luc; Andrieux, Joris; Corm, Sélim; Roche-Lestienne, Catherine

2008-04-15

Many published studies have indicated that various mechanisms could be involved in the genesis of variant chronic myelogeneous leukemia (CML) translocations. These are mainly one-step or two-step mechanisms, associated or not with deletions adjacent to the translocation junction on der(9) or der(22) chromosomes (or both). Based on the mechanism of genesis, it has been suggested that the complexity may affect the occurrence of ABL1 and BCR deletions (either or both), or may be associated with the CML disease course, and thus could determine the response to imatinib therapy. Through a retrospective molecular cytogenetic study of 41 CML patients with variant Philadelphia chromosome (Ph), we explored the genesis of these variant rearrangements and analyzed the correlation with deletion status and imatinib efficiency. Our results confirmed that the one-step mechanism is the most frequent, evidenced in 30 of 41 patients (73%); 3 patients demonstrated other more complex multistep events and 8 patients (19.5%) harbored ABL1 or BCR deletions that are not significantly associated with the complexity of translocation genesis. We also found no association between one-step, two-step, or multistep mechanisms and the response to imatinib therapy.

Emergence of MPLW515 mutation in a patient with CALR deletion: Evidence of secondary acquisition of MPL mutation in the CALR clone.

PubMed

Partouche, Nicolas; Conejero, Carole; Barathon, Quentin; Moroch, Julien; Tulliez, Michel; Cordonnier, Catherine; Giraudier, Stephane

2018-02-01

Myeloproliferative neoplasms are characterized by transduction pathway recognized as mutually exclusive molecular abnormalities such as BCR-ABL translocation, JAK2V617F or JAK2 exon 12 mutations, MPL w515, and CALR mutations. However, in some rare cases, associations of such mutations are found in 1 patient. This can be related to 2 pathologies (at least 2 different clones harboring 2 mutations) or associated mutations in 1 clone. We describe here such an association of CALR and MPL mutations in a patient harboring the second mutation in a subclone during the phenotypic evolution of the myeloproliferative neoplasms. Copyright © 2017 John Wiley & Sons, Ltd.

Identification of HNF4A Mutation p.T130I and HNF1A Mutations p.I27L and p.S487N in a Han Chinese Family with Early-Onset Maternally Inherited Type 2 Diabetes.

PubMed

Yang, Ying; Zhou, Tai-Cheng; Liu, Yong-Ying; Li, Xiao; Wang, Wen-Xue; Irwin, David M; Zhang, Ya-Ping

2016-01-01

Maturity-onset diabetes of the young (MODY) is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I) and two HNF1A polymorphisms (p.I27L and p.S487N) were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.

An acquired HER2 T798I gatekeeper mutation induces resistance to neratinib in a patient with HER2 mutant-driven breast cancer

PubMed Central

Hanker, Ariella B.; Brewer, Monica Red; Sheehan, Jonathan H.; Koch, James P.; Sliwoski, Gregory R.; Nagy, Rebecca; Lanman, Richard; Berger, Michael F.; Hyman, David M.; Solit, David B.; He, Jie; Miller, Vincent; Cutler, Richard E.; Lalani, Alshad S.; Cross, Darren; Lovly, Christine M.; Meiler, Jens; Arteaga, Carlos L.

2017-01-01

We report a HER2T798I gatekeeper mutation in a patient with HER2L869R-mutant breast cancer with acquired resistance to neratinib. Laboratory studies suggested that HER2L869R is a neratinib-sensitive, gain-of-function mutation that upon dimerization with mutant HER3E928G, also present in the breast cancer, amplifies HER2 signaling. The patient was treated with neratinib and exhibited a sustained partial response. Upon clinical progression, HER2T798I was detected in plasma tumor cell-free DNA. Structural modeling of this acquired mutation suggested that the increased bulk of isoleucine in HER2T798I reduces neratinib binding. Neratinib blocked HER2-mediated signaling and growth in cells expressing HER2L869R but not HER2L869R/T798I. In contrast, afatinib and the osimertinib metabolite AZ5104 strongly suppressed HER2L869R/T798I-induced signaling and cell growth. Acquisition of HER2T798I upon development of resistance to neratinib in a breast cancer with an initial activating HER2 mutation suggests HER2L869R is a driver mutation. HER2T798I-mediated neratinib resistance may be overcome by other irreversible HER2 inhibitors like afatinib. PMID:28274957

An Acquired HER2T798I Gatekeeper Mutation Induces Resistance to Neratinib in a Patient with HER2 Mutant-Driven Breast Cancer.

PubMed

Hanker, Ariella B; Brewer, Monica Red; Sheehan, Jonathan H; Koch, James P; Sliwoski, Gregory R; Nagy, Rebecca; Lanman, Richard; Berger, Michael F; Hyman, David M; Solit, David B; He, Jie; Miller, Vincent; Cutler, Richard E; Lalani, Alshad S; Cross, Darren; Lovly, Christine M; Meiler, Jens; Arteaga, Carlos L

2017-06-01

We report a HER2 T798I gatekeeper mutation in a patient with HER2 L869R -mutant breast cancer with acquired resistance to neratinib. Laboratory studies suggested that HER2 L869R is a neratinib-sensitive, gain-of-function mutation that upon dimerization with mutant HER3 E928G , also present in the breast cancer, amplifies HER2 signaling. The patient was treated with neratinib and exhibited a sustained partial response. Upon clinical progression, HER2 T798I was detected in plasma tumor cell-free DNA. Structural modeling of this acquired mutation suggested that the increased bulk of isoleucine in HER2 T798I reduces neratinib binding. Neratinib blocked HER2-mediated signaling and growth in cells expressing HER2 L869R but not HER2 L869R/T798I In contrast, afatinib and the osimertinib metabolite AZ5104 strongly suppressed HER2 L869R/T798I -induced signaling and cell growth. Acquisition of HER2 T798I upon development of resistance to neratinib in a breast cancer with an initial activating HER2 mutation suggests HER2 L869R is a driver mutation. HER2 T798I -mediated neratinib resistance may be overcome by other irreversible HER2 inhibitors like afatinib. Significance: We found an acquired HER2 gatekeeper mutation in a patient with HER2 -mutant breast cancer upon clinical progression on neratinib. We speculate that HER2 T798I may arise as a secondary mutation following response to effective HER2 tyrosine kinase inhibitors (TKI) in other cancers with HER2 -activating mutations. This resistance may be overcome by other irreversible HER2 TKIs, such as afatinib. Cancer Discov; 7(6); 575-85. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 539 . ©2017 American Association for Cancer Research.

c-Abl-Mediated Tyrosine Phosphorylation of the T-bet DNA-Binding Domain Regulates CD4+ T-Cell Differentiation and Allergic Lung Inflammation ▿

PubMed Central

Chen, An; Lee, Sang-Myeong; Gao, Beixue; Shannon, Stephen; Zhu, Zhou; Fang, Deyu

2011-01-01

The tyrosine kinase c-Abl is required for full activation of T cells, while its role in T-cell differentiation has not been characterized. We report that c-Abl deficiency skews CD4+ T cells to type 2 helper T cell (Th2) differentiation, and c-Abl−/− mice are more susceptible to allergic lung inflammation. c-Abl interacts with and phosphorylates T-bet, a Th1 lineage transcription factor. c-Abl-mediated phosphorylation enhances the transcriptional activation of T-bet. Interestingly, three tyrosine residues within the T-bet DNA-binding domain are the predominant sites of phosphorylation by c-Abl. Mutation of these tyrosine residues inhibits the promoter DNA-binding activity of T-bet. c-Abl regulates Th cell differentiation in a T-bet-dependent manner because genetic deletion of T-bet in CD4+ T cells abolishes c-Abl-deficiency-mediated enhancement of Th2 differentiation. Reintroduction of T-bet-null CD4+ T cells with wild-type T-bet, but not its tyrosine mutant, rescues gamma interferon (IFN-γ) production and inhibits Th2 cytokine production. Therefore, c-Abl catalyzes tyrosine phosphorylation of the DNA-binding domain of T-bet to regulate CD4+ T cell differentiation. PMID:21690296

The clinical spectrum of the m.10191T>C mutation in complex I-deficient Leigh syndrome.

PubMed

Nesbitt, Victoria; Morrison, Patrick J; Crushell, Ellen; Donnelly, Deirdre E; Alston, Charlotte L; He, Langping; McFarland, Robert; Taylor, Robert W

2012-06-01

Mitochondrial respiratory chain diseases represent one of the most common inherited neurometabolic disorders of childhood, affecting a minimum of 1 in 7500 live births. The marked clinical, biochemical, and genetic heterogeneity means that accurate genetic counselling relies heavily upon the identification of the underlying causative mutation in the individual and determination of carrier status in the parents. Isolated complex I deficiency is the most common respiratory chain defect observed in children, resulting in organ-specific or multisystem disease, but most often presenting as Leigh syndrome, for which mitochondrial DNA mutations are important causes. Several recurrent, pathogenic point mutations in the MTND3 gene - including m.10191T>C (p.Ser45Pro) - have been previously identified. In this short clinical review we evaluate the case reports of the m.10191T>C mutation causing complex I-deficient Leigh syndrome described in the literature, in addition to two new ones diagnosed in our laboratory. Both of these appear to have arisen de novo without transmission of the mutation from mother to offspring, illustrating the importance not only of fully characterizing the mitochondrial genome as part of the investigation of children with complex I-deficient Leigh syndrome but also of assessing maternal samples to provide crucial genetic advice for families. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

Enhancement of B-cell receptor signaling by a point mutation of adaptor protein 3BP2 identified in human inherited disease cherubism.

PubMed

Ogi, Kazuhiro; Nakashima, Kenji; Chihara, Kazuyasu; Takeuchi, Kenji; Horiguchi, Tomoko; Fujieda, Shigeharu; Sada, Kiyonao

2011-09-01

Tyrosine phosphorylation of adaptor protein c-Abl-Src homology 3 (SH3) domain-binding protein-2 (3BP2, also referred to SH3BP2) positively regulates the B-cell antigen receptor (BCR)-mediated signal transduction, leading to the activation of nuclear factor of activated T cells (NFAT). Here we showed the effect of the proline to arginine substitution of 3BP2 in which is the most common mutation in patients with cherubism (P418R) on B-cell receptor signaling. Comparing to the wild type, overexpression of the mutant form of 3BP2 (3BP2-P416R, corresponding to P418R in human protein) enhanced BCR-mediated activation of NFAT. 3BP2-P416R increased the signaling complex formation with Syk, phospholipase C-γ2 (PLC-γ2), and Vav1. In contrast, 3BP2-P416R could not change the association with the negative regulator 14-3-3. Loss of the association mutant that was incapable to associate with 14-3-3 could not mimic BCR-mediated NFAT activation in Syk-deficient cells. Moreover, BCR-mediated phosphorylation of extracellular signal regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) was not affected by P416R mutation. These results showed that P416R mutation of 3BP2 causes the gain of function in B cells by increasing the interaction with specific signaling molecules. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

[The quantitative testing of V617F mutation in gen JAK2 using pyrosequencing technique].

PubMed

Dunaeva, E A; Mironov, K O; Dribnokhodova, T E; Subbotina, E E; Bashmakova; Ol'hovskiĭ, I A; Shipulin, G A

2014-11-01

The somatic mutation V617F in gen JAK2 is a frequent cause of chronic myeloprolific diseases not conditioned by BCR/ABL mutation. The quantitative testing of relative percentage of mutant allele can be used in establishing severity of disease and its prognosis and in prescription of remedy inhibiting activity of JAK2. To quantitatively test mutation the pyrosequencing technique was applied. The developed technique permits detecting and quantitatively, testing percentage of mutation fraction since 7%. The "gray zone" is presented by samples with percentage of mutant allele from 4% to 7%. The dependence of expected percentage of mutant fraction in analyzed sample from observed value of signal is described by equation of line with regression coefficients y = - 0.97, x = -1.32 and at that measurement uncertainty consists ± 0.7. The developed technique is approved officially on clinical material from 192 patients with main forms of myeloprolific diseases not conditioned by BCR/ABL mutation. It was detected 64 samples with mautant fraction percentage from 13% to 91%. The developed technique permits implementing monitoring of therapy of myeloprolific diseases and facilitates to optimize tactics of treatment.

The T1048I mutation in ATP7A gene causes an unusual Menkes disease presentation

PubMed Central

2012-01-01

Background The ATP7A gene encodes the ATP7A protein, which is a trans-Golgi network copper transporter expressed in the brain and other organs. Mutations in this gene cause disorders of copper metabolism, such as Menkes disease. Here we describe the novel and unusual mutation (p.T1048I) in the ATP7A gene of a child with Menkes disease. The mutation affects a conserved DKTGT1048 phosphorylation motif that is involved in the catalytic activity of ATP7A. We also describe the clinical course and the response to copper treatment in this patient. Case presentation An 11-month-old male Caucasian infant was studied because of hypotonia, ataxia and global developmental delay. The patient presented low levels of serum copper and ceruloplasmin, and was shown to be hemizygous for the p.T1048I mutation in ATP7A. The diagnosis was confirmed when the patient was 18 months old, and treatment with copper-histidinate (Cu-His) was started immediately. The patient showed some neurological improvement and he is currently 8 years old. Because the p.T1048I mutation affects its catalytic site, we expected a complete loss of functional ATP7A and a classical Menkes disease presentation. However, the clinical course of the patient was mild, and he responded to Cu-His treatment, which suggests that this mutation leads to partial conservation of the activity of ATP7A. Conclusion This case emphasizes the important correlation between genotype and phenotype in patients with Menkes disease. The prognosis in Menkes disease is associated with early detection, early initiation of treatment and with the preservation of some ATP7A activity, which is necessary for Cu-His treatment response. The description of this new mutation and the response of the patient to Cu-His treatment will contribute to the growing body of knowledge about treatment response in Menkes disease. PMID:22992316

Fludarabine Phosphate, Cyclophosphamide, Total Body Irradiation, and Donor Stem Cell Transplant in Treating Patients With Blood Cancer

ClinicalTrials.gov

2018-06-13

Accelerated Phase Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Acute Leukemia in Remission; Acute Lymphoblastic Leukemia; Acute Myeloid Leukemia; Acute Myeloid Leukemia With FLT3/ITD Mutation; Acute Myeloid Leukemia With Gene Mutations; Aplastic Anemia; B-Cell Non-Hodgkin Lymphoma; CD40 Ligand Deficiency; Chronic Granulomatous Disease; Chronic Leukemia in Remission; Chronic Lymphocytic Leukemia; Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Chronic Myelomonocytic Leukemia; Chronic Phase Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Congenital Amegakaryocytic Thrombocytopenia; Congenital Neutropenia; Congenital Pure Red Cell Aplasia; Glanzmann Thrombasthenia; Immunodeficiency Syndrome; Myelodysplastic Syndrome; Myelofibrosis; Myeloproliferative Neoplasm; Paroxysmal Nocturnal Hemoglobinuria; Plasma Cell Myeloma; Polycythemia Vera; Recurrent Non-Hodgkin Lymphoma; Refractory Non-Hodgkin Lymphoma; Secondary Acute Myeloid Leukemia; Secondary Myelodysplastic Syndrome; Severe Aplastic Anemia; Shwachman-Diamond Syndrome; Sickle Cell Disease; T-Cell Non-Hodgkin Lymphoma; Thalassemia; Waldenstrom Macroglobulinemia; Wiskott-Aldrich Syndrome

Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

PubMed

Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

2017-05-08

In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

Enhanced SH3/Linker Interaction Overcomes Abl Kinase Activation by Gatekeeper and Myristic Acid Binding Pocket Mutations and Increases Sensitivity to Small Molecule Inhibitors*

PubMed Central

Panjarian, Shoghag; Iacob, Roxana E.; Chen, Shugui; Wales, Thomas E.; Engen, John R.; Smithgall, Thomas E.

2013-01-01

Multidomain kinases such as c-Src and c-Abl are regulated by complex allosteric interactions involving their noncatalytic SH3 and SH2 domains. Here we show that enhancing natural allosteric control of kinase activity by SH3/linker engagement has long-range suppressive effects on the kinase activity of the c-Abl core. Surprisingly, enhanced SH3/linker interaction also dramatically sensitized the Bcr-Abl tyrosine kinase associated with chronic myelogenous leukemia to small molecule inhibitors that target either the active site or the myristic acid binding pocket in the kinase domain C-lobe. Dynamics analyses using hydrogen exchange mass spectrometry revealed a remarkable allosteric network linking the SH3 domain, the myristic acid binding pocket, and the active site of the c-Abl core, providing a structural basis for the biological observations. These results suggest a rational strategy for enhanced drug targeting of Bcr-Abl and other multidomain kinase systems that use multiple small molecules to exploit natural mechanisms of kinase control. PMID:23303187

Rho kinase regulates the survival and transformation of cells bearing oncogenic forms of KIT, FLT3 and BCR-ABL

PubMed Central

Mali, Raghuveer Singh; Ramdas, Baskar; Ma, Peilin; Shi, Jianjian; Munugalavadla, Veerendra; Sims, Emily; Wei, Lei; Vemula, Sasidhar; Nabinger, Sarah C.; Goodwin, Charles B.; Chan, Rebecca J.; Traina, Fabiola; Visconte, Valeria; Tiu, Ramon V.; Lewis, Timothy A.; Stern, Andrew M.; Wen, Qiang; Crispino, John D.; Boswell, H. Scott; Kapur, Reuben

2011-01-01

Summary We show constitutive activation of Rho kinase (ROCK) in cells bearing oncogenic forms of KIT, FLT3 and BCR-ABL, which is dependent on PI3K and Rho GTPase. Genetic or pharmacologic inhibition of ROCK in oncogene bearing cells impaired their growth as well as the growth of acute myeloid leukemia patient derived blasts and prolonged the life span of mice bearing myeloproliferative disease. Downstream from ROCK, rapid dephosphorylation or loss of expression of myosin light chain resulted in enhanced apoptosis, reduced growth and loss of actin polymerization in oncogene bearing cells leading to significantly prolonged life span of leukemic mice. In summary, we describe a pathway involving PI3K/Rho/ROCK/MLC which may contribute to myeloproliferative disease and/or acute myeloid leukemia in humans. PMID:21907926

Complex I deficiency related to T10158C mutation ND3 gene: A further definition of the clinical spectrum.

PubMed

Grosso, Salvatore; Carluccio, Maria Alessandra; Cardaioli, Elena; Cerase, Alfonso; Malandrini, Alessandro; Romano, Chiara; Federico, Antonio; Dotti, Maria Teresa

2017-03-01

Complex I deficiency is the most common energy generation disorder which may clinically present at any age with a wide spectrum of symptoms and signs. The T10158C mutation ND3 gene is rare and occurs in patients showing an early rapid neurological deterioration invariably leading to death after a few months. We report a 9year-old boy with a mtDNA T10158C mutation showing a mild MELAS-like phenotype and brain MRI features congruent with both MELAS and Leigh syndrome. Epilepsia partialis continua also occurred in the clinical course and related to a mild cortical atrophy of the left perisylvian area. The present case confirms that the clinical spectrum of Complex I deficiency related to T10158C mutation ND3 gene is wider than previously described. Our observation further suggests that testing mutation in the MT-ND3 gene should be included in the diagnostic work-up of patients presenting with epilepsia partialis continua accompanied by suspicion of mitochondrial disorder. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

The episodic ataxia type 1 mutation I262T alters voltage-dependent gating and disrupts protein biosynthesis of human Kv1.1 potassium channels.

PubMed

Chen, Szu-Han; Fu, Ssu-Ju; Huang, Jing-Jia; Tang, Chih-Yung

2016-01-18

Voltage-gated potassium (Kv) channels are essential for setting neuronal membrane excitability. Mutations in human Kv1.1 channels are linked to episodic ataxia type 1 (EA1). The EA1-associated mutation I262T was identified from a patient with atypical phenotypes. Although a previous report has characterized its suppression effect, several key questions regarding the impact of the I262T mutation on Kv1.1 as well as other members of the Kv1 subfamily remain unanswered. Herein we show that the dominant-negative effect of I262T on Kv1.1 current expression is not reversed by co-expression with Kvβ1.1 or Kvβ2 subunits. Biochemical examinations indicate that I262T displays enhanced protein degradation and impedes membrane trafficking of Kv1.1 wild-type subunits. I262T appears to be the first EA1 mutation directly associated with impaired protein stability. Further functional analyses demonstrate that I262T changes the voltage-dependent activation and Kvβ1.1-mediated inactivation, uncouples inactivation from activation gating, and decelerates the kinetics of cumulative inactivation of Kv1.1 channels. I262T also exerts similar dominant effects on the gating of Kv1.2 and Kv1.4 channels. Together our data suggest that I262T confers altered channel gating and reduced functional expression of Kv1 channels, which may account for some of the phenotypes of the EA1 patient.

The First Pentacyclic Triterpenoid Gypsogenin Derivative Exhibiting Anti-ABL1 Kinase and Anti-chronic Myelogenous Leukemia Activities.

PubMed

Ciftci, Halil Ibrahim; Ozturk, Safiye Emirdag; Ali, Taha F S; Radwan, Mohamed O; Tateishi, Hiroshi; Koga, Ryoko; Ocak, Zeynep; Can, Mustafa; Otsuka, Masami; Fujita, Mikako

2018-04-01

The discovery of the chimeric tyrosine kinase breakpoint cluster region kinase-Abelson kinase (BCR-ABL)-targeted drug imatinib conceptually changed the treatment of chronic myelogenous leukemia (CML). However, some CML patients show drug resistance to imatinib. To address this issue, some artificial heterocyclic compounds have been identified as BCR-ABL inhibitors. Here we examined whether plant-derived pentacyclic triterpenoid gypsogenin and/or their derivatives show inhibitory activity against BCR-ABL. Among the three derivatives, benzyl 3-hydroxy-23-oxoolean-12-en-28-oate (1c) was found to be the most effective anticancer agent on the CML cell line K562, with an IC 50 value of 9.3 µM. In contrast, the IC 50 against normal peripheral blood mononuclear cells was 276.0 µM, showing better selectivity than imatinib. Compound 1c had in vitro inhibitory activity against Abelson kinase 1 (ABL1) (IC 50 =8.7 µM), the kinase component of BCR-ABL. In addition, compound 1c showed a different inhibitory profile against eight kinases compared with imatinib. The interaction between ATP binding site of ABL and 1c was examined by molecular docking study, and the binding mode was different from imatinib and newer generation inhibitors. Furthermore, 1c suppressed signaling downstream of BCR-ABL. This study suggests the possibility that plant extracts may be a source for CML treatment and offer a strategy to overcome drug resistance to known BCR-ABL inhibitors.

BCR-ABL1 molecular remission after 90Y-epratuzumab tetraxetan radioimmunotherapy in CD22+ Ph+ B-ALL: proof of principle.

PubMed

Chevallier, Patrice; Bodet-Milin, Caroline; Robillard, Nelly; Eugene, Thomas; Menard, Audrey; Le Houerou, Claire; Guillaume, Thierry; Delaunay, Jacques; Escoffre-Barbe, Martine; Wegener, William A; Goldenberg, David M; Kraeber-Bodéré, Francoise

2013-12-01

Although targeted therapies are used increasingly in hematologic malignancies, we are unaware of any prior studies of radioimmunotherapy (RAIT) in B-acute lymphoblastic leukemia (ALL), even though this radiosensitive tumor expresses CD22, potentially a good target for this approach. Here, we report a patient with Philadelphia chromosome-positive B-ALL in third relapse who received RAIT with (90) yttrium ((90) Y)-labeled anti-CD22 epratuzumab tetraxetan. Seven weeks after initiating therapy, the patient achieved a BCR-ABL1 molecular remission documented by RT-qPCR, which is now continuing at 6 months while awaiting an allogeneic hematopoietic stem cell transplant. (90) Y-Epratuzumab tetraxetan may be a promising therapeutic option for CD22(+) B-ALL patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Combined fulminant frontotemporal dementia and amyotrophic lateral sclerosis associated with an I113T SOD1 mutation.

PubMed

Katz, Jonathan S; Katzberg, Hans D; Woolley, Susan C; Marklund, Stefan L; Andersen, Peter M

2012-10-01

Mutations in the gene for superoxide dismutase type 1 cause amyotrophic lateral sclerosis (ALS), but are not thought to be associated with frontotemporal dementia (FTD). A lack of detailed case reports is one reason, among others, for this skepticism. This case report comments on a patient with familial ALS caused by I113T mutation in the SOD1 gene presenting with progressive cognitive and behavioral decline two years before developing progressive motor degeneration. In conclusion, this case provides evidence that SOD1 mutations can be associated with FTD.

Peptide nucleic acid probe-based fluorescence melting curve analysis for rapid screening of common JAK2, MPL, and CALR mutations.

PubMed

Park, Joonhong; Song, Minsik; Jang, Woori; Chae, Hyojin; Lee, Gun Dong; Kim, KyungTak; Park, Heekyung; Kim, Myungshin; Kim, Yonggoo

2017-02-01

We developed and evaluated the feasibility of peptide nucleic acid (PNA)-based fluorescence melting curve analysis (FMCA) to detect common mutations in myeloproliferative neoplasms (MPNs). We have set up two separate reactions of PNA-based FMCA: JAK2 V617F &CALR p.Leu367fs*46 (set A) and MPL W515L/K &CALR p.Lys385fs*47 (set B). Clinical usefulness was validated with allele-specific real-time PCR, fragment analysis, Sanger sequencing in 57 BCR-ABL1-negative MPNs. The limit of detection (LOD) of PNA-based FMCA was approximately 10% for each mutation and interference reactions using mixtures of different mutations were not observed. Non-specific amplification was not observed in normal control. PNA-based FMCA was able to detect all JAK2 V617F (n=20), CALR p.Leu367fs*46 (n=10) and p.Lys385fs*47 (n=8). Three of six MPL mutations were detected except three samples with low mutant concentration in out of LOD. JAK2 exon 12 mutations (n=7) were negative without influencing V617F results. Among six variant CALR exon 9 mutations, two were detected by this method owing to invading of probe binding site. PNA-based FMCA for detecting common JAK2, MPL, and CALR mutations is a rapid, simple, and sensitive technique in BCR-ABL1-negative MPNs with >10% mutant allele at the time of initial diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Deep targeted sequencing in pediatric acute lymphoblastic leukemia unveils distinct mutational patterns between genetic subtypes and novel relapse-associated genes.

PubMed

Lindqvist, C Mårten; Lundmark, Anders; Nordlund, Jessica; Freyhult, Eva; Ekman, Diana; Carlsson Almlöf, Jonas; Raine, Amanda; Övernäs, Elin; Abrahamsson, Jonas; Frost, Britt-Marie; Grandér, Dan; Heyman, Mats; Palle, Josefine; Forestier, Erik; Lönnerholm, Gudmar; Berglund, Eva C; Syvänen, Ann-Christine

2016-09-27

To characterize the mutational patterns of acute lymphoblastic leukemia (ALL) we performed deep next generation sequencing of 872 cancer genes in 172 diagnostic and 24 relapse samples from 172 pediatric ALL patients. We found an overall greater mutational burden and more driver mutations in T-cell ALL (T-ALL) patients compared to B-cell precursor ALL (BCP-ALL) patients. In addition, the majority of the mutations in T-ALL had occurred in the original leukemic clone, while most of the mutations in BCP-ALL were subclonal. BCP-ALL patients carrying any of the recurrent translocations ETV6-RUNX1, BCR-ABL or TCF3-PBX1 harbored few mutations in driver genes compared to other BCP-ALL patients. Specifically in BCP-ALL, we identified ATRX as a novel putative driver gene and uncovered an association between somatic mutations in the Notch signaling pathway at ALL diagnosis and increased risk of relapse. Furthermore, we identified EP300, ARID1A and SH2B3 as relapse-associated genes. The genes highlighted in our study were frequently involved in epigenetic regulation, associated with germline susceptibility to ALL, and present in minor subclones at diagnosis that became dominant at relapse. We observed a high degree of clonal heterogeneity and evolution between diagnosis and relapse in both BCP-ALL and T-ALL, which could have implications for the treatment efficiency.

The mutation profile of JAK2, MPL and CALR in Mexican patients with Philadelphia chromosome-negative myeloproliferative neoplasms.

PubMed

Labastida-Mercado, Nancy; Galindo-Becerra, Samantha; Garcés-Eisele, Javier; Colunga-Pedraza, Perla; Guzman-Olvera, Valeria; Reyes-Nuñez, Virginia; Ruiz-Delgado, Guillermo J; Ruiz-Argüelles, Guillermo J

2015-03-01

By using molecular markers, it is possible to gain information on both the classification and etiopathogenesis of chronic myeloproliferative neoplasias (MPN). In a group of 27 Mexican mestizo patients with MPNs, we studied seven molecular markers: the BCR/ABL1 fusion gene, the JAK2 V617F mutation, the JAK2 exon 12 mutations, the MPL W515L mutation, the MPL W515K mutation, and the calreticulin (CALR) exon 9 deletion or insertion. Patients with the BCR/ABL1 fusion gene were excluded. We studied 14 patients with essential thrombocythemia (ET), eight with polycythemia vera (PV), four with primary myelofibrosis (MF), and one with undifferentiated MPN. We found twelve individuals with the JAK2 V617F mutation; five of them had been clinically classified as PV, five as ET, and one as MF. One patient with the MPL W515L was identified with a clinical picture of ET. Five patients with the CALR mutation were identified, four ET and one MF. No individuals with either the MPL W515K mutation or the JAK2 exon 12 mutations were identified. The most consistent relationship was that between PV and the JAK2 V617F mutation (p=.01). Despite its small size, the study shows much less prevalence of JAK2 mutation in PV, ET and MF, which does not match international data. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Nutlin-3 plus tanshinone IIA exhibits synergetic anti-leukemia effect with imatinib by reactivating p53 and inhibiting the AKT/mTOR pathway in Ph+ ALL.

PubMed

Guo, Yong; Li, Yi; Xiang, Bing; Huang, Xiao-Ou; Ma, Hong-Bing; Wang, Fang-Fang; Gong, Yu-Ping

2017-12-06

Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph+ ALL) is triggered by BCR/ABL kinase. Recent efforts focused on the development of more potent tyrosine kinase inhibitors (TKIs) that also inhibit mutant tyrosine kinases such as nilotinib and dasatinib. Although major advances in the treatment of this aggressive disease with potent inhibitors of the BCR/ABL kinases, patients in remission frequently relapse due to drug resistance possibly mediated, at least in part, by compensatory activation of growth-signaling pathways and protective feedback signaling of leukemia cells in response to TKI treatment. Continuous activation of AKT/mTOR signaling and inactivation of p53 pathway were two mechanisms of TKI resistance. Here, we reported that nutlin-3 plus tanshinone IIA significantly potentiated the cytotoxic and apoptotic induction effects of imatinib by down-regulation of the AKT/mTOR pathway and reactivating the p53 pathway deeply in Ph+ ALL cell line. In primary samples from Ph+ ALL patients, nutlin-3 plus tanshinone IIA also exhibited synergetic cytotoxic effects with imatinib. Of note, three samples from Ph+ ALL patients harboring T315I mutation also showed sensitivity to the combined treatment of imatinib, nutlin-3 plus tanshinone IIA. In Ph+ ALL mouse models, imatinib combined with nutlin-3 plus tanshinone IIA also exhibited synergetic effects on reduction in leukemia burden. These results demonstrated that nutlin-3 plus tanshinone IIA combined TKI might be a promising treatment strategy for Ph+ ALL patients. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Drug resistance-related mutations T369V/I in the connection subdomain of HIV-1 reverse transcriptase severely impair viral fitness.

PubMed

Wang, Zheng; Zhang, Junli; Li, Fan; Ji, Xiaolin; Liao, Lingjie; Ma, Liying; Xing, Hui; Feng, Yi; Li, Dan; Shao, Yiming

2017-04-02

Fitness is a key parameter in the measurement of transmission capacity of individual drug-resistant HIV. Drug-resistance related mutations (DRMs) T369V/I and A371V in the connection subdomain (CN) of reverse transcriptase (RT) occur at higher frequencies in the individuals experiencing antiretroviral therapy failure. Here, we evaluated the effects of T369V/I and A371V on viral fitness, in the presence or in the absence of thymidine analogue resistance-associated mutations (TAMs) and assessed the effect of potential RT structure-related mechanism on change in viral fitness. Mutations T369V/I, A371V, alone or in combination with TAMs were introduced into a modified HIV-1 infectious clone AT1 by site-directed mutagenesis. Then, experiments on mutant and wild-type virus AT2 were performed separately using a growth-competition assay, and then the relative fitness was calculated. Structural analysis of RT was conducted using Pymol software. Results showed that T369V/I severely impaired the relative virus fitness, and A371V compensated for the viral fitness reduction caused by TAMs. Structural modeling of RT suggests that T369V/I substitutions disrupt powerful hydrogen bonds formed by T369 and V365 in p51 and p66. This study indicates that the secondary DRMs within CN might efficiently damage viral fitness, and provides valuable information for clinical surveillance and prevention of HIV-1 strains carrying these DRMs. Copyright © 2017 Elsevier B.V. All rights reserved.

Discovery of 4-Methyl-N-(4-((4-methylpiperazin-1-yl)methyl)-3-(trifluoromethyl)phenyl)-3-((1-nicotinoylpiperidin-4-yl)oxy)benzamide (CHMFL-ABL/KIT-155) as a Novel Highly Potent Type II ABL/KIT Dual Kinase Inhibitor with a Distinct Hinge Binding.

PubMed

Wang, Qiang; Liu, Feiyang; Wang, Beilei; Zou, Fengming; Qi, Ziping; Chen, Cheng; Yu, Kailin; Hu, Chen; Qi, Shuang; Wang, Wenchao; Hu, Zhenquan; Liu, Juan; Wang, Wei; Wang, Li; Liang, Qianmao; Zhang, Shanchun; Ren, Tao; Liu, Qingsong; Liu, Jing

2017-01-12

The discovery of a novel potent type II ABL/c-KIT dual kinase inhibitor compound 34 (CHMFL-ABL/KIT-155), which utilized a hydrogen bond formed by NH on the kinase backbone and carbonyl oxygen of 34 as a unique hinge binding, is described. 34 potently inhibited purified ABL (IC 50 : 46 nM) and c-KIT kinase (IC 50 : 75 nM) in the biochemical assays and displayed high selectivity (S Score (1) = 0.03) at the concentration of 1 μM among 468 kinases/mutants in KINOMEscan assay. It exhibited strong antiproliferative activities against BCR-ABL/c-KIT driven CML/GISTs cancer cell lines through blockage of the BCR-ABL/c-KIT mediated signaling pathways, arresting cell cycle progression and induction of apoptosis. 34 possessed a good oral PK property and effectively suppressed the tumor progression in the K562 (CML) and GIST-T1 (GISTs) cells mediated xenograft mouse model. The distinct hinge-binding mode of 34 provided a novel pharmacophore for expanding the chemical structure diversity for the type II kinase inhibitors discovery.

CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

PubMed

Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

2012-10-01

The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

Mucopolysaccharidosis type I in 21 Czech and Slovak patients: Mutation analysis suggests a functional importance of C-terminus of the IDUA protein

PubMed Central

Vazna, Alzbeta; Beesley, Clare; Berna, Linda; Stolnaja, Larisa; Myskova, Helena; Bouckova, Michaela; Vlaskova, Hana; Poupetova, Helena; Zeman, Jiri; Magner, Martin; Hlavata, Anna; Winchester, Bryan; Hrebicek, Martin; Dvorakova, Lenka

2009-01-01

Abstract Mucopolysaccharidosis type I (MPS I) is an autosomal recessive lysosomal storage disorder that is caused by a deficiency of the enzyme α-l-iduronidase (IDUA). Of the 21 Czech and Slovak patients who have been diagnosed with MPS I in the last 30 years, 16 have a severe clinical presentation (Hurler syndrome), 2 less severe manifestations (Scheie syndrome), and 3 an intermediate severity (Hurler/Scheie phenotype). Mutation analysis was performed in 20 MPS I patients and 39 mutant alleles were identified. There was a high prevalence of the null mutations p.W402X (12 alleles) and p.Q70X (7 alleles) in this cohort. Four of the 13 different mutations were novel: p.V620F (3 alleles), p.W626X (1 allele), c.1727 + 2T > G (1 allele) and c.1918_1927del (2 alleles). The pathogenicity of the novel mutations was verified by transient expression studies in Chinese hamster ovary cells. Seven haplotypes were observed in the patient alleles using 13 intragenic polymorphisms. One of the two haplotypes associated with the mutation p.Q70X was not found in any of the controls. Haplotype analysis showed, that mutations p.Q70X, p.V620F, and p.D315Y probably have more than one ancestor. Missense mutations localized predominantly in the hydrophobic core of the enzyme are associated with the severe phenotype, whereas missense mutations localized to the surface of the enzyme are usually associated with the attenuated phenotypes. Mutations in the 130 C-terminal amino acids lead to clinical manifestations, which indicates a functional importance of the C-terminus of the IDUA protein. © 2009 Wiley-Liss, Inc. PMID:19396826

Clinical Efficacy and Safety of First-Line Dasatinib Therapy and the Relevance of Velocity of BCR-ABL1 Transcript Decline for Achievement of Molecular Responses in Newly Diagnosed Chronic-Phase Chronic Myeloid Leukemia: Report from the Juntendo Yamanashi Cooperative Study Group.

PubMed

Takaku, Tomoiku; Iriyama, Noriyoshi; Mitsumori, Toru; Sato, Eriko; Gotoh, Akihiko; Kirito, Keita; Noguchi, Masaaki; Koike, Michiaki; Sakamoto, Junichi; Oba, Koji; Komatsu, Norio

2018-01-01

The use of tyrosine kinase inhibitors led to an improvement in the prognoses of patients with chronic myeloid leukemia (CML). The aims of this study were to investigate the efficacy and safety of dasatinib in Japanese patients and to explore the factors that affect the achievement of molecular responses. The primary endpoint was a major molecular response (MMR) by 12 months. The halving time for BCR-ABL1 transcripts was calculated using transcript levels. Thirty-two patients with chronic-phase CML (CML-CP) were enrolled and 30 received 100 mg dasatinib once daily. At 24 months of follow-up, 21 (72%) and 24 (83%) patients achieved an MMR by 12 and 24 months, respectively; the rates of a deep molecular response (DMR) by 12 and 24 months were 48 and 59%, respectively. A shorter halving time of BCR-ABL1 transcripts (≤10.6 days) accurately predicted both an MMR and a DMR. The incidence of pleural effusion was 50%. Our study reconfirmed the efficacy and safety of dasatinib treatment in Japanese patients with newly diagnosed CML-CP. In addition, the usefulness of the halving time of BCR-ABL1 transcripts was validated. These data emphasize the significance of an early treatment response in achieving a DMR during dasatinib therapy. © 2017 S. Karger AG, Basel.

SL-401 and SL-501, Targeted Therapeutics Directed at the Interleukin-3 Receptor, Inhibit the Growth of Leukaemic Cells and Stem Cells in Advanced Phase Chronic Myeloid Leukaemia

PubMed Central

Frolova, Olga; Benito, Juliana; Brooks, Chris; Wang, Rui-Yu; Korchin, Borys; Rowinsky, Eric K.; Cortes, Jorge; Kantarjian, Hagop; Andreeff, Michael; Frankel, Arthur E.; Konopleva, Marina

2014-01-01

SUMMARY While imatinib and other tyrosine kinase inhibitors (TKIs) are highly efficacious in the treatment of chronic myeloid leukaemia (CML), some patients become refractory to these therapies. After confirming that interleukin-3 receptor (IL3R, CD123) is highly expressed on CD34+/CD38− BCR-ABL1+ CML stem cells, we investigated whether targeting IL3R with diphtheria toxin (DT)-IL3 fusion proteins SL-401 (DT388-IL3) and SL-501 (DT388-IL3[K116W]) could eradicate these stem cells. SL-401 and SL-501 inhibited cell growth and induced apoptosis in the KBM5 cell line and its TKI-resistant KBM5-STI subline. Combinations of imatinib with these agents increased apoptosis in KBM5 and in primary CML cells. In six primary CML samples, including CML cells harbouring the ABL1 T315I mutation, SL-401 and SL-501 decreased the absolute numbers of viable CD34+/CD38−/CD123+ CML progenitor cells by inducing apoptosis. IL3-targeting agents reduced clonogenic growth and diminished the fraction of primitive long-term culture-initiating cells in samples from patients with advanced phase CML that were resistant to TKIs or harboured an ABL1 mutation. Survival was also extended in a mouse model of primary TKI-resistant CML blast crisis. These data suggest that the DT-IL3 fusion proteins, SL-401 and SL-501, deplete CML stem cells and may increase the effectiveness of current CML treatment, which principally targets tumour bulk. PMID:24942980

SL-401 and SL-501, targeted therapeutics directed at the interleukin-3 receptor, inhibit the growth of leukaemic cells and stem cells in advanced phase chronic myeloid leukaemia.

PubMed

Frolova, Olga; Benito, Juliana; Brooks, Chris; Wang, Rui-Yu; Korchin, Borys; Rowinsky, Eric K; Cortes, Jorge; Kantarjian, Hagop; Andreeff, Michael; Frankel, Arthur E; Konopleva, Marina

2014-09-01

While imatinib and other tyrosine kinase inhibitors (TKIs) are highly efficacious in the treatment of chronic myeloid leukaemia (CML), some patients become refractory to these therapies. After confirming that interleukin-3 receptor (IL3R, CD123) is highly expressed on CD34(+) /CD38(-) BCR-ABL1(+) CML stem cells, we investigated whether targeting IL3R with diphtheria toxin (DT)-IL3 fusion proteins SL-401 (DT388 -IL3) and SL-501 (DT388 -IL3[K116W]) could eradicate these stem cells. SL-401 and SL-501 inhibited cell growth and induced apoptosis in the KBM5 cell line and its TKI-resistant KBM5-STI subline. Combinations of imatinib with these agents increased apoptosis in KBM5 and in primary CML cells. In six primary CML samples, including CML cells harbouring the ABL1 T315I mutation, SL-401 and SL-501 decreased the absolute numbers of viable CD34(+) /CD38(-) /CD123(+) CML progenitor cells by inducing apoptosis. IL3-targeting agents reduced clonogenic growth and diminished the fraction of primitive long-term culture-initiating cells in samples from patients with advanced phase CML that were resistant to TKIs or harboured an ABL1 mutation. Survival was also extended in a mouse model of primary TKI-resistant CML blast crisis. These data suggest that the DT-IL3 fusion proteins, SL-401 and SL-501, deplete CML stem cells and may increase the effectiveness of current CML treatment, which principally targets tumour bulk. © 2014 John Wiley & Sons Ltd.

A large kindred with X-linked neutropenia with an I294T mutation of the Wiskott-Aldrich syndrome gene.

PubMed

Beel, Karolien; Cotter, Melanie M; Blatny, Jan; Bond, Jonathan; Lucas, Geoff; Green, Frances; Vanduppen, Vik; Leung, Daisy W; Rooney, Sean; Smith, Owen P; Rosen, Michael K; Vandenberghe, Peter

2009-01-01

X-linked neutropenia (XLN, OMIM #300299) is a rare form of severe congenital neutropenia. It was originally described in a three-generation family with five affected members that had an L270P mutation in the GTP-ase binding domain (GBD) of the Wiskott-Aldrich syndrome protein (WASP) [Devriendt et al (2001) Nature Genetics, Vol. 27, 313-317]. Here, we report and describe a large three-generation family with XLN, with 10 affected males and eight female carriers. A c.882T>C mutation was identified in the WAS gene, resulting in an I294T mutation. The infectious course is variable and mild in view of the profound neutropenia. In addition to the original description, low-normal IgA levels, low to low-normal platelet counts and reduced natural killer (NK)-cell counts also appear as consistent XLN features. However, inverted CD4/CD8 ratios were not found in this family, nor were cases identified with myelodysplastic syndrome or acute myeloid leukaemia. Female carriers exhibited a variable attenuated phenotype. Like L270P WASP, I294T WASP is constitutively active towards actin polymerization. In conclusion, this largest XLN kindred identified to date provides new independent genetic evidence that mutations disrupting the auto-inhibitory GBD of WASP are the cause of XLN. Reduced NK cells, low to low normal platelet counts and low to low-normal IgA levels are also features of XLN.

Rare recessive loss-of-function methionyl-tRNA synthetase mutations presenting as a multi-organ phenotype

PubMed Central

2013-01-01

Background Methionyl-tRNA synthetase (MARS) catalyzes the ligation of methionine to its cognate transfer RNA and therefore plays an essential role in protein biosynthesis. Methods We used exome sequencing, aminoacylation assays, homology modeling, and immuno-isolation of transfected MARS to identify and characterize mutations in the methionyl-tRNA synthetase gene (MARS) in an infant with an unexplained multi-organ phenotype. Results We identified compound heterozygous mutations (F370L and I523T) in highly conserved regions of MARS. The parents were each heterozygous for one of the mutations. Aminoacylation assays documented that the F370L and I523T MARS mutants had 18 ± 6% and 16 ± 6%, respectively, of wild-type activity. Homology modeling of the human MARS sequence with the structure of E. coli MARS showed that the F370L and I523T mutations are in close proximity to each other, with residue I523 located in the methionine binding pocket. We found that the F370L and I523T mutations did not affect the association of MARS with the multisynthetase complex. Conclusion This infant expands the catalogue of inherited human diseases caused by mutations in aminoacyl-tRNA synthetase genes. PMID:24103465

Prevalence of mutations in genes associated with isoniazid resistance Mycobacterium tuberculosis isolates from retreated smear positive pulmonary tuberculosis patients: A Meta-analysis.

PubMed

Alagappan, Chitra; Shivekar, Smita Sunil; Brammacharry, Usharani; Kapalamurthy, Vidya Raj Cuppusamy; Sakkaravarthy, Anbazhagi; Subashkumar, Rathinasamy; Muthaiah, Muthuraj

2018-03-28

The prevalence of isoniazid mono resistance is high in India. We investigated the molecular epidemiological characteristics association with the isoniazid resistance mutations in Mycobacterium tuberculosis in codon katG315 and in the promoter region of the inhA gene. Sputum specimens of smear-positive tuberculosis patients were subjected to Genotype MTBDRplus testing to identify katG and inhA mutations. Seventeen publications along with this current study assessed 14,100 genotypically resistant isolates for mutations in katG inclusive of codon position 315. In total, 1821 of 15438 isoniazid-resistant strains (11.8%) had detectable mutations: 71.0% in katG codon 315 (katG315) and 29.0% in the inhA promoter region. Economically active age group had 89.1%, paediatric age group had 0.4% and in the age group >60years had 10.5% isoniazid mono resistant and in males and females were 17.7% and 15.9% respectively. The meta-analysis derived a pooled katGS315T resistant TB prevalence of 64.5% (95% CI; 0.593±0.754%) with Q value 732.19, I2 98.35% and p-0.000 for treated TB cases. Isoniazid resistant was transferred widely and its prevalence and transmission of INH resistant isolates especially with katG315Thr mutation was confirmed. Therefore, it is important to diagnose the katG315Thr mutants among INH-resistant strains as it could be seen as a risk factor for subsequent development of MDR-TB. Prompt detection of the patients with INH resistant strains would expedite the modification of treatment regimens and appropriate infection control measures could be taken in time to diminish the risk of further development and transmission of MDR-TB. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

The oncolytic peptide LTX-315 triggers immunogenic cell death

PubMed Central

Zhou, H; Forveille, S; Sauvat, A; Yamazaki, T; Senovilla, L; Ma, Y; Liu, P; Yang, H; Bezu, L; Müller, K; Zitvogel, L; Rekdal, Ø; Kepp, O; Kroemer, G

2016-01-01

LTX-315 is a cationic amphilytic peptide that preferentially permeabilizes mitochondrial membranes, thereby causing partially BAX/BAK1-regulated, caspase-independent necrosis. Based on the observation that intratumorally injected LTX-315 stimulates a strong T lymphocyte-mediated anticancer immune response, we investigated whether LTX-315 may elicit the hallmarks of immunogenic cell death (ICD), namely (i) exposure of calreticulin on the plasma membrane surface, (ii) release of ATP into the extracellular space, (iii) exodus of HMGB1 from the nucleus, and (iv) induction of a type-1 interferon response. Using a panel of biosensor cell lines and robotized fluorescence microscopy coupled to automatic image analysis, we observed that LTX-315 induces all known ICD characteristics. This conclusion was validated by several independent methods including immunofluorescence stainings (for calreticulin), bioluminescence assays (for ATP), immunoassays (for HMGB1), and RT-PCRs (for type-1 interferon induction). When injected into established cancers, LTX-315 caused a transiently hemorrhagic focal necrosis that was accompanied by massive release of HMGB1 (from close-to-all cancer cells), as well as caspase-3 activation in a fraction of the cells. LTX-315 was at least as efficient as the positive control, the anthracycline mitoxantrone (MTX), in inducing local inflammation with infiltration by myeloid cells and T lymphocytes. Collectively, these results support the idea that LTX-315 can induce ICD, hence explaining its capacity to mediate immune-dependent therapeutic effects. PMID:26962684

The oncolytic peptide LTX-315 triggers immunogenic cell death.

PubMed

Zhou, H; Forveille, S; Sauvat, A; Yamazaki, T; Senovilla, L; Ma, Y; Liu, P; Yang, H; Bezu, L; Müller, K; Zitvogel, L; Rekdal, Ø; Kepp, O; Kroemer, G

2016-03-10

LTX-315 is a cationic amphilytic peptide that preferentially permeabilizes mitochondrial membranes, thereby causing partially BAX/BAK1-regulated, caspase-independent necrosis. Based on the observation that intratumorally injected LTX-315 stimulates a strong T lymphocyte-mediated anticancer immune response, we investigated whether LTX-315 may elicit the hallmarks of immunogenic cell death (ICD), namely (i) exposure of calreticulin on the plasma membrane surface, (ii) release of ATP into the extracellular space, (iii) exodus of HMGB1 from the nucleus, and (iv) induction of a type-1 interferon response. Using a panel of biosensor cell lines and robotized fluorescence microscopy coupled to automatic image analysis, we observed that LTX-315 induces all known ICD characteristics. This conclusion was validated by several independent methods including immunofluorescence stainings (for calreticulin), bioluminescence assays (for ATP), immunoassays (for HMGB1), and RT-PCRs (for type-1 interferon induction). When injected into established cancers, LTX-315 caused a transiently hemorrhagic focal necrosis that was accompanied by massive release of HMGB1 (from close-to-all cancer cells), as well as caspase-3 activation in a fraction of the cells. LTX-315 was at least as efficient as the positive control, the anthracycline mitoxantrone (MTX), in inducing local inflammation with infiltration by myeloid cells and T lymphocytes. Collectively, these results support the idea that LTX-315 can induce ICD, hence explaining its capacity to mediate immune-dependent therapeutic effects.

iMARS--mutation analysis reporting software: an analysis of spontaneous cII mutation spectra.

PubMed

Morgan, Claire; Lewis, Paul D

2006-01-31

The sensitivity of any mutational assay is determined by the level at which spontaneous mutations occur in the corresponding untreated controls. Establishing the type and frequency at which mutations occur naturally within a test system is essential if one is to draw scientifically sound conclusions regarding chemically induced mutations. Currently, mutation-spectra analysis is laborious and time-consuming. Thus, we have developed iMARS, a comprehensive mutation-spectrum analysis package that utilises routinely used methodologies and visualisation tools. To demonstrate the use and capabilities of iMARS, we have analysed the distribution, types and sequence context of spontaneous base substitutions derived from the cII gene mutation assay in transgenic animals. Analysis of spontaneous mutation spectra revealed variation both within and between the transgenic rodent test systems Big Blue Mouse, MutaMouse and Big Blue Rat. The most common spontaneous base substitutions were G:C-->A:T transitions and G:C-->T:A transversions. All Big Blue Mouse spectra were significantly different from each other by distribution and nearly all by mutation type, whereas the converse was true for the other test systems. Twenty-eight mutation hotspots were observed across all spectra generally occurring in CG, GA/TC, GG and GC dinucleotides. A mutation hotspot at nucleotide 212 occurred at a higher frequency in MutaMouse and Big Blue Rat. In addition, CG dinucleotides were the most mutable in all spectra except two Big Blue Mouse spectra. Thus, spontaneous base-substitution spectra showed more variation in distribution, type and sequence context in Big Blue Mouse relative to spectra derived from MutaMouse and Big Blue Rat. The results of our analysis provide a baseline reference for mutation studies utilising the cII gene in transgenic rodent models. The potential differences in spontaneous base-substitution spectra should be considered when making comparisons between these test systems

HO-1 induction in motor cortex and intestinal dysfunction in TDP-43 A315T transgenic mice.

PubMed

Guo, Yansu; Wang, Qian; Zhang, Kunxi; An, Ting; Shi, Pengxiao; Li, Zhongyao; Duan, Weisong; Li, Chunyan

2012-06-15

TAR DNA-binding protein 43 (TDP-43) has been found to be related to the pathogenesis of amyotrophic lateral sclerosis (ALS). TDP-43 A315T transgenic mice develop degeneration of specific motor neurons, and accumulation of ubiquitinated proteins has been observed in the pyramidal cells of motor cortex of these mice. In this study, we found stress-responsive HO-1 induction and no autophagic alteration in motor cortex of TDP-43 A315T transgenic mice. Glial activation, especially astrocytic proliferation, occurred in cortical layer 5 and sub-meningeal region. Interestingly, we noticed that progressively thinned colon, swollen small intestine and reduced food intake, rather than severe muscle weakness, contributed to the death of TDP-43 A315T transgenic mice. Increased TDP-43 accumulation in the myenteric nerve plexus and increased thickness of muscular layer of colon were related to the intestinal dysfunction. Copyright © 2012 Elsevier B.V. All rights reserved.

Bosutinib: a review of its use in patients with Philadelphia chromosome-positive chronic myelogenous leukemia.

PubMed

Syed, Yahiya Y; McCormack, Paul L; Plosker, Greg L

2014-02-01

Bosutinib (Bosulif®) is an orally administered small molecule tyrosine kinase inhibitor (TKI) of BCR-ABL and SRC family kinases. It is indicated for the treatment of adult patients with chronic-, accelerated-, or blast-phase Philadelphia chromosome-positive (Ph+) chronic myelogenous leukemia (CML) with resistance or intolerance to prior therapy (imatinib, dasatinib, or nilotinib) [USA] or for a small subpopulation of these patients for whom imatinib, nilotinib, and dasatinib are not considered appropriate treatment options (EU). In a multinational pivotal trial (n = 547), bosutinib treatment resulted in a major cytogenetic response (MCyR) at 24 weeks in one-third of all treated patients with imatinib-resistant chronic-phase CML who had no previous exposure to any TKIs other than imatinib (primary endpoint), with similar results observed in chronic-phase CML patients who were intolerant of imatinib and naïve to all other TKIs. MCyRs were also seen in more than one-quarter of evaluable patients with chronic-phase CML previously treated with multiple TKIs. Most of the patients with chronic-phase CML achieved a complete hematologic response with bosutinib and some patients with advanced phases of CML achieved an overall hematologic response. Responses were seen irrespective of the type of BCR-ABL mutation at baseline, except T315I. Bosutinib had a manageable tolerability profile in the pivotal trial, with ≤21 % of patients with chronic-phase CML discontinuing the treatment because of adverse events. Diarrhea was the most common adverse event but was generally manageable, with only few patients discontinuing the treatment because of diarrhea. Therefore, bosutinib is a useful TKI option for patients with Ph+ CML in second-line or greater settings.

31 CFR 19.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false May I use the services of an excluded person as a principal under a covered transaction? 19.315 Section 19.315 Money and Finance: Treasury...) Responsibilities of Participants Regarding Transactions Doing Business with Other Persons § 19.315 May I use the...

31 CFR 19.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2013 CFR

2013-07-01

... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false May I use the services of an excluded person as a principal under a covered transaction? 19.315 Section 19.315 Money and Finance: Treasury...) Responsibilities of Participants Regarding Transactions Doing Business with Other Persons § 19.315 May I use the...

31 CFR 19.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false May I use the services of an excluded person as a principal under a covered transaction? 19.315 Section 19.315 Money and Finance: Treasury...) Responsibilities of Participants Regarding Transactions Doing Business with Other Persons § 19.315 May I use the...

31 CFR 19.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2014 CFR

2014-07-01

... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false May I use the services of an excluded person as a principal under a covered transaction? 19.315 Section 19.315 Money and Finance: Treasury...) Responsibilities of Participants Regarding Transactions Doing Business with Other Persons § 19.315 May I use the...

31 CFR 19.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false May I use the services of an excluded person as a principal under a covered transaction? 19.315 Section 19.315 Money and Finance: Treasury...) Responsibilities of Participants Regarding Transactions Doing Business with Other Persons § 19.315 May I use the...

Clinical response of the novel activating ALK-I1171T mutation in neuroblastoma to the ALK inhibitor ceritinib.

PubMed

Guan, Jikui; Fransson, Susanne; Siaw, Joachim Tetteh T; Treis, Diana; Van den Eynden, Jimmy; Chand, Damini; Umapathy, Ganesh; Svenberg, Petter; Ruuth, Kristina; Wessman, Sandra; Shamikh, Alia; Jacobsson, Hans; Gordon, Lena; Stenman, Jakob; Larsson, Erik; Svensson, Par-Johan; Hansson, Magnus; Martinsson, Tommy; Kogner, Per; Palmer, Ruth H; Hallberg, Bengt

2018-06-15

Tumors with Anaplastic Lymphoma Kinase (ALK) fusion rearrangements, including non-small cell lung cancer and anaplastic large cell lymphoma, are highly sensitive to ALK tyrosine kinase inhibitors (TKIs), underscoring the notion that such cancers are addicted to ALK activity. While mutations in ALK are heavily implicated in childhood neuroblastoma, response to the ALK TKI crizotinib has been disappointing. Embryonal tumors in patients with DNA repair defects such as Fanconi anemia (FA) often have a poor prognosis, due to lack of therapeutic options. Here we report a child with underlying FA and ALK mutant high-risk neuroblastoma responding strongly to precision therapy with the ALK TKI ceritinib. Conventional chemotherapy treatment caused severe, life-threatening toxicity. Genomic analysis of the initial biopsy identified germ-line FANCA mutations as well as a novel ALK-I1171T variant. ALK-I1171T generates a potent gain-of-function mutant, as measured in PC12 cell neurite outgrowth and NIH3T3 transformation. Pharmacological inhibition profiling of ALK-I1171T in response to various ALK TKIs identified an 11-fold improved inhibition of ALK-I1171T with ceritinib when compared with crizotinib. Immunoaffinity-coupled LC-MS/MS phosphoproteomics analysis indicated a decrease in ALK signaling in response to ceritinib. Ceritinib was therefore selected for treatment in this child. Mono-therapy with ceritinib was well tolerated and resulted in normalized catecholamine markers and tumor shrinkage. After 7.5 months treatment, residual primary tumor was surgically removed and exhibited hallmarks of differentiation together with reduced Ki67 levels. Clinical follow-up after 21 months treatment revealed complete clinical remission including all metastatic sites. Therefore, ceritinib presents a viable therapeutic option for ALK-positive neuroblastoma. Cold Spring Harbor Laboratory Press.

Contribution of JAK2 mutations to T-cell lymphoblastic lymphoma development.

PubMed

Roncero, A M; López-Nieva, P; Cobos-Fernández, M A; Villa-Morales, M; González-Sánchez, L; López-Lorenzo, J L; Llamas, P; Ayuso, C; Rodríguez-Pinilla, S M; Arriba, M C; Piris, M A; Fernández-Navarro, P; Fernández, A F; Fraga, M F; Santos, J; Fernández-Piqueras, J

2016-01-01

The JAK-STAT pathway has a substantial role in lymphoid precursor cell proliferation, survival and differentiation. Nonetheless, the contribution of JAK2 to T-cell lymphoblastic lymphoma (T-LBL) development remains poorly understood. We have identified one activating TEL-JAK2 translocation and four missense mutations accumulated in 2 out of 16 T-LBL samples. Two of them are novel JAK2 mutations and the other two are reported for the first time in T-LBL. Notably, R683G and I682T might have arisen owing to RNA editing. Mutated samples showed different mutated transcripts suggesting sub-clonal heterogeneity. Functional approaches revealed that two JAK2 mutations (H574R and R683G) constitutively activate JAK-STAT signaling in γ2A cells and can drive the proliferation of BaF3-EpoR cytokine-dependent cell line. In addition, aberrant hypermethylation of SOCS3 might contribute to enhance the activation of JAK-STAT signaling. Of utmost interest is that primary T-LBL samples harboring JAK2 mutations exhibited increased expression of LMO2, suggesting a mechanistic link between JAK2 mutations and the expression of LMO2, which was confirmed for the four missense mutations in transfected γ2A cells. We therefore propose that active JAK2 contribute to T-LBL development by two different mechanisms, and that the use of pan-JAK inhibitors in combination with epigenetic drugs should be considered in future treatments.

Contribution of JAK2 mutations to T-cell lymphoblastic lymphoma development

PubMed Central

Roncero, A M; López-Nieva, P; Cobos-Fernández, M A; Villa-Morales, M; González-Sánchez, L; López-Lorenzo, J L; Llamas, P; Ayuso, C; Rodríguez-Pinilla, S M; Arriba, M C; Piris, M A; Fernández-Navarro, P; Fernández, A F; Fraga, M F; Santos, J; Fernández-Piqueras, J

2016-01-01

The JAK-STAT pathway has a substantial role in lymphoid precursor cell proliferation, survival and differentiation. Nonetheless, the contribution of JAK2 to T-cell lymphoblastic lymphoma (T-LBL) development remains poorly understood. We have identified one activating TEL-JAK2 translocation and four missense mutations accumulated in 2 out of 16 T-LBL samples. Two of them are novel JAK2 mutations and the other two are reported for the first time in T-LBL. Notably, R683G and I682T might have arisen owing to RNA editing. Mutated samples showed different mutated transcripts suggesting sub-clonal heterogeneity. Functional approaches revealed that two JAK2 mutations (H574R and R683G) constitutively activate JAK-STAT signaling in γ2A cells and can drive the proliferation of BaF3-EpoR cytokine-dependent cell line. In addition, aberrant hypermethylation of SOCS3 might contribute to enhance the activation of JAK-STAT signaling. Of utmost interest is that primary T-LBL samples harboring JAK2 mutations exhibited increased expression of LMO2, suggesting a mechanistic link between JAK2 mutations and the expression of LMO2, which was confirmed for the four missense mutations in transfected γ2A cells. We therefore propose that active JAK2 contribute to T-LBL development by two different mechanisms, and that the use of pan-JAK inhibitors in combination with epigenetic drugs should be considered in future treatments. PMID:26216197

Diagnosis and classification of hematologic malignancies on the basis of genetics

PubMed Central

2017-01-01

Genomic analysis has greatly influenced the diagnosis and clinical management of patients affected by diverse forms of hematologic malignancies. Here, we review how genetic alterations define subclasses of patients with acute leukemias, myelodysplastic syndromes (MDS), myeloproliferative neoplasms (MPNs), non-Hodgkin lymphomas, and classical Hodgkin lymphoma. These include new subtypes of acute myeloid leukemia defined by mutations in RUNX1 or BCR-ABL1 translocations as well as a constellation of somatic structural DNA alterations in acute lymphoblastic leukemia. Among patients with MDS, detection of mutations in SF3B1 define a subgroup of patients with the ring sideroblast form of MDS and a favorable prognosis. For patients with MPNs, detection of the BCR-ABL1 fusion delineates chronic myeloid leukemia from classic BCR-ABL1− MPNs, which are largely defined by mutations in JAK2, CALR, or MPL. In the B-cell lymphomas, detection of characteristic rearrangements involving MYC in Burkitt lymphoma, BCL2 in follicular lymphoma, and MYC/BCL2/BCL6 in high-grade B-cell lymphomas are essential for diagnosis. In T-cell lymphomas, anaplastic large-cell lymphoma is defined by mutually exclusive rearrangements of ALK, DUSP22/IRF4, and TP63. Genetic alterations affecting TP53 and the mutational status of the immunoglobulin heavy-chain variable region are important in clinical management of chronic lymphocytic leukemia. Additionally, detection of BRAFV600E mutations is helpful in the diagnosis of classical hairy cell leukemia and a number of histiocytic neoplasms. Numerous additional examples provided here demonstrate how clinical evaluation of genomic alterations have refined classification of myeloid neoplasms and major forms of lymphomas arising from B, T, or natural killer cells. PMID:28600336

JAK and MPL mutations in myeloid malignancies.

PubMed

Tefferi, Ayalew

2008-03-01

The Janus family of non-receptor tyrosine kinases (JAK1, JAK2, JAK3 and tyrosine kinase 2) transduces signals downstream of type I and II cytokine receptors via signal transducers and activators of transcription (STATs). JAK3 is important in lymphoid and JAK2 in myeloid cell proliferation and differentiation. The thrombopoietin receptor MPL is one of several JAK2 cognate receptors and is essential for myelopoiesis in general and megakaryopoiesis in particular. Germline loss-of-function (LOF) JAK3 and MPL mutations cause severe combined immunodeficiency and congenital amegakaryocytic thrombocytopenia, respectively. Germline gain-of-function (GOF) MPL mutation (MPLS505N) causes familial thrombocytosis. Somatic JAK3 (e.g. JAK3A572V, JAK3V722I, JAK3P132T) and fusion JAK2 (e.g. ETV6-JAK2, PCM1-JAK2, BCR-JAK2) mutations have respectively been described in acute megakaryocytic leukemia and acute leukemia/chronic myeloid malignancies. However, current attention is focused on JAK2 (e.g. JAK2V617F, JAK2 exon 12 mutations) and MPL (e.g. MPLW515L/K/S, MPLS505N) mutations associated with myeloproliferative neoplasms (MPNs). A JAK2 mutation, primarily JAK2V617F, is invariably associated with polycythemia vera (PV). The latter mutation also occurs in the majority of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF). MPL mutational frequency in MPNs is substantially less (<10%). In general, despite a certain degree of genotype - phenotype correlations, the prognostic relevance of harbouring one of these mutations, or their allele burden when present, remains dubious. Regardless, based on the logical assumption that amplified JAK-STAT signalling is central to the pathogenesis of PV, ET and PMF, several anti-JAK2 tyrosine kinase inhibitors have been developed and are currently being tested in humans with these disorders.

Analysis of patients with atypical hemolytic uremic syndrome treated at the Mie University Hospital: concentration of C3 p.I1157T mutation.

PubMed

Matsumoto, Takeshi; Fan, Xinping; Ishikawa, Eiji; Ito, Masaaki; Amano, Keishirou; Toyoda, Hidemi; Komada, Yoshihiro; Ohishi, Kohshi; Katayama, Naoyuki; Yoshida, Yoko; Matsumoto, Masanori; Fujimura, Yoshihiro; Ikejiri, Makoto; Wada, Hideo; Miyata, Toshiyuki

2014-11-01

Atypical hemolytic uremic syndrome (aHUS) is caused by abnormalities of the complement system and has a significantly poor prognosis. The clinical phenotypes of 12 patients in nine families with aHUS with familial or recurrent onset and ADAMTS13 activity of ≥20 % treated at the Mie University Hospital were examined. In seven of the patients, the first episode of aHUS occurred during childhood and ten patients experienced a relapse. All patients had renal dysfunction and three had been treated with hemodialysis. Seven patients experienced probable triggering events including common cold, influenza, bacterial infection and/or vaccination for influenza. All patients had entered remission, and renal function was improved in 11 patients. DNA sequencing of six candidate genes, identified a C3 p.I1157T missense mutation in all eight patients in six families examined and this mutation was causative for aHUS. A causative mutation THBD p.D486Y was also identified in an aHUS patient. Four missense mutations, CFH p.V837I, p.Y1058H, p.V1060L and THBD p.R403K may predispose to aHUS manifestation; the remaining seven missense mutations were likely neutral. In conclusion, the clinical phenotypes of aHUS are various, and there are often trigger factors. The C3 p.I1157T mutation was identified as the causative mutation for aHUS in all patients examined, and may be geographically concentrated in or around the Mie prefecture in central Japan.

Somatic hypermutation of T cell receptor α chain contributes to selection in nurse shark thymus.

PubMed

Ott, Jeannine A; Castro, Caitlin D; Deiss, Thaddeus C; Ohta, Yuko; Flajnik, Martin F; Criscitiello, Michael F

2018-04-17

Since the discovery of the T cell receptor (TcR), immunologists have assigned somatic hypermutation (SHM) as a mechanism employed solely by B cells to diversify their antigen receptors. Remarkably, we found SHM acting in the thymus on α chain locus of shark TcR. SHM in developing shark T cells likely is catalyzed by activation-induced cytidine deaminase (AID) and results in both point and tandem mutations that accumulate non-conservative amino acid replacements within complementarity-determining regions (CDRs). Mutation frequency at TcRα was as high as that seen at B cell receptor loci (BcR) in sharks and mammals, and the mechanism of SHM shares unique characteristics first detected at shark BcR loci. Additionally, fluorescence in situ hybridization showed the strongest AID expression in thymic corticomedullary junction and medulla. We suggest that TcRα utilizes SHM to broaden diversification of the primary αβ T cell repertoire in sharks, the first reported use in vertebrates. © 2018, Ott et al.

Somatic hypermutation of T cell receptor α chain contributes to selection in nurse shark thymus

PubMed Central

Ott, Jeannine A; Castro, Caitlin D; Deiss, Thaddeus C; Ohta, Yuko; Flajnik, Martin F

2018-01-01

Since the discovery of the T cell receptor (TcR), immunologists have assigned somatic hypermutation (SHM) as a mechanism employed solely by B cells to diversify their antigen receptors. Remarkably, we found SHM acting in the thymus on α chain locus of shark TcR. SHM in developing shark T cells likely is catalyzed by activation-induced cytidine deaminase (AID) and results in both point and tandem mutations that accumulate non-conservative amino acid replacements within complementarity-determining regions (CDRs). Mutation frequency at TcRα was as high as that seen at B cell receptor loci (BcR) in sharks and mammals, and the mechanism of SHM shares unique characteristics first detected at shark BcR loci. Additionally, fluorescence in situ hybridization showed the strongest AID expression in thymic corticomedullary junction and medulla. We suggest that TcRα utilizes SHM to broaden diversification of the primary αβ T cell repertoire in sharks, the first reported use in vertebrates. PMID:29664399

Mutations in glycyl-tRNA synthetase impair mitochondrial metabolism in neurons.

PubMed

Boczonadi, Veronika; Meyer, Kathrin; Gonczarowska-Jorge, Humberto; Griffin, Helen; Roos, Andreas; Bartsakoulia, Marina; Bansagi, Boglarka; Ricci, Giulia; Palinkas, Fanni; Zahedi, René P; Bruni, Francesco; Kaspar, Brian; Lochmüller, Hanns; Boycott, Kym M; Müller, Juliane S; Horvath, Rita

2018-06-15

The nuclear-encoded glycyl-tRNA synthetase gene (GARS) is essential for protein translation in both cytoplasm and mitochondria. In contrast, different genes encode the mitochondrial and cytosolic forms of most other tRNA synthetases. Dominant GARS mutations were described in inherited neuropathies, while recessive mutations cause severe childhood-onset disorders affecting skeletal muscle and heart. The downstream events explaining tissue-specific phenotype-genotype relations remained unclear. We investigated the mitochondrial function of GARS in human cell lines and in the GarsC210R mouse model. Human-induced neuronal progenitor cells (iNPCs) carrying dominant and recessive GARS mutations showed alterations of mitochondrial proteins, which were more prominent in iNPCs with dominant, neuropathy-causing mutations. Although comparative proteomic analysis of iNPCs showed significant changes in mitochondrial respiratory chain complex subunits, assembly genes, Krebs cycle enzymes and transport proteins in both recessive and dominant mutations, proteins involved in fatty acid oxidation were only altered by recessive mutations causing mitochondrial cardiomyopathy. In contrast, significant alterations of the vesicle-associated membrane protein-associated protein B (VAPB) and its downstream pathways such as mitochondrial calcium uptake and autophagy were detected in dominant GARS mutations. The role of VAPB has been supported by similar results in the GarsC210R mice. Our data suggest that altered mitochondria-associated endoplasmic reticulum (ER) membranes (MAM) may be important disease mechanisms leading to neuropathy in this condition.

Switching to second-generation tyrosine kinase inhibitor improves the response and outcome of frontline imatinib-treated patients with chronic myeloid leukemia with more than 10% of BCR-ABL/ABL ratio at 3 months

PubMed Central

Casado, Luis-Felipe; García-Gutiérrez, José-Valentín; Massagué, Isabel; Giraldo, Pilar; Pérez-Encinas, Manuel; de Paz, Raquel; Martínez-López, Joaquín; Bautista, Guiomar; Osorio, Santiago; Requena, María-José; Palomera, Luis; Peñarrubia, María-Jesús; Calle, Carmen; Hernández-Rivas, José-Ángel; Burgaleta, Carmen; Maestro, Begoña; García-Ormeña, Nuria; Steegmann, Juan-Luis

2015-01-01

Chronic myeloid leukemia patients display heterogeneous responses to imatinib. Survival depends on baseline clinical characteristics (including prognostic scoring systems) and on early response (such as >10% BCR-ABL/ABL ratio at 3 months of therapy). The results of switching to second-generation tyrosine kinase inhibitors (2GTKIs) may contain a bias since, in the majority of these studies, patients who switch treatment due to intolerance or failure are censored or excluded. We analyzed the Spanish Registry data on switching in an intention-to-treat analysis of patients in standard clinical practice. Switching to 2GTKIs improves responses from 45% to 75% of complete cytogenetic response (CCyR) and from 15% to 45% of major molecular response (MMR) in the group without molecular response 1 (MR1) at 3 months and from 70% to 87% in CCyR and from 52% to 87% in MMR in the group with MR1. The final response rate is poorer in the group with no MR1 at 3 months. Nevertheless, the differences in the rates of response were not translated into differences in major events (transformations or deaths), and the final progression-free survival and overall survival were similar. PMID:25756742

Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Fuxin; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

2009-11-20

We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visualmore » impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.« less

Cardiac muscle activation blunted by a mutation to the regulatory component, troponin T.

PubMed

Kobayashi, Minae; Debold, Edward P; Turner, Matthew A; Kobayashi, Tomoyoshi

2013-09-06

The striated muscle thin filament comprises actin, tropomyosin, and troponin. The Tn complex consists of three subunits, troponin C (TnC), troponin I (TnI), and troponin T (TnT). TnT may serve as a bridge between the Ca(2+) sensor (TnC) and the actin filament. In the short helix preceding the IT-arm region, H1(T2), there are known dilated cardiomyopathy-linked mutations (among them R205L). Thus we hypothesized that there is an element in this short helix that plays an important role in regulating the muscle contraction, especially in Ca(2+) activation. We mutated Arg-205 and several other amino acid residues within and near the H1(T2) helix. Utilizing an alanine replacement method to compare the effects of the mutations, the biochemical and mechanical impact on the actomyosin interaction was assessed by solution ATPase activity assay, an in vitro motility assay, and Ca(2+) binding measurements. Ca(2+) activation was markedly impaired by a point mutation of the highly conserved basic residue R205A, residing in the short helix H1(T2) of cTnT, whereas the mutations to nearby residues exhibited little effect on function. Interestingly, rigor activation was unchanged between the wild type and R205A TnT. In addition to the reduction in Ca(2+) sensitivity observed in Ca(2+) binding to the thin filament, myosin S1-ADP binding to the thin filament was significantly affected by the same mutation, which was also supported by a series of S1 concentration-dependent ATPase assays. These suggest that the R205A mutation alters function through reduction in the nature of cooperative binding of S1.

A high-fat jelly diet restores bioenergetic balance and extends lifespan in the presence of motor dysfunction and lumbar spinal cord motor neuron loss in TDP-43A315T mutant C57BL6/J mice

PubMed Central

Coughlan, Karen S.; Halang, Luise; Woods, Ina

2016-01-01

ABSTRACT Transgenic transactivation response DNA-binding protein 43 (TDP-43) mice expressing the A315T mutation under control of the murine prion promoter progressively develop motor function deficits and are considered a new model for the study of amyotrophic lateral sclerosis (ALS); however, premature sudden death resulting from intestinal obstruction halts disease phenotype progression in 100% of C57BL6/J congenic TDP-43A315T mice. Similar to our recent results in SOD1G93A mice, TDP-43A315T mice fed a standard pellet diet showed increased 5′ adenosine monophosphate-activated protein kinase (AMPK) activation at postnatal day (P)80, indicating elevated energetic stress during disease progression. We therefore investigated the effects of a high-fat jelly diet on bioenergetic status and lifespan in TDP-43A315T mice. In contrast to standard pellet-fed mice, mice fed high-fat jelly showed no difference in AMPK activation up to P120 and decreased phosphorylation of acetly-CoA carboxylase (ACC) at early-stage time points. Exposure to a high-fat jelly diet prevented sudden death and extended survival, allowing development of a motor neuron disease phenotype with significantly decreased body weight from P80 onward that was characterised by deficits in Rotarod abilities and stride length measurements. Development of this phenotype was associated with a significant motor neuron loss as assessed by Nissl staining in the lumbar spinal cord. Our work suggests that a high-fat jelly diet improves the pre-clinical utility of the TDP-43A315T model by extending lifespan and allowing the motor neuron disease phenotype to progress, and indicates the potential benefit of this diet in TDP-43-associated ALS. PMID:27491077

A high-fat jelly diet restores bioenergetic balance and extends lifespan in the presence of motor dysfunction and lumbar spinal cord motor neuron loss in TDP-43A315T mutant C57BL6/J mice.

PubMed

Coughlan, Karen S; Halang, Luise; Woods, Ina; Prehn, Jochen H M

2016-09-01

Transgenic transactivation response DNA-binding protein 43 (TDP-43) mice expressing the A315T mutation under control of the murine prion promoter progressively develop motor function deficits and are considered a new model for the study of amyotrophic lateral sclerosis (ALS); however, premature sudden death resulting from intestinal obstruction halts disease phenotype progression in 100% of C57BL6/J congenic TDP-43(A315T) mice. Similar to our recent results in SOD1(G93A) mice, TDP-43(A315T) mice fed a standard pellet diet showed increased 5' adenosine monophosphate-activated protein kinase (AMPK) activation at postnatal day (P)80, indicating elevated energetic stress during disease progression. We therefore investigated the effects of a high-fat jelly diet on bioenergetic status and lifespan in TDP-43(A315T) mice. In contrast to standard pellet-fed mice, mice fed high-fat jelly showed no difference in AMPK activation up to P120 and decreased phosphorylation of acetly-CoA carboxylase (ACC) at early-stage time points. Exposure to a high-fat jelly diet prevented sudden death and extended survival, allowing development of a motor neuron disease phenotype with significantly decreased body weight from P80 onward that was characterised by deficits in Rotarod abilities and stride length measurements. Development of this phenotype was associated with a significant motor neuron loss as assessed by Nissl staining in the lumbar spinal cord. Our work suggests that a high-fat jelly diet improves the pre-clinical utility of the TDP-43(A315T) model by extending lifespan and allowing the motor neuron disease phenotype to progress, and indicates the potential benefit of this diet in TDP-43-associated ALS. © 2016. Published by The Company of Biologists Ltd.

5 CFR 919.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2010 CFR

2010-01-01

... person as a principal under a covered transaction? 919.315 Section 919.315 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE REGULATIONS (CONTINUED) GOVERNMENTWIDE DEBARMENT... with Other Persons § 919.315 May I use the services of an excluded person as a principal under a...

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Primary hyperoxaluria type 1 in the Canary Islands: a conformational disease due to I244T mutation in the P11L-containing alanine:glyoxylate aminotransferase.

PubMed

Santana, A; Salido, E; Torres, A; Shapiro, L J

2003-06-10

Primary hyperoxaluria type 1 (PH1) is an inborn error of metabolism resulting from a deficiency of alanine:glyoxylate aminotransferase (AGXT; EC 2.6.1.44). Most of the PH1 alleles detected in the Canary Islands carry the Ile-244 --> Thr (I244T) mutation in the AGXT gene, with 14 of 16 patients homozygous for this mutation. Four polymorphisms within AGXT and regional microsatellites also were shared in their haplotypes (AGXT*LTM), consistent with a founder effect. The consequences of these amino acid changes were investigated. Although I244T alone did not affect AGXT activity or subcellular localization, when present in the same protein molecule as Leu-11 --> Pro (L11P), it resulted in loss of enzymatic activity in soluble cell extracts. Like its normal counterpart, the AGXT*LTM protein was present in the peroxisomes but it was insoluble in detergent-free buffers. The polymorphism L11P behaved as an intragenic modifier of the I244T mutation, with the resulting protein undergoing stable interaction with molecular chaperones and aggregation. This aggregation was temperature-sensitive. AGXT*LTM expressed in Escherichia coli, as a GST-fusion protein, and in insect cells could be purified and retained enzymatic activity. Among various chemical chaperones tested in cell culture, betaine substantially improved the solubility of the mutant protein and the enzymatic activity in cell lysates. In summary, I244T, the second most common mutation responsible for PH1, is a protein conformational disease that may benefit from new therapies with pharmacological chaperones or small molecules to minimize protein aggregation.

A longitudinal evaluation of performance of automated BCR-ABL1 quantitation using cartridge-based detection system.

PubMed

Enjeti, Anoop; Granter, Neil; Ashraf, Asma; Fletcher, Linda; Branford, Susan; Rowlings, Philip; Dooley, Susan

2015-10-01

An automated cartridge-based detection system (GeneXpert; Cepheid) is being widely adopted in low throughput laboratories for monitoring BCR-ABL1 transcript in chronic myelogenous leukaemia. This Australian study evaluated the longitudinal performance specific characteristics of the automated system.The automated cartridge-based system was compared prospectively with the manual qRT-PCR-based reference method at SA Pathology, Adelaide, over a period of 2.5 years. A conversion factor determination was followed by four re-validations. Peripheral blood samples (n = 129) with international scale (IS) values within detectable range were selected for assessment. The mean bias, proportion of results within specified fold difference (2-, 3- and 5-fold), the concordance rate of major molecular remission (MMR) and concordance across a range of IS values on paired samples were evaluated.The initial conversion factor for the automated system was determined as 0.43. Except for the second re-validation, where a negative bias of 1.9-fold was detected, all other biases fell within desirable limits. A cartridge-specific conversion factor and efficiency value was introduced and the conversion factor was confirmed to be stable in subsequent re-validation cycles. Concordance with the reference method/laboratory at >0.1-≤10 IS was 78.2% and at ≤0.001 was 80%, compared to 86.8% in the >0.01-≤0.1 IS range. The overall and MMR concordance were 85.7% and 94% respectively, for samples that fell within ± 5-fold of the reference laboratory value over the entire period of study.Conversion factor and performance specific characteristics for the automated system were longitudinally stable in the clinically relevant range, following introduction by the manufacturer of lot specific efficiency values.

Quantitative Proteomics of Human Fibroblasts with I1061T Mutation in Niemann–Pick C1 (NPC1) Protein Provides Insights into the Disease Pathogenesis*

PubMed Central

Rauniyar, Navin; Subramanian, Kanagaraj; Lavallée-Adam, Mathieu; Martínez-Bartolomé, Salvador; Balch, William E.; Yates, John R.

2015-01-01

Niemann-Pick type C (NPC) disease is a fatal neurodegenerative disorder characterized by the accumulation of unesterified cholesterol in the late endosomal/lysosomal compartments. Mutations in the NPC1 protein are implicated in 95% of patients with NPC disease. The most prevalent mutation is the missense mutation I1061T that occurs in ∼15–20% of the disease alleles. In our study, an isobaric labeling-based quantitative analysis of proteome of NPC1I1061T primary fibroblasts when compared with wild-type cells identified 281 differentially expressed proteins based on stringent data analysis criteria. Gene ontology enrichment analysis revealed that these proteins play important roles in diverse cellular processes such as protein maturation, energy metabolism, metabolism of reactive oxygen species, antioxidant activity, steroid metabolism, lipid localization, and apoptosis. The relative expression level of a subset of differentially expressed proteins (TOR4A, DHCR24, CLGN, SOD2, CHORDC1, HSPB7, and GAA) was independently and successfully substantiated by Western blotting. We observed that treating NPC1I1061T cells with four classes of seven different compounds that are potential NPC drugs increased the expression level of SOD2 and DHCR24. We have also shown an abnormal accumulation of glycogen in NPC1I1061T fibroblasts possibly triggered by defective processing of lysosomal alpha-glucosidase. Our study provides a starting point for future more focused investigations to better understand the mechanisms by which the reported dysregulated proteins triggers the pathological cascade in NPC, and furthermore, their effect upon therapeutic interventions. PMID:25873482

Role of a Novel I1781T Mutation and Other Mechanisms in Conferring Resistance to Acetyl-CoA Carboxylase Inhibiting Herbicides in a Black-Grass Population

PubMed Central

Kaundun, Shiv Shankhar; Hutchings, Sarah-Jane; Dale, Richard P.; McIndoe, Eddie

2013-01-01

Background Knowledge of the mechanisms of herbicide resistance is important for designing long term sustainable weed management strategies. Here, we have used an integrated biology and molecular approach to investigate the mechanisms of resistance to acetyl-CoA carboxylase inhibiting herbicides in a UK black-grass population (BG2). Methodology/Principal Findings Comparison between BG2 phenotypes using single discriminant rates of herbicides and genotypes based on ACCase gene sequencing showed that the I1781L, a novel I1781T, but not the W2027C mutations, were associated with resistance to cycloxydim. All plants were killed with clethodim and a few individuals containing the I1781L mutation were partially resistant to tepraloxydim. Whole plant dose response assays demonstrated that a single copy of the mutant T1781 allele conferred fourfold resistance levels to cycloxydim and clodinafop-propargyl. In contrast, the impact of the I1781T mutation was low (Rf = 1.6) and non-significant on pinoxaden. BG2 was also characterised by high levels of resistance, very likely non-target site based, to the two cereal selective herbicides clodinafop-propargyl and pinoxaden and not to the poorly metabolisable cyclohexanedione herbicides. Analysis of 480 plants from 40 cycloxydim resistant black grass populations from the UK using two very effective and high throughput dCAPS assays established for detecting any amino acid changes at the 1781 ACCase codon and for positively identifying the threonine residue, showed that the occurrence of the T1781 is extremely rare compared to the L1781 allele. Conclusion/Significance This study revealed a novel mutation at ACCase codon position 1781 and adequately assessed target site and non-target site mechanisms in conferring resistance to several ACCase herbicides in a black-grass population. It highlights that over time the level of suspected non-target site resistance to some cereal selective ACCase herbicides have in some instances

49 CFR 238.315 - Class IA brake test.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 4 2011-10-01 2011-10-01 false Class IA brake test. 238.315 Section 238.315... Requirements for Tier I Passenger Equipment § 238.315 Class IA brake test. (a) Except as provided in paragraph (b) of this section, either a Class I or a Class IA brake test shall be performed: (1) Prior to the...

Leptin reverts pro-apoptotic and antiproliferative effects of α-linolenic acids in BCR-ABL positive leukemic cells: involvement of PI3K pathway.

PubMed

Beaulieu, Aurore; Poncin, Géraldine; Belaid-Choucair, Zakia; Humblet, Chantal; Bogdanovic, Gordana; Lognay, Georges; Boniver, Jacques; Defresne, Marie-Paule

2011-01-01

It is suspected that bone marrow (BM) microenvironmental factors may influence the evolution of chronic myeloid leukaemia (CML). In this study, we postulated that adipocytes and lipids could be involved in the progression of CML. To test this hypothesis, adipocytes were co-cultured with two BCR-ABL positive cell lines (PCMDS and K562). T cell (Jurkat) and stroma cell (HS-5) lines were used as controls. In the second set of experiments, leukemic cell lines were treated with stearic, oleic, linoleic or α-linolenic acids in presence or absence of leptin. Survival, proliferation, leptin production, OB-R isoforms (OB-Ra and OB-Rb), phosphoinositide 3-kinase (PI3k) and BCL-2 expression have been tested after 24h, 48h and 72h of treatment. Our results showed that adipocytes induced a decrease of CML proliferation and an increase in lipid accumulation in leukemic cells. In addition, CML cell lines induced adipocytes cell death. Chromatography analysis showed that BM microenvironment cells were full of saturated (SFA) and monounsaturated (MUFA) fatty acids, fatty acids that protect tumor cells against external agents. Stearic acid increased Bcl-2 expression in PCMDS, whereas oleic and linoleic acids had no effects. In contrast, α-linolenic acid decreased the proliferation and the survival of CML cell lines as well as BCL-2 and OB-R expression. The effect of α-linolenic acids seemed to be due to PI3K pathway and Bcl-2 inhibition. Leptin production was detected in the co-culture medium. In the presence of leptin, the effect of α-linolenic acid on proliferation, survival, OB-R and BCl-2 expression was reduced.

Chronic Myeloid Leukemia in the Era of Tyrosine Kinase Inhibitors: An Evolving Paradigm of Molecularly Targeted Therapy.

PubMed

Ali, Mohamed A M

2016-08-01

Chronic myeloid leukemia (CML) is a myeloproliferative neoplasm, characterized by the unrestrained expansion of pluripotent hematopoietic stem cells. CML was the first malignancy in which a unique chromosomal abnormality was identified and a pathophysiologic association was suggested. The hallmark of CML is a reciprocal chromosomal translocation between the long arms of chromosomes 9 and 22, t(9; 22)(q34; q11), creating a derivative 9q+ and a shortened 22q-. The latter, known as the Philadelphia (Ph) chromosome, harbors the breakpoint cluster region-abelson (BCR-ABL) fusion gene, encoding the constitutively active BCR-ABL tyrosine kinase that is necessary and sufficient for initiating CML. The successful implementation of tyrosine kinase inhibitors (TKIs) for the treatment of CML remains a flagship for molecularly targeted therapy in cancer. TKIs have changed the clinical course of CML; however, some patients nonetheless demonstrate primary or secondary resistance to such therapy and require an alternative therapeutic strategy. Therefore, the assessment of early response to treatment with TKIs has become an important tool in the clinical monitoring of CML patients. Although mutations in the BCR-ABL have proven to be the most prominent mechanism of resistance to TKIs, other mechanisms-either rendering the leukemic cells still dependent on BCR-ABL activity or supporting oncogenic properties of the leukemic cells independent of BCR-ABL signaling-have been identified. This article provides an overview of the current understanding of CML pathogenesis; recommendations for diagnostic tools, treatment strategies, and management guidelines; and highlights the BCR-ABL-dependent and -independent mechanisms that contribute to the development of resistance to TKIs.

Nanoscale organization and dynamics of the siglec CD22 cooperate with the cytoskeleton in restraining BCR signalling.

PubMed

Gasparrini, Francesca; Feest, Christoph; Bruckbauer, Andreas; Mattila, Pieta K; Müller, Jennifer; Nitschke, Lars; Bray, Dennis; Batista, Facundo D

2016-02-01

Receptor organization and dynamics at the cell membrane are important factors of signal transduction regulation. Using super-resolution microscopy and single-particle tracking, we show how the negative coreceptor CD22 works with the cortical cytoskeleton in restraining BCR signalling. In naïve B cells, we found endogenous CD22 to be highly mobile and organized into nanodomains. The landscape of CD22 and its lateral diffusion were perturbed either in the absence of CD45 or when the CD22 lectin domain was mutated. To understand how a relatively low number of CD22 molecules can keep BCR signalling in check, we generated Brownian dynamic simulations and supported them with ex vivo experiments. This combined approach suggests that the inhibitory function of CD22 is influenced by its nanoscale organization and is ensured by its fast diffusion enabling a "global BCR surveillance" at the plasma membrane. © 2015 The Authors.

Primary hyperoxaluria type 1 in the Canary Islands: A conformational disease due to I244T mutation in the P11L-containing alanine:glyoxylate aminotransferase

PubMed Central

Santana, A.; Salido, E.; Torres, A.; Shapiro, L. J.

2003-01-01

Primary hyperoxaluria type 1 (PH1) is an inborn error of metabolism resulting from a deficiency of alanine:glyoxylate aminotransferase (AGXT; EC 2.6.1.44). Most of the PH1 alleles detected in the Canary Islands carry the Ile-244 → Thr (I244T) mutation in the AGXT gene, with 14 of 16 patients homozygous for this mutation. Four polymorphisms within AGXT and regional microsatellites also were shared in their haplotypes (AGXT*LTM), consistent with a founder effect. The consequences of these amino acid changes were investigated. Although I244T alone did not affect AGXT activity or subcellular localization, when present in the same protein molecule as Leu-11 → Pro (L11P), it resulted in loss of enzymatic activity in soluble cell extracts. Like its normal counterpart, the AGXT*LTM protein was present in the peroxisomes but it was insoluble in detergent-free buffers. The polymorphism L11P behaved as an intragenic modifier of the I244T mutation, with the resulting protein undergoing stable interaction with molecular chaperones and aggregation. This aggregation was temperature-sensitive. AGXT*LTM expressed in Escherichia coli, as a GST-fusion protein, and in insect cells could be purified and retained enzymatic activity. Among various chemical chaperones tested in cell culture, betaine substantially improved the solubility of the mutant protein and the enzymatic activity in cell lysates. In summary, I244T, the second most common mutation responsible for PH1, is a protein conformational disease that may benefit from new therapies with pharmacological chaperones or small molecules to minimize protein aggregation. PMID:12777626

Clonal Evolution and Blast Crisis Correlate with Enhanced Proteolytic Activity of Separase in BCR-ABL b3a2 Fusion Type CML under Imatinib Therapy.

PubMed

Haaß, Wiltrud; Kleiner, Helga; Weiß, Christel; Haferlach, Claudia; Schlegelberger, Brigitte; Müller, Martin C; Hehlmann, Rüdiger; Hofmann, Wolf-Karsten; Fabarius, Alice; Seifarth, Wolfgang

2015-01-01

Unbalanced (major route) additional cytogenetic aberrations (ACA) at diagnosis of chronic myeloid leukemia (CML) indicate an increased risk of progression and shorter survival. Moreover, newly arising ACA under imatinib treatment and clonal evolution are considered features of acceleration and define failure of therapy according to the European LeukemiaNet (ELN) recommendations. On the basis of 1151 Philadelphia chromosome positive chronic phase patients of the randomized CML-study IV, we examined the incidence of newly arising ACA under imatinib treatment with regard to the p210BCR-ABL breakpoint variants b2a2 and b3a2. We found a preferential acquisition of unbalanced ACA in patients with b3a2 vs. b2a2 fusion type (ratio: 6.3 vs. 1.6, p = 0.0246) concurring with a faster progress to blast crisis for b3a2 patients (p = 0.0124). ESPL1/Separase, a cysteine endopeptidase, is a key player in chromosomal segregation during mitosis. Separase overexpression and/or hyperactivity has been reported from a wide range of cancers and cause defective mitotic spindles, chromosome missegregation and aneuploidy. We investigated the influence of p210BCR-ABL breakpoint variants and imatinib treatment on expression and proteolytic activity of Separase as measured with a specific fluorogenic assay on CML cell lines (b2a2: KCL-22, BV-173; b3a2: K562, LAMA-84). Despite a drop in Separase protein levels an up to 5.4-fold increase of Separase activity under imatinib treatment was observed exclusively in b3a2 but not in b2a2 cell lines. Mimicking the influence of imatinib on BV-173 and LAMA-84 cells by ESPL1 silencing stimulated Separase proteolytic activity in both b3a2 and b2a2 cell lines. Our data suggest the existence of a fusion type-related feedback mechanism that posttranslationally stimulates Separase proteolytic activity after therapy-induced decreases in Separase protein levels. This could render b3a2 CML cells more prone to aneuploidy and clonal evolution than b2a2 progenitors

The BCR signalosome: where cell fate is decided.

PubMed

Ulivieri, C; Baldari, C T

2005-01-01

B cell antigen receptor (BCR) engagement results in the assembly of a multimolecular complex at the cytosolic side of the plasma membrane, known as signalosome. Here we briefly review the current knowledge on the molecules which participate in the BCR signalosome and on the response modulators which control the final signal output by enhancing or dampening BCR signaling.

21 CFR 315.6 - Evaluation of safety.

Code of Federal Regulations, 2011 CFR

2011-04-01

... information, the following types of data: (i) Pharmacology data, (ii) Toxicology data, (iii) Clinical adverse... 21 Food and Drugs 5 2011-04-01 2011-04-01 false Evaluation of safety. 315.6 Section 315.6 Food and... USE DIAGNOSTIC RADIOPHARMACEUTICALS § 315.6 Evaluation of safety. (a) Factors considered in the safety...

Molecular analysis of Cypriot patients with Glutaric aciduria type I: identification of two novel mutations.

PubMed

Georgiou, Theodoros; Nicolaidou, Paola; Hadjichristou, Anastasia; Ioannou, Rodothea; Dionysiou, Maria; Siama, Elli; Chappa, Georgia; Anastasiadou, Violetta; Drousiotou, Anthi

2014-09-01

The purpose of this study was to identify the mutations in the glutaryl-CoA dehydrogenase gene (GCDH) in ten Cypriot patients with Glutaric aciduria type I (GAI). Molecular analysis of the GCDH gene was performed by direct sequencing of the patients' genomic DNA. In silico tools were applied to predict the effect of the novel variants on the structure and function of the protein. All disease alleles were characterized (mutation detection rate 100%). Five missense mutations were identified: c.192G>T (p.Glu64Asp) and c.803G>T (p.Gly268Val), which are novel, and three previously described mutations, c.1123T>C (p.Cys375Arg), c.1204C>T (p.Arg402Trp) and c.1286C>T (p.Thr429Met). Two novel mutations, p.Glu64Asp and p.Gly268Val, account for the majority of disease alleles (76.5%) in Cypriot patients with Glutaric aciduria type I. A founder effect for the p.Glu64Asp and the p.Gly268Val can be suggested based on the place of origin of the carriers of these mutations. Identification of the causative mutations of GAI in Cypriot patients will facilitate carrier detection as well as post- and pre-natal diagnosis. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Potentiation of antileukemic therapies by the dual PI3K/PDK-1 inhibitor, BAG956: effects on BCR-ABL– and mutant FLT3-expressing cells

PubMed Central

Weisberg, Ellen; Banerji, Lolita; Wright, Renee D.; Barrett, Rosemary; Ray, Arghya; Moreno, Daisy; Catley, Laurence; Jiang, Jingrui; Hall-Meyers, Elizabeth; Sauveur-Michel, Maira; Stone, Richard; Galinsky, Ilene; Fox, Edward; Kung, Andrew L.

2008-01-01

Mediators of PI3K/AKT signaling have been implicated in chronic myeloid leukemia (CML) and acute myeloid leukemia (AML). Studies have shown that inhibitors of PI3K/AKT signaling, such as wortmannin and LY294002, are able to inhibit CML and AML cell proliferation and synergize with targeted tyrosine kinase inhi-bitors. We investigated the ability of BAG956, a dual PI3K/PDK-1 inhibitor, to be used in combination with inhibitors of BCR-ABL and mutant FLT3, as well as with the mTOR inhibitor, rapamycin, and the rapamycin derivative, RAD001. BAG956 was shown to block AKT phosphorylation induced by BCR-ABL–, and induce apoptosis of BCR-ABL–expressing cell lines and patient bone marrow cells at concentrations that also inhibit PI3K signaling. Enhancement of the inhibitory effects of the tyrosine kinase inhibitors, imatinib and nilotinib, by BAG956 was demonstrated against BCR-ABL expressing cells both in vitro and in vivo. We have also shown that BAG956 is effective against mutant FLT3-expressing cell lines and AML patient bone marrow cells. Enhancement of the inhibitory effects of the tyrosine kinase inhibitor, PKC412, by BAG956 was demonstrated against mutant FLT3-expressing cells. Finally, BAG956 and rapamycin/RAD001 were shown to combine in a nonantagonistic fashion against BCR-ABL– and mutant FLT3-expressing cells both in vitro and in vivo. PMID:18184863

Recurrent SETBP1 mutations in atypical chronic myeloid leukemia.

PubMed

Piazza, Rocco; Valletta, Simona; Winkelmann, Nils; Redaelli, Sara; Spinelli, Roberta; Pirola, Alessandra; Antolini, Laura; Mologni, Luca; Donadoni, Carla; Papaemmanuil, Elli; Schnittger, Susanne; Kim, Dong-Wook; Boultwood, Jacqueline; Rossi, Fabio; Gaipa, Giuseppe; De Martini, Greta P; di Celle, Paola Francia; Jang, Hyun Gyung; Fantin, Valeria; Bignell, Graham R; Magistroni, Vera; Haferlach, Torsten; Pogliani, Enrico Maria; Campbell, Peter J; Chase, Andrew J; Tapper, William J; Cross, Nicholas C P; Gambacorti-Passerini, Carlo

2013-01-01

Atypical chronic myeloid leukemia (aCML) shares clinical and laboratory features with CML, but it lacks the BCR-ABL1 fusion. We performed exome sequencing of eight aCMLs and identified somatic alterations of SETBP1 (encoding a p.Gly870Ser alteration) in two cases. Targeted resequencing of 70 aCMLs, 574 diverse hematological malignancies and 344 cancer cell lines identified SETBP1 mutations in 24 cases, including 17 of 70 aCMLs (24.3%; 95% confidence interval (CI) = 16-35%). Most mutations (92%) were located between codons 858 and 871 and were identical to changes seen in individuals with Schinzel-Giedion syndrome. Individuals with mutations had higher white blood cell counts (P = 0.008) and worse prognosis (P = 0.01). The p.Gly870Ser alteration abrogated a site for ubiquitination, and cells exogenously expressing this mutant exhibited higher amounts of SETBP1 and SET protein, lower PP2A activity and higher proliferation rates relative to those expressing the wild-type protein. In summary, mutated SETBP1 represents a newly discovered oncogene present in aCML and closely related diseases.

Expression, prognostic significance and mutational analysis of protein tyrosine phosphatase SHP-1 in chronic myeloid leukemia.

PubMed

Papadopoulou, Vasiliki; Kontandreopoulou, Elina; Panayiotidis, Panayiotis; Roumelioti, Maria; Angelopoulou, Maria; Kyriazopoulou, Lydia; Diamantopoulos, Panagiotis T; Vaiopoulos, George; Variami, Eleni; Kotsianidis, Ioannis; Athina Viniou, Nora

2016-05-01

The protein tyrosine phosphatase SHP-1 dephosphorylates BCR-ABL1, thereby serving as a potential control mechanism of BCR-ABL1 kinase activity. Pathways regulating SHP-1 expression, which could be exploited in the therapeutics of TKI-resistant chronic myeloid leukemia (CML), remain unknown. Moreover, the questions of whether there is any kind of SHP-1 deregulation in CML, contributing to disease initiation or evolution, as well as the question of prognostic significance of SHP-1, have not been definitively answered. This study shows moderately lower SHP-1 mRNA expression in chronic phase CML patients in comparison to healthy individuals and no change in SHP-1 mRNA levels after successful TKI treatment. Mutational analysis of the aminoterminal and phosphatase domains of SHP-1 in patients did not reveal genetic lesions. This study also found no correlation of SHP-1 expression at diagnosis with response to treatment, although a trend for lower SHP-1 expression was noted in the very small non-responders' group of the 3-month therapeutic milestone.

Cytogenetic and molecular characterization of double inversion 3 associated with a cryptic BCR-ABL1 rearrangement and additional genetic changes.

PubMed

Toydemir, Reha; Rowe, Leslie; Hibbard, Michele; Salama, Mohamed; Shetty, Shashirekha

2010-09-01

Rearrangements of chromosome 3 involving bands 3q21 and 3q26 have been reported in about 2% of patients with acute myeloid leukemia, and rarely in myelodysplastic syndrome or chronic myelogenous leukemia (CML). To date, only six cases of inversion of both homologues have been reported. Loss of normal chromosome 3 and duplication of the inverted chromosome have been proposed as the most likely mechanism, but have not been shown experimentally. We present a 36-year-old male with an initial diagnosis of CML and resistance to imatinib mesylate. Chromosome analysis showed an inversion within the long arm of both homologues of chromosome 3 and an interstitial deletion within the long arm of one chromosome 7. The rearrangement of EVI1 locus on both homologues of chromosome 3 was confirmed by fluorescence in situ hybridization (FISH). Additional FISH studies showed a cryptic insertion of ABL1 into the BCR region, and subsequent duplication of the derivative chromosome 22. The single-nucleotide polymorphism array showed copy-neutral loss of heterozygosity on chromosomes 3 and 22, suggesting that a somatic repair mechanism is involved in the evolution of these genetic alterations. This case illustrates the complexity of genetic aberrations in neoplastic cells, and the value of array technology, used in concert with conventional cytogenetic methods, for a better understanding of the pathogenesis. 2010 Elsevier Inc. All rights reserved.

I1171 missense mutation (particularly I1171N) is a common resistance mutation in ALK-positive NSCLC patients who have progressive disease while on alectinib and is sensitive to ceritinib.

PubMed

Ou, Sai-Hong Ignatius; Greenbowe, Joel; Khan, Ziad U; Azada, Michele C; Ross, Jeffrey S; Stevens, Phil J; Ali, Siraj M; Miller, Vincent A; Gitlitz, Barbara

2015-05-01

Acquired resistance mutations to anaplastic lymphoma kinase (ALK) inhibitors such as crizotinib and alectinib have been documented in non-small cell lung cancer (NSCLC) patients harboring ALK rearrangement (ALK+). Of note I1171T/N/S mutations in the ALK kinase domain have recently been described by several groups to confer resistance to alectinib, a second-generation ALK inhibitor. Additionally one of these reports demonstrated one ALK+ NSCLC patient harboring an I1171T acquired mutation has responded to ceritinib, another second-generation ALK inhibitor. We reported the presence of an ALK I1171N resistance mutation from comprehensive genomic profiling from a liver biopsy of a progressing metastatic lesion in an ALK+ patient on alectinib after an initial partial response. The patient then responded to ceritinib 750 mg orally once daily but required dose reduction to 600 mg once daily. She initially had grade 3 elevation of liver enzymes from crizotinib necessitating the original switch to alectinib but experienced no transaminase elevations with alectinib or ceritinib. This is the fifth patient case to date demonstrating that ALK I1171 mutation confers resistance to alectinib and the second reported case of ALK I1171 mutation being sensitivity to ceritinib. Substitutions of isoleucine at amino acid 1171 in the ALK kinase domain may distinguish which second generation ALK inhibitor will be effective after crizotinib failure. This case also provides evidence that transaminase elevations is likely a unique adverse event associated with crizotinib and unlikely a "class" effect involving all ALK inhibitors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Development of t(8;21) and RUNX1-RUNX1T1 in the Philadelphia-positive clone of a patient with chronic myelogenous leukemia: additional evidence for multiple steps involved in disease progression.

PubMed

Najfeld, Vesna; Wisch, Nathaniel; Mascarenhas, John; Issa, Leonard; Tripodi, Joseph; Sidhu, Manpreet; Hoffman, Ronald

2011-03-01

A 65-year-old patient with a high hemoglobin and hematocrit was treated for 14 months with therapeutic phlebotomy when cytogenetics of bone marrow revealed 100% cells with the Ph chromosome and 45% of the Ph+ cells contained trisomy 8. Treatment with tyrosine kinase inhibitors did not reduce the BCR-ABL1 fusion positive clone. Instead, the Ph positive cells acquired further the t(8;21)/RUNX1-RUNX1T1, del(4q) and trisomy 15 chromosomal abnormalities which were resistant to further treatment. Literature review revealed eight other patients who either had t(9;22) and t(8;21) simultaneously or developed t(8;21) in the Ph positive clone. We conclude that there are rare patients with CML who either present in blast crisis with coexistence of t(9;22) and t(8;21) with or without +8, or progress to blast crisis with acquiring RUNX1-RUNX1T1 in the BCR-ABL1 clone which may or may not be therapy related and represent a later event in a multistep pathogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

Frequency of ABL gene mutations in chronic myeloid leukemia patients resistant to imatinib and results of treatment switch to second-generation tyrosine kinase inhibitors.

PubMed

Marcé, Silvia; Zamora, Lurdes; Cabezón, Marta; Xicoy, Blanca; Boqué, Concha; Fernández, Cristalina; Grau, Javier; Navarro, José-Tomás; Fernández de Sevilla, Alberto; Ribera, Josep-Maria; Feliu, Evarist; Millá, Fuensanta

2013-08-04

Tyrosine kinase inhibitors (TKI) have improved the management of patients with chronic myeloid leukemia (CML). However, a significant proportion of patients do not achieve the optimal response or are resistant to TKI. ABL kinase domain mutations have been extensively implicated in the pathogenesis of TKI resistance. Treatment with second-generation TKI has produced high rates of hematologic and cytogenetic responses in mutated ABL patients. The aim of this study was to determine the type and frequency of ABL mutations in patients who were resistant to imatinib or had lost the response, and to analyze the effect of second-generation TKI on their outcome. The presence of ABL mutations in 45 CML patients resistant to imatinib was evaluated by direct sequencing and was correlated with the results of the cytogenetic study (performed in 39 cases). The outcome of these patients after therapy with nilotinib or dasatinib was analyzed. ABL mutations were detected in 14 out of 45 resistant patients. Patients with clonal cytogenetic evolution tended to develop mutations more frequently than those without clonal evolution. Nine out of the 15 patients with ABL mutation responded to a treatment switch to nilotinib (n=4), dasatinib (n=2), interferon (n=1) or hematopoietic stem cell transplantation (n=2). The frequency of ABL mutations in CML patients resistant to imatinib is high and is more frequent among those with clonal cytogenetic evolution. The change to second-generation TKI can overcome imatinib resistance in most of the mutated patients. Copyright © 2012 Elsevier España, S.L. All rights reserved.

Systems-wide analysis of BCR signalosomes and downstream phosphorylation and ubiquitylation

PubMed Central

Satpathy, Shankha; Wagner, Sebastian A; Beli, Petra; Gupta, Rajat; Kristiansen, Trine A; Malinova, Dessislava; Francavilla, Chiara; Tolar, Pavel; Bishop, Gail A; Hostager, Bruce S; Choudhary, Chunaram

2015-01-01

B-cell receptor (BCR) signaling is essential for the development and function of B cells; however, the spectrum of proteins involved in BCR signaling is not fully known. Here we used quantitative mass spectrometry-based proteomics to monitor the dynamics of BCR signaling complexes (signalosomes) and to investigate the dynamics of downstream phosphorylation and ubiquitylation signaling. We identify most of the previously known components of BCR signaling, as well as many proteins that have not yet been implicated in this system. BCR activation leads to rapid tyrosine phosphorylation and ubiquitylation of the receptor-proximal signaling components, many of which are co-regulated by both the modifications. We illustrate the power of multilayered proteomic analyses for discovering novel BCR signaling components by demonstrating that BCR-induced phosphorylation of RAB7A at S72 prevents its association with effector proteins and with endo-lysosomal compartments. In addition, we show that BCL10 is modified by LUBAC-mediated linear ubiquitylation, and demonstrate an important function of LUBAC in BCR-induced NF-κB signaling. Our results offer a global and integrated view of BCR signaling, and the provided datasets can serve as a valuable resource for further understanding BCR signaling networks. PMID:26038114

Evaluating the Predictivity of Virtual Screening for Abl Kinase Inhibitors to Hinder Drug Resistance

PubMed Central

Gani, Osman A B S M; Narayanan, Dilip; Engh, Richard A

2013-01-01

Virtual screening methods are now widely used in early stages of drug discovery, aiming to rank potential inhibitors. However, any practical ligand set (of active or inactive compounds) chosen for deriving new virtual screening approaches cannot fully represent all relevant chemical space for potential new compounds. In this study, we have taken a retrospective approach to evaluate virtual screening methods for the leukemia target kinase ABL1 and its drug-resistant mutant ABL1-T315I. ‘Dual active’ inhibitors against both targets were grouped together with inactive ligands chosen from different decoy sets and tested with virtual screening approaches with and without explicit use of target structures (docking). We show how various scoring functions and choice of inactive ligand sets influence overall and early enrichment of the libraries. Although ligand-based methods, for example principal component analyses of chemical properties, can distinguish some decoy sets from active compounds, the addition of target structural information via docking improves enrichment, and explicit consideration of multiple target conformations (i.e. types I and II) achieves best enrichment of active versus inactive ligands, even without assuming knowledge of the binding mode. We believe that this study can be extended to other therapeutically important kinases in prospective virtual screening studies. PMID:23746052

GTF2I mutation frequently occurs in more indolent thymic epithelial tumors and predicts better prognosis.

PubMed

Feng, Yanfen; Lei, Yiyan; Wu, Xiaoyan; Huang, Yuhua; Rao, Huilan; Zhang, Yu; Wang, Fang

2017-08-01

A missense mutation in GTF2I was previously identified in thymic epithelioid tumor (TET). However, the clinicopathological relevance of GTF2I mutation has not been illustrated. We studied the prognostic importance of GTF2I mutation as well as its relation to histological subtypes in a large number of TETs. TET samples from 296 patients with clinical and follow-up data were collected, and histological subtypes were classified. Analysis of the GTF2I (chromosome 7 c.74146970T>A) mutation was undertaken by using quantitative real time polymerase chain reaction (qPCR) and direct sequencing. The association of GTF2I mutation with clinicopathological features as well as prognosis was analyzed. One hundred twenty-four out of 296 (41.9%) patients harbored the GTF2I mutation (chromosome 7 c.74146970T>A). GTF2I mutation was observed in 20 (87.0%) cases of type A thymoma, 70 (78.7%) of type AB thymoma, and the frequency decreased with the degree of histological subtype aggressiveness, with the lowest rate in thymic carcinoma (7.7%). The difference of GTF2I mutation distribution in histological subtypes was statistically significant (p<0.001). The GTF2I mutation was found more frequently in patients with early Masaoka stage (I-II, n=112, 90.3%) than in those with advanced stage (III-IV) disease (n=12, 9.6%, p<0.001). However, only histological subtype significantly predicted the presence of the GTF2I mutation in patients with TETs. The presence of the GTF2I mutation correlated with better prognosis (90.0% compared to 72.0% 5-year survival, and 86% compared to 56% 10-year survival, respectively; log-rank p=0.001). Moreover, it was an independent prognostic factor [hazard ratio (HR), 0.35; 95% confidential interval (CI), 0.15-0.81; p=0.014)]. The frequency of the GTF2I mutation is higher in more indolent TETs, and correlates with better prognosis. Further studies are required to elucidate the role of the GTF2I mutation in TETs and its clinical application. Copyright © 2017

A Hypertension-Associated tRNAAla Mutation Alters tRNA Metabolism and Mitochondrial Function

PubMed Central

Jiang, Pingping; Wang, Meng; Xue, Ling; Xiao, Yun; Yu, Jialing; Wang, Hui; Yao, Juan; Liu, Hao; Peng, Yanyan; Liu, Hanqing; Li, Haiying; Chen, Ye

2016-01-01

In this report, we investigated the pathophysiology of a novel hypertension-associated mitochondrial tRNAAla 5655A → G (m.5655A → G) mutation. The destabilization of a highly conserved base pairing (A1-U72) at the aminoacyl acceptor stem by an m.5655A → G mutation altered the tRNAAla function. An in vitro processing analysis showed that the m.5655A → G mutation reduced the efficiency of tRNAAla precursor 5′ end cleavage catalyzed by RNase P. By using cybrids constructed by transferring mitochondria from lymphoblastoid cell lines derived from a Chinese family into mitochondrial DNA (mtDNA)-less (ρo) cells, we showed a 41% reduction in the steady-state level of tRNAAla in mutant cybrids. The mutation caused an improperly aminoacylated tRNAAla, as suggested by aberrantly aminoacylated tRNAAla and slower electrophoretic mobility of mutated tRNA. A failure in tRNAAla metabolism contributed to variable reductions in six mtDNA-encoded polypeptides in mutant cells, ranging from 21% to 37.5%, with an average of a 29.1% reduction, compared to levels of the controls. The impaired translation caused reduced activities of mitochondrial respiration chains. Furthermore, marked decreases in the levels of mitochondrial ATP and membrane potential were observed in mutant cells. These caused increases in the production of reactive oxygen species in the mutant cybrids. The data provide evidence for the association of the tRNAAla 5655A → G mutation with hypertension. PMID:27161322

Mitochondrial tRNA(Thr) A15951G mutation may not be associated with Leber's Hereditary Optic Neuropathy.

PubMed

Zhang, Xi; Yu, Shuaishuai; Tu, Yunhai; Huang, Wenjie

2016-07-01

Mutation in mitochondrial DNA (mtDNA) has been found to play an important role in the pathogenesis of Leber's Hereditary Optic Neuropathy (LHON). Three primary mutations, the ND4 G11778A, ND6 T14484C, and ND1 G3460A, have been found to account more than 90% of LHON patients in many families worldwide. In addition to the mutations in genes encoding the respiratory chain complex I, reports concerning the mt-tRNA gene mutations associated with LHON have increased, some pathogenic mutations caused the failure in mt-tRNA metabolism, thereby worsened the mitochondrial dysfunction that is responsible for LHON. Recently, the A15951G mutation in mt-tRNA(Thr) gene has been reported to be a "modified" factor in increasing the penetrance and expressivity of LHON-associated ND4 G11778A mutation in three Chinese families. However, evolutionary conservation analysis of this mutation suggested a poor conservation index and the pathogenicity scoring system showed that this mutation was a neutral polymorphism.

A Deafness- and Diabetes-associated tRNA Mutation Causes Deficient Pseudouridinylation at Position 55 in tRNAGlu and Mitochondrial Dysfunction*

PubMed Central

Wang, Meng; Liu, Hao; Zheng, Jing; Chen, Bobei; Zhou, Mi; Fan, Wenlu; Wang, Hen; Liang, Xiaoyang; Zhou, Xiaolong; Eriani, Gilbert; Jiang, Pingping; Guan, Min-Xin

2016-01-01

Several mitochondrial tRNA mutations have been associated with maternally inherited diabetes and deafness. However, the pathophysiology of these tRNA mutations remains poorly understood. In this report, we identified the novel homoplasmic 14692A→G mutation in the mitochondrial tRNAGlu gene among three Han Chinese families with maternally inherited diabetes and deafness. The m.14692A→G mutation affected a highly conserved uridine at position 55 of the TΨC loop of tRNAGlu. The uridine is modified to pseudouridine (Ψ55), which plays an important role in the structure and function of this tRNA. Using lymphoblastoid cell lines derived from a Chinese family, we demonstrated that the m.14692A→G mutation caused loss of Ψ55 modification and increased angiogenin-mediated endonucleolytic cleavage in mutant tRNAGlu. The destabilization of base-pairing (18A-Ψ55) caused by the m.14692A→G mutation perturbed the conformation and stability of tRNAGlu. An approximately 65% decrease in the steady-state level of tRNAGlu was observed in mutant cells compared with control cells. A failure in tRNAGlu metabolism impaired mitochondrial translation, especially for polypeptides with a high proportion of glutamic acid codons such as ND1, ND6, and CO2 in mutant cells. An impairment of mitochondrial translation caused defective respiratory capacity, especially reducing the activities of complexes I and IV. Furthermore, marked decreases in the levels of mitochondrial ATP and membrane potential were observed in mutant cells. These mitochondrial dysfunctions caused an increasing production of reactive oxygen species in the mutant cells. Our findings may provide new insights into the pathophysiology of maternally inherited diabetes and deafness, which is primarily manifested by the deficient nucleotide modification of mitochondrial tRNAGlu. PMID:27519417

The human tyrosine kinase Kit and its gatekeeper mutant T670I, show different kinetic properties: Implications for drug design.

PubMed

Kissova, Miroslava; Maga, Giovanni; Crespan, Emmanuele

2016-10-01

The tyrosine kinase Kit, a receptor for Stem Cell Factor, is involved, among others, in processes associated to cell survival, proliferation and migration. Upon physiological conditions, the activity of Kit is tightly regulated. However, primary mutations that lead to its constitutive activation are the causal oncogenic driver of gastrointestinal stromal tumours (GISTs). GISTs are known to be refractory to conventional therapies but the introduction of Imatinib, a selective inhibitor of tyrosine kinases Abl and Kit, significantly ameliorated the treatment options of GISTs patients. However, the acquisition of secondary mutations renders Kit resistant towards all available drugs. Mutation involving gatekeeper residues (such as V654a and T670I) influence both the structure and the catalytic activity of the enzyme. Therefore, detailed knowledge of the enzymatic properties of the mutant forms, in comparison with the wild type enzyme, is an important pre-requisite for the rational development of specific inhibitors. In this paper we report a thorough kinetic analysis of the reaction catalyzed by the Kit kinase and its gatekeeper mutated form T670I. Our results revealed the different mechanisms of action of these two enzymes and may open a new avenue for the future design of specific Kit inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genetic Screening of Selected Disease-Causing Mutations in Glutaryl-CoA Dehydrogenase Gene among Indian Patients with Glutaric Aciduria Type I.

PubMed

Tp, Kruthika-Vinod; Muntaj, Shaik; Devaraju, K S; Kamate, M; Vedamurthy, A B

2017-09-01

Glutaric aciduria type I (GA-I) is an organic aciduria caused by glutaryl-CoA dehydrogenase (GCDH) deficiency. There are limited studies on GA-I from India. A total of 48 Indian GA-I patients were screened for selected disease-causing mutations such as R402W, A421V, A293T, R227P, and V400M using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP). Among these patients, 9 (18.8%) had R402W mutation, and none had A421V, A293T, R227P, or V400M mutation. One low excretor mutation (P286S) and several novel mutations (I152M, Q144P, and E414X) were also found in this study. We conclude that among selected mutations, R402W is the most common mutation found among Indian GA-I patients.

SAHA and S116836, a novel tyrosine kinase inhibitor, synergistically induce apoptosis in imatinib-resistant chronic myelogenous leukemia cells

PubMed Central

Bu, Qiangui; Cui, Lijing; Li, Juan; Du, Xin; Zou, Waiyi; Ding, Ke; Pan, Jingxuan

2014-01-01

Limited treatment options are available for chronic myelogenous leukemia (CML) patients who develop imatinib mesylate (IM) resistance. Here we proposed a novel combination regimen, a co-administration of S116836, a novel small molecule multi-targeted tyrosine kinase inhibitor that was synthesized by rational design, and histone deacetylases inhibitor (HDACi) suberoylanilide hydroxamic acid (SAHA), to overcome IM resistance in CML. S116836 at low concentrations used in the present study mildly downregulates auto-tyrosine phosphorylation of Bcr-Abl. SAHA, an FDA-approved HDACi drug, at 1 μM has modest anti-tumor activity in treating CML. However, we found a synergistic interaction between SAHA and S116836 in Bcr-Abl-positive CML cells that were sensitive or resistant to IM. Exposure of KBM5 and KBM5-T315I cells to minimal or non-toxic concentrations of SAHA and S116836 synergistically reduced cell viability and induced cell death. Co-treatment with SAHA and S116838 repressed the expressions of anti-apoptosis proteins, such as Mcl-1 and XIAP, but promoted Bim expression and mitochondrial damage. Of importance, treatment with both drugs significantly reduced cell viability of primary human CML cells, as compared with either agent alone. Taken together, our findings suggest that SAHA exerts synergistically with S116836 at a non-toxic concentration to promote apoptosis in the CML, including those resistant to imatinib or dasatinib. PMID:24759597

Elucidating the Role of cAbl and the Abi-Family of cAbl Target Proteins in Cancer Development and Progression

DTIC Science & Technology

1999-07-01

patients with Ph’-positive leukemias also revealed loss of Abi proteins. We determined by RNase protection assay and reverse transcriptase polymerase...myelogenous leukemia . Abi protein levels also appeared unaltered by Western blot analysis of human lung, liver, colon, and breast carcinoma tissues as...generated in the presence of Bcr-Abl • Abi protein degradation was observed in Ph’+ leukemia -derived cells, but not in Ph1- leukemias or in human breast

Mucopolysaccharidosis type I: Identification and characterization of mutations affecting alpha-L-iduronidase activity.

PubMed

Lee-Chen, Guey-Jen; Lin, Shuan-Pei; Chen, I-Shen; Chang, Jui-Hung; Yang, Chyau-Wen; Chin, Yi-Wen

2002-06-01

Mucopolysaccharidosis type I (MPS I) is caused by a deficiency of the lysosomal enzyme alpha-L-iduronidase (IDUA). MPS I covers a broad spectrum of clinical severity ranging from severe Hurler syndrome through intermediate Hurler/Scheie syndrome to mild Scheie syndrome. Mutation screening was performed in two unrelated Taiwanese MPS I patients. A Hurler/Scheie patient had A79V (C to T transition in codon 79) in exon 2 and R619G (C to G transversion in codon 619) in exon 14. R619G has been shown to cause disease. Expression of A79V in COS-7 cells showed trace amounts of IDUA activity, demonstrating the deleterious nature of the mutation. A79V mutation did not cause a reduction in IDUA mRNA levels. The reduced level of IDUA protein suggests increased degradation of the mutant enzyme. A Hurler patient had 134del12 (in-frame deletion of codons 16-19 in signal peptide) in exon 1 and Q584X (C to T transition in codon 584) in exon 13. Transfection of COS-7 cells with Q584X did not yield active enzyme. Q584X mutation caused an apparent reduction in the IDUA mRNA level and no IDUA protein was detected. Conversely, 134del12 showed 124.6% of normal activity in transfected cells and a 77-kDa precursor protein was observed on Western blot, suggesting biologic activity of precursor IDUA without posttranslational cleavage. These findings provide further evidence of the molecular heterogeneity in mutations in MPS I.

A Comparison between CHEK2*1100delC/I157T Mutation Carrier and Noncarrier Breast Cancer Patients: A Clinicopathological Analysis.

PubMed

Huszno, Joanna; Budryk, Magdalena; Kołosza, Zofia; Tęcza, Karolina; Pamuła Piłat, Jolanta; Nowara, Elżbieta; Grzybowska, Ewa

2016-01-01

The suppressor gene CHEK2 encodes a cell cycle checkpoint kinase, involved in cell cycle regulation, apoptosis and response to DNA damage. The aim of this study was to analyze the differences between CHEK2 mutation carriers (CHEK2*1100delC/I157T) and noncarriers with respect to clinicopathological factors. We reviewed the medical records of 100 early breast cancer patients (46 mutation carriers and 54 noncarriers) who were treated with chemotherapy, hormonotherapy or trastuzumab. CHEK2 mutation carriers were older (>65 years) than noncarriers (17 vs. 7%; p = 0.215). Twenty-five (54%) of them had a history of cancer in the family. Gastric cancer in the family history was detected in 11% of mutation carriers and in 2% of noncarriers (p = 0.092). There was a trend for more frequent lymph node metastases in patients without the mutation in comparison to mutation carriers (46 vs. 28%; p = 0.098). Luminal B type breast cancer was detected more often in carriers (39 vs. 20%; p = 0.048). Breast-conserving treatment was also conducted more often in mutation carriers (57 vs. 31%; p = 0.015). Histologic grades G1/G2 were detected more frequently in mutation carriers (82 vs. 70%; p = 0.212). Mutation carriers were characterized by older age, a history of gastric cancer in the family, locally advanced disease, lower histologic grade and luminal B type breast cancer. © 2016 S. Karger AG, Basel.

Preexisting compensatory amino acids compromise fitness costs of a HIV-1 T cell escape mutation

DOE PAGES

Liu, Donglai; Zuo, Tao; Hora, Bhavna; ...

2014-01-01

Background: Fitness costs and slower disease progression are associated with a cytolytic T lymphocyte (CTL) escape mutation T242N in Gag in HIV-1-infected individuals carrying HLA-B*57/5801 alleles. However, the impact of different context in diverse HIV-1 strains on the fitness costs due to the T242N mutation has not been well characterized. To better understand the extent of fitness costs of the T242N mutation and the repair of fitness loss through compensatory amino acids, we investigated its fitness impact in different transmitted/founder (T/F) viruses. Results: The T242N mutation resulted in various levels of fitness loss in four different T/F viruses. However, themore » fitness costs were significantly compromised by preexisting compensatory amino acids in (Isoleucine at position 247) or outside (glutamine at position 219) the CTL epitope. Moreover, the transmitted T242N escape mutant in subject CH131 was as fit as the revertant N242T mutant and the elimination of the compensatory amino acid I247 in the T/F viral genome resulted in significant fitness cost, suggesting the fitness loss caused by the T242N mutation had been fully repaired in the donor at transmission. Analysis of the global circulating HIV-1 sequences in the Los Alamos HIV Sequence Database showed a high prevalence of compensatory amino acids for the T242N mutation and other T cell escape mutations. Conclusions: Our results show that the preexisting compensatory amino acids in the majority of circulating HIV-1 strains could significantly compromise the fitness loss due to CTL escape mutations and thus increase challenges for T cell based vaccines.« less

Functional analysis of mutations in SLC7A9, and genotype-phenotype correlation in non-Type I cystinuria.

PubMed

Font, M A; Feliubadaló, L; Estivill, X; Nunes, V; Golomb, E; Kreiss, Y; Pras, E; Bisceglia, L; d'Adamo, A P; Zelante, L; Gasparini, P; Bassi, M T; George , A L; Manzoni, M; Riboni, M; Ballabio, A; Borsani, G; Reig, N; Fernández, E; Zorzano, A; Bertran, J; Palacín, M

2001-02-15

Cystinuria (OMIM 220100) is a common recessive disorder of renal reabsorption of cystine and dibasic amino acids that results in nephrolithiasis of cystine. Mutations in SLC3A1, which encodes rBAT, cause Type I cystinuria, and mutations in SLC7A9, which encodes a putative subunit of rBAT (b(o,+)AT), cause non-Type I cystinuria. Here we describe the genomic structure of SLC7A9 (13 exons) and 28 new mutations in this gene that, together with the seven previously reported, explain 79% of the alleles in 61 non-Type I cystinuria patients. These data demonstrate that SLC7A9 is the main non-Type I cystinuria gene. Mutations G105R, V170M, A182T and R333W are the most frequent SLC7A9 missense mutations found. Among heterozygotes carrying these mutations, A182T heterozygotes showed the lowest urinary excretion values of cystine and dibasic amino acids. Functional analysis of mutation A182T after co-expression with rBAT in HeLa cells revealed significant residual transport activity. In contrast, mutations G105R, V170M and R333W are associated to a complete or almost complete loss of transport activity, leading to a more severe urinary phenotype in heterozygotes. SLC7A9 mutations located in the putative transmembrane domains of b(o,+)AT and affecting conserved amino acid residues with a small side chain generate a severe phenotype, while mutations in non-conserved residues give rise to a mild phenotype. These data provide the first genotype-phenotype correlation in non-Type I cystinuria, and show that a mild urinary phenotype in heterozygotes may associate with mutations with significant residual transport activity.

Recurrent SETBP1 mutations in atypical chronic myeloid leukemia

PubMed Central

Piazza, Rocco; Valletta, Simona; Winkelmann, Nils; Redaelli, Sara; Spinelli, Roberta; Pirola, Alessandra; Antolini, Laura; Mologni, Luca; Donadoni, Carla; Papaemmanuil, Elli; Schnittger, Susanne; Kim, Dong-Wook; Boultwood, Jacqueline; Rossi, Fabio; Gaipa, Giuseppe; De Martini, Greta P; di Celle, Paola Francia; Jang, Hyun Gyung; Fantin, Valeria; Bignell, Graham R; Magistroni, Vera; Haferlach, Torsten; Pogliani, Enrico Maria; Campbell, Peter J; Chase, Andrew J; Tapper, William J; Cross, Nicholas C P; Gambacorti-Passerini, Carlo

2013-01-01

Atypical chronic myeloid leukemia (aCML) shares clinical and laboratory features with CML, but it lacks the BCR-ABL1 fusion. We performed exome sequencing of eight aCMLs and identified somatic alterations of SETBP1 (encoding a p.Gly870Ser alteration) in two cases. Targeted resequencing of 70 aCMLs, 574 diverse hematological malignancies and 344 cancer cell lines identified SETBP1 mutations in 24 cases, including 17 of 70 aCMLs (24.3%; 95% confidence interval (CI) = 16–35%). Most mutations (92%) were located between codons 858 and 871 and were identical to changes seen in individuals with Schinzel-Giedion syndrome. Individuals with mutations had higher white blood cell counts (P = 0.008) and worse prognosis (P = 0.01). The p.Gly870Ser alteration abrogated a site for ubiquitination, and cells exogenously expressing this mutant exhibited higher amounts of SETBP1 and SET protein, lower PP2A activity and higher proliferation rates relative to those expressing the wild-type protein. In summary, mutated SETBP1 represents a newly discovered oncogene present in aCML and closely related diseases. PMID:23222956

BCR-ABL1: Test

MedlinePlus

... Acid-Fast Bacillus (AFB) Testing Activated Clotting Time Acute Viral Hepatitis Panel Adenosine Deaminase Adrenocorticotropic Hormone (ACTH) ... Guillain-Barré Syndrome Hashimoto Thyroiditis Heart Attack and Acute Coronary Syndrome Heart Disease Hemochromatosis Hemoglobin Abnormalities Hepatitis ...

Molecular Characterization of Isoniazid-Resistant Mycobacterium tuberculosis Isolates Collected in Australia

PubMed Central

Lavender, Caroline; Globan, Maria; Sievers, Aina; Billman-Jacobe, Helen; Fyfe, Janet

2005-01-01

Elucidation of the molecular basis of isoniazid (INH) resistance in Mycobacterium tuberculosis has led to the development of different genotypic approaches for the rapid detection of INH resistance in clinical isolates. Mutations in katG, in particular the S315T substitution, are responsible for INH resistance in a large proportion of tuberculosis cases. However, the frequency of the katG S315T substitution varies with population samples. In this study, 52 epidemiologically unrelated clinical INH-resistant M. tuberculosis isolates collected in Australia were screened for mutations at katG codon 315 and the fabG1-inhA regulatory region. Importantly, 52 INH-sensitive isolates, selected to reflect the geographic and genotypic diversity of the isolates, were also included for comparison. The katG S315T substitution and fabG1-inhA −15 C-to-T mutation were identified in 34 and 13 of the 52 INH-resistant isolates, respectively, and none of the INH-sensitive isolates. Three novel katG mutations, D117A, M257I, and G491C, were identified in three INH-resistant strains with a wild-type katG codon 315, fabG1-inhA regulatory region, and inhA structural gene. When analyzed for possible associations between resistance mechanisms, resistance phenotype, and genotypic groups, it was found that neither the katG S315T nor fabG1-inhA −15 C-to-T mutation clustered with any one genotypic group, but that the −15 C-to-T substitution was associated with isolates with intermediate INH resistance and isolates coresistant to ethionamide. In total, 90.4% of unrelated INH-resistant isolates could be identified by analysis of just two loci: katG315 and the fabG1-inhA regulatory region. PMID:16189082

41 CFR 105-68.315 - May I use the services of an excluded person as a principal under a covered transaction?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false May I use the services of an excluded person as a principal under a covered transaction? 105-68.315 Section 105-68.315 Public Contracts and Property Management Federal Property Management Regulations System (Continued...

Investigating the Structural Impacts of I64T and P311S Mutations in APE1-DNA Complex: A Molecular Dynamics Approach

PubMed Central

Doss, C. George Priya; NagaSundaram, N.

2012-01-01

Background Elucidating the molecular dynamic behavior of Protein-DNA complex upon mutation is crucial in current genomics. Molecular dynamics approach reveals the changes on incorporation of variants that dictate the structure and function of Protein-DNA complexes. Deleterious mutations in APE1 protein modify the physicochemical property of amino acids that affect the protein stability and dynamic behavior. Further, these mutations disrupt the binding sites and prohibit the protein to form complexes with its interacting DNA. Principal Findings In this study, we developed a rapid and cost-effective method to analyze variants in APE1 gene that are associated with disease susceptibility and evaluated their impacts on APE1-DNA complex dynamic behavior. Initially, two different in silico approaches were used to identify deleterious variants in APE1 gene. Deleterious scores that overlap in these approaches were taken in concern and based on it, two nsSNPs with IDs rs61730854 (I64T) and rs1803120 (P311S) were taken further for structural analysis. Significance Different parameters such as RMSD, RMSF, salt bridge, H-bonds and SASA applied in Molecular dynamic study reveals that predicted deleterious variants I64T and P311S alters the structure as well as affect the stability of APE1-DNA interacting functions. This study addresses such new methods for validating functional polymorphisms of human APE1 which is critically involved in causing deficit in repair capacity, which in turn leads to genetic instability and carcinogenesis. PMID:22384055

Mutations with epigenetic effects in myeloproliferative neoplasms and recent progress in treatment: Proceedings from the 5th International Post-ASH Symposium

PubMed Central

Tefferi, A; Abdel-Wahab, O; Cervantes, F; Crispino, J D; Finazzi, G; Girodon, F; Gisslinger, H; Gotlib, J; Kiladjian, J-J; Levine, R L; Licht, J D; Mullally, A; Odenike, O; Pardanani, A; Silver, R T; Solary, E; Mughal, T

2011-01-01

Immediately following the 2010 annual American Society of Hematology (ASH) meeting, the 5th International Post-ASH Symposium on Chronic Myelogenous Leukemia and BCR-ABL1-Negative Myeloproliferative Neoplasms (MPNs) took place on 7–8 December 2010 in Orlando, Florida, USA. During this meeting, the most recent advances in laboratory research and clinical practice, including those that were presented at the 2010 ASH meeting, were discussed among recognized authorities in the field. The current paper summarizes the proceedings of this meeting in BCR-ABL1-negative MPN. We provide a detailed overview of new mutations with putative epigenetic effects (TET oncogene family member 2 (TET2), additional sex comb-like 1 (ASXL1), isocitrate dehydrogenase (IDH) and enhancer of zeste homolog 2 (EZH2)) and an update on treatment with Janus kinase (JAK) inhibitors, pomalidomide, everolimus, interferon-α, midostaurin and cladribine. In addition, the new ‘Dynamic International Prognostic Scoring System (DIPSS)-plus' prognostic model for primary myelofibrosis (PMF) and the clinical relevance of distinguishing essential thrombocythemia from prefibrotic PMF are discussed. PMID:23471017

Effects of Mutations on Replicative Fitness and Major Histocompatibility Complex Class I Binding Affinity Are Among the Determinants Underlying Cytotoxic-T-Lymphocyte Escape of HIV-1 Gag Epitopes.

PubMed

Du, Yushen; Zhang, Tian-Hao; Dai, Lei; Zheng, Xiaojuan; Gorin, Aleksandr M; Oishi, John; Wu, Ting-Ting; Yoshizawa, Janice M; Li, Xinmin; Yang, Otto O; Martinez-Maza, Otoniel; Detels, Roger; Sun, Ren

2017-11-28

Certain "protective" major histocompatibility complex class I (MHC-I) alleles, such as B*57 and B*27, are associated with long-term control of HIV-1 in vivo mediated by the CD8 + cytotoxic-T-lymphocyte (CTL) response. However, the mechanism of such superior protection is not fully understood. Here we combined high-throughput fitness profiling of mutations in HIV-1 Gag, in silico prediction of MHC-peptide binding affinity, and analysis of intraperson virus evolution to systematically compare differences with respect to CTL escape mutations between epitopes targeted by protective MHC-I alleles and those targeted by nonprotective MHC-I alleles. We observed that the effects of mutations on both viral replication and MHC-I binding affinity are among the determinants of CTL escape. Mutations in Gag epitopes presented by protective MHC-I alleles are associated with significantly higher fitness cost and lower reductions in binding affinity with respect to MHC-I. A linear regression model accounting for the effect of mutations on both viral replicative capacity and MHC-I binding can explain the protective efficacy of MHC-I alleles. Finally, we found a consistent pattern in the evolution of Gag epitopes in long-term nonprogressors versus progressors. Overall, our results suggest that certain protective MHC-I alleles allow superior control of HIV-1 by targeting epitopes where mutations typically incur high fitness costs and small reductions in MHC-I binding affinity. IMPORTANCE Understanding the mechanism of viral control achieved in long-term nonprogressors with protective HLA alleles provides insights for developing functional cure of HIV infection. Through the characterization of CTL escape mutations in infected persons, previous researchers hypothesized that protective alleles target epitopes where escape mutations significantly reduce viral replicative capacity. However, these studies were usually limited to a few mutations observed in vivo Here we utilized our recently

Calibration of BCR-ABL1 mRNA quantification methods using genetic reference materials is a valid strategy to report results on the international scale.

PubMed

Mauté, Carole; Nibourel, Olivier; Réa, Delphine; Coiteux, Valérie; Grardel, Nathalie; Preudhomme, Claude; Cayuela, Jean-Michel

2014-09-01

Until recently, diagnostic laboratories that wanted to report on the international scale had limited options: they had to align their BCR-ABL1 quantification methods through a sample exchange with a reference laboratory to derive a conversion factor. However, commercial methods calibrated on the World Health Organization genetic reference panel are now available. We report results from a study designed to assess the comparability of the two alignment strategies. Sixty follow-up samples from chronic myeloid leukemia patients were included. Two commercial methods calibrated on the genetic reference panel were compared to two conversion factor methods routinely used at Saint-Louis Hospital, Paris, and at Lille University Hospital. Results were matched against concordance criteria (i.e., obtaining at least two of the three following landmarks: 50, 75 and 90% of the patient samples within a 2-fold, 3-fold and 5-fold range, respectively). Out of the 60 samples, more than 32 were available for comparison. Compared to the conversion factor method, the two commercial methods were within a 2-fold, 3-fold and 5-fold range for 53 and 59%, 89 and 88%, 100 and 97%, respectively of the samples analyzed at Saint-Louis. At Lille, results were 45 and 85%, 76 and 97%, 100 and 100%, respectively. Agreements between methods were observed in the four comparisons performed. Our data show that the two commercial methods selected are concordant with the conversion factor methods. This study brings the proof of principle that alignment on the international scale using the genetic reference panel is compatible with the patient sample exchange procedure. We believe that these results are particularly important for diagnostic laboratories wishing to adopt commercial methods. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Anti-Interferon Alpha Antibodies in Patients with High-Risk BCR/ABL-Negative Myeloproliferative Neoplasms Treated with Recombinant Human Interferon-α

PubMed Central

Li, Limei

2018-01-01

Background The objective of this study was to characterize the incidence and impact of immunogenicity to interferon-α (IFN-α-2a, IFN-α-2b, and Peg-IFN-α-2a) over a period of 12 months in patients with BCR/ABL-negative myeloproliferative neoplasms (MPNs). Material/Methods A total of 131 patients from an observational prospective cohort were selected. Antidrug antibodies, in serial serum samples obtained monthly after initiation of therapy, were measured by ELISA and WISH/VSV CPE assays. The association between antidrug antibodies and treatment response and adverse effects was evaluated. Results Among patients who completed 12 months of follow-up, binding antibodies (BAbs) were detected in 53% of those receiving IFN-α (69 of 131) and neutralizing antibodies (NAbs) were detected in 19% (25 of 131). NAbs-positivity was correlated with poorer clinical response, and Bab-positivity was associated with more adverse events. Almost all BAbs and NAbs appeared within 8 months after treatment began (≥95%). Complete remission (CR) rate was 62% for patients who were BAbs-positive and 69% for patients who were BAbs-negative; however, the CR rate of patients with NAbs(+) (24%) was obviously lower than in patients with NAbs(−) (75%). Patients with BAbs(+) had more immune adverse effects (including fever, myalgia, skin reaction, and stomatitis) than BAbs(−) patients, and NAbs to IFN-α had no obvious influence on the adverse effects rate. Conclusions The development of BAbs and NAbs can adversely affect IFN-α treatment in patients with MPN. PMID:29693647

Anti-Interferon Alpha Antibodies in Patients with High-Risk BCR/ABL-Negative Myeloproliferative Neoplasms Treated with Recombinant Human Interferon-α.

PubMed

Aruna; Li, Limei

2018-04-17

BACKGROUND The objective of this study was to characterize the incidence and impact of immunogenicity to interferon-a (IFN-α-2a, IFN-α-2b, and Peg-IFN-α-2a) over a period of 12 months in patients with BCR/ABL-negative myeloproliferative neoplasms (MPNs). MATERIAL AND METHODS A total of 131 patients from an observational prospective cohort were selected. Antidrug antibodies, in serial serum samples obtained monthly after initiation of therapy, were measured by ELISA and WISH/VSV CPE assays. The association between antidrug antibodies and treatment response and adverse effects was evaluated. RESULTS Among patients who completed 12 months of follow-up, binding antibodies (BAbs) were detected in 53% of those receiving IFN-α (69 of 131) and neutralizing antibodies (NAbs) were detected in 19% (25 of 131). NAbs-positivity was correlated with poorer clinical response, and Bab-positivity was associated with more adverse events. Almost all BAbs and NAbs appeared within 8 months after treatment began (≥95%). Complete remission (CR) rate was 62% for patients who were BAbs-positive and 69% for patients who were BAbs-negative; however, the CR rate of patients with NAbs(+) (24%) was obviously lower than in patients with NAbs(-) (75%). Patients with BAbs(+) had more immune adverse effects (including fever, myalgia, skin reaction, and stomatitis) than BAbs(-) patients, and NAbs to IFN-α had no obvious influence on the adverse effects rate. CONCLUSIONS The development of BAbs and NAbs can adversely affect IFN-a treatment in patients with MPN.

Deregulated activation of oncoprotein kinase Tpl2/Cot in HTLV-I-transformed T cells.

PubMed

Babu, Geetha; Waterfield, Michael; Chang, Mikyoung; Wu, Xuefeng; Sun, Shao-Cong

2006-05-19

Protein kinase Tpl2/Cot is encoded by a protooncogene that is cis-activated by retroviral insertion in murine T cell lymphomas. It has remained unclear whether this oncoprotein kinase is mutated or post-translationally activated in human cancer cells. We have shown here that Tpl2/Cot is constitutively activated in human leukemia cell lines transformed by the human T cell leukemia virus type I (HTLV-I). The kinase activity of Tpl2/Cot is normally suppressed through its physical interaction with an inhibitor, the NF-kappaB1 precursor protein p105. Interestingly, a large pool of Tpl2/Cot is liberated from p105 and exhibits constitutive kinase activity in HTLV-I-transformed T cells. In contrast to its labile property in normal cells, the pathologically activated Tpl2/Cot is remarkably stable. Further, whereas the physiological activation of Tpl2/Cot involves its long isoform, the HTLV-activated Tpl2/Cot is predominantly the short isoform. We have also shown that the HTLV-I-encoded Tax protein is able to activate Tpl2/Cot in transfected cells. Finally, Tpl2/Cot participates in the activation of NF-kappaB by Tax. These findings indicate that deregulated activation of Tpl2/Cot may occur in human cancer cells.

Crystal structure of an SH2-kinase construct of c-Abl and effect of the SH2 domain on kinase activity

PubMed Central

Lorenz, Sonja; Deng, Patricia; Hantschel, Oliver; Superti-Furga, Giulio; Kuriyan, John

2018-01-01

Constitutive activation of the non-receptor tyrosine kinase c-Abl (Abl1) in the Bcr-Abl1 fusion oncoprotein is the molecular cause of chronic myeloid leukemia. Recent studies have indicated that an interaction between the SH2 domain and the N-lobe of the c-Abl kinase domain has a critical role in leukemogenesis. To dissect the structural basis of this phenomenon we studied c-Abl constructs comprising the SH2 and kinase domains in vitro. We present a crystal structure of an SH2-kinase domain construct bound to dasatinib, which contains the relevant interface between the SH2 domain and the N-lobe of the kinase domain. We show that the presence of the SH2 domain enhances kinase activity moderately and that this effect depends on contacts in the SH2-N-lobe interface and is abrogated by specific mutations. Consistently, formation of the interface decreases slightly the association rate of imatinib with the kinase domain. That the effects are small compared to the dramatic in vivo consequences suggests an important function of the SH2-N-lobe interaction might be to help disassemble the autoinhibited conformation of c-Abl and promote processive phosphorylation, rather than substantially stimulate kinase activity. PMID:25779001

JAK2 aberrations in childhood B-cell precursor acute lymphoblastic leukemia

PubMed Central

de Goffau-Nobel, Willemieke; Hoogkamer, Alex Q.; Boer, Judith M.; Boeree, Aurélie; van de Ven, Cesca; Koudijs, Marco J.; Besselink, Nicolle J.M.; de Groot-Kruseman, Hester A.; Zwaan, Christian Michel; Horstmann, Martin A.; Pieters, Rob; den Boer, Monique L.

2017-01-01

JAK2 abnormalities may serve as target for precision medicines in pediatric B-cell precursor acute lymphoblastic leukemia (BCP-ALL). In the current study we performed a screening for JAK2 mutations and translocations, analyzed the clinical outcome and studied the efficacy of two JAK inhibitors in primary BCP-ALL cells. Importantly, we identify a number of limitations of JAK inhibitor therapy. JAK2 mutations mainly occurred in the poor prognostic subtypes BCR-ABL1-like and non- BCR-ABL1-like B-other (negative for sentinel cytogenetic lesions). JAK2 translocations were restricted to BCR-ABL1-like cases. Momelotinib and ruxolitinib were cytotoxic in both JAK2 translocated and JAK2 mutated cells, although efficacy in JAK2 mutated cells highly depended on cytokine receptor activation by TSLP. However, our data also suggest that the effect of JAK inhibition may be compromised by mutations in alternative survival pathways and microenvironment-induced resistance. Furthermore, inhibitors induced accumulation of phosphorylated JAK2Y1007, which resulted in a profound re-activation of JAK2 signaling upon release of the inhibitors. This preclinical evidence implies that further optimization and evaluation of JAK inhibitor treatment is necessary prior to its clinical integration in pediatric BCP-ALL. PMID:29163799

Two novel mutations of pfdhps K540T and I588F, affecting sulphadoxine-pyrimethamine-resistant response in uncomplicated falciparum malaria at Banjar district, South Kalimantan Province, Indonesia

PubMed Central

2014-01-01

Background Mutations in pfdhfr and pfdhps genes have been shown to associate with sulphadoxine-pyrimethamine (SP) resistance of Plasmodium falciparum parasites. However, pfdhfr, pfdhps genotypes and the correlations to SP treatment outcome in Indonesia has not yet been well analysed. Methods After obtaining informed consent, 61 uncomplicated falciparum malaria patients were recruited in Banjar district, South Kalimantan Province, Indonesia, from October 2009 to August 2010. They were treated by a single oral dose of SP and its effects on clinical and parasitological status were followed until day 28 after treatment. Occasionally, a thick smear blood film for microscopy observation and blood spot on a filter paper for pfdhfr and pfdhps genotype analysis were collected. Results Pfdhfr and pfdhps genotypes from 24 P. falciparum-infected patients consisting of adequate clinical parasitological response (ACPR) (n = 6; 25.0%) and early treatment failure (ETF) (n = 10; 41.7%) or late parasitological failure (LPF) (n = 8; 33.3%) were obtained by sequencing. Two novel mutations of pfdhps gene, K540T and I588F, were determined in ten and five isolates, respectively. These mutations were present in the pfdhfr/pfdhps combined haplotypes of ANRNI/SGTGA (n = 6), ANRNL/SGTGA (n = 4), and ANRNI/SGEAA(588F) (n = 5), (mutation codons are bold typed); these haplotypes were mostly belonging to parasitological failure (ETF or LPF). The parasites acquiring five mutations in pfdhfr/pfdhps haplotypes and four mutations with additional I588F did not respond adequately to SP treatment. Conclusion Many of Plasmodium falciparum infected patients in Banjar district, South Kalimantan, Indonesia did not respond adequately to SP treatment and these low ineffectiveness of SP in this area was associated with two novel mutations of pfdhps, K540T and I588F. PMID:25187019

Two novel mutations of pfdhps K540T and I588F, affecting sulphadoxine-pyrimethamine-resistant response in uncomplicated falciparum malaria at Banjar district, South Kalimantan Province, Indonesia.

PubMed

Basuki, Sukmawati; Fitriah; Riyanto, Sugeng; Budiono; Dachlan, Yoes P; Uemura, Haruki

2014-04-04

Mutations in pfdhfr and pfdhps genes have been shown to associate with sulphadoxine-pyrimethamine (SP) resistance of Plasmodium falciparum parasites. However, pfdhfr, pfdhps genotypes and the correlations to SP treatment outcome in Indonesia has not yet been well analysed. After obtaining informed consent, 61 uncomplicated falciparum malaria patients were recruited in Banjar district, South Kalimantan Province, Indonesia, from October 2009 to August 2010. They were treated by a single oral dose of SP and its effects on clinical and parasitological status were followed until day 28 after treatment. Occasionally, a thick smear blood film for microscopy observation and blood spot on a filter paper for pfdhfr and pfdhps genotype analysis were collected. Pfdhfr and pfdhps genotypes from 24 P. falciparum-infected patients consisting of adequate clinical parasitological response (ACPR) (n = 6; 25.0%) and early treatment failure (ETF) (n = 10; 41.7%) or late parasitological failure (LPF) (n = 8; 33.3%) were obtained by sequencing. Two novel mutations of pfdhps gene, K540T and I588F, were determined in ten and five isolates, respectively. These mutations were present in the pfdhfr/pfdhps combined haplotypes of ANRNI/SGTGA (n = 6), ANRNL/SGTGA (n = 4), and ANRNI/SGEAA(588F) (n = 5), (mutation codons are bold typed); these haplotypes were mostly belonging to parasitological failure (ETF or LPF). The parasites acquiring five mutations in pfdhfr/pfdhps haplotypes and four mutations with additional I588F did not respond adequately to SP treatment. Many of Plasmodium falciparum infected patients in Banjar district, South Kalimantan, Indonesia did not respond adequately to SP treatment and these low ineffectiveness of SP in this area was associated with two novel mutations of pfdhps, K540T and I588F.

Characterization of mouse and human GTP cyclohydrolase I genes. Mutations in patients with GTP cyclohydrolase I deficiency.

PubMed

Ichinose, H; Ohye, T; Matsuda, Y; Hori, T; Blau, N; Burlina, A; Rouse, B; Matalon, R; Fujita, K; Nagatsu, T

1995-04-28

GTP cyclohydrolase I is the first and rate-limiting enzyme for the biosynthesis of tetrahydrobiopterin in mammals. Previously, we reported three species of human GTP cyclohydrolase I cDNA in a human liver cDNA library (Togari, A., Ichinose, H., Matsumoto, S., Fujita, K., and Nagatsu, T. (1992) Biochem. Biophys. Res. Commun. 187, 359-365). Furthermore, very recently, we found that the GTP cyclohydrolase I gene is causative for hereditary progressive dystonia with marked diurnal fluctuation, also known as DOPA-responsive dystonia (Ichinose, H., Ohye, T., Takahashi, E., Seki, N., Hori, T., Segawa, M., Nomura, Y., Endo, K., Tanaka, H., Tsuji, S., Fujita, K., and Nagatsu, T. (1994) Nature Genetics 8, 236-242). To clarify the mechanisms that regulate transcription of the GTP cyclohydrolase I gene and to generate multiple species of mRNA, we isolated genomic DNA clones for the human and mouse GTP cyclohydrolase I genes. Structural analysis of the isolated clones revealed that the GTP cyclohydrolase I gene is encoded by a single copy gene and is composed of six exons spanning approximately 30 kilobases. We sequenced all exon/intron boundaries of the human and mouse genes. Structural analysis also demonstrated that the heterogeneity of GTP cyclohydrolase I mRNA is caused by an alternative usage of the splicing acceptor site at the sixth exon. The transcription start site of the mouse GTP cyclohydrolase I gene and the 5'-flanking sequences of the mouse and human genes were determined. We performed regional mapping of the mouse gene by fluorescence in situ hybridization, and the mouse GTP cyclohydrolase I gene was assigned to region C2-3 of mouse chromosome 14. We identified missense mutations in patients with GTP cyclohydrolase I deficiency and expressed mutated enzymes in Escherichia coli to confirm alterations in the enzyme activity.

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

Exome Sequencing Identifies Mitochondrial Alanyl-tRNA Synthetase Mutations in Infantile Mitochondrial Cardiomyopathy

PubMed Central

Götz, Alexandra; Tyynismaa, Henna; Euro, Liliya; Ellonen, Pekka; Hyötyläinen, Tuulia; Ojala, Tiina; Hämäläinen, Riikka H.; Tommiska, Johanna; Raivio, Taneli; Oresic, Matej; Karikoski, Riitta; Tammela, Outi; Simola, Kalle O.J.; Paetau, Anders; Tyni, Tiina; Suomalainen, Anu

2011-01-01

Infantile cardiomyopathies are devastating fatal disorders of the neonatal period or the first year of life. Mitochondrial dysfunction is a common cause of this group of diseases, but the underlying gene defects have been characterized in only a minority of cases, because tissue specificity of the manifestation hampers functional cloning and the heterogeneity of causative factors hinders collection of informative family materials. We sequenced the exome of a patient who died at the age of 10 months of hypertrophic mitochondrial cardiomyopathy with combined cardiac respiratory chain complex I and IV deficiency. Rigorous data analysis allowed us to identify a homozygous missense mutation in AARS2, which we showed to encode the mitochondrial alanyl-tRNA synthetase (mtAlaRS). Two siblings from another family, both of whom died perinatally of hypertrophic cardiomyopathy, had the same mutation, compound heterozygous with another missense mutation. Protein structure modeling of mtAlaRS suggested that one of the mutations affected a unique tRNA recognition site in the editing domain, leading to incorrect tRNA aminoacylation, whereas the second mutation severely disturbed the catalytic function, preventing tRNA aminoacylation. We show here that mutations in AARS2 cause perinatal or infantile cardiomyopathy with near-total combined mitochondrial respiratory chain deficiency in the heart. Our results indicate that exome sequencing is a powerful tool for identifying mutations in single patients and allows recognition of the genetic background in single-gene disorders of variable clinical manifestation and tissue-specific disease. Furthermore, we show that mitochondrial disorders extend to prenatal life and are an important cause of early infantile cardiac failure. PMID:21549344

Intracellular Retention of ABL Kinase Inhibitors Determines Commitment to Apoptosis in CML Cells

PubMed Central

Dziadosz, Marek; Schnöder, Tina; Heidel, Florian; Schemionek, Mirle; Melo, Junia V.; Kindler, Thomas; Müller-Tidow, Carsten; Koschmieder, Steffen; Fischer, Thomas

2012-01-01

Clinical development of imatinib in CML established continuous target inhibition as a paradigm for successful tyrosine kinase inhibitor (TKI) therapy. However, recent reports suggested that transient potent target inhibition of BCR-ABL by high-dose TKI (HD-TKI) pulse-exposure is sufficient to irreversibly commit cells to apoptosis. Here, we report a novel mechanism of prolonged intracellular TKI activity upon HD-TKI pulse-exposure (imatinib, dasatinib) in BCR-ABL-positive cells. Comprehensive mechanistic exploration revealed dramatic intracellular accumulation of TKIs which closely correlated with induction of apoptosis. Cells were rescued from apoptosis upon HD-TKI pulse either by repetitive drug wash-out or by overexpression of ABC-family drug transporters. Inhibition of ABCB1 restored sensitivity to HD-TKI pulse-exposure. Thus, our data provide evidence that intracellular drug retention crucially determines biological activity of imatinib and dasatinib. These studies may refine our current thinking on critical requirements of TKI dose and duration of target inhibition for biological activity of TKIs. PMID:22815843

Evidence-based guidelines for the use of tyrosine kinase inhibitors in adults with Philadelphia chromosome–positive or BCR-ABL–positive acute lymphoblastic leukemia: a Canadian consensus

PubMed Central

Couban, S.; Savoie, L.; Mourad, Y. Abou; Leber, B.; Minden, M.; Turner, R.; Palada, V.; Shehata, N.; Christofides, A.; Lachance, S.

2014-01-01

Adult Philadelphia chromosome–positive (Ph+) or BCR-ABL–positive (BCR-ABL+) acute lymphoblastic leukemia (all) is an acute leukemia previously associated with a high relapse rate, short disease-free survival, and poor overall survival. In adults, allogeneic hematopoietic cell transplant in first remission remains the only proven curative strategy for transplant-eligible patients. The introduction of tyrosine kinase inhibitors (tkis) in the treatment of patients with Ph+ or BCR-ABL+ all has significantly improved the depth and duration of complete remission, allowing more patients to proceed to transplantation. Although tkis are now considered a standard of care in this setting, few randomized trials have examined the optimal use of tkis in patients with Ph+ all. Questions of major importance remain, including the best way to administer these medications, the choice of tki to administer, and the schedule and the duration to use. We present the results of a systematic review of the literature with consensus recommendations based on the available evidence. PMID:24764712

Acquired initiating mutations in early hematopoietic cells of CLL patients.

PubMed

Damm, Frederik; Mylonas, Elena; Cosson, Adrien; Yoshida, Kenichi; Della Valle, Véronique; Mouly, Enguerran; Diop, M'boyba; Scourzic, Laurianne; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Kikushige, Yoshikane; Davi, Frederick; Lambert, Jérôme; Gautheret, Daniel; Merle-Béral, Hélène; Sutton, Laurent; Dessen, Philippe; Solary, Eric; Akashi, Koichi; Vainchenker, William; Mercher, Thomas; Droin, Nathalie; Ogawa, Seishi; Nguyen-Khac, Florence; Bernard, Olivier A

2014-09-01

Appropriate cancer care requires a thorough understanding of the natural history of the disease, including the cell of origin, the pattern of clonal evolution, and the functional consequences of the mutations. Using deep sequencing of flow-sorted cell populations from patients with chronic lymphocytic leukemia (CLL), we established the presence of acquired mutations in multipotent hematopoietic progenitors. Mutations affected known lymphoid oncogenes, including BRAF, NOTCH1, and SF3B1. NFKBIE and EGR2 mutations were observed at unexpectedly high frequencies, 10.7% and 8.3% of 168 advanced-stage patients, respectively. EGR2 mutations were associated with a shorter time to treatment and poor overall survival. Analyses of BRAF and EGR2 mutations suggest that they result in deregulation of B-cell receptor (BCR) intracellular signaling. Our data propose disruption of hematopoietic and early B-cell differentiation through the deregulation of pre-BCR signaling as a phenotypic outcome of CLL mutations and show that CLL develops from a pre-leukemic phase. The origin and pathogenic mechanisms of CLL are not fully understood. The current work indicates that CLL develops from pre-leukemic multipotent hematopoietic progenitors carrying somatic mutations. It advocates for abnormalities in early B-cell differentiation as a phenotypic convergence of the diverse acquired mutations observed in CLL. ©2014 American Association for Cancer Research.

Syk Mediates BCR- and CD40-Signaling Intergration during B Cell Activation

PubMed Central

Ying, Haiyan; Li, Zhenping; Yang, Lifen; Zhang, Jian

2010-01-01

CD40 is essential for optimal B cell activation. It has been shown that CD40 stimulation can augment BCR-induced B cell responses, but the molecular mechanism(s) by which CD40 regulates BCR signaling is poorly understood. In this report, we attempted to characterize the signaling synergy between BCR- and CD40-mediated pathways during B cell activation. We found that spleen tyrosine kinase (Syk) is involved in CD40 signaling, and is synergistically activated in B cells in response to BCR/CD40 costimulation. CD40 stimulation alone also activates B cell linker (BLNK), Bruton tyrosine kinase (Btk), and Vav-2 downstream of Syk, and significantly enhances BCR-induced formation of complex consisting of, Vav-2, Btk, BLNK, and phospholipase C-gamma2 (PLC-γ2) leading to activation of extracellular signal-regulated kinase (ERK), p38 mitogen-activated protein kinase, Akt, and NF-κB required for optimal B cell activation. Therefore, our data suggest that CD40 can strengthen BCR-signaling pathway and quantitatively modify BCR signaling during B cell activation. PMID:21074890

Pyrethroid resistance in Sitophilus zeamais is associated with a mutation (T929I) in the voltage-gated sodium channel.

PubMed

Araújo, Rúbia A; Williamson, Martin S; Bass, Christopher; Field, Linda M; Duce, Ian R

2011-08-01

The maize weevil, Sitophilus zeamais, is the most important pest affecting stored grain in Brazil and its control relies heavily on the use of insecticides. The intensive use of compounds such as the pyrethroids has led to the emergence of resistance, and previous studies have suggested that resistance to both pyrethroids and 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT) may result from reduced sensitivity of the insecticide target, the voltage-gated sodium channel. To identify the molecular mechanisms underlying pyrethroid resistance in S. zeamais, the domain II region of the voltage-gated sodium channel (para-orthologue) gene was amplified by PCR and sequenced from susceptible and resistant laboratory S. zeamais strains that were selected with a discriminating dose of DDT. A single point mutation, T929I, was found in the para gene of the resistant S. zeamais populations and its presence in individual weevils was strongly associated with survival after DDT exposure. This is the first identification of a target-site resistance mutation in S. zeamais and unusually it is a super-kdr type mutation occurring in the absence of the more common kdr (L1014F) substitution. A high-throughput assay based on TaqMan single nucleotide polymorphism genotyping was developed for sensitive detection of the mutation and used to screen field-collected strains of S. zeamais. This showed that the mutation is present at low frequency in field populations and is a useful tool for informing control strategies. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

Glycosylation of IgG B cell receptor (IgG BCR) in multiple myeloma: relationship between sialylation and the signal activity of IgG BCR.

PubMed

Ilić, Vesna; Milosević-Jovcić, Nadezda; Petrović, Sonja; Marković, Dragana; Stefanović, Gordana; Ristić, Tatjana

2008-05-01

Little is known about the glycosylation of the isotype switched B cell receptor (BCR) in multiple myeloma, and the way it might affect receptor function. In this work IgG BCRs isolated from the individual lysates of peripheral blood lymphocytes (PBL) of 32 patients with IgG multiple myeloma and healthy controls were investigated for the expression of sialic acid (SA), galactose (Gal) and N-acetylglucosamine (GlcNAc), the sugars known to specify the glycoforms of human serum IgG. The degree of glycosylation and signaling status of all 32 isolated myeloma IgG BCRs were correlated and compared with the glycosylation of the IgG paraproteins isolated from sera of the same patients. It was shown that BCR IgG in myeloma is more heavily sialylated when compared with normal controls, that the increased sialylation of IgG BCR is associated with higher levels of tyrosine phosphorylation (signaling activity) of the IgG BCR supramolecular complex and that BCR IgG and serum IgG paraprotein from the same patient differed in all cases in the levels of terminal sugar expression. The results suggest that the development of the malignant clone in MM from post-switch B cells expressing IgG BCR at their surfaces to plasma cells secreting IgG paraprotein may be followed by permanent glycosylation changes in the IgG molecules.

Non-syndromic hearing loss caused by the dominant cis mutation R75Q with the recessive mutation V37I of the GJB2 (Connexin 26) gene.

PubMed

Kim, Juwon; Jung, Jinsei; Lee, Min Goo; Choi, Jae Young; Lee, Kyung-A

2015-06-19

GJB2 alleles containing two cis mutations have been rarely found in non-syndromic hearing loss. Herein, we present a Korean patient with non-syndromic hearing loss caused by the R75Q cis mutation with V37I, which arose de novo in the father and was inherited by the patient. Biochemical coupling and hemichannel permeability assays were performed after molecular cloning and transfection of HEK293T cells. Student's t-tests or analysis of variance followed by Tukey's multiple comparison test was used as statistical analysis. Biochemical coupling was significantly reduced in connexin 26 (Cx26)-R75Q- and Cx26-V37I-transfected cells, with greater extent in Cx26-R75Q and Cx26-R75Q+V37I cells. Interestingly, our patient and his father with the mutations had more residual hearing compared with patients with the dominant mutation alone. Although the difference in hemichannel activity between R75Q alone and R75Q in combination with V37I failed to reach significance, it is of note that there is a possibility that V37I located upstream of R75Q might have the ability to ameliorate R75Q expression. Our study emphasizes the importance of cis mutations with R75Q, as the gene effect of R75Q can be modulated depending on the type of additional mutation.

The Parkinson Disease-linked LRRK2 Protein Mutation I2020T Stabilizes an Active State Conformation Leading to Increased Kinase Activity*

PubMed Central

Ray, Soumya; Bender, Samantha; Kang, Stephanie; Lin, Regina; Glicksman, Marcie A.; Liu, Min

2014-01-01

The effect of leucine-rich repeat kinase 2 (LRRK2) mutation I2020T on its kinase activity has been controversial, with both increased and decreased effects being reported. We conducted steady-state and pre-steady-state kinetic studies on LRRKtide and its analog LRRKtideS. Their phosphorylation differs by the rate-limiting steps: product release is rate-limiting for LRRKtide and phosphoryl transfer is rate-limiting for LRRKtideS. As a result, we observed that the I2020T mutant is more active than wild type (WT) LRRK2 for LRRKtideS phosphorylation, whereas it is less active than WT for LRRKtide phosphorylation. Our pre-steady-state kinetic data suggest that (i) the I2020T mutant accelerates the rates of phosphoryl transfer of both reactions by 3–7-fold; (ii) this increase is masked by a rate-limiting product release step for LRRKtide phosphorylation; and (iii) the observed lower activity of the mutant for LRRKtide phosphorylation is a consequence of its instability: the concentration of the active form of the mutant is 3-fold lower than WT. The I2020T mutant has a dramatically low KATP and therefore leads to resistance to ATP competitive inhibitors. Two well known DFG-out or type II inhibitors are also weaker toward the mutant because they inhibit the mutant in an unexpected ATP competitive mechanism. The I2020 residue lies next to the DYG motif of the activation loop of the LRRK2 kinase domain. Our modeling and metadynamic simulations suggest that the I2020T mutant stabilizes the DYG-in active conformation and creates an unusual allosteric pocket that can bind type II inhibitors but in an ATP competitive fashion. PMID:24695735

Mutations on M3 helix of Plutella xylostella glutamate-gated chloride channel confer unequal resistance to abamectin by two different mechanisms.

PubMed

Wang, Xingliang; Puinean, Alin M; O Reilly, Andrias O; Williamson, Martin S; Smelt, Charles L C; Millar, Neil S; Wu, Yidong

2017-07-01

Abamectin is one of the most widely used avermectins for agricultural pests control, but the emergence of resistance around the world is proving a major threat to its sustained application. Abamectin acts by directly activating glutamate-gated chloride channels (GluCls) and modulating other Cys-loop ion channels. To date, three mutations occurring in the transmembrane domain of arthropod GluCls are associated with target-site resistance to abamectin: A309V in Plutella xylostella GluCl (PxGluCl), G323D in Tetranychus urticae GluCl1 (TuGluCl1) and G326E in TuGluCl3. To compare the effects of these mutations in a single system, A309V/I/G and G315E (corresponding to G323 in TuGluCl1 and G326 in TuGluCl3) substitutions were introduced individually into the PxGluCl channel. Functional analysis using Xenopus oocytes showed that the A309V and G315E mutations reduced the sensitivity to abamectin by 4.8- and 493-fold, respectively. In contrast, the substitutions A309I/G show no significant effects on the response to abamectin. Interestingly, the A309I substitution increased the channel sensitivity to glutamate by one order of magnitude (∼12-fold). Analysis of PxGluCl homology models indicates that the G315E mutation interferes with abamectin binding through a steric hindrance mechanism. In contrast, the structural consequences of the A309 mutations are not so clear and an allosteric modification of the binding site is the most likely mechanism. Overall the results show that both A309V and G315E mutations may contribute to target-site resistance to abamectin and may be important for the future prediction and monitoring of abamectin resistance in P. xylostella and other arthropod pests. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dasatinib and Combination Chemotherapy in Treating Young Patients With Newly Diagnosed Acute Lymphoblastic Leukemia

ClinicalTrials.gov

2016-09-08

Adult B Acute Lymphoblastic Leukemia With t(9;22)(q34;q11.2); BCR-ABL1; Childhood B Acute Lymphoblastic Leukemia With t(9;22)(q34;q11.2); BCR-ABL1; Untreated Adult Acute Lymphoblastic Leukemia; Untreated Childhood Acute Lymphoblastic Leukemia

Identification of T-cell Receptors Targeting KRAS-mutated Human Tumors

PubMed Central

Wang, Qiong J.; Yu, Zhiya; Griffith, Kayla; Hanada, Ken-ichi; Restifo, Nicholas P.; Yang, James C.

2015-01-01

KRAS is one of the most frequently mutated proto-oncogenes in human cancers. The dominant oncogenic mutations of KRAS are single amino acid substitutions at codon 12, in particular G12D and G12V present in 60–70% of pancreatic cancers and 20–30% of colorectal cancers. The consistency, frequency, and tumor specificity of these “neo-antigens” make them attractive therapeutic targets. Recent data associates T cells that target mutated antigens with clinical immunotherapy responses in patients with metastatic melanoma, lung cancer, or cholangiocarcinoma. Using HLA-peptide prediction algorithms, we noted that HLA-A*11:01 could potentially present mutated KRAS variants. By immunizing HLA-A*11:01 transgenic mice, we generated murine T cells and subsequently isolated T-cell receptors (TCRs) highly reactive to the mutated KRAS variants G12V and G12D. Peripheral blood lymphocytes (PBLs) transduced with these TCRs could recognize multiple HLA-A*11:01+ tumor lines bearing the appropriate KRAS mutations. In a xenograft model of large established tumor, adoptive transfer of these transduced PBLs reactive with an HLA-A*11:01, G12D-mutated pancreatic cell line could significantly reduce its growth in NSG mice (P = 0.002). The success of adoptive transfer of TCR-engineered T cells against melanoma and other cancers support clinical trials with these T cells that recognize mutated KRAS in patients with a variety of common cancer types. PMID:26701267

Opposing roles of KIT and ABL1 in the therapeutic response of gastrointestinal stromal tumor (GIST) cells to imatinib mesylate.

PubMed

Rausch, Jessica L; Boichuk, Sergei; Ali, Areej A; Patil, Sneha S; Liu, Lijun; Lee, Donna M; Brown, Matthew F; Makielski, Kathleen R; Liu, Ying; Taguchi, Takahiro; Kuan, Shih-Fan; Duensing, Anette

2017-01-17

Most gastrointestinal stromal tumors (GISTs) are caused by activating mutations of the KIT receptor tyrosine kinase. The small molecule inhibitor imatinib mesylate was initially developed to target the ABL1 kinase, which is constitutively activated through chromosomal translocation in BCR-ABL1-positive chronic myeloid leukemia. Because of cross-reactivity of imatinib against the KIT kinase, the drug is also successfully used for the treatment of GIST. Although inhibition of KIT clearly has a major role in the therapeutic response of GIST to imatinib, the contribution of concomitant inhibition of ABL in this context has never been explored. We show here that ABL1 is expressed in the majority of GISTs, including human GIST cell lines. Using siRNA-mediated knockdown, we demonstrate that depletion of KIT in conjunction with ABL1 - hence mimicking imatinib treatment - leads to reduced apoptosis induction and attenuated inhibition of cellular proliferation when compared to depletion of KIT alone. These results are explained by an increased activity of the AKT survival kinase, which is mediated by the cyclin-dependent kinase CDK2, likely through direct phosphorylation. Our results highlight that distinct inhibitory properties of targeted agents can impede antitumor effects and hence provide insights for rational drug development. Novel KIT-targeted agents to treat GIST should therefore comprise an increased specificity for KIT while at the same time displaying a reduced ability to inhibit ABL1.

40 CFR 1051.315 - How do I know when my engine family fails the production-line testing requirements?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 32 2010-07-01 2010-07-01 false How do I know when my engine family... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM RECREATIONAL ENGINES AND VEHICLES Testing Production-Line Vehicles and Engines § 1051.315 How do I know when my engine...

Correction of the Middle Eastern M712T mutation causing GNE myopathy by trans-splicing.

PubMed

Tal-Goldberg, Tzukit; Lorain, Stéphanie; Mitrani-Rosenbaum, Stella

2014-06-01

GNE myopathy is a rare neuromuscular autosomal recessive disease, resulting from mutations in the gene UDP N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE). The most frequent mutation is the single homozygous missense mutation, M712T-the Middle Eastern mutation-located ten amino acids before the end of the protein. We have used an adeno-associated virus (AAV)-based trans-splicing (TS) vector as a gene therapy tool to overcome this mutation by replacing the mutated last exon of GNE by the wild-type exon while preserving the natural endogenous regulatory machinery. We have designed relevant plasmids directed either to mouse or to human GNE. Following transfection of C2C12 murine muscle cells with the mouse TS vectors, we have been able to detect by nested RT-PCR trans-spliced molecules carrying the wild-type exon 12 of GNE. Similarly, transfection of HEK293 human cells with the human-directed TS vectors resulted in the generation of trans-spliced human GNE RNA molecules. Furthermore, infection of primary muscle cells from a GNE myopathy patient carrying the homozygous M712T mutation, with an AAV8-based viral vector carrying a human-directed TS construct, resulted in the generation of wild-type GNE transcripts in addition to the mutated ones. These studies provide a proof of concept that the TS approach could be used to partially correct the Middle Eastern mutation in GNE myopathy patients. These results provide the basis for in vivo research in animal models using the AAV platform with TS plasmids as a potential genetic therapy for GNE myopathy.

Risk factors and outcomes for the Q151M and T69 insertion HIV-1 resistance mutations in historic UK data.

PubMed

Stirrup, Oliver T; Dunn, David T; Tostevin, Anna; Sabin, Caroline A; Pozniak, Anton; Asboe, David; Cox, Alison; Orkin, Chloe; Martin, Fabiola; Cane, Patricia

2018-04-16

The prevalence of HIV-1 resistance to antiretroviral therapies (ART) has declined in high-income countries over recent years, but drug resistance remains a substantial concern in many low and middle-income countries. The Q151M and T69 insertion (T69i) resistance mutations in the viral reverse transcriptase gene can reduce susceptibility to all nucleoside/tide analogue reverse transcriptase inhibitors, motivating the present study to investigate the risk factors and outcomes associated with these mutations. We considered all data in the UK HIV Drug Resistance Database for blood samples obtained in the period 1997-2014. Where available, treatment history and patient outcomes were obtained through linkage to the UK Collaborative HIV Cohort study. A matched case-control approach was used to assess risk factors associated with the appearance of each of the mutations in ART-experienced patients, and survival analysis was used to investigate factors associated with viral suppression. A further analysis using matched controls was performed to investigate the impact of each mutation on survival. A total of 180 patients with Q151M mutation and 85 with T69i mutation were identified, almost entirely from before 2006. Occurrence of both the Q151M and T69i mutations was strongly associated with cumulative period of virological failure while on ART, and for Q151M there was a particular positive association with use of stavudine and negative association with use of boosted-protease inhibitors. Subsequent viral suppression was negatively associated with viral load at sequencing for both mutations, and for Q151M we found a negative association with didanosine use but a positive association with boosted-protease inhibitor use. The results obtained in these analyses were also consistent with potentially large associations with other drugs. Analyses were inconclusive regarding associations between the mutations and mortality, but mortality was high for patients with low CD4 at

Leber's hereditary optic neuropathy (LHON)-associated ND5 12338T > C mutation altered the assembly and function of complex I, apoptosis and mitophagy.

PubMed

Zhang, Juanjuan; Ji, Yanchun; Lu, Yuanyuan; Fu, Runing; Xu, Man; Liu, Xiaoling; Guan, Min-Xin

2018-06-01

Mutations in mitochondrial DNA (mtDNA) have been associated with Leber's hereditary optic neuropathy (LHON) and their pathophysiology remains poorly understood. In this study, we demonstrated that a missense mutation (m.12338T>C, p.1M>T) in the ND5 gene contributed to the pathogenesis of LHON. The m.12338T>C mutation affected the first methionine (Met1) with a threonine and shortened two amino acids of ND5. We therefore hypothesized that the mutated ND5 perturbed the structure and function of complex I. Using the cybrid cell models, generated by fusing mtDNA-less (ρ°) cells with enucleated cells from LHON patients carrying the m.12338T>C mutation and a control subject belonging to the same mtDNA haplogroup, we demonstrated that the m.12338T>C mutation caused the reduction of ND5 polypeptide, perturbed assemble and activity of complex I. Furthermore, the m.12338T>C mutation caused respiratory deficiency, diminished mitochondrial adenosine triphosphate levels and membrane potential and increased the production of reactive oxygen species. The m.12338T>C mutation promoted apoptosis, evidenced by elevated release of cytochrome c into cytosol and increased levels of apoptosis-activated proteins: caspases 9, 3, 7 and Poly ADP ribose polymerase in the cybrids carrying the m.12338T>C mutation, as compared with control cybrids. Moreover, we also document the involvement of m.12338T>C mutation in decreased mitophagy, as showed by reduced levels of autophagy protein light chain 3 and accumulation of autophagic substrate p62 in the in mutant cybrids as compared with control cybrids. These data demonstrated the direct link between mitochondrial dysfunction caused by complex I mutation and apoptosis or mitophagy. Our findings may provide new insights into the pathophysiology of LHON.

31 CFR 315.36 - Payment during life of sole owner.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Payment during life of sole owner. 315.36 Section 315.36 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... § 315.36 Payment during life of sole owner. A savings bond registered in single ownership form (i.e...

Compound heterozygous TYK2 mutations underlie primary immunodeficiency with T-cell lymphopenia.

PubMed

Nemoto, Michiko; Hattori, Hiroyoshi; Maeda, Naoko; Akita, Nobuhiro; Muramatsu, Hideki; Moritani, Suzuko; Kawasaki, Tomonori; Maejima, Masami; Ode, Hirotaka; Hachiya, Atsuko; Sugiura, Wataru; Yokomaku, Yoshiyuki; Horibe, Keizo; Iwatani, Yasumasa

2018-05-03

Complete tyrosine kinase 2 (TYK2) deficiency has been previously described in patients with primary immunodeficiency diseases. The patients were infected with various pathogens, including mycobacteria and/or viruses, and one of the patients developed hyper-IgE syndrome. A detailed immunological investigation of these patients revealed impaired responses to type I IFN, IL-10, IL-12 and IL-23, which are associated with increased susceptibility to mycobacterial and/or viral infections. Herein, we report a recessive partial TYK2 deficiency in two siblings who presented with T-cell lymphopenia characterized by low naïve CD4 + T-cell counts and who developed Epstein-Barr virus (EBV)-associated B-cell lymphoma. Targeted exome-sequencing of the siblings' genomes demonstrated that both patients carried novel compound heterozygous mutations (c.209_212delGCTT/c.691C > T, p.Cys70Serfs*21/p.Arg231Trp) in the TYK2. The TYK2 protein levels were reduced by 35% in the T cells of the patient. Unlike the response under complete TYK2 deficiency, the patient's T cells responded normally to type I IFN, IL-6, IL-10 and IL-12, whereas the cells displayed an impaired response to IL-23. Furthermore, the level of STAT1 was low in the cells of the patient. These studies reveal a new clinical entity of a primary immunodeficiency with T-cell lymphopenia that is associated with compound heterozygous TYK2 mutations in the patients.

Computational study of molecular electrostatic potential, docking and dynamics simulations of gallic acid derivatives as ABL inhibitors.

PubMed

Raghi, K R; Sherin, D R; Saumya, M J; Arun, P S; Sobha, V N; Manojkumar, T K

2018-04-05

Chronic myeloid leukemia (CML), a hematological malignancy arises due to the spontaneous fusion of the BCR and ABL gene, resulting in a constitutively active tyrosine kinase (BCR-ABL). Pharmacological activity of Gallic acid and 1,3,4-Oxadiazole as potential inhibitors of ABL kinase has already been reported. Objective of this study is to evaluate the ABL kinase inhibitory activity of derivatives of Gallic acid fused with 1,3,4-Oxadiazole moieties. Attempts have been made to identify the key structural features responsible for drug likeness of the Gallic acid and the 1,3,4-Oxadiazole ring using molecular electrostatic potential maps (MESP). To investigate the inhibitory activity of Gallic acid derivatives towards the ABL receptor, we have applied molecular docking and molecular dynamics (MD) simulation approaches. A comparative study was performed using Bosutinib as the standard which is an approved CML drug acting on the same receptor. Furthermore, the novel compounds designed and reported here in were evaluated for ADME properties and the results indicate that they show acceptable pharmacokinetic properties. Accordingly these compounds are predicted to be drug like with low toxicity potential. Copyright © 2018 Elsevier Ltd. All rights reserved.

Imatinib Mesylate and Combination Chemotherapy in Treating Patients With Newly Diagnosed Philadelphia Chromosome Positive Acute Lymphoblastic Leukemia

ClinicalTrials.gov

2018-05-02

Acute Lymphoblastic Leukemia; B Acute Lymphoblastic Leukemia With t(9;22)(q34.1;q11.2); BCR-ABL1; BCR-ABL1 Fusion Protein Expression; Minimal Residual Disease; Philadelphia Chromosome Positive; T Acute Lymphoblastic Leukemia; Untreated Adult Acute Lymphoblastic Leukemia; Untreated Childhood Acute Lymphoblastic Leukemia

Spectrum of mutations in RARS-T patients includes TET2 and ASXL1 mutations.

PubMed

Szpurka, Hadrian; Jankowska, Anna M; Makishima, Hideki; Bodo, Juraj; Bejanyan, Nelli; Hsi, Eric D; Sekeres, Mikkael A; Maciejewski, Jaroslaw P

2010-08-01

While a majority of patients with refractory anemia with ring sideroblasts and thrombocytosis harbor JAK2V617F and rarely MPLW515L, JAK2/MPL-negative cases constitute a diagnostic problem. 23 RARS-T cases were investigated applying immunohistochemical phospho-STAT5, sequencing and SNP-A-based karyotyping. Based on the association of TET2/ASXL1 mutations with MDS/MPN we studied molecular pattern of these genes. Two patients harbored ASXL1 and another 2 TET2 mutations. Phospho-STAT5 activation was present in one mutated TET2 and ASXL1 case. JAK2V617F/MPLW515L mutations were absent in TET2/ASXL1 mutants, indicating that similar clinical phenotype can be produced by various MPN-associated mutations and that additional unifying lesions may be present in RARS-T. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Lymphotoxin activation by human T-cell leukemia virus type I-infected cell lines: role for NF-kappa B.

PubMed

Paul, N L; Lenardo, M J; Novak, K D; Sarr, T; Tang, W L; Ruddle, N H

1990-11-01

Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia.

Integrated genomic sequencing reveals mutational landscape of T-cell prolymphocytic leukemia

PubMed Central

Kiel, Mark J.; Velusamy, Thirunavukkarasu; Rolland, Delphine; Sahasrabuddhe, Anagh A.; Chung, Fuzon; Bailey, Nathanael G.; Schrader, Alexandra; Li, Bo; Li, Jun Z.; Ozel, Ayse B.; Betz, Bryan L.; Miranda, Roberto N.; Medeiros, L. Jeffrey; Zhao, Lili; Herling, Marco

2014-01-01

The comprehensive genetic alterations underlying the pathogenesis of T-cell prolymphocytic leukemia (T-PLL) are unknown. To address this, we performed whole-genome sequencing (WGS), whole-exome sequencing (WES), high-resolution copy-number analysis, and Sanger resequencing of a large cohort of T-PLL. WGS and WES identified novel mutations in recurrently altered genes not previously implicated in T-PLL including EZH2, FBXW10, and CHEK2. Strikingly, WGS and/or WES showed largely mutually exclusive mutations affecting IL2RG, JAK1, JAK3, or STAT5B in 38 of 50 T-PLL genomes (76.0%). Notably, gain-of-function IL2RG mutations are novel and have not been reported in any form of cancer. Further, high-frequency mutations in STAT5B have not been previously reported in T-PLL. Functionally, IL2RG-JAK1-JAK3-STAT5B mutations led to signal transducer and activator of transcription 5 (STAT5) hyperactivation, transformed Ba/F3 cells resulting in cytokine-independent growth, and/or enhanced colony formation in Jurkat T cells. Importantly, primary T-PLL cells exhibited constitutive activation of STAT5, and targeted pharmacologic inhibition of STAT5 with pimozide induced apoptosis in primary T-PLL cells. These results for the first time provide a portrait of the mutational landscape of T-PLL and implicate deregulation of DNA repair and epigenetic modulators as well as high-frequency mutational activation of the IL2RG-JAK1-JAK3-STAT5B axis in the pathogenesis of T-PLL. These findings offer opportunities for novel targeted therapies in this aggressive leukemia. PMID:24825865

Integrated genomic sequencing reveals mutational landscape of T-cell prolymphocytic leukemia.

PubMed

Kiel, Mark J; Velusamy, Thirunavukkarasu; Rolland, Delphine; Sahasrabuddhe, Anagh A; Chung, Fuzon; Bailey, Nathanael G; Schrader, Alexandra; Li, Bo; Li, Jun Z; Ozel, Ayse B; Betz, Bryan L; Miranda, Roberto N; Medeiros, L Jeffrey; Zhao, Lili; Herling, Marco; Lim, Megan S; Elenitoba-Johnson, Kojo S J

2014-08-28

The comprehensive genetic alterations underlying the pathogenesis of T-cell prolymphocytic leukemia (T-PLL) are unknown. To address this, we performed whole-genome sequencing (WGS), whole-exome sequencing (WES), high-resolution copy-number analysis, and Sanger resequencing of a large cohort of T-PLL. WGS and WES identified novel mutations in recurrently altered genes not previously implicated in T-PLL including EZH2, FBXW10, and CHEK2. Strikingly, WGS and/or WES showed largely mutually exclusive mutations affecting IL2RG, JAK1, JAK3, or STAT5B in 38 of 50 T-PLL genomes (76.0%). Notably, gain-of-function IL2RG mutations are novel and have not been reported in any form of cancer. Further, high-frequency mutations in STAT5B have not been previously reported in T-PLL. Functionally, IL2RG-JAK1-JAK3-STAT5B mutations led to signal transducer and activator of transcription 5 (STAT5) hyperactivation, transformed Ba/F3 cells resulting in cytokine-independent growth, and/or enhanced colony formation in Jurkat T cells. Importantly, primary T-PLL cells exhibited constitutive activation of STAT5, and targeted pharmacologic inhibition of STAT5 with pimozide induced apoptosis in primary T-PLL cells. These results for the first time provide a portrait of the mutational landscape of T-PLL and implicate deregulation of DNA repair and epigenetic modulators as well as high-frequency mutational activation of the IL2RG-JAK1-JAK3-STAT5B axis in the pathogenesis of T-PLL. These findings offer opportunities for novel targeted therapies in this aggressive leukemia. © 2014 by The American Society of Hematology.

Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

PubMed

Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

2018-02-05

Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

Ibrutinib inhibits pre-BCR+ B-cell acute lymphoblastic leukemia progression by targeting BTK and BLK.

PubMed

Kim, Ekaterina; Hurtz, Christian; Koehrer, Stefan; Wang, Zhiqiang; Balasubramanian, Sriram; Chang, Betty Y; Müschen, Markus; Davis, R Eric; Burger, Jan A

2017-03-02

Targeting B-cell receptor (BCR) signaling is a successful therapeutic strategy in mature B-cell malignancies. Precursor BCR (pre-BCR) signaling, which is critical during normal B lymphopoiesis, also plays an important role in pre-BCR + B cell acute lymphoblastic leukemia (B-ALL). Here, we investigated the activity and mechanism of action of the BTK inhibitor ibrutinib in preclinical models of B-ALL. Pre-BCR + ALL cells were exquisitely sensitive to ibrutinib at therapeutically relevant drug concentrations. In pre-BCR + ALL, ibrutinib thwarted autonomous and induced pre-BCR signaling, resulting in deactivation of PI3K/Akt signaling. Ibrutinib modulated the expression of pre-BCR regulators (PTPN6, CD22, CD72, and PKCβ) and substantially reduced BCL6 levels. Ibrutinib inhibited ALL cell migration toward CXCL12 and beneath marrow stromal cells and reduced CD44 expression. CRISPR-Cas9 gene editing revealed that both BTK and B lymphocyte kinase (BLK) are relevant targets of ibrutinib in pre-BCR + ALL. Consequently, in mouse xenograft models of pre-BCR + ALL, ibrutinib treatment significantly prolonged survival. Combination treatment of ibrutinib with dexamethasone or vincristine demonstrated synergistic activity against pre-BCR + ALL. These data corroborate ibrutinib as a promising targeted agent for pre-BCR + ALL and highlight the importance of ibrutinib effects on alternative kinase targets. © 2017 by The American Society of Hematology.

Ibrutinib inhibits pre-BCR+ B-cell acute lymphoblastic leukemia progression by targeting BTK and BLK

PubMed Central

Kim, Ekaterina; Hurtz, Christian; Koehrer, Stefan; Wang, Zhiqiang; Balasubramanian, Sriram; Chang, Betty Y.; Müschen, Markus; Davis, R. Eric

2017-01-01

Targeting B-cell receptor (BCR) signaling is a successful therapeutic strategy in mature B-cell malignancies. Precursor BCR (pre-BCR) signaling, which is critical during normal B lymphopoiesis, also plays an important role in pre-BCR+ B cell acute lymphoblastic leukemia (B-ALL). Here, we investigated the activity and mechanism of action of the BTK inhibitor ibrutinib in preclinical models of B-ALL. Pre-BCR+ ALL cells were exquisitely sensitive to ibrutinib at therapeutically relevant drug concentrations. In pre-BCR+ ALL, ibrutinib thwarted autonomous and induced pre-BCR signaling, resulting in deactivation of PI3K/Akt signaling. Ibrutinib modulated the expression of pre-BCR regulators (PTPN6, CD22, CD72, and PKCβ) and substantially reduced BCL6 levels. Ibrutinib inhibited ALL cell migration toward CXCL12 and beneath marrow stromal cells and reduced CD44 expression. CRISPR-Cas9 gene editing revealed that both BTK and B lymphocyte kinase (BLK) are relevant targets of ibrutinib in pre-BCR+ ALL. Consequently, in mouse xenograft models of pre-BCR+ ALL, ibrutinib treatment significantly prolonged survival. Combination treatment of ibrutinib with dexamethasone or vincristine demonstrated synergistic activity against pre-BCR+ ALL. These data corroborate ibrutinib as a promising targeted agent for pre-BCR+ ALL and highlight the importance of ibrutinib effects on alternative kinase targets. PMID:28031181

DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

PubMed Central

Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

2017-01-01

APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

Presentation and role of transplantation in adult patients with type 1 primary hyperoxaluria and the I244T AGXT mutation: Single-center experience.

PubMed

Lorenzo, V; Alvarez, A; Torres, A; Torregrosa, V; Hernández, D; Salido, E

2006-09-01

Primary hyperoxaluria type 1 (PH1) is a rare genetic disorder characterized by allelic and clinical heterogeneity. We aim to describe the presentation and full single-center experience of the management of PH1 patients bearing the mutation described in our community (I244T mutation+polymorphism P11L). Since 1983, 12 patients with recurrent renal lithiasis have been diagnosed with PH1 and renal failure in the Canary Islands, Spain. Diagnostic confirmation was based on the presence of oxalosis in undecalcified bone or kidney allograft biopsy, reduced alanine:glyoxylate aminotransferase activity in liver biopsy, and blood DNA analysis. Patients underwent different treatment modalities depending on individual clinical circumstances and therapeutic possibilities at the time of diagnosis: hemodialysis, isolated kidney, simultaneous liver-kidney, or pre-emptive liver transplantation. In all cases, the presentation of advanced renal disease was relatively late (>13 years) and no cases were reported during lactancy or childhood. The eight patients treated with hemodialysis or isolated kidney transplantation showed unfavorable evolution leading to death over a variable period of time. In contrast, the four patients undergoing liver transplantation (three liver+kidney and one pre-emptive liver alone) showed favorable long-term allograft and patient survival (up to 12 years follow-up). In conclusion, in this PH1 population, all bearing the I244T mutation, the development of end-stage renal disease was distinctive during late adolescence or adulthood. Our long-term results support pre-emptive liver transplantation at early stages of renal failure, and kidney-liver transplantation for those with advanced renal disease.

The Frequency of MEFV Gene Mutations and Genotypes in Sanliurfa Province, South-Eastern Region of Turkey, after the Syrian Civil War by Using Next Generation Sequencing and Report of a Novel Exon 4 Mutation (I423T).

PubMed

Gumus, Evren

2018-05-07

Familial Mediterranean Fever (FMF) is a genetic disorder characterized by recurrent episodes of fever and abdominal pain. Mutations in the Mediterranean fever (MEFV) gene are localized on the p arm of chromosome 16. Over 333 MEFV sequence variants have been identified so far in FMF patients, which occur mostly in the 2nd and 10th exons of the gene. In this study, 296 unrelated patients with clinical suspicion of FMF, which were admitted during January⁻December 2017, were retrospectively reviewed to identify the frequency of MEFV gene mutations by using next generation sequencing. Eighteen different mutations, 45 different genotypes and a novel exon 4 (I423T) mutation were identified in this study. This mutation is the fourth mutation identified in exon 4.The most frequent mutation was R202Q, followed by M694V, E148Q, M680I, R761H, V726A and R354W. One of the most important aims of this study is to investigate the MEFV mutation type and genotype of migrants coming to Sanliurfa after the civil war of Syria. This study also examines the effect of the condition on the region’s gene pool and the distribution of different types of mutations. Our results indicated that MEFV mutations are highly heterogeneous in our patient population, which is consistent with the findings of other studies in our region. Previously used methods, such as Restriction Fragment Length Polymorphism (RFLP), do not define uncommon or especially novel mutations. Therefore, Next Generation Sequencing (NGS) analysis of the MEFV gene could be useful for finding novel mutations, except for those located on exon 2 and 10.

The Bcr Kinase Downregulates Ras Signaling by Phosphorylating AF-6 and Binding to Its PDZ Domain

PubMed Central

Radziwill, G.; Erdmann, R. A.; Margelisch, U.; Moelling, K.

2003-01-01

The protein kinase Bcr is a negative regulator of cell proliferation and oncogenic transformation. We identified Bcr as a ligand for the PDZ domain of the cell junction and Ras-interacting protein AF-6. The Bcr kinase phosphorylates AF-6, which subsequently allows efficient binding of Bcr to AF-6, showing that the Bcr kinase is a regulator of the PDZ domain-ligand interaction. Bcr and AF-6 colocalize in epithelial cells at the plasma membrane. In addition, Bcr, AF-6, and Ras form a trimeric complex. Bcr increases the affinity of AF-6 to Ras, and a mutant of AF-6 that lacks a specific phosphorylation site for Bcr shows a reduced binding to Ras. Wild-type Bcr, but not Bcr mutants defective in binding to AF-6, interferes with the Ras-dependent stimulation of the Raf/MEK/ERK pathway. Since AF-6 binds to Bcr via its PDZ domain and to Ras via its Ras-binding domain, we propose that AF-6 functions as a scaffold-like protein that links Bcr and Ras to cellular junctions. We suggest that this trimeric complex is involved in downregulation of Ras-mediated signaling at sites of cell-cell contact to maintain cells in a nonproliferating state. PMID:12808105

Phase I Trial of AZD1775 and Belinostat in Treating Patients With Relapsed or Refractory Myeloid Malignancies or Untreated Acute Myeloid Leukemia

ClinicalTrials.gov

2018-05-24

Acute Myeloid Leukemia; Blast Phase Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Myelodysplastic Syndrome; Previously Treated Myelodysplastic Syndrome; Recurrent Adult Acute Myeloid Leukemia; Recurrent Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Refractory Acute Myeloid Leukemia; Refractory Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Secondary Acute Myeloid Leukemia; Therapy-Related Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

A PAX3 polymorphism (T315K) in a family exhibiting Waardenburg Syndrome type 2.

PubMed

Wang, C; Kim, E; Attaie, A; Smith, T N; Wilcox, E R; Lalwani, A K

1998-02-01

Waardenburg Syndrome (WS) is an autosomal-dominant disorder phenotypically characterized by sensorineural hearing loss and pigmentary disturbances. Presence of dystopia canthorum is indicative of WS type 1 and results from defects in the PAX3 gene, whereas normally located medial canthi is characteristic of type 2 WS (WS2) and is associated with defects in the microphthalmia-associated transcription factor (MIFT) gene. Here a neutral polymorphism is reported in the PAX3 gene (T315K) in a family with WS2. Copyright 1998 Academic Press Limited

Generation of TCR-Expressing Innate Lymphoid-like Helper Cells that Induce Cytotoxic T Cell-Mediated Anti-leukemic Cell Response.

PubMed

Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin

2018-06-05

CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

NS1 Protein Mutation I64T Affects Interferon Responses and Virulence of Circulating H3N2 Human Influenza A Viruses

PubMed Central

DeDiego, Marta L.; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis

2016-01-01

ABSTRACT Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. IMPORTANCE Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence

An activating mutation of GNB1 is associated with resistance to tyrosine kinase inhibitors in ETV6-ABL1-positive leukemia

PubMed Central

Zimmermannova, O; Doktorova, E; Stuchly, J; Kanderova, V; Kuzilkova, D; Strnad, H; Starkova, J; Alberich-Jorda, M; Falkenburg, J H F; Trka, J; Petrak, J; Zuna, J; Zaliova, M

2017-01-01

Leukemias harboring the ETV6-ABL1 fusion represent a rare subset of hematological malignancies with unfavorable outcomes. The constitutively active chimeric Etv6-Abl1 tyrosine kinase can be specifically inhibited by tyrosine kinase inhibitors (TKIs). Although TKIs represent an important therapeutic tool, so far, the mechanism underlying the potential TKI resistance in ETV6-ABL1-positive malignancies has not been studied in detail. To address this issue, we established a TKI-resistant ETV6-ABL1-positive leukemic cell line through long-term exposure to imatinib. ETV6-ABL1-dependent mechanisms (including fusion gene/protein mutation, amplification, enhanced expression or phosphorylation) and increased TKI efflux were excluded as potential causes of resistance. We showed that TKI effectively inhibited the Etv6-Abl1 kinase activity in resistant cells, and using short hairpin RNA (shRNA)-mediated silencing, we confirmed that the resistant cells became independent from the ETV6-ABL1 oncogene. Through analysis of the genomic and proteomic profiles of resistant cells, we identified an acquired mutation in the GNB1 gene, K89M, as the most likely cause of the resistance. We showed that cells harboring mutated GNB1 were capable of restoring signaling through the phosphoinositide-3-kinase (PI3K)/Akt/mTOR and mitogen-activated protein kinase (MAPK) pathways, whose activation is inhibited by TKI. This alternative GNB1K89M-mediated pro-survival signaling rendered ETV6-ABL1-positive leukemic cells resistant to TKI therapy. The mechanism of TKI resistance is independent of the targeted chimeric kinase and thus is potentially relevant not only to ETV6-ABL1-positive leukemias but also to a wider spectrum of malignancies treated by kinase inhibitors. PMID:28650474

Identification and Functional Characterisation of Novel Glucokinase Mutations Causing Maturity-Onset Diabetes of the Young in Slovakia

PubMed Central

Valentínová, Lucia; Beer, Nicola L.; Staník, Juraj; Tribble, Nicholas D.; van de Bunt, Martijn; Hučková, Miroslava; Barrett, Amy; Klimeš, Iwar; Gašperíková, Daniela; Gloyn, Anna L.

2012-01-01

Heterozygous glucokinase (GCK) mutations cause a subtype of maturity-onset diabetes of the young (GCK-MODY). Over 600 GCK mutations have been reported of which ∼65% are missense. In many cases co-segregation has not been established and despite the importance of functional studies in ascribing pathogenicity for missense variants these have only been performed for <10% of mutations. The aim of this study was to determine the minimum prevalence of GCK-MODY amongst diabetic subjects in Slovakia by sequencing GCK in 100 Slovakian probands with a phenotype consistent with GCK-MODY and to explore the pathogenicity of identified variants through family and functional studies. Twenty-two mutations were identified in 36 families (17 missense) of which 7 (I110N, V200A, N204D, G258R, F419S, c.580-2A>C, c.1113–1114delGC) were novel. Parental DNA was available for 22 probands (covering 14/22 mutations) and co-segregation established in all cases. Bioinformatic analysis predicted all missense mutations to be damaging. Nine (I110N, V200A, N204D, G223S, G258R, F419S, V244G, L315H, I436N) mutations were functionally evaluated. Basic kinetic analysis explained pathogenicity for 7 mutants which showed reduced glucokinase activity with relative activity indices (RAI) between 0.6 to <0.001 compared to wild-type GCK (1.0). For the remaining 2 mutants additional molecular mechanisms were investigated. Differences in glucokinase regulatory protein (GKRP) –mediated-inhibition of GCK were observed for both L315H & I436N when compared to wild type (IC50 14.6±0.1 mM & 20.3±1.6 mM vs.13.3±0.1 mM respectively [p<0.03]). Protein instability as assessed by thermal lability studies demonstrated that both L315H and I436N show marked thermal instability compared to wild-type GCK (RAI at 55°C 8.8±0.8% & 3.1±0.4% vs. 42.5±3.9% respectively [p<0.001]). The minimum prevalence of GCK-MODY amongst Slovakian patients with diabetes was 0.03%. In conclusion, we have identified 22 GCK mutations

mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Chengye; Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091; Graduate University of the Chinese Academy of Sciences, Beijing 100039

2006-09-22

Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To testmore » this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL.« less

Severe infantile leigh syndrome associated with a rare mitochondrial ND6 mutation, m.14487T>C.

PubMed

Tarnopolsky, Mark; Meaney, Brandon; Robinson, Brian; Sheldon, Katherine; Boles, Richard G

2013-08-01

We describe a case of severe infantile-onset complex I deficiency in association with an apparent de novo near-homoplasmic mutation (m.14487T>C) in the mitochondrial ND6 gene, which was previously associated with Leigh syndrome and other neurological disorders. The mutation was near-homoplasmic in muscle by NextGen sequencing (99.4% mutant), homoplasmic in muscle by Sanger sequencing, and it was associated with a severe complex I deficiency in both muscle and fibroblasts. This supports previous data regarding Leigh syndrome being on the severe end of a phenotypic spectrum including progressive myoclonic epilepsy, childhood-onset dystonia, bilateral striatal necrosis, and optic atrophy, depending on the proportion of mutant heteroplasmy. While the mother in all previously reported cases was heteroplasmic, the mother and brother of this case were homoplasmic for the wild-type, m.14487T. Importantly, the current data demonstrate the potential for cases of mutations that were previously reported to be homoplasmic by Sanger sequencing to be less homoplasmic by NextGen sequencing. This case underscores the importance of considering mitochondrial DNA mutations in families with a negative family history, even in offspring of those who have tested negative for a specific mtDNA mutation. Copyright © 2013 Wiley Periodicals, Inc.

The Src/c-Abl pathway is a potential therapeutic target in amyotrophic lateral sclerosis.

PubMed

Imamura, Keiko; Izumi, Yuishin; Watanabe, Akira; Tsukita, Kayoko; Woltjen, Knut; Yamamoto, Takuya; Hotta, Akitsu; Kondo, Takayuki; Kitaoka, Shiho; Ohta, Akira; Tanaka, Akito; Watanabe, Dai; Morita, Mitsuya; Takuma, Hiroshi; Tamaoka, Akira; Kunath, Tilo; Wray, Selina; Furuya, Hirokazu; Era, Takumi; Makioka, Kouki; Okamoto, Koichi; Fujisawa, Takao; Nishitoh, Hideki; Homma, Kengo; Ichijo, Hidenori; Julien, Jean-Pierre; Obata, Nanako; Hosokawa, Masato; Akiyama, Haruhiko; Kaneko, Satoshi; Ayaki, Takashi; Ito, Hidefumi; Kaji, Ryuji; Takahashi, Ryosuke; Yamanaka, Shinya; Inoue, Haruhisa

2017-05-24

Amyotrophic lateral sclerosis (ALS), a fatal disease causing progressive loss of motor neurons, still has no effective treatment. We developed a phenotypic screen to repurpose existing drugs using ALS motor neuron survival as readout. Motor neurons were generated from induced pluripotent stem cells (iPSCs) derived from an ALS patient with a mutation in superoxide dismutase 1 ( SOD1 ). Results of the screen showed that more than half of the hits targeted the Src/c-Abl signaling pathway. Src/c-Abl inhibitors increased survival of ALS iPSC-derived motor neurons in vitro. Knockdown of Src or c-Abl with small interfering RNAs (siRNAs) also rescued ALS motor neuron degeneration. One of the hits, bosutinib, boosted autophagy, reduced the amount of misfolded mutant SOD1 protein, and attenuated altered expression of mitochondrial genes. Bosutinib also increased survival in vitro of ALS iPSC-derived motor neurons from patients with sporadic ALS or other forms of familial ALS caused by mutations in TAR DNA binding protein ( TDP-43 ) or repeat expansions in C9orf72 Furthermore, bosutinib treatment modestly extended survival of a mouse model of ALS with an SOD1 mutation, suggesting that Src/c-Abl may be a potentially useful target for developing new drugs to treat ALS. Copyright © 2017, American Association for the Advancement of Science.

Refractory Anemia with Ring Sideroblasts (RARS) and RARS with Thrombocytosis (RARS-T) – “2017 Update on Diagnosis, Risk-stratification, and Management”

PubMed Central

Patnaik, Mrinal M.; Tefferi, Ayalew

2017-01-01

Disease Overview Ring sideroblasts (RS) are erythroid precursors with abnormal perinuclear mitochondrial iron accumulation. Two myeloid neoplasms defined by the presence of RS, include refractory anemia with ring sideroblasts (RARS), now classified under myelodysplastic syndromes with RS (MDS-RS) and RARS with thrombocytosis (RARS-T); now called myelodysplastic/myeloproliferative neoplasm with RS and thrombocytosis (MDS/MPN-RS-T). Diagnosis MDS-RS is a lower risk MDS, with single or multilineage dysplasia (SLD/MLD), <5% bone marrow (BM) blasts and ≥15% BM RS (≥5% in the presence of SF3B1 mutations). MDS/MPN-RS-T, now a formal entity in the MDS/MPN overlap syndromes, has diagnostic features of MDS-RS-SLD, along with a platelet count ≥ 450 × 10(9)/L and large atypical megakaryocytes (similar to BCR-ABL1 negative MPN). Mutations and Karyotype Mutations in SF3B1 are seen in ≥80% of patients with MDS-RS-SLD and MDS/MPN-RS-T, and strongly correlate with the presence of BM RS; MDS/MPN-RS-T patients also demonstrate JAK2V617F, ASXL1, DNMT3A, SETBP1, and TET2 mutations; with ASXL1/SETBP1 mutations adversely impacting survival. Cytogenetic abnormalities are uncommon in both diseases. Risk stratification Most patients with MDS-RS-SLD are stratified into lower risk groups by the revised-International Prognostic Scoring System (R-IPSS). Disease outcome in MDS/MPN-RS-T is better than that of MDS-RS-SLD, but worse than that of essential thrombocythemia. Both diseases have a low risk of leukemic transformation. Treatment Anemia and iron overload are complications seen in both and are managed similar to lower risk MDS and MPN. Aspirin therapy is reasonable in MDS/MPN-RS-T, especially in the presence of JAK2V617F, but the value of platelet-lowering drugs is uncertain. PMID:28188970

Population-based Testing and Treatment Characteristics for Chronic Myelogenous Leukemia

PubMed Central

Styles, Timothy; Wu, Manxia; Wilson, Reda; Babcock, Frances; Butterworth, David; West, Dee W.; Richardson, Lisa C.

2017-01-01

Introduction National and International Hematology/Oncology Practice Guidelines recommend testing for the BCR-ABL mutation for definitive diagnosis of chronic myeloid leukemia (CML) to allow for appropriate treatment with a Tyrosine Kinase Inhibitor (TKI). The purpose of our study was to describe population-based testing and treatment practice characteristics for patients diagnosed with CML. Methods We analyzed cases of CML using 2011 data from 10 state registries which are part of the Centers for Disease Control and Prevention’s (CDC) National Program of Cancer Registries. We describe completeness of testing for the BCR-ABL gene and availability of outpatient treatment with TKIs and associated characteristics. Results A total of 685 cases of CML were identified; 55% (374) had a documented BCR-ABL gene test with 96% (360) of these being positive for the BCR-ABL gene and the remaining 4% (14) either testing negative or had a missing result. Registries were able to identify the use of TKIs in 54% (369) of patients, though only 43% (296) had a corresponding BCR-ABL gene test documented. One state registry reported a significantly lower percentage of patients being tested for the BCR-ABL gene (25%) and receiving TKI treatment (21%). Limiting analysis to CML case reports from the remaining nine CER registries, 78% (305) patients had a documented BCR-ABL gene test and 79% (308) had documented treatment with a TKI. Receipt of testing or treatment for these nine states did not vary by sex, race, ethnicity, census tract poverty level, census tract urbanization, or insurance status; BCR-ABL testing varied by state of residence and BCR-ABL testing and TKI therapy occurred less often with increasing age (OR: 0.97, 95%CI: 0.95–0.99; OR: 0.97, 95%CI: 0.96–0.99 respectively). Conclusions Collection of detailed CML data vary significantly by states. A majority of the case patients had appropriate testing for the BCR-ABL gene and treatment with tyrosine kinase inhibitors

Specific Mutation of a Gammaherpesvirus-Expressed Antigen in Response to CD8 T Cell Selection In Vivo

PubMed Central

Loh, Joy; Popkin, Daniel L.; Droit, Lindsay; Braaten, Douglas C.; Zhao, Guoyan; Zhang, Xin; Vachharajani, Punit; Myers, Nancy; Hansen, Ted H.

2012-01-01

Herpesviruses are thought to be highly genetically stable, and their use as vaccine vectors has been proposed. However, studies of the human gammaherpesvirus, Epstein-Barr virus, have found viral isolates containing mutations in HLA class I-restricted epitopes. Using murine gammaherpesvirus 68 expressing ovalbumin (OVA), we examined the stability of a gammaherpesvirus antigenic locus under strong CD8 T cell selection in vivo. OVA-specific CD8 T cells selected viral isolates containing mutations in the OVA locus but minimal alterations in other genomic regions. Thus, a CD8 T cell response to a gammaherpesvirus-expressed antigen that is not essential for replication or pathogenesis can result in selective mutation of that antigen in vivo. This finding may have relevance for the use of herpesvirus vectors for chronic antigen expression in vivo. PMID:22171269

Declining lymphoid progenitor fitness promotes aging-associated leukemogenesis.

PubMed

Henry, Curtis J; Marusyk, Andriy; Zaberezhnyy, Vadym; Adane, Biniam; DeGregori, James

2010-12-14

Aging is associated with the functional decline of cells, tissues, and organs. At the same time, age is the single most important prognostic factor in the development of most human cancers, including chronic myelogenous and acute lymphoblastic leukemias initiated by Bcr-Abl oncogenic translocations. Prevailing paradigms attribute the association between aging and cancers to the accumulation of oncogenic mutations over time, because the accrual of oncogenic events is thought to be the rate-limiting step in initiation and progression of cancers. Conversely, aging-associated functional decline caused by both cell-autonomous and non-cell-autonomous mechanisms is likely to reduce the fitness of stem and progenitor cell populations. This reduction in fitness should be conducive for increased selection of oncogenic mutations that can at least partially alleviate fitness defects, thereby promoting the initiation of cancers. We tested this hypothesis using mouse hematopoietic models. Our studies indicate that the dramatic decline in the fitness of aged B-lymphopoiesis coincides with altered receptor-associated kinase signaling. We further show that Bcr-Abl provides a much greater competitive advantage to old B-lymphoid progenitors compared with young progenitors, coinciding with restored kinase signaling pathways, and that this enhanced competitive advantage translates into increased promotion of Bcr-Abl-driven leukemias. Moreover, impairing IL-7-mediated signaling is sufficient to promote selection for Bcr-Abl-expressing B progenitors. These studies support an unappreciated causative link between aging and cancer: increased selection of oncogenic mutations as a result of age-dependent alterations of the fitness landscape.

Lymphotoxin activation by human T-cell leukemia virus type I-infected cell lines: role for NF-kappa B.

PubMed Central

Paul, N L; Lenardo, M J; Novak, K D; Sarr, T; Tang, W L; Ruddle, N H

1990-01-01

Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia. Images PMID:1976820

Chronic neutrophilic leukemia 2014: Update on diagnosis, molecular genetics, and management.

PubMed

Elliott, Michelle A; Tefferi, Ayalew

2014-06-01

Chronic neutrophilic leukemia (CNL) is a myeloproliferative neoplasm characterized by sustained, mature neutrophilic leukocytosis, splenomegaly, and bone marrow granulocytic hyperplasia. Key diagnostic criteria include leukocytosis of >25 × 10(9) /l (of which >80% are neutrophils) with <10% and <1% circulating immature granulocytes and myeloblasts, respectively. There should be no dysplasia, monocytosis, molecular evidence of BCR-ABL1, PDGFRA, PDGFRB, or FGRF1 rearrangements and no identifiable cause for physiologic neutrophilia or, if present, demonstration of myeloid clonality. DEVELOPMENTS IN MOLECULAR GENETICS: Recently, CNL has been shown to be specifically driven by somatic activating mutations of CSF3R, most commonly CSF3R T618I. As such, the diagnosis of CNL will no longer be one of exclusion only, and revision of the current WHO classification is anticipated to include the molecular criterion of mutated CSF3R. © 2014 Wiley Periodicals, Inc.

CD40 signaling synergizes with TLR-2 in the BCR independent activation of resting B cells.

PubMed

Jain, Shweta; Chodisetti, Sathi Babu; Agrewala, Javed N

2011-01-01

Conventionally, signaling through BCR initiates sequence of events necessary for activation and differentiation of B cells. We report an alternative approach, independent of BCR, for stimulating resting B (RB) cells, by involving TLR-2 and CD40--molecules crucial for innate and adaptive immunity. CD40 triggering of TLR-2 stimulated RB cells significantly augments their activation, proliferation and differentiation. It also substantially ameliorates the calcium flux, antigen uptake capacity and ability of B cells to activate T cells. The survival of RB cells was improved and it increases the number of cells expressing activation induced deaminase (AID), signifying class switch recombination (CSR). Further, we also observed increased activation rate and decreased threshold period required for optimum stimulation of RB cells. These results corroborate well with microarray gene expression data. This study provides novel insights into coordination between the molecules of innate and adaptive immunity in activating B cells, in a BCR independent manner. This strategy can be exploited to design vaccines to bolster B cell activation and antigen presenting efficiency, leading to faster and better immune response.

BCR ligation induced by IgM stimulation results in gene expression and functional changes only in IgV H unmutated chronic lymphocytic leukemia (CLL) cells.

PubMed

Guarini, Anna; Chiaretti, Sabina; Tavolaro, Simona; Maggio, Roberta; Peragine, Nadia; Citarella, Franca; Ricciardi, Maria Rosaria; Santangelo, Simona; Marinelli, Marilisa; De Propris, Maria Stefania; Messina, Monica; Mauro, Francesca Romana; Del Giudice, Ilaria; Foà, Robert

2008-08-01

Chronic lymphocytic leukemia (CLL) patients exhibit a variable clinical course. To investigate the association between clinicobiologic features and responsiveness of CLL cells to anti-IgM stimulation, we evaluated gene expression changes and modifications in cell-cycle distribution, proliferation, and apoptosis of IgV(H) mutated (M) and unmutated (UM) samples upon BCR cross-linking. Unsupervised analysis highlighted a different response profile to BCR stimulation between UM and M samples. Supervised analysis identified several genes modulated exclusively in the UM cases upon BCR cross-linking. Functional gene groups, including signal transduction, transcription, cell-cycle regulation, and cytoskeleton organization, were up-regulated upon stimulation in UM cases. Cell-cycle and proliferation analyses confirmed that IgM cross-linking induced a significant progression into the G(1) phase and a moderate increase of proliferative activity exclusively in UM patients. Moreover, we observed only a small reduction in the percentage of subG(0/1) cells, without changes in apoptosis, in UM cases; contrariwise, a significant increase of apoptotic levels was observed in stimulated cells from M cases. These results document that a differential genotypic and functional response to BCR ligation between IgV(H) M and UM cases is operational in CLL, indicating that response to antigenic stimulation plays a pivotal role in disease progression.

The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

PubMed

Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

2016-10-01

The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

Rates of Spontaneous Mutation in Bacteriophage T4 Are Independent of Host Fidelity Determinants

PubMed Central

Santos, M. E.; Drake, J. W.

1994-01-01

Bacteriophage T4 encodes most of the genes whose products are required for its DNA metabolism, and host (Escherichia coli) genes can only infrequently complement mutationally inactivated T4 genes. We screened the following host mutator mutations for effects on spontaneous mutation rates in T4: mutT (destruction of aberrant dGTPs), polA, polB and polC (DNA polymerases), dnaQ (exonucleolytic proofreading), mutH, mutS, mutL and uvrD (methyl-directed DNA mismatch repair), mutM and mutY (excision repair of oxygen-damaged DNA), mutA (function unknown), and topB and osmZ (affecting DNA topology). None increased T4 spontaneous mutation rates within a resolving power of about twofold (nor did optA, which is not a mutator but overexpresses a host dGTPase). Previous screens in T4 have revealed strong mutator mutations only in the gene encoding the viral DNA polymerase and proofreading 3'-exonuclease, plus weak mutators in several polymerase accessory proteins or determinants of dNTP pool sizes. T4 maintains a spontaneous mutation rate per base pair about 30-fold greater than that of its host. Thus, the joint high fidelity of insertion by T4 DNA polymerase and proofreading by its associated 3'-exonuclease appear to determine the T4 spontaneous mutation rate, whereas the host requires numerous additional systems to achieve high replication fidelity. PMID:7851754

NS1 Protein Mutation I64T Affects Interferon Responses and Virulence of Circulating H3N2 Human Influenza A Viruses.

PubMed

DeDiego, Marta L; Nogales, Aitor; Lambert-Emo, Kris; Martinez-Sobrido, Luis; Topham, David J

2016-11-01

Influenza NS1 protein is the main viral protein counteracting host innate immune responses, allowing the virus to efficiently replicate in interferon (IFN)-competent systems. In this study, we analyzed NS1 protein variability within influenza A (IAV) H3N2 viruses infecting humans during the 2012-2013 season. We also evaluated the impact of the mutations on the ability of NS1 proteins to inhibit host innate immune responses and general gene expression. Surprisingly, a previously unidentified mutation in the double-stranded RNA (dsRNA)-binding domain (I64T) decreased NS1-mediated general inhibition of host protein synthesis by decreasing its interaction with cleavage and polyadenylation specificity factor 30 (CPSF30), leading to increased innate immune responses after viral infection. Notably, a recombinant A/Puerto Rico/8/34 H1N1 virus encoding the H3N2 NS1-T64 protein was highly attenuated in mice, most likely because of its ability to induce higher antiviral IFN responses at early times after infection and because this virus is highly sensitive to the IFN-induced antiviral state. Interestingly, using peripheral blood mononuclear cells (PBMCs) collected at the acute visit (2 to 3 days after infection), we show that the subject infected with the NS1-T64 attenuated virus has diminished responses to interferon and to interferon induction, suggesting why this subject could be infected with this highly IFN-sensitive virus. These data demonstrate the importance of influenza virus surveillance in identifying new mutations in the NS1 protein, affecting its ability to inhibit innate immune responses and, as a consequence, the pathogenicity of the virus. Influenza A and B viruses are one of the most common causes of respiratory infections in humans, causing 1 billion infections and between 300,000 and 500,000 deaths annually. Influenza virus surveillance to identify new mutations in the NS1 protein affecting innate immune responses and, as a consequence, the pathogenicity of

Comprehensive review of JAK inhibitors in myeloproliferative neoplasms

PubMed Central

Sonbol, Mohamad Bassam; Firwana, Belal; Zarzour, Ahmad; Morad, Mohammad; Rana, Vishal

2013-01-01

Myeloproliferative neoplasms (MPNs) are clonal hematopoietic stem-cell disorders, characterized phenotypically by the abnormal accumulation of mature-appearing myeloid cells. Polycythemia vera, essential thrombocythemia, primary myelofibrosis (also known as ‘BCR-ABL1-negative’ MPNs), and chronic myeloid leukemia (CML) are the primary types of MPNs. After the discovery of the BCR-ABL1 fusion protein in CML, several oncogenic tyrosine kinases have been identified in ‘BCR-ABL1-negative’ MPNs, most importantly, JAK2V617F mutation. The similarity in the clinical characteristics of the BCR-ABL1-negative MPN patients along with the prevalence of the Janus kinase mutation in this patient population provided a strong rationale for the development of a new class of pharmacologic inhibitors that target this pathway. The first of its class, ruxolitinib, has now been approved by the food and drug administration (FDA) for the management of patients with intermediate- to high-risk myelofibrosis. Ruxolitinib provides significant and sustained improvements in spleen related and constitutional symptoms secondary to the disease. Although noncurative, ruxolitinib represents a milestone in the treatment of myelofibrosis patients. Other types of JAK2 inhibitors are being tested in various clinical trials at this point and may provide better efficacy data and safety profile than its predecessor. In this article, we comprehensively reviewed and summarized the available preclinical and clinical trials pertaining to JAK inhibitors. PMID:23610611

Blinatumomab and Nivolumab With or Without Ipilimumab in Treating Patients With Poor-Risk Relapsed or Refractory CD19+ Precursor B-Lymphoblastic Leukemia

ClinicalTrials.gov

2018-05-14

B Acute Lymphoblastic Leukemia; B Acute Lymphoblastic Leukemia With t(9;22)(q34.1;q11.2); BCR-ABL1; CD19-Positive Neoplastic Cells Present; Mixed Phenotype Acute Leukemia; Mixed Phenotype Acute Leukemia With t(9;22)(q34.1;q11.2); BCR-ABL1; Recurrent B Acute Lymphoblastic Leukemia; Refractory B Acute Lymphoblastic Leukemia

Coexistence of JAK2 and CALR mutations and their clinical implications in patients with essential thrombocythemia.

PubMed

Kang, Min-Gu; Choi, Hyun-Woo; Lee, Jun Hyung; Choi, Yong Jun; Choi, Hyun-Jung; Shin, Jong-Hee; Suh, Soon-Pal; Szardenings, Michael; Kim, Hye-Ran; Shin, Myung-Geun

2016-08-30

Janus kinase 2 (JAK2) and calreticulin (CALR) constitute the two most frequent mutations in essential thrombocythemia (ET), and both are reported to be mutually exclusive. Hence, we examined a cohort of 123 myeloproliferative neoplasm (MPN) patients without BCR-ABL1 rearrangement and additional ET patients (n=96) for coexistence of JAK2 and CALR mutations. The frequency of CALR mutations was 20.3% in 123 MPN patients; 31.1% in ET (n=74), 25% in primary myelofibrosis (n=4) and 2.2% in polycythemia vera (n=45). JAK2 and CALR mutations coexisted in 7 (4.2%) of 167 ET patients. Clinical characteristics, progression-free survival (PFS), and elapsed time to achieve partial remission across 4 groups (JAK2+/CALR+, JAK2+/CALR-, JAK2-/CALR+, JAK2-/CALR-) were reviewed. The JAK2+/CALR- group had higher leukocyte counts and hemoglobin levels and more frequent thrombotic events than JAK2-/CALR- group. JAK2 mutations have a greater effect on the disease phenotype and the clinical features of MPN patients rather than do CALR mutation. JAK2+ groups showed a tendency of poor PFS than JAK2- groups regardless of CALR mutation. CALR+ was a predictor of late response to the treatment. Our study also showed that thrombosis was more frequent in ET patients with type 2 CALR mutations than in those with type 1 CALR mutations.

Genetic heterogeneity in primary and relapsed mantle cell lymphomas: Impact of recurrent CARD11 mutations.

PubMed

Wu, Chenglin; de Miranda, Noel Fcc; Chen, Longyun; Wasik, Agata M; Mansouri, Larry; Jurczak, Wojciech; Galazka, Krystyna; Dlugosz-Danecka, Monika; Machaczka, Maciej; Zhang, Huilai; Peng, Roujun; Morin, Ryan D; Rosenquist, Richard; Sander, Birgitta; Pan-Hammarström, Qiang

2016-06-21

The genetic mechanisms underlying disease progression, relapse and therapy resistance in mantle cell lymphoma (MCL) remain largely unknown. Whole-exome sequencing was performed in 27 MCL samples from 13 patients, representing the largest analyzed series of consecutive biopsies obtained at diagnosis and/or relapse for this type of lymphoma. Eighteen genes were found to be recurrently mutated in these samples, including known (ATM, MEF2B and MLL2) and novel mutation targets (S1PR1 and CARD11). CARD11, a scaffold protein required for B-cell receptor (BCR)-induced NF-κB activation, was subsequently screened in an additional 173 MCL samples and mutations were observed in 5.5% of cases. Based on in vitro cell line-based experiments, overexpression of CARD11 mutants were demonstrated to confer resistance to the BCR-inhibitor ibrutinib and NF-κB-inhibitor lenalidomide. Genetic alterations acquired in the relapse samples were found to be largely non-recurrent, in line with the branched evolutionary pattern of clonal evolution observed in most cases. In summary, this study highlights the genetic heterogeneity in MCL, in particular at relapse, and provides for the first time genetic evidence of BCR/NF-κB activation in a subset of MCL.

Crystal structure of an SH2-kinase construct of c-Abl and effect of the SH2 domain on kinase activity.

PubMed

Lorenz, Sonja; Deng, Patricia; Hantschel, Oliver; Superti-Furga, Giulio; Kuriyan, John

2015-06-01

Constitutive activation of the non-receptor tyrosine kinase c-Abl (cellular Abelson tyrosine protein kinase 1, Abl1) in the Bcr (breakpoint cluster region)-Abl1 fusion oncoprotein is the molecular cause of chronic myeloid leukaemia (CML). Recent studies have indicated that an interaction between the SH2 (Src-homology 2) domain and the N-lobe (N-terminal lobe) of the c-Abl kinase domain (KD) has a critical role in leukaemogenesis [Grebien et al. (2011) Cell 147, 306-319; Sherbenou et al. (2010) Blood 116, 3278-3285]. To dissect the structural basis of this phenomenon, we studied c-Abl constructs comprising the SH2 and KDs in vitro. We present a crystal structure of an SH2-KD construct bound to dasatinib, which contains the relevant interface between the SH2 domain and the N-lobe of the KD. We show that the presence of the SH2 domain enhances kinase activity moderately and that this effect depends on contacts in the SH2/N-lobe interface and is abrogated by specific mutations. Consistently, formation of the interface decreases slightly the association rate of imatinib with the KD. That the effects are small compared with the dramatic in vivo consequences suggests an important function of the SH2-N-lobe interaction might be to help disassemble the auto-inhibited conformation of c-Abl and promote processive phosphorylation, rather than substantially stimulate kinase activity.

CRISPR-Cas9-mediated saturated mutagenesis screen predicts clinical drug resistance with improved accuracy.

PubMed

Ma, Leyuan; Boucher, Jeffrey I; Paulsen, Janet; Matuszewski, Sebastian; Eide, Christopher A; Ou, Jianhong; Eickelberg, Garrett; Press, Richard D; Zhu, Lihua Julie; Druker, Brian J; Branford, Susan; Wolfe, Scot A; Jensen, Jeffrey D; Schiffer, Celia A; Green, Michael R; Bolon, Daniel N

2017-10-31

Developing tools to accurately predict the clinical prevalence of drug-resistant mutations is a key step toward generating more effective therapeutics. Here we describe a high-throughput CRISPR-Cas9-based saturated mutagenesis approach to generate comprehensive libraries of point mutations at a defined genomic location and systematically study their effect on cell growth. As proof of concept, we mutagenized a selected region within the leukemic oncogene BCR-ABL1 Using bulk competitions with a deep-sequencing readout, we analyzed hundreds of mutations under multiple drug conditions and found that the effects of mutations on growth in the presence or absence of drug were critical for predicting clinically relevant resistant mutations, many of which were cancer adaptive in the absence of drug pressure. Using this approach, we identified all clinically isolated BCR-ABL1 mutations and achieved a prediction score that correlated highly with their clinical prevalence. The strategy described here can be broadly applied to a variety of oncogenes to predict patient mutations and evaluate resistance susceptibility in the development of new therapeutics. Published under the PNAS license.

First Detection of the Kdr Mutation T929I in Head Lice (Phthiraptera: Pediculidae) in Schoolchildren of the Metropolitan Area of Nuevo Leon and Yucatan, Mexico.