Sample records for t4s r10e s14

  1. Evaluation of anti-melanoma activities of (1S,2E,4R,6E,8R,11S,12R)-8,12-epoxy-2,6-cembradiene-4,11-diol, (1S,2E,4R,6E,8S,11R,12S)-8,11-epoxy-4,12-epoxy-2,6-cembradiene and (1S,4R,13S)-cembra-2E,7E,11E-trien-4,13-diol from the Red Sea soft coral Sarcophyton glaucum.

    PubMed

    Szymanski, Pawel T; Ahmed, Safwat A; Radwan, Mohamed M; Khalifa, Sherief I; Fahmy, Hesham

    2014-08-01

    Three natural cembranoids from the Red Sea soft coral Sarcophyton glaucum namely (1S,2E,4R,6E,8R,11S,12R)-8,12-epoxy-2,6-cembradiene-4,11-diol, (1S,2E,4R,6E,8S,11R,12S)-8,11-epoxy-4,12-epoxy-2,6-cembradiene and (1S,4R,13S)-cembra-2E,7E,11E-trien-4,13-diol were evaluated for their inhibitory effects on mouse melanoma B16F10 cell growth. Results show that all the cembranoids strongly inhibit viability of melanoma cells particularly during 48 -72 hrs treatment and also inhibit de novo DNA synthesis and PARP activity and stimulate fragmentation of DNA. (1S,2E,4R,6E,8R,11S,12R)-8,12-epoxy-2,6-cembradiene-4,11-diol was not cytotoxic to monkey kidney CV-1 cells at the concentration that produces the anti-melanoma effects which indicates that this compound may be a good candidate for further development. (1S,2E,4R,6E,8S,11R,12S)-8,11-epoxy-4,12-epoxy-2,6-cembradiene and (1S,4R,13S)-cembra-2E,7E,11E-trien-4,13-diol were found to be cytotoxic to healthy cells.

  2. Structures of exocyclic R,R- and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine adducts induced by 1,2,3,4-diepoxybutane.

    PubMed

    Kowal, Ewa A; Seneviratne, Uthpala; Wickramaratne, Susith; Doherty, Kathleen E; Cao, Xiangkun; Tretyakova, Natalia; Stone, Michael P

    2014-05-19

    1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N(6) position of adenine in DNA. Two enantiomers of bis-N(6)-dA adducts of DEB have been identified: R,R-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (R,R-DHB-dA), and S,S-N(6),N(6)-(2,3-dihydroxybutan-1,4-diyl)-2'-deoxyadenosine (S,S-DHB-dA) [ Seneviratne , U. , Antsypovich , S. , Dorr , D. Q. , Dissanayake , T. , Kotapati , S. , and Tretyakova , N. ( 2010 ) Chem. Res. Toxicol. 23 , 1556 -1567 ]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5'-d(C(1)G(2)G(3)A(4)C(5)X(6)A(7)G(8)A(9)A(10)G(11))-3':5'-d(C(12)T(13)T(14)C(15)T(16)T(17)G(18)T(19)C(20)C(21)G(22))-3' duplex [X(6) = R,R-DHB-dA (R(6)) or S,S-DHB-dA (S(6))]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N(6) bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N(6) bond, allows the complementary thymine, T(17), to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T(17) N3H imino proton. The loss of the second Watson-Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as

  3. Structures of Exocyclic R,R- and S,S-N6,N6-(2,3-Dihydroxybutan-1,4-diyl)-2′-Deoxyadenosine Adducts Induced by 1,2,3,4-Diepoxybutane

    PubMed Central

    2015-01-01

    1,3-Butadiene (BD) is an industrial and environmental chemical present in urban air and cigarette smoke, and is classified as a human carcinogen. It is oxidized by cytochrome P450 to form 1,2,3,4-diepoxybutane (DEB); DEB bis-alkylates the N6 position of adenine in DNA. Two enantiomers of bis-N6-dA adducts of DEB have been identified: R,R-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (R,R-DHB-dA), and S,S-N6,N6-(2,3-dihydroxybutan-1,4-diyl)-2′-deoxyadenosine (S,S-DHB-dA) [SeneviratneU., AntsypovichS., DorrD. Q., DissanayakeT., KotapatiS., and TretyakovaN. (2010) Chem. Res. Toxicol.23, 1556−156720873715]. Herein, the R,R-DHB-dA and S,S-DHB-dA adducts have been incorporated into the 5′-d(C1G2G3A4C5X6A7G8A9A10G11)-3′:5′-d(C12T13T14C15T16T17G18T19C20C21G22)-3′ duplex [X6 = R,R-DHB-dA (R6) or S,S-DHB-dA (S6)]. The structures of the duplexes were determined by molecular dynamics calculations, which were restrained by experimental distances obtained from NMR data. Both the R,R- and S,S-DHB-dA adducts are positioned in the major groove of DNA. In both instances, the bulky 3,4-dihydroxypyrrolidine rings are accommodated by an out-of-plane rotation about the C6-N6 bond of the bis-alkylated adenine. In both instances, the directionality of the dihydroxypyrrolidine ring is evidenced by the pattern of NOEs between the 3,4-dihydroxypyrrolidine protons and DNA. Also in both instances, the anti conformation of the glycosyl bond is maintained, which combined with the out-of-plane rotation about the C6-N6 bond, allows the complementary thymine, T17, to remain stacked within the duplex, and form one hydrogen bond with the modified base, between the imine nitrogen of the modified base and the T17 N3H imino proton. The loss of the second Watson–Crick hydrogen bonding interaction at the lesion sites correlates with the lower thermal stabilities of the R,R- and S,S-DHB-dA duplexes, as compared to the corresponding unmodified duplex. The reduced base stacking at the

  4. The novel 13S,14S-epoxy-maresin is converted by human macrophages to maresin 1 (MaR1), inhibits leukotriene A4 hydrolase (LTA4H), and shifts macrophage phenotype

    PubMed Central

    Dalli, Jesmond; Zhu, Min; Vlasenko, Nikita A.; Deng, Bin; Haeggström, Jesper Z.; Petasis, Nicos A.; Serhan, Charles N.

    2013-01-01

    Maresins are produced by macrophages from docosahexaenoic acid (DHA) and exert potent proresolving and tissue homeostatic actions. Maresin 1 (MaR1; 7R,14S-dihydroxy-docosa-4Z,8E,10E,12Z,16Z,19Z-hexaenoic acid) is the first identified maresin. Here, we investigate formation, stereochemistry, and precursor role of 13,14-epoxy-docosahexaenoic acid, an intermediate in MaR1 biosynthesis. The 14-lipoxygenation of DHA by human macrophage 12-lipoxygenase (hm12-LOX) gave 14-hydro(peroxy)-docosahexaenoic acid (14-HpDHA), as well as several dihydroxy-docosahexaenoic acids, implicating an epoxide intermediate formation by this enzyme. Using a stereo-controlled synthesis, enantiomerically pure 13S,14S-epoxy-docosa-4Z,7Z,9E,11E,16Z,19Z-hexaenoic acid (13S,14S-epoxy-DHA) was prepared, and its stereochemistry was confirmed by NMR spectroscopy. When this 13S,14S-epoxide was incubated with human macrophages, it was converted to MaR1. The synthetic 13S,14S-epoxide inhibited leukotriene B4 (LTB4) formation by human leukotriene A4 hydrolase (LTA4H) ∼40% (P<0.05) to a similar extent as LTA4 (∼50%, P<0.05) but was not converted to MaR1 by this enzyme. 13S,14S-epoxy-DHA also reduced (∼60%; P<0.05) arachidonic acid conversion by hm12-LOX and promoted conversion of M1 macrophages to M2 phenotype, which produced more MaR1 from the epoxide than M1. Together, these findings establish the biosynthesis of the 13S,14S-epoxide, its absolute stereochemistry, its precursor role in MaR1 biosynthesis, and its own intrinsic bioactivity. Given its actions and role in MaR1 biosynthesis, this epoxide is now termed 13,14-epoxy-maresin (13,14-eMaR) and exhibits new mechanisms in resolution of inflammation in its ability to inhibit proinflammatory mediator production by LTA4 hydrolase and to block arachidonate conversion by human 12-LOX rather than merely terminating phagocyte involvement.—Dalli, J., Zhu, M., Vlasenko, N. A., Deng, B., Haeggström, J. Z., Petasis, N. A., Serhan, C. N. The novel 13S

  5. Synthesis of novel (2R,4R)- and (2S,4S)-iso dideoxynucleosides with exocyclic methylene as potential antiviral agents.

    PubMed

    Yoo, Su Jeong; Kim, Hea Ok; Lim, Yoongho; Kim, Jeongmin; Jeong, Lak Shin

    2002-01-01

    Novel (2R,4R)- and (2S,4S)-iso dideoxynucleosides with exocyclic methylene have been designed and synthesized, based on the lead BMS-200475 (3) which exhibited potent anti-HBV activity. For the synthesis of D types of (2R,4R)-nucleosides, L-xylose was converted to the key intermediate 14. The intermediate 14 was converted to the uracil derivative 4a and the cytosine derivative 4b. Compound 14 was also converted to the purine derivatives such as adenine derivative 4c, hypoxanthine derivative 4d, and guanine derivative 4e. The corresponding L types of (2S,4S)-enantiomers were more efficiently synthesized from the commercially available 1,2-isopropylidene-D-xylose (20) than the synthetic method used in the synthesis of (2R,4R)-nucleosides. The key intermediate 25 was converted to the pyrimidine analogues 5a and 5b and the purine derivatives 5c, 5d, and 5e using the similar method used in the preparation of 4c, 4d, and 4e. The synthesized final (2R,4R)- and (2S,4S)-nucleosides were tested against several viruses such as HIV-1, HSV-1, HSV-2, HCMV and HBV. (2R,4R)-Adenine analogue 4c exhibited potent anti-HBV activity (EC(50)=1.5 microM in 2.2.15 cells) among compounds tested, while (2R,4R)-uracil derivative 4a was the most active against HCMV among compounds tested and (2R,4R)-adenine derivative 4c was found to be moderately active against the same virus. However, the corresponding (2S,4S)-isomers were found to be totally inactive against all tested viruses. Both (2R,4R)-adenine derivative 4c and (2S,4S)-adenine analogue 5c were totally resistant to the adenosine deaminase like iso-ddA (1). From the molecular modeling study the hydroxymethyl side chains of BMS-200475 (3) and 4c were almost overlapped, indicating that 4c may be suitable for phosphorylation by cellular kinases like the lead 3, but some discrepancy between two bases was observed, indicating why 4c is less potent against HBV than 3. It is concluded that discovery of (2R,4R)-adenine analogue 4c as potent

  6. Synthesis and crystal structures of (2 E )-1,4-bis(4-chlorophenyl)but-2-ene-1,4-dione and (2 E )-1,4-bis(4-bromophenyl)but-2-ene-1,4-dione

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lastovickova, Dominika N.; La Scala, John J.; Sausa, Rosario C.

    The molecular structure of (2 E )-1,4-bis(4-chlorophenyl)but-2-ene-1,4-dione [C 16 H 10 Cl 2 O 2 , ( 1 )] is composed of two p -chlorophenyl rings, each bonded on opposite ends to a near planar 1,4- trans enedione moiety [–C(=O)—CH=CH—(C=O)–] [r.m.s. deviation = 0.003 (1) Å]. (2 E )-1,4-Bis(4-bromophenyl)but-2-ene-1,4-dione [C 16 H 10 Br 2 O 2 , ( 2 )] has a similar structure to ( 1 ), but with two p -bromophenyl rings and a less planar enedione group [r.m.s. deviation = 0.011 (1) Å]. Both molecules sit on a center of inversion, thus Z ′ = 0.5. The dihedral angles between themore » ring and the enedione group are 16.61 (8) and 15.58 (11)° for ( 1 ) and ( 2 ), respectively. In the crystal, molecules of ( 1 ) exhibit C—Cl...Cl type I interactions, whereas molecules of ( 2 ) present C—Br...Br type II interactions. van der Waals-type interactions contribute to the packing of both molecules, and the packing reveals face-to-face ring stacking with similar interplanar distances of approximately 3.53 Å.« less

  7. Synthesis and crystal structures of (2 E )-1,4-bis(4-chlorophenyl)but-2-ene-1,4-dione and (2 E )-1,4-bis(4-bromophenyl)but-2-ene-1,4-dione

    DOE PAGES

    Lastovickova, Dominika N.; La Scala, John J.; Sausa, Rosario C.

    2018-02-13

    The molecular structure of (2 E )-1,4-bis(4-chlorophenyl)but-2-ene-1,4-dione [C 16 H 10 Cl 2 O 2 , ( 1 )] is composed of two p -chlorophenyl rings, each bonded on opposite ends to a near planar 1,4- trans enedione moiety [–C(=O)—CH=CH—(C=O)–] [r.m.s. deviation = 0.003 (1) Å]. (2 E )-1,4-Bis(4-bromophenyl)but-2-ene-1,4-dione [C 16 H 10 Br 2 O 2 , ( 2 )] has a similar structure to ( 1 ), but with two p -bromophenyl rings and a less planar enedione group [r.m.s. deviation = 0.011 (1) Å]. Both molecules sit on a center of inversion, thus Z ′ = 0.5. The dihedral angles between themore » ring and the enedione group are 16.61 (8) and 15.58 (11)° for ( 1 ) and ( 2 ), respectively. In the crystal, molecules of ( 1 ) exhibit C—Cl...Cl type I interactions, whereas molecules of ( 2 ) present C—Br...Br type II interactions. van der Waals-type interactions contribute to the packing of both molecules, and the packing reveals face-to-face ring stacking with similar interplanar distances of approximately 3.53 Å.« less

  8. Synthesis and crystal structures of (2E)-1,4-bis-(4-chloro-phen-yl)but-2-ene-1,4-dione and (2E)-1,4-bis-(4-bromo-phen-yl)but-2-ene-1,4-dione.

    PubMed

    Lastovickova, Dominika N; La Scala, John J; Sausa, Rosario C

    2018-03-01

    The mol-ecular structure of (2 E )-1,4-bis-(4-chloro-phen-yl)but-2-ene-1,4-dione [C 16 H 10 Cl 2 O 2 , ( 1 )] is composed of two p -chlorophenyl rings, each bonded on opposite ends to a near planar 1,4- trans enedione moiety [-C(=O)-CH=CH-(C=O)-] [r.m.s. deviation = 0.003 (1) Å]. (2 E )-1,4-Bis(4-bromo-phen-yl)but-2-ene-1,4-dione [C 16 H 10 Br 2 O 2 , ( 2 )] has a similar structure to ( 1 ), but with two p -bromophenyl rings and a less planar enedione group [r.m.s. deviation = 0.011 (1) Å]. Both mol-ecules sit on a center of inversion, thus Z ' = 0.5. The dihedral angles between the ring and the enedione group are 16.61 (8) and 15.58 (11)° for ( 1 ) and ( 2 ), respectively. In the crystal, mol-ecules of ( 1 ) exhibit C-Cl⋯Cl type I inter-actions, whereas mol-ecules of ( 2 ) present C-Br⋯Br type II inter-actions. van der Waals-type inter-actions contribute to the packing of both mol-ecules, and the packing reveals face-to-face ring stacking with similar inter-planar distances of approximately 3.53 Å.

  9. 14S,21R-dihydroxy-docosahexaenoic acid treatment enhances mesenchymal stem cell amelioration of renal ischemia/reperfusion injury.

    PubMed

    Tian, Haibin; Lu, Yan; Shah, Shraddha P; Wang, Quansheng; Hong, Song

    2012-05-01

    Bone marrow mesenchymal stem cells (MSCs) have shown potential to improve treatment of renal failure. The prohealing functions of MSCs have been found to be enhanced by treatment with the lipid mediator, 14S,21R-dihydroxy-docosa4Z,7Z,10Z,12E,16Z,19Z-hexaenoic acid (14S,21R-diHDHA). In this article, using a murine model of renal ischemia/reperfusion (I/R) injury, we found that treatment with 14S,21R-diHDHA enhanced MSC amelioration of renal I/R injury. Treated MSCs more efficiently inhibited I/R-induced elevation of serum creatinine levels, reduced renal tubular cell death, and inhibited infiltration of neutrophils, macrophages, and dendritic cells in kidneys. Conditioned medium from treated MSCs reduced the generation of tumor necrosis factor-α and reactive oxygen species by macrophages under I/R conditions. Infusion of treated MSCs more efficiently reduced I/R-damage to renal histological structures compared with untreated MSCs (injury score: 7.9±0.4 vs. 10.5±0.5). Treated MSCs were resistant to apoptosis in vivo when transplanted under capsules of I/R-injured kidneys (active caspase-3+ MSCs: 4.2%±2.8% vs. 11.7%±2.4% of control) and in vitro when cultured under I/R conditions. Treatment with 14S,21R-diHDHA promoted viability of MSCs through a mechanism involving activation of the phosphoinositide 3-kinase -Akt signaling pathway. Additionally, treatment of MSCs with 14S,21R-diHDHA promoted secretion of renotrophic hepatocyte growth factor and insulin growth factor-1. Similar results were obtained when 14S,21RdiHDHA was used to inhibit apoptosis of human MSCs (hMSCs) and to increase the generation of renotrophic cytokines from hMSCs. These findings provide a lead for new strategies in the treatment of acute kidney injury with MSCs.

  10. 4. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. MAIN (TITLED FLORENCE) CANAL, CHINA WASH FLUME, 5/13/25 - San Carlos Irrigation Project, China Wash Flume, Main (Florence-Case Grande) Canal at Station 137+00, T4S, R10E, S14, Coolidge, Pinal County, AZ

  11. Neuroprotective Activity of (1S,2E,4R,6R,-7E,11E)-2,7,11-cembratriene-4,6-diol (4R) in vitro and in vivo in Rodent Models of Brain Ischemia

    PubMed Central

    Xu, Zhenfeng; Mu, Chaofeng; Alvarez, Paloma; Ford, Byron D.; El Sayed, Khalid; Eterovic, Vesna A.; Ferchmin, Pedro A.; Hao, Jiukuan

    2015-01-01

    (1S,2E,4R,6R,-7E,11E)-2,7,11-cembratriene-4,6-diol (4R) is a precursor to key flavor ingredients in leaves of Nicotiana species. The present study shows 4R decreased brain damage in rodent ischemic stroke models. The 4R-pretreated mice had lower infarct volume (26.2±9.7 mm3) than those in control groups (untreated: 63.4±4.2 mm3, DMSO: 60.2±14.2 mm3). The 4R-posttreated rats also had less infarct volume (120±65 mm3) than those in the rats of DMSO group (291±95 mm3). The results from in vitro experiments indicate that 4R decreased neuro2a cells (neuroblastoma cells) apoptosis induced by oxygen glucose deprivation (OGD), and improved the population spikes (PSs) recovery in rat acute hippocampal slices under OGD; a phosphatidylinositol 3-kinase (PI3K) inhibitor, wortmannin, abolished the effect of 4R on PSs recovery. Furthermore, 4R also inhibited monocyte adhesion to bEND5 cells (murine brain-derived endothelial cells) and upregulation of intercellular adhesion molecule-1(ICAM-1) induced by OGD/reoxygenation (OGD/R), and restored the p-Akt level to pre-OGD/R values in bEND5 cells. In conclusion, the present study indicates that 4R has a protective effect in rodent ischemic stroke models. Inhibition of ICAM-1 expression and restoration of Akt phosphorylation are the possible mechanisms involved in cellular protection by 4R. PMID:25677097

  12. Neuroprotective activity of (1S,2E,4R,6R,-7E,11E)-2,7,11-cembratriene-4,6-diol (4R) in vitro and in vivo in rodent models of brain ischemia.

    PubMed

    Martins, Antonio H; Hu, Jing; Xu, Zhenfeng; Mu, Chaofeng; Alvarez, Paloma; Ford, Byron D; El Sayed, Khalid; Eterovic, Vesna A; Ferchmin, Pedro A; Hao, Jiukuan

    2015-04-16

    (1S,2E,4R,6R,-7E,11E)-2,7,11-cembratriene-4,6-diol (4R) is a precursor to key flavor ingredients in leaves of Nicotiana species. The present study shows 4R decreased brain damage in rodent ischemic stroke models. The 4R-pretreated mice had lower infarct volumes (26.2±9.7 mm3) than those in control groups (untreated: 63.4±4.2 mm3, DMSO: 60.2±14.2 mm3). The 4R-posttreated rats also had less infarct volumes (120±65 mm3) than those in the rats of the DMSO group (291±95 mm3). The results from in vitro experiments indicate that 4R decreased neuro2a cell (neuroblastoma cells) apoptosis induced by oxygen-glucose deprivation (OGD), and improved the population spikes' (PSs) recovery in rat acute hippocampal slices under OGD; a phosphatidylinositol 3-kinase (PI3K) inhibitor, wortmannin, abolished the effect of 4R on PSs recovery. Furthermore, 4R also inhibited monocyte adhesion to murine brain-derived endothelial (bEND5) cells and upregulation of intercellular adhesion molecule-1(ICAM-1) induced by OGD/reoxygenation (OGD/R), and restored the p-Akt level to pre-OGD/R values in bEND5 cells. In conclusion, the present study indicates that 4R has a protective effect in rodent ischemic stroke models. Inhibition of ICAM-1 expression and restoration of Akt phosphorylation are the possible mechanisms involved in cellular protection by 4R. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  13. Peroxygenase-Catalyzed Fatty Acid Epoxidation in Cereal Seeds (Sequential Oxidation of Linoleic Acid into 9(S),12(S),13(S)-Trihydroxy-10(E)-Octadecenoic Acid).

    PubMed Central

    Hamberg, M.; Hamberg, G.

    1996-01-01

    Peroxygenase-catalyzed epoxidation of oleic acid in preparations of cereal seeds was investigated. The 105,000g particle fraction of oat (Avena sativa) seed homogenate showed high peroxygenase activity, i.e. 3034 [plus or minus] 288 and 2441 [plus or minus] 168 nmol (10 min)-1 mg-1 protein in two cultivars, whereas the corresponding fraction obtained from barley (Hordeum vulgare and Hordeum distichum), rye (Secale cereale), and wheat (Triticum aestivum) showed only weak activity, i.e. 13 to 138 nmol (10 min)-1 mg-1 protein. In subcellular fractions of oat seed homogenate, peroxygenase specific activity was highest in the 105,000g particle fraction, whereas lipoxygenase activity was more evenly distributed and highest in the 105,000g supernatant fraction. Incubation of [1-14C]linoleic acid with the 105,000g supernatant of oat seed homogenate led to the formation of several metabolites, i.e. in order of decreasing abundance, 9(S)-hydroxy-10(E),12(Z)-octadecadienoic acid, 9(S),12(S),13(S)-trihydroxy-10(E)-octadecenoic acid, cis-9,10-epoxy-12(Z)-octadecenoic acid [mainly the 9(R),10(S) enantiomer], cis-12,13-epoxy-9(Z)-octadecenoic acid [mainly the 12(R),13(S) enantiomer], threo-12,13-dihydroxy-9(Z)-octadecenoic acid, and 12(R),13(S)-epoxy-9(S)-hydroxy-10(E)-octadecenoic acid. Incubation of linoleic acid with the 105,000g particle fraction gave a similar, but not identical, pattern of metabolites. Conversion of linoleic acid into 9(S),12(S),13(S)-trihydroxy-10(E)-octadecenoic acid, a naturally occurring oxylipin with antifungal properties, took place by a pathway involving sequential catalysis by lipoxygenase, peroxygenase, and epoxide hydrolase. PMID:12226220

  14. 14. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. SACATON DAM AND BRIDGE, CONSTRUCTION BRIDGE PIERS - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  15. Absolute structure and structure-function relationships of 4R,2‧R and 4S,2‧S Pidotimod®

    NASA Astrophysics Data System (ADS)

    Sarno, Simone; Manzo, Angelo M.; Ferraris, Davide M.; Miggiano, Riccardo; Rizzi, Menico; Palin, Luca; Boccaleri, Enrico; Milanesio, Marco

    2017-11-01

    Pidotimod® is a dipeptide with widely recognized immunomodulatory properties and with particularly beneficial effects for the treatment of acute respiratory and urinary tract infections. Pidotimod® presents two chiral centres which originate four stereoisomers. (4R,2‧S, 4S,2‧R, 4R,2‧R and 4S,2‧S). To date, only the 4R,2‧S and 4S,2‧R stereoisomers are reported in the literature. We report here the absolute crystal structure of the 4R,2‧R and 4S,2‧S diastereoisomers of Pidotimod®, obtained by crystals grown by slow evaporation of a mixture of water and ethanol. The analysis of the crystal structures revealed the key role of a solvent water molecule in the crystal packing engaged in an extended hydrogen bonds network. This water-assisted H-bond network explained the recalcitrance of 4R,2‧R and 4S,2‧S Pidotimod® to crystallize in pure ethanol, despite their high solubility, and the growth of well-diffracting crystals only in presence of water. Hence, Pidotimod®4R,2‧R and 4S,2‧S stereoisomers markedly differ from the 4R,2‧S and 4S,2‧R ones, which crystallize in absence of water. The molecular and crystal structures of the 4R,2‧R and 4S,2‧S Pidotimod® stereoisomers here presented gave some hints on the differences in bioactivity with respect to the 4R,2‧S stereoisomer. In fact, beyond an expected different dispositions of hydrophilic ligands, 4R,2‧R and 4S,2‧S showed an incremented tendency to intermolecular H-bonds with water.

  16. U.S. EPA, Pesticide Product Label, T-CHLOR, 02/21/1990

    EPA Pesticide Factsheets

    2011-04-21

    ... t, tI'.;r:;";~I, SII";' ;; cf ttu ;:;r;::IlIn 'Itt 10 s.llor.s,' ,,;tH t; ,rO,'I'" ,;;r;lll.jtE1J t:: ,;a "iili!:lt CtlOrlJ;1 II wtiS:;:. ... h;:) ,n~ rlr.Sf 5,U,:fCj Ir~I~'lr.t .Itt ;::."1' .,', far .u, ...

  17. U.S./U.S.S.R. SYMPOSIUM ON PARTICULATE CONTROL (3RD) HELD AT SUZDAL, U.S.S.R. ON SEPTEMBER 10-12, 1979

    EPA Science Inventory

    The proceedings document the Third U.S./U.S.S.R. Symposium on Particulate Control, September 10-12, 1979, in Suzdal, U.S.S.R. Papers covered such topics as: predicting back-corona formation and fly ash resistivity, improved electrostatic precipitator (ESP) mathematical modeling, ...

  18. Enantioselective Allylation of (2E,4E)-2,4-Dimethylhexadienal: Synthesis of (5R,6S)-(+)-Pteroenone.

    PubMed

    Koukal, Petr; Kotora, Martin

    2015-05-11

    Allylation, trans- and cis-crotylation of (2E,4E)-2,4-dimethylhexadienal, a representative α,β,γ,δ-unsaturated aldehyde, was carried out under different catalytic and stoichiometric conditions. The reactions catalyzed by organocatalysts TRIP-PA and N,N'-dioxides gave the best results with respect to yields, asymmetric induction, and catalyst load in comparison to other procedures. The developed methodology was applied in the enantioselective synthesis of (5R,6S)-(+)-pteroenone, a defensive metabolite (ichthyodeterrent) of the Antarctic pteropod Clione antarctica. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Future Combat Systems Use of M&S for T&E

    DTIC Science & Technology

    2008-03-13

    providing M &S for both SBA and objective operations. M &S WG Subgroup (EMS) IS&T SSEI / C4ISR / NSI Network Analysis & Modeling SoS Analysis 3CE MSO M &S...IPTs & OTPs Inter-CoP grid M &S Enterprise Management- SSEI / LRR Modeling and Simulation Implementation Strategy Approved for public release...Future Combat Systems Use of M &S for T&E DoD Modeling and Simulation Conference Acquisition and T&E M &S Practitioners Panel Phil Zimmerman, FCS M &S

  20. E-selectin S128R polymorphism and severe coronary artery disease in Arabs

    PubMed Central

    Abu-Amero, Khaled K; Al-Boudari, Olayan M; Mohamed, Gamal H; Dzimiri, Nduna

    2006-01-01

    Background The E-selectin p. S128R (g. A561C) polymorphism has been associated with the presence of angiographic coronary artery disease (CAD) in some populations, but no data is currently available on its association with CAD in Arabs. Methods In the present study, we determined the potential relevance of the E-selectin S128R polymorphism for severe CAD and its associated risk factors among Arabs. We genotyped Saudi Arabs for this polymorphism by PCR, followed by restriction enzyme digestion. Results The polymorphism was determined in 556 angiographically confirmed severe CAD patients and 237 control subjects with no CAD as established angiographically (CON). Frequencies of the S/S, S/R and R/R genotypes were found as 81.1%, 16.6% and 2.3% in CAD patients and 87.8%, 11.8%, and 0.4% in CON subjects, respectively. The frequency of the mutant 128R allele was higher among CAD patients compared to CON group (11% vs. 6%; odds ratio = 1.76; 95% CI 1.14 – 2.72; p = .007), thus indicating a significant association of the 128R allele with CAD among our population. However, the stepwise logistic regression for the 128R allele and different CAD risk factors showed no significant association. Conclusion Among the Saudi population, The E-selectin p. S128R (g. A561C) polymorphism was associated with angiographic CAD in Univariate analysis, but lost its association in multivariate analysis. PMID:16756647

  1. Resistance mechanisms of linezolid-nonsusceptible enterococci in Korea: low rate of 23S rRNA mutations in Enterococcus faecium.

    PubMed

    Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong

    2017-12-01

    To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.

  2. Biotransformation of (-)-(1R,4S)-Menthone and (+)-(1S,4R)-Menthone by the Common Cutworm Spodoptera litura Larvae.

    PubMed

    Marumoto, Shinsuke; Okuno, Yoshiharu; Hagiwara, Yuki; Miyazawa, Mitsuo

    2017-08-01

    Using biotransformation as a biocatalytic process has the advantage of being able to proceed under mild conditions and with high regio- and enantioselectivity. This study investigated the biotransformation of (-)-(1R,4S)-menthone (1) and (+)-(1S,4R)-menthone (2) by Spodoptera litura larvae. Compound 1 was converted to (-)-(1R,4S)-7-hydroxymenthone (1-1), (+)-(1R,3S,4S)-7-hydroxyneomenthol (1-2) and (-)-(1R,4S,8R)-p-menth-3-one-9-oic acid (1-3). The metabolism of substrate 2 generated three enantiomers of the above metabolites, designated as 2-1 to 2-3, respectively. The C-9 position of (-)-menthone and (+)-menthone was oxidized to carboxylic acid by S. litura, which is a metabolic pathway not observed in any other example of biocatalysis.

  3. High power factor in thiospinels Cu2 T r Ti3S8 ( T r = Mn, Fe, Co, Ni) arising from TiS6 octahedron network

    NASA Astrophysics Data System (ADS)

    Hashikuni, Katsuaki; Suekuni, Koichiro; Usui, Hidetomo; Ohta, Michihiro; Kuroki, Kazuhiko; Takabatake, Toshiro

    2016-10-01

    Thermoelectric properties and electronic structures of n-type thiospinels Cu2T r Ti3S8 composed of CuS4 tetrahedron and (Tr/Ti)S6 octahedron network have been studied for T r = Mn, Fe, Co, and Ni. The samples with T r = Mn, Co, and Ni exhibit metallic behaviors in the electrical resistivity (ρ) and rather large and negative thermopower (S), leading to a high power factor (S2/ρ) of 0.4-0.6 mW/K2 m at 650 K. In addition to the superior electrical properties, relatively low thermal conductivity of ˜2 W/Km gives rise to a dimensionless figure of merit ZT reaching 0.16-0.18 at 650 K. The analysis of the temperature dependent magnetic susceptibility indicates that the Mn, Fe, and Ni ions are in high-spin divalent states while the Co2+ ion is in a low-spin nonmagnetic state. This electronic state for the Co2+ in Cu2CoTi3S8 is consistent with our first-principles electronic structure calculation indicating that the Fermi level lies in the conduction bands composed mainly of Ti-3d, Co-3d, and S-3p orbitals. The Ti-3d and S-3p orbitals forming the octahedron network likely results in high power factors irrespective of Tr elements. The addition of Co-3d orbitals makes a peak with steep slope in the density of states near the Fermi level, leading to the further enhanced power factor.

  4. 3-[4-Bromo-α( R*)-methoxybenzyl]-6-chloro-3( S*),4( S*)-dihydroxychroman: X-ray and DFT Studies

    NASA Astrophysics Data System (ADS)

    Sepay, Nayim; Mondal, Rina; Guha, Chayan; Mallik, Asok K.

    2018-05-01

    Sodium borohydride reduction of E-3-benzylidenechromanone epoxides in dry methanol has afforded 3( S*), 4( S*)-dihydroxy-3-[α( R*)-methoxybenzyl]chromans as an interesting class of products, the structures of which have been assigned mainly from spectral data and consideration of the mechanistic aspects. X-ray diffraction study of one of them, 3-[4-bromo-α( R*)-methoxybenzyl]-6-chloro-3( S*),4( S*)- dihydroxychroman, is performed. The title compound crystallizes in the monoclinic sp. gr. P21/ n, with a = 13.336(6) Å, b = 10.866(5) Å, c = 27.166(11) Å, β = 95.193(6)°, V = 3920(3) Å3, and Z = 8. Supramolecular construction of the compound involves O-H···O intermolecular hydrogen bonds as well as three other types of non-covalent interactions which are responsible for crystal packing. Density functional theory was applied for geometry optimization, molecular orbital calculations, and prediction of UV spectral features. The geometric parameters (bond lengths, bond angles, and dihedral angles) for the representative compound obtained from density functional theory with B3LY6-31G basis set were in good agreement with experimental values.

  5. Brief Report: CD14brightCD16- monocytes and sCD14 level negatively associate with CD4-memory T-cell frequency and predict HCV-decline on therapy.

    PubMed

    Judge, Chelsey J; Sandberg, Johan K; Funderburg, Nicholas T; Sherman, Kenneth E; Butt, Adeel A; Kang, Minhee; Landay, Alan L; Lederman, Michael M; Anthony, Donald D

    2016-11-01

    During HIV+ hepatitis C virus (HCV)+ coinfection CD14CD16 monocytes produce soluble immune-activation markers that predict disease progression and poor response to interferon (IFN)-α treatment. We evaluated relationships among immune activation, monocyte phenotype, CD4-memory T cells, and HCV-, cytomegalovirus-, and cytomegalovirus/Epstein-Barr virus/influenza-specific IFN-γ-response before and during IFN-α treatment. Effector-memory and central-memory CD4 T-cell frequencies were lower in HCV+ HIV+ donors than in uninfected donors and correlated negatively with HCV level, CD14CD16 monocytes, and plasma sCD14. sCD14 and CD14CD16 monocytes negatively correlated with IFN-α-dependent HCV decline. CD4 effector-memory T cells positively associated with cytomegalovirus/Epstein-Barr virus/influenza(CEF)-specific IFN-γ response, while sCD14 negatively associated with both CD4 effector-memory T cells and CEF-specific IFN-γ response. These data support a role for memory-CD4 T cells in HCV containment and link immune activation and CD14CD16-monocyte frequency to the failure of IFN-dependent HCV clearance.

  6. Threefold interweaving of (4,4) nets built from R(10)10(58) rings inthe hydrogen-bonded adduct 1,4-diazabicyclo

    PubMed

    Burchell; Ferguson; Lough; Glidewell

    2000-09-01

    The 1:1 adduct of 1,4-diazabicyclo[2.2.2]octane and 5-hydroxyisophthalic acid is a salt, [H(C(6)H(12)N(2))](+). [HOC(6)H(3)(COOH)COO](-) or C(6)H(13)N(2)(+).C(8)H(5)O(5)(-). The ions are linked by three types of hydrogen bond, i.e. N-H.O, O-H.O and O-H.N, into continuous two-dimensional (4,4) nets built from a single type of R(10)(10)(58) ring. Six independent sheets of this type make up the structure and these are interwoven in sets of three.

  7. 11 CFR 102.14 - Names of political committees (2 U.S.C. 432(e) (4) and (5)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Names of political committees (2 U.S.C. 432(e... REGISTRATION, ORGANIZATION, AND RECORDKEEPING BY POLITICAL COMMITTEES (2 U.S.C. 433) § 102.14 Names of political committees (2 U.S.C. 432(e) (4) and (5)). (a) The name of each authorized committee shall include...

  8. Overview of T.E.S.T. (Toxicity Estimation Software Tool)

    EPA Science Inventory

    This talk provides an overview of T.E.S.T. (Toxicity Estimation Software Tool). T.E.S.T. predicts toxicity values and physical properties using a variety of different QSAR (quantitative structure activity relationship) approaches including hierarchical clustering, group contribut...

  9. 10. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1919. Vol. I, RG 75, Entry 655, Box 25, National Archives, Washington, DC.) ASHURST-HAYDEN (FLORENCE) DAM SITE, BRUSH DAM ACROSS THE RIVER - San Carlos Irrigation Project, Ashurst-Hayden Dam, Gila River, T4S R11E S7, Coolidge, Pinal County, AZ

  10. Divergent Synthesis of Revised Apratoxin E, 30-epi-Apratoxin E, and 30S/30R-Oxoapratoxin E.

    PubMed

    Mao, Zhuo-Ya; Si, Chang-Mei; Liu, Yi-Wen; Dong, Han-Qing; Wei, Bang-Guo; Lin, Guo-Qiang

    2017-10-20

    In this report, originally proposed apratoxin E (30S-7), revised apratoxin E (30R-7), and (30S)/(30R)-oxoapratoxin E (30S)-38/(30R)-38 were efficiently prepared by two synthetic methods. The chiral lactone 10, recycled from the degradation of saponin glycosides, was utilized to prepare the key nonpeptide fragment 9. Our alternative convergent assembly strategy was applied to the divergent synthesis of revised apratoxin E and its three analogues. Moreover, ring-closing metathesis (RCM) was for the first time found to be an efficient strategy for the macrocyclization of apratoxins.

  11. Multidimensional Space-Time Methodology for Development of Planetary and Space Sciences, S-T Data Management and S-T Computational Tomography

    NASA Astrophysics Data System (ADS)

    Andonov, Zdravko

    Complex Time and Quan-tum Wave Cosmology Paradigm for Decision of the Main Problem of Contemporary Physics. 3. R&D of Einstein-Minkowski Geodesies' Paradigm in the 4D-Space-Time Continuum to 6D-6nD Space-Time Continuum Paradigms and 6D S-T Equations. . . 4. R&D of Erwin Schrüdinger 4D S-T Universe' Evolutional Equation; It's David Bohm 4D generalization for anisotropic mediums and innovative 6D -for instantaneously quantum measurement -Bohm-Schrüdinger 6D S-T Universe' Evolutional Equation. 5. R&D of brain new 6D Planning of S-T Experi-ments, brain new 6D Space Technicks and Space Technology Generalizations, especially for 6D RS VHRS Research, Monitoring and 6D Computational Tomography. 6. R&D of "6D Euler-Poisson Equations" and "6D Kolmogorov Turbulence Theory" for GeoDynamics and for Space Dynamics as evolution of Gauss-Riemann Paradigms. 7. R&D of N. Boneff NASA RD for Asteroid "Eros" & Space Science' Laws Evolution. 8. R&D of H. Poincare Paradigm for Nature and Cosmos as 6D Group of Transferences. 9. R&D of K. Popoff N-Body General Problem & General Thermodynamic S-T Theory as Einstein-Prigogine-Landau' Paradigms Development. ü 10. R&D of 1st GUT since 1958 by N. S. Kalitzin (Kalitzin N. S., 1958: Uber eine einheitliche Feldtheorie. ZAHeidelberg-ARI, WZHUmnR-B., 7 (2), 207-215) and "Multitemporal Theory of Relativity" -With special applications to Photon Rockets and all Space-Time R&D. GENERAL CONCLUSION: Multidimensional Space-Time Methodology is advance in space research, corresponding to the IAF-IAA-COSPAR Innovative Strategy and R&D Programs -UNEP, UNDP, GEOSS, GMES, Etc.

  12. Design and synthesis of highly potent benzodiazepine gamma-secretase inhibitors: preparation of (2S,3R)-3-(3,4-difluorophenyl)-2-(4-fluorophenyl)-4- hydroxy-N-((3S)-1-methyl-2-oxo-5- phenyl-2,3-dihydro-1H-benzo[e][1,4]-diazepin-3-yl)butyramide by use of an asymmetric Ireland-Claisen rearrangement.

    PubMed

    Churcher, Ian; Williams, Susie; Kerrad, Sonia; Harrison, Timothy; Castro, José L; Shearman, Mark S; Lewis, Huw D; Clarke, Earl E; Wrigley, Jonathan D J; Beher, Dirk; Tang, Yui S; Liu, Wensheng

    2003-06-05

    Novel benzodiazepine-containing gamma-secretase inhibitors for potential use in Alzheimer's disease have been designed that incorporate a substituted hydrocinnamide C-3 side chain. A syn combination of alpha-alkyl or aryl and beta-hydroxy or hydroxymethyl substituents was shown to give highly potent compounds. In particular, (2S,3R)-3-(3,4-difluorophenyl)-2-(4-fluorophenyl)-4-hydroxy-N-((3S)-2-oxo-5-phenyl-2,3-dihydro-1H-benzo[e][1,4]diazepin-3-yl)butyramide (34) demonstrated excellent in vitro potency (IC(50) = 0.06 nM). 34 could also be selectively methylated to give [(3)H]-28, which is of use in radioligand binding assays.

  13. (R,S)-2-chlorophenoxyl pyrazolides as novel substrates for improving lipase-catalyzed hydrolytic resolution.

    PubMed

    Kao, Min-fang; Lu, Pei-yu; Kao, Jou-yan; Wang, Pei-yun; Wu, An-chi; Tsai, Shau-Wei

    2012-01-01

    The best reaction condition of Candida antartica lipase B as biocatalyst, 3-(2-pyridyl)pyrazole as leaving azole, and water-saturated methyl t-butyl ether as reaction medium at 45°C were first selected for performing the hydrolytic resolution of (R,S)-2-(4-chlorophenoxyl) azolides (1-4). In comparison with the kinetic resolution of (R,S)-2-phenylpropionyl 3-(2-pyridyl)pyrazolide or (R,S)-α-methoxyphenylacetyl 3-(2-pyridyl)pyrazolide at the same reaction condition, excellent enantioselectivity with more than two order-of-magnitudes higher activity for each enantiomer was obtained. The resolution was then extended to other (R,S)-3-(2-pyridyl)pyrazolides (5-7) containing 2-chloro, 3-chloro, or 2,4-dichloro substituent, giving good (E > 48) to excellent (E > 100) enantioselectivity. The thermodynamic analysis for 1, 2, and 4-7 demonstrates profound effects of the acyl or leaving moiety on varying enthalpic and entropic contributions to the difference of Gibbs free energies. A thorough kinetic analysis further indicates that on the basis of 6, the excellent enantiomeric ratio for 4 and 7 is due to the higher reactivity of (S)-4 and lower reactivity of (R)-7, respectively. Copyright © 2011 Wiley-Liss, Inc.

  14. U.S. EPA, Pesticide Product Label, , 10/14/1982

    EPA Pesticide Factsheets

    2011-04-21

    ... p,<~,.d Of Pf~~, •• 4 'f," ""I r. food ,. _d_ ar rllArT".( '1lf.T~[.T 1/ '!oo.II_, [on"lno ..,'m',,,, dh",I.'e. 110 nbl Ind""" _'I""~. Go, "",~ll.1 .".,.li"". If In [yo" Flu, .. ~. ...

  15. 10. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1919. Vol. I, RG 75, Entry 655, BOx 25, National Archives, Washington, D.C.) Photographer unknown. SACATION DAM SITE LOOKING SOUTH SHOWING HEADWORKS OF SAN TAN FLOOD-WATER CANAL - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  16. Electron excitation cross sections for the 2s(2)2p(3)4S(O) -- 2s(2)2p(3)2D(O) (forbidden) and 4S(O) -- 2s2p(4) 4P (resonance) transitions in O II

    NASA Technical Reports Server (NTRS)

    Zuo, M.; Smith, Steven J.; Chutjian, A.; Williams, I. D.; Tayal, S. S.; Mclaughlin, Brendan M.

    1995-01-01

    Experimental and theoretical excitation cross sections are reported for the first forbidden transition 4S(O) -- 2S(2)2p(3) 2D(O) (lambda-lambda 3726, 3729) and the first allowed (resonance) transition 4S(O) -- 2s2p(4) 4P(lambda-833) in O II. Use is made of electron energy loss and merged-beams methods. The electron energy range covered is 3.33 (threshold) to 15 eV for the S -- D transition, and 14.9 (threshold) to 40 eV for the S -- P transition. Care was taken to assess and minimize the metastable fraction of the O II beam. An electron mirror was designed and tested to reflect inelastically backscattered electrons into the forward direction to account for the full range of polar scattering angles. Comparisons are made between present experiments and 11-state R-matrix calculations. Calculations are also presented for the 4S(O) -- 2s(2)2p(3)2P(O) (lambda-2470) transition.

  17. HFNET-A Computer Program to Calculate Nuclear Effects on HF/VHF Communications Systems. Volume II. User’s Guide.

    DTIC Science & Technology

    1979-11-30

    FE = rF, 10. 20 MH4Z -- DEFAULT HOPS : DETPILEF’ PPINTOUT FOP 20 MH2Z ONLY. S.HFFC PiC :T1 T’ DT LINK FREO HOPS EFLPG PFLRG A 1900 02100 0070 0 10...iutEP 3548.,-- -DFl’E-, NEXT I1ST NUDE SET’S WORDS ’Ŗ �! ’l 21 EvNT i6 󈧋 IO 1 14 ESIIT S8 34 I3 I-E 3 4 E T 16 - 58 7 -- 84IT 16 % 26 65 2’ E

  18. High Levels of IL-10 and CD4+CD25hi+ Treg Cells in Endemic Burkitt’s Lymphoma Patients

    PubMed Central

    Futagbi, Godfred; Gyan, Ben; Nunoo, Harriet; Tetteh, John K.A.; Welbeck, Jennifer E.; Renner, Lorna Awo; Ofori, Michael; Dodoo, Daniel; Edoh, Dominic A.; Akanmori, Bartholomew D.

    2015-01-01

    Background: The interplay between Epstein-Barr virus infection, malaria, and endemic Burkitt’s Lymphoma is not well understood. Reports show diminished EBV-specific Th1 responses in children living in malaria endemic areas and deficiency of EBNA1-specific IFN-γ T cell responses in children with endemic Burkitt’s Lymphoma (eBL). This study, therefore, examined some factors involved in the loss of EBNA-1-specific T cell responses in eBL. Methods: T-cell subset frequencies, activation, and IFN-γ- or IL-4-specific responses were analyzed by flow-cytometry. Plasma cytokine levels were measured by ELISA. Results: CD4+ and CD8+ cells in age- and sex-matched healthy controls (n = 3) expressed more IFN-γ in response to all immunostimulants than in pediatric endemic BL (eBL) patients (n = 4). In healthy controls, IFN-γ expression was higher than IL-4 expression, whereas in eBL patients the expression of IL-4 by CD4+ cells to EBNA-1 was slightly higher than IFN-γ. Moreover, the blood levels of TNF-α was significantly lower (p = 0.004) while IL-10 was significantly higher (p = 0.038), in eBL patients (n = 21) compared to controls (n = 16). Additionally, the frequency of CD4+CD25hi+ T cells was higher in both age-matched acute uncomplicated malaria (n = 26) and eBL (n = 14) patients compared to healthy controls (n = 19; p = 0.000 and p = 0.027, respectively). Conclusion: The data suggest that reduced Th1 response in eBL might be due to increased levels of IL-10 and T reg cells. PMID:28536409

  19. Measures and Trends U.S. and U.S.S.R. Strategic Force Effectiveness. (Sanitized)

    DTIC Science & Technology

    1978-07-01

    is limited by the uncer- tainties and inaccracies present in the data which are used to develop the moasure. In the main body of the text the...alplizan1e to the prvostwu noas;urO5 arc ar;ici~to tn; ~~z~ ’i.r 2ctwo mt- azurer i-rmores tne fact that t Cftl4t.0 av’curacy -f I tnk~ atv :a;r le... azured in aitica1 nilios, of all thv straregic nuclear weaorjzf in CaC!. forCe iS CO c~aztd. V. (U) in order to utlijZe .he stanl1ard qra:pl.ic re

  20. Synthesis, Structure, and Characterization of Cu4S10(4-methylpyridine)4

    NASA Technical Reports Server (NTRS)

    Hepp, Aloysius F.; Richman, Robert M.; Duraj, Stan A.; Andras, Maria T.; Moore, Hall L.; Sabat, Michal; Eckles, William E.; Martuch, Robert A.

    1996-01-01

    The title compound, Cu4S10(4-methylpyridine)(sub 4) (dot) 4-methylpyridine was prepared by three different reactions: the oxidation of copper powder by sulfur and the reaction of copper (I) sulfide (or CuBr (dot) SMe2) with excess sulfur, both in the coordinating solvent, 4-methylpyridine. Red crystals of the compound obtained by layering with hexanes were subjected to single crystal X-ray diffraction. The structure was refined to R = 0.026 and R(sub w) = 0.036 in a space group P1bar (No. 2), with Z = 2, a = 13.983 (2) A, b = 15.384 (2) A, c = 9.660 (1) A, alpha = 93.87 (1)deg., beta = 93.38 (1)deg., gamma = 99.78 (1)deg., V = 2037.9 (9) A(exp 3). The compound has approximate S(sub 4) symmetry and consists of two pentasulfide chains linking four Cu(I) ions, each with a corrdinating 2-methylpyridine. The infrared spectrum was dominated by absorption due to coordinated 4-methylpyridine with several low-energy peaks attributable to S-S stretches, which were also observed by Raman spectroscopy. A featureless electronic absorption spectrum yielded a single peak in the near ultraviolet upon computer enhancement (lambda = 334 nm, epsilon = 10,000), most likely an intraligand transition. Cyclic voltammetry indicates that the polysulfide complex undergoes irrversible oxidation and reduction at +0.04 and -0.34 V vs. SCE, respectively, at 298 K in 4-methylpyridine when swept at 20 mV/sec. The electrochemical behavior was unvaried even at sweep rates as high as 100 V/sec.

  1. Which is better? Guy's versus S.T.O.N.E. nephrolithometry scoring systems in predicting stone-free status post-percutaneous nephrolithotomy.

    PubMed

    Noureldin, Yasser A; Elkoushy, Mohamed A; Andonian, Sero

    2015-11-01

    The aim of the present study was to compare the accuracy of the Guy's and S.T.O.N.E. scoring systems in predicting percutaneous nephrolithotomy (PCNL) outcomes. After obtaining ethics approval, medical records of patients undergoing PCNL between 2009 and 2013 at a tertiary stone center were retrospectively reviewed. Guy's and S.T.O.N.E. scoring systems were calculated. Regression analysis and ROC curves were performed. A total of 185 PCNLs were reviewed. The overall stone-free rate was 71.9 % with a complication rate of 16.2 %. When compared to patients with residual fragments, stone-free patients had significantly lower Guy's grade (2.7 vs. 2; p < 0.001) and S.T.O.N.E. score (8.3 vs. 7.4; p = 0.004). Logistic regression analysis showed that both Guy's and S.T.O.N.E. systems were significantly associated with stone-free status, OR 0.4 (p < 0.001), and OR 0.7 (p = 0.001), respectively. Furthermore, both scoring systems were significantly associated with the estimated blood loss (p = 0.01 and p = 0.005). There was good correlation between both scoring systems and operative time (r = 0.3, p < 0.001 and r = 0.4, p < 0.001) and length of hospital stay (r = 0.2, p = 0.001 and r = 0.3, p < 0.001). However, there were no significant associations between both scoring systems and complications (p = 0.7 and p = 0.6). There was no significant difference in the areas under the curves for the Guy's and S.T.O.N.E. scoring systems (0.74 [95 % CI 0.66-0.82] vs. 0.63 [95 % CI 0.54-0.72]; p = 0.06). Both Guy's and S.T.O.N.E scoring systems have comparable accuracies in predicting post-PCNL stone-free status. Other factors not included in either scoring system may need to be incorporated in the future to increase their accuracy.

  2. (2R,3S,4R)-3,4-Isopropyl­idenedi­oxy-2-(phenyl­sulfonyl­meth­yl)pyrrolidin-1-ol

    PubMed Central

    Flores, Mari Fe; Garcia, Pilar; M. Garrido, Narciso; Sanz, Francisca; Diez, David

    2012-01-01

    The title compound, C14H19NO5S, was prepared by nucleophilic addition of the lithium derivative of methyl­phenyl­sulfone to (3S,4R)-3,4-isopropyl­idene­dioxy­pyrroline 1-oxide. There are four mol­ecules in the asymmetric unit. The crystal structure determination confirms the configuration of the chiral centres as 2R,3S,4R. In the crystal, pairs of O—H⋯N hydrogen bonds link the mol­ecules into dimers. PMID:22904989

  3. U.S. and U.S.S.R agree on ocean research

    NASA Astrophysics Data System (ADS)

    Ostenso, Ned A.

    On June 1, 1990, George Bush and Mikhail S. Gorbachev signed a renegotiated bilateral agreement for cooperation in oceanographic research. The original agreement for “Studies of the World Ocean,” signed in 1972, did not provide for the protection of intellectual property. The new agreement is administered by executive secretaries from both countries working under the U.S.-U.S.S.R. Joint Committee on Cooperation in Ocean Studies. The committee held its first meeting in Moscow September 14-17, 1990, at the headquarters of the U.S.S.R. State Committee for Science and Technology (GKNT).The U.S. delegation was led by John A. Knauss, undersecretary of commerce for oceans and atmosphere and administrator of the National Oceanic and Atmospheric Administration (NOAA), and included Ned A. Ostenso, executive secretary of the agreement; Thomas E. Murray, NOAA; M. Grant Gross, National Science Foundation; Robert S. Winokur, U.S. Navy; Bonnie McGregor Stubblefield, U.S. Geological Survey; William S. Busch, Office of Science and Technology Policy; and William A. Erb, Eric Green, and Sidney Smith, Department of State.

  4. The Toxicity Estimation Software Tool (T.E.S.T.)

    EPA Science Inventory

    The Toxicity Estimation Software Tool (T.E.S.T.) has been developed to estimate toxicological values for aquatic and mammalian species considering acute and chronic endpoints for screening purposes within TSCA and REACH programs.

  5. Prototype development and demonstration for response, emergency staging, communications, uniform management, and evacuation (R.E.S.C.U.M.E.) : R.E.S.C.U.M.E. prototype system architecture.

    DOT National Transportation Integrated Search

    2014-01-01

    This document provides the high-level system architecture for the Prototype Development and Demonstration of a R.E.S.C.U.M.E. system. The requirements addressed in this document are based upon those that can be found in previous R.E.S.C.U.M.E. report...

  6. D.R.E.A.M.S: (Digital Rehabilitation Environment-Altering Medical System).

    PubMed

    Suvajdzic, Marko; Bihorac, Azra; Rashidi, Parisa

    2017-04-01

    In project D.R.E.A.M.S., we propose to develop and assess the feasibility of a novel and intelligent delirium-prevention system to address depression, pain, sleep, activity patterns and emotional states using the Emotiv Epoc+ I 14 Channel EEG", and HTC Vive VR set.

  7. Kinetics of the R + NO2 reactions (R = i-C3H7, n-C3H7, s-C4H9, and t-C4H9) in the temperature range 201-489 K.

    PubMed

    Rissanen, Matti P; Arppe, Suula L; Eskola, Arkke J; Tammi, Matti M; Timonen, Raimo S

    2010-04-15

    The bimolecular rate coefficients of four alkyl radical reactions with NO(2) have been measured in direct time-resolved experiments. Reactions were studied under pseudo-first-order conditions in a temperature-controlled tubular flow reactor coupled to a laser photolysis/photoionization mass spectrometer (LP-PIMS). The measured reaction rate coefficients are independent of helium bath gas pressure within the experimental ranges covered and exhibit negative temperature dependence. For i-C(3)H(7) + NO(2) and t-C(4)H(9) + NO(2) reactions, the dependence of ordinate (logarithm of reaction rate coefficients) on abscissa (1/T or log(T)) was nonlinear. The obtained results (in cm(3) s(-1)) can be expressed by the following equations: k(n-C(3)H(7) + NO(2)) = ((4.34 +/- 0.08) x 10(-11)) (T/300 K)(-0.14+/-0.08) (203-473 K, 1-7 Torr), k(i-C(3)H(7) + NO(2)) = ((3.66 +/- 2.54) x 10(-12)) exp(656 +/- 201 K/T)(T/300 K)(1.26+/-0.68) (220-489 K, 1-11 Torr), k(s-C(4)H(9) + NO(2)) = ((4.99 +/- 0.16) x 10(-11))(T/300 K)(-1.74+/-0.12) (241-485 K, 2 - 12 Torr) and k(t-C(4)H(9) + NO(2)) = ((8.64 +/- 4.61) x 10(-12)) exp(413 +/- 154 K/T)(T/300 K)(0.51+/-0.55) (201-480 K, 2-11 Torr), where the uncertainties shown refer only to the 1 standard deviations obtained from the fitting procedure. The estimated overall uncertainty in the determined bimolecular rate coefficients is about +/-20%.

  8. Evidence of in-plane ferromagnetic order probed by planar Hall effect in the geometry-confined ruthenate S r4R u3O10

    NASA Astrophysics Data System (ADS)

    Liu, Yan; Yang, Jiyong; Wang, Weike; Du, Haifeng; Ning, Wei; Ling, Langsheng; Tong, Wei; Qu, Zhe; Cao, Gang; Zhang, Yuheng; Tian, Mingliang

    2017-04-01

    The magnetic structure in the strongly correlated ruthenate S r4R u3O10 has been debated for a long time and still remains elusive. Here, we perform a systematically planar Hall effect study on a single-crystalline S r4R u3O10 nanostripe with a thickness of less than 100 nm. Large sharp switching behavior is observed in the planar Hall resistance, unambiguously indicating a strong anisotropic in-plane ferromagnetic order in the nanostripe, which is in contrast to the bulk system. Temperature-dependent evolution of the in-plane magnetism reveals that the in-plane spin order transforms from a single-domain state below a Curie temperature TC into a multidomain state below a critical temperature TM, probably due to the inherent strong spin-orbit coupling driven reconfiguration of spins between the c axis and the a b plane.

  9. (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-Mono(di,tri)fluoromethylcyclopropyl]alanines and their incorporation into hormaomycin analogues

    PubMed Central

    Kozhushkov, Sergei I; Yufit, Dmitrii S; Grosse, Christian; Kaiser, Marcel

    2014-01-01

    Summary Efficient and scalable syntheses of enantiomerically pure (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-mono(di,tri)fluoromethylcyclopropyl]alanines 9a–c, as well as allo-D-threonine (4) and (2S,3R)-β-methylphenylalanine (3), using the Belokon' approach with (S)- and (R)-2-[(N-benzylprolyl)amino]benzophenone [(S)- and (R)-10] as reusable chiral auxiliaries have been developed. Three new fluoromethyl analogues of the naturally occurring octadepsipeptide hormaomycin (1) with (fluoromethylcyclopropyl)alanine moieties have been synthesized and subjected to preliminary tests of their antibiotic activity. PMID:25550751

  10. Production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing 10S-dioxygenase from Nostoc punctiforme PCC 73102 with the aid of a chaperone.

    PubMed

    Kim, Min-Ji; Seo, Min-Ju; Shin, Kyung-Chul; Oh, Deok-Kun

    2017-01-01

    To increase the production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing Nostoc punctiforme 10S-dioxygenase with the aid of a chaperone. The optimal conditions for 10S-hydroxy-8(E)-octadecenoic acid production by recombinant cells co-expressing chaperone plasmid were pH 9, 35 °C, 15 % (v/v) dimethyl sulfoxide, 40 g cells l -1 , and 10 g oleic acid l -1 . Under these conditions, recombinant cells co-expressing chaperone plasmid produced 7.2 g 10S-hydroxy-8(E)-octadecenoic acid l -1 within 30 min, with a conversion yield of 72 % (w/w) and a volumetric productivity of 14.4 g l -1 h -1 . The activity of recombinant cells expressing 10S-dioxygenase was increased by 200 % with the aid of a chaperone, demonstrating the first biotechnological production of 10S-hydroxy-8(E)-octadecenoic acid using recombinant cells expressing 10S-dioxygenase.

  11. Aircraft Survivability: Assuring M&S Credibility for Defense Acquisition and T&E, Fall 2001

    DTIC Science & Technology

    2001-01-01

    Acquisition and T&E, Fall 2001 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER...Dave worked his way through col- lege at Disneyland , first selling ice cream and then picking up trash. Dave met his wife, Te r r i , his freshman

  12. Synthesis of 13(R)-Hydroxy-7Z,10Z,13R,14E,16Z,19Z Docosapentaenoic Acid (13R-HDPA) and Its Biosynthetic Conversion to the 13-Series Resolvins

    PubMed Central

    2016-01-01

    Specialized pro-resolving lipid mediators are biosynthesized during the resolution phase of acute inflammation from n-3 polyunsaturated fatty acids. Recently, the isolation and identification of the four novel mediators denoted 13-series resolvins, namely, RvT1 (1), RvT2 (2), RvT3 (3) and RvT4 (4), were reported, which showed potent bioactions characteristic for specialized pro-resolving lipid mediators. Herein, based on results from LC/MS-MS metabololipidomics and the stereoselective synthesis of 13(R)-hydroxy-7Z,10Z,13R,14E,16Z,19Z docosapentaenoic acid (13R-HDPA, 5), we provide direct evidence that the four novel mediators 1–4 are all biosynthesized from the pivotal intermediate 5. The UV and LC/MS-MS results from synthetic 13R-HDPA (5) matched those from endogenously and biosynthetically produced material obtained from in vivo infectious exudates, endothelial cells, and human recombinant COX-2 enzyme. Stereochemically pure 5 was obtained with the use of a chiral pool starting material that installed the configuration at the C-13 atom as R. Two stereoselective Z-Wittig reactions and two Z-selective reductions of internal alkynes afforded the geometrically pure alkene moieties in 5. Incubation of 5 with isolated human neutrophils gave all four RvTs. The results presented herein provide new knowledge on the biosynthetic pathways and the enzymatic origin of RvTs 1–4. PMID:27704804

  13. 5. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. MAIN (TITLED FLORENCE) CANAL, CHINA WASH FLUME, 5/13/25 - San Carlos Irrigation Project, China Wash Flume, Main (Florence-Case Grande) Canal at Station 137+00, T4S, R10E, S14, Coolidge, Pinal County, AZ

  14. Alanine and glycine conjugates of (2S,4R)-4-[18F]fluoroglutamine for tumor imaging.

    PubMed

    Zha, Zhihao; Ploessl, Karl; Lieberman, Brian P; Wang, Limin; Kung, Hank F

    2018-05-01

    Glutamine is an essential source of energy, metabolic substrates, and building block for supporting tumor proliferation. Previously, (2S,4R)-4-[ 18 F]fluoroglutamine (4F-Gln) was reported as a glutamine-related metabolic imaging agent. To improve the in vivo kinetics of this radiotracer, two new dipeptides, [ 18 F]Gly-(2S,4R)4-fluoroglutamine (Gly-4F-Gln) and [ 18 F]Ala-(2S,4R)4-fluoroglutamine (Ala-4F-Gln) were investigated. Radiolabeling was performed via 2-steps 18 F-fluorination. Cell uptake studies of Gly-4F-Gln and Ala-4F-Gln were investigated in 9 L cell lines. In vitro and in vivo metabolism studies were carried out in Fisher 344 rats. Biodistribution and microPET imaging studies were performed in 9 L tumor-bearing rats. In vitro incubation of these [ 18 F]dipeptides in rat and human blood showed a rapid conversion to (2S,4R)-4-[ 18 F]fluoroglutamine (t 1/2  = 2.3 and 0.2 min for [ 18 F]Gly-4F-Gln and [ 18 F]Ala-4F-Gln, respectively for human blood). Biodistribution and PET imaging in Fisher 344 rats bearing 9 L tumor xenografts showed that these dipeptides rapidly localized in the tumors, comparable to that of (2S,4R)-4-[ 18 F]fluoroglutamine (4F-Gln). The results support that these dipeptides, [ 18 F]Gly-4F-Gln and [ 18 F]Ala-4F-Gln, are prodrugs, which hydrolyze in the blood after an iv injection. They appear to be selectively taken up and trapped by tumor tissue in vivo. The dipeptide, [ 18 F]Ala-4F-Gln, may be suitable as a PET tracer for imaging glutaminolysis in tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Substitution of (R,S)-methadone by (R)-methadone: Impact on QTc interval.

    PubMed

    Ansermot, Nicolas; Albayrak, Ozgür; Schläpfer, Jürg; Crettol, Séverine; Croquette-Krokar, Marina; Bourquin, Michel; Déglon, Jean-Jacques; Faouzi, Mohamed; Scherbaum, Norbert; Eap, Chin B

    2010-03-22

    Methadone is administered as a chiral mixture of (R,S)-methadone. The opioid effect is mainly mediated by (R)-methadone, whereas (S)-methadone blocks the human ether-à-go-go-related gene (hERG) voltage-gated potassium channel more potently, which can cause drug-induced long QT syndrome, leading to potentially lethal ventricular tachyarrhythmias. To investigate whether substitution of (R,S)-methadone by (R)-methadone could reduce the corrected QT (QTc) interval, (R,S)-methadone was replaced by (R)-methadone (half-dose) in 39 opioid-dependent patients receiving maintenance treatment for 14 days. (R)-methadone was then replaced by the initial dose of (R,S)-methadone for 14 days (n = 29). Trough (R)-methadone and (S)-methadone plasma levels and electrocardiogram measurements were taken. The Fridericia-corrected QT (QTcF) interval decreased when (R,S)-methadone was replaced by a half-dose of (R)-methadone; the median (interquartile range [IQR]) values were 423 (398-440) milliseconds (ms) and 412 (395-431) ms (P = .06) at days 0 and 14, respectively. Using a univariate mixed-effect linear model, the QTcF value decreased by a mean of -3.9 ms (95% confidence interval [CI], -7.7 to -0.2) per week (P = .04). The QTcF value increased when (R)-methadone was replaced by the initial dose of (R,S)-methadone for 14 days; median (IQR) values were 424 (398-436) ms and 424 (412-443) ms (P = .01) at days 14 and 28, respectively. The univariate model showed that the QTcF value increased by a mean of 4.7 ms (95% CI, 1.3-8.1) per week (P = .006). Substitution of (R,S)-methadone by (R)-methadone reduces the QTc interval value. A safer cardiac profile of (R)-methadone is in agreement with previous in vitro and pharmacogenetic studies. If the present results are confirmed by larger studies, (R)-methadone should be prescribed instead of (R,S)-methadone to reduce the risk of cardiac toxic effects and sudden death.

  16. Protective activity of (1S,2E,4R,6R,7E,11E)-2,7,11-cembratriene-4,6-diol analogues against diisopropylfluorophosphate neurotoxicity: preliminary structure-activity relationship and pharmacophore modeling.

    PubMed

    Eterović, Vesna A; Del Valle-Rodriguez, Angelie; Pérez, Dinely; Carrasco, Marimée; Khanfar, Mohammad A; El Sayed, Khalid A; Ferchmin, Pedro A

    2013-08-01

    Diisopropylfluorophosphate (DFP) is an organophosphorous insecticide used as a surrogate for the more toxic chemical warfare nerve agent sarin. DFP produces neurotoxicity in vivo and irreversibly decreases the area of population spikes recorded from the CA1 region of acute hippocampal slices. (1S,2E,4R,6R,7E,11E)-2,7,11-Cembratriene-4,6-diol (1) is a neuroprotective natural cembranoid that reverses DFP-induced damage both in vivo and in the hippocampal slice. Cembranoid 1 acts by noncompetitive inhibition of the α7 nicotinic acetylcholine receptor. This study aims at establishing a preliminary structure-activity relationship to define the neuroprotective cembranoid pharmacophores using the hippocampal slice assay and pharmacophore modeling. Fourteen natural, semisynthetic, or biocatalytic cembranoid analogues 2-15 related to 1 were tested for their capacity to protect the population spikes from DFP-induced damage and intrinsic toxicity. Twelve cembranoids caused significant reversal of DFP toxicity; only 3 active analogues displayed minor intrinsic toxicity at 10 μM. The C-4 epimer of 1 (2) and the 4-O-methyl ether analogue of 1 (3), were totally devoid of neuroprotective activity. The results suggested a model for cembranoid binding where the hydrophobic ring surface binds to a hydrophobic (Hbic) patch on the receptor molecule and an electronegative atom (oxygen or sulfur) in proper spatial relationship to the ring surface interacts with an electropositive group in the receptor binding site. A pharmacophore model consisting of 1 hydrogen bond acceptor (HBA), 2 Hbic, and 10 exclusion spheres was established using HipHop-REFINE and supported the above mentioned pharmacophoric hypothesis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    PubMed

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. U.S. EPA, Pesticide Product Label, TDC DICOFOL 4E, 02/19/1982

    EPA Pesticide Factsheets

    2011-04-21

    ... kJI ~ ...-I ~ ... M<1 ~ IIrf'Ie(II.-cI -- roc D«X>fOt '·E CWI be ~ 8IIOnI or 'tII"Ith ott>.f ~~ ... t9COiI ••• ded 'Pf'-r ~ • ttIouId Ml ~ ....s wtth limit or ... y ~ tIO .-piM.! ...

  19. État de santé des nouveaux réfugiés à Toronto, en Ontario

    PubMed Central

    Redditt, Vanessa J.; Janakiram, Praseedha; Graziano, Daniela; Rashid, Meb

    2015-01-01

    Résumé Objectif Déterminer la prévalence de certaines maladies infectieuses parmi les patients nouvellement réfugiés et la présence ou non d’une variation en fonction de facteurs démographiques clés. Conception Revue rétrospective de dossiers. Contexte Clinique de soins primaires pour patients réfugiés à Toronto, en Ontario. Participants Au total, 1063 patients réfugiés inscrits à la clinique entre décembre 2011 à juin 2014. Principaux paramètres à l’étude Données démographiques (âge, sexe et pays de naissance); prévalence de VIH, d’hépatite B, d’hépatite C, d’infections à strongyloïdes, à schistosomes, à parasite intestinal, de gonorrhée, de chlamydia et de syphilis; et immunité contre la varicelle. Résultats L’âge médian des patients était de 29 ans et 56 % étaient de sexe féminin. Les réfugiés étaient nés dans 87 pays différents. Environ 33 % des patients étaient originaires d’Afrique, 28 % d’Europe, 14 % de la région de la Méditerranée orientale, 14 % d’Asie et 8 % des Amériques (à l’exception de 4 % nés au Canada ou aux États-Unis). Le taux global de VIH était de 2 %. La prévalence d’hépatite B était de 4 %, ce taux étant supérieur parmi les réfugiés originaires d’Asie (12 %, p < 0,001). L’immunité contre l’hépatite B était de 39 %, ce taux étant supérieur parmi les réfugiés originaires d’Asie (64 %, p < 0,001) et les enfants de moins de 5 ans (68 %, p < 0,001). Le taux d’hépatite C se situait à moins de 1 %. Une infection à strongyloïdes a été dépistée chez 3 % des patients testés, ce taux étant supérieur parmi les réfugiés originaires d’Afrique (6 %, p = 0,003). Une infection à schistosomes a été dépistée chez 15 % des patients africains. Des parasites intestinaux ont été observés chez 16 % des patients ayant soumis un échantillon de selles. Environ 8 % des patients n’étaient pas immunisés contre la varicelle, ce taux étant sup

  20. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    PubMed

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  1. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

    PubMed

    Chun, J; Huq, A; Colwell, R R

    1999-05-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

  2. The E. coli 16S rRNA binding site of ribosomal protein S15: higher-order structure in the absence and in the presence of the protein.

    PubMed Central

    Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C

    1988-01-01

    We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025

  3. Insight into a conformation of the PNA-PNA duplex with (2‧R,4R)- and (2‧R,4S)-prolyl-(1S,2S)-2-aminocyclopentanecarboxylic acid backbones

    NASA Astrophysics Data System (ADS)

    Maitarad, Amphawan; Poomsuk, Nattawee; Vilaivan, Chotima; Vilaivan, Tirayut; Siriwong, Khatcharin

    2018-04-01

    Suitable conformations for peptide nucleic acid (PNA) self-hybrids with (2‧R,4R)- and (2‧R,4S)-prolyl-(1S,2S)-2-aminocyclopentanecarboxylic acid backbones (namely, acpcPNA and epi-acpcPNA, respectively) were investigated based on molecular dynamics simulations. The results revealed that hybridization of the acpcPNA was observed only in the parallel direction, with a conformation close to the P-type structure. In contrast, self-hybrids of the epi-acpcPNA were formed in the antiparallel and parallel directions; the antiparallel duplex adopted the B-form conformation, and the parallel duplex was between B- and P-forms. The calculated binding energies and the experimental data indicate that the antiparallel epi-acpcPNA self-hybrid was more stable than the parallel duplex.

  4. Evaluation Studies of the DEN-2/S-1 Vaccine.

    DTIC Science & Technology

    1981-08-01

    1.0 3.0, L o 1 .0 I11 125 11111 1.4 n .6_t _ MICROCOPY RESOLUTION TEST CHART NATIONAL WII ALI 0 MF S’ANDAkLT, ,’I, A ;40- AD EVALUATION STUDIES OF THE...monkeys Vaccination DEN-2/S-l Vaccine /AE TlhACT ( i - ,ewr e e1 If .,ceweu7 amd Iderdtlfy by block number) A dengue-2 live virus vaccine was tested in...viremia was detected in control animals. Serological tests were pi.r- formed on sera taken on post infection days 30,56 and 90. HI tests revealed sero

  5. The S.M.A.R.T. Strategy to Recruiting and Retaining High School Coaches

    ERIC Educational Resources Information Center

    Lubisco, Robyn; Birren, Genevieve F. E.

    2017-01-01

    This article discusses the S.M.A.R.T. strategy for recruiting and retaining quality high school coaches. S.M.A.R.T. stands for Scouting, Mentoring and Coaching, Appreciation, Rating, and Time. Scouting addresses how one goes about locating and hiring quality coaches. Mentoring and Coaching addresses how to develop the coach within the specific…

  6. Thermal degradation of (6R,S)-5,10-methenyltetrahydrofolate in aqueous solution at pH 8

    NASA Astrophysics Data System (ADS)

    Tyagi, A.; Penzkofer, A.; Batschauer, A.; Wolf, E.

    2009-03-01

    The degradation of the folate (6R,S)-5,10-methenyltetrahydrofolate chloride (MTHF-Cl) in aqueous solution at pH 8 at room temperature is studied by absorption spectra measurements. Samples with and without the reducing agent β-mercaptoethanol (β-ME) both under aerobic and anaerobic conditions are investigated. MTHF-Cl hydrolyses to (6R,S)-10-formyltetrahydrofolate (10-HCO-H4folate) in all four cases. 10-HCO-H4folate oxidizes to 10-formyldihydrofolate (10-HCO-H2folate) under aerobic conditions in the absence of β-ME. The degradation dynamics is analysed theoretically and conversion rate constants of hydrolysis and oxidation are determined.

  7. U.S. EPA, Pesticide Product Label, , 10/04/1988

    EPA Pesticide Factsheets

    2011-04-21

    ... t""ff If~I!t'd ~u:s .. !P'OJI :"tolft: .. , cte-''''O tI"!~ ~Irs n,-.r"'f'1 ~~~~.e {!'I'll'~ ",!U rif fap.nrf I"O't f~!";:I'''' 'ePf1~1 .Nt"'.oI"SI:J" "'OJS (..;OO;~ ~e~'t

  8. Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

    PubMed Central

    Lill, R; Robertson, J M; Wintermeyer, W

    1989-01-01

    A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

  9. Wind and Wave Summaries for Selected U.S. Coast Guard Operating Areas. Addendum,

    DTIC Science & Technology

    1984-05-01

    tD t L. 2...s񓑷 -- -. . .. --+ -..- - ’ -- td --’+s :95-- Z24 .32 1 3 .11 0.is 14$ is4 86 itt o -- "-- .’ to _ Is h 26r s1 L49.,M 5p434~t 0 1 ~ 201S94I...4-’ 4-. - - ,o; - ~ - S$ - 50 P-so • 0 .𔃺, l.2 .. ... ... ..0Tho𔃾.. 5_’.. W- td Sp.ed oto tBo 6t!!gO 9 46012 0. " o . No Occurrences rr 04 01 1.0

  10. S+T+R+O+N+G Kids Life Skills Program: Levels K-5.

    ERIC Educational Resources Information Center

    Silbert, Linda Bress; Silbert, Alvin J.

    Strong kids have the fortitude to resist drug/alcohol abuse and other tendencies towards anti-social behavior. Research has shown that strong kids have attained a high level of development in six crucial areas. The S+T+R+O+N+G Kids Program builds upon each of these areas: (1) Self-Esteem; (2) Trust; (3) Responsibility; (4) Options; (5) Needs; (6)…

  11. 78 FR 56242 - Notice of Realty Action: Competitive Sale of 28 Parcels of Public Land in Clark County, NV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-12

    ... acres: T. 20 S., R. 60 E., Sec. 6, NW\\1/4\\SW\\1/4\\SE\\1/4\\, W\\1/2\\NE\\1/4\\SW\\1/4\\SE\\1/4\\, NE\\1/4\\NE\\1/4\\SW\\1/4\\SE\\1/4\\. N-78190, 2.50 acres: T. 22 S., R. 60 E., Sec. 14, NW\\1/4\\SW\\1/4\\NW\\1/4\\SW\\1/4\\. N-91783, 5.00 acres: T. 22 S., R. 60 E., Sec. 14, S\\1/2\\SW\\1/4\\SW\\1/4\\SW\\1/4\\. N-91794, 10.00 acres: T. 22 S...

  12. Niobium in R And (S6, 6e) and HR 1105 (S5, 3). [S star abundance

    NASA Technical Reports Server (NTRS)

    Davis, D. N.

    1985-01-01

    Lines of the first multiplet of niobium are strong in R And and HR 1105. These lines are also present in other S stars: HR 8714, R Cam, V Cnc, R CMi, and T Sgr. They are also visible in the M stars, Beta-Peg and Mu-UMa. An approximation to the abundance ratio, Nb/Fe, has been deduced from pairs of lines having nearly equal intensity. In R And, the ratio is about 200 times the solar value. It is hoped that good plates will soon be obtained for the near infrared region, so that the significant Nb/Rb abundance ratio may be determined.

  13. A natural S 4 × SO(10) model of flavour

    NASA Astrophysics Data System (ADS)

    Björkeroth, Fredrik; de Anda, Francisco J.; King, Stephen F.; Perdomo, Elena

    2017-10-01

    We propose a natural S 4 × SO(10) supersymmetric grand unified theory of flavour with an auxiliary Z_4^2× Z_4^R symmetry, based on small Higgs representations (nothing larger than an adjoint) and hence a type-I seesaw mechanism. The Yukawa structure of all fermions is determined by the hierarchical vacuum expectation values of three S 4 triplet flavons, with CSD3 vacuum alignments, where up-type quarks and neutrinos couple to one Higgs 10, and the down-type quarks and charged leptons couple to a second Higgs 10. The Yukawa matrices are obtained from sums of low-rank matrices, where each matrix in the sum naturally accounts for the mass of a particular family, as in sequential dominance in the neutrino sector, which predicts a normal neutrino mass hierarchy. The model accurately fits all available quark and lepton data, with predictions for the leptonic CP phase in 95% credible intervals given by 281° < δ ℓ < 308° and 225° < δ ℓ < 253°. The model reduces to the MSSM, with the two Higgs doublets emerging from the two Higgs 10s without mixing, and we demonstrate how a μ term of O(TeV) can be realised, as well as doublet-triplet splitting, with Planck scale operators controlled by symmetry, leading to acceptable proton decay.

  14. Emergence of novel and dominant acquired EGFR solvent-front mutations at Gly796 (G796S/R) together with C797S/R and L792F/H mutations in one EGFR (L858R/T790M) NSCLC patient who progressed on osimertinib.

    PubMed

    Ou, Sai-Hong Ignatius; Cui, Jean; Schrock, Alexa B; Goldberg, Michael E; Zhu, Viola W; Albacker, Lee; Stephens, Philip J; Miller, Vincent A; Ali, Siraj M

    2017-06-01

    Acquired epidermal growth factor receptor (EGFR) resistance mutations to osimertinib are common, including the EGFR C797S that abolishes the covalent binding of osimertinib to EGFR. Here we report the emergence of novel EGFR solvent front mutations at Gly796 (G796S/R) in addition to a hinge pocket L792F/H mutations, and C797S/G all in cis with T790M in a single patient on progression on osimertinib as detected by plasma circulating tumor DNA (ctDNA) assay in the course of clinical care. A 69-year-old Caucasian female former light-smoker presented with stage IV EGFR L858R positive adenocarcinoma who developed EGFR T790M mutation after 8 month treatment of erlotinib. The patient was initiated on osimertinib with disease shrinkage after 2 months, but tumor regrowth was observed after 5 months of osimertinib treatment. Assay of plasma ctDNA at this time revealed these different secondary resistance mutations all in trans with each other including distinct mutations at the same codon producing different amino acid changes: G796S/R (mutant allele frequency [MAF]; 14.4%), C797S/G (MAF: 2.26%), L792F/H (MAF: 0.36%), and V802F (MAF: 0.40%), in addition to the pre-existing L858R (MAF:17.9%) and T790M (MAF:18.2%) but all in cis with T790M. The G796S/R mutations are homologous with known reported solvent front mutations in ALK G1202R, ROS1 G2032R, TrkA G595R and TrkC G623R, all of which are associated with acquired resistance to type I TKIs. In silico modeling revealed mutation at G796 interferes with osimertinib binding to the EGFR kinase domain at the phenyl aromatic ring position as this residue forms a narrow "hydrophobic sandwich" with L718, while L792F/H mutation interferes with osimertinib binding at the methoxyl group on the phenyl ring. Multiple resistance mutations at differing allele frequencies including novel EGFR solvent front mutations can emerge in a single patient with progression on osimertinib potentially due to tumor hetereogeneity and definitely present a

  15. A subset of walnut allergic adults is sensitized to walnut 11S globulin Jug r 4.

    PubMed

    Blankestijn, Mark A; den Hartog Jager, Constance F; Blom, W Marty; Otten, Henny G; de Jong, G Aard H; Gaspari, Marco; Houben, Geert F; Knulst, André C; Verhoeckx, Kitty C M

    2018-06-15

    The role of sensitization to commercially available allergens of English walnut (Juglans regia) Jug r 1, 2 and 3 in walnut allergy has been previously investigated in walnut allergic adults and was unable to explain allcases of walnut allergy. Identify recognized walnut allergens, other than the ones previously investigated (Jug r 1-3), in walnut allergic adults and determine the sensitization frequency and diagnostic value. Three different in-house walnut extracts were prepared and analysed on SDS-PAGE blots to identify allergenic walnut proteins. Immunoblots and immunoprecipitation, followed by LC-MS analysis, were performed to screen for, and confirm, IgE binding to walnut allergens in selected walnut allergic adults. In a cohort of 55 walnut challenged adults, including 33 allergic and 22 tolerant, sensitization to native and recombinant walnut allergen Jug r 4 was assessed using immunoblotting and immuno-line blot (EUROLINE), respectively. Screening of sera of eight walnut allergic adults identified Jug r 4 as an allergen in our population. In the total cohort of 55 subjects, five were positive for Jug r 4 on immunoblot and 10 on EUROLINE. All but one EUROLINE positive subject had a positive food challenge (sensitivity 27%, specificity 95%, PPV 90%, NPV 47%). All five subjects positive on immunoblot were also positive on EUROLINE. LC-MS analysis showed a lack of Jug r 4 in the ImmunoCAP extract. Co-sensitization to other 11S albumins (e.g. hazelnut Cor a 9) was common in Jug r 4 sensitized subjects, potentially due to cross-reactivity. Walnut 11S globulin Jug r 4 is a relevant minor allergen, recognized by 27% of walnut allergic adults. It has a high positive predictive value of 90% for walnut allergy. Specific IgE against Jug r 4 occurred mostly with concomitant sensitization to other walnut components, mainly Jug r 1. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  16. Synthesis and Mesomorphic Behavior of Poly((2S, 3S)-(+)-2-Chloro-3- Methylpentyl 4’-(Omega-Vinyloxyalkyloxy)biphenyl-4-Carboxylate)s with Ethyl and Propyl Alkyl Groups

    DTIC Science & Technology

    1994-06-30

    1 . Synthesis of (2S, 3S)-(+)-2-chloro-3-methyl-pentyl 4’-(2-vinyloxyethyloxy) biphenyl-4-carboxylate (15-2...CH2)2-),7.65 (d, 3=8.3Hz, 2 ArH, m to -COO-), 8.11 (d, J=7.4Hz, 2 ArH, o to -COO-). 3-Chloroprop~yl- 1 -vinyl ether (13-3) The mixture of 3- chloropropan ...VA .% fo - " A’* *i f’. - % .oL.,ae- a * 1 nOl-6..io. Ocw. ’•.1ý’ ..a.. :l•t :...•.t ;,,31 -. 1 " 1 . 2 . 10 1 -- Of , • l 0’ i’*J.. e t *no suaqetg

  17. Effective Biotransformation of Ethyl 4-Chloro-3-Oxobutanoate into Ethyl (S)-4-Chloro-3-Hydroxybutanoate by Recombinant E. coli CCZU-T15 Whole Cells in [ChCl][Gly]-Water Media.

    PubMed

    Dai, Yong; Huan, Bin; Zhang, Hai-Sheng; He, Yu-Cai

    2017-04-01

    To increase the biocatalytic activity of Escherichia coli CCZU-T15 whole cells, choline chloride/glycerol ([ChCl][Gly]) was firstly used as biocompatible solvent for the effective biotransformation of ethyl 4-chloro-3-oxobutanoate (COBE) into ethyl (S)-4-chloro-3-hydroxybutanoate [(S)-CHBE]. Furthermore, L-glutamine (150 mM) was added into [ChCl][Gly]-water ([ChCl][Gly] 12.5 vol%, pH 6.5) media instead of NAD + for increasing the biocatalytic efficiency. To further improve the biosynthesis of (S)-CHBE (>99 % e.e.) by E. coli CCZU-T15 whole cells, Tween-80 (7.5 mM) was also added into this reaction media, and (S)-CHBE (>9 % e.e.) could be effectively synthesized from 2000 and 3000 mM COBE in the yields of 100 and 93.0 % by whole cells of recombinant E. coli CCZU-T15, respectively. TEM image indicated that the cell membrane was permeabilized and lost its integrity and when the cell was exposed to [ChCl][Gly]-water media with Tween-80. Clearly, this bioprocess has high potential for the effective biosynthesis of (S)-CHBE (>99 % e.e.).

  18. Worldwide U.S. Active Duty Military Deaths. Alphabetical Index by Name, 1 October 1979 Through 30 September 1994

    DTIC Science & Technology

    1994-09-30

    DE LME NDO G E R A R D O MAR I GZA A I R F O R C E D E LMUNDO L I LY F E D E R I S NAVY D E LOACH B O B B Y D E A N A I R F ORCE D E LOGE B...YAN LAMON EAR LE JAME S ARTHUR EAR LEY KEN W EAR LEY R OB E R T WI L L IAM J R EAR LS M I CHAE L G EAR LS OMAR DALE EAR LY BE N JAMIN J R...8 9 B R OOK LYN E 0 4 2 2 F e b 8 2 KEN TON E 0 7 14 D e c 9 1 R OCKH I L L 0 0 2 1 4 J u l 8 1 T E XAS C I T Y E 0 6 24 Oc t 7 9

  19. Dibenzo[b,f][1,4]oxazepines and dibenzo[b,e]oxepines: Influence of the chlorine substitution pattern on the pharmacology at the H1R, H4R, 5-HT2AR and other selected GPCRs.

    PubMed

    Naporra, Franziska; Gobleder, Susanne; Wittmann, Hans-Joachim; Spindler, Julia; Bodensteiner, Michael; Bernhardt, Günther; Hübner, Harald; Gmeiner, Peter; Elz, Sigurd; Strasser, Andrea

    2016-11-01

    Inspired by VUF6884 (7-Chloro-11-(4-methylpiperazin-1-yl)dibenzo[b,f][1,4]oxazepine), reported as a dual H 1 /H 4 receptor ligand (pK i : 8.11 (human H 1 R (hH 1 R)), 7.55 (human H 4 R (hH 4 R))), four known and 28 new oxazepine and related oxepine derivatives were synthesised and pharmacologically characterized at histamine receptors and selected aminergic GPCRs. In contrast to the oxazepine series, within the oxepine series, the new compounds showed high affinity to the hH 1 R (pK i : 6.8-8.7), but no or moderate affinity to the hH 4 R (pK i :≤5.3). For one oxepine derivative (1-(2-Chloro-6,11-dihydrodibenzo[b,e]oxepin-11-yl)-4-methylpiperazine), the enantiomers were separated and the R-enantiomer was identified as the eutomer at the hH 1 R (pK i : 8.83 (R), 7.63 (S)) and the guinea-pig H 1 R (gpH 1 R) (pK i : 8.82 (R), 7.41 (S)). Molecular dynamic studies suggest that the tricyclic core of the compounds is bound in a similar mode into the binding pocket, as described for doxepine in the hH 1 R crystal structure. Moreover, docking studies of all oxepine derivatives at the hH 1 R indicate that the oxygen and the position of the chlorine in the tricyclic core determines, if the R- or the S-enantiomer is the eutomer. For some of the oxazepines and oxepines the affinity to other aminergic GPCRs is in the same range as to hH 1 R or hH 4 R, thus, those compounds have to be classified as dirty drugs. However, one oxazepine derivative (3,7-Dichloro-11-(4-methylpiperazin-1-yl)dibenzo[b,f][1,4]oxazepine was identified as dual hH 1 /h5-HT 2A receptor ligand (pK i : 9.23 (hH 1 R), 8.74 (h5-HT 2A R), ≤7 at other analysed GPCRs), whereas one oxepine derivative (1-(3,8-Dichloro-6,11-dihydrodibenzo[b,e]oxepin-11-yl)-4-methylpiperazine) was identified as selective hH 1 R antagonist (pK i : 8.44 (hH 1 R), ≤6.7 at other analyzed GPCRs). Thus, the pharmacological results suggest that the oxazepine/oxepine moiety and additionally the chlorine substitution pattern toggles

  20. Synthesis and antioxidant evaluation of (S,S)- and (R,R)-secoisolariciresinol diglucosides (SDGs).

    PubMed

    Mishra, Om P; Simmons, Nicholas; Tyagi, Sonia; Pietrofesa, Ralph; Shuvaev, Vladimir V; Valiulin, Roman A; Heretsch, Philipp; Nicolaou, K C; Christofidou-Solomidou, Melpo

    2013-10-01

    Secoisolariciresinol diglucosides (SDGs) (S,S)-SDG-1 (major isomer in flaxseed) and (R,R)-SDG-2 (minor isomer in flaxseed) were synthesized from vanillin via secoisolariciresinol (6) and glucosyl donor 7 through a concise route that involved chromatographic separation of diastereomeric diglucoside derivatives (S,S)-8 and (R,R)-9. Synthetic (S,S)-SDG-1 and (R,R)-SDG-2 exhibited potent antioxidant properties (EC50=292.17±27.71 μM and 331.94±21.21 μM, respectively), which compared well with that of natural (S,S)-SDG-1 (EC50=275.24±13.15 μM). These values are significantly lower than those of ascorbic acid (EC50=1129.32±88.79 μM) and α-tocopherol (EC50=944.62±148.00 μM). Compounds (S,S)-SDG-1 and (R,R)-SDG-2 also demonstrated powerful scavenging activities against hydroxyl [natural (S,S)-SDG-1: 3.68±0.27; synthetic (S,S)-SDG-1: 2.09±0.16; synthetic (R,R)-SDG-2: 1.96±0.27], peroxyl [natural (S,S)-SDG-1: 2.55±0.11; synthetic (S,S)-SDG-1: 2.20±0.10; synthetic (R,R)-SDG-2: 3.03±0.04] and DPPH [natural (S,S)-SDG-1: EC50=83.94±2.80 μM; synthetic (S,S)-SDG-1: EC50=157.54±21.30 μM; synthetic (R,R)-SDG-2: EC50=123.63±8.67 μM] radicals. These results confirm previous studies with naturally occurring (S,S)-SDG-1 and establish both (S,S)-SDG-1 and (R,R)-SDG-2 as potent antioxidants and free radical scavengers for potential in vivo use. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Synthesis and antioxidant evaluation of (S,S)- and (R,R)-secoisolariciresinol diglucosides (SDGs)

    PubMed Central

    Mishra, Om P.; Simmons, Nicholas; Tyagi, Sonia; Pietrofesa, Ralph; Shuvaev, Vladimir V.; Valiulin, Roman A.; Heretsch, Philipp; Nicolaou, K. C.; Christofidou-Solomidou, Melpo

    2013-01-01

    Secoisolariciresinol diglucosides (SDGs) (S,S)-SDG-1 (major isomer in flaxseed) and (R,R)-SDG-2 (minor isomer in flaxseed) were synthesized from vanillin via secoisolariciresinol (6) and glucosyl donor 7 through a concise route that involved chromatographic separation of diastereomeric diglucoside derivatives (S,S)-8 and (R,R)-9. Synthetic (S,S)-SDG-1 and (R,R)-SDG-2 exhibited potent antioxidant properties (EC50 = 292.17 ± 27.71 μM and 331.94 ± 21.21 μM, respectively) which compared well with that of natural (S,S)-SDG-1 (EC50 = 275.24 ± 13.15 μM). These values are significantly lower than those of ascorbic acid (EC50 = 1129.32 ± 88.79 μM) and α-tocopherol (EC50 = 944.62 ± 148.00 μM). Compounds (S,S)-SDG-1 and (R,R)-SDG-2 also demonstrated powerful scavenging activities against hydroxyl [natural (S,S)-SDG-1: 3.68 ± 0.27; synthetic (S,S)-SDG-1: 2.09 ± 0.16; synthetic (R,R)-SDG-2: 1.96 ± 0.27], peroxyl [natural (S,S)-SDG-1: 2.55 ± 0.11; synthetic (S,S)-SDG-1: 2.20 ± 0.10; synthetic (R,R)-SDG-2: 3.03 ± 0.04] and DPPH [natural (S,S)-SDG-1: EC50 = 83.94 ± 2.80 μM; synthetic (S,S)-SDG-1: EC50 = 157.54 ± 21.30; synthetic (R,R)-SDG-2: EC50 = 123.63 ± 8.67] radicals. These results confirm previous studies with naturally occurring (S,S)-SDG-1 and establish both (S,S)-SDG-1 and (R,R)-SDG-2 as potent antioxidants and free radical scavengers for potential in vivo use. PMID:23978651

  2. Niobium in R And (S6, 6e) and HR 1105 (S5, 3)

    NASA Astrophysics Data System (ADS)

    Davis, D. N.

    Lines of the first multiplet of niobium are strong in R And and HR 1105. These lines are also present in other S stars: HR 8714, R Cam, V Cnc, R CMi, and T Sgr. They are also visible in the M stars, Beta-Peg and Mu-UMa. An approximation to the abundance ratio, Nb/Fe, has been deduced from pairs of lines having nearly equal intensity. In R And, the ratio is about 200 times the solar value. It is hoped that good plates will soon be obtained for the near infrared region, so that the significant Nb/Rb abundance ratio may be determined.

  3. Prototype development and demonstration for response, emergency staging, communications, uniform management, and evacuation (R.E.S.C.U.M.E.) : R.E.S.C.U.M.E. final functional and performance requirements.

    DOT National Transportation Integrated Search

    2014-01-01

    This document provides the high-level functional and performance requirements for the Prototype Development and Demonstration of a R.E.S.C.U.M.E. system. The requirements included in this document are based upon those that can be found in previous R....

  4. Multicolour CCD surface photometry for E and S0 galaxies in 10 clusters

    NASA Astrophysics Data System (ADS)

    Jorgensen, Inger; Franx, Marijn; Kjaergaard, Per

    1995-04-01

    CCD surface photometry for 232 E and S0 galaxies is presented. The galaxies are observed in Gunn r and Johnson B, or Gunn r and g. For 48 of the galaxies surface photometry in Johnson U is also presented. Aperture magnitudes in Gunn nu are derived for half of the galaxies. Galaxies in the following clusters have been observed: Abell 194, Abell 539, Abell 3381, Abell 3574, Abell S639, Abell S753, HydraI (Abell 1060), DC2345-28, Doradus and Grm15. The data are part of our ongoing study of the large-scale motions in the Universe and the physical background for the fundamental plane. We use a full model fitting technique for analysing the CCD images. This gives radial profiles of local surface brightness, colour, ellipticity and position angle. The residuals relative to the elliptical isophotes are described quantitatively by Fourier expansions. Effective radius, mean surface brightness and total magnitude are derived by fitting a de Vaucouleurs r^¼ growth curve. We have derived a characteristic radius r_n similar to the diameter D_n introduced by Dressler et al. The derivation of the effective parameters and of r_n takes the seeing into account. We confirm the results by Saglia et al. that the effects of the seeing can be substantial. Seeing-corrected values of the effective parameters and r_n are also presented for 147 E and S0 galaxies in the Coma cluster. Colours, colour gradients and geometrical parameters are derived. The photometry is internally consistent within 0.016 mag. Comparison with the photoelectric aperture photometry from Burstein et al. shows a mean offset of 0.010 mag with an rms scatter of 0.034 mag. The global photometric parameters are compared with data from Faber et al., Lucey et al. and Lucey & Carter. These comparisons imply that the typical rms errors are as follows - log r_n:+/-0.015 log r_e:+/-0.045 m_T:+/-0.09 mag; _e:+/-0.16 mag. The rms error on the combination log r_e-0.35_e which enters the fundamental plane is +/-0.020. Also

  5. Total Syntheses of (±)-Ovalicin, C4(S*)-Isomer, and Its C5-Analogs and Anti-trypanosomal Activities∥

    PubMed Central

    Hua, Duy H.; Zhao, Huiping; Battina, Srinivas K.; Lou, Kaiyan; Jimenez, Ana L.; Desper, John; Perchellet, Elisabeth M.; Perchellet, Jean-Pierre H.; Chiang, Peter K.

    2008-01-01

    Total syntheses of (±)-ovalicin, its C4(S*)-isomer 44, and C5-side chain intermediate 46 were accomplished via an intramolecular Heck reaction of (Z)-3-(t-butyldimethylsilyloxy)-1-iodo-1,6-heptadiene and a catalytic amount of palladium acetate. Subsequent epoxidation, dihydroxylation, methylation and oxidation led to (3S*,5R*,6R*)-5-methoxy-6-(t-butyldimethylsilyloxy)-1-oxaspiro[2.5]octan-4-one (2), a reported intermediate. The addition of a side chain with cis-1-lithio-1,5-dimethyl-1,4-hexadiene (27) followed by oxidation afforded (±)-ovalicin. The functional group manipulation afforded a number of regio- and stereoisomers, which allow the synthesis of analogs for bioevaluation. The structure of 44 was firmly established via a single-crystal X-ray analysis. The stereochemistry at C4 generated from the addition reactions of alkenyllithium with ketones 2, 40, and 45 is dictated by C6-alkoxy functionality. Anti-trypanosomal activities of various ovalicin analogs and synthetic intermediates were evaluated, and C5-side chain analog, 46, shows the strongest activity. Compound 44 shows antiproliferative effect against HL-60 tumor cells in vitro. Compounds 46 and a precursor, (3S*,4R*,5R*,6R*)-5-methoxy-4-[(E)-1’,5’-dimethylhexa-1’,4’–dienyl)]-6-(t-butyldimethylsilyloxy)-1-oxaspiro[2.5]octan-4-ol (28), may be explored for the development of anti-parasitic drugs. PMID:18356059

  6. Evolution post-opératoire des séquelles de tuberculose pulmonaire chez les séropositifs VIH

    PubMed Central

    Grégoire, Ayegnon Kouakou; Flavien, Kendja Hypolite; Raphaël, Ouédé; Démine, Blaise; Christophe, Ménéas Gueu; Marie, Ano Kounangui; Hervé, Yangni-Angaté Koffi; Yves, Tanauh

    2014-01-01

    Cette étude rapporte les aspects cliniques et évolutifs des séquelles pulmonaires tuberculeuses (SPT) opérées chez les séropositifs (VIH+). Il s'agit d'une étude prospective transversale réalisée entre Novembre 2005 et Octobre 2012. Elle a porté sur 20 patients VIH+, ayant dans leurs antécédents, une tuberculose pulmonaire (TP) traitée et déclarée guérie, et admise dans ladite période pour une chirurgie de la SPT secondaire. Une enquête sérologique VIH a été réalisée systématiquement au cours du bilan pré-opératoire. Le diagnostic pré-opératoire de la SPT, la mortalité, les complications post- opératoires (CPOP), le séjour hospitalier, le suivi à moyen terme des STP opérées ont été évalués. Les séropositifs étaient VIH1+ (n = 12; 60%), VIH1&2+ (n = 4; 20%) et VIH2+ (n = 4; 20%). La durée moyenne d’évolution des STP était de 26,22 ± 21,3 mois. Les STP étaient les pyothorax ou pleurésies enkystées (n = 16; 80%), le poumon détruit (n = 2;10%) et les dilatations de bronches (n = 2;10%). Les VIH+ ne présentaient pas d'aspergillome pulmonaire. Le séjour hospitalier moyen était 13,1 ± 10,2 jours. Le suivi total était de 82 patients-année avec une moyenne de suivi de 4,2 ± 2,3 ans (extrêmes: 1 et 7 ans). Le taux de mortalité à court et moyen terme était nul. Aucun décès post-opératoire immédiat n'a été noté. Les CPOP immédiates étaient les bullages prolongés chez 75% des immunodéprimés. Les CPOP tardives (n = 3) étaient un syndrome restrictif pulmonaire, un pyothorax persistant et une pachypleurite résiduelle restrictive. A court terme, le taux de guérison radiologique était de 80% (n = 16). PMID:24932331

  7. Lightweight Combat Vehicle S&T Initiatives

    DTIC Science & Technology

    2015-08-01

    1 U.S. ARMY TANK AUTOMOTIVE RESEARCH, DEVELOPMENT AND ENGINEERING CENTER Lightweight Combat Vehicle S &T Initiatives Dr. Richard Gerth Ground Systems...00-00-2015 to 00-00-2015 4. TITLE AND SUBTITLE Lightweight Combat Vehicle S &T Initiatives Global Automotive Lightweight Materials 2015 - August...18-20 2015 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Richard Gerth 5d. PROJECT NUMBER 5e. TASK NUMBER 5f

  8. Interface-enhanced high-temperature superconductivity in single-unit-cell FeT e1 -xS ex films on SrTi O3

    NASA Astrophysics Data System (ADS)

    Li, Fangsen; Ding, Hao; Tang, Chenjia; Peng, Junping; Zhang, Qinghua; Zhang, Wenhao; Zhou, Guanyu; Zhang, Ding; Song, Can-Li; He, Ke; Ji, Shuaihua; Chen, Xi; Gu, Lin; Wang, Lili; Ma, Xu-Cun; Xue, Qi-Kun

    2015-06-01

    Recently discovered high-temperature superconductivity in single-unit-cell (UC) FeSe films on SrTi O3 (STO) substrate has stimulated tremendous research interest, both experimental and theoretical. Whether this scenario could be extended to other superconductors is vital in both identifying the enhanced superconductivity mechanism and further raising the critical transition temperature (Tc). Here we successfully prepared single-UC FeT e1 -xS ex(0.1 ≤x ≤0.6 ) films on STO substrates by molecular beam epitaxy and observed U -shaped superconducting gaps (Δ ) up to ˜16.5 meV , nearly ten times the gap value (Δ ˜1.7 meV ) of the optimally doped bulk FeT e0 .6S e0 .4 single crystal (Tc˜14.5 K ). No superconducting gap has been observed on the second UC and thicker FeT e1 -xS ex films at 5.7 K, indicating the important role of the interface. This interface-enhanced high-temperature superconductivity is further confirmed by ex situ transport measurements, which revealed an onset superconducting transition temperature above 40 K, nearly two times higher than that of the optimally doped bulk FeT e0 .6S e0 .4 single crystal. This work demonstrates that interface engineering is a feasible way to discover alternative superconductors with higher Tc.

  9. Trauma simulation in bilingual Canada: Insurmountable barrier or unexpected strength? Insights from the first bilingual S.T.A.R.T.T. course.

    PubMed

    Gillman, Lawrence M; Widder, Sandy; Clément, Julien; Engels, Paul T; Paton-Gay, John Damian; Brindley, Peter G

    2016-04-01

    The Standardized Trauma and Resuscitation Team Training (S.T.A.R.T.T.) course focuses on training multidisciplinary trauma teams: surgeons/physicians, registered nurses (RNs), respiratory therapists (RTs) and, most recently, prehospital personnel. The S.T.A.R.T.T. curriculum highlights crisis management (CRM) skills: communication, teamwork, leadership, situational awareness and resource utilization. This commentary outlines the modifications made to the course curriculum in order to satisfy the learning needs of a bilingual audience. The results suggest that bilingual multidisciplinary CRM courses are feasible, are associated with high participant satisfaction and have no clear detriments.

  10. Superconductivity in multiple phases of compressed GeS b2T e4

    NASA Astrophysics Data System (ADS)

    Greenberg, E.; Hen, B.; Layek, Samar; Pozin, I.; Friedman, R.; Shelukhin, V.; Rosenberg, Y.; Karpovski, M.; Pasternak, M. P.; Sterer, E.; Dagan, Y.; Rozenberg, G. Kh.; Palevski, A.

    2017-02-01

    Here we report the discovery of superconductivity in multiple phases of the compressed GeS b2T e4 (GST) phase change memory alloy, which has attracted considerable attention for the last decade due to its unusual physical properties with many potential applications. Superconductivity is observed through electrical transport measurements, both for the amorphous (a -GST) and for the crystalline (c -GST) phases. The superconducting critical temperature Tc continuously increases with applied pressure, reaching a maximum Tc=6 K at P =20 GPa for a -GST, whereas the critical temperature of the cubic phase reaches a maximum Tc=8 K at 30 GPa. This material system, exhibiting a superconductor-insulator quantum phase transition, has an advantage over disordered metals since it has a continuous control of the crystal structure and the electronic properties using pressure as an external stimulus.

  11. A Preliminary Analysis on Empirical Attenuation of Absolute Velocity Response Spectra (1 to 10s) in Japan

    NASA Astrophysics Data System (ADS)

    Dhakal, Y. P.; Kunugi, T.; Suzuki, W.; Aoi, S.

    2013-12-01

    The Mw 9.1 Tohoku-oki earthquake caused strong shakings of super high rise and high rise buildings constructed on deep sedimentary basins in Japan. Many people felt difficulty in moving inside the high rise buildings even on the Osaka basin located at distances as far as 800 km from the epicentral area. Several empirical equations are proposed to estimate the peak ground motions and absolute acceleration response spectra applicable mainly within 300 to 500km from the source area. On the other hand, Japan Meteorological Agency has recently proposed four classes of absolute velocity response spectra as suitable indices to qualitatively describe the intensity of long-period ground motions based on the observed earthquake records, human experiences, and actual damages that occurred in the high rise and super high rise buildings. The empirical prediction equations have been used in disaster mitigation planning as well as earthquake early warning. In this study, we discuss the results of our preliminary analysis on attenuation relation of absolute velocity response spectra calculated from the observed strong motion records including those from the Mw 9.1 Tohoku-oki earthquake using simple regression models with various model parameters. We used earthquakes, having Mw 6.5 or greater, and focal depths shallower than 50km, which occurred in and around Japanese archipelago. We selected those earthquakes for which the good quality records are available over 50 observation sites combined from K-NET and KiK-net. After a visual inspection on approximately 21,000 three component records from 36 earthquakes, we used about 15,000 good quality records in the period range of 1 to 10s within the hypocentral distance (R) of 800km. We performed regression analyses assuming the following five regression models. (1) log10Y (T) = c+ aMw - log10R - bR (2) log10Y (T) = c+ aMw - log10R - bR +gS (3) log10Y (T) = c+ aMw - log10R - bR + hD (4) log10Y (T) = c+ aMw - log10R - bR +gS +hD (5) log10Y

  12. Logical recoding of S-R rules can reverse the effects of spatial S-R correspondence.

    PubMed

    Wühr, Peter; Biebl, Rupert

    2009-02-01

    Two experiments investigated competing explanations for the reversal of spatial stimulus-response (S-R) correspondence effects (i.e., Simon effects) with an incompatible S-R mapping on the relevant, nonspatial dimension. Competing explanations were based on generalized S-R rules (logical-recoding account) or referred to display-control arrangement correspondence or to S-S congruity. In Experiment 1, compatible responses to finger-name stimuli presented at left/right locations produced normal Simon effects, whereas incompatible responses to finger-name stimuli produced an inverted Simon effect. This finding supports the logical-recoding account. In Experiment 2, spatial S-R correspondence and color S-R correspondence were varied independently, and main effects of these variables were observed. The lack of an interaction between these variables, however, disconfirms a prediction of the display-control arrangement correspondence account. Together, the results provide converging evidence for the logical-recoding account. This account claims that participants derive generalized response selection rules (e.g., the identity or reversal rule) from specific S-R rules and inadvertently apply the generalized rules to the irrelevant (spatial) S-R dimension when selecting their response.

  13. I. T. - R. O. C. K. S. Comet Nuclei Sample Return Mission

    NASA Astrophysics Data System (ADS)

    Dalcher, N.

    2009-04-01

    Fadden L.A., Sunshine J., Wellnitz D., Lisse C., Schultz P., Meech K. J., Delamere W. A. Icarus 187,4-15 (2007). [4] Simon S.B., Joswiak D.J., Ishii H.A., Bradley J.P., Chi M., Grossman L., Aléon J., Brownlee D.E., Fallon S., Hutcheon I.D., Matrajt G., Mckeegan K.D.: Refractory Inclusion Returned by Stardust from Comet P81/Wild 2. Meteoritics and Planetary Science (2007). [5] George D. Cody, Harald Ade, Conel M. O'D. Alexander, Tohru Araki, Anna Butterworth, Holger Fleckenstein, George Flynn, Mary K. Gilles, Chris Jacobsen, A.L. D. Kilcoyne, Keiko Messenger, Scott A. Sandford, Tolek Tyliszczak, Andrew J.Westphal4, Susan Wirick, and Hikaru Yabuta. Quantitative Organic and Light Element analysis of Comet 81P/Wild 2 particles using C-, N-, and O- µ-XANES, Meteoretics and Planetary Science: In Press. [6] Stern, S. et al. Alice: The Rosetta Ultraviolet Imaging Spectrograph. Space Science Reviews 128, 507-527 (2007). [7] Balsiger, H. et al. Rosina-Rosetta Orbiter Spectrometer for Ion and Neutral Analysis. Space Science Reviews 128, 745-801 (2007). [8] Colangeli, L. et al. The Grain Impact Analyser and Dust Accumulator (GIADA) Experiment for the Rosetta Mission: Design, Performances and First Results. Space Science Reviews 128, 803-821 (2007). [9] Yoshimitsu, T., Kubota, T., Nakatani, I., Adachi, T. & Saito, H. Micro-hopping robot for asteroid exploration. Acta Astronautica 52, 441-446 (2003). [10] Lorenz, R. et al. Demonstration of comet sample collection by penetrator. ESA SP-542, 387-393 (2003). [11] Küppers et al. Triple F—a comet nucleus sample return mission. Experimental Astronomy, Online First (2008).

  14. Accountability: A M.E.A.S.U.R.E of the Impact School Counselors Have on Student Achievement.

    ERIC Educational Resources Information Center

    Dahir, Carol A.; Stone, Carolyn B.

    2003-01-01

    Presents information on M.E.A.S.U.R.E., a process that assists school counselors in delivering a data-driven school counseling program. Highlights challenges faced by school counselors in an accountability-driven environment and provisions of the No Child Left Behind Act. (Contains 10 references and 6 tables.) (GCP)

  15. Computational Study on the Unimolecular Decomposition of JP-8 Jet Fuel Surrogates III: Butylbenzene Isomers ( n-, s-, and t-C14H10).

    PubMed

    Belisario-Lara, Daniel; Mebel, Alexander M; Kaiser, Ralf I

    2018-04-26

    Ab initio G3(CCSD,MP2)//B3LYP/6-311G(d,p) calculations of potential energy surfaces have been carried out to unravel the mechanism of the initial stages of pyrolysis of three C 10 H 14 isomers: n-, s-, and t-butylbenzenes. The computed energy and molecular parameters have been utilized in RRKM-master equation calculations to predict temperature- and pressure-dependent rate constants and product branching ratios for the primary unimolecular decomposition of these molecules and for the secondary decomposition of their radical fragments. The results showed that the primary dissociation of n-butylbenzene produces mostly benzyl (C 7 H 7 ) + propyl (C 3 H 7 ) and 1-phenyl-2-ethyl (C 6 H 5 C 2 H 4 ) + ethyl (C 2 H 5 ), with their relative yields strongly dependent on temperature and pressure, together with a minor amount of 1-phenyl-prop-3-yl (C 9 H 11 ) + methyl (CH 3 ). Secondary decomposition reactions that are anticipated to occur on a nanosecond scale under typical combustion conditions split propyl (C 3 H 7 ) into ethylene (C 2 H 4 ) + methyl (CH 3 ), ethyl (C 2 H 5 ) into ethylene (C 2 H 4 ) + hydrogen (H), 1-phenyl-2-ethyl (C 6 H 5 C 2 H 4 ) into mostly styrene (C 8 H 8 ) + hydrogen (H) and to a lesser extent phenyl (C 6 H 5 ) + ethylene (C 2 H 4 ), and 1-phenyl-prop-3-yl (C 9 H 11 ) into predominantly benzyl (C 7 H 7 ) + ethylene (C 2 H 4 ). The primary decomposition of s-butylbenzene is predicted to produce 1-phenyl-1-ethyl (C 6 H 5 CHCH 3 ) + ethyl (C 2 H 5 ) and a minor amount of 1-phenyl-prop-1-yl (C 9 H 11 ) + methyl (CH 3 ), and then 1-phenyl-1-ethyl (C 6 H 5 CHCH 3 ) and 1-phenyl-prop-1-yl (C 9 H 11 ) rapidly dissociate to styrene (C 8 H 8 ) + hydrogen (H) and styrene (C 8 H 8 ) + methyl (CH 3 ), respectively. t-Butylbenzene decomposes nearly exclusively to 2-phenyl-prop-2-yl (C 9 H 11 ) + methyl (CH 3 ), and further, 2-phenyl-prop-2-yl (C 9 H 11 ) rapidly eliminates a hydrogen atom to form 2-phenylpropene (C 9 H 10 ). If hydrogen atoms or other reactive

  16. Plasma CXCL10, sCD163 and sCD14 Levels Have Distinct Associations with Antiretroviral Treatment and Cardiovascular Disease Risk Factors

    PubMed Central

    Castley, Alison; Williams, Leah; James, Ian; Guelfi, George; Berry, Cassandra; Nolan, David

    2016-01-01

    We investigate the associations of three established plasma biomarkers in the context of HIV and treatment-related variables including a comprehensive cardiovascular disease risk assessment, within a large ambulatory HIV cohort. Patients were recruited in 2010 to form the Royal Perth Hospital HIV/CVD risk cohort. Plasma sCD14, sCD163 and CXCL10 levels were measured in 475 consecutive patients with documented CVD risk (age, ethnicity, gender, smoking, blood pressure, BMI, fasting metabolic profile) and HIV treatment history including immunological/virological outcomes. The biomarkers assessed showed distinct associations with virological response: CXCL10 strongly correlated with HIV-1 RNA (p<0.001), sCD163 was significantly reduced among ‘aviraemic’ patients only (p = 0.02), while sCD14 was unaffected by virological status under 10,000 copies/mL (p>0.2). Associations between higher sCD163 and protease inhibitor therapy (p = 0.05) and lower sCD14 with integrase inhibitor therapy (p = 0.02) were observed. Levels of sCD163 were also associated with CVD risk factors (age, ethnicity, HDL, BMI), with a favourable influence of Framingham score <10% (p = 0.04). Soluble CD14 levels were higher among smokers (p = 0.002), with no effect of other CVD risk factors, except age (p = 0.045). Our findings confirm CXCL10, sCD163 and sCD14 have distinct associations with different aspects of HIV infection and treatment. Levels of CXCL10 correlated with routinely monitored variables, sCD163 levels reflect a deeper level of virological suppression and influence of CVD risk factors, while sCD14 levels were not associated with routinely monitored variables, with evidence of specific effects of smoking and integrase inhibitor therapy warranting further investigation. PMID:27355513

  17. Pharmacokinetics and Metabolism of 4R-Cembranoid.

    PubMed

    Vélez-Carrasco, Wanda; Green, Carol E; Catz, Paul; Furimsky, Anna; O'Loughlin, Kathleen; Eterović, Vesna A; Ferchmin, P A

    2015-01-01

    4R-cembranoid (4R) is a natural cyclic diterpenoid found in tobacco leaves that displays neuroprotective activity. 4R protects against NMDA, paraoxon (POX), and diisopropylfluorophosphate (DFP) damage in rat hippocampal slices and against DFP in rats in vivo. The purpose of this study was to examine the metabolism and pharmacokinetics of 4R as part of its preclinical development as a neuroprotective drug. 10 µM 4R was found to be very stable in plasma for up to 1 hr incubation. 4R metabolism in human microsomes was faster than in the rat. Ten metabolites of 4R were detected in the microsomal samples; 6 dihydroxy and 4 monohydroxy forms of 4R. Male rats received a single dose of 4R at 6 mg/kg i.v., i.m., or s.c. The i.v. group had the highest plasma concentration of 1017 ng/mL. The t1/2 was 36 min and reached the brain within 10 min. The brain peak concentration was 6516 ng/g. The peak plasma concentration in the i.m. group was 163 ng/mL compared to 138 ng/mL in the s.c. group. The t1/2 of 4R after i.m. and s.c. administration was approximately 1.5 hr. The brain peak concentration was 329 ng/g in the i.m. group and 323 ng/g for the s.c. group. The brain to plasma ratio in the i.v. group was 6.4, reached 10 min after dose, whereas in the i.m. and s.c. groups was 2.49 and 2.48, respectively, at 90 min after dose. Our data show that 4R crosses the BBB and concentrates in the brain where it exerts its neuroprotective effect.

  18. Pharmacokinetics and Metabolism of 4R-Cembranoid

    PubMed Central

    Vélez-Carrasco, Wanda; Green, Carol E.; Catz, Paul; Furimsky, Anna; O’Loughlin, Kathleen; Eterović, Vesna A.; Ferchmin, P. A.

    2015-01-01

    4R-cembranoid (4R) is a natural cyclic diterpenoid found in tobacco leaves that displays neuroprotective activity. 4R protects against NMDA, paraoxon (POX), and diisopropylfluorophosphate (DFP) damage in rat hippocampal slices and against DFP in rats in vivo. The purpose of this study was to examine the metabolism and pharmacokinetics of 4R as part of its preclinical development as a neuroprotective drug. 10 µM 4R was found to be very stable in plasma for up to 1 hr incubation. 4R metabolism in human microsomes was faster than in the rat. Ten metabolites of 4R were detected in the microsomal samples; 6 dihydroxy and 4 monohydroxy forms of 4R. Male rats received a single dose of 4R at 6 mg/kg i.v., i.m., or s.c. The i.v. group had the highest plasma concentration of 1017 ng/mL. The t1/2 was 36 min and reached the brain within 10 min. The brain peak concentration was 6516 ng/g. The peak plasma concentration in the i.m. group was 163 ng/mL compared to 138 ng/mL in the s.c. group. The t1/2 of 4R after i.m. and s.c. administration was approximately 1.5 hr. The brain peak concentration was 329 ng/g in the i.m. group and 323 ng/g for the s.c. group. The brain to plasma ratio in the i.v. group was 6.4, reached 10 min after dose, whereas in the i.m. and s.c. groups was 2.49 and 2.48, respectively, at 90 min after dose. Our data show that 4R crosses the BBB and concentrates in the brain where it exerts its neuroprotective effect. PMID:25811857

  19. Stereospecific oxidation of (R)- and (S)-1-indanol by naphthalene dioxygenase from Pseudomonas sp. strain NCIB 9816-4.

    PubMed Central

    Lee, K; Resnick, S M; Gibson, D T

    1997-01-01

    A recombinant Escherichia coli strain which expresses naphthalene dioxygenase (NDO) from Pseudomonas sp. strain NCIB 9816-4 oxidized (S)-1-indanol to trans-(1S,3S)-indan-1,3-diol (95.5%) and (R)-3-hydroxy-1-indanone (4.5%). The same cells oxidized (R)-1-indanol to cis-1,3-indandiol (71%), (R)-3-hydroxy-1-indanone (18.2%), and cis-1,2,3-indantriol (10.8%). Purified NDO oxidized (S)-1-indenol to both syn- and anti-2,3-dihydroxy-1-indanol. PMID:9143136

  20. Stereospecific oxidation of (R)- and (S)-1-indanol by naphthalene dioxygenase from Pseudomonas sp. strain NCIB 9816-4.

    PubMed

    Lee, K; Resnick, S M; Gibson, D T

    1997-05-01

    A recombinant Escherichia coli strain which expresses naphthalene dioxygenase (NDO) from Pseudomonas sp. strain NCIB 9816-4 oxidized (S)-1-indanol to trans-(1S,3S)-indan-1,3-diol (95.5%) and (R)-3-hydroxy-1-indanone (4.5%). The same cells oxidized (R)-1-indanol to cis-1,3-indandiol (71%), (R)-3-hydroxy-1-indanone (18.2%), and cis-1,2,3-indantriol (10.8%). Purified NDO oxidized (S)-1-indenol to both syn- and anti-2,3-dihydroxy-1-indanol.

  1. [Population data analysis of miniSTR loci: D10S1248, D14S1434 and D22S1045 in the Pomerania-Kujawy region of Poland].

    PubMed

    Kodroń, Agata; Rychlicka, Edyta; Milewska, Iwona; Woźniak, Marcin; Grzybowski, Tomasz

    2010-01-01

    This paper presents the allele frequencies and forensic parameters of the three miniSTR loci D10S1248, D14S1434 and D22S1045 in the Pomerania-Kujawy region of Poland. Genomic DNA was extracted by a standard phenol-chloroform extraction procedure. The three miniSTR loci D10S1248, D14S1434 and D22S1045 were amplified in a triplex polymerase chain reaction with the primer sets designed by Coble and Butler in a GeneAmp PCR System 9700 (Applied Biosystems). The amplified products were separated and detected by capillary electrophoresis on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).The genotype frequency distributions showed no deviations from Hardy-Weinberg equilibrium expectations. The values of forensic parameters confirm that D10S1248 and D22S1045 are highly informative genetic markers, whereas D14S1434 is a moderately useful for forensic genetic identification purposes.

  2. Crystal structure and absolute configuration of (3aS,4S,5R,7aR)-2,2,7-trimethyl-3a,4,5,7a-tetra-hydro-1,3-benzodioxole-4,5-diol.

    PubMed

    Macías, Mario A; Suescun, Leopoldo; Pandolfi, Enrique; Schapiro, Valeria; Tibhe, Gaurao D; Mombrú, Álvaro W

    2015-09-01

    The absolute configuration of the title compound, C10H16O4, determined as 3aS,4S,5R,7aR on the basis of the synthetic pathway, was confirmed by X-ray diffraction. The mol-ecule contains a five- and a six-membered ring that adopt twisted and envelope conformations, respectively. The dihedral angle between the mean planes of the rings is 76.80 (11)° as a result of their cis-fusion. In the crystal, mol-ecules are linked by two pairs of O-H⋯O hydrogen bonds, forming chains along [010]. These chains are further connected by weaker C-H⋯O inter-actions along [100], creating (001) sheets that inter-act only by weak van der Waals forces.

  3. U.S. International Firms and R,D&E in Developing Countries.

    ERIC Educational Resources Information Center

    National Academy of Sciences, Washington, DC.

    This document provides a panel report of research, development, and engineering (R,D&E) issues confronting international firms operating in developing countries. Biscussed are the R,D&E objectives of developing countries, the objectives of international firms, conflicts and the possibilities for cooperation between the two, and the role of U.S.…

  4. 70. Photocopy of 4' 10 x 3'10 Propeller, U.S. Coast ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    70. Photocopy of 4' 10 x 3'10 Propeller, U.S. Coast Guard 133 Ft. Tender. Columbian Bronze Corporation, Freeport, Long Island, New York, Coast Guard Headquarters Drawing No. 540-WAGL-4400-4, dated July 1953. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  5. Prototype development and demonstration for response, emergency staging, communications, uniform management, and evacuation (R.E.S.C.U.M.E.) : R.E.S.C.U.M.E. prototype system design document.

    DOT National Transportation Integrated Search

    2014-04-01

    This report documents the System Design Document (SDD) for the prototype development and demonstration of the Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) application bundle, with a focus on the Inc...

  6. 75 FR 5314 - T.E.S. Filer City Station Limited Partnership; Notice of Filing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-02

    ... lieu of paper using the ``eFiling'' link at http://www.ferc.gov . Persons unable to file electronically... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. EL10-35-000] T.E.S. Filer City Station Limited Partnership; Notice of Filing January 26, 2010. Take notice that on January 20...

  7. Scale invariance of the η-deformed AdS5 × S5 superstring, T-duality and modified type II equations

    NASA Astrophysics Data System (ADS)

    Arutyunov, G.; Frolov, S.; Hoare, B.; Roiban, R.; Tseytlin, A. A.

    2016-02-01

    We consider the ABF background underlying the η-deformed AdS5 ×S5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that has 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R-R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R-R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS3 ×S3 ×T4and AdS2 ×S2 ×T6models.

  8. RTS,S/AS01E Malaria Vaccine Induces Memory and Polyfunctional T Cell Responses in a Pediatric African Phase III Trial.

    PubMed

    Moncunill, Gemma; De Rosa, Stephen C; Ayestaran, Aintzane; Nhabomba, Augusto J; Mpina, Maximillian; Cohen, Kristen W; Jairoce, Chenjerai; Rutishauser, Tobias; Campo, Joseph J; Harezlak, Jaroslaw; Sanz, Héctor; Díez-Padrisa, Núria; Williams, Nana Aba; Morris, Daryl; Aponte, John J; Valim, Clarissa; Daubenberger, Claudia; Dobaño, Carlota; McElrath, M Juliana

    2017-01-01

    Comprehensive assessment of cellular responses to the RTS,S/AS01E vaccine is needed to understand potential correlates and ultimately mechanisms of protection against malaria disease. Cellular responses recognizing the RTS,S/AS01E-containing circumsporozoite protein (CSP) and Hepatitis B surface antigen (HBsAg) were assessed before and 1 month after primary vaccination by intracellular cytokine staining and 16-color flow cytometry in 105 RTS,S/AS01-vaccinated and 74 rabies-vaccinated participants (controls) in a pediatric phase III trial in Africa. RTS,S/AS01E-vaccinated children had significantly higher frequencies of CSP- and HBsAg-specific CD4 + T cells producing IL-2, TNF-α, and CD40L and HBsAg-specific CD4 + T producing IFN-γ and IL-17 than baseline and the control group. Vaccine-induced responses were identified in both central and effector memory (EM) compartments. EM CD4 + T cells expressing IL-4 and IL-21 were detected recognizing both vaccine antigens. Consistently higher response rates to both antigens in RTS,S/AS01E-vaccinated than comparator-vaccinated children were observed. RTS,S/AS01E induced polyfunctional CSP- and HBsAg-specific CD4 + T cells, with a greater degree of polyfunctionality in HBsAg responses. In conclusion, RTS,S/AS01E vaccine induces T cells of higher functional heterogeneity and polyfunctionality than previously characterized. Responses detected in memory CD4 + T cell compartments may provide correlates of RTS,S/AS01-induced immunity and duration of protection in future correlates of immunity studies.

  9. U.S. EPA, Pesticide Product Label, MONTEDISON ZIRAM TECHNICAL, 10/04/1979

    EPA Pesticide Factsheets

    2011-04-21

    ... I I -~ I ~~.' c -"c= > ~ • t: g .o,&A. !III~Sr! () W·~O:!T ~ . n n. _. ( () 2S$.~"I .. Po.-8.~ I:'Ij ~ ~ • w ~ ffa. v-, "O~r ~ "tI ~ ~H ~ ~ \\ n:-e; t1j ..... t " fI ~ • -. . r --- - ...

  10. U.S. EPA, Pesticide Product Label, HAWK T-A 25 MOSQUITO COILS, 10/06/1972

    EPA Pesticide Factsheets

    2011-04-21

    , .', • 1' ••. _. _ .... T?DQ?-\\S) r I I ~ i I i j l \\. - . . II YO ... -- I.... • I .1 '.'\\I"I\\} " f ' .. , . I (. ' " . LI . ~ '" , fj" /' \\ . t\\ 'r; I ' "\\' II 'I . ...• I·~I I ...

  11. Ada Compiler Validation Summary Report: Certificate Number: 891201S1. 10215 U.S. Navy Ada/M, Version 2.0 (/No Optimize Option) VAX 8550 and VAX 11/785 Host and AN/AYK-14 Target

    DTIC Science & Technology

    1990-01-12

    NIST89USN555 7 1.10 DATE VSR CPIIED BEFORE ON-SITE: 08-11-89 DATE VSR COMPI=E AFTER ON-SITE: 12-04-89 DATE VSR MODIFIED PER AVO COMMENS: 12-29-89 DATE...AD-A223 579I I Final 12 Jan 89 to 12 Jan 90 4WPUASS1TTL Ada Compler Validation Summary Report: U.S. Navy.~ Gaithersburg, E1D A USA 7 . PEXNX&M...0Rl3Wfl4 NUADACAMSO) R. A flff om4oN National Institute of Standards and Technology = & National Computer Systew± !.boratory N/S T U W6�- 7 /0 Bldg. 255, Em

  12. Building bridges: an interpretive phenomenological analysis of nurse educators' clinical experience using the T.R.U.S.T. Model for inclusive spiritual care.

    PubMed

    Scott Barss, Karen

    2012-04-30

    Educating nurses to provide evidence-based, non-intrusive spiritual care in today's pluralistic context is both daunting and essential. Qualitative research is needed to investigate what helps nurse educators feel more prepared to meet this challenge. This paper presents findings from an interpretive phenomenological analysis of the experience of nurse educators who used the T.R.U.S.T. Model for Inclusive Spiritual Care in their clinical teaching. The T.R.U.S.T. Model is an evidence-based, non-linear resource developed by the author and piloted in the undergraduate nursing program in which she teaches. Three themes are presented: "The T.R.U.S.T. Model as a bridge to spiritual exploration"; "blockades to the bridge"; and "unblocking the bridge". T.R.U.S.T. was found to have a positive influence on nurse educators' comfort and confidence in the teaching of spiritual care. Recommendations for maximizing the model's positive impact are provided, along with "embodied" resources to support holistic teaching and learning about spiritual care.

  13. Luxation traumatique invétérée de la hanche

    PubMed Central

    Rachid, Abdelillah; Abdeljaouad, Najib; Abdelkrim, Daoudi; Hicham, Yacoubi

    2015-01-01

    La luxation traumatique invétérée de la hanche est une affection rare et grave avec une prise en charge difficile et non encore codifiée. L'arthroplastie totale de la hanche reste le traitement chirurgical de choix. Nous rapportons un cas de luxation iliaque invétérée de la hanche chez un jeune patient de 19 ans, traitée par une arthroplastie totale de la hanche. Après un recul de 2 ans, le résultat fonctionnel est satisfaisant, avec une marche indolore sans aide. Le Score de Harris est de 96 et le score de Merle d'aubigné-Postel est de 17. PMID:26848347

  14. Transformation of dinitrosyl iron complexes [(NO)2Fe(SR)2]- (R = Et, Ph) into [4Fe-4S] Clusters [Fe4S4(SPh)4]2-: relevance to the repair of the nitric oxide-modified ferredoxin [4Fe-4S] clusters.

    PubMed

    Tsou, Chih-Chin; Lin, Zong-Sian; Lu, Tsai-Te; Liaw, Wen-Feng

    2008-12-17

    Transformation of dinitrosyl iron complexes (DNICs) [(NO)(2)Fe(SR)(2)](-) (R = Et, Ph) into [4Fe-4S] clusters [Fe(4)S(4)(SPh)(4)](2-) in the presence of [Fe(SPh)(4)](2-/1-) and S-donor species S(8) via the reassembling process ([(NO)(2)Fe(SR)(2)](-) --> [Fe(4)S(3)(NO)(7)](-) (1)/[Fe(4)S(3)(NO)(7)](2-) (2) --> [Fe(4)S(4)(NO)(4)](2-) (3) --> [Fe(4)S(4)(SPh)(4)](2-) (5)) was demonstrated. Reaction of [(NO)(2)Fe(SR)(2)](-) (R = Et, Ph) with S(8) in THF, followed by the addition of HBF(4) into the mixture solution, yielded complex [Fe(4)S(3)(NO)(7)](-) (1). Complex [Fe(4)S(3)(NO)(7)](2-) (2), obtained from reduction of complex 1 by [Na][biphenyl], was converted into complex [Fe(4)S(4)(NO)(4)](2-) (3) along with byproduct [(NO)(2)Fe(SR)(2)](-) via the proposed [Fe(4)S(3)(SPh)(NO)(4)](2-) intermediate upon treating complex 2 with 1.5 equiv of [Fe(SPh)(4)](2-) and the subsequent addition of 1/8 equiv of S(8) in CH(3)CN at ambient temperature. Complex 3 was characterized by IR, UV-vis, and single-crystal X-ray diffraction. Upon addition of complex 3 to the CH(3)CN solution of [Fe(SPh)(4)](-) in a 1:2 molar ratio at ambient temperature, the rapid NO radical-thiyl radical exchange reaction between complex 3 and the biomimetic oxidized form of rubredoxin [Fe(SPh)(4)](-) occurred, leading to the simultaneous formation of [4Fe-4S] cluster [Fe(4)S(4)(SPh)(4)](2-) (5) and DNIC [(NO)(2)Fe(SPh)(2)](-). This result demonstrates a successful biomimetic reassembly of [4Fe-4S] cluster [Fe(4)S(4)(SPh)(4)](2-) from NO-modified [Fe-S] clusters, relevant to the repair of DNICs derived from nitrosylation of [4Fe-4S] clusters of endonuclease III back to [4Fe-4S] clusters upon addition of ferrous ion, cysteine, and IscS.

  15. Electron-impact excitation of the 1{sup 1}{ital S}{r_arrow}3{sup 1}{ital P} and 1{sup 1}{ital S}{r_arrow}4{sup 1}{ital P} transitions in helium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khakoo, M.A.; Roundy, D.; Rugamas, F.

    1996-11-01

    The method of electron-photon coincidence is used to {open_quote}{open_quote}resolve{close_quote}{close_quote} the electron-impact excitation of the {ital n}{sup 1}{ital P} levels ({ital n}=3 and 4) from nearby levels. Experimentally determined ratios of the differential cross sections for the electron-impact excitation of 1{sup 1}{ital S}{r_arrow}2{sup 1}{ital P}, to 1{sup 1}{ital S}{r_arrow}3{sup 1}{ital P}, and 4{sup 1}{ital P} transitions are presented at 30-, 40-, and 80-eV incident electron energies. Differential cross sections for the 1{sup 1}{ital S}{r_arrow}3{sup 1}{ital P} and 1{sup 1}{ital S}{r_arrow}4{sup 1}{ital P} transitions are derived by normalizing these ratios to available experimental differential cross sections for the 1{sup 1}{ital S}{r_arrow}2{sup 1}{italmore » P} transition. The ratios and differential cross sections are compared to available theoretical and semiempirical data. {copyright} {ital 1996 The American Physical Society.}« less

  16. Making Riflemen from Mud: Restoring the Army’s Culture of Irregular Warfare (CSL Student Issue Paper, Volume S01-07, Jul 2007)

    DTIC Science & Technology

    2007-07-01

    CSLC E N T E R f o r S T R AT E G I C L E A D E R S H I P Student Issue PaperCenter for Strategic Leadership, U.S...Matthew Batson was commanding L Troop, 4th U.S. Cavalry, during operations in the Philippines. Already recognized as an energetic and courageous officer...Said England unto Pharaoh, “You’ve had miracles before, When Aaron struck your rivers into blood; But if you watch the Sergeant he can show you

  17. Novel Solution Process for Fabricating Ultra-Thin-Film Absorber Layers in Fe 2SiS 4 and Fe 2GeS 4 Photovoltaics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orefuwa, Samuel A.; Lai, Cheng-Yu; Dobson, Kevin D.

    2014-05-12

    Fe 2SiS 4 and Fe 2GeS 4 crystalline materials posses direct bandgaps of ~1.55 and ~1.4 eV respectively and an absorption coefficient larger than 10^5 cm–1; their theoretical potential as solar photovoltaic absorbers has been demonstrated. However, no solar devices that employ either Fe 2SiS 4 or Fe 2GeS 4 have been reported to date. In the presented work, nanoprecursors to Fe 2SiS 4 and Fe 2GeS 4 have been fabricated and employed to build ultra-thin-film layers via spray coating and rod coating methods. Temperature-dependent X-Ray diffraction analyses of nanoprecursors coatings show an unprecedented low temperature for forming crystalline Femore » 2SiS 4 and Fe 2GeS 4. Fabricating of ultra-thin-film photovoltaic devices utilizing Fe 2SiS 4 and Fe 2GeS 4 as solar absorber material is presented.« less

  18. Computer Assisted Medical Diagnosis (CAMD) System. Version 1.0. User’s Guide

    DTIC Science & Technology

    1992-10-01

    ULCERA CHOLECYSTITIS SMALL BOWEL OBSTRUCTION PEPTIC ULCER DISEASE MESENTERIC ADENITIS DIVERTICULITIS V <S;e > < View > <Cancel> Computer Assisted Medical...JOHN SSN 123-45-6789 Diseases on File <Complaint > APPENDL1X iT!rS~ A <Sym NONS ECIAICABDOMINAL PAIN sist> -VA RENAL COLIC AGE PERFORATED DUODENAL...elevated unless perforation occurs. <OK> 4.4.4 SF600 Report. This option extracts the encounter data and compiles it into the SF600 report format. The

  19. 77 FR 1947 - Filing of Plats of Survey: Oregon/Washington

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-12

    ... publication. WILLAMETTE MERIDIAN Oregon T. 10 S., R. 1 East, accepted December 8, 2011 T. 14 S., R. 1 W., accepted December 27, 2011 T. 6 S., R. 7 W., accepted December 27, 2011 T. 37 S., R. 1 E., accepted..., 2011 T. 21 S., R. 4 W., accepted December 27, 2011 Washington T. 17 N., R. 10 E., accepted December 27...

  20. Search for the decays B_{(s)};{0} --> e;{+} micro;{-} and B_{(s)};{0} --> e;{+} e;{-} in CDF run II.

    PubMed

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Griso, S Pagan; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Renz, M; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Rutherford, B; Saarikko, H; Safonov, A; Sakumoto, W K; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Stuart, D; Suh, J S; Sukhanov, A; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Trovato, M; Tsai, S-Y; Tu, Y; Turini, N; Ukegawa, F; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wagner-Kuhr, J; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Weinelt, J; Wenzel, H; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Würthwein, F; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zhang, X; Zheng, Y; Zucchelli, S

    2009-05-22

    We report results from a search for the lepton flavor violating decays B_{s};{0} --> e;{+} micro;{-} and B;{0} --> e;{+} micro;{-}, and the flavor-changing neutral-current decays B_{s};{0} --> e;{+} e;{-} and B;{0} --> e;{+} e;{-}. The analysis uses data corresponding to 2 fb;{-1} of integrated luminosity of pp[over ] collisions at sqrt[s] = 1.96 TeV collected with the upgraded Collider Detector (CDF II) at the Fermilab Tevatron. The observed number of B0 and B_{s};{0} candidates is consistent with background expectations. The resulting Bayesian upper limits on the branching ratios at 90% credibility level are B(B_{s};{0} --> e;{+} micro;{-}) < 2.0 x 10;{-7}, B(B;{0} --> e;{+} micro;{-}) < 6.4 x 10;{-8}, B(B_{s};{0} --> e;{+} e;{-}) < 2.8 x 10;{-7}, and B(B;{0} --> e;{+} e;{-}) < 8.3 x 10;{-8}. From the limits on B(B_{(s)};{0} --> e;{+} micro;{-}), the following lower bounds on the Pati-Salam leptoquark masses are also derived: M_{LQ}(B_{s};{0} --> e;{+} micro;{-}) > 47.8 TeV/c;{2}, and M_{LQ}(B;{0} --> e;{+} micro;{-}) > 59.3 TeV / c;{2}, at 90% credibility level.

  1. Mechanistic studies on the reactions of PhS(-) or [MoS(4)](2)(-) with [M(4)(SPh)(10)](2)(-) (M = Fe or Co).

    PubMed

    Cui, Zhen; Henderson, Richard A

    2002-08-12

    Kinetic studies, using stopped-flow spectrophotometry, on the reactions of [M(4)(SPh)(10)](2)(-) (M = Fe or Co) with PhS(-) to form [M(SPh)(4)](2)(-) are described, as are the reactions between [M(4)(SPh)(10)](2)(-) and [MoS(4)](2)(-) to form [S(2)MoS(2)Fe(SPh)(2)](2)(-) or [S(2)MoS(2)CoS(2)MoS(2)](2)(-). The kinetics of the reactions with PhS(-) are consistent with an initial associative substitution mechanism involving attack of PhS(-) at one of the tetrahedral M sites of [M(4)(SPh)(10)](2)(-) to form [M(4)(SPh)(11)](3)(-). Subsequent or concomitant cleavage of a micro-SPh ligand, at the same M, initiates a cascade of rapid reactions which result ultimately in the complete rupture of the cluster and formation of [M(SPh)(4)](2)(-). The kinetics of the reaction between [M(4)(SPh)(10)](2)(-) and [MoS(4)](2)(-) indicate an initial dissociative substitution mechanism at low concentrations of [MoS(4)](2)(-), in which rate-limiting dissociation of a terminal thiolate from [M(4)(SPh)(10)](2)(-) produces [M(4)(SPh)(9)](-) and the coordinatively unsaturated M site is rapidly attacked by a sulfido group of [MoS(4)](2)(-). It is proposed that subsequent chelation of the MoS(4) ligand results in cleavage of an M-micro-SPh bond, initiating a cascade of reactions which lead to the ultimate break-up of the cluster and formation of the products, [S(2)MoS(2)Fe(SPh)(2)](2)(-) or [S(2)MoS(2)CoS(2)MoS(2)](2)(-). With [Co(4)(SPh)(10)](2)(-), at higher concentrations of [MoS(4)](2)(-), a further substitution pathway is evident which exhibits a second order dependence on the concentration of [MoS(4)](2)(-). The mechanistic picture of cluster disruption which emerges from these studies rationalizes the "all or nothing" reactivity of [M(4)(SPh)(10)](2)(-).

  2. The S.T.o.R.M. (tm): Air transport system design simulation

    NASA Technical Reports Server (NTRS)

    1992-01-01

    The members of Team Asylum have proposed a helicopter design concept, called the S.T.o.R.M., in order to meet the market demands for an aircraft to perform overnight package delivery services in Aeroworld. The helicopter concept was chosen over a fixed wing aircraft design to fulfill the mission requirements for a variety of reasons, all of which will be discussed later. However, many critical design areas needed to be investigated as part of the helicopter concept's selection. One of the most significant design factors was the weight of the aircraft. This determined the selection of the propulsion system necessary to get the S.T.o.R.M. off the ground, and maintain flight once airborne. Another significant factor that went hand in hand with the motor selection was the choice of the main rotor. Since the main rotor is the primary source of lift for the helicopter, its proper selection became increasingly important.

  3. Synthesis and X-ray structures of dilithium complexes of the phosphonate anions [PhP(E)(N(t)Bu)(2)](2-) (E = O, S, Se, Te) and dimethylaluminum derivatives of [PhP(E)(N(t)Bu)(NH(t)Bu)](-) (E = S, Se).

    PubMed

    Briand, Glen G; Chivers, Tristram; Krahn, Mark; Parvez, Masood

    2002-12-16

    The dilithium salts of the phosphonate dianions [PhP(E)(N(t)Bu)(2)](2-) (E = O, S, Se) are generated by the lithiation of [PhP(E)(NH(t)Bu)(2)] with n-butyllithium. The formation of the corresponding telluride (E = Te) is achieved by oxidation of [Li(2)[PhP(N(t)Bu)(2)

  4. IBHVG2 (Interior Ballistics of High Velocity Guns, Version 2)--A User’s Guide

    DTIC Science & Technology

    1987-07-01

    AT GAGE LOCATIONS - BREECH, CA 0 38 -- > ORIGINAL PROJECTILE BASE, AND AT 10 INCHES OF TRAVEL CARD 39 -*SGUN CARD 40-- NAMEaE1SS-MN 198’ CNAMu1150...03 SAMIE AS RPT 0 Wr’C usr*s Un14lassile _____ V~nNAUS1&1 n c’’ e Isn D UA (301) 27蔶 SLCl3R- 10 -A DD FOM 147. . AR ;3 APF4 Z70tiQfli*m b mosw itw...004vlted xi t CAS .’Np~ A( All othof Eatt n$ 4( )M,’ UNCLASSI FIED Noec Lert lntentiontly bllank CONTENTS L INTRODUCTION ............. . . . . 4 IL

  5. 76 FR 66322 - Filing of Plats of Survey: Oregon/Washington

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-26

    ...., accepted October 14, 2011. Washington T. 23 N., R. 10 W., accepted October 14, 2011. ADDRESSES: A copy of... publication. Willamette Meridian Oregon T. 20 S., R. 4 W., accepted October 7, 2011. T. 29 S., R. 6 W., accepted October 7, 2011. T. 29 S., R. 7 W., accepted October 7, 2011. T. 4 S., R. 2 E., accepted October 7...

  6. Interaction between GPR120 p.R270H loss-of-function variant and dietary fat intake on incident type 2 diabetes risk in the D.E.S.I.R. study.

    PubMed

    Lamri, A; Bonnefond, A; Meyre, D; Balkau, B; Roussel, R; Marre, M; Froguel, P; Fumeron, F

    2016-10-01

    GPR120 (encoded by FFAR4) is a lipid sensor that plays an important role in the control of energy balance. GPR120 is activated by long chain fatty acids (FAs) including omega-3 FAs. In humans, the loss of function p.R270H variant of the gene FFAR4 has been associated with a lower protein activity, an increased risk of obesity and higher fasting plasma glucose levels. The aim of this study was to investigate whether p.R270H interacts with dietary fat intake to modulate the risk of type 2 diabetes (T2D, 198 incident; 368 prevalent cases) and overweight (787 incident and 2891 prevalent cases) in the prospective D.E.S.I.R. study (n = 5,212, 9 years follow-up). The association of p.R270H with dietary fat and total calories was assessed by linear mixed models. The interaction between p.R270H and dietary fat on T2D and overweight was assessed by logistic regression analysis. The p.R270H variant had a minor allele frequency of 1.45% and was not significantly associated with total calories intake, fat intake or the total calories derived from fat (%). However, there was a significant interaction between p.R270H and dietary fat modulating the incidence of T2D (Pinteraction = 0.02) where the H-carriers had a higher risk of T2D than RR homozygotes in the low fat intake category only. The interaction between p.R270H and fat intake modulating the incidence and prevalence of overweight was not significant. The p.R270H variant of GPR120 modulates the risk of T2D in interaction with dietary fat intake in the D.E.S.I.R. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  7. Synthesis of (R)- and (S)-10,16-dihydroxyhexadecanoic acid: cutin stereochemistry and fungal activation.

    PubMed

    Ahmed, Aqeel; Crawford, Terry; Gould, Stephanie; Ha, Y S; Hollrah, Monica; Noor-E-Ain, Farhana; Dickman, Martin B; Dussault, Patrick H

    2003-05-01

    The first asymmetric syntheses of the cutin monomers (R)- and (S)-10,16-dihydroxyhexadecanoic acid (10,16-DHPA) and confirmation of (S)(+)-absolute configuration for 10,16-DHPA derived from tomato are reported. The individual DHPA stereoisomers display differences in their ability to activate the fungal pathogen Colletotrichum trifolii.

  8. KCNN4 and S100A14 act as predictors of recurrence in optimally debulked patients with serous ovarian cancer

    PubMed Central

    Hu, Ting; Sun, Qian; Wu, Jianli; Lin, Xingguang; Luo, Danfeng; Sun, Chaoyang; Wang, Changyu; Zhou, Bo; Li, Na; Xia, Meng; Lu, Hao; Meng, Li; Xu, Xiaoyan; Hu, Junbo; Ma, Ding; Chen, Gang; Zhu, Tao

    2016-01-01

    Approximately 50-75% of patients with serous ovarian carcinoma (SOC) experience recurrence within 18 months after first-line treatment. Current clinical indicators are inadequate for predicting the risk of recurrence. In this study, we used 7 publicly available microarray datasets to identify gene signatures related to recurrence in optimally debulked SOC patients, and validated their expressions in an independent clinic cohort of 127 patients using immunohistochemistry (IHC). We identified a two-gene signature including KCNN4 and S100A14 which was related to recurrence in optimally debulked SOC patients. Their mRNA expression levels were positively correlated and regulated by DNA copy number alterations (CNA) (KCNN4: p=1.918e-05) and DNA promotermethylation (KCNN4: p=0.0179; S100A14: p=2.787e-13). Recurrence prediction models built in the TCGA dataset based on KCNN4 and S100A14 individually and in combination showed good prediction performance in the other 6 datasets (AUC:0.5442-0.9524). The independent cohort supported the expression difference between SOC recurrences. Also, a KCNN4 and S100A14-centered protein interaction subnetwork was built from the STRING database, and the shortest regulation path between them, called the KCNN4-UBA52-KLF4-S100A14 axis, was identified. This discovery might facilitate individualized treatment of SOC. PMID:27270322

  9. Measurement of J/psi production in continuum e(+)e(-) annihilations near square root of s = 10.6 GeV.

    PubMed

    Aubert, B; Boutigny, D; Gaillard, J M; Hicheur, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Palano, A; Chen, G P; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Reinertsen, P L; Stugu, B; Abbott, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Clark, A R; Fan, Q; Gill, M S; Gritsan, A; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kluth, S; Kolomensky, Y G; Kral, J F; LeClerc, C; Levi, M E; Liu, T; Lynch, G; Meyer, A B; Momayezi, M; Oddone, P J; Perazzo, A; Pripstein, M; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Bright-Thomas, P G; Harrison, T J; Hawkes, C M; Kirk, A; Knowles, D J; O'Neale, S W; Penny, R C; Watson, A T; Watson, N K; Deppermann, T; Goetzen, K; Koch, H; Krug, J; Kunze, M; Lewandowski, B; Peters, K; Schmuecker, H; Steinke, M; Andress, J C; Barlow, N R; Bhimji, W; Chevalier, N; Clark, P J; Cottingham, W N; De Groot, N; Dyce, N; Foster, B; Mass, A; McFall, J D; Wallom, D; Wilson, F F; Abe, K; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Camanzi, B; Jolly, S; McKemey, A K; Tinslay, J; Blinov, V E; Bukin, A D; Bukin, D A; Buzykaev, A R; Dubrovin, M S; Golubev, V B; Ivanchenko, V N; Korol, A A; Kravchenko, E A; Onuchin, A P; Salnikov, A A; Serednyakov, S I; Skovpen, Y I; Telnov, V I; Yushkov, A N; Best, D; Lankford, A J; Mandelkern, M; McMahon, S; Stoker, D P; Ahsan, A; Arisaka, K; Buchanan, C; Chun, S; Branson, J G; MacFarlane, D B; Prell, S; Rahatlou, S; Raven, G; Sharma, V; Campagnari, C; Dahmes, B; Hart, P A; Kuznetsova, N; Levy, S L; Long, O; Lu, A; Richman, J D; Verkerke, W; Witherell, M; Yellin, S; Beringer, J; Dorfan, D E; Eisner, A M; Frey, A; Grillo, A A; Grothe, M; Heusch, C A; Johnson, R P; Kroeger, W; Lockman, W S; Pulliam, T; Sadrozinski, H; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Turri, M; Walkowiak, W; Williams, D C; Wilson, M G; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Metzler, S; Oyang, J; Porter, F C; Ryd, A; Samuel, A; Weaver, M; Yang, S; Zhu, R Y; Devmal, S; Geld, T L; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Bloom, P; Dima, M O; Fahey, S; Ford, W T; Gaede, F; Johnson, D R; Michael, A K; Nauenberg, U; Olivas, A; Park, H; Rankin, P; Roy, J; Sen, S; Smith, J G; van Hoek, W C; Wagner, D L; Blouw, J; Harton, J L; Krishnamurthy, M; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Brandt, T; Brose, J; Colberg, T; Dahlinger, G; Dickopp, M; Dubitzky, R S; Maly, E; Müller-Pfefferkorn, R; Otto, S; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Behr, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Ferrag, S; Roussot, E; T'Jampens, S; Thiebaux, C; Vasileiadis, G; Verderi, M; Anjomshoaa, A; Bernet, R; Khan, A; Muheim, F; Playfer, S; Swain, J E; Falbo, M; Borean, C; Bozzi, C; Dittongo, S; Folegani, M; Piemontese, L; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Xie, Y; Zallo, A; Bagnasco, S; Buzzo, A; Contri, R; Crosetti, G; Fabbricatore, P; Farinon, S; Lo Vetere, M; Macri, M; Monge, M R; Musenich, R; Pallavicini, M; Parodi, R; Passaggio, S; Pastore, F C; Patrignani, C; Pia, M G; Priano, C; Robutti, E; Santroni, A; Morii, M; Bartoldus, R; Dignan, T; Hamilton, R; Mallik, U; Cochran, J; Crawley, H B; Fischer, P A; Lamsa, J; Meyer, W T; Rosenberg, E I; Benkebil, M; Grosdidier, G; Hast, C; Höcker, A; Lacker, H M; Lepeltier, V; Lutz, A M; Plaszczynski, S; Schune, M H; Trincaz-Duvoid, S; Valassi, A; Wormser, G; Bionta, R M; Brigljević, V; Fackler, O; Fujino, D; Lange, D J; Mugge, M; Shi, X; van Bibber, K; Wenaus, T J; Wright, D M; Wuest, C R; Carroll, M; Fry, J R; Gabathuler, E; Gamet, R; George, M; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Aspinwall, M L; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gunawardane, N J; Martin, R; Nash, J A; Sanders, P; Smith, D; Azzopardi, D E; Back, J J; Dixon, P; Harrison, P F; Potter, R J; Shorthouse, H W; Strother, P; Vidal, P B; Williams, M I; Cowan, G; George, S; Green, M G; Kurup, A; Marker, C E; McGrath, P; McMahon, T R; Ricciardi, S; Salvatore, F; Scott, I; Vaitsas, G; Brown, D; Davis, C L; Allison, J; Barlow, R J; Boyd, J T; Forti, A C; Fullwood, J; Jackson, F; Lafferty, G D; Savvas, N; Simopoulos, E T; Weatherall, J H; Farbin, A; Jawahery, A; Lillard, V; Olsen, J; Roberts, D A; Schieck, J R; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Lin, C S; Moore, T B; Staengle, H; Willocq, S; Wittlin, J; Brau, B; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Britton, D I; Milek, M; Patel, P M; Trischuk, J; Lanni, F; Palombo, F; Bauer, J M; Booke, M; Cremaldi, L; Eschenburg, V; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Martin, J P; Nief, J Y; Seitz, R; Taras, P; Zacek, V; Nicholson, H; Sutton, C S; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; LoSecco, J M; Alsmiller, J R; Gabriel, T A; Handler, T; Brau, J; Frey, R; Iwasaki, M; Sinev, N B; Strom, D; Colecchia, F; Dal Corso, F; Dorigo, A; Galeazzi, F; Margoni, M; Michelon, G; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Torassa, E; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de la Vaissière, C; Del Buono, L; Hamon, O; Le Diberder, F; Leruste, P; Lory, J; Roos, L; Stark, J; Versillé, S; Manfredi, P F; Re, V; Speziali, V; Frank, E D; Gladney, L; Guo, Q H; Panetta, J H; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Simi, G; Triggiani, G; Walsh, J; Haire, M; Judd, D; Paick, K; Turnbull, L; Wagoner, D E; Albert, J; Bula, C; Elmer, P; Lu, C; McDonald, K T; Miftakov, V; Schaffner, S F; Smith, A J; Tumanov, A; Varnes, E W; Cavoto, G; del Re, D; Faccini, R; Ferrarotto, F; Ferroni, F; Fratini, K; Lamanna, E; Leonardi, E; Mazzoni, M A; Morganti, S; Piredda, G; Safai Tehrani, F; Serra, M; Voena, C; Christ, S; Waldi, R; Adye, T; Franek, B; Geddes, N I; Gopal, G P; Xella, S M; Aleksan, R; De Domenico, G; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P F; Hamel de Monchenault, G; Kozanecki, W; Langer, M; London, G W; Mayer, B; Serfass, B; Vasseur, G; Yèche, C; Zito, M; Copty, N; Purohit, M V; Singh, H; Yumiceva, F X; Adam, I; Anthony, P L; Aston, D; Baird, K; Bloom, E; Boyarski, A M; Bulos, F; Calderini, G; Claus, R; Convery, M R; Coupal, D P; Coward, D H; Dorfan, J; Doser, M; Dunwoodie, W; Field, R C; Glanzman, T; Godfrey, G L; Gowdy, S J; Grosso, P; Himel, T; Huffer, M E; Innes, W R; Jessop, C P; Kelsey, M H; Kim, P; Kocian, M L; Langenegger, U; Leith, D W; Luitz, S; Luth, V; Lynch, H L; Manzin, G; Marsiske, H; Menke, S; Messner, R; Moffeit, K C; Mount, R; Muller, D R; O'Grady, C P; Perl, M; Petrak, S; Quinn, H; Ratcliff, B N; Robertson, S H; Rochester, L S; Roodman, A; Schietinger, T; Schindler, R H; Schwiening, J; Serbo, V V; Snyder, A; Soha, A; Spanier, S M; Stahl, A; Stelzer, J; Su, D; Sullivan, M K; Talby, M; Tanaka, H A; Trunov, A; Va'vra, J; Wagner, S R; Weinstein, A J; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Cheng, C H; Kirkby, D; Meyer, T I; Roat, C; Henderson, R; Bugg, W; Cohn, H; Hart, E; Weidemann, A W; Benninger, T; Izen, J M; Kitayama, I; Lou, X C; Turcotte, M; Bianchi, F; Bona, M; Di Girolamo, B; Gamba, D; Smol, A; Zanin, D; Lanceri, L; Pompili, A; Vaugin, G; Panvini, R S; Brown, C M; De Silva, A; Kowalewski, R; Roney, J M; Band, H R; Charles, E; Dasu, S; Di Lodovico, F; Eichenbaum, A M; Hu, H; Johnson, J R; Liu, R; Nielsen, J; Orejudos, W; Pan, Y; Prepost, R; Scott, I J; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, S L; Yu, Z; Zobernig, H; Kordich, T M; Neal, H

    2001-10-15

    The production of J/psi mesons in continuum e(+)e(-) annihilations has been studied with the BABAR detector at energies near the Upsilon(4S) resonance. The mesons are distinguished from J/psi production in B decays through their center-of-mass momentum and energy. We measure the cross section e(+)e(-)-->J/psi X to be 2.52+/-0.21+/-0.21 pb. We set a 90% C.L. upper limit on the branching fraction for direct Upsilon(4S)-->J/psi X decays at 4.7 x 10(-4).

  10. Effects of peritoneal fluid from endometriosis patients on interferon-gamma-induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells.

    PubMed

    Kim, Ji-Yeon; Lee, Dong-Hyung; Joo, Jong-Kil; Jin, Jun-O; Wang, Ji-Won; Hong, Young-Seoub; Kwak, Jong-Young; Lee, Kyu-Sup

    2009-09-01

    Intraperitoneal immuno-inflammatory changes may be associated with the pathogenesis of endometriosis. We evaluated the effects of peritoneal fluid obtained from patients with endometriosis (ePF) on the release of interferon-gamma-induced protein-10 (IP-10/CXCL10) and interleukin-8 (IL-8/CXCL8) by neutrophils, CD4(+) T cells, and monocytes. Neutrophils, CD4(+) T cells, and monocytes were cultured with ePF and the chemokine levels in the supernatants were then measured using enzyme-linked immunosorbent assay. The addition of ePF to cultures of CD4(+) T cells led to a significant increase in the release of IP-10 when compared with control PF without endometriosis (cPF). There was a positive correlation between the levels of IL-8 and IP-10 in ePF (R = 0.89, P = 0.041), but not between the levels of IP-10 and IL-8 released by neutrophils, CD4(+) T cells, and monocytes. The levels of IP-10 in ePF were positively correlated with the release of IP-10 by ePF-treated neutrophils (R = 0.89, P < 0.001), CD4(+) T cells (R = 0.93, P < 0.001), and monocytes (R = 0.70, P = 0.01). Moreover, the addition of ePF significantly enhanced the interferon-gamma-induced release of IP-10 by nuetrophils and CD4(+) T cells. These findings suggest that neutrophils and T cells release differential levels of IP-10 and IL-8 in response to stimulation with ePF, and that these cells are a major source of IP-10 in the PF of endometriosis patients.

  11. The abundance of 28Si32S, 29Si32S, 28Si34S, and 30Si32S in the inner layers of the envelope of IRC+10216.

    PubMed

    Fonfría, J P; Cernicharo, J; Richter, M J; Fernández-López, M; Prieto, L Velilla; Lacy, J H

    2015-08-13

    We present high spectral resolution mid-IR observations of SiS towards the C-rich AGB star IRC+10216 carried out with the Texas Echelon-cross-Echelle Spectrograph mounted on the NASA Infrared Telescope Facility. We have identified 204 ro-vibrational lines of 28 Si 32 S, 26 of 29 Si 32 S, 20 of 28 Si 34 S, and 15 of 30 Si 32 S in the frequency range 720 - 790 cm -1 . These lines belong to bands v = 1 - 0, 2 - 1, 3 - 2, 4-3, and 5-4, and involve rotational levels with J low ≲ 90. About 30 per cent of these lines are unblended or weakly blended and can be partially or entirely fitted with a code developed to model the mid-IR emission of a spherically symmetric circumstellar envelope composed of expanding gas and dust. The observed lines trace the envelope at distances to the star ≲ 35 R ⋆ (≃ 0″.7). The fits are compatible with an expansion velocity of 1+2.5( r / R ⋆ -1) km s -1 between 1 and 5 R ⋆ , 11 km s -1 between 5 and 20 R ⋆ , and 14.5 km s -1 outwards. The derived abundance profile of 28 Si 32 S with respect to H 2 is 4.9 × 10 -6 between the stellar photosphere and 5 R ⋆ , decreasing linearly down to 1.6 × 10 -6 at 20 R ⋆ and to 1.3 × 10 -6 at 50 R ⋆ . 28 Si 32 S seems to be rotationally under LTE in the region of the envelope probed with our observations and vibrationally out of LTE in most of it. There is a red-shifted emission excess in the 28 Si 32 S lines of band v = 1 - 0 that cannot be found in the lines of bands v = 2 - 1, 3 - 2, 4 - 3, and 5 - 4. This excess could be explained by an enhancement of the vibrational temperature around 20 R ⋆ behind the star. The derived isotopic ratios 28 Si/ 29 Si, and 32 S/ 34 S are 17 and 14, compatible with previous estimates.

  12. Cryogenic Refractive Indices of S-LAH55, S-LAH55V, S-LAH59, S-LAM3, S-NBM51, S-NPH2, S-PHM52, and S-TIH14 Glasses

    NASA Technical Reports Server (NTRS)

    Miller, Kevin H.; Quijada, Manuel A.; Leviton, Doug

    2015-01-01

    The Transiting Exoplanet Survey Satellite (TESS) is an explorer-class planet finder, whose principal goal is to detect small planets with bright host starts in the solar neighborhood. The TESS payload consists of four identical cameras with seven optical elements each that include various types of Ohara glass substrates. The successful implementation both panchromatic and thermal lens assembly designs for these cameras requires a fairly accurate (up to 1E-6) knowledge of the temperature and wavelength dependence of the refractive index in the wavelength and temperature range of operation. Hence, this paper is devoted to report on measurements of the refractive index over the wavelength range of 0.42-1.15 um and temperature range of 110-310 K for the following Ohara glasses: S-LAH55, S-LAH55V, SLAH59, S-LAM3, S-NBM51, S-NPH2, S-PHM52, and S-TIH14. The measurements were performed utilizing the Cryogenic High Accuracy Refraction Measuring System (CHARMS) facility at NASA's Goddard Space Flight Center. A dense coverage of the absolute refractive index for the title substrates in the aforementioned wavelength and temperature ranges was used to determine the thermo-optic coefficient (dn/dT) and dispersion relation (dn/d lambda) as a function of wavelength and temperature. A comparison of the measured indices with literature values, specifically the temperature-dependent refractive indices of S-PHM52 and S-TIH14, will be presented.

  13. U.S., U.S.S.R. Marine Expedition

    NASA Astrophysics Data System (ADS)

    Wainger, Lisa A.

    An historic expedition involving U.S. and U.S.S.R. scientists may open a new era of cooperation in marine research. A University of California, San Diego/Scripps Institution of Oceanography ship carrying a team that includes two Soviet scientists is on an expedition that will take the R/V Thomas Washington into the Exclusive Economic Zone (EEZ) of the U.S.S.R. For the first time in a decade a U.S. research vessel has been given permission to operate in the Soviet Union's EEZ, according to Department of State representative Tom Cocke, who worked with Scripps on this project. The ship will also operate in the U.S. EEZ and international waters.

  14. Project W.A.T.E.R.

    ERIC Educational Resources Information Center

    EnviroTeach, 1992

    1992-01-01

    Introduces networking projects for studying rivers and water quality. Describes two projects in South Africa (Project W.A.T.E.R and SWAP) associated with the international network, Global Rivers Environmental Education Network. Discusses water test kits and educational material developed through Project W.A.T.E.R. (Water Awareness through…

  15. 19. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. SACATON DAM AND BRIDGE, CANAL BRIDGE, OPERATING HOUSE AND INTAKE, SOUTH END, 2/14/25 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  16. Mesostructured Metal Germanium Sulfide and Selenide Materials Based on the Tetrahedral [Ge 4S 10] 4- and [Ge 4Se 10] 4- Units: Surfactant Templated Three-Dimensional Disordered Frameworks Perforated with Worm Holes

    NASA Astrophysics Data System (ADS)

    Wachhold, Michael; Kasthuri Rangan, K.; Lei, Ming; Thorpe, M. F.; Billinge, Simon J. L.; Petkov, Valeri; Heising, Joy; Kanatzidis, Mercouri G.

    2000-06-01

    The polymerization of [Ge4S10]4- and [Ge4Se10]4- unit clusters with the divalent metal ions Zn2+, Cd2+, Hg2+, Ni2+, and Co2+ in the presence of various surfactant cations leads to novel mesostructured phases. The surfactants are the quaternary ammonium salts C12H25NMe3Br, C14H29NMe3Br, C16H33NMe3Br, and C18H37NMe3Br, which play the role of templates, helping to assemble a three-dimensional mesostructured metal-germanium chalcogenide framework. These materials are stoichiometric in nature and have the formula of (R-NMe3)2[MGe4Q10] (Q=S, Se). The local atomic structure was probed by X-ray diffuse scattering and pair distribution function analysis methods and indicates that the adamantane clusters stay intact while the linking metal atoms possess a tetrahedral coordination environment. A model can be derived, from the comparison of measured and simulated X-ray powder diffraction patterns, describing the structure as an amorphous three-dimensional framework consisting of adamantane [Ge4Q10]4- units that are bridged by tetrahedral coordinated M2+ cations. The network structures used in the simulations were derived from corresponding disordered structures developed for amorphous silicon. The frameworks in (R-NMe3)2[MGe4Q10] are perforated with worm hole-like tunnels, occupied by the surfactant cations, which show no long-range order. This motif is supported by transmission electron microscopy images of these materials. The pore sizes of these channels were estimated to lie in the range of 20-30 Å, depending on the appointed surfactant cation length. The framework wall thickness of ca. 10 Å is thereby independent from the surfactant molecules used. Up to 80% of the surfactant molecules can be removed by thermal degradation under vacuum without loss of mesostructural integrity. Physical, chemical, and spectroscopic properties of these materials are discussed.

  17. A Major Upgrade of the H.E.S.S. Cherenkov Cameras

    NASA Astrophysics Data System (ADS)

    Lypova, Iryna; Giavitto, Gianluca; Ashton, Terry; Balzer, Arnim; Berge, David; Brun, Francois; Chaminade, Thomas; Delagnes, Eric; Fontaine, Gerard; Füßling, Matthias; Giebels, Berrie; Glicenstein, Jean-Francois; Gräber, Tobias; Hinton, Jim; Jahnke, Albert; Klepser, Stefan; Kossatz, Marko; Kretzschmann, Axel; Lefranc, Valentin; Leich, Holger; Lüdecke, Hartmut; Manigot, Pascal; Marandon, Vincent; Moulin, Emmanuel; de Naurois, Mathieu; Nayman, Patrick; Ohm, Stefan; Penno, Marek; Ross, Duncan; Salek, David; Schade, Markus; Schwab, Thomas; Simoni, Rachel; Stegmann, Christian; Steppa, Constantin; Thornhill, Julian; Toussnel, Francois

    2017-03-01

    The High Energy Stereoscopic System (H.E.S.S.) is an array of imaging atmospheric Cherenkov telescopes (IACTs) located in Namibia. It was built to detect Very High Energy (VHE, >100 GeV) cosmic gamma rays, and consists of four 12 m diameter Cherenkov telescopes (CT1-4), built in 2003, and a larger 28 m telescope (CT5), built in 2012. The larger mirror surface of CT5 permits to lower the energy threshold of the array down to 30 GeV. The cameras of CT1-4 are currently undergoing an extensive upgrade, with the goals of reducing their failure rate, reducing their readout dead time and improving the overall performance of the array. The entire camera electronics has been renewed from ground-up, as well as the power, ventilation and pneumatics systems, and the control and data acquisition software. Technical solutions forseen for the next-generation Cherenkov Telescope Array (CTA) observatory have been introduced, most notably the readout is based on the NECTAr analog memory chip. The camera control subsystems and the control software framework also pursue an innovative design, increasing the camera performance, robustness and flexibility. The CT1 camera has been upgraded in July 2015 and is currently taking data; CT2-4 will upgraded in Fall 2016. Together they will assure continuous operation of H.E.S.S at its full sensitivity until and possibly beyond the advent of CTA. This contribution describes the design, the testing and the in-lab and on-site performance of all components of the newly upgraded H.E.S.S. camera.

  18. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  19. Singlet oxygenation of 1,2-poly/1,4-hexadiene/s

    NASA Technical Reports Server (NTRS)

    Golub, M. A.; Rosenberg, M. L.; Gemmer, R. V.

    1979-01-01

    The microstructural changes that occur in cis and trans forms of 1,2-poly(1,4-hexadiene) during methylene blue-photosensitized oxidation were examined by infrared and (C-13)-NMR spectroscopy. The singlet oxygenation of these polymers yielded the expected allylic hydroperoxides accompanied by double bond shifts to new vinyl and trans-vinylene double bonds. The photosensitized oxidation exhibited zero-order kinetics; the relative rates for the cis- and trans-1,2-poly(1,4-hexadiene)s were approximately 3.8:1.0.

  20. 75 FR 41237 - Public Land Order No. 7746; Withdrawal of Public Lands, South Fork of the American River; California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-15

    ... the American River: Mount Diablo Meridian T. 11 N., R. 9 E., Sec. 10, NW\\1/4\\NW\\1/4\\ and S\\1/2\\; Sec...\\,SW\\1/4\\, and SE\\1/4\\; Sec. 32, N\\1/2\\NE\\1/4\\, SW\\1/4\\NE\\1/4\\, W\\1/2\\, and S\\1/2\\SE\\1/ 4\\. T. 11 N., R. 10 E., Sec. 18, lots 5, 6, and 7, and NW\\1/4\\NE\\1/4\\NW\\1/4\\; Sec. 22, NW\\1/4\\SE\\1/4\\SW\\1/4\\, and that...

  1. Structure and binding energy of the H2S dimer at the CCSD(T) complete basis set limit.

    PubMed

    Lemke, Kono H

    2017-06-21

    This study presents results for the binding energy and geometry of the H 2 S dimer which have been computed using Møller-Plesset perturbation theory (MP2, MP4) and coupled cluster (CCSD, CCSD(T)) calculations with basis sets up to aug-cc-pV5Z. Estimates of D e , E ZPE , D o , and dimer geometry have been obtained at each level of theory by taking advantage of the systematic convergence behavior toward the complete basis set (CBS) limit. The CBS limit binding energy values of D e are 1.91 (MP2), 1.75 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD[T]). The most accurate values for the equilibrium S-S distance r SS (without counterpoise correction) are 4.080 (MP2/aug-cc-pV5Z), 4.131 (MP4/aug-cc-pVQZ), 4.225 (CCSD/aug-cc-pVQZ), and 4.146 Å (CCSD(T)/aug-cc-pVQZ). This study also evaluates the effect of counterpoise correction on the H 2 S dimer geometry and binding energy. As regards the structure of (H 2 S) 2 , MPn, CCSD, and CCSD(T) level values of r SS , obtained by performing geometry optimizations on the counterpoise-corrected potential energy surface, converge systematically to CBS limit values of 4.099 (MP2), 4.146 (MP4), 4.233 (CCSD), and 4.167 Å (CCSD(T)). The corresponding CBS limit values of the equilibrium binding energy D e are 1.88 (MP2), 1.76 (MP4), 1.41 (CCSD), and 1.69 kcal/mol (CCSD(T)), the latter in excellent agreement with the measured binding energy value of 1.68 ± 0.02 kcal/mol reported by Ciaffoni et al. [Appl. Phys. B 92, 627 (2008)]. Combining CBS electronic binding energies D e with E ZPE predicted by CCSD(T) vibrational second-order perturbation theory calculations yields D o = 1.08 kcal/mol, which is around 0.6 kcal/mol smaller than the measured value of 1.7 ± 0.3 kcal/mol. Overall, the results presented here demonstrate that the application of high level calculations, in particular CCSD(T), in combination with augmented correlation consistent basis sets provides valuable insight into the structure and energetics of the hydrogen sulfide

  2. U.S. EPA, Pesticide Product Label, PYRE-MIST 3610, 05/21/1982

    EPA Pesticide Factsheets

    2011-04-14

    ... "fO~ 1'lf Cf.t C.I'; tt d~l;f.td .rth !,t,"fd "t~~t!tS _"",tI tr.td f~· ~ J ... _ .... CII.1$ ~.1'f Gf ff'flO'.t fl~R4 food ~f14 bxlr..aa..;;,& s.,;rt,f:{H C::.r !xt:I .rlJ stl"t lift .11111 ...

  3. Synthesis and Pharmacological Characterization of C4-(Thiotriazolyl)-substituted-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylates. Identification of (1R,2S,4R,5R,6R)-2-Amino-4-(1H-1,2,4-triazol-3-ylsulfanyl)bicyclo[3.1.0]hexane-2,6-dicarboxylic Acid (LY2812223), a Highly Potent, Functionally Selective mGlu2 Receptor Agonist.

    PubMed

    Monn, James A; Prieto, Lourdes; Taboada, Lorena; Hao, Junliang; Reinhard, Matthew R; Henry, Steven S; Beadle, Christopher D; Walton, Lesley; Man, Teresa; Rudyk, Helene; Clark, Barry; Tupper, David; Baker, S Richard; Lamas, Carlos; Montero, Carlos; Marcos, Alicia; Blanco, Jaime; Bures, Mark; Clawson, David K; Atwell, Shane; Lu, Frances; Wang, Jing; Russell, Marijane; Heinz, Beverly A; Wang, Xushan; Carter, Joan H; Getman, Brian G; Catlow, John T; Swanson, Steven; Johnson, Bryan G; Shaw, David B; McKinzie, David L

    2015-09-24

    Identification of orthosteric mGlu(2/3) receptor agonists capable of discriminating between individual mGlu2 and mGlu3 subtypes has been highly challenging owing to the glutamate-site sequence homology between these proteins. Herein we detail the preparation and characterization of a series of molecules related to (1S,2S,5R,6S)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylate 1 (LY354740) bearing C4-thiotriazole substituents. On the basis of second messenger responses in cells expressing other recombinant human mGlu2/3 subtypes, a number of high potency and efficacy mGlu2 receptor agonists exhibiting low potency mGlu3 partial agonist/antagonist activity were identified. From this, (1R,2S,4R,5R,6R)-2-amino-4-(1H-1,2,4-triazol-3-ylsulfanyl)bicyclo[3.1.0]hexane-2,6-dicarboxylic acid 14a (LY2812223) was further characterized. Cocrystallization of 14a with the amino terminal domains of hmGlu2 and hmGlu3 combined with site-directed mutation studies has clarified the underlying molecular basis of this unique pharmacology. Evaluation of 14a in a rat model responsive to mGlu2 receptor activation coupled with a measure of central drug disposition provides evidence that this molecule engages and activates central mGlu2 receptors in vivo.

  4. Observation of an enhancement in e{sup +}e{sup -}{yields}{Upsilon}(1S){pi}{sup +}{pi}{sup -}, {Upsilon}(2S){pi}{sup +}{pi}{sup -}, and {Upsilon}(3S){pi}{sup +}{pi}{sup -} production near {radical}(s)=10.89 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, K.-F.; Hou, W.-S.; Chang, P.

    2010-11-01

    We measure the production cross sections for e{sup +}e{sup -}{yields}{Upsilon}(1S){pi}{sup +}{pi}{sup -}, {Upsilon}(2S){pi}{sup +}{pi}{sup -}, and {Upsilon}(3S){pi}{sup +}{pi}{sup -} as a function of {radical}(s) between 10.83 GeV and 11.02 GeV. The data consist of 8.1 fb{sup -1} collected with the Belle detector at the KEKB e{sup +}e{sup -} collider. We observe enhanced production in all three final states that does not agree well with the conventional {Upsilon}(10860) line shape. A fit using a Breit-Wigner resonance shape yields a peak mass of [10 888.4{sub -2.6}{sup +2.7}(stat){+-}1.2(syst)] MeV/c{sup 2} and a width of [30.7{sub -7.0}{sup +8.3}(stat){+-}3.1(syst)] MeV/c{sup 2}.

  5. Discriminative Stimulus Effects of Psychostimulants and Hallucinogens in S(+)-3,4-Methylenedioxymethamphetamine (MDMA) and R(−)-MDMA Trained Mice

    PubMed Central

    Murnane, K. S.; Murai, N.; Howell, L. L.

    2009-01-01

    3,4-Methylenedioxymethamphetamine (MDMA) is a substituted phenethylamine more commonly known as the drug of abuse “ecstasy.” The acute and persistent neurochemical effects of MDMA in the mice are distinct from those in other species. MDMA shares biological effects with both amphetamine-type stimulants and mescaline-type hallucinogens, which may be attributable to distinct effects of its two enantiomers, both of which are active in vivo. In this regard, among the substituted phenethylamines, R(−)-enantiomers tend to have hallucinogen-like effects, whereas S(+)-enantiomers tend to have stimulant-like effects. In the present study, mice were trained to discriminate S(+)- or R(−)-MDMA from vehicle. Drug substitution tests were then undertaken with the structurally similar phenethylamine dopamine/norepinephrine releaser S(+)-amphetamine, the structurally dissimilar tropane nonselective monoamine reuptake inhibitor cocaine, the structurally similar phenethylamine 5-hydroxytryptamine (5-HT)2A agonist 2,5-dimethoxy-4-(n)-propylthiophenethylamine (2C-T-7), and the structurally dissimilar mixed action tryptamine 5-HT2A agonist/monoamine reuptake inhibitor N,N-dipropyltryptamine (DPT). S(+)-amphetamine fully substituted in the S(+)-MDMA-treated animals but did not substitute for the R(−)-MDMA cue. 2C-T-7 fully substituted in the R(−)-MDMA-trained animals but did not substitute for the S(+)-MDMA cue. Cocaine and DPT substituted for both training drugs, but whereas cocaine was more potent in S(+)-MDMA-trained mice, DPT was more potent in R(−)-MDMA-trained mice. These data suggest that qualitative differences in the discriminative stimulus effects of each stereoisomer of MDMA exist in mice and further our understanding of the complex nature of the interoceptive effects of MDMA. PMID:19684254

  6. Novel variants of the 5S rRNA genes in Eruca sativa.

    PubMed

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Pressure-induced phase transitions in the CdC r2S e4 spinel

    NASA Astrophysics Data System (ADS)

    Efthimiopoulos, I.; Liu, Z. T. Y.; Kucway, M.; Khare, S. V.; Sarin, P.; Tsurkan, V.; Loidl, A.; Wang, Y.

    2016-11-01

    We have conducted high-pressure x-ray diffraction and Raman spectroscopic studies on the CdC r2S e4 spinel at room temperature up to 42 GPa. We have resolved three structural transitions up to 42 GPa, i.e., the starting F d 3 ¯m phase transforms at ˜11 GPa into a tetragonal I 41/a m d structure, an orthorhombic distortion was observed at ˜15 GPa , whereas structural disorder initiates beyond 25 GPa. Our ab initio density functional theory studies successfully reproduced the observed crystalline-to-crystalline structural transitions. In addition, our calculations propose an antiferromagnetic ordering as a potential magnetic ground state for the high-pressure tetragonal and orthorhombic modifications, compared with the starting ferromagnetic phase. Furthermore, the computational results indicate that all phases remain insulating in their stability pressure range, with a direct-to-indirect band gap transition for the F d 3 ¯m phase taking place at 5 GPa. We attempted also to offer an explanation behind the peculiar first-order character of the F d 3 ¯m (cubic ) →I 41/a m d (tetragonal) transition observed for several relevant Cr spinels, i.e., the sizeable volume change at the transition point, which is not expected from space group symmetry considerations. We detected a clear correlation between the cubic-tetragonal transition pressures and the next-nearest-neighbor magnetic exchange interactions for the Cr-bearing sulfide and selenide members, a strong indication that the cubic-tetragonal transitions in these systems are principally governed by magnetic effects.

  8. ATLAS Mission Planner’s Guide for the ATLAS Launch Vehicle Family. Revision 3

    DTIC Science & Technology

    1992-04-01

    000 oIgo lat -. o 0 14o, 0 1 a Eta IU -~a..---.. c - 6j0 t 4 - 1 I 4 IILI - K- 0 ’fiuue 8-. 1 i peaf imivjiom activvem at wacecimat sqwtiom. 0b1...unwt supcnede #.he Mis~fm Pbnnr’s Gudec &W th&e Aas Launch Whak Family - Revison 2.w JOiY 1990 Appnwed by: Deonaia R. Ikuiha Bn) Vk~Ptcsidcnt % 1 "Pce...ac totio n A r i wo v al 21 March 1999 1 10 July 90 2 April 1992 3- 1 *Section 2 is a complete update of Vehicle performanceI Secion 3 mujor updates

  9. Scale invariance of the η-deformed AdS 5 × S 5 superstring, T-duality and modified type II equations

    DOE PAGES

    Arutyunov, G.; Frolov, S.; Hoare, B.; ...

    2015-12-23

    We consider the ABF background underlying the η-deformed AdS 5 × S 5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that hasmore » 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R–R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R–R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS 3 × S 3 × T 4 and AdS 2 × S 2 × T 6 models.« less

  10. Canada’s First National Interoperability Baseline Assessment: CPRC 91052 Project Study

    DTIC Science & Technology

    2012-03-01

    Time and Leadership. 33 Y on ge S t ., S ui te 4 20 , T or on to , O nt ar io C an ad a, M 5E 1 G 4 #91052 T A B L E O F C O N T E N T ...28  Essential Guidance 30   #91052 L I S T O F F I G U R E S P 1 Demographics...30 #91052 1 I N T H I S S T U D Y M e t h o d o l o g y This study was based on a web survey of 105

  11. Blood-C.S.F. barriers dysfunction in the chronic organic brain syndrome; a R.I.A. study.

    PubMed

    Vardi, Y; Czerniak, P; Rabey, Y; Flechter, S; Boruchowsky, S; Streifler, M

    1978-01-01

    C.S.F. samples of 35 patients, who suffered from verified chronic, non-tumorous organic brain syndrome, were radioimmunoassayed for T4 and T.S.H., and were compared to C.S.F.-R.I.A. samples from a control group of patients who underwent myelography because of lumbar disc. In addition T4 and T.S.H. plasma levels were evaluated in the O.B.S. patients. C.S.F. T4 and T.S.H. levels were significantly higher in 65% of the O.B.S. group of patients than those of the control group. The average determinations for T4 were: 0.77 muh/100 ml in O.B.S. group as against 0--0.4 micrograms/100 ml in the C.S.F.'s of the control group. P greater than 0,001 T.S.H. C.S.F. levels were 1.33 microU/ml in the O.B.S. group, and 0--0.6 microU/ml in the control group (P greater than 0.005). It is suggested that the elevated R.I.A. values of these hormones in the C.S.F. of the O.B.S. patients reflect a disruption of blood-C.S.F. barriers. Therefore in the organic brain syndrome there seems to exist a pathophysiological dysfunction of brain barriers in addition of the neural damage.

  12. Light harvesting and charge management by Ni4S3 modified metal-organic frameworks and rGO in the process of photocatalysis.

    PubMed

    Liu, Duanduan; Jin, Zhiliang; Zhang, Yongke; Wang, Guorong; Ma, Bingzhen

    2018-06-01

    Harvesting and charge management is obtained by means of Ni 4 S 3 modified Metal-organic Frameworks (MOF) and rGO, namely, the Uio-66 (Zr)/rGO combined with Ni 4 S 3 photocatalyst was successfully prepared with the solvothermal method. The Ni 4 S 3 acted as the electron transfer agent greatly improve the electrons transmission from the excited state dye to the rGO/MOF surface for proton reduction reaction. The hydrogen production amount over EY-sensitized rGO/MOF/Ni 4 S 3 photocatalyst has reached 280 μmol for 5 h, which is about 14 times than that of the pure Ni 4 S 3 photocatalyst and 185 times than that of the pure rGO/MOF photocatalyst under visible light irradiation (λ ≥ 420 nm). In the composite, the rGO acts as electron-transfer mediator and Ni 4 S 3 serves as H 2 -evolution active site. A series of studies shown that the Ni 4 S 3 modified MOF and rGO provided more active sites and improved the efficiency of photo-generated charge separation by means of several characterizations such as SEM, XRD, XPS, Element Mapping, UV-vis DRS, BET, Photocurrent, Voltammetric Scanning, Fluorescence Spectra and FTIR. and the results of which were in good agreement with each other. The photoelectron migration rate and photogenerated charge separation efficiency of the composite can be obviously increased with graphene as a good electron acceptor and transfer medium and Ni 4 S 3 as hydrogen producing active site. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. U.S. EPA, Pesticide Product Label, GEISLER DOG FLEA & TICK POWDER, 10/14/1972

    EPA Pesticide Factsheets

    2011-04-14

    ... ' ~ f' • • '.1" (. t .'. • ~ I ,. • ( II f;l'J :fl,; i ~ J', • 't. ; •. 1" ., P' , ;. ~ t' • d • : {1 ACTIVI I ~·iGf~[[)1 r r~ r (, f",',, INERl IriGR! lJl( fJ IS. "",' h['· ,1',1" • ~'e" ...

  14. Cryogenic Refractive Indices of S-LAH55, S-LAH55V, S-LAH59, S-LAM3, S-NBM51, S-NPH2, S-PHM52, and S-TIH14 Glasses

    NASA Technical Reports Server (NTRS)

    Miller, Kevin H.; Quijada, Manuel A.; Leviton, Douglas B.

    2015-01-01

    The Transiting Exoplanet Survey Satellite (TESS) is an explorer-class planet finder, whose principal goal is to detect small planets with bright host starts in the solar neighborhood. The TESS payload consists of four identical cameras and a Data Handling Unit (DHU) fitted with CCD detectors and associated electronics. Each camera consist of a lens assembly with seven optical elements that include various types of Ohara glass substrates. The successful implementation of a panchromatic and a thermal lens assembly design for these cameras requires a fairly accurate (up to 0.000001 (1e-6)) knowledge of the temperature- and wavelength-dependent of the refractive index in the wavelength and temperature range of operation. Hence, this paper is devoted to report on measurements of the refractive index over the wavelength range of 0.42-1.15 micrometers and temperature range of 110-300 K for the following Ohara glasses: S-LAH55, S-LAH55V, S-LAH59, S-LAM3, S-NBM51, S-NPH2, S-PHM52, and S-TIH14. The measurements were performed utilizing the Cryogenic High Accuracy Refraction Measuring System (CHARMS) facility at NASA's Goddard Space Flight Center. A dense coverage of the absolute refractive index for all these substrates in the aforementioned wavelength and temperature ranges was used to determine the thermo-optic coefficient (dndT) and dispersion relation (dnd) as a function of wavelength and temperature. A comparison of the measured indices with literature values, specifically the temperature-dependent refractive indices of S-PHM52 and S-TIH14 reported by Yamamuro et al. [Yamamuro et al., Opt. Eng. 45(8), 083401 (2006)], will be presented.

  15. Analysis of the right-handed Majorana neutrino mass in an S U (4S U (2 )L×S U (2 )R Pati-Salam model with democratic texture

    NASA Astrophysics Data System (ADS)

    Yang, Masaki J. S.

    2017-03-01

    In this paper, we attempt to build a unified model with the democratic texture, that has some unification between up-type Yukawa interactions Yν and Yu . Since the S3 L×S3 R flavor symmetry is chiral, the unified gauge group is assumed to be Pati-Salam type S U (4 )c×S U (2 )L×S U (2 )R. The breaking scheme of the flavor symmetry is considered to be S3 L×S3 R→S2 L×S2 R→0 . In this picture, the four-zero texture is desirable for realistic masses and mixings. This texture is realized by a specific representation for the second breaking of the S3 L×S3 R flavor symmetry. Assuming only renormalizable Yukawa interactions, type-I seesaw mechanism, and neglecting C P phases for simplicity, the right-handed neutrino mass matrix MR can be reconstructed from low energy input values. Numerical analysis shows that the texture of MR basically behaves like the "waterfall texture." Since MR tends to be the "cascade texture" in the democratic texture approach, a model with type-I seesaw and up-type Yukawa unification Yν≃Yu basically requires fine-tunings between parameters. Therefore, it seems to be more realistic to consider universal waterfall textures for both Yf and MR, e.g., by the radiative mass generation or the Froggatt-Nielsen mechanism. Moreover, analysis of eigenvalues shows that the lightest mass eigenvalue MR 1 is too light to achieve successful thermal leptogenesis. Although the resonant leptogenesis might be possible, it also requires fine-tunings of parameters.

  16. Can 100Gb/s wavelengths be deployed using 10Gb/s engineering rules?

    NASA Astrophysics Data System (ADS)

    Saunders, Ross; Nicholl, Gary; Wollenweber, Kevin; Schmidt, Ted

    2007-09-01

    A key challenge set by carriers for 40Gb/s deployments was that the 40Gb/s wavelengths should be deployable over existing 10Gb/s DWDM systems, using 10Gb/s link engineering design rules. Typical 10Gb/s link engineering rules are: 1. Polarization Mode Dispersion (PMD) tolerance of 10ps (mean); 2. Chromatic Dispersion (CD) tolerance of +/-700ps/nm 3. Operation at 50GHz channel spacing, including transit through multiple cascaded [R]OADMs; 4. Optical reach up to 2,000km. By using a combination of advanced modulation formats and adaptive dispersion compensation (technologies rarely seen at 10Gb/s outside of the submarine systems space), vendors did respond to the challenge and broadly met this requirement. As we now start to explore feasible technologies for 100Gb/s optical transport, driven by 100GE port availability on core IP routers, the carrier challenge remains the same. 100Gb/s links should be deployable over existing 10Gb/s DWDM systems using 10Gb/s link engineering rules (as listed above). To meet this challenge, optical transport technology must evolve to yet another level of complexity/maturity in both modulation formats and adaptive compensation techniques. Many clues as to how this might be achieved can be gained by first studying sister telecommunications industries, e.g. satellite (QPSK, QAM, LDCP FEC codes), wireless (advanced DSP, MSK), HDTV (TCM), etc. The optical industry is not a pioneer of new ideas in modulation schemes and coding theory, we will always be followers. However, we do have the responsibility of developing the highest capacity "modems" on the planet to carry the core backbone traffic of the Internet. As such, the key to our success will be to analyze the pros and cons of advanced modulation/coding techniques and balance this with the practical limitations of high speed electronics processing speed and the challenges of real world optical layer impairments. This invited paper will present a view on what advanced technologies are likely

  17. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  18. Census of U.S. Civil Aircraft. Calendar Year 1981.

    DTIC Science & Technology

    1981-12-31

    that for 1978. This increase is partly due to the deregulation of the airlines under the Airline Deregulation Act of 1978 and the associated entry of...4. - AIR t UCY 4 .. ... 4 . .. AIRLIFT ASSOCIATES 2 .. ... ... 2 - AIR Li K 1 ... - I - AIR LOwsTIcS OF ALASKA, IC 4 ... 4 ..... AIR NEV AIRLINES 10...VALLEY 14 ... .... 14 --- -- Mtotu CARIEA AIRWAYS 4 --- ..... 1 2 1 MOUNTAIN HOmE AIR SERVICE 5 --- --- ---. 3 2 --- PMNz NORTHERN AIRLINEs, INC 7

  19. Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

    2011-09-01

    The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid.

  20. Enantioselective separation and online affinity chromatographic characterization of R,R- and S,S-fenoterol.

    PubMed

    Beigi, Farideh; Bertucci, Carlo; Zhu, Weizhong; Chakir, Khalid; Wainer, Irving W; Xiao, Rui-Ping; Abernethy, Darrell R

    2006-11-01

    rac-Fenoterol is a beta2-adrenoceptor agonist (beta2-AR) used in the treatment of asthma. It has two chiral centers and is marketed as a racemic mixture of R,R'- and S,S'-fenoterol (R-F and S-F). Here we report the separation of the R-F and S-F enantiomers and the evaluation of their binding to and activation of the beta2-AR. R-F and S-F were separated from the enantiomeric mixture by chiral chromatography and absolute configuration determined by circular dichroism. Beta2-AR binding was evaluated using frontal affinity chromatography with a stationary phase containing immobilized membranes from HEK-293 cells that express human beta2-AR and standard membrane binding studies using the same membranes. The effect of R-F and S-F on cardiomyocyte contractility was also investigated using freshly isolated adult rat cardiomyocytes. Chiral chromatography of rac-fenoterol yielded separated peaks with an enantioselectivity factor of 1.21. The less retained peak was assigned the absolute configuration of S-F and the more retained peak R-F. Frontal chromatography using membrane-bound beta2-AR as the stationary phase and rac-3H-fenoterol as a marker ligand showed that addition of increasing concentrations of R-F to the mobile phase produced concentration-dependent decreases in rac-3H-fenoterol retention, while similar addition of S-F produced no change in rac-3H-fenoterol retention. The calculated dissociation constant of R-F was 472 nM and the number of available binding sites 176 pmol/column, which was consistent with the results from the membrane binding study 460 +/- 55 nM (R-F) and 109,000 +/- 10,400 nM (S-F). In the cardiomyocytes, R-F increased maximum contractile response from (265 +/- 11.6)% to (306 +/- 11.8)% of resting cell length (P < 0.05) and reduced EC50 from -7.0 +/- 0.270 to -7.1 +/- 0.2 log[M] (P < 0.05), while S-F had no significant effect. Previous studies have shown that rac-fenoterol acts as an apparent beta2-AR/G(s) selective agonist and fully restores

  1. The R.I.R.S. scoring system: An innovative scoring system for predicting stone-free rate following retrograde intrarenal surgery.

    PubMed

    Xiao, Yinglong; Li, Deng; Chen, Lei; Xu, Yaoting; Zhang, Dingguo; Shao, Yi; Lu, Jun

    2017-11-21

    To establish and internally validate an innovative R.I.R.S. scoring system that allows urologists to preoperatively estimate the stone-free rate (SFR) after retrograde intrarenal surgery (RIRS). This study included 382 eligible samples from a total 573 patients who underwent RIRS from January 2014 to December 2016. Four reproducible factors in the R.I.R.S. scoring system, including renal stone density, inferior pole stone, renal infundibular length and stone burden, were measured based on preoperative computed tomography of urography to evaluate the possibility of stone clearance after RIRS. The median cumulative diameter of the stones was 14 mm, and the interquartile range was 10 to 21. The SFR on postoperative day 1 in the present cohort was 61.5% (235 of 382), and the final SFR after 1 month was 73.6% (281 of 382). We established an innovative scoring system to evaluate SFR after RIRS using four preoperative characteristics. The range of the R.I.R.S. scoring system was 4 to 10. The overall score showed a great significance of stone-free status (p < 0.001). The area under the receiver operating characteristic curve of the R.I.R.S. scoring system was 0.904. The R.I.R.S. scoring system is associated with SFR after RIRS. This innovative scoring system can preoperatively assess treatment success after intrarenal surgery and can be used for preoperative surgical arrangement and comparisons of outcomes among different centers and within a center over time.

  2. The mTORC1-4E-BP-eIF4E axis controls de novo Bcl6 protein synthesis in T cells and systemic autoimmunity.

    PubMed

    Yi, Woelsung; Gupta, Sanjay; Ricker, Edd; Manni, Michela; Jessberger, Rolf; Chinenov, Yurii; Molina, Henrik; Pernis, Alessandra B

    2017-08-15

    Post-transcriptional modifications can control protein abundance, but the extent to which these alterations contribute to the expression of T helper (T H ) lineage-defining factors is unknown. Tight regulation of Bcl6 expression, an essential transcription factor for T follicular helper (T FH ) cells, is critical as aberrant T FH cell expansion is associated with autoimmune diseases, such as systemic lupus erythematosus (SLE). Here we show that lack of the SLE risk variant Def6 results in deregulation of Bcl6 protein synthesis in T cells as a result of enhanced activation of the mTORC1-4E-BP-eIF4E axis, secondary to aberrant assembly of a raptor-p62-TRAF6 complex. Proteomic analysis reveals that this pathway selectively controls the abundance of a subset of proteins. Rapamycin or raptor deletion ameliorates the aberrant T FH cell expansion in mice lacking Def6. Thus deregulation of mTORC1-dependent pathways controlling protein synthesis can result in T-cell dysfunction, indicating a mechanism by which mTORC1 can promote autoimmunity.Excessive expansion of the T follicular helper (T FH ) cell pool is associated with autoimmune disease and Def6 has been identified as an SLE risk variant. Here the authors show that Def6 limits proliferation of T FH cells in mice via alteration of mTORC1 signaling and inhibition of Bcl6 expression.

  3. Elevated Plasma Levels of sIL-2R in Complex Regional Pain Syndrome: A Pathogenic Role for T-Lymphocytes?

    PubMed Central

    Stronks, Dirk L.; Dik, Willem A.; Schreurs, Marco W. J.

    2017-01-01

    The immune system has long been thought to be involved in the pathophysiology of complex regional pain syndrome (CRPS). However, not much is known about the role of the immune system and specifically T-cells in the onset and maintenance of this disease. In this study, we aimed to evaluate T-cell activity in CRPS by comparing blood soluble interleukin-2 receptor (sIL-2R) levels between CRPS patients and healthy controls. CRPS patients had statistically significant elevated levels of sIL-2R as compared to healthy controls (median sIL-2R levels: 4151 pg/ml (Q3 − Q1 = 5731 pg/ml − 3546 pg/ml) versus 1907 pg/ml (Q3 − Q1: 2206 pg/ml − 1374 pg/ml), p < 0.001, resp.). Furthermore, sIL-2R level seems to be a good discriminator between CRPS patients and healthy controls with a high sensitivity (90%) and specificity (89.5%). Our finding indicates increased T-cell activity in patients with CRPS. This finding is of considerable relevance as it could point towards a T-cell-mediated inflammatory process in this disease. This could pave the way for new anti-inflammatory therapies in the treatment of CRPS. Furthermore, sIL-2R could be a promising new marker for determining inflammatory disease activity in CRPS. PMID:28634419

  4. Technology Insertion (TI)/Industrial Process Improvement (IPI). Task Order no. 1 (Misc Manufacturing). Book 3. Database Documentation Book for OO-ALC MANPWW. Main Landing Gear Except C5 - WCD’s

    DTIC Science & Technology

    1989-12-15

    PIROIN ICt _IN6 tNUMooR 14 "PUN 1*0R1UE ARM ir~~Is 17-T - s gAraNO WORK~ t* *tACC@NPUSNCO66 MECHANIC -A * ~C/p MOVE 00201" 003iBEG 26 :060 STRIP CRM ...25SET UP SALLIEOIWILATHE -PRAW 0 4 ?ART 04962 0-143 0020 E AA-- 2.00 1ST PART IN-OUT SCLL OWC � .023 0030 R ITL-N1 2,00 NIKE 011 2 FLAT SIRFACES...13SEP83 NEW INPUT-NO OCC FACTOR HISTORY 0011 14NOV84 2 YR REVIEW W/NO CHANGE 0012 1811AR85 DOWN GRADED NOT MARKET BASKET 0013 25NOV85 CHANGED SUBOPS TO

  5. Prototype development and demonstration for response, emergency staging, communications, uniform management, and evacuation (R.E.S.C.U.M.E.) : technical report on prototype development and field testing of R.E.S.C.U.M.E. applications.

    DOT National Transportation Integrated Search

    2015-04-01

    This document is the final project technical report for the development and field testing of the Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) application bundle, with a focus on the Incident Zone (I...

  6. E.S.R., magnetic, electronic and superoxide dismutase studies of imidazolate-bridged Cu(II)-Cu(II) complexes with ethylenediamine as capping ligand.

    PubMed

    Patel, R N; Singh, Nripendra; Shukla, K K; Gundla, V L N

    2005-06-01

    X-band E.S.R., magnetic and electronic spectra of some imidazolate-bridged homometallic complexes [(en)2Cu-R-Im-Cu(en)2](ClO4)3 where en, ethylenediamine; R-ImH, R = H imidazole (ImH); if R = CH3, 2-methylimidazole (M-ImH) and if R = C2H5, 2-ethylimidazole (E-ImH), and mononuclear complexes [(en)Cu-dien](ClO4)2 and [(en)Cu-PMDT](ClO4)2 where dien, diethylenetriamine; PMDT, pentamethyldiethylenetriamine have been described. Superoxide dismutase (SOD) activity has also been measured and compared with earlier reported complexes. In frozen solution at 77 K, the spectra show axial symmetry with a d(x2-y2) ground state. Difference in lambda(max) between mononuclear and binuclear complexes was found to be approximately 65-75 nm. Magnetic susceptibility and E.S.R. spectral measurements for all these binuclear complexes revealed that the copper(II) ions are involved in antiferromagnetic exchange interactions propagated by the imidazolate bridge.

  7. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. mGluR4-positive allosteric modulation as potential treatment for Parkinson’s disease

    PubMed Central

    Hopkins, Corey R; Lindsley, Craig W; Niswender, Colleen M

    2009-01-01

    Although Parkinson’s disease was first diagnosed nearly 200 years ago, its effective treatment still remains elusive for most of those diagnosed. The gold standard of treatment for most patients is 3,4-dihydroxy-l-phenylalanine. This drug works for most individuals early in the disease; however, resistant symptoms start to emerge after several years of treatment. There has been increased interest in finding novel therapies to help Parkinson’s disease patients. Such strategies may have the benefit of not only treating the symptomatic issues of the disorder, but might also offer promise in protecting dopaminergic neurons from further degeneration. One such target that is now receiving much attention from the scientific community is the metabotropic glutamate receptor mGluR4. In this article, we briefly review Parkinson’s disease and then recent work in the mGluR area, with a focus on the efforts being made toward finding and optimizing novel mGluR4 positive allosteric modulators (PAMs). Preclinically in rodent models, mGluR4 activation has offered much promise as a novel treatment of Parkinson’s disease. Additionally, the specific use of PAMs, rather than direct-acting agonists at the orthosteric glutamate site, continues to be validated as a viable treatment option for this target. It is anticipated that continued progress in this area will further our understanding of the potential of mGluR4 modulation as a novel symptomatic and potentially disease-modifying treatment for Parkinson’s disease. PMID:20161443

  9. Crystal structures of the diastereomeric salt pair of the prostaglandin intermediate 1 R, 2 S(+)- cis-2-hydroxycyclopent-4-enylacetic acid with S- and R- 1-phenylethylamine

    NASA Astrophysics Data System (ADS)

    Czugler, Mátyás; Csöregh, Ingeborg; Kálmán, Alajos; Faigl, Ferenc; Ács, Mária

    1989-05-01

    Crystal structures of an enantiomeric salt pair formed between 1 R,2 S- cis-2-hydroxycyclopent-4-enylacetic acid ( S-HCA) and R(+)-1-phenylethylamine ( R-PEA) and the corresponding S-PEA salt have been determined by X-ray crystallography. The S-HCA: R-PEA 1:1 salt ( R-HCA-PEA hereafter) is orthorhombic, P2 12 12 1, with the unit-cell parameters a = 5.806(1), b = 9.261(1), c = 27.624(2) Å and R = 0.056 for 1162 reflections at ambient temperature. The S-HCA: S-PEA 1:1 salt ( S-HCAPEA) is also orthorhombic, P2 12 12 1, with the unit-cell data a = 6.034(2), b = 11.840(7), c = 20.198(11) Å at 170 K, R = 0.082 for 1196 data measured at low temperatures (170 K). The R-HCAPEA salt has its two components assembled into an elongated rod-like shape via two-dimensional hydrogen bonding between cations and anions thus forming a well-ordered crystal. In contrast, the cation and anion in the S-HCAPEA salt forms a more globular aggregate and displays orientation disorder in the five-membered ring part of the anion and maintains an essentially one-dimensional hydrogen-bond network, while the total number of hydrogen bonds between cationic and anionic species remains three in both crystals.

  10. Maternal uniparental disomy of chromosome 14 in a boy with t(14q14q) associated with a paternal t(13q14q)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkins, D.J.; Waye, J.S.; Whelan, D.T.

    An 11-year-old boy was referred for chromosomal analysis because of precocious development and behavioral problems suggestive of the fragile X syndrome. The cytogenetic fragile X studies were normal, but a routine GTG-banded karyotype revealed an abnormal male karyotype with a Robertsonian translocation between the two chromosome 14`s: 46,XY,t(14q14q). Paternal karyotyping revealed another abnormal karyotype: 46,XY,t(13q14q). A brother had the same karyotype as the father; the mother was deceased. In order to determine if the apparently balanced t(14q14q) in the proband might be the cause of the clinical findings, molecular analysis of the origin of the chromosome 14`s was initiated. Southernmore » blotting and hybridization with D4S13 showed that the proband had two copies of one maternal allele which was shared by his brother. The brother`s second allele corresponded to one of the paternal alleles; the proband had no alleles from the father. Analysis of four other VNTRs demonstrated the probability of paternity to be greater than 99%. Thus, the t(14q14q) was most likely composed of two maternal chromosome 14`s. Further characterization of the t(14q14q) by dinucleotide repeat polymorphic markers is in progress to determine whether it has arisen from maternal isodisomy or heterodisomy. Several cases of uniparental disomy for chromosome 14 have been reported recently. Paternal disomy appears to be associated with more severe congenital anomalies and mental retardation, whereas maternal disomy may be associated with premature puberty and minimal intellectual impairment. The origin of the t(14q14q) in the present case may be related to the paternal translocation, as the segregation of the t(13q14q) in meiosis could lead to sperm that are nullisomic for chromosome 14.« less

  11. Teaching/learning styles, performance, and students' teaching evaluation in S/T/E/S-focused science teacher education: A quasiquantitative probe of a case study

    NASA Astrophysics Data System (ADS)

    Toller, Uri

    In response to the new needs for S/T/E/S-literate science teachers, an S/T/E/S-oriented ISMMC-IEE combination model of instruction was implemented in two specially designed undergraduate courses and one graduate course within college science teacher training programs. These three courses served as case studies for class-based, quasiquantitative pilot investigation aimed at gaining a deeper insight into some of the issues involved in the implementation in college of nontraditional, open-ended, problem-solving-oriented teaching strategies which are in dissonance with the cognitive or affective styles and functional paradigms of most students. This probe into the dissonance issue revealed that prospective teachers are capable of handling the new instructional model and do gain in their higher-level cognitive learning. However, undergraduates perceive these courses to be either difficult or not in accord with their needs, and their appreciation of the instructional techniques and style employed is different from that of graduate students accordingly. The current study suggests that although the ISMMC-IEE model is useful in S/T/E/S-oriented courses in science teacher training programs, special attention to the implementation stage is required to close the gap between students' and S/T/E/S educators' functional paradigms.

  12. (1S,2E,4S,7E,11E)-2,7,11-Cembratriene-4,6-diol semisynthetic analogs as novel c-Met inhibitors for the control of c-Met-dependent breast malignancies.

    PubMed

    Ebrahim, Hassan Y; Mohyeldin, Mohamed M; Hailat, Mohammad M; El Sayed, Khalid A

    2016-11-15

    (1S,2E,4S,6R,7E,11E)-2,7,11-Cembratriene-4,6-diol (1) and its 4-epi-analog (2) are the cembranoid precursors to several key flavor ingredients in most Nicotiana (tobacco) species. Nearly 40-60% of 1 and 2 are purposely degraded during the commercial tobacco fermentation. However, 1 and 2 display promising bioactivities, including anticancer. Breast cancer is the most diagnosed cancer in women and ranked second female disease killer. The receptor tyrosine kinase c-Met correlates with aggressiveness of certain breast cancer phenotypes and thus considered a valid therapeutic target. This study reports the discovery and optimization of the tobacco-based cembranoid 1 as a novel c-Met inhibitory scaffold using combined structure- and ligand-based approaches. 1 displayed antiproliferative, anti-migratory and anti-invasive effects against the c-Met overexpressing MDA-MB-231 breast cancer cells at moderate μM concentrations. The Z'-LYTE kinase platform and Western blot analysis identified c-Met as a potential macromolecular target. Rationally designed carbamate analogs were proposed to probe additional targeted c-Met interactions and improve the cellular potency. The 6-phenyl carbamate 3 showed enhanced c-Met inhibitory activity. Structure-activity relationships of different substituents on the 3's phenyl moiety were studied. The most active analog 20 showed potent in vitro anticancer activity against the MDA-MB-231 breast cancer cells at low μM concentrations, with minimal toxicity on the non-tumorigenic MCF-10A mammary epithelial cells. Cembranoid 20 potently inhibited the c-Met catalytic activity in Z'-LYTE kinase assay and various cellular c-Met-driven signaling pathways. Furthermore, 20 displayed a robust antitumor activity in a breast cancer xenograft athymic mouse model and thus promoted to the lead rank. Cembranoids are novel c-Met inhibitors appropriate for future use to control c-Met dependent malignancies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Increased U.S. Military Sales to China: Arguments and Alternatives

    DTIC Science & Technology

    1981-05-20

    provides a detailed pro- con analysis of the issue. It concludes by noting cross pressures that are likely to greet U.S. policy makers as they grapple...ema ted . The Chinese l e a d e r s a r e a l s o l i k e l y t o con t inue t o p r e s s f o r U.S. m i l i t a r y s u p p l i e s...to the U.S. sales to China suggest that U.S. policy makers will be taking certain--possibly grave-- risks if they decide to go ahead with more sales

  14. Phase II Study of Preoperative Concurrent Chemoradiation Therapy With S-1 in Patients With T4 Oral Squamous Cell Carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nomura, Tomoko; Murakami, Ryuji, E-mail: murakami@kumamoto-u.ac.j; Toya, Ryo

    Purpose: To determine the feasibility and efficacy of preoperative concurrent chemoradiation therapy (CCRT) with S-1, an oral fluoropyrimidine derivative, in patients with T4 oral squamous cell carcinoma (SCC). Methods and Materials: Only patients with histologically proven T4 oral SCC were included. Radiotherapy (total dose, 30 Gy) was delivered in 2-Gy daily fractions over a period of 3 weeks. Concurrently, S-1 (80 mg/m{sup 2}/day) was administered orally twice daily for 14 consecutive days. Results: We enrolled 46 patients. All underwent radiotherapy as planned; however, oral S-1 was discontinued in 3 patients who manifested acute toxicity. Grade 3 toxicities were mucositis (20%),more » anorexia (9%), and neutropenia (4%). We encountered no Grade 4 adverse events or serious postoperative morbidity requiring surgical intervention. After CCRT, 32 of the 46 patients underwent radical resection; in 17 (53%) of the operated patients, the pathologic response was complete. During follow-up ranging from 7 to 58 months (median, 22 months), tumor control failed in 5 (16%) of the 32 operated patients; there were 3 local and 2 regional failures. Of the 14 non-operated patients, 8 (57%) manifested local (n = 7) or regional failure (n = 1). The 3-year overall survival rate for all 46 patients was 69%; it was significantly higher for operated than for non-operated patients (82% vs. 48%; p = 0.0288). Conclusion: Preoperative CCRT with S-1 is feasible and effective in patients with T4 oral SCC. Even in inoperable cases, CCRT with S-1 provides adequate tumor control.« less

  15. 25. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1928. Vol I. Irrigation District #4, California and Southern Arizona, RG 75, BIA-Phoenix, BOx 40, National Archives, Pacific Southwest Region.) SACATON DAM SHOWING CONSTRUCTION OF CONDUIT AND EXCAVATION OF GRAVEL, APRIL 10, 1928 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  16. 24. Photographic copy of photograph. (Source: U.S. Department of interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    24. Photographic copy of photograph. (Source: U.S. Department of interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1928. Vol I. Irrigation District #4, California and Southern Arizona, RG 75, BIA-Phoenix, Box 40, National Archives, Pacific Southwest Region) Photographer unknown. SACATON DAM, CONDUIT ANCHORING AND REINFORCING STEEL, APRIL 10, 1928 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  17. Synthesis and structure determination of La{sub 8}Ti{sub 10}S{sub 24}O{sub 4}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cario, L.; Deudon, C.; Meerschaut, A.

    1998-02-15

    The new compound La{sub 8}Ti{sub 10}S{sub 24}O{sub 4} has been prepared from a mixture of La{sub 2}Ti{sub 2}O{sub 7} and La{sub 2}O{sub 3} (in a 5:1 ratio) heated at 1,200 C under a H{sub 2}S gas flow. This new quaternary phase was obtained due to an incomplete sulfidizing process. Single-crystal X-ray diffraction studies show that La{sub 8}Ti{sub 10}S{sub 24}O{sub 4} crystallizes in space group P4/mmm, with Z = 1, in a cell of dimensions a = b = 10.421 {angstrom} and c = 8.384 {angstrom}. Least-squares refinement converged to values of R - 0.045 and R{sub w} = 0.048. Themore » structure can be viewed as a stacking of two types of layers along the {rvec c} axis. These layers are built up from infinite rutile-like chains (Ti octahedra) that cross perpendicularly. La atoms, in a tricapped prismatic coordination, are located in tunnels that develop parallel to the {rvec c} direction.« less

  18. Job Language Performance Requirements for MOS-62J, General Construction Equipment Operator, Reference Soldier’s Manual Dated 28 September 1979.

    DTIC Science & Technology

    1979-09-28

    DAAosrt O14.NE VRO1 H__IH_1_________1_______1 1~~hN EIl 1___________ dsknind.o ~~~importance aCCA .Is %1* NU%3E OF REODE D RATA OBTAINED FROM...9~44r £LM2 ae1s ~ Am 424~~del 4e A ~-~. f3 N w ~ Ail 2~ZV41/- t-.. c4 fz d/1,C4t let e -~4Z tz 4L~ fl~4k*1 Wed 4 4-’V 4~bf6144a- 6d>zi.i Z a~ r

  19. User’s guide for MapMark4GUI—A graphical user interface for the MapMark4 R package

    USGS Publications Warehouse

    Shapiro, Jason

    2018-05-29

    MapMark4GUI is an R graphical user interface (GUI) developed by the U.S. Geological Survey to support user implementation of the MapMark4 R statistical software package. MapMark4 was developed by the U.S. Geological Survey to implement probability calculations for simulating undiscovered mineral resources in quantitative mineral resource assessments. The GUI provides an easy-to-use tool to input data, run simulations, and format output results for the MapMark4 package. The GUI is written and accessed in the R statistical programming language. This user’s guide includes instructions on installing and running MapMark4GUI and descriptions of the statistical output processes, output files, and test data files.

  20. S14 as a Therapeutic Target in Breast Cancer

    DTIC Science & Technology

    2006-08-01

    stained agarose gel is shown. Total RNA was analyzed by RT-PCR. Templates (500 ng) were from HepG2 hepatocarcinoma , T47D lipogenic breast cancer, and...cancer, but not MCF10a mammary epithelial or HepG2 hepatocarcinoma cells (not shown). We attempted to reduce S14 mRNA and protein expression using

  1. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

    PubMed Central

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G . incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G . raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

  2. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    PubMed

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  3. S-2-hydroxyglutarate regulates CD8+ T-lymphocyte fate.

    PubMed

    Tyrakis, Petros A; Palazon, Asis; Macias, David; Lee, Kian L; Phan, Anthony T; Veliça, Pedro; You, Jia; Chia, Grace S; Sim, Jingwei; Doedens, Andrew; Abelanet, Alice; Evans, Colin E; Griffiths, John R; Poellinger, Lorenz; Goldrath, Ananda W; Johnson, Randall S

    2016-12-08

    R-2-hydroxyglutarate accumulates to millimolar levels in cancer cells with gain-of-function isocitrate dehydrogenase 1/2 mutations. These levels of R-2-hydroxyglutarate affect 2-oxoglutarate-dependent dioxygenases. Both metabolite enantiomers, R- and S-2-hydroxyglutarate, are detectible in healthy individuals, yet their physiological function remains elusive. Here we show that 2-hydroxyglutarate accumulates in mouse CD8 + T cells in response to T-cell receptor triggering, and accumulates to millimolar levels in physiological oxygen conditions through a hypoxia-inducible factor 1-alpha (HIF-1α)-dependent mechanism. S-2-hydroxyglutarate predominates over R-2-hydroxyglutarate in activated T cells, and we demonstrate alterations in markers of CD8 + T-cell differentiation in response to this metabolite. Modulation of histone and DNA demethylation, as well as HIF-1α stability, mediate these effects. S-2-hydroxyglutarate treatment greatly enhances the in vivo proliferation, persistence and anti-tumour capacity of adoptively transferred CD8 + T cells. Thus, S-2-hydroxyglutarate acts as an immunometabolite that links environmental context, through a metabolic-epigenetic axis, to immune fate and function.

  4. NsrR from Streptomyces coelicolor Is a Nitric Oxide-sensing [4Fe-4S] Cluster Protein with a Specialized Regulatory Function*

    PubMed Central

    Crack, Jason C.; Munnoch, John; Dodd, Erin L.; Knowles, Felicity; Al Bassam, Mahmoud M.; Kamali, Saeed; Holland, Ashley A.; Cramer, Stephen P.; Hamilton, Chris J.; Johnson, Michael K.; Thomson, Andrew J.; Hutchings, Matthew I.; Le Brun, Nick E.

    2015-01-01

    The Rrf2 family transcription factor NsrR controls expression of genes in a wide range of bacteria in response to nitric oxide (NO). The precise form of the NO-sensing module of NsrR is the subject of controversy because NsrR proteins containing either [2Fe-2S] or [4Fe-4S] clusters have been observed previously. Optical, Mössbauer, resonance Raman spectroscopies and native mass spectrometry demonstrate that Streptomyces coelicolor NsrR (ScNsrR), previously reported to contain a [2Fe-2S] cluster, can be isolated containing a [4Fe-4S] cluster. ChIP-seq experiments indicated that the ScNsrR regulon is small, consisting of only hmpA1, hmpA2, and nsrR itself. The hmpA genes encode NO-detoxifying flavohemoglobins, indicating that ScNsrR has a specialized regulatory function focused on NO detoxification and is not a global regulator like some NsrR orthologues. EMSAs and DNase I footprinting showed that the [4Fe-4S] form of ScNsrR binds specifically and tightly to an 11-bp inverted repeat sequence in the promoter regions of the identified target genes and that DNA binding is abolished following reaction with NO. Resonance Raman data were consistent with cluster coordination by three Cys residues and one oxygen-containing residue, and analysis of ScNsrR variants suggested that highly conserved Glu-85 may be the fourth ligand. Finally, we demonstrate that some low molecular weight thiols, but importantly not physiologically relevant thiols, such as cysteine and an analogue of mycothiol, bind weakly to the [4Fe-4S] cluster, and exposure of this bound form to O2 results in cluster conversion to the [2Fe-2S] form, which does not bind to DNA. These data help to account for the observation of [2Fe-2S] forms of NsrR. PMID:25771538

  5. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  6. Facteurs associés à la non observance thérapeutique des sujets adultes infectés par le VIH sous antirétroviraux dans un hôpital de référence à Douala

    PubMed Central

    Essomba, Emmanuel Noel; Adiogo, Dieudonné; Koum, Danielle Christiane Kedy; Amang, Baudouin; Lehman, Leopold Gustave; Coppieters, Yves

    2015-01-01

    Introduction Le succès du traitement antirétroviral repose sur l'observance. Elle est nécessaire pour réduire la mortalité, diminuer le risque de résistance et restaurer l'immunité. Cette étude a pour but d'identifier et analyser les différents facteurs associés à la non observance thérapeutique des patients infectés par le VIH sous traitement antirétroviraux à l'hôpital de référence Laquintinie de Douala. Méthodes Il s'agit d'une étude transversale et analytique effectuée de mars à juin 2014. La non observance est mesurée à travers les déclarations du patient et sur consultation des registres de renouvellement des ordonnances. Etaient non observant, ceux ayant consommé moins de 95% de médicaments et ceux ne s’étant pas présentés pour le renouvellement de l'ordonnance. L'analyse bivariée et le modèle de régression logistique ont été utilisés pour la détermination des facteurs associés à la non observance. Résultats Au total, 524 patients ont été enrôlés dans l’étude;l’âge moyen était de 43,0 ± 10,7 ans et le sexe ratio H/F de 0,54. De ces patients, 49,0% étaient non observant, majoritairement des femmes (61,9%). Les principales raisons avancées de la non observance sont: l'oubli (32,9%), la rupture de médicaments (14,0%), les occupations (12,8%). Les personnes veuves(IC 95% OR= 1,31-5,22, p= 0,006), la consommation des excitants (IC 95%, OR= 2,30-6,90, p= 0,0001) et la présence d'infection opportuniste (IC 95%, OR= 1,41-17,54, p= 0,01) ont fortement été associés à la non observance. Conclusion Le taux d'observance était faible, lié à plusieurs facteurs. Des mesures sont nécessaires pour résoudre ce problème, y compris des stratégies tendant à l'amélioration du soutien psycho-social, et la limitation des ruptures de stock de médicaments. La recherche qualitative est souhaitée pour comprendre les raisons de la non observance afin de mettre au point des interventions fondées sur des donn

  7. Chromosome jumping from D4S10 (G8) toward the Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richards, J.E.; Gilliam, T.C.; Cole, J.L.

    1988-09-01

    The gene for Huntington disease (HD) has been localized to the distal portion of the short arm of human chromosome 4 by linkage analysis. Currently, the two closest DNA markers are D4S10 (G8), located /approx/3 centimorgans centromeric to HD, and D4S43 (C4H), positioned 0-1.5 centimorgans from HD. In an effort to move closer to the HD gene, with the eventual goal of identifying the gene itself, the authors have applied the technique of chromosome jumping to this region. A 200-kilobase jumping library has been constructed, and a jump from D4S10 has been obtained and its approximate distance verified by pulsedmore » field gel electrophoresis. Two restriction fragment length polymorphisms have been identified at the jump locus, which is denoted D4S81. Linkage analysis of previously identified recombinants between D4S10 and HD or D4S10 and D4S43 shows that in two of five events the jump has crossed the recombination points. This unequivocally orients D4S10 and D4S81 on the chromosome, provides additional markers for HD, and suggests that recombination frequency in this region of chromosome 4 may be increased, so that the physical distance from D4S10 to HD may not be as large as originally suspected.« less

  8. Fabrication of water-soluble polymer-encapsulated As4S4 to increase oral bioavailability and chemotherapeutic efficacy in AML mice

    PubMed Central

    Ma, Qiang; Wang, Chuan; Li, Xiaojin; Guo, Hua; Meng, Jie; Liu, Jian; Xu, Haiyan

    2016-01-01

    Realgar (As4S4) has been demonstrated to be effective for the treatment of acute myeloid leukemia (AML); it has the advantages of no drug resistance and oral administration. Nevertheless, its poor solubility has been an obstacle to its bioavailability, requiring high-dose administration over a long period. We investigated whether crushing realgar crystals to the nanoscale and encapsulating the particles in a water-soluble polymer in one step using hot-melt extrusion would increase the bioavailability of As4S4. Raw As4S4 (r-As4S4) and water-soluble polymer were processed via co-rotating twin screw extrusion. The resulting product (e-As4S4) was characterized by SEM, XRD, and DLS. The cytotoxicity and therapeutic effects of e-As4S4 were evaluated in vivo and in vitro. The results show that e-As4S4 dissolved rapidly in water, forming a stable colloid solution. The average size of e-As4S4 particles was 680 nm, which was reduced by more than 40-fold compared with that of r-As4S4. The bioavailability of e-As4S4 was up to 12.6-fold higher than that of r-As4S4, and it inhibited the proliferation of HL-60 cells much more effectively than did r-As4S4, inducing apoptosis and significantly reducing the infiltration of HL-60 cells into the bone marrow, spleen, and liver. This in turn prolonged the survival of AML mice. PMID:27383126

  9. New insights into the pharmacokinetics and metabolism of (R,S)-ifosfamide in cancer patients using a population pharmacokinetic-metabolism model.

    PubMed

    Di Marco, M P; Wainer, I W; Granvil, C L; Batist, G; Ducharme, M P

    2000-06-01

    To describe the pharmacokinetics of R- and S-Ifosfamide (IFF), and their respective 2 and 3 N-dechloroethylated (DCE) metabolites (R2-, R3-, S2, S3-DCE-IFF) in cancer patients. (R,S)-IFF was administered (1.5 g/m2) daily for 5 days in 13 cancer patients. Plasma and urine samples were collected and analyzed using an enantioselective GC-MS method. An average of 97 observations per patient were simultaneously fitted using a pharmacokinetic-metabolism (PK-MB) model. A population PK analysis was performed using an iterative 2-stage method (IT2S). Auto-induction of IFF metabolism was observed over the 5 day period. Increases were seen in IFF clearance (R: 4 vs. 7 L/h; S: 5 vs. 10 L/h), and in the formation of DCE (R: 7 vs. 9%; S: 14 vs. 19%) and active metabolites (4-OHM-IFF; R: 71 vs. 77%; S: 67 vs. 71%). A novel finding of this analysis was that the renal excretion of the DCE metabolites was also induced. This population PK-MB model for (R,S)-IFF may be useful in the optimization of patient care, and gives new insight into the metabolism of (R,S)-IFF.

  10. Le rôle du soutien parental dans la relation entre la victimisation homophobe, l’homophobie intériorisée et la détresse psychologique chez les jeunes de minorités sexuelles (JMS) : une approche de médiation modérée

    PubMed Central

    Bergeron, Félix-Antoine; Blais, Martin; Hébert, Martine

    2016-01-01

    Résumé Cet article explore le rôle modérateur du soutien parental dans les relations entre la victimisation homophobe, l’homophobie intériorisée et la détresse psychologique chez des jeunes de minorités sexuelles (JMS), que l’on dit aussi lesbiennes, gais, bisexuels ou en questionnement. Il vise à 1) documenter la prévalence des différentes formes de victimisation homophobe vécue par les JMS, et ce, selon le genre et l’âge et 2) à explorer l’effet modérateur du soutien parental dans la relation entre la victimisation homophobe, l’homophobie intériorisée et la détresse psychologique. Un échantillon de 228 JMS âgés de 14 à 22 ans, non exclusivement hétérosexuels, recrutés en milieu communautaire dans le cadre de l’enquête sur le Parcours Amoureux des Jeunes (PAJ) du Québec a été analysé. L’impact de la victimisation homophobe, du soutien parental, de l’homophobie intériorisée sur la détresse psychologique est exploré par un modèle de régression linéaire avec effets de médiation modérée. Le rôle modérateur du soutien parental est confirmé dans la relation entre la victimisation homophobe et la détresse psychologique. Ces variables peuvent constituer des leviers pour prévenir les effets négatifs des préjudices homophobes sur la santé mentale des JMS. PMID:26966851

  11. 11. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. SACATON DAM AND BRIDGE SITE FROM QUARRY HILL, 10/1/24 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  12. The tobacco cembranoid (1S,2E,4S,7E,11E)-2,7,11-cembratriene-4,6-diol as a novel angiogenesis inhibitory lead for the control of breast malignancies.

    PubMed

    Hailat, Mohammad M; Ebrahim, Hassan Y; Mohyeldin, Mohamed M; Goda, Amira A; Siddique, Abu Bakar; El Sayed, Khalid A

    2017-08-01

    (1S,2E,4S,6R,7E,11E)-2,7,11-cembratriene-4,6-diol (1) and its 4-epi-analog (2) are diterpene precursors of the key flavor components in most Nicotiana (tobacco) species that purposely degraded during commercial tobacco fermentation. Angiogenesis, recruitment of new blood vessels, is important for tumor growth, survival and metastasis that can be targeted to control cancer. This study shows evidences and potential of the cembranoid 1 as a potent angiogenesis modulator through targeting VEGFR 2 . In silico study suggested favorable docking scores and binding affinity of 1 at the ATP binding pocket of VEGFR 2 . The binding mode of 1 was parallel to the standard FDA-approved antiangiogenic drug sunitinib (4). In vitro, cembranoid 1 significantly reduced the activated VEGFR 2 levels in multiple breast cancer cell lines. Intraperitoneal 40mg/kg, 3X/week treatment of 1 significantly reduced the MDA-MB-231 cells breast tumor size in mice. Immunohistochemistry and Western blotting analysis of the treated mice tumors showed significant downregulation of the vasculogenesis marker CD31 and suppressed activated VEGFR 2 -paxillin-FAK pathway. Matrigel study in Swiss albino mice showed similar trend. The tobacco cembranoid 1 is a potential antiangiogenic lead useful for future use to control breast malignancies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    PubMed

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  14. Cs 2 Hg 3 S 4 : A Low-Dimensional Direct Bandgap Semiconductor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Islam, Saiful M.; Vanishri, S.; Li, Hao

    2015-01-13

    Cs2Hg3S4 was synthesized by slowly cooling a melted stoichiometric mixture of Hg and Cs2S4. Cs2Hg3S4 crystallizes in the Ibam spacegroup with a = 6.278(1) angstrom, b = 11.601(2) angstrom, and c = 14.431(3)angstrom; d(calc) = 6.29 g/cm(3). Its crystal structure consists of straight chains of [Hg3S4](n)(2n-) that engage in side-by-side weak bonding interactions forming layers and are charge balanced by Cs+ cations. The thermal stability of this compound was investigated with differential thermal analysis and temperature dependent in situ synchrotron powder diffraction. The thermal expansion coefficients of the a, b, and c axes were assessed at 1.56 x 10(-5), 2.79more » x10(-5), and 3.04 x 10(-5) K-1, respectively. Large single-crystals up to similar to 5 cm in length and similar to 1 cm in diameter were grown using a vertical Bridgman method. Electrical conductivity and photoconductivity measurements on naturally cleaved crystals of Cs2Hg3S4 gave resistivity rho of >= 10(8) Omega.cm and carrier mobility-lifetime (mu tau) products of 4.2 x 10(-4) and 5.82 x 10(-5) cm(2) V-1 for electrons and holes, respectively. Cs2Hg3S4 is a semiconductor with a bandgap E-g similar to 2.8 eV and exhibits photoluminescence (PL) at low temperature. Electronic band structure calculations within the density functional theory (DFT) framework employing the nonlocal hybrid functional within Heyd-Scuseria-Ernzerhof (HSE) formalism indicate a direct bandgap of 2.81 eV at Gamma. The theoretical calculations show that the conduction band minimum has a highly dispersive and relatively isotropic mercury-based s-orbital-like character while the valence band maximum features a much less dispersive and more anisotropic sulfur orbital-based band.« less

  15. Les pneumopathies nosocomiales en réanimation de CHU Hassan II de Fès

    PubMed Central

    Shimi, Abdelkarim; Touzani, Soumaya; Elbakouri, Nabil; Bechri, Brahim; Derkaoui, Ali; Khatouf, Mohammed

    2015-01-01

    L'objectif principal de notre étude était d'identifier les bactéries incriminées dans la pneumopathie nosocomiale (PN) au service de réanimation A1 du CHU Hassan II de Fès, en vue d'en améliorer la prise en charge et de diminuer la morbi-mortalité associée. Il s'agit d'une étude rétrospective et descriptive, menée du 1er janvier 2012 au 31 décembre 2013. Seules les infections pulmonaires survenant au-delà de 48 heures de l'admission du patient au service de réanimation ont été incluses. L'incidence de la PN était de 11,2%. Les Bacilles à Gram négatif (BGN) étaient retrouvés dans 48,5% des cas, le Staphylocoque Aureus dans 21,21% des cas et le Klebsiella Pneumoniae était dans 10,7% des cas. Le taux de mortalité était de 48,33%. L’âge, la gravité de la pathologie sous jacente et le retard de l'instauration d'une antibiothérapie adaptée étaient considérées comme facteurs de mauvais pronostic. L’étude de la résistance aux antibiotiques, montre une multirésistance surtout pour les BGN, dont il faut tenir compte en mettant en place une stratégie de prévention active. PMID:26966481

  16. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  17. A Very Compact Rijndael S-box

    DTIC Science & Technology

    2005-05-17

    6A 01101010 40 r8 107 6B 01101011 84 N4 108 6C 01101100 250 R 109 6D 01101101 133 s128 110 6E 01101110 61 S64 111 6F 01101111 186 n64 112 70 01110000...210 D2 11010010 132 l128 109 6D 01101101 133 s128 183 B7 10110111 134 C128 194 C2 11000010 135 T 128 93 5D 01011101 136 α8 231 E7 11100111 137 g128

  18. Microstructure Evolution During Warm Working of Ti-6Al-4V with a Colony Alpha Microstructure (Preprint)

    DTIC Science & Technology

    2008-09-01

    6 maps such as those shown in Fig. 4 ; typical examples of the cumulative misorientation are given in Figs. 5 and 6 , respectively...misorientation line scans shown in Figs. 5 and 6 . Fig. 5. Typical line scans from EBSD maps in Fig. 4 showing the variation of orientation over a long...e g 0 2 4 6 8 10 12 14 16 (b) Distance, μm 0 20 40 60 80 100 C u m u l a t i v e m i s o r i e n t a t i o n , d e g 0 5 10 15

  19. Live transport of Yellow Perch and Nile Tilapia in AQUI-S 20E (10% Eugenol) at high loading densities

    USGS Publications Warehouse

    Cupp, Aaron R.; Schreier, Theresa M.; Schleis, Sue M.

    2017-01-01

    Fish transport costs are a substantial portion of the operational expenses for aquaculture facilities in the USA. Safely transporting higher loading densities of fish would benefit haulers by increasing efficiency and reducing costs, but research evaluating transport for individual species is generally lacking. In this study, Yellow Perch Perca flavescens and Nile Tilapia Oreochromis niloticus were transported for 6 h immersed in water containing AQUI-S 20E (10% eugenol) at fish loading densities of 240 g/L (2 lb/gal) for perch and 480 g/L (4 lb/gal) for tilapia. Survival was quantified for fish transported in AQUI-S 20E concentrations of (1) control or 0 mg/L of water, (2) 100 mg/L, or (3) 200 mg/L. Yellow Perch had 98–100% survival, and Nile Tilapia had 100% survival up to through 14 d after transport across all AQUI-S 20E levels, including the control. Eugenol concentrations decreased rapidly in transport tank water, and fish showed no signs of sedation by the end of transport. We conclude that live transport of Yellow Perch and Nile Tilapia at higher loading densities resulted in high survival regardless of the AQUI-S 20E concentrations we tested.

  20. U.S. EPA, Pesticide Product Label, GRASLAN BRUSH BULLETS 125, 01/13/1983

    EPA Pesticide Factsheets

    2011-04-14

    ... r!af"S ;'OP', f· q"l ClnA~LAN E·l.~'" t~~. etc; ':" ·l::n ..... f;' "'J'-o( ~ ,': f:f Il{'f '1"'0 ~"!~.J,ll '''''d. c'aT'1 Ol.! "n rr',:'e Ina"'':O \\.")R",S'-A~. BII.~" t~" j'::;' ...

  1. Analysis of the Pilot Conversion Process for the Air Force T-46A Jet Trainer Aircraft.

    DTIC Science & Technology

    1983-09-01

    both the T-37 and T-46. Therefore, when an IP begins transition training into the T-46, he can no longer fly the T-37. One exception to this policy may...4 4 ’- - C14 -4 r-4 1-4 o 0. 1 >% 0 r I- r-0 C4co =- r.=. D 03 40 cnCD 0.M nC4r. % - - -,P , D-4 M ’r % > a. m0 >r 0 *1*** Ln S-.~ U- 10 .. a 4...Equipment Maintenance Policies , Objectives and Responsibilities. Accomplish for the implementing command depot level maintenance source repair

  2. Crystal structure of EGFR T790 M/C797S/V948R in complex with EAI045.

    PubMed

    Zhao, Peng; Yao, Ming-Yu; Zhu, Su-Jie; Chen, Ji-Yun; Yun, Cai-Hong

    2018-05-23

    Lung cancer is the leading cause of cancer deaths. Epidermal growth factor receptor (EGFR) kinase domain mutations are a common cause of non-small cell lung cancers (NSCLCs), a major subtype of lung cancers. Patients harboring most of these mutations respond well to the anti-EGFR tyrosine kinase inhibitors (TKIs) gefitinib and erlotinib initially, but soon develop resistance to them in about half of the cases due to the emergence of the gatekeeper mutation T790 M. The third-generation TKIs such as AZD9291, HM61713, CO-1686 and WZ4002 can overcome T790 M through covalent binding to the EGFR kinase through Cys 797, but ultimately lose their efficacy upon emergence of the C797S mutation that abolishes the covalent bonding. Therefore to develop new TKIs to overcome EGFR drug-resistant mutants harboring T790 M/C797S is urgently demanded. EAI001 and EAI045 are a new type of EGFR TKIs that bind to EGFR reversibly and not relying on Cys 797. EAI045 in combination with cetuximab is effective in mouse models of lung cancer driven by EGFR L858 R/T790 M and L858 R/T790 M/C797S. Here we report the crystal structure of EGFR T790 M/C797S/V948R in complex with EAI045, and compare it to EGFR T790 M/V948R in complex with EAI001. The complex structure reveals why EAI045 binds tighter to EGFR than does EAI001, and why EAI001 and EAI045 prefer binding to EGFR T790 M. The knowledge may facilitate future drug development studies targeting this very important cancer target. Copyright © 2018. Published by Elsevier Inc.

  3. S.T.E.P. - Students Toward Environmental Participation - Into Your Environment.

    ERIC Educational Resources Information Center

    Brandt, Sandy, Ed.; Walters, Casey, Ed.

    This high school environmental guide uses the Students Toward Environmental Participation (S.T.E.P.) approach. Activities are designed to develop an awareness of the purpose, interrelationship, and wholeness of the earth through activities, games and role-playing. Sample activities include: trust walk, scavenger hunt, nature collage, and alphabet…

  4. U.S. EPA, Pesticides, Label, CUPRO 2005 T/N/O, 7/6/2011

    EPA Pesticide Factsheets

    2011-07-19

    ... rl!.4gt§ig~)ig~.]tOd~~MJ?~.'.r: ~~~iS!f¥i~§i~;i!X~~fu'~Y)~!l~: c~!i~~$t1in~ht~t!~~~~ep~ti~ri;-?f¥i§)~rQ.a ... Begonia semperflorens ...

  5. Clinicopathological outcomes of preoperative chemoradiotherapy using S-1 plus Irinotecan for T4 lower rectal cancer.

    PubMed

    Beppu, Naohito; Yoshie, Hidenori; Kimura, Fumihiko; Aihara, Tsukasa; Doi, Hiroshi; Kamikonya, Norihiko; Matsubara, Nagahide; Tomita, Naohiro; Yanagi, Hidenori; Yamanaka, Naoki

    2016-07-01

    To investigate the clinicopathological outcomes of patients with T4 lower rectal cancer treated using preoperative chemoradiotherapy with S-1 plus Irinotecan. Between 2005 and 2011, 35 patients with T4M0 lower rectal cancer, diagnosed initially as T4a in 12 and as T4b in 23, were treated with 45 Gy of radiotherapy concomitantly with S-1 plus Irinotecan. The median follow-up period was 50.6 months (range 2-123 months). A total of 32 patients (91.4 %) completed the radiotherapy and 26 (74.3 %) completed the full chemotherapy regimen. Radical surgery was then performed in 33 (94.3 %) of the 35 patients after the exclusion of two patients, who had macroscopic residual disease. The pathological diagnosis was downstaged from T4a to ypT0-3 in all 12 of those patients (100 %) and from T4b to ypT0-4a in 20 of those 23 patients (87.0 %). The tumor regression grade of 1a/1b/2/3 (complete response) was 10/8/15/2, respectively. In terms of long-term survival, the 5-year local relapse-free survival rate was 74.8 % and the recurrence-free survival rate was 52.0 %. This regimen may result in favorable downstaging. Moreover, in this series, pathological evidence of involvement of adjacent organs was rare following preoperative chemoradiotherapy, in the patients with disease diagnosed as T4b at the initial staging.

  6. Propriétés électrostrictives de céramiques massives du type PbMg{1/3}Nb{2/3}O3 (PMN)

    NASA Astrophysics Data System (ADS)

    Lattard, E.; Lejeune, M.; Abelard, P.

    1994-07-01

    Loop hysteresis, dielectric and electrostrictive properties of bulk ceramics (1 - x) PbMg{1/3}Nb{2/3}O3 - xPbTiO3 - yMgO for x = 0, 5, 10 % and y = 0, 6, 12 % have been investigated. An initial lead oxide magnesium excess stabilises the perovskite structure during its formation and leads to an improvement of the electrical properties. These materials are relaxor type ferroelectrics with high permittivities in a large space of temperature around - 12 ^circC for x = 0 % to + 45 ^circC for x = 10 %. They exhibit, at 25 ^circC, large electrostrictive longitudinal (x_3 = Δ e/e) and transversal (x_1 = Δ d/d) strains without hysteresis, under an electric field of ± 2 kV/mm and at low frequency (F = 20 mHz) : x_3 = 3.5 × 10^{-4} and x_1 =10^{-4} for PMN 0.12-MgO and x_3 = 10^{-3} and x_1 = 2 × 10^{-4} for 0.9 PMN-0.1 PT-0.12 MgO. Additions of titanium improve the polarization of material which largely contribute to large strains whereas electrostrictive coefficients Q_{ij} (x_i = Q_{ij} \\cdot P_j^2), determined at 25 ^circC, slightly increase with PbTiO3 percent (for a constant magnesium excess). Les propriétés diélectriques, d'hystérésis de polarisation et électrostrictives (déformation sous champ électrique) ont été étudiées sur des composés massifs du type (1 - x) PbMg{1/3}Nb{2/3}O3 - xPbTiO3 - y Mgo pour x = 0, 5, 10 % et y = 0, 6, 12 %. L'excès initial d'oxyde de magnésium stabilise la phase pérovskite lors de sa formation et permet d'éviter la dégradation des propriétés électriques observée sur un composé de type PMN stœchiométrique. Ces matériaux sont des relaxeurs ferroélectriques caractérisés par une transition ferroélectrique diffuse. Les permittivités sont élevées dans un domaine de température centré autour de - 12 ^circC pour x = 0 % à + 45 ^circC pour x = 10 %. Ils présentent, à 25 ^circC, des déformations notables en mode longitudinal (x_3 = Δ e/e) et transversal (x_1 = Δ d/d), dépourvues d'hystérèse, d

  7. COSAGE (Concepts Analysis Agency’s Combat Sample Generator) Analysis and Design Report. Volume 1.

    DTIC Science & Technology

    1984-04-29

    CM. C4UT.TI ON 12 5..j FUNCTION m2-. WLr 12 j -1 ---VUTINE w-fA.NEPT 112 5 3 ; CUTINE CA S. =V3L 1 1 5- P JU T loE z- 4 L 0Y.L C T FR S 11 55 P;ICESS... CUTINE PLAT.COUNT 5 -7 1 1 OUT I N PROX.CHiEOK 5 * 14ROUTINE Sw IT CH FrO 5 Figu, .- Modules Ranked by Functional IF Tests Conti nued 3-30 -SCIENCE...2 ; CUTIN -" ...CR T=CT 231 ;OUTI- = Kv .Ir UT T 232 UuTIN.-- Mi 3s.I~d3UT , 2 3 Z Ru T iiM d:’ 3 N-l 2". OUT:N .44 1’ ,1 L3i R OUT INE %4 l Nk 0 (3o

  8. Apolipoprotein E alleles in Alzheimer`s and Parkinson`s patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poduslo, S.E.; Schwankhaus, J.D.

    1994-09-01

    A number of investigators have found an association between the apolipoprotein E4 allele and Alzheimer`s disease. The E4 allele appears at a higher frequency in late onset familial Alzheimer`s patients. In our studies we obtained blood samples from early and late onset familial and sporadic Alzheimer`s patients and spouses, as well as from Parkinson`s patients. The patients were diagnosed as probable Alzheimer`s patients after a neurological examination, extensive blood work, and a CAT scan. The diagnosis was made according to the NINCDS-ADRDA criteria. The apolipoprotein E4 polymorphism was detected after PCR amplification of genomic DNA, restriction enzyme digestion with Hhal,more » and polyacrylamide gel electrophoresis. Ethidium bromide-stained bands at 91 bp were designated as allele 3, at 83 bp as allele 2, and at 72 bp as allele 4. Of the 84 probable Alzheimer`s patients (all of whom were Caucasian), 47 were heterozygous and 13 were homozygous for the E4 allele. There were 26 early onset patients; 13 were heterozygous and 7 homozygous for the E4 allele. The frequencies for the E4 allele for late onset familial patients was 0.45 and for sporadic patients was 0.37. We analyzed 77 spouses with an average age of 71.9 {plus_minus} 7.4 years as controls, and 15 were heterozygous for the E4 allele for an E4 frequency of 0.097. Of the 53 Parkinson`s patients, 11 had the E4 allele for a frequency of 0.113. Thus our findings support the association of the ApoE4 allele with Alzheimer`s disease.« less

  9. Heliport Noise Model (HNM). Version 1. (User’s Guide)

    DTIC Science & Technology

    1988-02-01

    Examples of acoustically hard surfaces include concrete or asphalt paving, water or baked clay surfaces. Mote that if the site does not meet the...neighbor should be characterized as either Hard (H) or Soft (S). From an acoustic point of view, "hard" ground is either pavement or water . All other...GROUND DISraNCE 10 - MAP - SEIUP 11 - HELIPADS 3 - HELIPADS 12- rAKEOI tRACKS 4 - HELICOPrERS 13 - APPROACH IRACKS 5 - IAKt-OFFS 14- rAxx fRACKS C6

  10. Cloning, Expression and Characterization of a Thermostable Esterase HydS14 from Actinomadura sp. Strain S14 in Pichia pastoris.

    PubMed

    Sriyapai, Pichapak; Kawai, Fusako; Siripoke, Somjai; Chansiri, Kosum; Sriyapai, Thayat

    2015-06-12

    A thermostable esterase gene (hydS14) was cloned from an Actinomadura sp. S14 gene library. The gene is 777 bp in length and encodes a polypeptide of 258 amino acid residues with no signal peptide, no N-glycosylation site and a predicted molecular mass of 26,604 Da. The encoded protein contains the pentapeptide motif (GYSLG) and catalytic triad (Ser88-Asp208-His235) of the esterase/lipase superfamily. The HydS14 sequence shows 46%-64% identity to 23 sequences from actinomycetes (23 α/β-hydrolases), has three conserved regions, and contains the novel motif (GY(F)SLG), which distinguishes it from other clusters in the α/β-hydrolase structural superfamily. A plasmid containing the coding region (pPICZαA-hydS14) was used to express HydS14 in Pichia pastoris under the control of the AOXI promoter. The recombinant HydS14 collected from the supernatant had a molecular mass of ~30 kDa, which agrees with its predicted molecular mass without N-glycosylation. HydS14 had an optimum temperature of approximately 70 °C and an optimum pH of 8.0. HydS14 was stable at 50 and 60 °C for 120 min, with residual activities of above 80% and above 90%, respectively, as well as 50% activity at pH 6.0-8.0 and pH 9.0, respectively. The enzyme showed higher activity with p-nitrophenyl-C2 and C4. The Km and Vmax values for p-nitrophenyl-C4 were 0.21 ± 0.02 mM and 37.07 ± 1.04 μmol/min/mg, respectively. The enzyme was active toward short-chain p-nitrophenyl ester (C2-C6), displaying optimal activity with p-nitrophenyl-C4 (Kcat/Km = 11.74 mM(-1) · S(-1)). In summary, HydS14 is a thermostable esterase from Actinomadura sp. S14 that has been cloned and expressed for the first time in Pichia pastoris.

  11. A Recombinant DNA Plasmid Encoding the sIL-4R-NAP Fusion Protein Suppress Airway Inflammation in an OVA-Induced Mouse Model of Asthma.

    PubMed

    Liu, Xin; Fu, Guo; Ji, Zhenyu; Huang, Xiabing; Ding, Cong; Jiang, Hui; Wang, Xiaolong; Du, Mingxuan; Wang, Ting; Kang, Qiaozhen

    2016-08-01

    Asthma is a chronic inflammatory airway disease. It was prevalently perceived that Th2 cells played the crucial role in asthma pathogenesis, which has been identified as the important target for anti-asthma therapy. The soluble IL-4 receptor (sIL-4R), which is the decoy receptor for Th2 cytokine IL-4, has been reported to be effective in treating asthma in phase I/II clinical trail. To develop more efficacious anti-asthma agent, we attempt to test whether the Helicobacter pylori neutrophil-activating protein (HP-NAP), a novel TLR2 agonist, would enhance the efficacy of sIL-4R in anti-asthma therapy. In our work, we constructed a pcDNA3.1-sIL-4R-NAP plasmid, named PSN, encoding fusion protein of murine sIL-4R and HP-NAP. PSN significantly inhibited airway inflammation, decreased the serum OVA-specific IgE levels and remodeled the Th1/Th2 balance. Notably, PSN is more effective on anti-asthma therapy comparing with plasmid only expressing sIL-4R.

  12. Electron Excitation Cross Sections for the 2s(sup 2)2p(sup 3) (sup 4)S -> 2s(sup 2)2p(sup 3) (sup 2d) ->2s2p(sup 4) (sup 4p) (Resonance) Transitions in Oil

    NASA Technical Reports Server (NTRS)

    Zuo, M.; Smith, S.; Chutjian, A.; Williams, I.; Tayal, S.; McLaughlin, B.

    1994-01-01

    Experimental and theoretical excitation cross sections are reported for the first forbidden transition xxx and the first allowed (resonance) transition xxx in OII. Use is made of electron-energy loss and merged beams methods. The electron energy range covered is 3.33 eV (threshold) to 15 eV for the S->D transition, and 14.9 eV (threshold) to 40 eV for the S->P transition. Care was taken to assess and minimize the metastable fraction of the OII beam. An electron mirror was designed and tested to reflect inelastically back-scattered electrons into the forward direction to account for the full range of polar scattering angles. Comparisons are made between present experiments and 11-state R-Matrix calculations. Calculations are also presented for the xxx transition.

  13. Replication of KCNJ11 (p.E23K) and ABCC8 (p.S1369A) Association in Russian Diabetes Mellitus 2 Type Cohort and Meta-Analysis

    PubMed Central

    Sokolova, Ekaterina Alekseevna; Bondar, Irina Arkadievna; Shabelnikova, Olesya Yurievna; Pyankova, Olga Vladimirovna; Filipenko, Maxim Leonidovich

    2015-01-01

    The genes ABCC8 and KCNJ11 have received intense focus in type 2 diabetes mellitus (T2DM) research over the past two decades. It has been hypothesized that the p.E23K (KCNJ11) mutation in the 11p15.1 region may play an important role in the development of T2DM. In 2009, Hamming et al. found that the p.1369A (ABCC8) variant may be a causal factor in the disease; therefore, in this study we performed a meta-analysis to evaluate the association between these single nucleotide polymorphisms (SNPs), including our original data on the Siberian population (1384 T2DM and 414 controls). We found rs5219 and rs757110 were not associated with T2DM in this population, and that there was linkage disequilibrium in Siberians (D’=0.766, r2= 0.5633). In addition, the haplotype rs757110[T]-rs5219[C] (p.23K/p.S1369) was associated with T2DM (OR = 1.52, 95% CI: 1.04-2.24). We included 44 original studies published by June 2014 in a meta-analysis of the p.E23K association with T2DM. The total OR was 1.14 (95% CI: 1.11-1.17) for p.E23K for a total sample size of 137,298. For p.S1369A, a meta-analysis was conducted on a total of 10 studies with a total sample size of 14,136 and pooled OR of 1.14 [95% CI (1.08-1.19); p = 2 x 10-6]. Our calculations identified causal genetic variation within the ABCC8/KCNJ11 region for T2DM with an OR of approximately 1.15 in Caucasians and Asians. Moreover, the OR value was not dependent on the frequency of p.E23K or p.S1369A in the populations. PMID:25955821

  14. Matériaux diélectriques à base de K_2Sr4Nb{10}O_{30} présentant des courbes \\varepsilon'_r = f (T) plates avec de hautes constantes diélectriques

    NASA Astrophysics Data System (ADS)

    Tribotté, B.; Desgardin, G.

    1997-06-01

    BQT. Dans ce travail, nous montrons que des matériaux à base de K2Sr4Nb{10}O{30}, sans présence simultanée de phase pérovskite d'après la diffraction des rayons X, peuvent conduire à des courbes \\varepsilon'_r= f (T) à caractère plat.

  15. Symmetry and geometry considerations of atom transfer: deoxygenation of (silox)3WNO and R3PO (R = Me, Ph, (t)Bu) by (silox)3M (M = V, NbL (L = PMe3, 4-picoline), Ta; silox = (t)Bu3SiO).

    PubMed

    Veige, Adam S; Slaughter, LeGrande M; Lobkovsky, Emil B; Wolczanski, Peter T; Matsunaga, Nikita; Decker, Stephen A; Cundari, Thomas R

    2003-10-06

    Deoxygenations of (silox)(3)WNO (12) and R(3)PO (R = Me, Ph, (t)Bu) by M(silox)(3) (1-M; M = V, NbL (L = PMe(3), 4-picoline), Ta; silox = (t)Bu(3)SiO) reflect the consequences of electronic effects enforced by a limiting steric environment. 1-Ta rapidly deoxygenated R(3)PO (23 degrees C; R = Me (DeltaG degrees (rxn)(calcd) = -47 kcal/mol), Ph) but not (t)Bu(3)PO (85 degrees, >2 days), and cyclometalation competed with deoxygenation of 12 to (silox)(3)WN (11) and (silox)(3)TaO (3-Ta; DeltaG degrees (rxn)(calcd) = -100 kcal/mol). 1-V deoxygenated 12 slowly and formed stable adducts (silox)(3)V-OPR(3) (3-OPR(3)) with OPR(3). 1-Nb(4-picoline) (S = 0) and 1-NbPMe(3) (S = 1) deoxygenated R(3)PO (23 degrees C; R = Me (DeltaG degrees (rxn)(calcd from 1-Nb) = -47 kcal/mol), Ph) rapidly and 12 slowly (DeltaG degrees (rxn)(calcd) = -100 kcal/mol), and failed to deoxygenate (t)Bu(3)PO. Access to a triplet state is critical for substrate (EO) binding, and the S --> T barrier of approximately 17 kcal/mol (calcd) hinders deoxygenations by 1-Ta, while 1-V (S = 1) and 1-Nb (S --> T barrier approximately 2 kcal/mol) are competent. Once binding occurs, significant mixing with an (1)A(1) excited state derived from population of a sigma-orbital is needed to ensure a low-energy intersystem crossing of the (3)A(2) (reactant) and (1)A(1) (product) states. Correlation of a reactant sigma-orbital with a product sigma-orbital is required, and the greater the degree of bending in the (silox)(3)M-O-E angle, the more mixing energetically lowers the intersystem crossing point. The inability of substrates EO = 12 and (t)Bu(3)PO to attain a bent 90 degree angle M-O-E due to sterics explains their slow or negligible deoxygenations. Syntheses of relevant compounds and ramifications of the results are discussed. X-ray structural details are provided for 3-OPMe(3) (90 degree angle V-O-P = 157.61(9) degrees), 3-OP(t)Bu(3) ( 90 degree angle V-O-P = 180 degrees ), 1-NbPMe(3), and (silox)(3)ClWO (9).

  16. Linezolid-resistant Staphylococcus haemolyticus and Staphylococcus hominis: single and double mutations at the domain V of 23S rRNA among isolates from a Rio de Janeiro hospital.

    PubMed

    Chamon, Raiane Cardoso; Iorio, Natalia Lopes Pontes; Cavalcante, Fernanda Sampaio; Teodoro, Cristiane R S; de Oliveira, Ana Paula Chaves; Maia, Fernanda; dos Santos, Kátia Regina Netto

    2014-12-01

    In this work, the molecular and phenotypic antimicrobial resistance and clonal diversity of 10 linezolid-resistant Staphylococcus spp. isolates were investigated. The 7 Staphylococcus haemolyticus isolates presented Staphylococcal cassete chromosome mec (SCCmec) V and belonged to the same pulsed-field gel electrophoresis pulsotype. Their MICs for oxacillin, vancomycin, and linezolid were ≥ 256 μg/mL, 1-4 μg/mL, and 8-16 μg/mL, respectively. The 3 S. hominis presented MIC values 32 to >256 μg/mL, 2-4 μg/mL, and 12-24 μg/mL, and all carried the nontypeable SCCmec (ccr1 + mecA class) and belonged to 2 different genotypes. The cfr gene was not found, but the mutation G2603T was detected in S. haemolyticus and C2190T and G2603T in Staphylococcus hominis in 23S rRNA. This study demonstrates the spread of a linezolid-resistant S. haemolyticus genotype and, for the first time, describes the mutation C2190T among S. hominis isolates with a double mutation in Brazil. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Ada Compiler Validation Summary Report. Certificate Number: 920918S1. 11275 U.S. Navy Ada/M, Version 4.5 (/NO OPTIMIZE) VAX 8550/8600/8650 (Cluster) = VHSIC Processor Module (VPM) AN/AYK-14 (Bare Board)

    DTIC Science & Technology

    1992-10-27

    REPORT 1lr.I IMrF:MTATION PAGE OrM ft 00401 Hocq~i AD-A 265 4 3 7 : 6o tM0*lo i ue oWoo-fwva"o o "t "VoMaag ion 4LaVils HW~aiy. S, UAl 1204, k*Vinto...Porcessor Module (VPM) AN/AYK-14 (Bare Board) (target), 920918S1.11275 6. AUTHOR(S) National Institute of Standards and Technology Gaithersburg, MD USA 7 ...Summary Report ( VSR ) gives an account of the testing of this Ada implementation. For any technical terms used in this report, the reader is referred

  18. NiCo2S4 nanorod embedded rGO sheets as electrodes for supercapacitor

    NASA Astrophysics Data System (ADS)

    Sarkar, Aatreyee; Bera, Supriya; Chakraborty, Amit Kumar

    2018-04-01

    We report the synthesis of a hybrid nanostructure based on NiCo2S4 and reduced graphene oxide (rGO) following a facile hydrothermal method. X-ray diffraction (XRD), and electron microscopy (FESEM and HRTEM) analyses showed rod-like NiCo2S4 nanostructures embedded in rGO sheets. The electrochemical analysis of the synthesized nanohybrid using cyclic voltammetry (CV) and galvanostatic charge discharge (GCD) revealed specific capacitance of 410 F/gm indicating its suitability as a good electrode material for supercapacitor.

  19. Discovery of trans-4-[1-[[2,5-Dichloro-4-(1-methyl-3-indolylcarboxamido)phenyl]acetyl]-(4S)-methoxy-(2S)-pyrrolidinylmethoxy]cyclohexanecarboxylic acid: an orally active, selective very late antigen-4 antagonist.

    PubMed

    Muro, Fumihito; Iimura, Shin; Sugimoto, Yuuichi; Yoneda, Yoshiyuki; Chiba, Jun; Watanabe, Toshiyuki; Setoguchi, Masaki; Iigou, Yutaka; Matsumoto, Keiko; Satoh, Atsushi; Takayama, Gensuke; Taira, Tomoe; Yokoyama, Mika; Takashi, Tohru; Nakayama, Atsushi; Machinaga, Nobuo

    2009-12-24

    We have focused on optimization of the inadequate pharmacokinetic profile of trans-4-substituted cyclohexanecarboxylic acid 5, which is commonly observed in many small molecule very late antigen-4 (VLA-4) antagonists. We modified the lipophilic moiety in 5 and found that reducing the polar surface area of this moiety results in improvement of the PK profile. Consequently, our efforts have led to the discovery of trans-4-[1-[[2,5-dichloro-4-(1-methyl-3-indolylcarboxamido)phenyl]acetyl]-(4S)-methoxy-(2S)-pyrrolidinylmethoxy]cyclohexanecarboxylic acid (14e) with potent activity (IC(50) = 5.4 nM) and significantly improved bioavailability in rats, dogs, and monkeys (100%, 91%, 68%), which demonstrated excellent oral efficacy in murine and guinea pig models of asthma. Based on its overall profile, compound 14e was progressed into clinical trails. In a single ascending-dose phase I clinical study, compound 14e exhibited favorable oral exposure as expected and had no serious adverse events.

  20. Axial Fatigue Tests at Zero Mean Stress of 24S-T and 75S-T Aluminum-alloy Strips with a Central Circular Hole

    NASA Technical Reports Server (NTRS)

    Brueggeman, W C; Mayer, M JR

    1948-01-01

    Axial fatigue tests at zero mean stress have been made on 0.032- and 0.064-inch 24S-T and 0.032-inch 75S-T sheet-metal specimens 1/4, 1/2, 1, and 2 inches wide without a hole and with central holes giving a range of hole diameter D to specimen width W from 0.01 to 0.95. No systematic difference was noted between the results for the 0.032-inch and the 0.064-inch specimens although the latter seemed the more consistent. In general the fatigue strength based on the minimum section dropped sharply as the ration D/W was increased from zero to about 0.25. The plain specimens showed quite a pronounced decrease in fatigue strength with increasing width. The holed specimens showed only slight and rather inconclusive evidence of this size effect. The fatigue stress-concentration factor was higher for 75S-T than for 24S-T alloy. Evidence was found that a very small hole would not cause any reduction in fatigue strength.

  1. U.S. EPA, Pesticide Product Label, NACO COPPER-SEVIN-SULPHUR 4-5-75 DUST, 01/26/1972

    EPA Pesticide Factsheets

    2011-04-14

    'I'J)'1 ••• \\ 1 u. S. ( ,'" i) 0 i 1 d ) ) T \\ (' : 1 • ') <- Il (',\\1--' 10' , , ,J , .. !'O]J) t, , , I'! , , \\ r,' , , . I"'l' "" , " jl \\ t r,' 1 ,r' .( ! , I .: . ' 1 ( : .) - t , ., I \\ \\, ...

  2. U.S. EPA, Pesticide Product Label, COSSMAN PATIO PELLETS, 12/15/1969

    EPA Pesticide Factsheets

    2011-04-14

    ... F 'iE."I ,'" I, • r !c't',:ing 11" p.>rti,le ,.,j hait. The S,ln'!:' ~ijt parti,:e :!,1'0' ki.: ' .. t ' ' "et're it 1,'ses i's etfe,·tiveile~". S(dttl'!- li,,:1tlv '1, ~rd •. ·.I"l·; ~". ...

  3. The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

    PubMed Central

    Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

    2014-01-01

    Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

  4. Intercalated hybrid of kaolinite with KH2PO4 showing high ionic conductivity (∼10-4 S cm-1) at room temperature

    NASA Astrophysics Data System (ADS)

    Liu, Shao-Xian; Xue, Chen; Yang, Hao; Huang, Xiao-Qing; Zou, Yang; Ding, Yan-Ni; Li, Li; Ren, Xiao-Ming

    2017-12-01

    In this paper, we present the study of preparation and ionic conductance for an intercalated hybrid of kaolinite with potassium dihydrogen. The intercalation efficiency is high up to ca. 90%. The intercalated hybrid has been characterized by powder X-ray diffraction, infrared spectroscopy, and thermogravimetric analysis. The ionic conductivity (σ) of the hybrid material is strongly dependent on the moisture in the environment, with σ = 8.4 × 10-10 S cm-1 at 293 K and gradually increases to 7.16 × 10-9 S cm-1 under N2 atmosphere (anhydrous environment) at 353 K as well as an activation energy of Ea = 0.618 e V, whereas σ = 2.19 × 10-4 S cm-1 at 100% relative humidity and 293 K with Ea = 0.44 eV. The mechanism that the moisture affects the ionic conductance of the intercalated hybrid is further discussed.

  5. Measurement of D s + production and nuclear modification factor in Pb-Pb collisions at sqrt{{s}_{NN}}=2.76 TeV

    NASA Astrophysics Data System (ADS)

    Adam, J.; Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Almaraz, J. R. M.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Alves Garcia Prado, C.; Andrei, C.; Andronic, A.; Anguelov, V.; Anielski, J.; Antičić, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Belmont, R.; Belmont-Moreno, E.; Belyaev, V.; Bencedi, G.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biswas, R.; Biswas, S.; Bjelogrlic, S.; Blair, J. T.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Bøggild, H.; Boldizsár, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Bossú, F.; Botta, E.; Böttger, S.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Caffarri, D.; Cai, X.; Caines, H.; Calero Diaz, L.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Ceballos Sanchez, C.; Cepila, J.; Cerello, P.; Cerkala, J.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, S.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Balbastre, G. Conesa; Conesa del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Crochet, P.; Cruz Albino, R.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; De, S.; De Caro, A.; de Cataldo, G.; de Conti, C.; de Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; Deisting, A.; Deloff, A.; Dénes, E.; Deplano, C.; Dhankher, P.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Engel, H.; Epple, E.; Erazmus, B.; Erdemir, I.; Erhardt, F.; Espagnon, B.; Estienne, M.; Esumi, S.; Eum, J.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Fleck, M. G.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gallio, M.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Germain, M.; Gheata, A.; Gheata, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Goméz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, V.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Grachov, O. A.; Graczykowski, L. K.; Graham, K. L.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gronefeld, J. M.; Grosse-Oetringhaus, J. F.; Grossiord, J.-Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Haake, R.; Haaland, Ø.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hosokawa, R.; Hristov, P.; Huang, M.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Innocenti, G. M.; Ippolitov, M.; Irfan, M.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jahnke, C.; Jakubowska, M. J.; Jang, H. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jimenez Bustamante, R. T.; Jones, P. G.; Jung, H.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kamin, J.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Mohisin Khan, M.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, D. W.; Kim, D. J.; Kim, D.; Kim, H.; Kim, J. S.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobayashi, T.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Kretz, M.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Ladron de Guevara, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lea, R.; Leardini, L.; Lee, G. R.; Lee, S.; Lehas, F.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; León Vargas, H.; Leoncino, M.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martin Blanco, J.; Martinengo, P.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastroserio, A.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzoni, M. A.; Mcdonald, D.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Minervini, L. M.; Mischke, A.; Mishra, A. N.; Miskowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Montaño Zetina, L.; Montes, E.; Moreira De Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Munzer, R. H.; Murray, S.; Musa, L.; Musinsky, J.; Naik, B.; Nair, R.; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Natal da Luz, H.; Nattrass, C.; Nayak, K.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Oh, S. K.; Ohlson, A.; Okatan, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira Da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pagano, P.; Paić, G.; Pal, S. K.; Pan, J.; Pandey, A. K.; Papcun, P.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, W. J.; Parmar, S.; Passfeld, A.; Paticchio, V.; Patra, R. N.; Paul, B.; Peitzmann, T.; Pereira Da Costa, H.; Pereira De Oliveira Filho, E.; Peresunko, D.; Pérez Lara, C. E.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Ploskon, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Read, K. F.; Redlich, K.; Reed, R. J.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Revol, J.-P.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rocco, E.; Rodríguez Cahuantzi, M.; Rodriguez Manso, A.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Romita, R.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Šándor, L.; Sandoval, A.; Sano, M.; Sarkar, D.; Scapparone, E.; Scarlassara, F.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schuchmann, S.; Schukraft, J.; Schulc, M.; Schuster, T.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Shigaki, K.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singha, S.; Singhal, V.; Sinha, B. C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Søgaard, C.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spacek, M.; Spiriti, E.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Stachel, J.; Stan, I.; Stefanek, G.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Szabo, A.; Szanto de Toledo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tangaro, M. A.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thäder, J.; Thomas, D.; Tieulent, R.; Timmins, A. R.; Toia, A.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vajzer, M.; Vala, M.; Valencia Palomo, L.; Vallero, S.; Van Der Maarel, J.; Van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vechernin, V.; Veen, A. M.; Veldhoen, M.; Velure, A.; Venaruzzo, M.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Vislavicius, V.; Viyogi, Y. P.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Vranic, D.; Vrláková, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilkinson, J.; Williams, M. C. S.; Windelband, B.; Winn, M.; Yaldo, C. G.; Yang, H.; Yang, P.; Yano, S.; Yasar, C.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yoon, J. H.; Yurchenko, V.; Yushmanov, I.; Zaborowska, A.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zgura, I. S.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zyzak, M.

    2016-03-01

    The production of prompt D s + mesons was measured for the first time in collisions of heavy nuclei with the ALICE detector at the LHC. The analysis was performed on a data sample of Pb-Pb collisions at a centre-of-mass energy per nucleon pair, sqrt{s_{NN}} , of 2.76 TeV in two different centrality classes, namely 0-10% and 20-50%. D s + mesons and their antiparticles were reconstructed at mid-rapidity from their hadronic decay channel D s + → ϕπ +, with ϕ → K-K+, in the transverse momentum intervals 4 < p T < 12GeV/ c and 6 < p T < 12 GeV/ c for the 0-10% and 20-50% centrality classes, respectively. The nuclear modification factor R AA was computed by comparing the p T-differential production yields in Pb-Pb collisions to those in proton-proton (pp) collisions at the same energy. This pp reference was obtained using the cross section measured at sqrt{s}=7 TeV and scaled to sqrt{s}=2.76 TeV. The R AA of D s + mesons was compared to that of non-strange D mesons in the 10% most central Pb-Pb collisions. At high p T (8 < p T < 12 GeV/ c) a suppression of the D s + -meson yield by a factor of about three, compatible within uncertainties with that of non-strange D mesons, is observed. At lower p T (4 < p T < 8 GeV/ c) the values of the D s + -meson R AA are larger than those of non-strange D mesons, although compatible within uncertainties. The production ratios D s + /D0 and D s + /D+ were also measured in Pb-Pb collisions and compared to their values in proton-proton collisions. [Figure not available: see fulltext.

  6. Perturbative QCD analysis of exclusive processes e+e-→V P and e+e-→T P

    NASA Astrophysics Data System (ADS)

    Lü, Cai-Dian; Wang, Wei; Xing, Ye; Zhang, Qi-An

    2018-06-01

    We study the e+e-→V P and e+e-→T P processes in the perturbative QCD approach based on kT factorization, where the P , V and T denotes a light pseudoscalar, vector, and tensor meson, respectively. We point out in the case of e+e-→T P transition due to charge conjugation invariance, only three channels are allowed: e+e-→a2±π∓ , e+e-→K2*±K∓ and the V-spin suppressed e+e-→K2*0K¯ 0+K¯2 *0K0 . Cross sections of e+e-→V P and e+e-→T P at √{s }=3.67 GeV and √{s }=10.58 GeV are calculated and the invariant mass dependence is found to favor the 1 /s4 power law. Most of our theoretical results are consistent with the available experimental data and other predictions can be tested at the ongoing BESIII and forthcoming Belle-II experiments.

  7. "U.S.R.S., Grand Valley Project, Colo. Sprocket, shaft and chain for ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    "U.S.R.S., Grand Valley Project, Colo. Sprocket, shaft and chain for 70 ft. roller hoist. May 14, 1915." Note that on this and other working drawings of the roller gates, the German manufacturer/patent holder is not acknowledged - Grand Valley Diversion Dam, Half a mile north of intersection of I-70 & Colorado State Route 65, Cameo, Mesa County, CO

  8. Rational Design of Protein Stability: Effect of (2S,4R)-4-Fluoroproline on the Stability and Folding Pathway of Ubiquitin

    PubMed Central

    Crespo, Maria D.; Rubini, Marina

    2011-01-01

    Background Many strategies have been employed to increase the conformational stability of proteins. The use of 4-substituted proline analogs capable to induce pre-organization in target proteins is an attractive tool to deliver an additional conformational stability without perturbing the overall protein structure. Both, peptides and proteins containing 4-fluorinated proline derivatives can be stabilized by forcing the pyrrolidine ring in its favored puckering conformation. The fluorinated pyrrolidine rings of proline can preferably stabilize either a Cγ-exo or a Cγ-endo ring pucker in dependence of proline chirality (4R/4S) in a complex protein structure. To examine whether this rational strategy can be generally used for protein stabilization, we have chosen human ubiquitin as a model protein which contains three proline residues displaying Cγ-exo puckering. Methodology/Principal Findings While (2S,4R)-4-fluoroproline ((4R)-FPro) containing ubiquitinin can be expressed in related auxotrophic Escherichia coli strain, all attempts to incorporate (2S,4S)-4-fluoroproline ((4S)-FPro) failed. Our results indicate that (4R)-FPro is favoring the Cγ-exo conformation present in the wild type structure and stabilizes the protein structure due to a pre-organization effect. This was confirmed by thermal and guanidinium chloride-induced denaturation profile analyses, where we observed an increase in stability of −4.71 kJ·mol−1 in the case of (4R)-FPro containing ubiquitin ((4R)-FPro-ub) compared to wild type ubiquitin (wt-ub). Expectedly, activity assays revealed that (4R)-FPro-ub retained the full biological activity compared to wt-ub. Conclusions/Significance The results fully confirm the general applicability of incorporating fluoroproline derivatives for improving protein stability. In general, a rational design strategy that enforces the natural occurring proline puckering conformation can be used to stabilize the desired target protein. PMID:21625626

  9. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides A<->T+C<->G in the mitogenome of Kamimuria wangi.

    PubMed

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (X<->Y, i.e. A<->C) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the A<->T+C<->G exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  10. R1 in the Shaker S4 occupies the gating charge transfer center in the resting state

    PubMed Central

    Lin, Meng-chin A.; Hsieh, Jui-Yi; Mock, Allan F.

    2011-01-01

    During voltage-dependent activation in Shaker channels, four arginine residues in the S4 segment (R1–R4) cross the transmembrane electric field. It has been proposed that R1–R4 movement is facilitated by a “gating charge transfer center” comprising a phenylalanine (F290) in S2 plus two acidic residues, one each in S2 and S3. According to this proposal, R1 occupies the charge transfer center in the resting state, defined as the conformation in which S4 is maximally retracted toward the cytoplasm. However, other evidence suggests that R1 is located extracellular to the charge transfer center, near I287 in S2, in the resting state. To investigate the resting position of R1, we mutated I287 to histidine (I287H), paired it with histidine mutations of key voltage sensor residues, and determined the effect of extracellular Zn2+ on channel activity. In I287H+R1H, Zn2+ generated a slow component of activation with a maximum amplitude (Aslow,max) of ∼56%, indicating that only a fraction of voltage sensors can bind Zn2+ at a holding potential of −80 mV. Aslow,max decreased after applying either depolarizing or hyperpolarizing prepulses from −80 mV. The decline of Aslow,max after negative prepulses indicates that R1 moves inward to abolish ion binding, going beyond the point where reorientation of the I287H and R1H side chains would reestablish a binding site. These data support the proposal that R1 occupies the charge transfer center upon hyperpolarization. Consistent with this, pairing I287H with A359H in the S3–S4 loop generated a Zn2+-binding site. At saturating concentrations, Aslow,max reached 100%, indicating that Zn2+ traps the I287H+A359H voltage sensor in an absorbing conformation. Transferring I287H+A359H into a mutant background that stabilizes the resting state significantly enhanced Zn2+ binding at −80 mV. Our results strongly support the conclusion that R1 occupies the gating charge transfer center in the resting conformation. PMID:21788609

  11. U.S. EPA, Pesticide Product Label, VETERINARIAN TYPE DISINFECTANT, 10/22/1980

    EPA Pesticide Factsheets

    2011-04-14

    nlR[< I Itl'\\S fOJ;: !'S! GENER,\\l CI ,\\SSl F IrATI,·" i t ',j 3 It is ;1 viol"t{"l' tf r .. rl"ral ,.~". fl' ., .. pl'~duct in aI I9I11:nnf"r in.''1l ... • . t.·:1t '.·It" It l.ht"'liny. L ...

  12. Human Merkel cell polyomavirus small T antigen is an oncoprotein targeting the 4E-BP1 translation regulator

    PubMed Central

    Shuda, Masahiro; Kwun, Hyun Jin; Feng, Huichen; Chang, Yuan; Moore, Patrick S.

    2011-01-01

    Merkel cell polyomavirus (MCV) is the recently discovered cause of most Merkel cell carcinomas (MCCs), an aggressive form of nonmelanoma skin cancer. Although MCV is known to integrate into the tumor cell genome and to undergo mutation, the molecular mechanisms used by this virus to cause cancer are unknown. Here, we show that MCV small T (sT) antigen is expressed in most MCC tumors, where it is required for tumor cell growth. Unlike the closely related SV40 sT, MCV sT transformed rodent fibroblasts to anchorage- and contact-independent growth and promoted serum-free proliferation of human cells. These effects did not involve protein phosphatase 2A (PP2A) inhibition. MCV sT was found to act downstream in the mammalian target of rapamycin (mTOR) signaling pathway to preserve eukaryotic translation initiation factor 4E–binding protein 1 (4E-BP1) hyperphosphorylation, resulting in dysregulated cap-dependent translation. MCV sT–associated 4E-BP1 serine 65 hyperphosphorylation was resistant to mTOR complex (mTORC1) and mTORC2 inhibitors. Steady-state phosphorylation of other downstream Akt-mTOR targets, including S6K and 4E-BP2, was also increased by MCV sT. Expression of a constitutively active 4E-BP1 that could not be phosphorylated antagonized the cell transformation activity of MCV sT. Taken together, these experiments showed that 4E-BP1 inhibition is required for MCV transformation. Thus, MCV sT is an oncoprotein, and its effects on dysregulated cap-dependent translation have clinical implications for the prevention, diagnosis, and treatment of MCV-related cancers. PMID:21841310

  13. A new quaternary semiconductor compound (Ba2Sb4GeS10): Ab initio study

    NASA Astrophysics Data System (ADS)

    Ozisik, Havva Bogaz; Ozisik, Haci; Deligoz, Engin

    2017-03-01

    The newly synthesised Ba2Sb4GeS10 compound is notable because of the interesting features of the quaternary Sb-containing materials. The first principle method has been used to determine the physical properties of this compound. In particular, the electronic structure has been analysed using both conventional GGA-PBE and HSE06 functional. The values of the band gap for PBE and HSE06 calculations were 1.324 and 1.84 eV, respectively. The calculated elastic constants were used to predict polycrystalline mechanical properties. The estimated Vickers hardness (2.7 GPa) values show that Ba2Sb4GeS10 is soft matter. Moreover, the vibrational properties of the compound have been studied. The calculation of the elastic constants and phonon dispersion curves indicates that the Ba2Sb4GeS10 compound is stable both mechanically and dynamically. Furthermore, the minimum thermal conductivity and optical properties, such as dielectric functions and energy loss function, have also been discussed in detail in this paper.

  14. Pressure-enhanced superconductivity in Eu 3 Bi 2 S 4 F 4

    DOE PAGES

    Luo, Yongkang; Zhai, Hui -Fei; Zhang, Pan; ...

    2014-12-17

    The pressure effect on the newly discovered charge-transferred BiS 2-based superconductor, Eu 3Bi 2S 4F 4, with a T c of 1.5 K at ambient pressure, is investigated by transport and magnetic measurements. Accompanied with the enhancement of metallicity under pressures, the onset superconducting transition temperature increases abruptly around 1.0 GPa, reaching ~10.0 K at 2.26 GPa. Alternating current magnetic susceptibility measurements indicate that a new superconducting phase with a higher T c emerges and dominates at high pressures. In the broad pressure window of 0.68GPa≤p≤2.00 GPa, the high-T c phase coexists with the low-T c phase. Hall effect measurementsmore » reveal a significant difference in electronic structures between the two superconducting phases. As a result, our work devotes the effort to establish the commonality of pressure effect on the BiS 2-based superconductors, and also uncovers the importance of electron carrier density in the high-T c phase.« less

  15. Acculturation Indices as a Means of Confirming Cultural Differences. Navy Recruit’s Expectations of Productivity, Liking, and Intentions to Quit under Different Supervisors.

    DTIC Science & Technology

    1983-11-01

    C )a IaI Ř aa 36 14 14 o* f iAt NJ *. 4 I E .3 .4 .4 C4 CE .4.4CE @ . ev 13.4 *0 a 4**m r m...NA C 0407 / /1 N 0 E ,. E hh IDETEhEEhE L.6 1.8:(1111_25 JllO MICROCOPY RESOLUTION TEST CHART NATIONAL SuRfAL) PA ,JANDARD t A PERSONNEL TECHNOLOGY 00...A MEANS OF CONFIRMING CULTURAL DIFFERENCES H. C . Triandis, Y. Kashima, E . Shimada & M. Villareal Technical Report ONR-27 NAVY RECRUIT’S

  16. Observation of e + e → Φ χ c 1 and Φ χ c 2 at s = 4.600 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.

    Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a centerof- mass energy of √s = 4.600 GeV, we search for the production of e +e - → φχ c0,1,2. A search is also performed for the charmonium-like state X(4140) in the radiative transition e +e - → γX(4140) with X(4140) subsequently decaying into φJ/ψ. The processes e +e - → φχ c1 and φχ c2 are observed for the first time, each with a statistical significance ofmore than 10σ, and the Born cross sections are measuredmore » to be (4.2+1.7 -1.0±0.3) pb and (6.7+3.4 -1.7 ± 0.5) pb, respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e +e - → φχ c0 and e +e - → γX(4140) and upper limits on the Born cross sections at 90% confidence level are provided at √s = 4.600 GeV.« less

  17. Observation of e + e → Φ χ c 1 and Φ χ c 2 at s = 4.600 GeV

    DOE PAGES

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...

    2018-02-12

    Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a centerof- mass energy of √s = 4.600 GeV, we search for the production of e +e - → φχ c0,1,2. A search is also performed for the charmonium-like state X(4140) in the radiative transition e +e - → γX(4140) with X(4140) subsequently decaying into φJ/ψ. The processes e +e - → φχ c1 and φχ c2 are observed for the first time, each with a statistical significance ofmore than 10σ, and the Born cross sections are measuredmore » to be (4.2+1.7 -1.0±0.3) pb and (6.7+3.4 -1.7 ± 0.5) pb, respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e +e - → φχ c0 and e +e - → γX(4140) and upper limits on the Born cross sections at 90% confidence level are provided at √s = 4.600 GeV.« less

  18. How the Enceladus dust plume feeds Saturn’s E ring

    NASA Astrophysics Data System (ADS)

    Kempf, Sascha; Beckmann, Uwe; Schmidt, Jürgen

    2010-04-01

    Pre-Cassini models of Saturn's E ring [Horányi, M., Burns, J., Hamilton, D., 1992. Icarus 97, 248-259; Juhász, A., Horányi, M., 2002. J. Geophys. Res. 107, 1-10] failed to reproduce its peculiar vertical structure inferred from Earth-bound observations [de Pater, I., Martin, S.C., Showalter, M.R., 2004. Icarus 172, 446-454]. After the discovery of an active ice-volcanism of Saturn's icy moon Enceladus the relevance of the directed injection of particles for the vertical ring structure of the E ring was swiftly recognised [Juhász, A., Horányi, M., Morfill, G.E., 2007. Geophys. Res. Lett. 34, L09104; Kempf, S., Beckmann, U., Moragas-Klostermeyer, G., Postberg, F., Srama, R., Economou, T., Schmidt, J., Spahn, F., Grün, E., 2008. Icarus 193, 420-437]. However, simple models for the delivery of particles from the plume to the ring predict a too small vertical ring thickness and overestimate the amount of the injected dust. Here we report on numerical simulations of grains leaving the plume and populating the dust torus of Enceladus. We run a large number of dynamical simulations including gravity and Lorentz force to investigate the earliest phase of the ring particle life span. The evolution of the electrostatic charge carried by the initially uncharged grains is treated selfconsistently. Freshly ejected plume particles are moving in almost circular orbits because the Enceladus orbital speed exceeds the particles' ejection speeds by far. Only a small fraction of grains that leave the Hill sphere of Enceladus survive the next encounter with the moon. Thus, the flux and size distribution of the surviving grains, replenishing the ring particle reservoir, differs significantly from the flux and size distribution of the particles freshly ejected from the plume. Our numerical simulations reproduce the vertical ring profile measured by the Cassini Cosmic Dust Analyzer (CDA) [Kempf, S., Beckmann, U., Moragas-Klostermeyer, G., Postberg, F., Srama, R., EconoDmou, T

  19. Inactivation of Bacteria S. aureus ATCC 25923 and S. Thyphimurium ATCC 14 028 Influence of UV-HPEF

    NASA Astrophysics Data System (ADS)

    Bakri, A.; Hariono, B.; Utami, M. M. D.; Sutrisno

    2018-01-01

    The research was objected to study the performance of the UV unit - HPEF in inactivating bacteria population of Gram-positive (S aureus ATCC 25923) and Gram-negative (S Thyphimurium ATCC 14028) inoculated in sterilized goat’s milk. UV pasteurization instrument employed three reactors constructed in series UV-C system at 10 W, 253.7 nm wavelength made in Kada (USA) Inc. with 1.8 J/cm2 dose per reactor. HPEF instrument used high pulsed electric field at 31.67 kV/cm, 15 Hz and goat’s milk rate at 4:32 ± 0.71 cc/second. Pathogenic bacteria was observed According to Indonesian National Standard 01-2782-1998. Inactivation rate of pathogenic bacteria ie S Thyphimurium ATCC 14028 and S. aureus ATCC 25923 was 0.28 and 0.19 log cycle or 6.35 and 4.34 log cfu/ml/hour, respectively; D value was 0.16 and 0.23 hour with k value was 14.62 and 10 hour-1 respectively.

  20. VizieR Online Data Catalog: S4 1030+61 VLBA observations, 2009-2014 (Kravchenko+, 2016)

    NASA Astrophysics Data System (ADS)

    Kravchenko, E. V.; Kovalev, Y. Y.; Hovatta, T.; Ramakrishnan, V.

    2018-02-01

    The source S4 1030+61 was observed (code S2087E) with the VLBA of the National Radio Astronomy Observatory (NRAO) during four sessions: 2010-05-24, 2010-07-09, 2010-08-28 and 2010-10-18 (noted as 'epochs' below). We supplemented our analysis with the data obtained within the MOJAVE programme. Observations are done at 15.4GHz with VLBA at 10 epochs: 2009-06-25, 2009-12-26, 2010-12-24, 2011-04-11, 2011-05-26, 2011-07-15, 2012-01-02, 2012-03-27, 2012-11-11 and 2013-07-08. Public data (http://www.astro.caltech.edu/ovroblazars/) of S4 1030+61 observations within the OVRO 40-m Telescope monitoring programme were used in the analysis. Observations are done at 15GHz in a 3GHz bandwidth from 2008-06-20 to 2014-01-21 about twice per week. The γ-ray fluxes in the range 0.1-200GeV were obtained with the LAT onboard the space Fermi γ-ray observatory from 2008-08-04 to 2014-02-23. (3 data files).

  1. Synthesis, characterization, structural and biological aspects of copper(II) dithiocarbamate complexes - Part II, [Cu{S2CN(Me)(R1)}2], [Cu{S2CN(Me)(R2)}2] and [Cu{S2CN(R3)(R4)}2] {R1 = CH2CH(OMe)2, R2 = 2-methyl-1,3-dioxolane, R3 = CH2(CH2)2NCHPhOCH2Ph and R4 = CH2CH2OH}

    NASA Astrophysics Data System (ADS)

    Ferreira, Isabella P.; de Lima, Geraldo M.; Paniago, Eucler B.; Takahashi, Jacqueline A.; Krambrock, Klaus; Pinheiro, Carlos B.; Wardell, James L.; Visentin, Lorenzo C.

    2013-09-01

    Three new copper(II) dithiocarbamates (DTC), [Cu{S2CN(Me)(R1)}2] (1), [Cu{S2CN(Me)(R2)}2] (2) and [Cu{S2CN(R3)(R4)}2] (3) with R1 = CH2CH(OMe)2, R2 = 2-methyl-1,3-dioxolane, R3 = CH2(CH2)2NCHPhOCH2Ph and R4 = CH2CH2OH, have been synthesized and characterized by different spectroscopic techniques. Complexes (1) and (2) display typical EPR spectra for separated Cu(II) centers, and the spectrum of (3) is characteristic of two magnetically coupled Cu(II) ions with S = 1. The X-ray crystallographic determination has shown that complexes (1) and (2) crystallise in the triclinic and monoclinic systems. In addition both complexes are monomers in which the geometry at each Cu(II) is square planar. The in vitro antimicrobial activity of the sodium salts of ligands, and of the Cu(II)-DTC complexes have been screened against Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, Penicillium citrinum and Curvularia senegalensis, as well as Gram positive and Gram negative bacteria. Finally, the toxic effects of complexes (1)-(3) were performed using Chlorella vulgaris.

  2. Probing dynamics and mechanism of exchange process of quaternary ammonium dimeric surfactants, 14-s-14, in the presence of conventional surfactants.

    PubMed

    Liu, Jun; Jiang, Yan; Chen, Hong; Mao, Shi Zhen; Du, You Ru; Liu, Mai Li

    2012-12-27

    In this Article, we investigated effects of different types of conventional surfactants on exchange dynamics of quaternary ammonium dimeric surfactants, with chemical formula C(14)H(29)N(+)(CH(3))(2)- (CH(2))(s)-N(+)(CH(3))(2)C(14)H(29)·2Br(-), or 14-s-14 for short. Two nonionic surfactants, TritonX-100 (TX-100) and polyethylene glycol (23) laurylether (Brij-35), and one cationic surfactant, n-tetradecyltrimethyl ammonium bromide (TTAB), and one ionic surfactant, sodium dodecyl sulfate (SDS) were chosen as typical conventional surfactants. Exchange rates of 14-s-14 (s = 2, 3, and 4) between the micelle form and monomer in solution were detected by two NMR methods: one-dimensional (1D) line shape analysis and two-dimensional (2D) exchange spectroscopy (EXSY). Results show that the nonionic surfactants (TX-100 and Brij-35), the cationic surfactant (TTAB), and the ionic surfactant (SDS) respectively accelerated, barely influenced, and slowed the exchange rate of 14-s-14. The effect mechanism was investigated by the self-diffusion experiment, relaxation time measurements (T(2)/T(1)), the fluorescence experiment (I(1)/I(3)) and observed chemical shift variations. Results reveal that, nonionic conventional surfactants (TX-100 and Brij-35) loosened the molecule arrangement and decreased hydrophobic interactions in the micelle, and thus accelerated the exchange rate of 14-s-14. The cationic conventional surfactant (TTAB) barely changed the molecule arrangement and thus barely influenced the exchange rate of 14-s-14. The ionic conventional surfactant (SDS) introduced the electrostatic attraction effect, tightened the molecule arrangement, and increased hydrophobic interactions in the micelle, and thus slowed down the exchange rate of 14-s-14. Additionally, the two-step exchange mechanism of 14-s-14 in the mixed solution was revealed through interesting variation tendencies of exchange rates of 14-s-14.

  3. CRISPR-Cas-Mediated Gene Silencing Reveals RacR To Be a Negative Regulator of YdaS and YdaT Toxins in Escherichia coli K-12.

    PubMed

    Bindal, Gargi; Krishnamurthi, Revathy; Seshasayee, Aswin Sai Narain; Rath, Devashish

    2017-01-01

    Bacterial genomes are rich in horizontally acquired prophages. racR is an essential gene located in the rac prophage that is resident in many Escherichia coli genomes. Employing a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas-based gene silencing approach, we show that RacR is a negative regulator of the divergently transcribed and adjacent ydaS-ydaT operon in Escherichia coli K-12. Overexpression of YdaS and YdaT due to RacR depletion leads to cell division defects and decrease in survival. We further show that both YdaS and YdaT can act independently as toxins and that RacR serves to counteract the toxicity by tightly downregulating the expression of these toxins. IMPORTANCE racR is an essential gene and one of the many poorly studied genes found on the rac prophage element that is present in many Escherichia coli genomes. Employing a CRISPR-based approach, we have silenced racR expression to various levels and elucidated its physiological consequences. We show that the downregulation of racR leads to upregulation of the adjacent ydaS-ydaT operon. Both YdaS and YdaT act as toxins by perturbing the cell division resulting in enhanced cell killing. This work establishes a physiological role for RacR, which is to keep the toxic effects of YdaS and YdaT in check and promote cell survival. We, thus, provide a rationale for the essentiality of racR in Escherichia coli K-12 strains.

  4. CRISPR-Cas-Mediated Gene Silencing Reveals RacR To Be a Negative Regulator of YdaS and YdaT Toxins in Escherichia coli K-12

    PubMed Central

    Bindal, Gargi; Krishnamurthi, Revathy; Seshasayee, Aswin Sai Narain

    2017-01-01

    ABSTRACT Bacterial genomes are rich in horizontally acquired prophages. racR is an essential gene located in the rac prophage that is resident in many Escherichia coli genomes. Employing a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas-based gene silencing approach, we show that RacR is a negative regulator of the divergently transcribed and adjacent ydaS-ydaT operon in Escherichia coli K-12. Overexpression of YdaS and YdaT due to RacR depletion leads to cell division defects and decrease in survival. We further show that both YdaS and YdaT can act independently as toxins and that RacR serves to counteract the toxicity by tightly downregulating the expression of these toxins. IMPORTANCE racR is an essential gene and one of the many poorly studied genes found on the rac prophage element that is present in many Escherichia coli genomes. Employing a CRISPR-based approach, we have silenced racR expression to various levels and elucidated its physiological consequences. We show that the downregulation of racR leads to upregulation of the adjacent ydaS-ydaT operon. Both YdaS and YdaT act as toxins by perturbing the cell division resulting in enhanced cell killing. This work establishes a physiological role for RacR, which is to keep the toxic effects of YdaS and YdaT in check and promote cell survival. We, thus, provide a rationale for the essentiality of racR in Escherichia coli K-12 strains. PMID:29205229

  5. U.S.-U.S.S.R. Rail Inspection Information Exchange

    DOT National Transportation Integrated Search

    1977-06-01

    This trip report describes the results and conclusions of the U.S. delegation resulting from the U.S.-U.S.S.R. Rail Inspection Information exchange tour of the Soviet Union, August 24 through September 1, 1975. This information exchange was conducted...

  6. Transplantation rénale au Maroc: l'hémodialysé et son entourage sont-ils suffisamment informés?

    PubMed Central

    Noto-Kadou-Kaza, Béfa; Sabi, Kossi Akomola; Imangue, Ghislain; Al-Torayhi, Mays Hadi; Amekoudi, Eyram Yoan Makafui; Tsevi, Claude Mawufemo; Zamd, Mohamed; Medkouri, Ghislaine; Benghanem, Mohamed Gharbi; Ramdani, Benyounes

    2014-01-01

    Introduction La transplantation rénale constitue le traitement idéal de l'insuffisance rénale chronique. Cependant il existe une insuffisance de donneurs contrairement aux receveurs dont le nombre ne cesse de s'accroitre. La méconnaissance de la transplantation par les hémodialysés et leur entourage pourrait être l'une des causes. Notre but était d’évaluer les connaissances et opinions de l'hémodialysé et de son entourage sur la transplantation rénale. Méthodes L'enquête menée en Aout 2013 avait inclus 83 hémodialysés de notre centre et 70 membres de leur entourage. Ils ont été soumis à un questionnaire qui portait sur les thèmes suivants: statut socio-économique, volonté d’être transplanté ou d’être donneur, avantages de la transplantation rénale, point de vue de la religion sur la transplantation. Aucun des individus interrogés n'avait jamais fait l'objet d'une transplantation ou d'un don d'organe. Résultats Parmi 83 hémodialysés on notait 49,4% de femmes avec une moyenne d’âge de 41,4±12 ans. Le niveau socio-économique bas représentait 66,7%. Le manque d'information chez était estimé à 62,7%. Seuls 41% se disaient être candidat à la transplantation rénale mais 12% seulement était inscrit sur la liste d'attente de greffe. La transplantation était estimée plus couteuse que l'hémodialyse par 50,6% des patients et seuls 71,1% estimaient qu'elle offrait une meilleure vie. Pour 20,5%, l'Islam s'opposerait au don cadavérique et pour 10,9% au don vivant. Parmi les 70 membres de l'entourage interrogé il y avait 56,8% de femmes; la moyenne d’âge était de 44,4±10,5 ans. Le niveau économique bas représentait 52,3%. Le manque d'information était estimé à 61,4%. Pour 56,8% la vie serait impossible avec un seul rein. Seuls 13,6% étaient inscrit sur le registre de don. Pour 45,5% l'Islam s'opposerait au don cadavérique. Conclusion Il importe d'intensifier la sensibilisation des hémodialysées et leur famille

  7. Hydrogen-induced structural transition in single layer ReS2

    NASA Astrophysics Data System (ADS)

    Yagmurcukardes, M.; Bacaksiz, C.; Senger, R. T.; Sahin, H.

    2017-09-01

    By performing density functional theory-based calculations, we investigate how structural, electronic and mechanical properties of single layer ReS2 can be tuned upon hydrogenation of its surfaces. It is found that a stable, fully hydrogenated structure can be obtained by formation of strong S-H bonds. The optimized atomic structure of ReS2H2 is considerably different than that of the monolayer ReS2 which has a distorted-1T phase. By performing phonon dispersion calculations, we also predict that the Re2-dimerized 1T structure (called 1T {{}\\text{R{{\\text{e}}2}}} ) of the ReS2H2 is dynamically stable. Unlike the bare ReS2 the 1T {{}\\text{R{{\\text{e}}2}}} -ReS2H2 structure which is formed by breaking the Re4 clusters into separated Re2 dimers, is an indirect-gap semiconductor. Furthermore, mechanical properties of the 1T {{}\\text{R{{\\text{e}}2}}} phase in terms of elastic constants, in-plane stiffness (C) and Poisson ratio (ν) are investigated. It is found that full hydrogenation not only enhances the flexibility of the single layer ReS2 crystal but also increases anisotropy of the elastic constants.

  8. Asymmetric conjugate 1,4-addition of arylboronic acids to alpha, beta-unsaturated esters catalyzed by Rhodium(I)/(S)-binap

    PubMed

    Sakuma; Sakai; Itooka; Miyaura

    2000-09-22

    Arylboronic acids underwent the conjugate 1,4-addition to alpha, beta-unsaturated esters to give beta-aryl esters in high yields in the presence of a rhodium(I) catalyst. The addition of arylboronic acids to isopropyl crotonate resulted in high yields and high enantioselectivity exceeding 90% ee in the presence of 3 mol % of Rh(acac)(C(2)H(4))(2) and (S)-binap at 100 degrees C. The rhodium/(S)-binap complex provided (R)-3-phenylbutanoate in the addition of phenylboronic acid to benzyl crotonate. The effects on the enantioselectivity of chiral phosphine ligands, rhodium precursors, and substituents on alpha,beta-unsaturated esters are discussed, as well as the mechanistic aspect of the catalytic cycle.

  9. Fires. A Joint Publication for U.S. Artillery Professionals. July - August 2011

    DTIC Science & Technology

    2011-07-01

    fundamentalism was diametrically opposed to the democratic capitalist system and the Western conception of freedom and liberalism. The religion of Islam...The process of dismantling and inactivating the F i n a l l y , w e w e r e s t a r t i n g t o s e e s i g n s o f a n o r g a n i z a t i o...with the number of hostile attacks that the system has intercepted. (Photo courtesy of Task Force C-RAM) A l l t h a t w e d o a s m i l i t a r y

  10. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  11. U.S. Naval Strategy in the 1990s: Selected Documents

    DTIC Science & Technology

    2006-09-01

    Crawshaw , USN; Capt. Eric Briggs, USN; Capt. Charles Schaefer, USN; Cdr. Joseph Connelly, USN; Cdr. Al Seifert, USN; Capt. Frank Dobrydney, USN. † Vice...countermeasures 33 counter-terrorism 206, 208 courage 107 CPAM See CNO Program Analysis Memorandum Crawshaw , Robert 88 U . S . N A V A L S T R A T E G Y I N T

  12. Search for Strange Pentaquark Production in e{sup +}e{sup -} Annihilations at {radical}s=10.5 GeV and in {Upsilon}(4S) Decays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aubert, B

    2004-08-16

    The authors present a preliminary inclusive search for strange pentaquark production in e{sup +}e{sup -} interactions at a center-of-mass energy of 10.58 GeV using 123 fb{sup -1} of data collected with the BABAR detector. They look for the states that have been reported previously: the {Theta}{sup +}(1540), interpreted as a udud{bar s} state; and the {Xi}{sup --}(1860) and {Xi}{sup 0}(1860), candidate dsds{bar u} and uss(u{bar u} + d{bar d}) states, respectively. In addition they search for other members of the antidecuplet and corresponding octet to which these states are thought to belong. They find no evidence for the production ofmore » such states and set preliminary limits on their production cross sections as functions of c.m. momentum. The corresponding limits on the {Theta}{sup +}(1540) and {Xi}{sup --}(1860) rates per e{sup +}e{sup -} --> q{bar q} event are well below the rates measured for ordinary baryons of similar mass.« less

  13. An Overview of the Semi-Span Super-Sonic Transport (S4T) Wind-Tunnel Model Program

    NASA Technical Reports Server (NTRS)

    Silva, Walter A.; Perry, Boyd, III; Florance, James R.; Sanetrik, Mark D.; Wieseman, Carol D.; Stevens, William L.; Funk, Christie J.; Christhilf, David M.; Coulson, David A.

    2012-01-01

    A summary of computational and experimental aeroelastic (AE) and aeroservoelastic (ASE) results for the Semi-Span Super-Sonic Transport (S4T) wind-tunnel model is presented. A broad range of analyses and multiple AE and ASE wind-tunnel tests of the S4T wind-tunnel model have been performed in support of the ASE element in the Supersonics Program, part of the NASA Fundamental Aeronautics Program. This paper is intended to be an overview of multiple papers that comprise a special S4T technical session. Along those lines, a brief description of the design and hardware of the S4T wind-tunnel model will be presented. Computational results presented include linear and nonlinear aeroelastic analyses, and rapid aeroelastic analyses using CFD-based reduced-order models (ROMs). A brief survey of some of the experimental results from two open-loop and two closed-loop wind-tunnel tests performed at the NASA Langley Transonic Dynamics Tunnel (TDT) will be presented as well.

  14. Study of η and dipion transitions in Υ ( 4 S ) decays to lower bottomonia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guido, E.; Mussa, R.; Tamponi, U.

    We study hadronic transitions between bottomonium states using 496 fb -1 data collected at the $Y$(4S) resonance with the Belle detector at the KEKB asymmetric energy e +e - collider. We measure B($Y$(4S)→π +π -$-Y$(1S))=(8.2 ± 0.5(stat) ± 0.4(syst))×10 -5, B($Y$(4S) → π +π -$Y$ð2SÞÞ¼ð7.91.0ðstatÞ 0.4ðsystÞÞ×10-5, and Bð$Y$ð4SÞ → η$Y$ð1SÞÞ ¼ ð1.70 0.23ðstatÞ 0.08ðsystÞÞ × 10-4. We measure the ratio of branching fractions R ¼ Bð$Y$ð4SÞ → η$Y$ð1SÞÞ=Bð$Y$ð4SÞ → πþπ-$Y$ð1SÞÞ ¼ 2.07 0.30ðstatÞ 0.11ðsystÞ. We search for the decay $Y$ð13D1;2 Þ → η$Y$ð1SÞ, but do not find significant evidence for such a transition.We also measure the initial-state radiation production crossmore » sections of the $Y$ð2S; 3SÞ resonances and we find values compatible with the expected ones. Finally, the analysis of the $Y$(4S) → π +π -$Y$(1S) events shows indications for a resonant contribution due to the f 0 (980) meson.« less

  15. [Synthesis and biological activity of 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone analogs. 1. Substitution at the S atom].

    PubMed

    Schulze, W; Gutsche, W; Wohlrabe, K; Fleck, W; Tresselt, D

    1985-08-01

    The synthesis of S-substituted derivatives of 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone is described. The obtained 1,4-benzoquinone-guanylhydrazone-S-alkyl (resp. aralkyl)-isothiosemicarbazones, in comparison with the unsubstituted standard compound, showed a significantly decreased biological activity against the murine leukemias L 1210 and P 388 as well as against the growth of several kinds of bacteria. Therefore the S-substitution seems not to be useful for reaching a maximum activity.

  16. 14 CFR 382.10 - How does a U.S. or foreign carrier obtain a determination that it is providing an equivalent...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false How does a U.S. or foreign carrier obtain a....10 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) SPECIAL REGULATIONS NONDISCRIMINATION ON THE BASIS OF DISABILITY IN AIR TRAVEL General Provisions § 382.10...

  17. 14 CFR 382.10 - How does a U.S. or foreign carrier obtain a determination that it is providing an equivalent...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 4 2011-01-01 2011-01-01 false How does a U.S. or foreign carrier obtain a....10 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) SPECIAL REGULATIONS NONDISCRIMINATION ON THE BASIS OF DISABILITY IN AIR TRAVEL General Provisions § 382.10...

  18. 14 CFR 382.10 - How does a U.S. or foreign carrier obtain a determination that it is providing an equivalent...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 4 2012-01-01 2012-01-01 false How does a U.S. or foreign carrier obtain a....10 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) SPECIAL REGULATIONS NONDISCRIMINATION ON THE BASIS OF DISABILITY IN AIR TRAVEL General Provisions § 382.10...

  19. 14 CFR 382.10 - How does a U.S. or foreign carrier obtain a determination that it is providing an equivalent...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 4 2013-01-01 2013-01-01 false How does a U.S. or foreign carrier obtain a....10 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) SPECIAL REGULATIONS NONDISCRIMINATION ON THE BASIS OF DISABILITY IN AIR TRAVEL General Provisions § 382.10...

  20. 14 CFR 382.10 - How does a U.S. or foreign carrier obtain a determination that it is providing an equivalent...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 4 2014-01-01 2014-01-01 false How does a U.S. or foreign carrier obtain a....10 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) SPECIAL REGULATIONS NONDISCRIMINATION ON THE BASIS OF DISABILITY IN AIR TRAVEL General Provisions § 382.10...

  1. Helicopter Flying Qualities Characteristics-CH-46E. Volume 4.

    DTIC Science & Technology

    1983-10-03

    AUSI I&N r- oLnC N.rW UN .- i"e 9- cm ca q -. in 40f IWc %’c .a w - S. %.* *% p" .. . . . . . . . . . . . . . . . . . . . .. * N M . 7 - 7 -- 7 NADC-81 118...09l1 ’. 0:0 a.o 100 a.W*0, CD N %r 001’lIN cm N %0I~C .41 L 0..J" a . 0 . N CLCL v o N40 7 Zu E.a.. N U.be"-a ~N O n 1- -OIn-4 LLU0Dw a cI 1 & 6% tN o" K...Helicopter Flying Qualities Final Report ~iaaerscs-6. PERFORMING ORG. REPORT HUMMER Volume 4______________ 7 .- AUTHOR() S. CONTRACT OR GRANT NUMUER1(s) 9

  2. Molecular mechanism of the dual activity of 4EGI-1: Dissociating eIF4G from eIF4E but stabilizing the binding of unphosphorylated 4E-BP1

    DOE PAGES

    Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; ...

    2015-07-13

    The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less

  3. U.S. EPA, Pesticide Product Label, PURITY BACTERIOSTATIC WATER TREATMENT UNIT,MODEL 514C.C., 09/10/1982

    EPA Pesticide Factsheets

    2011-04-21

    ... [ .... EEO PL"',lI.', Pl:>1S:. .. · nAG.',EEJ A€~f)EA~''''ETTlE RE::'f-o':'::l P,G'.H:JR;)S",lhPEt. ... ','.! Pf" g':-'" iI~~~ 2.- ~~. I.~r 0" S' l_t e I.l'l ~aM;: .I.,. ...

  4. The immunometabolite S-2-hydroxyglutarate regulates CD8+ T-lymphocyte fate

    PubMed Central

    Tyrakis, Petros A.; Palazon, Asis; Macias, David; Lee, Kian. L.; Phan, Anthony. T.; Veliça, Pedro; You, Jia; Chia, Grace S.; Sim, Jingwei; Doedens, Andrew; Abelanet, Alice; Evans, Colin E.; Griffiths, John R.; Poellinger, Lorenz; Goldrath, Ananda. W.; Johnson, Randall S.

    2016-01-01

    R-2-hydroxyglutarate accumulates to millimolar levels in cancers with gain-of-function isocitrate dehydrogenase 1/2 mutations. These levels of R-2-hydroxyglutarate affect 2-oxoglutarate-dependent dioxygenases. Both R- and S-2-hydroxyglutarate, the other enantiomer of this metabolite, are detectible in healthy individuals, yet their physiological function remains elusive. Here we show that CD8+ T-lymphocytes accumulate 2-hydroxyglutarate in response to T-cell receptor triggering. This increases to millimolar levels in physiological oxygen conditions, via a hypoxia inducible factor 1 alpha-dependent mechanism. S-2-hydroxyglutarate predominates over R-2-hydroxyglutarate in activated T cells, and we demonstrate alterations in markers of CD8+ T-lymphocyte differentiation in response to this metabolite. Modulation of histone and DNA demethylation as well as hypoxia inducible factor 1 alpha stability mediate these effects. S-2-hydroxyglutarate treatment greatly enhances the in vivo proliferation, persistence and anti-tumour capacity of adoptively transferred CD8+ T-lymphocytes. Thus S-2-hydroxyglutarate acts as an immunometabolite that links environmental context, via a metabolic-epigenetic axis, to immune fate and function. PMID:27798602

  5. 75 FR 21344 - Filing of Plats of Survey: Oregon/Washington

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-23

    ... publication. Willamette Meridian Oregon T. 14 S., R. 7 W., accepted March 9, 2010. T. 26 S., R. 7 W., accepted March 9, 2010. T. 22 S., R. 10 E., accepted March 22, 2010. T. 31 S., R. 14 W., accepted March 22, 2010.... 10 W., accepted April 2, 2010. T. 31 S., R. 13 W., accepted April 2, 2010. T. 21 S., R. 8 W...

  6. Measurement of the 1s2s ^1S0 - 1s2p ^3P1 interval in helium-like silicon.

    NASA Astrophysics Data System (ADS)

    Redshaw, M.; Harry, R.; Myers, E. G.; Weatherford, C. A.

    2001-05-01

    Accurate calculation of the energy levels of helium-like ions is a basic problem in relativistic atomic theory. For the n=3D2 levels at moderate Z, published calculations give all ``structure'' but not all explicit QED contributions to order (Zα)^4 a.u.(D.R. Plante, W.R. Johnson and J. Sapirstein, Phys. Rev. A 49), 3519 (1994).^, (K.T. Cheng, M.H. Chen, W.R. Johnson and J. Sapirstein, Phys. Rev. A 50), 247 (1994).. Measurements of the 1s2p ^3P - 1s2s ^3S transitions, which lie in the vacuum ultra-violet, are barely precise enough to challenge the theory. However, the intercombination 1s2s ^1S0 - 1s2p ^3P1 interval lies in the infra-red for Z<40 and enables precision measurements using laser spectroscopy(E.G. Myers, J.K. Thompson, E.P. Gavathas, N.R. Claussen, J.D. Silver and D.J.H. Howie, Phys. Rev. Lett. 75), 3637 (1995).. We aim to measure this interval in Si^12+ using a foil-stripped 1 MeV/u ion beam from the Florida State Van de Graaff accelerator and a single-mode c.w. Nd:YAG laser at 1.319 μm. To obtain a sufficient transition probability, the Si^12+ beam is merged co-linearly with the laser light inside an ultra-high finesse build-up cavity. The results should provide a clear test of current and developing calculations of QED contributions in two-electron ions.

  7. Determination of the 1s2{\\ell }2{{\\ell }}^{\\prime } state production ratios {{}^{4}P}^{o}/{}^{2}P, {}^{2}D/{}^{2}P and {{}^{2}P}_{+}/{{}^{2}P}_{-} from fast (1{s}^{2},1s2s\\,{}^{3}S) mixed-state He-like ion beams in collisions with H2 targets

    NASA Astrophysics Data System (ADS)

    Benis, E. P.; Zouros, T. J. M.

    2016-12-01

    New results are presented on the ratio {R}m={σ }{T2p}( {}4P)/{σ }{T2p}({}2P) concerning the production cross sections of Li-like 1s2s2p quartet and doublet P states formed in energetic ion-atom collisions by single 2p electron transfer to the metastable 1s2s {}3S component of the He-like ion beam. Spin statistics predict a value of R m = 2 independent of the collision system in disagreement with most reported measurements of {R}m≃ 1{--}9. A new experimental approach is presented for the evaluation of R m having some practical advantages over earlier approaches. It also allows for the determination of the separate contributions of ground- and metastable-state beam components to the measured spectra. Applying our technique to zero-degree Auger projectile spectra from 4.5 MeV {{{B}}}3+ (Benis et al 2002 Phys. Rev. A 65 064701) and 25.3 MeV {{{F}}}7+ (Zamkov et al 2002 Phys. Rev. A 65 062706) mixed state (1{s}2 {}1S,1s2s {}3S) He-like ion collisions with H2 targets, we report new values of {R}m=3.5+/- 0.4 for boron and {R}m=1.8+/- 0.3 for fluorine. In addition, the ratios of {}2D/{}2P and {{}2P}+/{{}2P}- populations from either the metastable and/or ground state beam component, also relevant to this analysis, are evaluated and compared to previously reported results for carbon collisions on helium (Strohschein et al 2008 Phys. Rev. A 77 022706) including a critical comparison to theory.

  8. RpoS induces expression of the Vibrio anguillarum quorum-sensing regulator VanT.

    PubMed

    Weber, Barbara; Croxatto, Antony; Chen, Chang; Milton, Debra L

    2008-03-01

    In vibrios, regulation of the Vibrio harveyi-like LuxR transcriptional activators occurs post-transcriptionally via small regulatory RNAs (sRNAs) that destabilize the luxR mRNA at a low cell population, eliminating expression of LuxR. Expression of the sRNAs is modulated by the vibrio quorum-sensing phosphorelay systems. However, vanT mRNA, which encodes a LuxR homologue in Vibrio anguillarum, is abundant at low and high cell density, indicating that VanT expression may be regulated via additional mechanisms. In this study, Western analyses showed that VanT was expressed throughout growth with a peak of expression during late exponential growth. VanO induced partial destabilization of vanT mRNA via activation of at least one Qrr sRNA. Interestingly, the sigma factor RpoS significantly stabilized vanT mRNA and induced VanT expression during late exponential growth. This induction was in part due to RpoS repressing expression of Hfq, an RNA chaperone. RpoS is not part of the quorum-sensing regulatory cascade since RpoS did not regulate expression or activity of VanO, and RpoS was not regulated by VanO or VanT. VanT and RpoS were needed for survival following UV irradiation and for pigment and metalloprotease production, suggesting that RpoS works with the quorum-sensing systems to modulate expression of VanT, which regulates survival and stress responses.

  9. Dynamic mobility application policy analysis : policy and institutional issues for Response, Emergency Staging and Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E).

    DOT National Transportation Integrated Search

    2015-07-01

    This report documents policy considerations for Response, Emergency Staging and Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E). R.E.S.C.U.M.E. comprises a "bundle" of mobility applications that use existing and new connected vehic...

  10. An examination of the thermodynamics of fusion, vaporization, and sublimation of (R,S)- and (R)-flurbiprofen by correlation gas chromatography.

    PubMed

    Umnahanant, Patamaporn; Hasty, Darrell; Chickos, James

    2012-06-01

    The vaporization, fusion, and sublimation enthalpies of (R,S)- and (R)-flurbiprofen at T = 298.15 K are reported and compared with literature values when available. Correlation gas chromatography experiments were first performed to identify appropriate standards that could be used for materials containing a single fluorine substituent. Subsequent correlations resulted in a vaporization enthalpy for (R,S)-flurbiprofen and (R)-flurbiprofen, ΔH(vap) (298.15 K), of (127.5 ± 5.5) and (127.4 ± 4.7) kJ mol, respectively. Fusion enthalpies, ΔH(fus) (387 K), of (28.2 ± and, ΔH(fus) (381 K), (22.8 ± kJ mol(-1) were also measured by differential scanning calorimetry for the racemic and chiral forms of flurbiprofen. Adjusted to T = 298.15 K and combined with the vaporization enthalpy resulted in sublimation enthalpies, ΔH(sub) (298.15 K), of (155.6 ± 5.8) and (145.1 ± 5.7) kJ mol(-1) for (R,S)- and (R)-flurbiprofen, respectively. The fusion enthalpy measured for the racemic form was in excellent agreement with the literature value, while the sublimation enthalpy varies substantially from previous work. Two weak solid-solid phase transitions were also observed for (R)-flurbiprofen at T = 353.9 K (0.30 ± 0.1) and 363.2 K (0.21 ± 0.03) kJ · mol(-1). Copyright © 2012 Wiley Periodicals, Inc.

  11. 50 CFR 1.4 - Director.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Director. 1.4 Section 1.4 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR GENERAL PROVISIONS DEFINITIONS § 1.4 Director. Director means the Director, U.S. Fish and Wildlife Service or the authorized...

  12. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    PubMed Central

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  13. Alpha List of Prime Contract Awards. Oct 91 - Sep 92. FY 92 (General Image Engineering Corp - H E H Heins GMBH)

    DTIC Science & Technology

    1993-01-01

    CDO-4 zaw O il E sOO Mcq it 0 0 0 0 0 0D (’AN 00 ɜ 1 MI 10 3a’COON U.L 1-1 Ui. 4 -. C>O - LA- WA 1-1 La-O)OC 1-14- Wr2CO iO z- 0 0) 01 a 00 0 0 0 0 4...0 c) tun r- 1-1 In a) cli In r- f-- to <> V) r- r- I- -i ,1 14 ed < o c) 11 00 (0 (0 (D (10 Z) (0 00 0 C> o C> 00 (Tf o 00 C) C, 00 qzr 00-4 r- t- P

  14. Propriétés optiques du silicium mésoporeux et ses applications potentielles

    NASA Astrophysics Data System (ADS)

    Lévy-Clément, C.; Bastide, S.

    2002-04-01

    Une couche de silicium poreux formée électrochimiquement à la surface de l'émetteur d'une jonction p-n+ peut jouer efficacement le rôle d'une couche antireflet pour les cellules solaires au silicium. En ajustant la densité de courant et le temps de formation, des simple et double-couches antireflet aux propriétés optiques optimisées ont pu être réalisées, conduisant à des réflectivités effectives respectives de 7.3 et 2.7 % sur l'ensemble du spectre solaire utile pour les cellules (400-1000 nm). De hauts rendements de conversion de l'énergie solaire, de l'ordre de 13-13.4 %, sont ainsi actuellement obtenus pour des cellules au silicium multicristallin avec une couche antireflet de silicium poreux.

  15. État de santé des nouveaux réfugiés à Toronto, en Ontario

    PubMed Central

    Redditt, Vanessa J.; Graziano, Daniela; Janakiram, Praseedha; Rashid, Meb

    2015-01-01

    Résumé Objectif Déterminer la prévalence de certaines maladies chroniques parmi les nouveaux réfugiés et la présence ou non d’une variation en fonction de facteurs démographiques clés. Conception Revue rétrospective de dossiers. Contexte Clinique de soins primaires pour patients réfugiés à Toronto, en Ontario. Participants Au total, 1063 patients réfugiés inscrits à la clinique entre décembre 2011 et juin 2014. Principaux paramètres à l’étude Données démographiques (âge, sexe et pays de naissance); prévalence de résultats anormaux au test Pap, d’anémie, d’élévation de la tension artérielle (TA) et de présence de marqueurs de prédiabète ou de diabète (glycémie aléatoire, glycémie à jeun ou taux d’hémoglobine A1c élevés). Résultats Plus de la moitié de nos patients étaient des femmes (56 %) et l’âge médian était de 29 ans. Les réfugiés étaient nés dans 87 pays différents. Les pays d’origine du plus grand nombre de réfugiés étaient la Hongrie (210 patients), la Corée du Nord (119 patients) et le Nigéria (93 patients). La plupart des patients sont arrivés à titre de demandeurs d’asile (92 %) plutôt qu’à titre de réfugiés pris en charge par le gouvernement (5 %). Dans l’ensemble, 11 % des patientes ayant subi un test Pap ont obtenu des résultats de cytologie cervicale anormaux, ce taux étant le plus élevé parmi les patientes originaires d’Asie (26 %; p = 0,028). La prévalence d’anémie parmi les enfants de moins de 15 ans était de 11 %; et elle était de 14 % parmi les enfants de moins de 5 ans. Environ 25 % des femmes de plus de 15 ans étaient anémiques, ce taux était le plus élevé parmi les patientes originaires d’Afrique (37 %; p < 0,001). L’élévation de la TA a été observée chez 30 % des adultes de plus de 15 ans, ce taux étant supérieur parmi les patients de sexe masculin (38 %; p < 0,001) et originaires d’Europe (42 %; p < 0,001). Les marqueurs biologiques

  16. A Very Compact Rijndael S-Box

    DTIC Science & Technology

    2004-09-28

    01101011 84 N4 108 6C 01101100 250 R 109 6D 01101101 133 s128 110 6E 01101110 61 S64 111 6F 01101111 186 n64 112 70 01110000 43 m 113 71 01110001 121...109 6D 01101101 133 s128 183 B7 10110111 134 C128 194 C2 11000010 135 T 128 93 5D 01011101 136 α8 231 E7 11100111 137 g128 50 32 00110010 138 N128 86

  17. Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

    PubMed

    Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

    2003-01-01

    The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

  18. Investigation of the Photocurrent in Hot-Wall-Epitaxy-Grown BaIn2S4 Layers

    NASA Astrophysics Data System (ADS)

    You, S. H.; Hong, K. J.; Jeong, T. S.; Youn, C. J.

    2015-12-01

    The photocurrent (PC) of hot-wall-epitaxy-grown BaIn2S4 layers was studied at different temperatures and for different photoresponse intensities. With increasing temperature, the position of the PC spectra tended to shift toward longer wavelength. These PC peaks corresponded to band-to-band transitions caused by intrinsic transitions from the valence band states to the conduction band states. Also, the bandgap variations were well matched by the equation E g( T) = E g(0) - 3.79 × 10-3 T 2/( T + 499), where E g(0) was estimated to be 3.0597 eV, 3.2301 eV, and 3.2606 eV for transitions corresponding to the valence band states Γ 4(z), Γ 5(x), and Γ 5(y), respectively. By use of the selection rule and results from the PC spectroscopy, the crystal field and the spin-orbit splitting were found to be 0.1703 and 0.0306 eV, respectively. Thus, the PC intensity gradually decreased with decreasing temperature. The decrease of PC intensity was caused by the presence of trapping centers associated with native defects in the BaIn2S4 layers. The trap level was found to be a shallow donor-level type of 20.4 meV, 1.6 meV below the conduction band. Consequently, these trap levels, which are related to native defects in BaIn2S4 layers, are believed to limit PC intensity with decreasing temperature.

  19. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    PubMed

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  20. Significant linkage disequilibrium between the Huntington disease gene and the loci D4S10 and D4S95 in the Dutch population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skraastad, M.I.; Van de Vosse, E.; Belfroid, R.

    1992-10-01

    Significant linkage disequilibrium has been found between the Huntington disease (HD) gene and DNA markers located around D4S95 and D4S98. The linkage-disequilibrium studies favor the proximal location of the HD gene, in contrast to the conflicting results of recombination analyses. The authors have analyzed 45 Dutch HD families with 19 DNA markers and have calculated the strength of linkage disequilibrium. Highly significant linkage disequilibrium has been detected with D4S95, consistent with the studies in other populations. In contrast with most other studies, however, the area of linkage disequilibrium extends from D4S10 proximally to D4S95, covering 1,100 kb. These results confirmmore » that the HD gene most likely maps near D4S95. 28 refs., 1 fig., 2 tabs.« less

  1. A Short-Term, Quasi-Experimental Evaluation of D.A.R.E.'s Revised Elementary School Curriculum

    ERIC Educational Resources Information Center

    Vincus, Amy A.; Ringwalt, Chris; Harris, Melissa S.; Shamblen, Stephen R.

    2010-01-01

    We present the short-term results of a quasi-experimental evaluation of the revised D. A. R. E. (Drug Abuse Resistance Education) curriculum. Study outcomes examined were D. A. R. E.'s effects on three substances, namely students' lifetime and 30-day use of tobacco, alcohol, and marijuana, as well as their school attendance and academic…

  2. Appendicite aigue non compliquée: y a-t- il une place pour le traitement conservateur

    PubMed Central

    El Khader, Ahmed; Lahkim, Mohamed; El Barni, Rachid; Achour, Abdessamad

    2015-01-01

    Le but de cette étude a été d’évaluer l'efficacité de l'antibiothérapie seule dans le traitement des appendicites aigues non compliquées. C'est une étude prospective, intéressant 68 patients ayant eu une appendicite aigue simple, de confirmation radiologique, traités par l'amoxicilline associée à l'acide clavulanique pendant 10 jours. L'appendicectomie a été réalisée en cas d'aggravation ou en cas de non amélioration au bout de 48heures de traitement. Le traitement conservateur a été efficace dans 82,35% avec une résolution complète des symptômes chez 56 patients. Les 12 cas restants (17,65%) ont subit une appendicectomie. l'appendicite a été gangréneuse dans 8 cas et phlegmoneuse dans 4 cas. Cinq des 56 patients, qui ont bien évolué sous traitement conservateur, ont été réadmis et opérés pour récidive, soit 8,9%. Deux cas ont eu une appendicite compliquée. L'appendicectomie reste le traitement de référence pour l'appendicite aigue, mais le traitement antibiotique peut être proposé en première intension à des patients présentant une appendicite aigue non compliquée. PMID:26327981

  3. 40 CFR 81.303 - Arizona.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...′ 111°29.0min; 1 X San Manuel: T10S, R16E X T10S, R17E X Morenci: T4S, R29E 1 X Rest of State 1 X 1 EPA... x T4S, R28E 2 x T4S, R29E x T4S, R30E x T5S, R28E 2 x T5S, R29E 2 x T5S, R30E x San Manuel: T8S... outside Tucson Area: Pinal County Santa Cruz County Yavapai County Yuma County 1 This date is November 15...

  4. Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

    PubMed Central

    Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

    2014-01-01

    Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

  5. Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

  6. Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

    PubMed

    Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

    2004-07-16

    In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

  7. 1,4-Dioxane

    Integrated Risk Information System (IRIS)

    EPA / 635 / R - 11 / 003F www.epa.gov / iris TOXICOLOGICAL REVIEW OF 1,4 - DIOXANE ( WITH INHALATION UPDATE ) ( CAS No . 123 - 91 - 1 ) In Support of Summary Information on the Integrated Risk Information System ( IRIS ) September 2013 U.S . Environmental Protection Agency Washington , DC DISCLAIMER

  8. La Deletion from Mouse Brain Alters Pre-tRNA Metabolism and Accumulation of Pre-5.8S rRNA, with Neuron Death and Reactive Astrocytosis

    PubMed Central

    Blewett, Nathan H.; Iben, James R.; Gaidamakov, Sergei

    2017-01-01

    ABSTRACT Human La antigen (Sjögren's syndrome antigen B [SSB]) is an abundant multifunctional RNA-binding protein. In the nucleoplasm, La binds to and protects from 3′ exonucleases, the ends of precursor tRNAs, and other transcripts synthesized by RNA polymerase III and facilitates their maturation, while a nucleolar isoform has been implicated in rRNA biogenesis by multiple independent lines of evidence. We showed previously that conditional La knockout (La cKO) from mouse cortex neurons results in defective tRNA processing, although the pathway(s) involved in neuronal loss thereafter was unknown. Here, we demonstrate that La is stably associated with a spliced pre-tRNA intermediate. Microscopic evidence of aberrant nuclear accumulation of 5.8S rRNA in La cKO is supported by a 10-fold increase in a pre-5.8S rRNA intermediate. To identify pathways involved in subsequent neurodegeneration and loss of brain mass in the cKO cortex, we employed mRNA sequencing (mRNA-Seq), immunohistochemistry, and other approaches. This revealed robust enrichment of immune and astrocyte reactivity in La cKO cortex. Immunohistochemistry, including temporal analyses, demonstrated neurodegeneration, followed by astrocyte invasion associated with immune response and decreasing cKO cortex size over time. Thus, deletion of La from postmitotic neurons results in defective pre-tRNA and pre-rRNA processing and progressive neurodegeneration with loss of cortical brain mass. PMID:28223366

  9. Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

    PubMed Central

    Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

    1982-01-01

    1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

  10. Physical mapping of 18S-25S rDNA and 5S rDNA in Lupinus via fluorescent in situ hybridization.

    PubMed

    Naganowska, Barbara; Zielińska, Anna

    2002-01-01

    Double-target fluorescent in situ hybridization (FISH) was used to determine the genomic distribution of ribosomal RNA genes in five Lupinus species: L. cosentinii (2n=32), L. pilosus (2n=42), L. angustifolius (2n=40), L. luteus (2n=52) and L. mutabilis (2n=48). 18S-25S rDNA and 5S rDNA were used as probes. Some interspecific variation was observed in the number and size of the 18S-25S rDNA loci. All the studied species had one chromosome pair carrying 5S rDNA.

  11. Mechanical Properties of Aerojet, Thiokol, and JA2 High-Energy Gun Propellants at 1.5 m/s Deformation Rate

    DTIC Science & Technology

    2002-01-01

    a2 6 n -32 4C La /C A> i c 4S Figure 5. Remains of specimens tested at 210, 630, and -32 0C. 5 I AUg 2001 "-1t AERQJET/"THIDKOL LOTS 0111W PM 4-40.00...10.00 +78.00 STRESS (Mra) -THIOKOL LOT LA -10T3--01 +5.C THIOKOL LOT JA-IEZ35--Z-02 JAZ LOT HCL03JO14-001 -28.00 AE J>:T? +0.00 4.00 0.0 .0 *20.0 O30 +40M0...WARREN MI 48397-5000 MATERIAL SCIENCE TEAM AMSSB RSS 14 BENET LABORATORIES J HERBERT AMSTA AR CCB M SENNETT R FISCELLA KANSAS ST M SOJA NATICK MA 01760

  12. RESOURCES CONSERVATIONS COMPANY - B.E.S.T. SOLVENT EXTRACTION TECHNOLOGY - APPLICATIONS ANALYSIS REPORT

    EPA Science Inventory

    This document is an evaluation of the performance of the Resources Conservation Company (RCC) Basic Extractive Sludge Treatment (B.E.S.T.®) solvent extraction technology and its applicability as a treatment technique for soils, sediments, and sludges contaminated with organics. B...

  13. Photoionization of Cl+ from the 3s23p4 3P2,1,0 and the 3s23p4 1D2,1S0 states in the energy range 19-28 eV

    NASA Astrophysics Data System (ADS)

    McLaughlin, Brendan M.

    2017-01-01

    Absolute photoionization cross-sections for the Cl+ ion in its ground and the metastable states, 3s23p4 3P2,1,0 and 3s23p4 1D2,1S0, were measured recently at the Advanced Light Source at Lawrence Berkeley National Laboratory using the merged beams photon-ion technique at a photon energy resolution of 15 meV in the energy range 19-28 eV. These measurements are compared with large-scale Dirac-Coulomb R-matrix calculations in the same energy range. Photoionization of this sulphur-like chlorine ion is characterized by multiple Rydberg series of auto-ionizing resonances superimposed on a direct photoionization continuum. A wealth of resonance features observed in the experimental spectra is spectroscopically assigned, and their resonance parameters are tabulated and compared with the recent measurements. Metastable fractions in the parent ion beam are determined from this study. Theoretical resonance energies and quantum defects of the prominent Rydberg series 3s23p3nd, identified in the spectra as 3p → nd transitions, are compared with the available measurements made on this element. Weaker Rydberg series 3s23p3ns, identified as 3p → ns transitions and window resonances 3s3p4(4P)np features, due to 3s → np transitions, are also found in the spectra.

  14. Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies

    PubMed Central

    Li, Zhaoyang; Younger, Kenisha; Gartenhaus, Ronald; Joseph, Ann Mary; Hu, Fang; Baer, Maria R.; Brown, Patrick; Davila, Eduardo

    2015-01-01

    Signaling via the MyD88/IRAK pathway in T cells is indispensable for cell survival; however, it is not known whether this pathway functions in the progression of T acute lymphoblastic leukemia (T-ALL). Here, we determined that compared with thymic and peripheral T cells, T-ALL cells from patients have elevated levels of IRAK1 and IRAK4 mRNA as well as increased total and phosphorylated protein. Targeted inhibition of IRAK1 and IRAK4, either with shRNA or with a pharmacological IRAK1/4 inhibitor, dramatically impeded proliferation of T-ALL cells isolated from patients and T-ALL cells in a murine leukemia model; however, IRAK1/4 inhibition had little effect on cell death. We screened several hundred FDA-approved compounds and identified a set of drugs that had enhanced cytotoxic activity when combined with IRAK inhibition. Administration of an IRAK1/4 inhibitor or IRAK knockdown in combination with either ABT-737 or vincristine markedly reduced leukemia burden in mice and prolonged survival. IRAK1/4 signaling activated the E3 ubiquitin ligase TRAF6, increasing K63-linked ubiquitination and enhancing stability of the antiapoptotic protein MCL1; therefore, IRAK inhibition reduced MCL1 stability and sensitized T-ALL to combination therapy. These studies demonstrate that IRAK1/4 signaling promotes T-ALL progression through stabilization of MCL1 and suggest that impeding this pathway has potential as a therapeutic strategy to enhance chemotherapeutic efficacy. PMID:25642772

  15. Measurement of the ratio $$B(t \\to Wb)/B(t \\to Wq)$$ in pp collisions at $$\\sqrt{s}$$ = 8 TeV

    DOE PAGES

    Khachatryan, Vardan

    2014-07-03

    The ratio of the top-quark branching fractions R=B(t to Wb)/B(t to Wq), where the denominator includes the sum over all down-type quarks (q = b, s, d), is measured in the t t-bar dilepton final state with proton-proton collision data at sqrt(s)=8 TeV from an integrated luminosity of 19.7 inverse femtobarns, collected with the CMS detector. In order to quantify the purity of the signal sample, the cross section is measured by fitting the observed jet multiplicity, thereby constraining the signal and background contributions. By counting the number of b jets per event, an unconstrained value of R=1.014 +/- 0.003more » (stat.) +/- 0.032 (syst.) is measured, in good agreement with the standard model prediction. A lower limit R > 0.955 at the 95% confidence level is obtained after requiring R <;=1, and a lower limit on the Cabibbo-Kobayashi-Maskawa matrix element abs(V[tb]) > 0.975 is set at 95% confidence level. The result is combined with a previous CMS measurement of the t-channel single-top-quark cross section to determine the top-quark total decay width, Gamma[t]=1.36 +/- 0.02 (stat.) +0.14/-0.11 (syst.) GeV.« less

  16. 5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. #2 TRANSMISSION LINES, MARCH 7, 1916. SCE drawing no. 4932. - Santa Ana River Hydroelectric System, Transmission Lines, Redlands, San Bernardino County, CA

  17. Kinetics of plasma procalcitonin, soluble CD14, CCL2 and IL-10 after a sublethal infusion of lipopolysaccharide in horses.

    PubMed

    Bonelli, Francesca; Meucci, Valentina; Divers, Thomas J; Wagner, Bettina; Intorre, Luigi; Sgorbini, Micaela

    2017-02-01

    Endotoxemia represents a significant clinical and economic problem for the equine industry. This study assesses the kinetics of soluble CD14 (sCD14), chemokine (CC motif) ligand 2 (CCL2), interleukin 10 (IL-10) and plasma procalcitonin (PCT) in healthy horses after the intravenous infusion of lipopolysaccharide (LPS). The aim was to contribute to the basic understanding of the equine species-specific kinetics of these molecules in response to LPS exposure, which could support further findings in clinical studies and identify valuable inflammatory biomarkers for equine practice. Eleven healthy horses were involved in this experimental in vivo study. Horses were classified as healthy before the LPS infusion. After the pre-infusion blood collection (T0), all horses received an infusion of E. coli endotoxin (30ng/kg over 30min). Data and samples were collected 1h (T1), 2 (T2), 3 (T3) and 24h (T24) after infusion. Plasma sCD14, CCL2 and IL-10 were evaluated with a fluorescent bead-based assay, while PCT was evaluated with an equine PCT ELISA assay. A one-way ANOVA test was performed between each blood-sampling time for PCT, sCD14 and IL-10, and a Friedman test was performed for CCL2. Plasma PCT, IL-10 and CCL2 concentrations increased statistically significantly at T1, T2 and T3 compared to T0. No statistically significant differences were found between plasma IL-10 and CCL2 concentrations between T0 vs T24, although plasma PCT values remained high 24h after LPS infusion. Plasma sCD14 concentration showed no statistically significant differences for any of sampling times. Our results demonstrate that LPS injection into healthy horses results in PCT, CCL2 and IL-10 increases in plasma without an increase in sCD14. The increases in PCT, CCL2 and IL-10 are related to the inflammatory response induced by circulating lipopolysaccharide. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. 10 CFR 4.14 - Medical emergencies.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Medical emergencies. 4.14 Section 4.14 Energy NUCLEAR... and Title IV of the Energy Reorganization Act of 1974 Discrimination Prohibited § 4.14 Medical... health, and such service or other benefit cannot be provided except by or through a medical institution...

  19. 10 CFR 4.14 - Medical emergencies.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Medical emergencies. 4.14 Section 4.14 Energy NUCLEAR... and Title IV of the Energy Reorganization Act of 1974 Discrimination Prohibited § 4.14 Medical... health, and such service or other benefit cannot be provided except by or through a medical institution...

  20. 10 CFR 4.14 - Medical emergencies.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Medical emergencies. 4.14 Section 4.14 Energy NUCLEAR... and Title IV of the Energy Reorganization Act of 1974 Discrimination Prohibited § 4.14 Medical... health, and such service or other benefit cannot be provided except by or through a medical institution...

  1. 10 CFR 4.14 - Medical emergencies.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Medical emergencies. 4.14 Section 4.14 Energy NUCLEAR... and Title IV of the Energy Reorganization Act of 1974 Discrimination Prohibited § 4.14 Medical... health, and such service or other benefit cannot be provided except by or through a medical institution...

  2. 10 CFR 4.14 - Medical emergencies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Medical emergencies. 4.14 Section 4.14 Energy NUCLEAR... and Title IV of the Energy Reorganization Act of 1974 Discrimination Prohibited § 4.14 Medical... health, and such service or other benefit cannot be provided except by or through a medical institution...

  3. [Book Review] Bykhovskaya-Pavllvskaya: Key to parasites of freshwater fish of the U.S.S.R

    USGS Publications Warehouse

    Hoffman, G.L.

    1966-01-01

    Review of: Key to parasites of freshwater fish of the U.S.S.R. Opredelitel' parazitov presnovodnykh ryb SSSR. Compiled by I. E. Bykhovskaya-Pavlovskaya [and others] Assisted by L. F. Nagibina, E. V. Baikova, and Yu. A. Strelkov. Chief Editor: E. N. Pavlovskii. Translated from Russian [by A. Birron and Z.S. Cole] Published 1964 by Israel Program for Scientific Translations, [available from the Office of Technical Services, U.S. Dept. of Commerce, Washington] in Jerusalem.

  4. Pressure-induced topological insulator-to-metal transition and superconductivity in Sn-doped B i1.1S b0.9T e2S

    NASA Astrophysics Data System (ADS)

    An, Chao; Chen, Xuliang; Wu, Bin; Zhou, Yonghui; Zhou, Ying; Zhang, Ranran; Park, Changyong; Song, Fengqi; Yang, Zhaorong

    2018-05-01

    Tetradymite-type topological insulator Sn-doped B i1.1S b0.9T e2S (Sn-BSTS), with a surface state Dirac point energy well isolated from the bulk valence and conduction bands, is an ideal platform for studying the topological transport phenomena. Here, we present high-pressure transport studies on single-crystal Sn-BSTS, combined with Raman scattering and synchrotron x-ray diffraction measurements. Over the studied pressure range of 0.7-37.2 GPa, three critical pressure points can be observed: (i) At ˜9 GPa, a pressure-induced topological insulator-to-metal transition is revealed due to closure of the bulk band gap, which is accompanied by changes in slope of the Raman frequencies and a minimum in c /a within the pristine rhombohedral structure (R -3 m ); (ii) at ˜13 GPa, superconductivity is observed to emerge, along with the R -3 m to a C 2 /c (monoclinic) structural transition; (iii) at ˜24 GPa, the superconducting transition onset temperature TC reaches a maximum of ˜12 K , accompanied by a second structural transition from the C 2 /c to a body-centered cubic I m -3 m phase.

  5. Interleukin-7 (IL-7) enhances class switching to IgE and IgG4 in the presence of T cells via IL-9 and sCD23.

    PubMed

    Jeannin, P; Delneste, Y; Lecoanet-Henchoz, S; Gretener, D; Bonnefoy, J Y

    1998-02-15

    Interleukin-7 (IL-7) is a B-cell growth factor produced by both bone marrow stroma cells and follicular dendritic cells (FDCs) located in primary lymphoid follicles and germinal centers. In this study, we have evaluated the role of IL-7 on human Ig class switching. IL-7 was added to peripheral blood mononuclear cells (PBMCs) or tonsillar B cells in the absence or presence of IL-4 and/or anti-CD40 monoclonal antibody (MoAb). Alone, IL-7 did not affect Ig production by PBMCs or by anti-CD40 MoAb-stimulated B cells. Rather, IL-7 potentiated IL-4-induced IgE and IgG4 production by PBMCs. In parallel, IgG3 production was also enhanced but to a lesser extent, whereas the production of the other isotypes was unaltered. The activity of IL-2, IL-9, or IL-15, which share usage of the common gamma chain for signaling, was also assessed. IL-9, like IL-7, potentiated mainly IgE and IgG4 production by IL-4-stimulated PBMCs. IL-15, in contrast, was ineffective, whereas IL-2 enhanced the production of all isotypes. More precisely, IL-7 potentiation of IgE and IgG4 production required the presence of T cells and was accompanied by an increase of the expression of two soluble molecules favoring preferentially IgE and IgG4 synthesis: CD23 (sCD23) and IL-9. Moreover, neutralizing anti-CD23 and anti-IL-9 antibodies partly inhibited the increase of IgE synthesis induced by IL-7. Thus, IL-7 produced locally in the germinal centers by FDCs may interact with T cells and potentiate human IgE and IgG4 switching by favoring IL-9 and sCD23 production.

  6. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    NASA Astrophysics Data System (ADS)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  7. Computational Aeroelastic Analysis of the Semi-Span Super-Sonic Transport (S4T) Wind-Tunnel Model

    NASA Technical Reports Server (NTRS)

    Sanetrik, Mark D.; Silva, Walter A.; Hur, Jiyoung

    2012-01-01

    A summary of the computational aeroelastic analysis for the Semi-Span Super-Sonic Transport (S4T) wind-tunnel model is presented. A broad range of analysis techniques, including linear, nonlinear and Reduced Order Models (ROMs) were employed in support of a series of aeroelastic (AE) and aeroservoelastic (ASE) wind-tunnel tests conducted in the Transonic Dynamics Tunnel (TDT) at NASA Langley Research Center. This research was performed in support of the ASE element in the Supersonics Program, part of NASA's Fundamental Aeronautics Program. The analysis concentrated on open-loop flutter predictions, which were in good agreement with experimental results. This paper is one in a series that comprise a special S4T technical session, which summarizes the S4T project.

  8. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  9. Non-equilibrium effects in steady relativistic e^+e^-gamma winds

    NASA Astrophysics Data System (ADS)

    Grimsrud, Ole M.; Wasserman, Ira

    1998-11-01

    We consider an ultrarelativistic wind consisting of electron-positron pairs and photons with the principal goal of finding the asymptotic Lorentz factor gamma_∞ for zero baryon number. The wind is assumed to originate at radius r_i where it has a Lorentz factor gamma_i and a temperature T_i sufficiently high to maintain pair equilibrium. As r increases, T decreases and becomes less than the temperature corresponding to the electron mass m_e, after which non-equilibrium effects become important. The pairs, which carry only a small fraction of the total energy, may be accelerated by the photons until tau falls below ~2x10^-5gamma^3/4_i. Radiative transfer calculations show that only at this point do the radiation flux and pressure start to deviate significantly from their blackbody values. The acceleration of the pairs increases gamma by a factor ~45 compared with its value at the photosphere; it is shown to approach gamma_∞~1.4x10^3(r^6_i/10cm)^1/4gamma^{3/4}_iT_i/m_e. The limit of zero baryon number is a good approximation when the mass injection rate Msolar in the flow is below a critical value corresponding to (Esolar/MsolarM)_c,0~5x10^7(r^6_i/10cm)T_i/m_e for fixed energy injection rate E/E. For large baryon loading, (Esolar/Msolar<~Esolar/Msolar)_c,M~350(r_i/10^6cm)^1/4gamma^3/4_iT_i/ m_e, the asymptotic Lorentz factor is gamma_∞~Esolar/Msolar. Surprisingly, increasing Esolar/Msolar from (Esolar/Msolar)_c,M to ∞ only increases gamma_∞ by a factor ~(m_p/m_e)^1/4~6.5, less than an order of magnitude. As Esolar/Msolar increases, the fraction of the energy carried by pairs decreases, reaching ~10^-5gamma^3/4_i as Esolar/Msolar to ∞.

  10. 74. MISSISSIPPI, NOXUBEE CO., MACON MAHORNER' S BRIDGE E on ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    74. MISSISSIPPI, NOXUBEE CO., MACON MAHORNER' S BRIDGE E on Ms. 14 6.5 mi. to McLeod. S 4.5 miles S on McLeod-Shuqualak road. Mahorner's bridge (1884). Lower panel point, S side of W end of turn span. View looks W. shows pin connection at right angles to pin. Sarcone Photography, Columbus, Ms., Sep 1978. - Bridges of the Upper Tombigbee River Valley, Columbus, Lowndes County, MS

  11. Word Frequency Analysis. MOS: 91S. Skill Levels 1 & 2.

    DTIC Science & Technology

    1981-05-01

    cZsGuIsr I Cl!5(S I Ol;..tCC. rB j!5PL&YCD I C Il ’S ’L I tIsFoSE I ’ Ln I TI f1 4 DlS.KJPT IVb I DIS:’ LVING 12 C!ST3KNCF I DIST!JCTIVE 2 Ul ST NU...41 V H 7 󈧐 WHICtH 4’ COWi3I ICENS 41 ST04DAftDS I, , - i 39 𔃻.GALZ INE 35 H 14 ;KI QfFcENCI S * 19 D.- 37 GWt j.. NE 37 CUr ?5 ’RAINING 34 GRID 34

  12. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    PubMed

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. A Measurement of $$t\\bar{t}$$Production Cross Section in $$p\\bar{p}$$ Collisions at $$\\sqrt{s}$$ = 1.8 TeV Using Neural Networks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Harpreet

    We present the results of a new measurement of themore » $$t\\bar{t}$$ production cross section using eμ channel in pp collisions at $$\\sqrt{s}$$= 1.8 TeV. This study corresponds to an integrated luminosity of 108.3 ± 5.7 $$pb^{-1}$$ acquired by the D0 detector during the Fermilab Tevatron Collider Run I (1992-1996). By using neural network techniques instead of the conventional analysis methods, we show that the signal acceptance can be increased by 10% (for $$m_t$$ = 172 GeV /$c^2$ ) while the background remains constant. Four eμ events are observed in data with an estimated background of 0.22 ± 0.14 corresponding to a $$t\\bar{t}$$ production cross section of 9.75 ± 5.53 pb.« less

  14. Band alignments of different buffer layers (CdS, Zn(O,S), and In{sub 2}S{sub 3}) on Cu{sub 2}ZnSnS{sub 4}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Chang; Liu, Fangyang; Song, Ning

    2014-04-28

    The heterojunctions of different n-type buffers, i.e., CdS, Zn(O,S), and In{sub 2}S{sub 3} on p-type Cu{sub 2}ZnSnS{sub 4} (CZTS) were investigated using X-ray Photoelectron Spectroscopy (XPS) and Near Edge X-ray Absorption Fine Structure (NEXAFS) Measurements. The band alignment of the heterojunctions formed between CZTS and the buffer materials was carefully measured. The XPS data were used to determine the Valence Band Offsets (VBO) of different buffer/CZTS heterojunctions. The Conduction Band Offset (CBO) was calculated indirectly by XPS data and directly measured by NEXAFS characterization. The CBO of the CdS/CZTS heterojunction was found to be cliff-like with CBO{sub XPS} = −0.24 ± 0.10eV and CBO{submore » NEXAFS} = −0.18 ± 0.10eV, whereas those of Zn(O,S) and In{sub 2}S{sub 3} were found to be spike-like with CBO{sub XPS} = 0.92 ± 0.10eV and CBO{sub NEXAFS} = 0.87 ± 0.10eV for Zn(O,S)/CZTS and CBO{sub XPS} = 0.41 ± 0.10eV for In{sub 2}S{sub 3}/CZTS, respectively. The CZTS photovoltaic device using the spike-like In{sub 2}S{sub 3} buffer was found to yield a higher open circuit voltage (Voc) than that using the cliff-like CdS buffer. However, the CBO of In{sub 2}S{sub 3}/CZTS is slightly higher than the optimum level and thus acts to block the flow of light-generated electrons, significantly reducing the short circuit current (Jsc) and Fill Factor (FF) and thereby limiting the efficiency. Instead, the use of a hybrid buffer for optimization of band alignment is proposed.« less

  15. U.S. Coast Guard Cutter KAW - WYT-61 Outboard Profile.

    DTIC Science & Technology

    1977-10-01

    NUMBER if 4 ’. TYPE OF REPORT A PERIOD COVERED l " " 6. PERFORMING ORG, REPORT NUMBER 7. AUTHOR(*) 8 . CONTRACT OR GRANT NUMBER(#) 00S. PERFORMING...34y % 04 FINNT OF DW5&Wkt4wE. Oft PILoT WOUSE TOP OCLICT90 CENTIM SOW TOWWAi LIGICr AV40 VtP ^*r8W*A. AS9CO P*KeOf LW4rT. On MAIM MAs- CaLeTs . IMA L...uwr AM wLc^Tu* wmina. ~ L4VAT. ^DIM* AMOMEfTlER, frv.. AwTals4A AND . OCLTD ATCK Viticp-s".A on ao a s D@oc, AsggD *wTIMww A COW’IiU AwvES C. 4 . wwmSLuA

  16. Synthesis of the new quaternary sulfides K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaLnAgS[sub 3] (Ln = Er, Y, Gd) and the structures of K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaErAgS[sub 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Ping; Ibers, J.A.

    1994-05-01

    Several new quarternary sulfides, K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaLnAgS[sub 3] (Ln = Er, Y, Gd), have been synthesized by the reaction of the constituent binary chalcogenides and elements at 1000[degrees]C. The crystal structures of K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11] and BaErAgS[sub 3] have been determined by single-crystal X-ray diffraction techniques. Crystal data: K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11]-space group D[sup 8][sub 4h] - P4/ncc, M = 1023.88, Z = 4, a = 8.587(1), c = 27.892(4) [angstrom] (T = 115 K), V = 2056.7(4) [angstrom][sup 3], R[sub W](F[sup 2]) = 0.093 for 1965 observations having F[sup 2][sub 0] >more » 2[sigma](F[sup 2][sub 0]); BaEr AgS[sub 3]-space group C[sup 3][sub 2H] - C2/m, M = 508.65, Z = 4, a = 17.340(4), b = 4.014(1), x = 8.509(2) [angstrom], [beta] = 103.23(3)[degrees], (T = 115 K), V = 576.5(2) [angstrom][sup 3], R[sub W](F[sup 2]) = 0.049 for 1404 observations and 48 variables, R(F) = 0.018 for 1299 observations having F[sup 2][sub 0] > 2[sigma](F[sup 2][sub 0]). In both structures, the rare-earth atoms have octahedral coordination and the octahedra form slabs through edge- and corner-sharing. These slabs are separated by K[sup +] Ba[sup 2+] cations, and are crosslinked into three-dimensional frameworks by Sn[sub 2]S[sub 6] units as edge-sharing SnS[sub 4] tetrahedral pairs in K[sub 2]Y[sub 4]Sn[sub 2]S[sub 11], and by Ag[sub 2]S[sub 9] units as corner-sharing trigonal-bipyramidal AgS[sub 5] pairs in BaEr AgS[sub 3]. From their powder diffraction patterns, BaYAgS[sub 3] and Ba GdAgS[sub 3] appear to be isostructural with BaErAgS[sub 3].« less

  17. Ultrafast transient photocarrier dynamics of the bulk-insulating topological insulator B i1.5S b0.5T e1.7S e1.3

    NASA Astrophysics Data System (ADS)

    Choi, Young Gwan; Zhung, Chan June; Park, Sun-Hee; Park, Joonbum; Kim, Jun Sung; Kim, Seongheun; Park, Jaehun; Lee, J. S.

    2018-02-01

    Using optical-pump terahertz-probe spectroscopy, we investigated an ultrafast photocarrier relaxation behavior in a B i1.5S b0.5T e1.7S e1.3 (BSTS) single crystal, which is one of the most bulk-insulating topological insulators. Compared to n -type bulk-metallic B i2S e3 , we found that BSTS endows distinct behaviors in its photocarrier dynamics; the relaxation time turns out to be an order of magnitude longer, and the transient conductance spectrum exhibits a nonlinear increase as a function of the pumping power. Also, we observed an abrupt reduction of the photocarrier scattering rate in several picoseconds after the initial photoexcitation. We discuss these intriguing experimental observations based on a bulk-to-surface carrier injection assisted by the built-in electric field near the surface and electron-phonon scattering.

  18. Electronic structure in 1T-ZrS2 monolayer by strain

    NASA Astrophysics Data System (ADS)

    Xin, Qianqian; Zhao, Xu; Ma, Xu; Wu, Ninghua; Liu, Xiaomeng; Wei, Shuyi

    2017-09-01

    We report electronic structure of 1T-ZrS2 monolayer with biaxial strain from -10% to 15%, basing the first principles calculations. Our calculation results indicate that the band structure of ZrS2 monolayer was changed clearly. The location of conduction band minimum (CBM) and valence band maximum (VBM) changed with the variation of isotropic strain. At compressive strain, the location of CBM and VBM retains at M and Γ point, respectively. The band gap of ZrS2 monolayer decreases from 1.111 eV to 0 eV when compressive strain increases from 0% to -8%, which means that the ZrS2 monolayer turns to metal at -8% compressive strain. Under the tensile strain, the ZrS2 monolayer also retains be an indirect band gap semiconductor. The location of CBM moves from M to Γ point and the location of VBM moves along Γ-A-K-Γ direction. The band gap of ZrS2 monolayer firstly increases and then decreases and the biggest band gap is 1.577 eV at tensile strain 6%. We can see the compression strain is more effective than tensile strain in modulating band gap of 1T-ZrS2 monolayer.

  19. Anticonvulsant activity of a mGlu(4alpha) receptor selective agonist, (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid.

    PubMed

    Chapman, A G; Talebi, A; Yip, P K; Meldrum, B S

    2001-07-20

    The metabotropic Group III agonist, (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid (ACPT-1), selective for the mGlu(4alpha) receptor, suppresses sound-induced seizures in DBA/2 mice following its intracerebroventricular (i.c.v.) administration (ED(50) 5.6 [2.9-10.7], nmol i.c.v., 15 min, clonic phase) and in genetically epilepsy-prone (GEP) rats following focal administration into the inferior colliculus (ED(50) 0.08 [0.01-0.50], nmol, 60 min, clonic phase). ACPT-1 also protects against clonic seizures induced in DBA/2 mice by the Group I agonist, (RS)-3,5-dihydroxyphenylglycine (3,5-DHPG) (ED(50) 0.60 [0.29-1.2], nmol i.c.v.) and by the Group III antagonist, (RS)-alpha-methylserine-O-phosphate (MSOP) (ED(50) 49.3 [37.9-64.1], nmol i.c.v.). Another Group III agonist, (RS)-4-phosphonophenyl-glycine (PPG), preferentially activating the mGlu(8) receptor, previously shown to protect against sound-induced seizures in DBA/2 mice and GEP rats, also protects against seizures induced in DBA/2 by 3,5-DHPG (ED(50) 3.7 [2.4-5.7], nmol i.c.v.) and by the Group III antagonist, MSOP (ED(50) 40.2 [21.0-77.0], nmol i.c.v.). At very high doses (500 nmol i.c.v. and above), Group III antagonists have pro-convulsant and convulsant activity. The anticonvulsant protection against sound-induced seizures in DBA/2 mice provided by a fully protective dose (20 nmol, i.c.v.) of the mGlu(4) receptor agonist ACPT-1, is partially reversed by the co-administration of the Group III antagonists, MSOP, (RS)-alpha-methyl-4-phosphonophenylglycine (MPPG) or (S)-2-amino-2-methyl-4-phosphonobutanoic acid (MAP4), in the 20-50 nmol dose range. At doses of 50-200 nmol, MPPG and MAP4 cause further reversal of the ACPT-1 anticonvulsant protection, while the MSOP effect on ACPT-1 protection is abolished at higher doses. In contrast, the anticonvulsant protection against sound-induced seizures in DBA/2 mice provided by a fully protective dose (20 nmol, i.c.v.) of the mGlu(8) receptor agonist PPG, is not

  20. Systematic R -matrix analysis of the 13C(p ,γ )14N capture reaction

    NASA Astrophysics Data System (ADS)

    Chakraborty, Suprita; deBoer, Richard; Mukherjee, Avijit; Roy, Subinit

    2015-04-01

    Background: The proton capture reaction 13C(p ,γ )14N is an important reaction in the CNO cycle during hydrogen burning in stars with mass greater than the mass of the Sun. It also occurs in astrophysical sites such as red giant stars: the asymptotic giant branch (AGB) stars. The low energy astrophysical S factor of this reaction is dominated by a resonance state at an excitation energy of around 8.06 MeV (Jπ=1-,T =1 ) in 14N. The other significant contributions come from the low energy tail of the broad resonance with Jπ=0-,T =1 at an excitation of 8.78 MeV and the direct capture process. Purpose: Measurements of the low energy astrophysical S factor of the radiative capture reaction 13C(p ,γ )14N reported extrapolated values of S (0 ) that differ by about 30 % . Subsequent R -matrix analysis and potential model calculations also yielded significantly different values for S (0 ) . The present work intends to look into the discrepancy through a detailed R -matrix analysis with emphasis on the associated uncertainties. Method: A systematic reanalysis of the available decay data following the capture to the Jπ=1-,T =1 resonance state of 14N around 8.06 MeV excitation had been performed within the framework of the R -matrix method. A simultaneous analysis of the 13C(p ,p0 ) data, measured over a similar energy range, was carried out with the capture data. The data for the ground state decay of the broad resonance state (Jπ=0-,T =1 ) around 8.78 MeV excitations was included as well. The external capture model along with the background poles to simulate the internal capture contribution were used to estimate the direct capture contribution. The asymptotic normalization constants (ANCs) for all states were extracted from the capture data. The multichannel, multilevel R -matrix code azure2 was used for the calculation. Results: The values of the astrophysical S factor at zero relative energy, resulting from the present analysis, are found to be consistent within the

  1. Cocrystal assembled by 1,4-diiodotetrafluorobenzene and phenothiazine based on C-I...π/N/S halogen bond and other assisting interactions.

    PubMed

    Wang, Hui; Jin, Wei Jun

    2017-04-01

    The halogen-bonded cocrystal of 1,4-diiodotetrafluorobenzene (1,4-DITFB) with the butterfly-shape non-planar heterocyclic compound phenothiazine (PHT) was successfully assembled by the conventional solution-based method. X-ray single-crystal diffraction analysis reveals a 3:2 stoichiometric ratio for the cocrystal (1,4-DITFB/PHT), and the cocrystal structure is constructed via C-I...π, C-I...N and C-I...S halogen bonds as well as other assisting interactions (e.g. C-H...F/S hydrogen bond, C-H...H-C and C-F...F-C bonds). The small shift of the 1,4-DITFB vibrational band to lower frequencies in FT-IR and Raman spectroscopies provide evidence to confirm the existence of the halogen bond. In addition, the non-planarity of the PHT molecule in the cocrystal results in PHT emitting weak phosphorescence and relatively strong delayed fluorescence. Thus, a wide range of delayed fluorescence and weak phosphorescence could play a significant role in selecting a proper π-conjugated system to engineer functional cocrystal and luminescent materials by halogen bonds.

  2. U.S.-U.S.S.R. Seminar on Access to Library Resources through Technology and Preservation (Washington, D.C., July 5-8, 1988). Papers by U.S.S.R. Participants.

    ERIC Educational Resources Information Center

    International Research and Exchange Board, New York, NY.

    This document contains 13 papers by Soviet participants in the U.S.-U.S.S.R. Seminar on Access to Library Resources through Technology and Preservation: (1) "Automation of Information-Library Work at Scientific and Technical Libraries of the U.S.S.R." (A. S. Sorokin and V. M. Rostovtsev); (2) "Automated Information Systems for…

  3. GENERAL VIEW OF TYPE HB54s (BUILDINGS T1088 TO T1093) & ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    GENERAL VIEW OF TYPE HB-54s (BUILDINGS T-1088 TO T-1093) & CONVERTED TYPE HB-54S (BUILDINGS T-1094 TO T-1096), LOOKING SOUTHWEST; BUILDING T-1088 AT LEFT, BUILDING T-1096 AT RIGHT - Fort McCoy, Building No. T-1096, South side of South Ninth Avenue, Block 10, Sparta, Monroe County, WI

  4. S3 and S4 abundances and improved chemical kinetic model for the lower atmosphere of Venus

    NASA Astrophysics Data System (ADS)

    Krasnopolsky, Vladimir A.

    2013-07-01

    Mixing ratios of S3 and S4 are obtained from reanalysis of the spectra of true absorption in the visible range retrieved by Maiorov et al. (Maiorov, B.S. et al. [2005]. Solar Syst. Res. 39, 267-282) from the Venera 11 observations. These mixing ratios are fS3 = 11 ± 3 ppt at 3-10 km and 18 ± 3 ppt at 10-19 km, fS4 = 4 ± 4 ppt at 3-10 km and 6 ± 2 ppt at 10-19 km, and show a steep decrease in both S3 and S4 above 19 km. Photolysis rates of S3 and S4 at various altitudes are calculated using the Venera 11 spectra and constant photolysis yields as free parameters. The chemical kinetic model for the Venus lower atmosphere (Krasnopolsky, V.A. [2007]. Icarus 191, 25-37) has been improved by inclusion of the S4 cycle from Yung et al. (Yung, Y.L. et al. [2009]. J. Geophys. Res. 114, E00B34), reduction of the H2SO4 and CO fluxes at the upper boundary of 47 km by a factor of 4 in accord with the recent photochemical models for the middle atmosphere, by using a closed lower boundary for OCS instead of a free parameter for this species at the surface, and some minor updates. Our model with the S4 cycle but without the SO3 + 2 OCS reaction suggested by Krasnopolsky and Pollack (Krasnopolsky, V.A., Pollack, J.B. [1994]. Icarus 109, 58-78) disagrees with the observations of OCS, CO, S3, and S4. However, inclusion of the S4 cycle improves the model fit to all observational constraints. The best-fit activation energy of 7800 K for thermolysis of S4 supports the S4 enthalpy from Mills (Mills, K.C. [1974]. Thermodynamic Data for Inorganic Sulfides, Selenides and Tellurides. Butterworths, London). Chemistry of the Venus lower atmosphere is initiated by disequilibrium products H2SO4 and CO from the middle atmosphere, photolysis of S3 and S4, and thermochemistry in the lowest scale height. The chemistry is mostly driven by sulfur that is formed in a slow reaction SO + SO, produces OCS, and results in dramatic changes in abundances of OCS, CO, and free sulfur allotropes. The SX + OCS

  5. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    PubMed

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  6. MiR-34a, a promising novel biomarker for benzene toxicity, is involved in cell apoptosis triggered by 1,4-benzoquinone through targeting Bcl-2.

    PubMed

    Chen, Yujiao; Sun, Pengling; Guo, Xiaoli; Gao, Ai

    2017-02-01

    Exposure to benzene is inevitable, and concerns regarding the adverse health effects of benzene have been raised. Most investigators found that benzene exposure induced hematotoxicity. In this regard, Our study aimed to explore a novel potential biomarker of adverse health effects following benzene exposure and the toxic mechanisms of benzene metabolites in vitro. This study consisted of 314 benzene-exposed workers and 288 control workers, an air benzene concentration of who were 2.64 ± 1.60 mg/m 3 and 0.05 ± 0.01 mg/m 3 , respectively. In this population-based study, miR-34a expression was elevated in benzene-exposed workers. The correlation of miR-34a with the airborne benzene concentration, S-phenylmercapturic acid (S-PMA) and trans, trans-muconic acid (t, t-MA), all of which reflect benzene exposure, was found. Correlation analysis indicated that miR-34a was associated with peripheral blood count, alanine transaminase (ALT) and oxidative stress. Furthermore, multivariate analysis demonstrated that miR-34a expression was strongly associated with white blood cell count (structure loadings = 0.952). In population-based study, miR-34a had the largest contribution to altered peripheral blood counts, which reflect benzene-induced hematotoxicity. The role of miR-34a in benzene toxicity was assessed using lentiviral vector transfection. Results revealed that 1,4-benzoquinone induced abnormal cell apoptosis and simultaneously upregulated miR-34a accompanied with decreased Bcl-2. Finally, inhibition of miR-34a elevated Bcl-2 and decreased 1,4-benzoquinone-induced apoptosis. In conclusion, miR-34a was observed to be involved in benzene-induced hematotoxicity by targeting Bcl-2 and could be regarded as a potential novel biomarker for benzene toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  8. From Titan’s tholins to Titan’s aerosols: Isotopic study and chemical evolution at Titan’s surface

    NASA Astrophysics Data System (ADS)

    Nguyen, Mai-Julie; Raulin, François; Coll, Patrice; Derenne, Sylvie; Szopa, Cyril; Cernogora, Guy; Israël, Guy; Bernard, Jean-Michel

    2008-07-01

    In the present work, we focused on the possible isotopic fractionation of carbon during the processes involved in the formation of Titan’s tholins. We present the first results obtained on the 12C/13C isotopic ratios measured on Titan’s tholins synthesized in laboratory with cold plasma discharges. Measurements of isotopic ratio 12C/13C, done both on tholins and on the initial gas mixture (N2:CH4 (98:2)) used to produce them, do not show any evident deficit or enrichment in 13C relatively to 12C in the synthesized tholins, compared to the initial gas mixture. This observation allows to go further in the analyses of the ACP experiment data, including part of the Cassini Huygens mission. We also focused on the chemical evolution of the aerosols at Titan surface by studying species coming from acid hydrolysis treatment of Titan’s tholins. Preliminary results show a wide diversity of chemical families, going from carboxylic acids to amino acids. Advanced studies could bring at short-term clues on the still unidentified mixture that induces the decrease of the reflectivity as measure by the DISR instrument [Tomasko, M.G., Archinal, B., Becker, T., Bézard, B., Bushroe, M., Combes, M., Cook, D., Coustenis, A., de Bergh, C., Dafoe, L.E., Doose, L., Douté, S., Eibl, A., Engel, S., Gliem, F., Grieger, B., Holso, K., Howington-Kraus, E., Karkoschka, E., Keller, H.U., Kirk, R., Kramm, R., Küppers, M., Lanagan, P., Lellouch, E., Lemmon, M., Lunine, J., McFarlane, E., Moores, J., Prout, G.M., Rizk, B., Rosiek, M., Rueffer, P., Schröder, S.E., Schmitt, B., See, C., Smith, P., Soderblom, L., Thomas, N., West, R. Rain, winds and haze during the Huygens probe’s descent to Titan’s surface. Nature 438(7069), 765 778, 2005]. At longer-term it could allow to better understand the possible chemical evolution of the Titan’s aerosols after falling down at the surface when brought into contact with water.

  9. Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

    PubMed

    Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

    2009-01-01

    Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved. Copyright 2009 S. Karger AG, Basel.

  10. Efficient total synthesis of (S)-14-azacamptothecin.

    PubMed

    Liu, Guan-Sai; Yao, Yuan-Shan; Xu, Peng; Wang, Shaozhong; Yao, Zhu-Jun

    2010-06-01

    An efficient total synthesis of (S)-14-azacamptothecin has been accomplished in 10 steps and 56% overall yield from 5H-pyrano[4,3-d]pyrimidine 8. A mild Hendrickson reagent-triggered intramolecular cascade cyclization, a highly enantioselective dihydroxylation, and an efficient palladium-catalyzed transformation of an O-allyl into N-allyl group are the key steps in the synthesis. This work provides a much higher overall yield than the previous achievement and shows sound flexibility for the further applications that will lead to new bioactive analogues.

  11. Reports of the U.S. - U.S.S.R. Weddell Polynya Expedition, October-November 1981. Volume 6. Upper-Air Data.

    DTIC Science & Technology

    1983-05-01

    65 0 7 *.’• 7P 72 66 i-3 r.f 5? 50 «» 36 25 E IMi 1 IE*: Hr-.n (KG/«•»3 > i|6 iEC -J sprt r (8/° ) O.7708 0.6677 0.751" 0•652 2...16974. 73.5 17025 . 72.9 17077. 72.3 1712t?. 71.7 1718ü. 71.1 17233. 70.5 17277. 73.0 17331. o9.4 I <c > —1 1 • ’- -el.f -fei. I -11.1...10.3 99.9 100. 0.1903 0.1743 0.7829 4416. 527.9 -35.5 12.1 12.1 -35.5 KC. 0.2123 0.1936 0.7740 4464. 524.3 -3 5.6 12.5 12.6 99.9 ISO . 0.2093 0.191C

  12. A Study of the Jettisoning of JP-4 Fuel in the Atmosphere

    DTIC Science & Technology

    1975-11-01

    t e r m i n e d by m e a s u r i n g the s tagna t ion p r e s s u r e with a pitot probe , shown in Fig. 21, with the s p h e r i c a l t...ip. The rod loca ted to the r igh t of the pitot probe was loca ted in the s a m e photographic plane as the suspended J P - 4 drop- le t...of Atomiza t ion in C a r b u r e t o r s . " NACA TM 518, 1929. 13. Lapple , C. E . , Henry , J . P . , J r . , and Blake, D. E. " A t o

  13. Search for Dark Matter Annihilations towards the Inner Galactic Halo from 10 Years of Observations with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    Abdallah, H.; Abramowski, A.; Aharonian, F.; Ait Benkhali, F.; Akhperjanian, A. G.; Angüner, E.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Becker Tjus, J.; Berge, D.; Bernhard, S.; Bernlöhr, K.; Birsin, E.; Blackwell, R.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Bulik, T.; Capasso, M.; Carr, J.; Casanova, S.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Couturier, C.; Cui, Y.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Djannati-Ataï, A.; Domainko, W.; Donath, A.; Drury, L. O'C.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Funk, S.; Füßling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Grudzińska, M.; Hadasch, D.; Hahn, J.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kerszberg, D.; Khélifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Kraus, M.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Lui, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Morâ, K.; Moulin, E.; Murach, T.; de Naurois, M.; Niederwanger, F.; Niemiec, J.; Oakes, L.; Odaka, H.; Ohm, S.; Öttl, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Rieger, F.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwemmer, S.; Seyffert, A. S.; Shafi, N.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spieß, F.; Stawarz, L.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Tuffs, R.; van der Walt, J.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Völk, H. J.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Żywucka, N.; H. E. S. S. Collaboration

    2016-09-01

    The inner region of the Milky Way halo harbors a large amount of dark matter (DM). Given its proximity, it is one of the most promising targets to look for DM. We report on a search for the annihilations of DM particles using γ -ray observations towards the inner 300 pc of the Milky Way, with the H.E.S.S. array of ground-based Cherenkov telescopes. The analysis is based on a 2D maximum likelihood method using Galactic Center (GC) data accumulated by H.E.S.S. over the last 10 years (2004-2014), and does not show any significant γ -ray signal above background. Assuming Einasto and Navarro-Frenk-White DM density profiles at the GC, we derive upper limits on the annihilation cross section ⟨σ v ⟩. These constraints are the strongest obtained so far in the TeV DM mass range and improve upon previous limits by a factor 5. For the Einasto profile, the constraints reach ⟨σ v ⟩ values of 6 ×10-26 cm3 s-1 in the W+W- channel for a DM particle mass of 1.5 TeV, and 2 ×10-26 cm3 s-1 in the τ+τ- channel for a 1 TeV mass. For the first time, ground-based γ -ray observations have reached sufficient sensitivity to probe ⟨σ v ⟩ values expected from the thermal relic density for TeV DM particles.

  14. Site-preference and valency for rare-earth sites in (R-Ce)2Fe14B [R =La,Nd] magnets

    NASA Astrophysics Data System (ADS)

    Alam, Aftab; Khan, Mahmud; McCallum, R. W.; Johnson, D. D.

    2013-03-01

    Rare-earth (R) permanent magnets of R2Fe14B have technological importance due to their high energy products, and they have two symmetry distinct R-sites (Wyckoff 4f and 4g) that affect chemistry and valence. Designing magnetic behavior and stability via alloying is technologically relevant to reduce critical (expensive) R-content while retaining key properties; cerium, an abundant (cheap) R-element, offers this potential. We calculate magnetic properties and Ce site preference in (R1-xCex)Fe14B [R=La,Nd] using density functional theory (DFT) methods. The Fe moments compare well with neutron scattering data - remain weakly affected by Hubbard U, but improved with spin-orbit coupling. In (La,Ce)2Fe14B, Ce alloys for 0 < x < 1 with a preference for smaller R(4f) sites, as observed, a trend we find unaffected by valence. Whereas in (Nd,Ce)2Fe14B, Ce is predicted to have limited alloying (x < 0.3) with a preference for larger R(4g) sites, resulting in weak partial ordering and segregation. Curie temperatures versus x were predicted for a typical sample processing and verified experimentally. We shall also present some initial results on the critical mixed valency of Ce in related compounds. Work at Ames Laboratory was supported by the U.S. Department of Energy, ARPA-E under the REACT program (0472-1526)

  15. U.S. EPA, Pesticide Product Label, SHACKLE HERBICIDE, 10/31/1988

    EPA Pesticide Factsheets

    2011-04-14

    ... IS! ,l,Ro....\\ flOMR 6!DS IQ(tS SH~.j'3~ fI \\,j S ~.l..l'S A',) sr-uJ PH,l''''' 1 j.'; tP,·'o Fe~:I t~~ e~~ 'e (,Jt.I!f btf)f'e I.$. ~it~ ~ P';;tI ... AUToC', SIX ":. y.NITS ...

  16. Strikingly higher interleukin (IL)-1alpha, IL-1beta and soluble interleukin-1 receptor antagonist (sIL-1RA) but similar IL-2, sIL-2R, IL-3, IL-4, IL-6, sIL-6R, IL-10, tumour necrosis factor (TNF)-alpha, transforming growth factor (TGF)-beta and interferon IFN-gamma urine levels in healthy females compared to healthy males: protection against urinary tract injury?

    PubMed

    Sadeghi, M; Daniel, V; Naujokat, C; Weimer, R; Opelz, G

    2005-11-01

    The aim of this prospective study was to examine gender-related differences of cytokines in the plasma and urine of healthy individuals that might provide a clue concerning the lower rate of chronic renal diseases in females. Soluble interleukin-1 receptor antagonist (sIL-1RA), interleukin (IL)-1alpha, IL-1beta, IL-2, sIL-2R, IL-3, IL-4, IL-6, sIL-6R, IL-10, tumor necrosis factor (TNF)-alpha, transforming growth factor (TGF)-beta(2) and interferon (IFN)-gamma were determined using standard enzyme-linked immunosorbent assay (ELISA). Cytokine levels were determined in simultaneously obtained plasma and urine samples of 18 male and 28 female healthy members of our laboratory staff. Urine cytokine levels were studied three times at 1-month intervals. All individuals had a negative urine nitrite test and showed no symptoms of urinary tract infection (UTI). Plasma levels of all studied cytokines were similar in males and females (P = n.s.). However, females had significantly higher urine IL-1alpha (P < 0.0001; P < 0.0001; P < 0.0001) and sIL-1RA (P = 0.0001; P = 0.0003; P = 0.0002) than males at three and higher IL-1beta at one of the three investigations (P = 0.098; P = 0.003; P = 0.073). Urine levels of the other cytokines were similar in males and females. Higher urine levels of IL-1alpha, IL-1beta and sIL-1RA in females may result from stimulation of cells in the urinary tract. Increased sIL-1RA might block T lymphocyte activation. The elevated cytokines may play a role in the protection of the female urinary tract from certain renal diseases, such as pyelonephritis and other inflammatory and sclerotic kidney diseases.

  17. Epidemiology of National Collegiate Athletic Association men’s and women’s swimming and diving injuries from 2009/10 to 2013/14

    PubMed Central

    Kerr, Zachary Y.; Baugh, Christine M.; Hibberd, Elizabeth E.; Snook, Erin M.; Hayden, Ross; Dompier, Thomas P.

    2015-01-01

    Background/Aim Recent injury data for collegiate-level swimming and diving is limited. Previous data is limited to single seasons, elite and national team athletes, or emergency department data. This study describes the epidemiology of men’s and women’s swimming and diving injuries reported by the National Collegiate Athletic Association (NCAA) Injury Surveillance Program (ISP) during the 2009/10-2013/14 academic years. Methods Injuries and athlete-exposure (AE) data reported within nine men’s and 13 women’s swimming and diving programs were analyzed. Injury rates, injury rate ratios (IRR), and injury proportions by body site, diagnosis, and mechanism were reported with 95% confidence intervals (CI). Results The ISP captured 149 and 208 injuries for men’s and women’s swimming and diving, respectively, leading to injury rates of 1.54/1000AEs and 1.71/1000AEs. Among females, divers had a higher injury rate (2.49/1000AEs) than swimmers (1.63/1000AEs; IRR=1.53; 95%CI: 1.07, 2.19). Injury rates for male divers (1.94/1000AEs) and swimmers (1.48/1000AEs) did not differ (IRR=1.33; 95%CI: 0.85, 2.31). Most injuries occurred to the shoulder and resulted in strains. Many injuries were classified as overuse or non-contact. Female swimmers had a higher overuse injury rate (1.04/1000AEs) than male swimmers (0.66/1000AEs; IRR=1.58; 95%CI: 1.14, 2.19). Overuse injury rates for female divers (0.54/1000AEs) and male divers (0.46/1000AEs) did not differ (IRR=1.16; 95%CI: 0.40, 3.34). Conclusions Shoulder, strain, and overuse injuries were common in collegiate men’s and women’s swimming and diving. In addition, divers may have higher injury rates than swimmers, although small reported numbers in this study warrant additional research. PMID:25633831

  18. Achieving 14.4% Alcohol-Based Solution-Processed Cu(In,Ga)(S,Se)2 Thin Film Solar Cell through Interface Engineering.

    PubMed

    Park, Gi Soon; Chu, Van Ben; Kim, Byoung Woo; Kim, Dong-Wook; Oh, Hyung-Suk; Hwang, Yun Jeong; Min, Byoung Koun

    2018-03-28

    An optimization of band alignment at the p-n junction interface is realized on alcohol-based solution-processed Cu(In,Ga)(S,Se) 2 (CIGS) thin film solar cells, achieving a power-conversion-efficiency (PCE) of 14.4%. To obtain a CIGS thin film suitable for interface engineering, we designed a novel "3-step chalcogenization process" for Cu 2- x Se-derived grain growth and a double band gap grading structure. Considering S-rich surface of the CIGS thin film, an alternative ternary (Cd,Zn)S buffer layer is adopted to build favorable "spike" type conduction band alignment instead of "cliff" type. Suppression of interface recombination is elucidated by comparing recombination activation energies using a dark J- V- T analysis.

  19. Measurement of the branching fractions of D s + → η ' X and D s + → η ' ρ + in e + e - → D s + D s -

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.

    We study D + s decays to final states involving the η' with a 482 pb -1 data sample collected at √s = 4.009 GeV with the BESIII detector at the BEPCII collider. We measure the branching fractions Β(D + s → η'Χ) = (8.8 ± 1.8 ± 0.5)% and Β(D + s → η'ρ +) = (5.8 ± 1.4 ± 0.4)% where the first uncertainty is statistical and the second is systematic. In addition, we estimate an upper limit on the non-resonant branching ratio Β(D + s → η'π +π 0) < 5.1% at the 90% confidence level. Lastly,more » our results are consistent with CLEO's recent measurements and help to resolve the disagreement between the theoretical prediction and CLEO's previous measurement of Β(D + s → η'ρ +).« less

  20. Measurement of the branching fractions of D s + → η ' X and D s + → η ' ρ + in e + e - → D s + D s -

    DOE PAGES

    Ablikim, M.

    2015-09-30

    We study D + s decays to final states involving the η' with a 482 pb -1 data sample collected at √s = 4.009 GeV with the BESIII detector at the BEPCII collider. We measure the branching fractions Β(D + s → η'Χ) = (8.8 ± 1.8 ± 0.5)% and Β(D + s → η'ρ +) = (5.8 ± 1.4 ± 0.4)% where the first uncertainty is statistical and the second is systematic. In addition, we estimate an upper limit on the non-resonant branching ratio Β(D + s → η'π +π 0) < 5.1% at the 90% confidence level. Lastly,more » our results are consistent with CLEO's recent measurements and help to resolve the disagreement between the theoretical prediction and CLEO's previous measurement of Β(D + s → η'ρ +).« less

  1. 77 FR 14417 - Notice of Temporary Closure on Public Lands in Gooding and Elmore Counties, ID

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-09

    ... affected public lands is: Boise Meridian, Idaho T. 3 S., R. 10 E., Sec. 35. T. 4 S., R. 10 E., Secs. 1 and 2; Secs. 12 to 15, inclusive; Sec. 17; Secs. 20 to 28, inclusive; Secs. 33 to 35, inclusive. T. 5 S., R. 10 E., Secs. 3 and 4. T. 3 S., R. 11 E., Secs. 31 and 33. T. 4 S., R. 11 E., Secs. 3 to 15...

  2. U.S. EPA, Pesticide Product Label, TRIPLE ACTION 10-6-4 LITE WGT PLNT FD CRABGRSS PREVNTR INSECT CTRL, 04/02/1968

    EPA Pesticide Factsheets

    2011-04-19

    li!"~:'i • 1l1t.t~j 1:l1-.1. l':~'l~t):.,'i\\ (: ,( At·t i ','t' ] II~' r't"! i l'T,! ~: ' lli m.-t h y 1 (. s , r' I' " , acid ll'('!ll1 iC

  3. U.S. EPA, Pesticide Product Label, SANI-CLOTH PLUS GERMICIDAL DISPOSABLE CLOTH, 10/30/2007

    EPA Pesticide Factsheets

    2011-04-21

    ... Escherichia coli (E. coli) 0157:H7 (AIQGE~5Jj:5P) .... ... k1~~~g~:g~l~~I~r~;,'~ 1~~~~:e!g:'tEi#ure~"wiP.Ei!:c)~~b;s:;[~H~';iji~9J!Ii;~~] ...

  4. How practical is the application of percutaneous nephrolithotomy scoring systems? Prospective study comparing Guy's Stone Score, S.T.O.N.E. score and the Clinical Research Office of the Endourological Society (CROES) nomogram.

    PubMed

    Singla, Anurag; Khattar, Nikhil; Nayyar, Rishi; Mehra, Shibani; Goel, Hemant; Sood, Rajeev

    2017-03-01

    To prospectively compare the Guy's Stone Score (GSS), S.T.O.N.E. [stone size (S), tract length (T), obstruction (O), number of involved calices (N), and essence or stone density (E)] score and the Clinical Research Office of the Endourological Society (CROES) nephrolithometric nomogram to predict percutaneous nephrolithotomy (PCNL) success rate and assess the correlation with perioperative complications. We prospectively evaluated all consecutive PCNL patients at our institute between 1 November 2013 and 31 May 2015. The above scoring systems were applied to preoperative non-contrast computed tomography and the practical difficulties in such applications were noted. Perioperative complications and the stone-free rate (SFR) were also recorded. Receiver operating characteristic curves were drawn and the areas under curves were compared and appropriate statistical analysis done. In all, 48 renal units were included in the study. The overall SFR was 62.2%. The presence of staghorn stones ( β  = 27.285, 95% confidence interval 1.19-625.35; P  = 0.039) was the only significant variable associated with the residual stones on multivariate analysis. Stone-free patients had significantly lower median GSS (2 vs 4) and S.T.O.N.E. scores (6 vs 10) and higher median CROES scores (83% vs 63%) (all P  < 0.001) compared to residual-stone patients. All scoring systems were significantly associated with SFR (all P  < 0.001). There was no significant difference in the areas under curves of the scoring systems (0.858, 0.923, and 0.931, respectively). Furthermore, all scoring systems had weak correlations with Clavien-Dindo classified complications ( r  = 0.29, P  = 0.045; r  = 0.40, P  = 0.005 and r  = -0.295, P  = 0.04, respectively). We found no standardisation for the measurement of stone dimensions, tract length, Hounsfield units, and staghorn definition. All scoring systems equally predicted SFR and had a weak correlation with Clavien-Dindo complications

  5. Weyerhaeuser Export Facility at DuPont. Volume III. Appendices R - T.

    DTIC Science & Technology

    1982-05-01

    o 1 0N. u 𔃺-43-.Ell. in- All~ 4E-W -Sl >.41 03..l 0 -. 0.El El4 -0 00. ElE w wo El0 0 E.W a A44 l iV t 4 r A - - . 1 %9C 4 U. o U 10 ).- 3W 4 aQ 4...8217 , u =1 0.H, a t 0𔃺 El4 2-0.4 4 00 LI 40. -0 f.. N . .2 C 44 04 >, . 00 a 10 0 ~ 01 020 0 *. 20A 3. 40 04 .4 a,4 - 44 4 E 0 A2. U.~E4 Q 4 4.0 0 6.a

  6. Contribution of three CYP3A isoforms to metabolism of R- and S-warfarin.

    PubMed

    Jones, Drew R; Kim, So-Young; Boysen, Gunnar; Yun, Chul-Ho; Miller, Grover P

    2010-12-01

    Effective coumadin (R/S-warfarin) therapy is complicated by inter-individual variability in metabolism. Recent studies have demonstrated that CYP3A isoforms likely contribute to patient responses and clinical outcomes. Despite a significant focus on CYP3A4, little is known about CYP3A5 and CYP3A7 metabolism of warfarin. Based on our studies, recombinant CYP3A4, CYP3A5 and CYP3A7 metabolized R- and S-warfarin to 10- and 4'-hydroxywarfarin with efficiencies that depended on the individual enzymes. For R-warfarin, CYP3A4, CYP3A7, and CYP3A5 demonstrated decreasing preference for 10-hydroxylation over 4'-hydroxylation. By contrast, there was no regioselectivity toward S-warfarin. While all enzymes preferentially metabolized R-warfarin, CYP3A4 was the most efficient at metabolizing all reactions. Individuals, namely African-Americans and children, with higher relative levels of CYP3A5 and/or CYP3A7, respectively, compared to CYP3A4 may metabolize warfarin less efficiently and thus may require lower doses and be at risk for adverse drug-drug interactions related to the contributions of the respective enzymes.

  7. Renierite, Cu10ZnGe2Fe4S16-Cu11GeAsFe4S16: a coupled solid solution series.

    USGS Publications Warehouse

    Bernstein, L.R.

    1986-01-01

    The composition of renierite is found to be Cu10(Zn1-xCux)Ge2-xAsxFe4S16 (0 = or < x = or < 1), with continuous solid solution between the zincian and arsenian end-members, Cu10ZnGe2Fe4S16 and Cu11GeAsFe4S16, through the coupled substitution Zn(II) + Ge(IV) = Cu(I) + As(V). This is the first reported example of extensive coupled solid solution in a sulphide mineral. Arsenian renierite, not previously characterized, is similar to zincian renierite in polished section, with a slightly redder colour and lower anisotropy. It is reddish orange with relief very similar to that of bornite, though it is harder (VHN25 = 286) and does not tarnish in air. It is slightly bireflective, with colours varying from orange-yellow to reddish orange in nearly crossed polarizers. The strongest powder XRD lines are: 3.042(100), 1.861(29), 1.869(16), 1.594(11) and 1.017(10) A; D(calc.) 4.50 g/cm3. Specimens have been found at the Ruby Creek copper deposit, Alaska, where zincian renierite also occurs, and at the Inexco no. 1 mine, Jamestown, Colorado.-J.A.Z.

  8. 40 CFR 81.303 - Arizona.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., R141/2E X T1S, R15E X T2N, R13E 1 X T2N, R16E X T1N, R16E X T1S, R13E 1 X T1S, R16E X T2S, R14E 1 X T2S..., R13E; T1N, R14E; T1N, R15E; T1S, R14E; T1S, R14 1/2E; T1S, R15E 1 Excludes Indian country located in...); T1S, R14E (sections 124); T1S, R141/2E; and T1S, R15E 11/15/90 Nonattainment 11/15/90 Moderate. Gila...

  9. Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) : Concept of Operations. [supporting datasets

    DOT National Transportation Integrated Search

    2012-10-31

    This zip file contains 45 files of data to support FHWA-JPO-13-063 Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) : Concept of Operations. Zip size is 9.9 MB. The files have been uploaded as-is; no fu...

  10. Monkey liver cytochrome P450 2C19 is involved in R- and S-warfarin 7-hydroxylation.

    PubMed

    Hosoi, Yoshio; Uno, Yasuhiro; Murayama, Norie; Fujino, Hideki; Shukuya, Mitsunori; Iwasaki, Kazuhide; Shimizu, Makiko; Utoh, Masahiro; Yamazaki, Hiroshi

    2012-12-15

    Cynomolgus monkeys are widely used as primate models in preclinical studies. However, some differences are occasionally seen between monkeys and humans in the activities of cytochrome P450 enzymes. R- and S-warfarin are model substrates for stereoselective oxidation in humans. In this current research, the activities of monkey liver microsomes and 14 recombinantly expressed monkey cytochrome P450 enzymes were analyzed with respect to R- and S-warfarin 6- and 7-hydroxylation. Monkey liver microsomes efficiently mediated both R- and S-warfarin 7-hydroxylation, in contrast to human liver microsomes, which preferentially catalyzed S-warfarin 7-hydroxylation. R-Warfarin 7-hydroxylation activities in monkey liver microsomes were not inhibited by α-naphthoflavone or ketoconazole, and were roughly correlated with P450 2C19 levels and flurbiprofen 4-hydroxylation activities in microsomes from 20 monkey livers. In contrast, S-warfarin 7-hydroxylation activities were not correlated with the four marker drug oxidation activities used. Among the 14 recombinantly expressed monkey P450 enzymes tested, P450 2C19 had the highest activities for R- and S-warfarin 7-hydroxylations. Monkey P450 3A4 and 3A5 slowly mediated R- and S-warfarin 6-hydroxylations. Kinetic analysis revealed that monkey P450 2C19 had high V(max) and low K(m) values for R-warfarin 7-hydroxylation, comparable to those for monkey liver microsomes. Monkey P450 2C19 also mediated S-warfarin 7-hydroxylation with V(max) and V(max)/K(m) values comparable to those for recombinant human P450 2C9. R-warfarin could dock favorably into monkey P450 2C19 modeled. These results collectively suggest high activities for monkey liver P450 2C19 toward R- and S-warfarin 6- and 7-hydroxylation in contrast to the saturation kinetics of human P450 2C9-mediated S-warfarin 7-hydroxylation. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Inhibition of /sup 3/H-leukotriene D4 binding to guinea pig lung receptors by the novel leukotriene antagonist ICI 198,615

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aharony, D.; Falcone, R.C.; Krell, R.D.

    1987-12-01

    The specific binding of (/sup 3/H)5(S)hydroxy-6(R)-S-cysteinylglycyl -7(E),9(E),11(Z),14(Z)-eicosatetraenoic acid ((/sup 3/H)LTD4) to receptors on guinea pig lung parenchymal membranes and its inhibition by ICI 198,615, a representative example of a new class of leukotriene antagonists, was characterized by a receptor-ligand binding assay. (/sup 3/H)LTD4 bound specifically and rapidly (Kon = 0.29 +/- 0.6 nM-1.min-1) reaching equilibrium within 15 min. The rate of binding was greatly inhibited in the presence of ICI 198,615. Excess LTD4 or ICI 198,615 slowly (t1/2 = 20 min) dissociated about 70% of the receptor-bound (/sup 3/H)LTD4, whereas in combination with GTP analogs, both induced a rapid (t1/2more » less than 5 min) and full dissociation. Equilibrium saturation analysis of (/sup 3/H)LTD4 binding demonstrated a saturable (Bmax = 1014 +/- 174 fmol/mg) and high affinity (Kd = 0.43 +/- 0.09 nM) binding site. A high degree of stereoselectivity was demonstrated with inhibition of binding by the stereoisomers of LTD4: S,R much greater than R,R greater than R,S much greater than S,S. The rank order for inhibition of binding by peptide leukotriene was: LTD4 greater than 5(S)-hydroxy-6(R)-S-cysteinyl-7(E),9(E),11(Z),14(Z)-eicosatetraenoic acid much greater than 5(S)hydroxy-6(R)-S-glutathionyl-7(E),9(E),11(Z),14(Z)-eicosatetraenoic acid (potency ratios were: 1:4:590). In competition assays, ICI 198,615 competitively inhibited binding of (/sup 3/H)LTD4 (Ki = 0.27 +/- 0.16 nM) and was 2300-fold and 3100-fold more potent than LY171883 or FPL55712. These data, together with results obtained previously in functional receptor assays, illustrate that this new class of leukotriene antagonists are the most potent and selective competitive antagonists of LTD4 receptors yet described.« less

  12. One-step synthesis of water-dispersible ultra-small Fe3O4 nanoparticles as contrast agents for T1 and T2 magnetic resonance imaging

    NASA Astrophysics Data System (ADS)

    Wang, Guannan; Zhang, Xuanjun; Skallberg, Andreas; Liu, Yaxu; Hu, Zhangjun; Mei, Xifan; Uvdal, Kajsa

    2014-02-01

    -1, r2 = 28.62 mM-1 s-1). This demonstrates that the proposed ultra-small Fe3O4 nanoparticles have great potential as a new type of T1 magnetic resonance imaging contrast agents. Especially, the 2.2 nm sized Fe3O4 nanoparticles, have a competitive r1 value and r2 value compared to commercial contrasting agents such as Gd-DTPA (r1 = 4.8 mM-1 s -1), and SHU-555C (r2 = 69 mM-1 s-1). In vitro and in vivo imaging experiments, show that the 2.2 nm sized Fe3O4 nanoparticles exhibit great contrast enhancement, long-term circulation, and low toxicity, which enable these ultra-small sized Fe3O4 nanoparticles to be promising as T1 and T2 dual contrast agents in clinical settings. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr05550g

  13. 78 FR 58554 - Notice of Application for Withdrawal Extension, and Notification of a Public Meeting, Desert...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-24

    ...., partially surveyed, Sec. 7, NW\\1/4\\ and S\\1/2\\. T. 16 S., R. 58 E., unsurveyed, Secs. 11 thru 14, inclusive; Secs. 23 thru 26, inclusive; Secs. 35 and 36. T. 15 S., R. 59 E., unsurveyed, Secs. 2 thru 11, inclusive; Secs. 14 thru 23, inclusive; Secs. 26 thru 35, inclusive. T. 16 S., R. 59 E., unsurveyed, Secs. 2...

  14. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    PubMed Central

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  15. 77 FR 53906 - Notice of Proposed Withdrawal and Opportunity for Public Meeting; California

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-04

    ...\\; Sec. 32, lots 4 and 5; Sec. 34, lot 4. T. 13 N., R. 10 E., Sec. 2, lot 1, and lots 3 to 15, inclusive; Sec. 9, lots 8, 12, and 13, and SW\\1/4\\NE\\1/4\\; Sec. 10, lots 1 to 10, inclusive, E\\1/2\\NE\\1/4\\, E\\1/2..., inclusive, S\\1/2\\ of lot 5, S\\1/2\\ of lot 8, lots 11 and 13; Sec. 19, lot 24; Sec. 20, lots 1, 2, 3, and 8...

  16. Tungsten phosphanylarylthiolato complexes [W{PhP(2-SC6H4)2-kappa3S,S',P} 2] and [W{P(2-SC6H4)3-kappa4S,S',S",P}2]: synthesis, structures and redox chemistry.

    PubMed

    Hildebrand, Alexandra; Lönnecke, Peter; Silaghi-Dumitrescu, Luminita; Hey-Hawkins, Evamarie

    2008-09-14

    PhP(2-SHC6H4)2 (PS2H2) reacts with WCl6 with reduction of tungsten to give the air-sensitive tungsten(IV) complex [W{PhP(2-SC6H4)2-kappa(3)S,S',P}2] (1). 1 is oxidised in air to [WO{PhPO(2-SC6H4)2-kappa(3)S,S',O}{PhP(2-SC6H4)2-kappa(3)S,S',P}] (2). The attempted synthesis of 2 by reaction of 1 with iodosobenzene as oxidising agent was unsuccessful. [W{P(2-SC6H4)3-kappa(4)S,S',S",P}2] (3) was formed in the reaction of P(2-SHC6H4)3 (PS3H3) with WCl6. The W(VI) complex 3 contains two PS3(3-) ligands, each coordinated in a tetradentate fashion resulting in a tungsten coordination number of eight. The reaction of 3 with AgBF4 yields the dinuclear tungsten complex [W2{P(2-SC6H4)3-kappa(4)S,S',S",P}3]BF4 (4). Complexes 1-4 were characterised by spectral methods and X-ray structure determination.

  17. 75 FR 78266 - Filing of Plats of Survey: Oregon/Washington

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-15

    ... publication. Willamette Meridian Oregon T. 6 S., R. 10 E., accepted November 1, 2010 T. 41 S., R. 15 E., accepted November 1, 2010 T. 41 S., R. 14\\1/2\\ E., accepted November 1, 2010 T. 3 S., R. 44 E., accepted November 1, 2010 T. 26 S., R. 12 W., accepted November 5, 2010 ADDRESSES: A copy of the plats may be...

  18. Overexpression of afsR and Optimization of Metal Chloride to Improve Lomofungin Production in Streptomyces lomondensis S015.

    PubMed

    Wang, Wei; Wang, Huasheng; Hu, Hongbo; Peng, Huasong; Zhang, Xuehong

    2015-05-01

    As a global regulatory gene in Streptomyces, afsR can activate the biosynthesis of many secondary metabolites. The effect of afsR on the biosynthesis of a phenazine metabolite, lomofungin, was studied in Streptomyces lomondensis S015. There was a 2.5-fold increase of lomofungin production in the afsR-overexpressing strain of S. lomondensis S015 N1 compared with the wild-type strain. Meanwhile, the transcription levels of afsR and two important genes involved in the biosynthesis of lomofungin (i.e., phzC and phzE) were significantly upregulated in S. lomondensis S015 N1. The optimization of metal chlorides was investigated to further increase the production of lomofungin in the afsR-overexpressing strain. The addition of different metal chlorides to S. lomondensis S015 N1 cultivations showed that CaCl2, FeCl2, and MnCl2 led to an increase in lomofungin biosynthesis. The optimum concentrations of these metal chlorides were obtained using response surface methodology. CaCl2 (0.04 mM), FeCl2 (0.33 mM), and MnCl2 (0.38 mM) gave a maximum lomofungin production titer of 318.0 ± 10.7 mg/l, which was a 4.1-fold increase compared with that of S. lomondensis S015 N1 without the addition of a metal chloride. This work demonstrates that the biosynthesis of phenazine metabolites can be induced by afsR. The results also indicate that metal chlorides addition might be a simple and useful strategy for improving the production of other phenazine metabolites in Streptomyces.

  19. The U.S. Army’s Health Risk Appraisal (HRA) Survey, Part I, History, Reliability, and Validity

    DTIC Science & Technology

    2003-08-01

    reports as a clinical decision-making rule in deciding whether or not to administer the screening test. Second, accuracy of patient self-reports may...10): 1665-1669, 1997. 6. Baker, F., S. R. Ainsworth, J. T. Dye, C. Crammer , M. J. Thun, D. Hoffmann, J. L. Repace, J. E. Henningfield, J. Slade, J

  20. Ternary chalcogenides C s 2 Z n 3 S e 4 and C s 2 Z n 3 T e 4 : Potential p -type transparent conducting materials

    DOE PAGES

    Shi, Hongliang; Saparov, Bayrammurad; Singh, David J.; ...

    2014-11-11

    Here we report prediction of two new ternary chalcogenides that can potentially be used as p-type transparent conductors along with experimental synthesis and initial characterization of these previously unknown compounds, Cs 2Zn 3Ch 4 (Ch = Se, Te). In particular, the structures are predicted based on density functional calculations and confirmed by experiments. Phase diagrams, electronic structure, optical properties, and defect properties of Cs 2Zn 3Se 4 and Cs 2Zn 3Te 4 are calculated to assess the viability of these materials as p-type TCMs. Cs 2Zn 3Se 4 and Cs 2Zn 3Te 4, which are stable under ambient air, displaymore » large optical band gaps (calculated to be 3.61 and 2.83 eV, respectively) and have small hole effective masses (0.5-0.77 m e) that compare favorably with other proposed p-type TCMs. Defect calculations show that undoped Cs2Zn3Se4 and Cs2Zn3Te4 are p-type materials. However, the free hole concentration may be limited by low-energy native donor defects, e.g., Zn interstitials. Lastly, non-equilibrium growth techniques should be useful for suppressing the formation of native donor defects, thereby increasing the hole concentration.« less

  1. Synthesis, structure, and electrochemistry of di- and zerovalent nickel, palladium, and platinum monomers and dimers derived from an enantiopure (S,S)-tetra(tertiary phosphine).

    PubMed

    Kitto, Heather J; Rae, A David; Webster, Richard D; Willis, Anthony C; Wild, S Bruce

    2007-09-17

    The ligand (S,S)-1,1,4,7,10,10-hexaphenyl-1,4,7,10-tetraphosphadecane, (S,S)-tetraphos, reacts with hexa(aqua)nickel(II) chloride in the presence of trimethylsilyl triflate (TMSOTf) in dichloromethane to give the yellow square-planar complex [Ni{(R,R)-tetraphos}](OTf)2, which has been crystallographically characterized as the square-pyramidal, acetonitrile adduct [Ni(NCMe){(R,R)-tetraphos}]OTf. Cyclic voltammograms of the nickel(II) complex in dichloromethane and acetonitrile at 20 degrees C showed two reduction processes at negative potentials with oxidative (E(p)(ox)) and reductive (E(p)(red)) peak separations similar to those observed for ferrocene/ferrocenium under identical conditions, suggesting two one-electron steps. The cyclic voltammetric data for the divalent nickel complex in acetonitrile at temperatures below -20 degrees C were interpreted according to reversible coordination of acetonitrile to the nickel(I) and nickel(0) complexes. The divalent palladium and platinum complexes [M{(R,R)-tetraphos}](PF6)2 and [M2{(R,R)-tetraphos}2](OTf)4 have been prepared. The reduction potentials for the complexes [M{(R,R)-tetraphos}](PF6)2 increase in the order nickel(II) < palladium(II) < platinum(II). The reaction of (S,S)-tetraphos with bis(cycloocta-1,5-diene)nickel(0) in benzene affords orange [Ni{(R,R)-tetraphos}], which slowly rearranges into the thermodynamically more stable, yellow, double-stranded helicate [Ni2{(R,R)-tetraphos}2]; the crystal structures of both complexes have been determined. The reactions of (S,S)-tetraphos with [M(PPh3)4] in toluene (M = Pd) or benzene (M = Pt) furnish the double-stranded helicates [M2{(R,R)-tetraphos}2]; the palladium complex crystallizes from hot benzene as the 2-benzene solvate and was structurally characterized by X-ray crystallography. In each of the three zerovalent complexes, the coordinated (R,R)-tetraphos stereospecifically generates tetrahedral M(PP)2 stereocenters of M configuration.

  2. Resveratrol, 4' Acetoxy Resveratrol, R-equol, Racemic Equol or S-equol as Cosmeceuticals to Improve Dermal Health.

    PubMed

    Lephart, Edwin D

    2017-06-03

    Phytochemicals are botanical compounds used in dermatology applications as cosmeceuticals to improve skin health. Resveratrol and equol are two of the best-known polyphenolic or phytoestrogens having similar chemical structures and some overlapping biological functions to 17β-estradiol. Human skin gene expression was reviewed for 28 different biomarkers when resveratrol, 4' acetoxy resveratrol (4AR), R -equol, racemic equol or S -equol were tested. Sirtuin 1 activator (SIRT 1) was stimulated by resveratrol and 4AR only. Resveratrol, R -equol and racemic equol were effective on the aging biomarkers proliferating cell nuclear factor (PCNA), nerve growth factor (NGF), 5α-reductase and the calcium binding proteins S100 A8 and A9. Racemic equol and 4AR displayed among the highest levels for the collagens, elastin and tissue inhibitor of the matrix metalloproteinase 1 (TIMP 1). S -equol displayed the lowest level of effectiveness compared to the other compounds. The 4AR analog was more effective compared to resveratrol by 1.6-fold. R -equol and racemic equol were almost equal in potency displaying greater inhibition vs. resveratrol or its 4' analog for the matrix metalloproteinases (MMPs), but among the inflammatory biomarkers, resveratrol, 4AR, R -equol and racemic equol displayed high inhibition. Thus, these cosmeceuticals display promise to improve dermal health; however, further study is warranted to understand how phytochemicals protect/enhance the skin.

  3. Attempts on producing lymphoid cell line from Penaeus monodon by induction with SV40-T and 12S EIA oncogenes.

    PubMed

    Puthumana, Jayesh; Prabhakaran, Priyaja; Philip, Rosamma; Singh, I S Bright

    2015-12-01

    In an attempt of in vitro transformation, transfection mediated expression of Simian virus-40 (T) antigen (SV40-T) and transduction mediated expression of Adenovirus type 12 early region 1A (12S E1A) oncogene were performed in Penaeus monodon lymphoid cells. pSV3-neo vector encoding SV40-T oncogene and a recombinant baculovirus BacP2-12S E1A-GFP encoding 12S E1A oncogene under the control of hybrid promoters were used. Electroporation and lipofection mediated transformation of SV40-T in lymphoid cells confirmed the transgene expression by phenotypic variation and the expression of GFP in co-transfection experiment. The cells transfected by lipofection (≥ 5%) survived for 14 days with lower toxicity (30%), whilst on electroporation, most of the cells succumbed to death (60%) and survived cells lived up to 7 days. Transduction efficiency in primary lymphoid cells was more than 80% within 14 days of post-transduction, however, an incubation period of 7 days post-transduction was observed without detectable expression of 12S E1A. High level of oncogenic 12S E1A expression were observed after 14 day post-transduction and the proliferating cells survived for more than 90 days with GFP expression, however, without in vitro transformation and immortalization. The study put forth the requirement of transduction mediated 'specific' oncogene expression along with telomerase activation and epigenetic induction for the immortalization and establishment of shrimp cell line. Copyright © 2015. Published by Elsevier Ltd.

  4. It’s Your Career - Get Involved and Give It all You Got,

    DTIC Science & Technology

    1985-04-01

    SSS) the z-, 1 1 e,es of FtiE. s- ... t+ P23. c’-aCJ. s ,-u f, r - arc t- rt .I th sI.r I ar r, th,- -ds F ac’rri 1 -shmen t . Ser or Is-Ts s. r...Fcrn’ "I F- f 7r , I nll :j H-r-ni In ’ 1 Pci Ia leq- pc +’ N-’’i rl + rfre Z, aca r Plec ,eP P’,,.al s r-sr c ,zr C,-. l qe ,-, P-ir I -’rn a._r ,-sj-aF...who enters his/her current base three times. That’s where the officer is’ Checking the box "Desire to remain at current station" will let the

  5. Observation of e+e-→ϕ χc 1 and ϕ χc 2 at √{s }=4.600 GeV

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, P. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guo, A. Q.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuessner, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K. J.; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Musiol, P.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, Meng; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhou, Y. X.; Zhu, J.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2018-02-01

    Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a center-of-mass energy of √{s }=4.600 GeV , we search for the production of e+e-→ϕ χc 0 ,1 ,2 . A search is also performed for the charmonium-like state X (4140 ) in the radiative transition e+e-→γ X (4140 ) with X (4140 ) subsequently decaying into ϕ J /ψ . The processes e+e-→ϕ χc 1 and ϕ χc 2 are observed for the first time, each with a statistical significance of more than 10 σ , and the Born cross sections are measured to be (4. 2-1.0+1.7±0.3 ) and (6. 7-1.7+3.4±0.5 ) pb , respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e+e-→ϕ χc 0 and e+e-→γ X (4140 ) and upper limits on the Born cross sections at 90% C.L. are provided at √{s }=4.600 GeV .

  6. Validation of the βeta-s.t.a.r. 1 + 1 for rapid screening of residues of β-lactam antibiotics in milk

    PubMed Central

    Reybroeck, W.; Ooghe, S.; De Brabander, H.F.; Daeseleire, E.

    2010-01-01

    The 2-min protocol (1 + 1) for the βeta-s.t.a.r. (manufactured by Neogen Corporation, Lansing, MI, USA) was validated at the Technology and Food Science Unit of the Institute for Agricultural and Fisheries Research according to Commission Decision 2002/657/EC. The test was very selective for the group of β-lactam compounds: the only interference found was by clavulanic acid at 2500 μg kg−1 and above. The modified protocol (βeta-s.t.a.r. 1 + 1) detected all β-lactams with a maximum residue limit (MRL) in milk, but not all these compounds were detected at their respective MRL. The detection of cefalexin (detection capability = 6000 μg kg−1; MRL = 100 μg kg−1) and penethamate (detection capability = 80 μg kg−1; MRL = 4 μg kg−1) was especially poor, and also ceftiofur was only detected from 500 μg kg−1 (MRL = 100 μg kg−1). The repeatability of the reader and of the test was very good. The test was very robust: test results were not significantly influenced by small changes in the test protocol, by the milk composition or by the type of milk. The test was also suitable to test the milk of animal species other than cow. Favourable results were obtained in testing monitoring samples, in two national ring trials, and in an international proficiency test. The βeta-s.t.a.r. 1 + 1 is a very fast, simple, and reliable test that could be used at the farm level to prevent tanker milk contamination by β-lactams. PMID:20512709

  7. Estudo do espalhamento elastico em colisoes pp a √s = 1.96 T eV com o Detector de Protons Frontais FPD (in Portuguese)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molina, Jorge

    Proton-antiproton elastic scattering was measured with the Forward Proton De- tectors installed in the Tevatron tunel near the DØ detector. Measurements were made at c.m.s. energies of √s = 1.96 T eV in the range of four momentum transfer 0.96 < |t| < 1.3 GeV 2. Data are well described by the exponential form of eb t with the slope given by b = −4.015 ± 0.193 GeV −2.

  8. A measurement of t$$\\bar{t}$$ production cross section in p$$\\bar{p}$$ collisions at √s = 1.8 TeV using neural networks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Harpreet

    The authors present the results of a new measurement of the tmore » $$\\bar{t}$$ production cross section using eμ channel in p$$\\bar{p}$$ collisions at √s = 1.8 TeV. This study corresponds to an integrated luminosity of 108.3 ± 5.7 pb -1 acquired by the D0 detector during the Fermilab Tevatron Collider Run 1 (1992--1996). By using neural network techniques instead of the conventional analysis methods, the authors show that the signal acceptance can be increased by 10% (for m t = 172 GeV/c 2) while the background remains constant. Four eμ events are observed in data with an estimated background of 0.22 ± 0.14 corresponding to a t$$\\bar{t}$$ production cross section of 9.75 ± 5.53 pb.« less

  9. Importance of individual amino acids in the Switch I region in eEF2 studied by functional complementation in S. cerevisiae.

    PubMed

    Bartish, Galyna; Nygård, Odd

    2008-05-01

    Elongation factor 2 (eEF2) is a member of the G-protein super family. G-proteins undergo conformational changes associated with binding of the guanosine nucleotide and hydrolysis of the bound GTP. These structural rearrangements affects the Switch I region (also known as the Effector loop). We have studied the role of individual amino acids in the Switch I region (amino acids 25-73) of S. cerevisiae eEF2 using functional complementation in yeast. 21 point mutations in the Switch I region were created by site-directed mutagenesis. Mutants K49R, E52Q, A53G, F55Y, K60R, Q63A, T68S, I69M and A73G were functional while mutants R54H, F55N, D57A, D57E, D57S, R59K, R59M, Q63E, R65A, R65N, T68A and T68M were inactive. Expression of mutants K49R, A53G, Q63A, I69M and A73G was associated with markedly decreased growth rates and yeast cells expressing mutants A53G and I69M became temperature sensitive. The functional capacity of eEF2 in which the major part Switch I (amino acids T56 to I69) was converted into the homologous sequence found in EF-G from E. coli was also studied. This protein chimera could functionally replace yeast eEF2 in vivo. Yeast cells expressing this mutant grew extremely slowly, showed increased cell death and became temperature sensitive. The ability of the mutant to replace authentic eEF2 in vivo indicates that the structural rearrangement of Switch I necessary for eEF2 function is similar in eukaryotes and bacteria. The effect of two point mutations in the P-loop was also studied. Mutant A25G but not A25V could functionally replace yeast eEF2 even if cells expressing the mutant grew slowly. The A25G mutation converted the consensus sequences AXXXXGK[T/S] in eEF2 to the corresponding motif GXXXXGK[T/S] found in all other G-proteins, suggesting that the alanine found in the P-loop of peptidyltranslocases are not essential for function.

  10. A Characterization of t/s-Diagnosability and Sequential t-Diagnosability in Designs

    DTIC Science & Technology

    1990-10-01

    41 151 161 171 181 r91 1101 REFERENCES K.-Y. Chwa and S. L. Hakimi, “On fault identification in diagnosable systems,” ZEEE Tmns. Comput...1975, pp. 167-170. S. L. Hakimi and A. T. Amin, “Characterization of the connection assignment problem of diagnosable systems,” ZEEE Trans. Comput...S. Karunanithi and A. D. Friedman, “Analysis of digital systems using a new measure of system diagnosis,” ZEEE Trans. Cornput., vol. C- A

  11. Hadronic Transitions from Upsilon (2S) to Upsilon (1s) and Upsilon Dipion Transitions at Energies Near the Upsilon (4S)

    NASA Astrophysics Data System (ADS)

    Kotoy, Sergei Anatolievich

    This dissertation consists of two closely related analyses, both of which were performed using data collected with the CLEO II detector at the Cornell Electron Storage Ring. In the first analysis, using the world largest data sample of Υ(2 S) events, we have investigated the hadronic transitions between the Υ(2S) and the Υ(1S), i.e. decays of the Υ(2S) into the Υ(1S), plus a pair of pions ( p+p- or p0p0 ), a single η or a single p0 . The dipion transitions U(2S)-->U( 1S)pp were studied most closely, by using two different techniques: ``exclusive'' and ``inclusive''. In these measurements we determine the U(2S)-->U( 1S)pp branching ratios, and, by combining the exclusive and inclusive results, we derive the Υ(1S), leptonic branching ratios Bee and Bmm . Parameters of the ππ system in the dipion transitions (dipion invariant mass spectra, angular distributions) were analyzed and found to be consistent with current theoretical models. Lastly, we searched for the η and single π0 transitions and obtained upper limits on the branching ratios B(U(2S) -->U(1S)h ) and B(U(2S) -->U(1S)p 0) . In the second analysis, the data collected at the center of mass energies near the Υ(4S) were used to search for the dipion transition between pairs of Υ resonances. As a result of this search, we established upper limits on the branching ratios of the dipion transitions post='par'>p+p- and U(4S)-->U( 1S)p+p- , and measured the cross-sections for the radiative production of Υ(3 S) and Υ(2S) resonances e+e--->U(nS) g at the center of mass energies of Ecm = 10.58 GeV and Ecm = 10.52 GeV.

  12. Measurement of the t anti-t production cross-section at √s = 1.96-TeV using lifetime tagging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khanov, Alexander

    2004-01-01

    A measurement of the tmore » $$\\bar{t}$$ production cross section in the lepton+jets channels with the D0 detector at √s = 1.96 TeV using the lifetime-tagging techniques is presented. The t$$\\bar{t}$$ cross section is estimated from the combination of the e+jets and μ+jets channels. The obtained result σ t$$\\bar{t}$$ = 7.47$$+ 1.22\\atop{-1.14}$$(stat)$$+ 1.65\\atop{-1.03}$$(syst) ± 0.49(lumi) pb is consistent with the Standard Model expectation.« less

  13. Super reduced Fe4S4 cluster of Balch's dithiolene series.

    PubMed

    Begum, Ameerunisha; Moula, Golam; Bose, Moumita; Sarkar, Sabyasachi

    2012-03-28

    A super reduced Fe(4)S(4) cluster with a sulfur based radical, [NBu(4)](4)[Fe(3)(III)Fe(II)(μ(3)-S)(4)(mnt)(3)(6-)(mnt)(1-)˙](4-)˙, (1) (mnt, maleonitrile dithiolate) which evolves H(2)S gas on treatment with acid under ambient conditions has been synthesized and structurally characterized. The Fe-S distances in 1 are in the range 2.246-2.383 Å, in stark contrast to that of the known n = -2 member of the series based on the [Fe(4)(μ(3)-S)(4)(S(2)C(2)R(2))(4)](n) unit (R = CF(3), Ph) with Fe-S bond lengths of 2.149-2.186 Å. The EPR of 1 displays very weak signals at g, 4.03 and 2.38 along with a strong S-based radical EPR signal at g, 2.003 associated with five structured components tentatively assigned to hyperfine interaction arising out of the naturally abundant (57)Fe with = 88 G. The EPR profile resembles the reduced Fe-S cluster of CO inhibited Clostridium pasteurianum W5 hydrogenase or the Fe(4)S(4) centers of wild-type enzyme, IspH treated with HMBPP or IPP.

  14. 14 CFR 47.9 - Corporations not U.S. citizens.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Corporations not U.S. citizens. 47.9... AIRCRAFT REGISTRATION General § 47.9 Corporations not U.S. citizens. (a) Each corporation applying for... disregarded. (e) The corporation that registers an aircraft pursuant to 49 U.S.C. 44102 shall maintain, and...

  15. 14 CFR 47.9 - Corporations not U.S. citizens.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Corporations not U.S. citizens. 47.9... AIRCRAFT REGISTRATION General § 47.9 Corporations not U.S. citizens. (a) Each corporation applying for... disregarded. (e) The corporation that registers an aircraft pursuant to 49 U.S.C. 44102 shall maintain, and...

  16. Soluble CD40-ligand (sCD40L, sCD154) plays an immunosuppressive role via regulatory T cell expansion in HIV infection

    PubMed Central

    Jenabian, M-A; Patel, M; Kema, I; Vyboh, K; Kanagaratham, C; Radzioch, D; Thébault, P; Lapointe, R; Gilmore, N; Ancuta, P; Tremblay, C; Routy, J-P

    2014-01-01

    CD40/CD40-ligand (CD40L) signalling is a key stimulatory pathway which triggers the tryptophan (Trp) catabolizing enzyme IDO in dendritic cells and is immunosuppressive in cancer. We reported IDO-induced Trp catabolism results in a T helper type 17 (Th17)/regulatory T cell (Treg) imbalance, and favours microbial translocation in HIV chronic infection. Here we assessed the link between sCD40L, Tregs and IDO activity in HIV-infected patients with different clinical outcomes. Plasmatic sCD40L and inflammatory cytokines were assessed in anti-retroviral therapy (ART)-naive, ART-successfully treated (ST), elite controllers (EC) and healthy subjects (HS). Plasma levels of Trp and its metabolite Kynurenine (Kyn) were measured by isotope dilution tandem mass spectrometry and sCD14 was assessed by enzyme-linked immunosorbent assay (ELISA). IDO-mRNA expression was quantified by reverse transcription–polymerase chain reaction (RT–PCR). The in-vitro functional assay of sCD40L on Treg induction and T cell activation were assessed on peripheral blood mononuclear cells (PBMCs) from HS. sCD40L levels in ART-naive subjects were significantly higher compared to ST and HS, whereas EC showed only a minor increase. In ART-naive alone, sCD40L was correlated with T cell activation, IDO-mRNA expression and CD4 T cell depletion but not with viral load. sCD40L was correlated positively with IDO enzymatic activity (Kyn/Trp ratio), Treg frequency, plasma sCD14 and inflammatory soluble factors in all HIV-infected patients. In-vitro functional sCD40L stimulation induced Treg expansion and favoured Treg differentiation by reducing central memory and increasing terminal effector Treg proportion. sCD40L also increased T cell activation measured by co-expression of CD38/human leucocyte antigen D-related (HLA-DR). These results indicate that elevated sCD40L induces immunosuppression in HIV infection by mediating IDO-induced Trp catabolism and Treg expansion. PMID:24924152

  17. Soluble CD40-ligand (sCD40L, sCD154) plays an immunosuppressive role via regulatory T cell expansion in HIV infection.

    PubMed

    Jenabian, M-A; Patel, M; Kema, I; Vyboh, K; Kanagaratham, C; Radzioch, D; Thébault, P; Lapointe, R; Gilmore, N; Ancuta, P; Tremblay, C; Routy, J-P

    2014-10-01

    CD40/CD40-ligand (CD40L) signalling is a key stimulatory pathway which triggers the tryptophan (Trp) catabolizing enzyme IDO in dendritic cells and is immunosuppressive in cancer. We reported IDO-induced Trp catabolism results in a T helper type 17 (Th17)/regulatory T cell (Treg ) imbalance, and favours microbial translocation in HIV chronic infection. Here we assessed the link between sCD40L, Tregs and IDO activity in HIV-infected patients with different clinical outcomes. Plasmatic sCD40L and inflammatory cytokines were assessed in anti-retroviral therapy (ART)-naive, ART-successfully treated (ST), elite controllers (EC) and healthy subjects (HS). Plasma levels of Trp and its metabolite Kynurenine (Kyn) were measured by isotope dilution tandem mass spectrometry and sCD14 was assessed by enzyme-linked immunosorbent assay (ELISA). IDO-mRNA expression was quantified by reverse transcription-polymerase chain reaction (RT-PCR). The in-vitro functional assay of sCD40L on Treg induction and T cell activation were assessed on peripheral blood mononuclear cells (PBMCs) from HS. sCD40L levels in ART-naive subjects were significantly higher compared to ST and HS, whereas EC showed only a minor increase. In ART-naive alone, sCD40L was correlated with T cell activation, IDO-mRNA expression and CD4 T cell depletion but not with viral load. sCD40L was correlated positively with IDO enzymatic activity (Kyn/Trp ratio), Treg frequency, plasma sCD14 and inflammatory soluble factors in all HIV-infected patients. In-vitro functional sCD40L stimulation induced Treg expansion and favoured Treg differentiation by reducing central memory and increasing terminal effector Treg proportion. sCD40L also increased T cell activation measured by co-expression of CD38/human leucocyte antigen D-related (HLA-DR). These results indicate that elevated sCD40L induces immunosuppression in HIV infection by mediating IDO-induced Trp catabolism and Treg expansion. © 2014 British Society for Immunology.

  18. Deception Integration in the U.S. Army

    DTIC Science & Technology

    1990-06-01

    lemon of Information Siend cormentif ear q th~b~4%e~mt rayo ~~IOIo ,. (OIleeI,on of .nfor-on.on. Including lu99C~L.Of for reou’l In’s burdem, t0 o~an~n1 n...London: 1936) pp. 106-7. 72 SITATINA6PM 8T OCT. 191 7 .73 Wtd&ERRA N 4-1 a Q PMV rAMw: M XXI xx Sh GA W X . mp. SL Detachment F"’, a-- dIL 4f N *44 Yoe. d...guile and cunning and putting together the concept of operations. It’s not a mechanical thing, its not this guy’s got X and I’ve Y and force balance of

  19. Allelic association at the D14S43 locus in early onset Alzheimer`s disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brice, A.; Tardieu, S.; Campion, D.

    1995-04-24

    The D14S43 marker is closely linked to the major gene for early onset autosomal dominant Alzheimer`s disease on chromosome 14. Allelic frequencies at the D14S43 locus were compared in 113 familial and isolated cases of early onset Alzheimer`s disease (<60 years of age at onset) (EOAD) and 109 unaffected individuals of the same geographic origin. Allele 7 was significantly (P = 0.033) more frequent in type 1 EOAD patients (13.2%), defined by the presence of at least another first degree relative with EOAD, than in controls (4.1%). Since an autosomal dominant gene is probably responsible for type 1 patients, allelicmore » association may reflect linkage disequilibrium at the D14S43 locus. This would mean that some patients share a common ancestral mutation. However, since multiple tests were carried out, this result must be interpreted with caution, and needs confirmation in an independent sample. 16 refs., 2 tabs.« less

  20. An Analysis of DOD’s Standards of Conduct Applicable to Personnel Assigned to the Contracting Arena.

    DTIC Science & Technology

    1980-12-01

    THIS PAS Mw bas aem, REPOIR DOCUM NTATION PAGE RED NMIucLrlTWs . NEPORT NUVOW .GOVT ACcSmow e 3. NECIPg~wTS CATALOG NUMMERa 4. TITLe (ad 1,N.J 1. TYPE...SnAnfards on CNui-t4haR boon- DO ~ 1473 EmalOm e e 6.OSŕ Vill 0802-014. 501 1 10 , TO P 1 , - woono-o--- - - a s fi developed for use by procurement...ASSUMPTIONS---------------------------------------- 11 E . LIMITATIONS---------------------------------------- 11 F. METHODOLOGY

  1. Facteurs associés à la tuberculose chez l'enfant au Centre Hospitalier Universitaire Mère-Enfant de Tsaralalàna, Antananarivo: une étude cas-témoins

    PubMed Central

    Randriatsarafara, Fidiniaina Mamy; Vololonarivelo, Barbara Elyan Edwige; Rabemananjara, Nambinina Nirina Gaby; Randrianasolo, Jean Baptiste Olivier; Rakotomanga, Jean de Dieu Marie; Randrianarimanana, Vahiniarison Dieudonné

    2014-01-01

    Introduction A Madagascar, la tuberculose reste un problème de santé publique majeur, l'incidence s’élevant à 16% depuis 2009. Le présent travail a pour objet d'identifier les facteurs de risque de tuberculose chez l'enfant. Méthodes Nous avons mené une étude rétrospective de type cas-témoins sur les facteurs de risque de la tuberculose chez les enfants de 0 à 15 ans au Centre Hospitalier Universitaire Mère-Enfant de Tsaralalàna, de Janvier 2009 à Décembre 2011. Les enfants diagnostiqués de tuberculose dont le diagnostic a été retenu par des éléments de certitude ou par le score pédiatrique de la tuberculose représentent les cas. Les enfants hospitalisés durant la même période, non tuberculeux et de même âge, sont classés témoins. L'Odds Ratio quantifie les associations. Résultats Au total, 91 cas et 173 témoins ont été inclus. Parmi les cas, 73,62% présentent une malnutrition. De fortes associations sont démontrées avec: la malnutrition sévère (OR=6 (IC95% 2,43-15,61 (p<10-5))); le contage tuberculeux (OR=4,71 (IC95% 1,76-12,7 (p=0,003))); la non vaccination par le BCG (OR=4,21 (IC95% 1,99-8,99 (p < 2.10-5))); le niveau intellectuel maternel bas (OR=4,17 (IC95% 0,67-28,14 (p=0,06))); la taille de la fratrie à partir de 5 (OR=4,5). Des associations faibles sont retrouvées pour les autres facteurs étudiés. Les cas présentent une létalité de 18,7% contre 6,3% chez les témoins (p<10-5); 64,7 % des décès sont dus aux formes méningées. Conclusion La tuberculose reste un fléau chez les enfants, avec une lourde responsabilité de la pauvreté rassemblant presque tous les facteurs sus-cités. PMID:25838852

  2. Expression of the Eukaryotic Translation Initiation Factors 4E and 2α in Non-Hodgkin’s Lymphomas

    PubMed Central

    Wang, Songtao; Rosenwald, Igor B.; Hutzler, Michael J.; Pihan, German A.; Savas, Lou; Chen, Jane-Jane; Woda, Bruce A.

    1999-01-01

    Transition of cells from quiescence to proliferation requires an increase in the rate of protein synthesis, which is regulated in part by two key translation initiation factors, 4E and 2α. The expression and activity of both factors are increased transiently when normal resting cells are stimulated to proliferate. They are constitutively elevated in oncogene transformed cultured cells, and overexpression of either initiation factor in rodent cells makes them tumorigenic. In this study we investigate an association between the expression of translation initiation factors and lymphomagenesis. We have analyzed the expression of the protein synthesis initiation factors 4E and 2α by immunohistochemistry in reactive lymph nodes and several types of non-Hodgkin’s lymphoma representing a wide range of clinical behaviors based on the Revised European-American Lymphoma behavioral classification. The study included 7 benign lymph nodes with follicular hyperplasia, 26 indolent lymphomas (6 marginal zone lymphomas, 7 small lymphocytic lymphomas, and 13 follicular lymphomas, grades 1 and 2), 16 moderately aggressive lymphomas (8 mantle cell lymphomas and 8 follicular lymphomas, grade 3), 24 aggressive lymphomas (14 large-B-cell lymphomas and 10 anaplastic large-cell lymphomas), and 15 highly aggressive lymphomas (7 lymphoblastic lymphomas and 8 Burkitt’s lymphomas). Strong expression of initiation factors 4E and 2α was demonstrated in the germinal centers of reactive follicles. Minimal or no expression was seen in the mantle zones and surrounding paracortices, indicating that high expression of initiation factors 4E and 2α is associated with the active proliferation of lymphocytes. Most cases of aggressive and highly aggressive lymphomas showed strong expression of initiation factors 4E and 2α, in contrast to the cases of indolent and moderately aggressive lymphoma, in which their expression was intermediate between the germinal centers and the mantles of reactive

  3. Higher Education in the U.S.S.R.: Curriculums, Schools, and Statistics. Bulletin, 1963, No. 16. OE-14088

    ERIC Educational Resources Information Center

    Rosen, Seymour M.

    1963-01-01

    The demand for basic information on Soviet higher education continues to grow. Previous bulletins on Soviet education published by the Office of Education have either been overall surveys ("Education in the U.S.S.R.," Bulletin 1957, No. 14; "Soviet Commitment to Education," Bulletin 1959, No. 16) or studies of general…

  4. Phase diagrams of the sections As/sub 2/S/sub 3/-Tl/sub 3/AsS/sub 4/, Tl/sub 3/AsS/sub 4/-S, and Tl/sub 3/AsS/sub 4/-Tl/sub 2/S of the ternary system As-Tl-S

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vorob'ev, Yu.I.; Velikova, N.G.; Kirilenko, V.V.

    1987-12-01

    Using DTA and XPA methods, microstructural investigations, and microhardness measurements, phase diagrams of the quasibinary sections As/sub 2/S/sub 3/-Tl/sub 3/AsS/sub 4/, Tl/sub 3/AsS/sub 4/-S, and Tl/sub 3/AsS/sub 4/-Tl/sub 2/S, are characterized by five ternary compounds Tl/sub 3/As/sub 5/S/sub 10/, Tl/sub 9/As/sub 5/S/sub 15/, Tl/sub 9/As/sub 3/S/sub 13/, Tl/sub 3/AsS/sub 6/, and Tl/sub 8/As/sub 2/S/sub 9/, which decompose by peritectic reactions at 198, 307, 408, 362, and 318/degree/C, respectively. Interplanar spacings and line intensities are given for the detected compounds. Glass formation is considered in the Tl-As-S system.

  5. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  6. Inhibitory activity of bacteriocin produced from Lactobacillus SCG 1223 toward L. monocytogenes, S. thypimurium and E. coli

    NASA Astrophysics Data System (ADS)

    Marwati, T.; Cahyaningrum, N.; Widodo, S.; Januarsyah, T.; Purwoko

    2018-01-01

    Bacteriocin is a protein compound which has bactericidal ability against pathogen bacteria. This research aims to study the inhibitory activity of bacteriocin produced from Lactobacillus SCG 1223 against Listeria monocytogenes, Salmonella thypimuruim and Escherchia coli. The bacteriocin produce from Lactobacillus SCG 1223 in the MRS broth media The experimental design used was Completely Randomized Design. The variations used in this design were percentage of inoculum (5%, 10%), medium pH (4, 6), incubation temperature (27°C, 40°C), and incubation time (4, 10, 14 hours). Result showed that bacteriocin from Lactobacillus SCG 1223 had wide spectrum toward L. monocytogenes, S. thypimuruim and E. coli. The highest bacteriocin activity toward L. monocytogenes produced by Lactobacillus SCG 1223 with 10% inoculum in media with initial pH 6, incubation temperature 27°C for 14 hour, toward S. thypimurium produced by Lactobacillus SCG 1223 with in media with initial pH 6, incubation temperature 40°C for 14 hour, and toward E. coli was 1085.81 AU/ml, produced by Lactobacillus SCG 1223 in MRS broth with initial pH 4, incubation temperature 40°C for 14 hour. This study is expected to find a new food preservative that can inhibit the growth of pathogenic bacteria and extend the shelf life of food. From the economic prospective of view, bacteriocin is very promising natural alternative biopreservatives.

  7. Core/shell Fe3O4/Gd2O3 nanocubes as T1-T2 dual modal MRI contrast agents

    NASA Astrophysics Data System (ADS)

    Li, Fenfen; Zhi, Debo; Luo, Yufeng; Zhang, Jiqian; Nan, Xiang; Zhang, Yunjiao; Zhou, Wei; Qiu, Bensheng; Wen, Longping; Liang, Gaolin

    2016-06-01

    T1-T2 dual modal magnetic resonance imaging (MRI) has attracted considerable interest because it offers complementary diagnostic information, leading to more precise diagnosis. To date, a number of nanostructures have been reported as T1-T2 dual modal MR contrast agents (CAs). However, hybrids of nanocubes with both iron and gadolinium (Gd) elements as T1-T2 dual modal CAs have not been reported. Herein, we report the synthesis of novel core/shell Fe3O4/Gd2O3 nanocubes as T1-T2 dual-modal CAs and their application for enhanced T1-T2 MR imaging of rat livers. A relaxivity study at 1.5 T indicated that our Fe3O4/Gd2O3 nanocubes have an r1 value of 45.24 mM-1 s-1 and an r2 value of 186.51 mM-1 s-1, which were about two folds of those of Gd2O3 nanoparticles and Fe3O4 nanocubes, respectively. In vivo MR imaging of rats showed both T1-positive and T2-negative contrast enhancements in the livers. We envision that our Fe3O4/Gd2O3 nanocubes could be applied as T1-T2 dual modal MR CAs for a wide range of theranostic applications in the near future.T1-T2 dual modal magnetic resonance imaging (MRI) has attracted considerable interest because it offers complementary diagnostic information, leading to more precise diagnosis. To date, a number of nanostructures have been reported as T1-T2 dual modal MR contrast agents (CAs). However, hybrids of nanocubes with both iron and gadolinium (Gd) elements as T1-T2 dual modal CAs have not been reported. Herein, we report the synthesis of novel core/shell Fe3O4/Gd2O3 nanocubes as T1-T2 dual-modal CAs and their application for enhanced T1-T2 MR imaging of rat livers. A relaxivity study at 1.5 T indicated that our Fe3O4/Gd2O3 nanocubes have an r1 value of 45.24 mM-1 s-1 and an r2 value of 186.51 mM-1 s-1, which were about two folds of those of Gd2O3 nanoparticles and Fe3O4 nanocubes, respectively. In vivo MR imaging of rats showed both T1-positive and T2-negative contrast enhancements in the livers. We envision that our Fe3O4/Gd2O3 nanocubes

  8. Les infections urinaires chez les patients insuffisants rénaux chroniques hospitalisés au service de néphrologie: profil bactériologique et facteurs de risque

    PubMed Central

    Chemlal, Abdeljalil; Ismaili, Fatiha Alaoui; Karimi, Ilham; Elharraqui, Ryme; Benabdellah, Nawal; Bekaoui, Samira; Haddiya, Intissar; Bentata, Yassamine

    2015-01-01

    L'infection urinaire chez l'insuffisant rénal est fréquente et particulière dans sa prise en charge diagnostique et thérapeutique. L'objectif de notre étude est de déterminer le profil bactériologique et d’étudier les facteurs de risque des infections urinaires chez le patient insuffisant rénal chronique en milieu de néphrologie. Etude prospective débutée en Septembre 2012 menée au service de néphrologie à l'hôpital régional d'Oujda de l'oriental Marocain. Ont été inclus tous les patients hospitalisés en néphrologie avec une infection urinaire documentée. Nous avons analysé les données démographiques, cliniques, biologiques, et thérapeutiques de nos patients à l'admission et au cours de leurs hospitalisations. 48 épisodes d'infections urinaires chez 43 patients ont été colligés dont 3 enfants. L'incidence de l'infection urinaire dans notre étude était de 4,65%. La médiane d’âge était de 53 (32-66) années. 60,4% étaient de sexe féminin. Le germe isolé était un Escheria Coli dans 58,3% et un Klebsiella dans 29,2%. Le germe isolé était résistant à l'amoxicilline-acide clavulanique dans 83% des cas. L'antibiotique prescris en premiére intention chez nos patients était une céphalosporine de 3 éme génération dans 50%. L’évolution chez nos patients était favorable dans 89,6% des cas. 33,3% avaient présenté un sepsis et on a noté le décès dans 10,4% des cas. Les infections urinaires chez l'insuffisant rénal chronique reste très grave vu leur lourde morbi-mortalié d'où l'intêrét d'un dépistage précoce chez cette population. Un usage raisonné des antibiotiques est nécessaire afin de prévenir l'extension des résistances bactériennes. PMID:26213601

  9. Pump-probe photoelectron velocity-map imaging of autoionizing singly excited 4s{sup 1}4p{sup 6}np{sup 1}(n=7,8) and doubly excited 4s{sup 2}4p{sup 4}5s{sup 1}6p{sup 1} resonances in atomic krypton

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Doughty, Benjamin; Haber, Louis H.; Leone, Stephen R.

    2011-10-15

    Pump-probe photoelectron velocity-map imaging, using 27-eV high-harmonic excitation and 786-nm ionization, is used to resolve overlapping autoionizing resonances in atomic krypton, obtaining two-photon photoelectron angular distributions (PADs) for singly and doubly excited states. Two features in the photoelectron spectrum are assigned to singly excited 4s{sup 1}4p{sup 6}np{sup 1} (n = 7,8) configurations and four features provide information about double excitation configurations. The anisotropy parameters for the singly excited 7p configuration are measured to be {beta}{sub 2} = 1.61 {+-} 0.06 and {beta}{sub 4} = 1.54 {+-} 0.16 while the 8p configuration gives {beta}{sub 2} = 1.23 {+-} 0.19 and {beta}{submore » 4} = 0.60 {+-} 0.15. These anisotropies most likely represent the sum of overlapping PADs from states of singlet and triplet spin multiplicities. Of the four bands corresponding to ionization of doubly excited states, two are assigned to 4s{sup 2}4p{sup 4}5s{sup 1}6p{sup 1} configurations that are probed to different J-split ion states. The two remaining doubly excited states are attributed to a previously observed, but unassigned, resonance in the vacuum-ultraviolet photoabsorption spectrum. The PADs from each of the double excitation states are also influenced by overlap from neighboring states that are not completely spectrally resolved. The anisotropies of the observed double excitation states are reported, anticipating future theoretical and experimental work to separate the overlapping PADs into the state resolved PADs. The results can be used to test theories of excited state ionization.« less

  10. A consistent and unified picture for critical phenomena of f(R) AdS black holes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mo, Jie-Xiong; Li, Gu-Qiang; Wu, Yu-Cheng, E-mail: mojiexiong@gmail.com, E-mail: zsgqli@hotmail.com, E-mail: wuyucheng0827@163.com

    A consistent and unified picture for critical phenomena of charged AdS black holes in f ( R ) gravity is drawn in this paper. Firstly, we investigate the phase transition in canonical ensemble. We derive the explicit solutions corresponding to the divergence of C {sub Q} . The two solutions merge into one when the condition Q {sub c} =√(−1/3 R {sub 0}) is satisfied. The curve of specific heat for Q < Q {sub c} has two divergent points and can be divided into three regions. Both the large radius region and the small radius region are thermodynamically stablemore » with positive specific heat while the medium radius region is unstable with negative specific heat. However, when Q > Q {sub c} , the specific heat is always positive, implying the black holes are locally stable and no phase transition will take place. Secondly, both the Tr {sub +} curve and TS curve f ( R ) AdS black holes are investigated and they exhibit Van der Vaals like behavior as the P − v curve in the former research. Critical physical quantities are obtained and they are consistent with those derived from the specific heat analysis. We carry out numerical check of Maxwell equal area law for the cases Q =0.2 Q {sub c} , 0.4 Q {sub c} , 0.6 Q {sub c} , 0.8 Q {sub c} . The relative errors are amazingly small and can be negligible. So the Maxwell equal area law holds for TS curve of f ( R ) black holes. Thirdly, we establish geometrothermodynamics for f ( R ) AdS black hole to examine the phase structure. It is shown that the Legendre invariant scalar curvature R would diverge exactly where the specific heat diverges. To summarize, the above three perspectives are consistent with each other, thus providing a unified picture which deepens the understanding of critical phenomena of f ( R ) AdS black holes.« less

  11. Morbidité et mortalité des nouveau-nés hospitalisés sur 10 années à la Clinique El Fateh-Suka (Ouagadougou, Burkina Faso)

    PubMed Central

    Nagalo, Kisito; Dao, Fousséni; Tall, François Housséini; Yé, Diarra

    2013-01-01

    Introduction La mortalité néonatale demeure un problème majeur de santé publique dans les pays en développement. Notre étude avait pour but de déterminer la morbidité et la mortalité des nouveau-nés à Ouagadougou, Burkina Faso. Méthodes Une étude rétrospective sur 10 années a permis d'inclure tous les nouveau-nés admis dans l'Unité de Néonatologie de la Clinique El Fateh-Suka. Résultats Au total, 697 nouveau-nés étaient hospitalisés sur la période d'étude. Les principaux diagnostics étaient les infections néonatales (23.5%), les anomalies liées à la durée de la gestation et à la croissance du fætus (17.9%) et le paludisme congénital (15.1%). Les 91 (13.1%) décès étaient dus aux anomalies liées à la durée de la grossesse et à la croissance du fætus (46.1%), à l'hypoxie intra-utérine et à l'asphyxie obstétricale (20,9%) et aux infections néonatales (17.6%). Ces décès survenaient dans 81.3% dans les 72 heures, dans 93.4% des cas dans la première semaine d'hospitalisation. Le facteur de risque associé à ces décès était la voie basse d'accouchement (p = 0.02). Conclusion Cette étude a identifié des pathologies évitables déjà décrites comme les principales causes d'hospitalisations et de décès néonatals. La voie basse d'accouchement était le facteur de risque associé à ces décès, ce qui n'avait pas encore été rapporté. Les efforts pour améliorer la qualité des services de soins périnatals doivent être intensifiés afin de réduire la mortalité néonatale dans les pays en développement. PMID:23785558

  12. A system to measure isomeric state half-lives in the 10 ns to 10 μs range

    NASA Astrophysics Data System (ADS)

    Toufen, D. L.; Allegro, P. R. P.; Medina, N. H.; Oliveira, J. R. B.; Cybulska, E. W.; Seale, W. A.; Linares, R.; Silveira, M. A. G.; Ribas, R. V.

    2014-07-01

    The Isomeric State Measurement System (SISMEI) was developed to search for isomeric nuclear states produced by fusion-evaporation reactions. The SISMEI consists of 10 plastic phoswich telescopes, two lead shields, one NaI(Tl) scintillation detector, two Compton suppressed HPGe γ-ray detectors, and a cone with a recoil product catcher. The new system was tested at the 8 UD Pelletron tandem accelerator of the University of São Paulo with the measurement of two known isomeric states: 54Fe, 10+ state (E = 6527.1 (11) keV, T1/2 = 364(7) ns) and the 5/2+ state of 19F (E = 197.143 (4) keV, T1/2 = 89.3 (10) ns). The results indicate that the system is capable of identifying delayed transitions, of measuring isomeric state lifetimes, and of identifying the feeding transitions of the isomeric state through the delayed γ-γ coincidence method. The measured half-life for the 10+ state was T1/2 = 365(14) ns and for the 5/2+ state, 100(36) ns.

  13. A system to measure isomeric state half-lives in the 10 ns to 10 μs range.

    PubMed

    Toufen, D L; Allegro, P R P; Medina, N H; Oliveira, J R B; Cybulska, E W; Seale, W A; Linares, R; Silveira, M A G; Ribas, R V

    2014-07-01

    The Isomeric State Measurement System (SISMEI) was developed to search for isomeric nuclear states produced by fusion-evaporation reactions. The SISMEI consists of 10 plastic phoswich telescopes, two lead shields, one NaI(Tl) scintillation detector, two Compton suppressed HPGe γ-ray detectors, and a cone with a recoil product catcher. The new system was tested at the 8 UD Pelletron tandem accelerator of the University of São Paulo with the measurement of two known isomeric states: (54)Fe, 10(+) state (E = 6527.1 (11) keV, T(1/2) = 364(7) ns) and the 5/2(+) state of (19)F (E = 197.143 (4) keV, T(1/2) = 89.3 (10) ns). The results indicate that the system is capable of identifying delayed transitions, of measuring isomeric state lifetimes, and of identifying the feeding transitions of the isomeric state through the delayed γ-γ coincidence method. The measured half-life for the 10(+) state was T(1/2) = 365(14) ns and for the 5/2(+) state, 100(36) ns.

  14. Understanding the Delay in Onset of Paget’s Disease of Bone

    DTIC Science & Technology

    2014-09-01

    Virol 2011;85:3162-3171. 6. Indoh T , Yokota S, Okabayashi T , Yokosawa N, Fujii N. Suppression of NF-kappaB and AP-1 activation in monocytic cells...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

  15. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    PubMed

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  16. THE MILKY WAY'S CIRCULAR-VELOCITY CURVE BETWEEN 4 AND 14 kpc FROM APOGEE DATA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bovy, Jo; Allende Prieto, Carlos; Meszaros, Szabolcs

    2012-11-10

    We measure the Milky Way's rotation curve over the Galactocentric range 4 kpc {approx}< R {approx}< 14 kpc from the first year of data from the Apache Point Observatory Galactic Evolution Experiment. We model the line-of-sight velocities of 3365 stars in 14 fields with b = 0 Degree-Sign between 30 Degree-Sign {<=} l {<=} 210 Degree-Sign out to distances of 10 kpc using an axisymmetric kinematical model that includes a correction for the asymmetric drift of the warm tracer population ({sigma} {sub R} Almost-Equal-To 35 km s{sup -1}). We determine the local value of the circular velocity to be V{submore » c} (R {sub 0}) = 218 {+-} 6 km s{sup -1} and find that the rotation curve is approximately flat with a local derivative between -3.0 km s{sup -1} kpc{sup -1} and 0.4 km s{sup -1} kpc{sup -1}. We also measure the Sun's position and velocity in the Galactocentric rest frame, finding the distance to the Galactic center to be 8 kpc < R {sub 0} < 9 kpc, radial velocity V {sub R, Sun} = -10 {+-} 1 km s{sup -1}, and rotational velocity V {sub {phi}, Sun} = 242{sup +10} {sub -3} km s{sup -1}, in good agreement with local measurements of the Sun's radial velocity and with the observed proper motion of Sgr A*. We investigate various systematic uncertainties and find that these are limited to offsets at the percent level, {approx}2 km s{sup -1} in V{sub c} . Marginalizing over all the systematics that we consider, we find that V{sub c} (R {sub 0}) < 235 km s{sup -1} at >99 % confidence. We find an offset between the Sun's rotational velocity and the local circular velocity of 26 {+-} 3 km s{sup -1}, which is larger than the locally measured solar motion of 12 km s{sup -1}. This larger offset reconciles our value for V{sub c} with recent claims that V{sub c} {approx}> 240 km s{sup -1}. Combining our results with other data, we find that the Milky Way's dark-halo mass within the virial radius is {approx}8 Multiplication-Sign 10{sup 11} M {sub Sun }.« less

  17. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  18. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  19. Degradability in vitro of polyurethanes based on synthetic atactic poly[(R,S)-3-hydroxybutyrate].

    PubMed

    Brzeska, J; Janeczek, H; Janik, H; Kowalczuk, M; Rutkowska, M

    2015-01-01

    The aim of the present study was to determine the degradability of aliphatic polyurethanes, based on a different amount of synthetic, atactic poly[(R,S)-3-hydroxybutyrate] (a-PHB), in hydrolytic (phosphate buffer) and oxidative (H2O2/CoCl2) solutions. The soft segments were built with atactic poly[(R,S)-3-hydroxybutyrate] and polycaprolactone or polyoxytetramethylenediols, whereas hard segments were the reaction product of 4,4'-methylenedicyclohexyl diisocyanate and 1,4-butanediol.The selected properties - density and morphology of polymer surfaces - which could influence the sensitivity of polymers to degradation processes - were analyzed.The analysis of molecular mass (GPC), thermal properties (DSC) and the sample weight changes were undertaken to estimate the degree of degradability of polymer samples after incubation in environments studied.Investigated polyurethanes were amorphous with the very low amount of crystalline phases of hard segments.The polyurethane synthesized with a poly[(R,S)-3-hydroxybutyrate] and polyoxytetramethylenediol at a molar ratio of NCO:OH=3.7:1 (prepolymer step) appeared as the most sensitive for both degradative solutions. Its weight and molecular mass losses were the highest in comparison to other investigated polyurethanes.It could be expected that playing with the amount of poly[(R,S)-3-hydroxybutyrate] in polyurethane synthesis the rate of polyurethane degradation after immersion in living body would be modeled.

  20. China’s ASAT Test: Motivations and Implications

    DTIC Science & Technology

    2007-01-01

    h i l l i P c . S a u n D e r S and c h a r l e S D . l u t e S Dr. Phillip C. saunders and Colonel Charles D. Lutes, UsaF, are senior Research...at <www.aviationweek.com/aw/generic/story_generic. jsp?channel= awst &id=news/aw012207p2.xml>. 11 Chris Buckley, “China confirms satellite test, says

  1. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    PubMed

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  2. Efficient syntheses of climate relevant isoprene nitrates and (1R,5S)-(-)-myrtenol nitrate.

    PubMed

    Bew, Sean P; Hiatt-Gipson, Glyn D; Mills, Graham P; Reeves, Claire E

    2016-01-01

    Here we report the chemoselective synthesis of several important, climate relevant isoprene nitrates using silver nitrate to mediate a 'halide for nitrate' substitution. Employing readily available starting materials, reagents and Horner-Wadsworth-Emmons chemistry the synthesis of easily separable, synthetically versatile 'key building blocks' (E)- and (Z)-3-methyl-4-chlorobut-2-en-1-ol as well as (E)- and (Z)-1-((2-methyl-4-bromobut-2-enyloxy)methyl)-4-methoxybenzene has been achieved using cheap, 'off the shelf' materials. Exploiting their reactivity we have studied their ability to undergo an 'allylic halide for allylic nitrate' substitution reaction which we demonstrate generates (E)- and (Z)-3-methyl-4-hydroxybut-2-enyl nitrate, and (E)- and (Z)-2-methyl-4-hydroxybut-2-enyl nitrates ('isoprene nitrates') in 66-80% overall yields. Using NOESY experiments the elucidation of the carbon-carbon double bond configuration within the purified isoprene nitrates has been established. Further exemplifying our 'halide for nitrate' substitution chemistry we outline the straightforward transformation of (1R,2S)-(-)-myrtenol bromide into the previously unknown monoterpene nitrate (1R,2S)-(-)-myrtenol nitrate.

  3. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    PubMed Central

    Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus

    2005-01-01

    Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518

  4. SO(10) × S 4 grand unified theory of flavour and leptogenesis

    NASA Astrophysics Data System (ADS)

    de Anda, Francisco J.; King, Stephen F.; Perdomo, Elena

    2017-12-01

    We propose a Grand Unified Theory of Flavour, based on SO(10) together with a non-Abelian discrete group S 4, under which the unified three quark and lepton 16-plets are unified into a single triplet 3'. The model involves a further discrete group ℤ 4 R × ℤ 4 3 which controls the Higgs and flavon symmetry breaking sectors. The CSD2 flavon vacuum alignment is discussed, along with the GUT breaking potential and the doublet-triplet splitting, and proton decay is shown to be under control. The Yukawa matrices are derived in detail, from renormalisable diagrams, and neutrino masses emerge from the type I seesaw mechanism. A full numerical fit is performed with 15 input parameters generating 19 presently constrained observables, taking into account supersymmetry threshold corrections. The model predicts a normal neutrino mass ordering with a CP oscillation phase of 260°, an atmospheric angle in the first octant and neutrinoless double beta decay with m ββ = 11 meV. We discuss N 2 leptogenesis, which fixes the second right-handed neutrino mass to be M 2 ≃ 2 × 1011 GeV, in the natural range predicted by the model.

  5. Evidence for e+e-→γ ηc(1 S ) at center-of-mass energies between 4.01 and 4.60 GeV

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Alekseev, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dorjkhaidav, O.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garillon, B.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, S.; Gu, Y. T.; Guo, A. Q.; Guo, L. B.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, S. H.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, K. J.; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J. B.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Morello, G.; Muchnoi, N. Yu.; Muramatsu, H.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qi, T. Y.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B. T.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, X. H.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2017-09-01

    We present first evidence for the process e+e-→γ ηc(1 S ) at six center-of-mass energies between 4.01 and 4.60 GeV using data collected by the BESIII experiment operating at BEPCII. We measure the Born cross section at each energy using a combination of twelve ηc(1 S ) decay channels. We also combine all six energies under various assumptions for the energy-dependence of the cross section. If the process is assumed to proceed via the Y (4260 ), we measure a peak Born cross section σpeak(e+e-→γ ηc(1 S ))=2.11 ±0.49 (stat . )±0.36 (syst . ) pb with a statistical significance of 4.2 σ .

  6. U.S. EPA, Pesticide Product Label, , 03/20/1975

    EPA Pesticide Factsheets

    2011-04-21

    ... i4 S ~"aula~ Lt;i ... Po ~ct 4rci~ ~~£, tat~~~ ccnd~tic~~ ~av~~ d~{~t !\\r~ 4~~a) :,cat~d. 0: ~ct eO'lt~~i~ar~ ~al ... chemicil descrlntl~" on the la~el dnd '. ...

  7. In-plane magnetic anisotropy in strontium iridate S r2Ir O4

    NASA Astrophysics Data System (ADS)

    Nauman, Muhammad; Hong, Yunjeong; Hussain, Tayyaba; Seo, M. S.; Park, S. Y.; Lee, N.; Choi, Y. J.; Kang, Woun; Jo, Younjung

    2017-10-01

    Magnetic anisotropy in strontium iridate (S r2Ir O4 ) is found to be large because of the strong spin-orbit interactions. In our work, we studied the in-plane magnetic anisotropy of S r2Ir O4 and traced the anisotropic exchange interactions between the isospins in the crystal. The magnetic-field-dependent torque τ(H ) showed a prominent transition from the canted antiferromagnetic state to the weak ferromagnetic (WFM) state. A comprehensive analysis was conducted to examine the isotropic and anisotropic regimes and probe the easy magnetization axis along the a b plane. The angle-dependent torque τ(θ) revealed a deviation from the sinusoidal behavior, and small differences in hysteresis were observed around 0° and 90° in the low-magnetic-field regime. This indicates that the orientation of the easy axis of the FM component is along the b axis, where the antiferromagnetic to WFM spin-flop transition occurs. We compared the coefficients of the magnetic susceptibility tensors and captured the anisotropy of the material. The in-plane τ(θ) revealed a tendency toward isotropic behavior for fields with values above the field value of the WFM transition.

  8. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  9. Aeroelastic Analyses of the SemiSpan SuperSonic Transport (S4T) Wind Tunnel Model at Mach 0.95

    NASA Technical Reports Server (NTRS)

    Hur, Jiyoung

    2014-01-01

    Detailed aeroelastic analyses of the SemiSpan SuperSonic Transport (S4T) wind tunnel model at Mach 0.95 with a 1.75deg fixed angle of attack are presented. First, a numerical procedure using the Computational Fluids Laboratory 3-Dimensional (CFL3D) Version 6.4 flow solver is investigated. The mesh update method for structured multi-block grids was successfully applied to the Navier-Stokes simulations. Second, the steady aerodynamic analyses with a rigid structure of the S4T wind tunnel model are reviewed in transonic flow. Third, the static analyses were performed for both the Euler and Navier-Stokes equations. Both the Euler and Navier-Stokes equations predicted a significant increase of lift forces, compared to the results from the rigid structure of the S4T wind-tunnel model, over various dynamic pressures. Finally, dynamic aeroelastic analyses were performed to investigate the flutter condition of the S4T wind tunnel model at the transonic Mach number. The condition of flutter was observed at a dynamic pressure of approximately 75.0-psf for the Navier-Stokes simulations. However, it was observed that the flutter condition occurred a dynamic pressure of approximately 47.27-psf for the Euler simulations. Also, the computational efficiency of the aeroelastic analyses for the S4T wind tunnel model has been assessed.

  10. H.E.S.S. discovery of VHE γ-rays from the quasar PKS 1510-089

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Acero, F.; Aharonian, F.; Akhperjanian, A. G.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Behera, B.; Bernlöhr, K.; Birsin, E.; Biteau, J.; Bochow, A.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chaves, R. C. G.; Cheesebrough, A.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Egberts, K.; Eger, P.; Espigat, P.; Fallon, L.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Gast, H.; Giebels, B.; Glicenstein, J. F.; Glück, B.; Göring, D.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hague, J. D.; Hahn, J.; Hampf, D.; Harris, J.; Hauser, M.; Heinz, S.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Kossakowski, R.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Masbou, J.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Medina, M. C.; Méhault, J.; Menzler, U.; Moderski, R.; Mohamed, M.; Moulin, E.; Naumann, C. L.; Naumann-Godo, M.; de Naurois, M.; Nedbal, D.; Nguyen, N.; Niemiec, J.; Nolan, S. J.; Ohm, S.; de Oña Wilhelmi, E.; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Rieger, F.; Ripken, J.; Rob, L.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sheidaei, F.; Skilton, J. L.; Sol, H.; Spengler, G.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorobiov, S.; Vorster, M.; Wagner, S. J.; Ward, M.; White, R.; Wierzcholska, A.; Wouters, D.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H. S.

    2013-06-01

    The quasar PKS 1510-089 (z = 0.361) was observed with the H.E.S.S. array of imaging atmospheric Cherenkov telescopes during high states in the optical and GeV bands, to search for very high energy (VHE, defined as E ≥ 0.1 TeV) emission. VHE γ-rays were detected with a statistical significance of 9.2 standard deviations in 15.8 h of H.E.S.S. data taken during March and April 2009. A VHE integral flux of I(0.15 TeV < E < 1.0 TeV)= (1.0 ± 0.2stat ± 0.2sys) × 10-11 cm-2 s-1 is measured. The best-fit power law to the VHE data has a photon index of Γ = 5.4 ± 0.7stat ± 0.3sys. The GeV and optical light curves show pronounced variability during the period of H.E.S.S. observations. However, there is insufficient evidence to claim statistically significant variability in the VHE data. Because of its relatively high redshift, the VHE flux from PKS 1510-089 should suffer considerable attenuation in the intergalactic space due to the extragalactic background light (EBL). Hence, the measured γ-ray spectrum is used to derive upper limits on the opacity due to EBL, which are found to be comparable with the previously derived limits from relatively-nearby BL Lac objects. Unlike typical VHE-detected blazars where the broadband spectrum is dominated by nonthermal radiation at all wavelengths, the quasar PKS 1510-089 has a bright thermal component in the optical to UV frequency band. Among all VHE detected blazars, PKS 1510-089 has the most luminous broad line region. The detection of VHE emission from this quasar indicates a low level of γ - γ absorption on the internal optical to UV photon field.

  11. Optoelectronic properties of candidate photovoltaic Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 semiconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nhalil, Hariharan; Han, Dan; Du, Mao-Hua

    High temperature synthesis and optical band gaps are reported for three candidate photovoltaic earth-abundant Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 semiconductors. The reported synthesis method is found to be more advantageous for KAg 2SbS 4 compared to the literature reported synthesis utilizing supercritical ammonia as a reaction medium, which produces a mixture of chalcogenide products. Based on optical diffuse reflectance data, Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 have band gaps in the 1.6–1.8 eV range, and are shown to be stable in ambient air for a period of 6 weeks, making themmore » attractive candidates for solar cell applications. Density functional theory (DFT) calculations indicate indirect band gaps for Cu 2PbSiS 4 and KAg 2SbS 4, and a nearly direct band gap for Ag 2PbGeS 4 with the calculated difference between indirect and direct gaps of only 30 meV. The p-type semiconducting behavior of Cu 2PbSiS 4, Ag 2PbGeS 4 is also verified by the transport measurments. The 3D connectivity of the polyanionic networks in these compounds results in dispersive valence and conduction bands, which is especially noticeable for KAg 2SbS 4. This fact is in part attributed to the presence of formally pentavalent SbV in this compound leading to empty Sb 5s orbitals in the conduction band. Finally, we discuss the potential of Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 for photovoltaic applications based on synthesis, stability, band gap and electronic structure considerations.« less

  12. Optoelectronic properties of candidate photovoltaic Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 semiconductors

    DOE PAGES

    Nhalil, Hariharan; Han, Dan; Du, Mao-Hua; ...

    2018-03-01

    High temperature synthesis and optical band gaps are reported for three candidate photovoltaic earth-abundant Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 semiconductors. The reported synthesis method is found to be more advantageous for KAg 2SbS 4 compared to the literature reported synthesis utilizing supercritical ammonia as a reaction medium, which produces a mixture of chalcogenide products. Based on optical diffuse reflectance data, Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 have band gaps in the 1.6–1.8 eV range, and are shown to be stable in ambient air for a period of 6 weeks, making themmore » attractive candidates for solar cell applications. Density functional theory (DFT) calculations indicate indirect band gaps for Cu 2PbSiS 4 and KAg 2SbS 4, and a nearly direct band gap for Ag 2PbGeS 4 with the calculated difference between indirect and direct gaps of only 30 meV. The p-type semiconducting behavior of Cu 2PbSiS 4, Ag 2PbGeS 4 is also verified by the transport measurments. The 3D connectivity of the polyanionic networks in these compounds results in dispersive valence and conduction bands, which is especially noticeable for KAg 2SbS 4. This fact is in part attributed to the presence of formally pentavalent SbV in this compound leading to empty Sb 5s orbitals in the conduction band. Finally, we discuss the potential of Cu 2PbSiS 4, Ag 2PbGeS 4 and KAg 2SbS 4 for photovoltaic applications based on synthesis, stability, band gap and electronic structure considerations.« less

  13. H.E.S.S. and ATOM detection of renewed activity of the FSRQ 3C 279

    NASA Astrophysics Data System (ADS)

    De Naurois, Mathieu

    2018-06-01

    H.E.S.S. observations at very-high energies (E > 100 GeV) of the flat spectrum radio quasar 3C 279 (reshift z=0.536, R.A.: 12h56m11.1665s, Dec: -05d47m21.523s (J2000)) have been carried out over the last 3 nights on the basis of another strong flare in the high-energy gamma-ray band (E > 100 MeV) detected with Fermi-LAT.

  14. Synthesis and structure of the extended phosphazane ligand [(1,4-C6H4){N(μ-PN(t)Bu)2N(t)Bu}2](4).

    PubMed

    Sevilla, Raquel; Less, Robert J; García-Rodríguez, Raúl; Bond, Andrew D; Wright, Dominic S

    2016-02-07

    The reaction of the phenylene-bridged precursor (1,4-C6H4)[N(PCl2)2]2 with (t)BuNH2 in the presence of Et3N gives the new ligand precursor (1,4-C6H4)[N(μ-N(t)Bu)2(PNH(t)Bu)2]2, deprotonation of which with Bu2Mg gives the novel tetraanion [(1,4-C6H4){N(μ-N(t)Bu)2(PN(t)Bu)2}2](4-).

  15. U.S. Federal Investments in Energy R&D: 1961-2008

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dooley, James J.

    2008-10-10

    This paper documents nearly a half century of U.S. federal government support for energy research and development (R&D). Data on energy R&D expenditures disaggregated by major program area are presented here for the first time for the period 1961-2008. This paper also documents U.S. federal government spending on key large scale energy R&D programs that were initiated in response to the oil crisis of the 1970s. Since 1961, the U.S. government has invested nearly $172 billion (in inflation adjusted 2005 US dollars) for the development of advanced energy technologies and for the necessary underlying basic science. Over this period, nearlymore » 24% of the total federal investment in energy R&D occurred during the short seven-year span of 1974-1980. From 1977-1981, energy R&D investments briefly rose above 10% of all federal R&D; however, since the mid-1990s energy R&D has accounted for only about 1% of all federal R&D investments.« less

  16. Differences in the Mechanism of the Allosteric L-Rhamnose Responses of the AraC/XylS Family Transcription Activators RhaS and RhaR

    PubMed Central

    Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.

    2008-01-01

    SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439

  17. The Genome of S-PM2, a “Photosynthetic” T4-Type Bacteriophage That Infects Marine Synechococcus Strains

    PubMed Central

    Mann, Nicholas H.; Clokie, Martha R. J.; Millard, Andrew; Cook, Annabel; Wilson, William H.; Wheatley, Peter J.; Letarov, Andrey; Krisch, H. M.

    2005-01-01

    Bacteriophage S-PM2 infects several strains of the abundant and ecologically important marine cyanobacterium Synechococcus. A large lytic phage with an isometric icosahedral head, S-PM2 has a contractile tail and by this criterion is classified as a myovirus (1). The linear, circularly permuted, 196,280-bp double-stranded DNA genome of S-PM2 contains 37.8% G+C residues. It encodes 239 open reading frames (ORFs) and 25 tRNAs. Of these ORFs, 19 appear to encode proteins associated with the cell envelope, including a putative S-layer-associated protein. Twenty additional S-PM2 ORFs have homologues in the genomes of their cyanobacterial hosts. There is a group I self-splicing intron within the gene encoding the D1 protein. A total of 40 ORFs, organized into discrete clusters, encode homologues of T4 proteins involved in virion morphogenesis, nucleotide metabolism, gene regulation, and DNA replication and repair. The S-PM2 genome encodes a few surprisingly large (e.g., 3,779 amino acids) ORFs of unknown function. Our analysis of the S-PM2 genome suggests that many of the unknown S-PM2 functions may be involved in the adaptation of the metabolism of the host cell to the requirements of phage infection. This hypothesis originates from the identification of multiple phage-mediated modifications of the host's photosynthetic apparatus that appear to be essential for maintaining energy production during the lytic cycle. PMID:15838046

  18. Circulating sICAM-1 and sE-Selectin as biomarker of infection and prognosis in patients with systemic inflammatory response syndrome.

    PubMed

    de Pablo, Raúl; Monserrat, Jorge; Reyes, Eduardo; Díaz, David; Rodríguez-Zapata, Manuel; de la Hera, Antonio; Prieto, Alfredo; Álvarez-Mon, Melchor

    2013-03-01

    Vascular endothelium activation is a key pathogenic step in systemic inflammatory response syndrome (SIRS) that can be triggered by both microbial and sterile proinflammatory stimuli. The relevance of soluble adhesion molecules as clinical biomarkers to discriminate between infectious and non-infectious SIRS, and the individual patient prognosis, has not been established. We prospectively measured by sandwich ELISA, serum levels of soluble E-Selectin (sE-Selectin), soluble vascular cell adhesion molecule-1 (sVCAM-1), soluble intercellular adhesion molecule-1 (sICAM-1) and soluble intercellular adhesion molecule-2 (sICAM-2) at ICU admission and at days 3, 7, 14 and 28 in patients with sepsis and at days 3 and 7 in patients with non-infectious SIRS. At ICU admission, sE-Selectin, sVCAM-1 and sICAM-1 in patients with infectious SIRS were significantly higher than those found in patients with non-infectious SIRS. ROC analysis revealed that the AUC for infection identification was best for sICAM-1 (0.900±0.041; 95% CI 0.819-0.981; p<0.0001). Moreover, multivariate analysis showed that 4 variables were significantly and independently associated with mortality at 28 days: male gender (OR 15.90; 95% CI, 2.54-99.32), MODS score (OR 5.60; 95% CI, 1.67-18.74), circulating sE-Selectin levels (OR 4.81; 95% CI, 1.34-17.19) and sVCAM-1 concentrations (OR 4.80; 95% CI, 1.34-17.14). Patients with SIRS secondary to infectious or non-infectious etiology show distinctive patterns of disturbance in serum soluble adhesion molecules. Serum ICAM-1 is a reliable biomarker for classifying patients with infectious SIRS from those with non-infectious SIRS. In addition, soluble E-Selectin is a prognostic biomarker with higher levels in patients with SIRS and fatal outcome. Copyright © 2012 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved.

  19. Crystallization of lysozyme with ( R)-, ( S)- and ( RS)-2-methyl-2,4-pentanediol

    DOE PAGES

    Stauber, Mark; Jakoncic, Jean; Berger, Jacob; ...

    2015-03-01

    Chiral control of crystallization has ample precedent in the small-molecule world, but relatively little is known about the role of chirality in protein crystallization. In this study, lysozyme was crystallized in the presence of the chiral additive 2-methyl-2,4-pentanediol (MPD) separately using the R and S enantiomers as well as with a racemic RS mixture. Crystals grown with ( R)-MPD had the most order and produced the highest resolution protein structures. This result is consistent with the observation that in the crystals grown with ( R)-MPD and ( RS)-MPD the crystal contacts are made by ( R)-MPD, demonstrating that there ismore » preferential interaction between lysozyme and this enantiomer. These findings suggest that chiral interactions are important in protein crystallization.« less

  20. Possible Alzheimer’s Disease in an Apolipoprotein E2 Homozygote

    PubMed Central

    Ignatov, Ignat; Belden, Christine; Jacobson, Sandra; Connor, Donald; Sabbagh, Marwan N.

    2010-01-01

    The objective of this study was to describe a case of Alzheimer’s disease in an ApoE ε2/ε2 homozygote. ApoE ε2/ε2 is the rarest of the apolipoprotein E genotypes, representing only 1.4% of the population. There is only one case reported in the literature of a nonagenarian with minimal cognitive changes whose brain showed AD pathology on postmortem study. Here we report an 87-year-old ApoE ε2/ε2 female who meets clinical criteria for Alzheimer’s disease, with confirmation from neuropsychological testing and PET scan. Clinical course is typical for Alzheimer’s disease with decline on the Mini-Mental Status Examination from a score of 25 to 19 over 3.5 years. The patient is currently treated with donepezil and memantine. In conclusion, a clinically confirmed case of Alzheimer’s disease is rare in Apo E2 homozygotes but can occur. PMID:19158419

  1. Identification and synchronization of the common cosmic-ray signal in the IntCal13 14C calibration and the Greenland ice-core 10Be records

    NASA Astrophysics Data System (ADS)

    Muscheler, Raimund; Adolphi, Florian; Bronk Ramsey, Christopher; Rasmussen, Sune; Hughen, Konrad; Cooper, Alan; Turney, Chris

    2017-04-01

    core and radiocarbon timescales over the Holocene - Bayesian wiggle-matching of cosmogenic radionuclide records: Clim. Past. , v. 12, p. 15-30. Muscheler, R., Adolphi, F., and Svensson, A., 2014, Challenges in 14C dating towards the limit of the method inferred from anchoring a floating tree ring radiocarbon chronology to ice core records around the Laschamp geomagnetic field minimum: Earth Planet. Sci. Lett., v. 394, p. 209-215. Reimer, P., Bard, E., Bayliss, A., Beck, J. W., Blackwell, P. G., Bronk Ramsey, C., Buck, C. E., Cheng, H., Edwards, R. L., Friedrich, M., Grootes, P., Guilderson, T. P., Haflidison, H., Hajdas, I., Hatté, C., Heaton, T. J., Hoffmann, D. L., Hogg, A. G., Hughen, K. A., Kaiser, K. F., Kromer, B., Manning, S. W., Niu, M., Reimer, R. W., Richards, D. A., Scott, E. M., Southon, J., Staff, R. A., Turney, C. S. M., and van der Plicht, J., 2013, IntCal13 AND Marine13 radiocarbon age calibration curves 0-50,000 years cal BP: Radiocarbon, v. 55, No. 4, p. 1869-1887.

  2. miR-195 inhibited abnormal activation of osteoblast differentiation in MC3T3-E1 cells via targeting RAF-1.

    PubMed

    Chao, Chen; Li, Feng; Tan, Zhiping; Zhang, Weizhi; Yang, Yifeng; Luo, Cheng

    2018-01-15

    Recent reports have demonstrated that RAF-1 L613V (a mutant of RAF-1) mutant mice show bone deformities similar to Noonan syndrome. It has been suggested that RAF-1 L613V might abnormally activate osteoblast differentiation of MC3T3-E1 cells. To demonstrate that RAF-1 is associated with bone deformity and that RAF-1 L613V dependent bone deformity could be inhibited by microRNA-195 (miR-195), we first investigated the amplifying influence of wild-type RAF-1 (WT) or RAF-1 L613V (L613V) on the viability and differentiation of MC3T3-E1 cells induced by bone morphogenetic protein-2 (BMP-2) via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, alkaline phosphatase (ALP) and Alizarin Red S (ARS) staining, quantitative real-time polymerase chain reaction (qRT-PCR) and western blot analysis. Subsequently, we investigated the blocking effect and its mechanism of miR-195 for abnormal activation of osteoblast differentiation of MC3T3-E1 cells via targeting RAF-1. RAF-1, especially RAF-1 L613V , abnormally activates osteoblast differentiation of MC3T3-E1 cells induced by BMP-2. Meanwhile, miR-195 could inhibit the cell viability and differentiation of MC3T3-E1 cells. Transfection of miR-195 largely suppressed the L613V-induced viability and osteoblast differentiation of MC3T3-E1 cells and attenuated the accelerative effect of L613V on runt-related transcription factor-2 (Runx2), Osterix (OSX), alkaline phosphatase (ALP), osteocalcin (OCN), and distal-less homeobox 5 (DLX5) osteogenic gene expressions. In addition, miR-195 decreased the expression of RAF-1 mRNA and protein by directly targeting the 3'-untranslated regions (3'-UTR) of RAF-1 mRNA in MC3T3-E1 cells. Our findings indicated that miR-195 inhibited WT and L613V RAF-1 induced hyperactive osteoblast differentiation in MC3T3-E1 cells by targeting RAF-1. miR-195 might be a novel therapeutic agent for the treatment of L613V-induced bone deformity in Noonan syndrome. Copyright © 2017. Published by

  3. Observation of e+e-→ηJ/ψ at center-of-mass energy s=4.009GeV

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ambrose, D. J.; An, F. F.; An, Q.; An, Z. H.; Bai, J. Z.; Ban, Y.; Becker, J.; Bennett, J. V.; Bertani, M.; Bian, J. M.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Bytev, V.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, Y. B.; Cheng, H. P.; Chu, Y. P.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; Ding, W. M.; Ding, Y.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Fang, J.; Fang, S. S.; Fava, L.; Feldbauer, F.; Feng, C. Q.; Ferroli, R. B.; Fu, C. D.; Fu, J. L.; Gao, Y.; Geng, C.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, Y. P.; Han, Y. L.; Harris, F. A.; He, K. L.; He, M.; He, Z. Y.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, H. M.; Hu, J. F.; Hu, T.; Huang, G. M.; Huang, J. S.; Huang, X. T.; Huang, Y. P.; Hussain, T.; Ji, C. S.; Ji, Q.; Ji, X. B.; Ji, X. L.; Jiang, L. L.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jing, F. F.; Kalantar-Nayestanaki, N.; Kavatsyuk, M.; Kuehn, W.; Lai, W.; Lange, J. S.; Li, C. H.; Li, Cheng; Li, Cui; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, K.; Li, Lei; Li, Q. J.; Li, S. L.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, X. R.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Liao, X. T.; Liu, B. J.; Liu, C. L.; Liu, C. X.; Liu, C. Y.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H.; Liu, H. B.; Liu, H. H.; Liu, H. M.; Liu, H. W.; Liu, J. P.; Liu, K. Y.; Liu, Kai; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, X. H.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqiang; Liu, Zhiqing; Loehner, H.; Lu, G. R.; Lu, H. J.; Lu, J. G.; Lu, Q. W.; Lu, X. R.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Ma, C. L.; Ma, F. C.; Ma, H. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. Y.; Ma, Y.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Morales, C. Morales; Motzko, C.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nicholson, C.; Nikolaev, I. B.; Ning, Z.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Park, J. W.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Ping, J. L.; Ping, R. G.; Poling, R.; Prencipe, E.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, X. S.; Qin, Y.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Rong, G.; Ruan, X. D.; Sarantsev, A.; Schaefer, B. D.; Schulze, J.; Shao, M.; Shen, C. P.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, W. M.; Song, X. Y.; Spataro, S.; Spruck, B.; Sun, D. H.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Toth, D.; Ullrich, M.; Varner, G. S.; Wang, B.; Wang, B. Q.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q.; Wang, Q. J.; Wang, S. G.; Wang, X. L.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wei, D. H.; Weidenkaff, P.; Wen, Q. G.; Wen, S. P.; Werner, M.; Wiedner, U.; Wu, L. H.; Wu, N.; Wu, S. X.; Wu, W.; Wu, Z.; Xia, L. G.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, G. M.; Xu, H.; Xu, Q. J.; Xu, X. P.; Xu, Z. R.; Xue, F.; Xue, Z.; Yan, L.; Yan, W. B.; Yan, Y. H.; Yang, H. X.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yu, S. P.; Yuan, C. Z.; Yuan, Y.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, S. H.; Zhang, X. J.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. S.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, H. S.; Zhao, J. W.; Zhao, K. X.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, X. H.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, Y. H.; Zhong, B.; Zhong, J.; Zhou, L.; Zhou, X. K.; Zhou, X. R.; Zhu, C.; Zhu, K.; Zhu, K. J.; Zhu, S. H.; Zhu, X. L.; Zhu, X. W.; Zhu, Y. C.; Zhu, Y. M.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.

    2012-10-01

    Using a 478pb-1 data sample collected with the BESIII detector operating at the Beijing Electron Positron Collider storage ring at a center-of-mass energy of s=4.009GeV, the production of e+e-→ηJ/ψ is observed for the first time with a statistical significance of greater than 10σ. The Born cross section is measured to be (32.1±2.8±1.3)pb, where the first error is statistical and the second systematic. Assuming the ηJ/ψ signal is from a hadronic transition of the ψ(4040), the fractional transition rate is determined to be B(ψ(4040)→ηJ/ψ)=(5.2±0.5±0.2±0.5)×10-3, where the first, second, and third errors are statistical, systematic, and the uncertainty from the ψ(4040) resonant parameters, respectively. The production of e+e-→π0J/ψ is searched for, but no significant signal is observed, and B(ψ(4040)→π0J/ψ)<2.8×10-4 is obtained at the 90% confidence level.

  4. An efficient system for the asymmetric acylation of (R,S)-3-n-butylphthalide catalyzed by novozyme 435.

    PubMed

    Li, Cuiqin; He, Laping; Qiu, Baoquan; Gao, Bing

    2010-01-01

    Novozyme 435 could be a highly efficient catalyst in the asymmetric acylation of (R,S)-3-n-butylphthalide in tetrahydrofuran-hexane solvents. The effect of various reaction parameters such as agitation velocity, water content, mixed media, temperature, concentration of Novozyme 435, molar ratio of acetic anhydride to (R,S)-3-n-butylphthalide, reaction time, enantiomeric excess of substrate (ee(S)), enantiomeric excess of product (ee(P)), and enantioselective ratio (E) were studied. Tetrahydrofuran markedly improved (R,S)-3-n-butylphthalide conversion, enantiomeric excess of remaining 3-n-butylphthalide, and enantiomeric ratio. The optimum media were 50% (v/v) tetrahydrofuran and 50% (v/v) hexane. Other ideal reaction conditions were an agitation velocity of 150 rpm, 0.4% (v/v) water content, temperature of 30 °C, 8 mg/mL dosage of Novozyme 435, 8:1 (0.4 mmol: 0.05 mmol) molar ratio of acetic anhydride to (R,S)-3-n-butylphthalide, and a reaction time of 48 hr. Under the optimum conditions, 96.4% ee(S) and 49.3% conversion of (R,S)-3-n-butylphthalide were achieved. In addition, enantiomeric excess of the product was above 98.0%.

  5. The Metagenome-Derived Enzymes LipS and LipT Increase the Diversity of Known Lipases

    PubMed Central

    Chow, Jennifer; Kovacic, Filip; Dall Antonia, Yuliya; Krauss, Ulrich; Fersini, Francesco; Schmeisser, Christel; Lauinger, Benjamin; Bongen, Patrick; Pietruszka, Joerg; Schmidt, Marlen; Menyes, Ina; Bornscheuer, Uwe T.; Eckstein, Marrit; Thum, Oliver; Liese, Andreas; Mueller-Dieckmann, Jochen; Jaeger, Karl-Erich; Streit, Wolfgang R.

    2012-01-01

    Triacylglycerol lipases (EC 3.1.1.3) catalyze both hydrolysis and synthesis reactions with a broad spectrum of substrates rendering them especially suitable for many biotechnological applications. Most lipases used today originate from mesophilic organisms and are susceptible to thermal denaturation whereas only few possess high thermotolerance. Here, we report on the identification and characterization of two novel thermostable bacterial lipases identified by functional metagenomic screenings. Metagenomic libraries were constructed from enrichment cultures maintained at 65 to 75°C and screened resulting in the identification of initially 10 clones with lipolytic activities. Subsequently, two ORFs were identified encoding lipases, LipS and LipT. Comparative sequence analyses suggested that both enzymes are members of novel lipase families. LipS is a 30.2 kDa protein and revealed a half-life of 48 h at 70°C. The lipT gene encoded for a multimeric enzyme with a half-life of 3 h at 70°C. LipS had an optimum temperature at 70°C and LipT at 75°C. Both enzymes catalyzed hydrolysis of long-chain (C12 and C14) fatty acid esters and additionally hydrolyzed a number of industry-relevant substrates. LipS was highly specific for (R)-ibuprofen-phenyl ester with an enantiomeric excess (ee) of 99%. Furthermore, LipS was able to synthesize 1-propyl laurate and 1-tetradecyl myristate at 70°C with rates similar to those of the lipase CalB from Candida antarctica. LipS represents the first example of a thermostable metagenome-derived lipase with significant synthesis activities. Its X-ray structure was solved with a resolution of 1.99 Å revealing an unusually compact lid structure. PMID:23112831

  6. Resveratrol, 4′ Acetoxy Resveratrol, R-equol, Racemic Equol or S-equol as Cosmeceuticals to Improve Dermal Health

    PubMed Central

    Lephart, Edwin D.

    2017-01-01

    Phytochemicals are botanical compounds used in dermatology applications as cosmeceuticals to improve skin health. Resveratrol and equol are two of the best-known polyphenolic or phytoestrogens having similar chemical structures and some overlapping biological functions to 17β-estradiol. Human skin gene expression was reviewed for 28 different biomarkers when resveratrol, 4′ acetoxy resveratrol (4AR), R-equol, racemic equol or S-equol were tested. Sirtuin 1 activator (SIRT 1) was stimulated by resveratrol and 4AR only. Resveratrol, R-equol and racemic equol were effective on the aging biomarkers proliferating cell nuclear factor (PCNA), nerve growth factor (NGF), 5α-reductase and the calcium binding proteins S100 A8 and A9. Racemic equol and 4AR displayed among the highest levels for the collagens, elastin and tissue inhibitor of the matrix metalloproteinase 1 (TIMP 1). S-equol displayed the lowest level of effectiveness compared to the other compounds. The 4AR analog was more effective compared to resveratrol by 1.6-fold. R-equol and racemic equol were almost equal in potency displaying greater inhibition vs. resveratrol or its 4′ analog for the matrix metalloproteinases (MMPs), but among the inflammatory biomarkers, resveratrol, 4AR, R-equol and racemic equol displayed high inhibition. Thus, these cosmeceuticals display promise to improve dermal health; however, further study is warranted to understand how phytochemicals protect/enhance the skin. PMID:28587197

  7. Meeting report on the Alzheimer’s Drug Discovery Foundation 14th International Conference on Alzheimer’s Drug Discovery

    PubMed Central

    2014-01-01

    The Alzheimer’s Drug Discovery Foundation’s 14th International Conference on Alzheimer’s Drug Discovery was held on 9 and 10 September in Jersey City, NJ, USA. This annual meeting highlights novel therapeutic approaches supported by the Alzheimer’s Drug Discovery Foundation in development for Alzheimer’s disease and related dementias.

  8. U.S. EPA, Pesticide Product Label, , 07/14/1970

    EPA Pesticide Factsheets

    2011-04-14

    ... '~~'n. ":~"f '\\Jsh skin ''lHI'''CJ!e~! I'o.t,· ,'i,P ,r' tr'[' Internal: If ''hallu''''ed. ,rciu c ,. vcr" t Ii, .. nl'I,{·r'ldtc " ~OdPy (H ~ t:rp~~ !>ji:., ., 1!~·· h· C··r'jI. ...

  9. Finite-action solutions of Yang-Mills equations on de Sitter dS4 and anti-de Sitter AdS4 spaces

    NASA Astrophysics Data System (ADS)

    Ivanova, Tatiana A.; Lechtenfeld, Olaf; Popov, Alexander D.

    2017-11-01

    We consider pure SU(2) Yang-Mills theory on four-dimensional de Sitter dS4 and anti-de Sitter AdS4 spaces and construct various solutions to the Yang-Mills equations. On de Sitter space we reduce the Yang-Mills equations via an SU(2)-equivariant ansatz to Newtonian mechanics of a particle moving in R^3 under the influence of a quartic potential. Then we describe magnetic and electric-magnetic solutions, both Abelian and non-Abelian, all having finite energy and finite action. A similar reduction on anti-de Sitter space also yields Yang-Mills solutions with finite energy and action. We propose a lower bound for the action on both backgrounds. Employing another metric on AdS4, the SU(2) Yang-Mills equations are reduced to an analytic continuation of the above particle mechanics from R^3 to R^{2,1} . We discuss analytical solutions to these equations, which produce infinite-action configurations. After a Euclidean continuation of dS4 and AdS4 we also present self-dual (instanton-type) Yang-Mills solutions on these backgrounds.

  10. Annual Progress Report, FY 1980 (U.S. Army Medical Research Institute of Infectious Diseases, Frederick, MD)

    DTIC Science & Technology

    1980-10-01

    Detrick, MD 21701 Fort Detrick, MD 21701 PW 44.p UW ~$" TOM r,ý 8i It V &. A ý 0.00"UAL wmwo* Anderson, A. 0. Barquist, R. F. IWLEPMgo: 301 663-7211 S301...Antiviral Agent (R. A. Smith and W. Kirkpatrick, eds). Academic Press, New York. 10i RESIAMO A14D TECNOOGY W=~ UW SUMAMY DA 0G6427 80 10 01 DOD96Z&(AR)OJ6 L...Defense; 010100 Microbiology 77 10 80 0Q*..... C. In-house I, a* 010WOA a"Isb-Ws ?A I5T V -WLAL 8 1.0 121 VONA We"J lo of 444 C UW S". 0MY 0 S USA

  11. Corrosion Studies on Titanium and Zirconium Metals

    DTIC Science & Technology

    1950-12-01

    respectively 1.08 percent tantalum and 3.70 percent oolumbium. These alloys were in the cold rolled condition. The tantalum metal used was in the annealed ... vo2 iI 1’os th-, n 6 dr s Tal’ V17. C v"-" ’’ 4 Tesi,: s,.li tix , r - :.il s jer ce tr C..C. 73I 5 S1SO) + 5 ]r 0 s U.31 1.36 2, . O Ŗsf4 + 10 H 0...CDCD64 L O 1- V4. .06 14 ct-o to 400 toE La- LOr~ La 10 Go t O 0 d dojtc dtI- d. 0 . W0W44 .OC J 4 . 4d430 to0 0~e-0O ca 1.10t0 bQ 0a002t 0 OK 4140 to

  12. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    PubMed

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  13. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels

    PubMed Central

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel

    2018-01-01

    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447

  14. CTC Sentinel. Volume 3, Issue 1, January 2010. The Facade of Allegiance: Bin Ladin’s Dubious Pledge to Mullah Omar

    DTIC Science & Technology

    2010-01-01

    Academy, the Department of the Army, or any other agency of the U.s. Government. C o M B A T I n G T E R R o R I s M C E n T E R A T W E s T...p o I n T o B j E C T I V E . R E L E V A n T . R I G o R o U s CTC SeNTiNeL Usama bin Ladin explains why he declared jihad against the United...Taliban professed today by al- Qa`ida and its Pakistan-based allies— including the Haqqani network and Tehrik- i -Taliban Pakistan (TTP)—is more a

  15. VizieR Online Data Catalog: Periods of 4-10 Myr old T Tauri members of Orion OB1 (Karim+, 2016)

    NASA Astrophysics Data System (ADS)

    Karim, M. T.; Stassun, K. G.; Briceno, C.; Vivas, A. K.; Raetz, S.; Mateu, C.; Downes, J. J.; Calvet, N.; Hernandez, J.; Neuhauser, R.; Mugrauer, M.; Takahashi, H.; Tachihara, K.; Chini, R.; Cruz-Dias, G. A.; Aarnio, A.; James, D. J.; Hackstein, M.

    2017-02-01

    The Astronomia Variability Survey of Orion (CVSO) was carried out at the Llano del Hato National Astronomical Observatory in Venezuela, with the QUEST CCD mosaic camera (8000*8000pixels) on the 1m (clear aperture) Schmidt telescope, with a plate scale of 1.02''/pixel and field of view of 5.4 deg2. This V-, RC-, and IC-band multi-epoch survey, covering ~180deg2 of the Orion OB1 association, spans a time baseline of 12yr, from 1998 December to 2011 February. The 25 Ori cluster was observed by the 0.6/0.9m Schmidt-type telescope at Jena Observatory (Germany), the two 5.9'' telescopes at Observatorio Cerro Armazones (OCA, Chile), and the 1.5m reflector at the Gunma Astronomical Observatory in Japan, over four observing campaigns during the years 2010-2013. The Jena Schmidt-type telescope was equipped with the optical Schmidt Telescope Camera (STK), with an e2v 42-10 2048*2048 detector, yielding a plate scale of 1.55''/pixel and a field of view of 53'*53', thus encompassing most of the cluster. The Jena 50s exposures, all taken through the R filter, were centered on 25 Ori. A total of 8506 individual exposures were obtained in 108 nights. The Gunma 1.5m reflector observations were carried out by obtaining 60s integrations in R with the Gunma Low-resolution Spectrograph and Imager (GLOWS), which has an e2v CCD55-30 1250*1152 pixel detector with a 0.6''/pixel scale, covering a field of view of 12.5'*11.5'. Observations were obtained during four nights in year 2010. The Observatorio Cerro Armazones observations were done in the R band using the RoBoTT (Robotic Bochum TWin Telescope), which consists of twin Takahashi 150mm aperture apochromatic astrographs, each equipped with an Apogee U16M camera with a KAF-16803 4096*4096 pixel CCD, providing a 2.7°*2.7° field of view with 2.37''/pixel scale. The 60s exposures were centered on 25 Ori, spanning an area much larger than the cluster. OCA data were obtained during all YETI seasons. During the nights of 2006 January 8-15, we

  16. DEMONSTRATION BULLETIN: THE BASIC EXTRACTIVE SLUDGE TREATMENT (B.E.S.T.) RESOURCES CONSERVATION COMPANY (RCC)

    EPA Science Inventory

    The Basic Extractive Sludge Treatment (B.E.S.T.®) process is a solvent extraction system that separates organic contaminants from sludges, soils, and sediments. The primary distinguishing feature of the process is the extraction agent, triethylamine. The key to the success of tri...

  17. The Army’s Wireless Communications Programs

    DTIC Science & Technology

    2009-02-11

    20Plans%20First%20AEHF% 20Launch%20Early%20Next%20Year&channel= awst .9 CBO Other Strategic Wireless Communications Programs The Army invests in a number...O N G R E SS O F T H E U N IT E D ST AT E S C O N G R E SSIO N A L B U D G E T O FFIC E W A SH IN G T O N , D C 20515

  18. Positional cloning of the chromosome 14 Alzheimer`s disease locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clark, R.F.; Korenblat, K.M.; Goate, A.M.

    1994-09-01

    Genetic linkage analysis had indicated a locus for familial early-onset Alzheimer`s disease (FAD) on chromosome 14 at q24.3. The FAD locus has been shown previously to lie between the dinucleotide markers D14S61 and D14S63, a genetic distance of approximately 13 cM. We are currently attempting to identify the gene using a positional cloning strategy. The first step towards the isolation and characterization of this locus was the construction of an overlapping YAC contig covering the entire region. Over forty YACs which map to this region have been isolated from the St. Louis and CEPH libraries by a combination of YACmore » end sequence walking and sequence tagged site mapping. Our contig fully spans the complete domain, encompassing all genetic markers non-recombinant with FAD (i.e. D14S76, D14S43, D14S71, D14S77) and the two nearest flanking FAD-recombinant markers. With restriction mapping of the domain, we can determine the exact size of the region. As a second step, the YACs in this contig are currently being inspected for expressed sequences by exon trapping, initially on those YACs known to be nonchimeric. We have currently made exon-trapped libraries from YACs that have the markers D14S76 and D14S43. Sequence analysis of these libraries indicates that a trapped exon is identified on average for each 30 kb of YAC DNA. The trapped exons are being screened to identify likely candidate genes, which will be examined for mutations in FAD families.« less

  19. Completing the Heterocubane Family [Cp*AlE]4 (E = O, S, Se, and Te) by Selective Oxygenation and Sulfuration of [Cp*Al]4: Density Functional Theory Calculations of [Cp*AlE]4 and Reactivity of [Cp*AlO]4 toward Hydrolysis.

    PubMed

    Stelzer, Adrian C; Hrobárik, Peter; Braun, Thomas; Kaupp, Martin; Braun-Cula, Beatrice

    2016-05-16

    The subvalent aluminum compound [Cp*Al]4 (1) reacts with dioxygen, N2O, or sulfur to yield the heterocubane complexes [Cp*AlX]4 [X = O (2) and S (3)]. Treatment of [Cp*AlO]4 (2) with (tBuO)3SiOH gave [(tBuO)3SiOAlO]4 (6) and Cp*H. The structures and spectroscopic data of the Al clusters are supported by density functional theory (DFT) calculations, which also demonstrate the importance of noncovalent interactions (NCI) in oligomeric Al(I) complexes as well as in [Cp*AlS]4 and the heavier homologues of Se and Te. The computed (27)Al NMR shifts indicate a deshielding at the Al centers with increasing electronegativity of the chalcogen atom as well as significant spin-orbit shielding effects within the heavier heterocubane [Al4E4] cores. Further hydrolysis of 6 with an additional amount of silanol in the presence of water resulted in the formation of [Al4(OH)6(OH2)2(OSiOtBu3)6] (7), which shows a structural motif found in boehmite and diaspore.

  20. Diversity in the 18S SSU rRNA V4 hyper-variable region of Theileria spp. in Cape buffalo (Syncerus caffer) and cattle from southern Africa.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Latif, Abdalla A; Potgieter, Fred T

    2011-05-01

    Sequence variation within the 18S SSU rRNA V4 hyper-variable region can affect the accuracy of real-time hybridization probe-based diagnostics for the detection of Theileria spp. infections. This is relevant for assays that use non-specific primers, such as the real-time hybridization assay for T. parva (Sibeko et al. 2008). To assess the effect of sequence variation on this test, the Theileria 18S gene from 62 buffalo and 49 cattle samples was cloned and ∼1000 clones sequenced. Twenty-six genotypes were detected which included known and novel genotypes for the T. buffeli, T. mutans, T. taurotragi and T. velifera clades. A novel genotype related to T. sp. (sable) was also detected in 1 bovine sample. Theileria genotypic diversity was higher in buffalo compared to cattle. Polymorphism within the T. parva hyper-variable region was confirmed by aberrant real-time melting peaks and supported by sequencing of the S5 ribosomal gene. Analysis of the S5 gene suggests that this gene can be a marker for species differentiation. T. parva, T. sp. (buffalo) and T. sp. (bougasvlei) remain the only genotypes amplified by the primer set of the hybridization assay. Therefore, the 18S sequence diversity observed does not seem to affect the current real-time hybridization assay for T. parva.

  1. User’s Manual for Electromagnetic Pulse Coupling Code TEMPO.

    DTIC Science & Technology

    1981-02-01

    I.IEM’tRS. ’ A 𔃾’" IIEEARTrMFSI O ’tE TI NAVY ""MANDES A.TTN ’" APEl 6 1 74112, EIMWARD F. * IlFFR 5’ RE I SIN TE.:’HNrlI p 15 !DIVl!I0N,’M AS!’’ P’S1! A...I. BOX R810847 IT. l, 4",8. T~ 0."E SYLVANIA, INC ATTN ’. B. WILLIAMS F< ’’TRONI’S YSTRMS ;RP-EASTERN DIV ATTN TENNIS SWIF’F MCI’NNFI.I [’ITGLAS

  2. HEC-4 Monthly Streamflow Simulation (User’s Manual)

    DTIC Science & Technology

    1971-02-01

    adding this product to the uroduct of the complement of this multiplier and the value of the ele - ment in the inconsistent matrix. The averaged or...the month pre- ceding the first month specified (by input data) to be generated. The var-’ ele M.1A is comnutel f’or the subscript o" ; that conforms...1-4 .f’o .Td74 r m 1i4 tf’t 0atQ P PkPkk4 el %04 k04 fl 0 -41. ----- 4-4-4 a-4 -44 44-4- - -4 *fF_4Q cacao---1 00 0404- -4 Cb 0 0-r-o .0. 4

  3. Absence of quantum anomalous Hall state in 4 d transition-metal-doped B i2S e3 : An ab initio study

    NASA Astrophysics Data System (ADS)

    Deng, Bei; Liu, Feng; Zhu, Junyi

    2017-11-01

    The realization of insulating ferromagnetic states in topological insulator (TI) systems, with sufficiently high Curie temperatures (TC) and large magnetically induced gaps, has been the key bottleneck towards the realization of the quantum anomalous Hall effect (QAHE). Despite the limited reports on 3 d or 4 f transition-metal (TM)-doped B i2S e3 , there remains a lack of systematic studies on 4 d TMs, which may be potential candidates since the atomic sizes of 4 d TMs and that of Bi are similar. Here, we report a theoretical work that probes the magnetic behaviors of the 4 d TM-doped B i2S e3 system. We discovered that among the 4 d TMs, Nb and Mo can create magnetic moments of 1.76 and 2.96 μ B in B i2S e3 , respectively. While Mo yields a stable gapless antiferromagnetic ground state, Nb favors a strong ferromagnetic order, with the magnetic coupling strength (TC) ˜6 times of that induced by the traditional Cr impurity. Yet, we found that Nb is still unfavorable to support the QAH state in B i2S e3 because of the reduced correlation in the t2 g band that gives a gapless character. This rationale is not only successful in interpreting why Nb, the strongest candidate among 4 d TMs for achieving ferromagnetism in B i2S e3 , actually cannot lead to QAHE in the B i2S e3 system even with the assistance of codoping but also is particularly important to fully understand the mechanism of acquisition of insulating ferromagnetic states inside TI. On the other hand, we discovered that Mo-doped B i2S e3 favors strong antiferromagnetic states and may lead to superconducting states.

  4. Pro-resolving actions and stereoselective biosynthesis of 18S E-series resolvins in human leukocytes and murine inflammation

    PubMed Central

    Oh, Sungwhan F.; Pillai, Padmini S.; Recchiuti, Antonio; Yang, Rong; Serhan, Charles N.

    2011-01-01

    E-series resolvins are antiinflammatory and pro-resolving lipid mediators derived from the ω-3 polyunsaturated fatty acid eicosapentaenoic acid (EPA) that actively clear inflammation to promote tissue homeostasis. Aspirin, in addition to exerting antithrombotic actions, also triggers the biosynthesis of these specialized pro-resolving mediators. Here, we used metabolomic profiling to investigate the biosynthesis of E-series resolvins with specific chiral chemistry in serum from human subjects and present evidence for new 18S series resolvins. Aspirin increased endogenous formation of 18S-hydroxyeicosapentaenoate (18S-HEPE) compared with 18R-HEPE, a known resolvin precursor. Human recombinant 5-lipoxygenase used both enantiomers as substrates, and recombinant LTA4 hydrolase (LTA4H) converted chiral 5S(6)-epoxide–containing intermediates to resolvin E1 and 18S-resolvin E1 (RvE1 and 18S-RvE1, respectively). 18S-RvE1 bound to the leukocyte GPCRs ChemR23 and BLT1 with increased affinity and potency compared with the R-epimer, but was more rapidly inactivated than RvE1 by dehydrogenase. Like RvE1, 18S-RvE1 enhanced macrophage phagocytosis of zymosan, E. coli, and apoptotic neutrophils and reduced both neutrophil infiltration and proinflammatory cytokines in murine peritonitis. These results demonstrate two parallel stereospecific pathways in the biosynthesis of E-series resolvins, 18R- and 18S-, which are antiinflammatory, pro-resolving, and non-phlogistic and may contribute to the beneficial actions of aspirin and ω-3 polyunsaturated fatty acids. PMID:21206090

  5. Repression of YdaS Toxin Is Mediated by Transcriptional Repressor RacR in the Cryptic rac Prophage of Escherichia coli K-12.

    PubMed

    Krishnamurthi, Revathy; Ghosh, Swagatha; Khedkar, Supriya; Seshasayee, Aswin Sai Narain

    2017-01-01

    Horizontal gene transfer is a major driving force behind the genomic diversity seen in prokaryotes. The cryptic rac prophage in Escherichia coli K-12 carries the gene for a putative transcription factor RacR, whose deletion is lethal. We have shown that the essentiality of racR in E. coli K-12 is attributed to its role in transcriptionally repressing toxin gene(s) called ydaS and ydaT , which are adjacent to and coded divergently to racR . IMPORTANCE Transcription factors in the bacterium E. coli are rarely essential, and when they are essential, they are largely toxin-antitoxin systems. While studying transcription factors encoded in horizontally acquired regions in E. coli , we realized that the protein RacR, a putative transcription factor encoded by a gene on the rac prophage, is an essential protein. Here, using genetics, biochemistry, and bioinformatics, we show that its essentiality derives from its role as a transcriptional repressor of the ydaS and ydaT genes, whose products are toxic to the cell. Unlike type II toxin-antitoxin systems in which transcriptional regulation involves complexes of the toxin and antitoxin, repression by RacR is sufficient to keep ydaS transcriptionally silent.

  6. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Poultry Allele-Specific Expression (ASE) of CD4+ T Cells in Response to Marek’s Disease Virus Infection

    USDA-ARS?s Scientific Manuscript database

    Marek’s disease (MD) is a T cell lymphoma disease of poultry induced by Marek’s disease virus (MDV), a highly oncogenic alphaherpesvirus. To identify high-confidence candidate genes of MD genetic resistance, transcriptomic data in CD4+ T cells were obtained from MDV infected and non-infected groups ...

  8. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunita,S.; Zhenxing, H.; Swaathi, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. Themore » structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.« less

  9. Software OT&E Guidelines. Volume 3. Software Maintainability Evaluator’s Handbook

    DTIC Science & Technology

    1980-04-01

    SOFTWARE OT&E " 1 GUIDELINES . VOLUME III SOFTWARE MAINTAINABILITY EVALUATOR’S HANDBOOK APRIL 1980 AIR FORCE TEST AND EVALUATION CENTER KIRTLAND AIR...FORCE BASE NEW MEXICO 87117 C-, -j AfTECP 800-3 AF’r...........3 ...... UNCLASSIFIED SECURITY CLASSIFICATION OF THIS PAGE (When D.. Entered) RE:PORT...c -. 5 TY!aJ0. PERIOD COVERED SOFTWARE OT& . GUIDELINES, Volume III .of five). -1 softare-R.aintainability Evaluator’s P-IEFnook’ 4ina. i 1980

  10. Observation of e+e-→ω χc 1 ,2 near √{s }=4.42 and 4.6 GeV

    NASA Astrophysics Data System (ADS)

    Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Eren, E. E.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Farinelli, R.; Fava, L.; Fedorov, O.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, X. Y.; Gao, Y.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. W.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kiese, P.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuehn, W.; Kupsc, A.; Lange, J. S.; Lara, M.; Larin, P.; Leng, C.; Li, C.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, Lei; Li, P. R.; Li, Q. Y.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ripka, M.; Rong, G.; Rosner, Ch.; Ruan, X. D.; Santoro, V.; Sarantsev, A.; Savrié, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, S. G.; Wang, W.; Wang, W. P.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. N.; Zhang, Y. T.; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zotti, L.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

    2016-01-01

    Based on data samples collected with the BESIII detector operating at the BEPCII storage ring at center-of-mass energies √{s }>4.4 GeV , the processes e+e-→ω χc 1 ,2 are observed for the first time. With an integrated luminosity of 1074 pb-1 near √{s }=4.42 GeV , a significant ω χc 2 signal is found, and the cross section is measured to be (20.9 ±3.2 ±2.5 ) pb . With 567 pb-1 near √{s }=4.6 GeV , a clear ω χc 1 signal is seen, and the cross section is measured to be (9.5 ±2.1 ±1.3 ) pb , while evidence is found for an ω χc 2 signal. The first errors are statistical, and the second are systematic. Due to low luminosity or low cross section at other energies, no significant signals are observed. In the ω χc 2 cross section, an enhancement is seen around √{s }=4.42 GeV . Fitting the cross section with a coherent sum of the ψ (4415 ) Breit-Wigner function and a phase-space term, the branching fraction B (ψ (4415 )→ω χc 2) is obtained to be of the order of 1 0-3.

  11. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  12. North-South S and T gap

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moghadam, A.A.

    1985-01-01

    The objectives of this study were (1) to demonstrate the existence of the science and technology (S and T) gap between developed countries (DCs) or the north, and less developed countries (LDCs) or the south; (2) to test the hypothesis that there exists a critical mass with respect to population, gross domestic product (GDP), per capita income, and literacy rate below which S and T development is insignificant; and (3) to recommend possible remedial actions for reducing this gap. The research comprises a thorough review of the existing literature, and an extensive analysis of 1976-78 and 1980-82 statistics for 66more » countries, presenting a global picture of the S and T gap in the free world. A comprehensive account was given of the S and T status for Britain, Germany, United States, Japan, Brazil, Mexico, South Korea, Hong Kong, Singapore, Taiwan, Egypt, and Nigeria. A plot of S and T indicators versus independent variables for the 66 counties clearly indicated the existence of the North-South S and T gap. The test of the critical hypothesis, using t distribution, revealed that population size does not have a significant impact on the development or deployment of S and T. This test with respect to GDP indicated that greater GDPs would facilitate the progress of S and T. The results for per capita income were similar. Adequate infrastructure had the greatest impact on absorption, deployment, and maintenance of S and T for development. It was also indicated that with literacy rates below 40% no significant S and T activity can be expected.« less

  13. NaV1.4 mutations cause hypokalaemic periodic paralysis by disrupting IIIS4 movement during recovery

    PubMed Central

    Lehmann-Horn, Frank; Fan, Chunxiang; Wolf, Markus; Winston, Vern; Merlini, Luciano

    2014-01-01

    Hypokalaemic periodic paralysis is typically associated with mutations of voltage sensor residues in calcium or sodium channels of skeletal muscle. To date, causative sodium channel mutations have been studied only for the two outermost arginine residues in S4 voltage sensor segments of domains I to III. These mutations produce depolarization of skeletal muscle fibres in response to reduced extracellular potassium, owing to an inward cation-selective gating pore current activated by hyperpolarization. Here, we describe mutations of the third arginine, R3, in the domain III voltage sensor i.e. an R1135H mutation which was found in two patients in separate families and a novel R1135C mutation identified in a third patient in another family. Muscle fibres from a patient harbouring the R1135H mutation showed increased depolarization tendency at normal and reduced extracellular potassium compatible with the diagnosis. Additionally, amplitude and rise time of action potentials were reduced compared with controls, even for holding potentials at which all NaV1.4 are fully recovered from inactivation. These findings may be because of an outward omega current activated at positive potentials. Expression of R1135H/C in mammalian cells indicates further gating defects that include significantly enhanced entry into inactivation and prolonged recovery that may additionally contribute to action potential inhibition at the physiological resting potential. After S4 immobilization in the outward position, mutant channels produce an inward omega current that most likely depolarizes the resting potential and produces the hypokalaemia-induced weakness. Gating current recordings reveal that mutations at R3 inhibit S4 deactivation before recovery, and molecular dynamics simulations suggest that this defect is caused by disrupted interactions of domain III S2 countercharges with S4 arginines R2 to R4 during repolarization of the membrane. This work reveals a novel mechanism of disrupted S

  14. Using solution- and solid-state S K-edge X-ray absorption spectroscopy with density functional theory to evaluate M-S bonding for MS4(2-) (M = Cr, Mo, W) dianions.

    PubMed

    Olson, Angela C; Keith, Jason M; Batista, Enrique R; Boland, Kevin S; Daly, Scott R; Kozimor, Stosh A; MacInnes, Molly M; Martin, Richard L; Scott, Brian L

    2014-12-14

    Herein, we have evaluated relative changes in M-S electronic structure and orbital mixing in Group 6 MS4(2-) dianions using solid- and solution-phase S K-edge X-ray absorption spectroscopy (XAS; M = Mo, W), as well as density functional theory (DFT; M = Cr, Mo, W) and time-dependent density functional theory (TDDFT) calculations. To facilitate comparison with solution measurements (conducted in acetonitrile), theoretical models included gas-phase calculations as well as those that incorporated an acetonitrile dielectric, the latter of which provided better agreement with experiment. Two pre-edge features arising from S 1se* and t electron excitations were observed in the S K-edge XAS spectra and were reasonably assigned as (1)A1 → (1)T2 transitions. For MoS4(2-), both solution-phase pre-edge peak intensities were consistent with results from the solid-state spectra. For WS4(2-), solution- and solid-state pre-edge peak intensities for transitions involving e* were equivalent, while transitions involving the t orbitals were less intense in solution. Experimental and computational results have been presented in comparison to recent analyses of MO4(2-) dianions, which allowed M-S and M-O orbital mixing to be evaluated as the principle quantum number (n) for the metal valence d orbitals increased (3d, 4d, 5d). Overall, the M-E (E = O, S) analyses revealed distinct trends in orbital mixing. For example, as the Group 6 triad was descended, e* (π*) orbital mixing remained constant in the M-S bonds, but increased appreciably for M-O interactions. For the t orbitals (σ* + π*), mixing decreased slightly for M-S bonding and increased only slightly for the M-O interactions. These results suggested that the metal and ligand valence orbital energies and radial extensions delicately influenced the orbital compositions for isoelectronic ME4(2-) (E = O, S) dianions.

  15. Metal-Arc Welded Ti-6Al-4V, Ti-4Al-4V, and Ti-5Al-2 and 1/2 SN Titanium Alloys

    DTIC Science & Technology

    1959-05-01

    x . 7 8 8 - x 2 . 1 2 i n c h ) V n o t c h Charpy i m p a c t spec imen . MATERIALS COHN* .25 . 2 3 The m a t e r i a l s u s e d d...i e d V n o t c h Charpy i m p a c t spec imen i n a s t a n d a r d i m p a c t machine w i th anvi l s modified so t h a t the center...of percussion of the pendulum coincided with the center of the impact specimen, This FIGURE 3: SUBSIZE T E N S I L E SPECIMEN FIGURE 4

  16. Observation of 1(-)0(-) final states from psi(2S) decays and e(+)e(-) annihilation.

    PubMed

    Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Hsu, L; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Rosner, J L; Ryd, A; Sadoff, A J; Schwarthoff, H; Shepherd, M R; Sun, W M; Thayer, J G; Urner, D; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; Thaler, J J; Williams, J; Wiss, J; Edwards, K W; Besson, D; Gao, K Y; Gong, D T; Kubota, Y; Li, S Z; Poling, R; Scott, A W; Smith, A; Stepaniak, C J; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Mahmood, A H; Severini, H; Asner, D M; Dytman, S A; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shibata, E I; Shipsey, I P J; Adams, G S; Chasse, M; Cummings, J P; Danko, I; Napolitano, J; Cronin-Hennessy, D; Park, C S; Park, W; Thayer, J B; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dambasuren, E; Dorjkhaidav, O; Menaa, N; Mountain, R; Muramatsu, H; Nandakumar, R; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Briere, R A; Chen, G P; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E

    2005-01-14

    Using CLEO data collected from CESR e(+)e(-) collisions at the psi(2S) resonance and nearby continuum at sqrt[s]=3.67 GeV, we report the first significantly nonzero measurements of light vector-pseudoscalar hadron pair production (including rhopi, omegapi, rhoeta, and K(*0)K0 ) and the pi(+)pi(-)pi(0) final state, both from psi(2S) decays and direct e(+)e(-) annihilation.

  17. 40 CFR 81.303 - Arizona.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., R13E 1 X T1N, R14E X T1N, R15E X T1S, R14E 1 X T1S, R141/2E X T1S, R15E X T2N, R13E 1 X T2N, R16E X T1N...); T1S, R14E (sections 124); T1S, R141/2E; and T1S, R15E 11/15/90 Nonattainment 11/15/90 Moderate. Gila...

  18. 40 CFR 81.303 - Arizona.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., R13E 1 X T1N, R14E X T1N, R15E X T1S, R14E 1 X T1S, R141/2E X T1S, R15E X T2N, R13E 1 X T2N, R16E X T1N...); T1S, R14E (sections 124); T1S, R141/2E; and T1S, R15E 11/15/90 Nonattainment 11/15/90 Moderate. Gila...

  19. 40 CFR 81.303 - Arizona.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., R13E 1 X T1N, R14E X T1N, R15E X T1S, R14E 1 X T1S, R141/2E X T1S, R15E X T2N, R13E 1 X T2N, R16E X T1N...); T1S, R14E (sections 124); T1S, R141/2E; and T1S, R15E 11/15/90 Nonattainment 11/15/90 Moderate. Gila...

  20. Validity and Reliability of the 30-s Continuous Jump for Anaerobic Power and Capacity Assessment in Combat Sport

    PubMed Central

    Čular, Drazen; Ivančev, Vladimir; Zagatto, Alessandro M.; Milić, Mirjana; Beslija, Tea; Sellami, Maha; Padulo, Johnny

    2018-01-01

    Cycling test such Wingate anaerobic test (WAnT) is used to measure anaerobic power (AP), but not anaerobic capacity (AC, i.e., the metabolic energy demand). However, in sports that do not involve cycling movements (Karate), the continuous jump for 30 s (vertical jumps for 30 s) has been extensively used to measure anaerobic performance in all young athletes. Limited information’s are available concerning its validity and reliability especially in children. As such, the current study aimed to test validity and reliability of a continuous jumps test (the CJ30s), using WAnT as a reference. Thirteen female Karate kids (age: 11.07 ± 1.32 years; mass: 41.76 ± 15.32 kg; height: 152 ± 11.52 cm; training experience: 4.38 ± 2.14 years) were tested on three separate sessions. The first and second sessions were used to assess the reliability using Intra-class correlation coefficient (ICC) of CJ30s, whereas on the third session WAnT was administered. Following CJ30s and WAnT, we assessed AP (1/CJ30s, as jump height [JH], fatigue index [FI], and blood lactate [BL]; 2/WAnT, as mechanical power [P], FI, and BL) and AC as the excess post-exercise oxygen consumption (EPOC). Large/highly significant correlations were found between CJ30s and WAnT EPOCs (r = 0.730, P = 0.003), and BLs (r = 0.713, P = 0.009). Moderate/significant correlations were found between CJ30s and WAnT FIs (r = 0.640, P = 0.014), CJ30s first four jumps mean JH and WAnT peak P (r = 0.572, P = 0.032), and CJ30s mean JH and WAnT mean P (r = 0.589, P = 0.021). CJ30s showed excellent and moderate reliability (ICC) for AP (maximal JH 0.884, mean JH 0.742, FI 0.657, BL 0.653) and AC (EPOC 0.788), respectively. Correlations observed especially in terms of AC between CJ30s and WAnT provide evidence that former may adequately assess anaerobic performance for the young combat athlete. CJ30 is a reliable test and allow an easy assessment of AP and AC in karate children. PMID:29867580

  1. Involvement of the BLT2 receptor in the itch-associated scratching induced by 12-(S)-lipoxygenase products in ICR mice

    PubMed Central

    Kim, H J; Kim, D K; Kim, H; Koh, J Y; Kim, K M; Noh, M S; Lee, S; Kim, S; Park, S H; Kim, J J; Kim, S Y; Lee, C H

    2008-01-01

    Background and purpose: Recently, we reported that 12(S)-HPETE (12(S)-hydroperoxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid) induces scratching in ICR mice. We hypothesized that 12(S)-HPETE might act as an agonist of the low-affinity leukotriene B4 receptor BLT2. To confirm the involvement of the BLT2 receptor in 12(S)-HPETE-induced scratching, we studied the scratch response using the BLT2 receptor agonists compound A (4′-{[pentanoyl (phenyl) amino]methyl}-1,1′-biphenyl-2-carboxylic acid) and 12(S)-HETE (12(S)-hydroxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid). Experimental approach: A video recording was used to determine whether the BLT2 receptor agonists caused itch-associated scratching in ICR mice. Selective antagonists and several chemicals were used. Key results: Both 12(S)-HETE and compound A dose dependently induced scratching in the ICR mice. The dose–response curve for compound A showed peaks at around 0.005–0.015 nmol per site. Compound A- and 12(S)-HETE-induced scratching was suppressed by capsaicin and naltrexon. We examined the suppressive effects of U75302 (6-[6-(3-hydroxy-1E,5Z-undecadienyl)-2-pyridinyl]-1,5-hexanediol, the BLT1 receptor antagonist) and LY255283 (1-[5-ethyl-2-hydroxy-4-[[6-methyl-6-(1H-tetrazol-5-yl)heptyl]oxy]phenyl]-ethanone, the BLT2 receptor antagonist) on the BLT2 agonist-induced scratching. LY255283 suppressed compound A- and 12(S)-HETE-induced scratching, but U75302 did not. LY255283 required a higher dose to suppress the compound A-induced scratching than it did to suppress the 12(S)-HETE-induced scratching. One of the BLT2 receptor agonists, 12(R)-HETE (12(R)-hydroxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid), also induced scratching in the ICR mice. Conclusions and implications: Our present results corroborate the hypothesis that the BLT2 receptor is involved in 12(S)-lipoxygenase-product-induced scratching in ICR mice. We also confirmed that this animal model could be a valuable means of evaluating the effects of BLT2 receptor

  2. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae)

    PubMed Central

    2012-01-01

    Background For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Results Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Conclusions Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location

  3. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    PubMed

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

  4. Cytogenetic analysis in three Bryconamericus species (Characiformes, Characidae): first description of the 5S rDNA-bearing chromosome pairs in the genus

    PubMed Central

    2013-01-01

    Background Nowadays, the genus Bryconamericus is placed in subfamily Stevardiinae within of Characidae, but not shows consistent evidence of monophyletism. The purpose of this work was to study the chromosomes of three species of Bryconamericus, aiming to add cytogenetic knowledge and contribute to the understanding of the chromosomal evolution of this genus. Results The chromosomes of three species of Bryconamericus were analyzed using cytogenetic techniques. The karyotype of Bryconamericus stramineus contained 6 metacentric (m) + 10 submetacentric (sm) + 16 subtelocentric (st) + 20 acrocentric (a), the fundamental number (FN) of 84, one silver impregnated (Ag-NOR) pair, one pair bearing the 18S ribosomal DNA sites, another pair bearing the 5S rDNA sites, and a few positive C-bands. Bryconamericus turiuba had a karyotype containing 8 m + 10sm + 14st + 20a (FN = 84), one chromosome pair Ag-NOR, two pairs bearing the 18S rDNA sites, two pairs bearing the 5S rDNA sites, and a few C-band regions. Bryconamericus cf. iheringii had a karyotype containing 10 m + 14sm + 18st + 10a (FN = 94), including one pair with a secondary constriction Ag-NOR positive. In this karyotype the fluorescent in situ hybridization (FISH) showed the 18S and 5S rDNA probe in adjacent position. Conclusions The results obtained in this work showed different characteristics in the organization of two multigene families, indicating that distinct evolutionary forces acting on the diversity of rDNA sequences in the genome of three Bryconamericus species. PMID:23547656

  5. 15. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. SACATON DAM AND BRIDGE, CONSTRUCTION BRIDGE DECK, 4/5/25 - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  6. A system to measure isomeric state half-lives in the 10 ns to 10 μs range

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toufen, D. L., E-mail: dennis@if.usp.br; Federal Institute of Education, Science and Technology of São Paulo - IFSP, 07115-000 Guarulhos, São Paulo; Allegro, P. R. P.

    2014-07-15

    The Isomeric State Measurement System (SISMEI) was developed to search for isomeric nuclear states produced by fusion-evaporation reactions. The SISMEI consists of 10 plastic phoswich telescopes, two lead shields, one NaI(Tl) scintillation detector, two Compton suppressed HPGe γ-ray detectors, and a cone with a recoil product catcher. The new system was tested at the 8 UD Pelletron tandem accelerator of the University of São Paulo with the measurement of two known isomeric states: {sup 54}Fe, 10{sup +} state (E = 6527.1 (11) keV, T{sub 1/2} = 364(7) ns) and the 5/2{sup +} state of {sup 19}F (E = 197.143 (4)more » keV, T{sub 1/2} = 89.3 (10) ns). The results indicate that the system is capable of identifying delayed transitions, of measuring isomeric state lifetimes, and of identifying the feeding transitions of the isomeric state through the delayed γ-γ coincidence method. The measured half-life for the 10{sup +} state was T{sub 1/2} = 365(14) ns and for the 5/2{sup +} state, 100(36) ns.« less

  7. First limits on the very-high energy gamma-ray afterglow emission of a fast radio burst. H.E.S.S. observations of FRB 150418

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abdalla, H.; Abramowski, A.; Aharonian, F.; Ait Benkhali, F.; Akhperjanian, A. G.; Andersson, T.; Angüner, E. O.; Arakawa, M.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Becker Tjus, J.; Berge, D.; Bernhard, S.; Bernlöhr, K.; Blackwell, R.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Büchele, M.; Bulik, T.; Capasso, M.; Carr, J.; Casanova, S.; Cerruti, M.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chrétien, M.; Coffaro, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Cui, Y.; Davids, I. D.; Decock, J.; Degrange, B.; Deil, C.; Devin, J.; Dewilt, P.; Dirson, L.; Djannati-Ataï, A.; Domainko, W.; Donath, A.; Drury, L. O.'c.; Dutson, K.; Dyks, J.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Funk, S.; Füßling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Hahn, J.; Haupt, M.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Iwasaki, H.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzyński, K.; Katsuragawa, M.; Katz, U.; Kerszberg, D.; Khangulyan, D.; Khélifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Kraus, M.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Liu, R.; López-Coto, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Mohrmann, L.; Morå, K.; Moulin, E.; Murach, T.; Nakashima, S.; de Naurois, M.; Niederwanger, F.; Niemiec, J.; Oakes, L.; O'Brien, P.; Odaka, H.; Öttl, S.; Ohm, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Pekeur, N. W.; Pelletier, G.; Perennes, C.; Petrucci, P.-O.; Peyaud, B.; Piel, Q.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; de Los Reyes, R.; Richter, S.; Rieger, F.; Romoli, C.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Saito, S.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwemmer, S.; Seglar-Arroyo, M.; Settimo, M.; Seyffert, A. S.; Shafi, N.; Shilon, I.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stycz, K.; Sushch, I.; Takahashi, T.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tibaldo, L.; Tiziani, D.; Tluczykont, M.; Trichard, C.; Tsuji, N.; Tuffs, R.; Uchiyama, Y.; van der Walt, D. J.; van Eldik, C.; van Rensburg, C.; van Soelen, B.; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Völk, H. J.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zanin, R.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Żywucka, N.; Superb Collaboration; Jankowski, F.; Keane, E. F.; Petroff, E.

    2017-01-01

    Aims: Following the detection of the fast radio burst FRB150418 by the SUPERB project at the Parkes radio telescope, we aim to search for very-high energy gamma-ray afterglow emission. Methods: Follow-up observations in the very-high energy gamma-ray domain were obtained with the H.E.S.S. imaging atmospheric Cherenkov telescope system within 14.5 h of the radio burst. Results: The obtained 1.4 h of gamma-ray observations are presented and discussed. At the 99% C.L. we obtained an integral upper limit on the gamma-ray flux of Φγ(E > 350 GeV) < 1.33 × 10-8 m-2 s-1. Differential flux upper limits as function of the photon energy were derived and used to constrain the intrinsic high-energy afterglow emission of FRB 150418. Conclusions: No hints for high-energy afterglow emission of FRB 150418 were found. Taking absorption on the extragalactic background light into account and assuming a distance of z = 0.492 based on radio and optical counterpart studies and consistent with the FRB dispersion, we constrain the gamma-ray luminosity at 1 TeV to L < 5.1 × 1047 erg/s at 99% C.L.

  8. Phase 1 Environmental Baseline Survey for Leasing Nellis Air Force Base Land for Construction and Maintenance of a Stormwater Detention System and Relocation of Military Family Housing Clark County, Nevada

    DTIC Science & Technology

    2006-11-01

    31138 - 65 -5Case Number: Not reportedPhone Number 3: (702)254-0031 HPhone...3000 WPhone Number 1: DAVIS,JEFFContact Name: 1,274.00Facility Rec#: BORAL HCChemical Name: 600 GALQuantity: 31138 - 65 -5Case Number: Not reportedPhone...E G A S S 10 65 14 38 6 R O Y A L E X P R E S S , I N C . IN T E R S T A T E 1 5 @ U .S . H IG H W A Y 9 S H W S LA S V E G A S S 10 58 05 49

  9. Arabidopsis thaliana Nfu2 accommodates [2Fe-2S] or [4Fe-4S] clusters and is competent for in vitro maturation of chloroplast [2Fe-2S] and [4Fe-4S] cluster-containing proteins†

    PubMed Central

    Gao, Huanyao; Subramanian, Sowmya; Couturier, Jérémy; Naik, Sunil; Kim, Sung-Kun; Leustek, Thomas; Knaff, David B.; Wu, Hui-Chen; Vignols, Florence; Huynh, Boi Hanh; Rouhier, Nicolas; Johnson, Michael K.

    2013-01-01

    Nfu-type proteins are essential in the biogenesis of iron-sulfur (Fe-S) clusters in numerous organisms. A number of phenotypes including low levels of Fe-S cluster incorporation are associated with deletion of the gene encoding a chloroplast-specific Nfu-type protein, Nfu2 from Arabidopsis thaliana (AtNfu2). Here we report that recombinant AtNfu2 is able to assemble both [2Fe-2S] and [4Fe-4S] clusters. Analytical data and gel filtration studies support cluster/protein stoichiometries of one [2Fe-2S] cluster/homotetramer and one [4Fe-4S] cluster/homodimer. The combination of UV-visible absorption and circular dichroism, resonance Raman and Mössbauer spectroscopies has been employed to investigate the nature, properties and transfer of the clusters assembled on Nfu2. The results are consistent with subunit-bridging [2Fe-2S]2+ and [4Fe-4S]2+ clusters coordinated by the cysteines in the conserved CXXC motif. The results also provided insight into the specificity of Nfu2 for maturation of chloroplastic Fe-S proteins via intact, rapid and quantitative cluster transfer. [2Fe-2S] cluster-bound Nfu2 is shown to be an effective [2Fe-2S]2+ cluster donor for glutaredoxin S16, but not glutaredoxin S14. Moreover, [4Fe-4S] cluster-bound Nfu2 is shown to be a very rapid and efficient [4Fe-4S]2+ cluster donor for adenosine 5′-phosphosulfate reductase (APR1) and yeast two-hybrid studies indicate that APR1 forms a complex with Nfu2, but not with Nfu1 and Nfu3, the two other chloroplastic Nfu proteins. This cluster transfer is likely to be physiologically relevant and is particularly significant for plant metabolism as APR1 catalyzes the second step in reductive sulfur assimilation which ultimately results in the biosynthesis of cysteine, methionine, glutathione, and Fe-S clusters. PMID:24032747

  10. Chiral Recognition in Molecular and Macromolecular Pairs of(S)- and (R)- 1-Cyano-2-Methylpropyl 4’((4-(8-Vinyloxyoctyloxy)Benzoyl) Biphenyl-4-Carboxylate Enantiomers

    DTIC Science & Technology

    1994-06-30

    above please provide a graphical abstract of the paper ar, return it to the Editorial Office as soon as possible. 4oeg0 o F-99S or TS A& I DTI•’ I J. u1...TCLSICAON 2.LIMITATION OF ABSTRAC •F oFPORT OF THIS PAGE OF ABSTRACT . unclass ified Graphical Abstracts for Perkin Txans. 1 Example TITLE GRAPHICAL ... ABSTRACT AUTHORS’ N AMES Template (S)-II Chiral recognition in molecular and . -- macromolecular pairs of (S)- and -- (R)-i-cyano-2-methyipropyl 4’-{[4

  11. U.S. EPA, Pesticide Product Label, MR. HOLIDAY CALCIUM HYPOCHLORITE, 09/03/1985

    EPA Pesticide Factsheets

    2011-04-19

    ... QrdICfR- IIfT'r (')'rt.~>W!: ~i!"W- \\l'" It(I t,e 1lII\\IICI \\II., De hUI t1 s.~ ,), r, oec 11\\ flitS ~ ~tI ct ~ !"'- iIIl'31:J~ ~!Jet \\.'Id\\I lAd rI/JI:I. ~ ~~~ Ut .... " M:!.t ...

  12. 76 FR 64101 - Filing of Plats of Survey: Oregon/Washington

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-17

    ... September 23, 2011. T. 29 S., R. 8 W., accepted September 23, 2011. T. 40 S., R. 10 E., accepted September..., 2011. T. 26 S., R. 3 W., accepted September 29, 2011. T. 8 S., R. 10 E., accepted September 29, 2011. T..., 2011. T. 10 N., R. 16 E., accepted September 29, 2011. T. 36 N., R. 4 W., accepted September 29, 2011...

  13. Remedial Investigations Report, Phase 2. Volume 4. Appendices Sites P11/P13 and A12/P36/P37, Fort Devens Sudbury Training Annex, Maynard, Massachusetts

    DTIC Science & Technology

    1995-12-01

    Geotechnical Data D Geophysical Surveys E Analysis of QA/QC Program F Aquifer Hydraulic Characterization (Slug Testing) G Groundwater Model Report H...M " f ; Soil/Rock ~ Dataii~ 2!Desc~lpliOn ccl - -GR OUND SURFACE- -~~ MMJrb OMOE U)IF ’G gm~ * t -iG O p& 11 i 1 ’ w //* I M E - F .51"’/j H5As o4 2-e...o fS A D 11tL IN SNE,7f ’(;v ,* , F * It~ .-. 4 1I4O WLD ~*’h4,Ft , T6.r,17,L ’DIULLe8ING NOTa 4 14.6@AO 0w- IUL W 33s - reyce pae A-, 7 1= amd n 01r0r

  14. Measurement of D s + production and nuclear modification factor in Pb-Pb collisions at $$ \\sqrt{{\\mathrm{s}}_{\\mathrm{NN}}}=2.76 $$

    DOE PAGES

    Adam, J.; Adamová, D.; Aggarwal, M. M.; ...

    2016-03-14

    Here, the production of prompt D s + mesons was measured for the first time in collisions of heavy nuclei with the ALICE detector at the LHC. The analysis was performed on a data sample of Pb-Pb collisions at a centre-of-mass energy per nucleon pair, √s NN, of 2.76 TeV in two different centrality classes, namely 0–10% and 20–50%. Ds+ mesons and their antiparticles were reconstructed at mid-rapidity from their hadronic decay channel D s + → Φπ +, with Φ → K –K +, in the transverse momentum intervals 4 < pT < 12GeV/c and 6 < pT 10% and 20–50% centrality classes, respectively. The nuclear modification factor RAA was computed by comparing the pT-differential production yields in Pb-Pb collisions to those in proton-proton (pp) collisions at the same energy. This pp reference was obtained using the cross section measured at √s = 7 TeV and scaled to √s = 2.76 TeV. The RAA of D s + mesons was compared to that of non-strange D mesons in the 10% most central Pb-Pb collisions. At high p T (8 < p T < 12 GeV/c) a suppression of the D s +-meson yield by a factor of about three, compatible within uncertainties with that of non-strange D mesons, is observed. At lower p T (4 < p T < 8 GeV/c) the values of the D s +-meson R AA are larger than those of non-strange D mesons, although compatible within uncertainties. The production ratios D s +/D 0 and D s +/D + were also measured in Pb-Pb collisions and compared to their values in proton-proton collisions.« less

  15. Electronic structure and fragmentation properties of [Fe4S4(SEt)4-x(SSEt)x]2-

    NASA Astrophysics Data System (ADS)

    Fu, You-Jun; Laskin, Julia; Wang, Lai-Sheng

    2007-06-01

    A limited exposure of (n-Bu4N)2[Fe4S4(SEt)4] solutions in acetonitrile to air was found to produce a new series of [4Fe-4S] cluster complexes, [Fe4S4(SEt)4-x(SSEt)x]2- (x = 1-4), with the original -SEt ligands substituted by -SSEt di-sulfide ligands, which were formed due to partial decomposition of the [4Fe-4S] core in parent [Fe4S4(SEt)4]2-. The products were first observed in the experiments with an ESI-ion Trap-TOF mass spectrometer and were further identified using high resolution Fourier transform ion cyclotron resonance (FTICR) mass spectrometer. Photoelectron spectra of the [Fe4S4(SEt)4-x(SSEt)x]2- dianions revealed that the -SSEt coordination induced little change in the electronic structure of the [4Fe-4S] cluster, but the electron binding energies of [Fe4S4(SEt)4-x(SSEt)x]2- increased from 0.52 to 0.73 eV with increase in x from 0 to 4, suggesting a greater electron withdrawing ability of -SSEt than -SEt. In high resolution MS/MS experiments on [Fe4S4(SEt)3(SSEt)]2-/1-, clusters with both charge states yielded fragment [Fe4S4(SEt)3]-, suggesting that -SSEt could be lost either as a negatively charged ion SSEt- from the doubly charged precursor, or as a radical SSEt from the singly charged species. The biological implication of the interaction between [Fe4S4(SEt)4]2- and O2 is discussed in comparison to the air exposure of [4Fe-4S] proteins to the air.

  16. Elektroninės cigaretės: naujas būdas mesti rūkyti ar nauja grėsmė?

    PubMed Central

    Aleknaitė, Aistė; Andrijauskaitė, Monika; Latauskienė, Justė; Andrejevaitė, Viktorija

    2016-01-01

    Nuo 2010 m. tarp suaugusiųjų ir paauglių išaugo elektroninių cigarečių vartojimas. Dauguma el. cigarečių vartotojų anksčiau yra rūkę tradicinius tabako gaminius. Didžioji dalis žmonių el. cigaretes suvokia kaip priemonę, padėsiančią mesti rūkyti ar sumažinti surūkomų įprastinių cigarečių kiekį. Elektroninės cigaretės yra prietaisas, susidedantis iš skysčiu užpildytos kasetės, kaitiklio bei baterijos. Nuspaudus mygtuką įjungiamas kaitiklis, kuris šildo skystį, o, šiam tapus garais, jie įkvepiami. Visų rūšių el. skysčių pagrindinės sudedamosios dalys yra glicerolis arba propileno glikolis, papildomai gali būti pridedama nikotino ir / ar aromatų. Skysčiuose taip pat nustatyta įvairių kitų cheminių medžiagų. Ilgalaikio el. cigarečių vartojimo pasekmės sveikatai nėra išaiškintos, manoma, kad jos turėtų būti saugesnės nei rūkyti įprastines cigaretes. Nėra pakankamai ištirtas el. cigarečių skysčiuose esančių medžiagų toksiškumas. Trūksta duomenų apie el. cigarečių, kaip pagalbinės priemonės norint mesti rūkyti, veiksmingumą ir saugumą. Gydytojas norinčiam mesti rūkyti pacientui pirmiausia turėtų pasiūlyti patvirtintas pakaitinės nikotino terapijos ar kitas pagalbines priemones ir užtikrinti, kad pacientas gautų informaciją apie naujausius medikamentus, galinčius jam padėti. Jei pacientas atsisako šių priemonių ir renkasi el. cigaretes, gydytojas turėtų informuoti apie abejotiną jų saugumą ir veiksmingumą. Visuomenėje kyla susirūpinimas, kad el. cigarečių rūkymas gali paskatinti priklausomybę nikotinui ir padidinti norą išbandyti įprastines cigaretes. Nerimą kelia ir neapribotas el. cigarečių vartojimas viešosiose vietose. Nėra žinoma, kokią įtaką aplinkinių sveikatai gali turėti pasyvus garinimas. El. cigarečių reglamentavimas visame pasaulyje skiriasi ir laikui bėgant kinta. PMID:28356791

  17. T.D.S. spectroscopic databank for spherical tops: DOS version

    NASA Astrophysics Data System (ADS)

    Tyuterev, V. G.; Babikov, Yu. L.; Tashkun, S. A.; Perevalov, V. I.; Nikitin, A.; Champion, J.-P.; Wenger, C.; Pierre, C.; Pierre, G.; Hilico, J.-C.; Loete, M.

    1994-10-01

    T.D.S. (Traitement de Donnees Spectroscopiques or Tomsk-Dijon-Spectroscopy project) is a computer package concerned with high resolution spectroscopy of spherical top molecules like CH4, CF4, SiH4, SiF4, SnH4, GeH4, SF6, etc. T.D.S. contains information, fundamental spectroscopic data (energies, transition moments, spectroscopic constants) recovered from comprehensive modeling and simultaneous fitting of experimental spectra, and associated software written in C. The T.D.S. goal is to provide an access to all available information on vibration-rotation molecular states and transitions including various spectroscopic processes (Stark, Raman, etc.) under extended conditions based on extrapolations of laboratory measurements using validated theoretical models. Applications for T.D.S. may include: education/training in molecular physics, quantum chemistry, laser physics; spectroscopic applications (analysis, laser spectroscopy, atmospheric optics, optical standards, spectroscopic atlases); applications to environment studies and atmospheric physics (remote sensing); data supply for specific databases; and to photochemistry (laser excitation, multiphoton processes). The reported DOS-version is designed for IBM and compatible personal computers.

  18. TRF2 Recruits RTEL1 to Telomeres in S Phase to Promote T-Loop Unwinding

    PubMed Central

    Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John H.J.; Boulton, Simon J.

    2015-01-01

    Summary The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to prevent catastrophic t-loop processing by structure-specific nucleases. We show that the TRF2-RTEL1 interaction is mediated by a metal-coordinating C4C4 motif in RTEL1, which is compromised by the Hoyeraal-Hreidarsson syndrome (HHS) mutation, RTEL1R1264H. Conversely, we define a TRF2I124D substitution mutation within the TRFH domain of TRF2, which eliminates RTEL1 binding and phenocopies the RTEL1R1264H mutation, giving rise to aberrant t-loop excision, telomere length heterogeneity, and loss of the telomere as a circle. These results implicate TRF2 in the recruitment of RTEL1 to facilitate t-loop disassembly at telomeres in S phase. PMID:25620558

  19. TRF2 recruits RTEL1 to telomeres in S phase to promote t-loop unwinding.

    PubMed

    Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John H J; Boulton, Simon J

    2015-02-19

    The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to prevent catastrophic t-loop processing by structure-specific nucleases. We show that the TRF2-RTEL1 interaction is mediated by a metal-coordinating C4C4 motif in RTEL1, which is compromised by the Hoyeraal-Hreidarsson syndrome (HHS) mutation, RTEL1(R1264H). Conversely, we define a TRF2(I124D) substitution mutation within the TRFH domain of TRF2, which eliminates RTEL1 binding and phenocopies the RTEL1(R1264H) mutation, giving rise to aberrant t-loop excision, telomere length heterogeneity, and loss of the telomere as a circle. These results implicate TRF2 in the recruitment of RTEL1 to facilitate t-loop disassembly at telomeres in S phase. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  20. [Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia].

    PubMed

    Dzhemileva, L U; Posukh, O L; Tazetdinov, A M; Barashkov, N A; Zhuravskiĭ, S G; Ponidelko, S N; Markova, T G; Tadinova, V N; Fedorova, S A; Maksimova, N R; Khusnutdinova, E K

    2009-07-01

    Mitochondrial DNA (mtDNA) mutations play an important role in etiology of hereditary hearing loss. In various regions of the world, patients suffer from nonsyndromic sensorineural hearing loss initiated by aminoglycoside antibiotics. Mutations that had been shown as pathogenetically important for hearing function disturbance were identified in mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes while pathogenic role of several DNA sequences requires additional studies. This work presents the results of studying the spectrum of mutations and polymorphic variations in mtDNA genes 12S rRNA and tRNA(Ser(UGN)) in 410 patients with nonsyndromal sensoneural hearing impairment/loss from the Volga Ural region, St Petersburg, Yakutia, and Altai and in 520 individuals with normal hearing, which represent several ethnic groups (Russians, Tatars, Bashkirs, Yakuts, Altaians) residing in the Russian Federation. Pathogenetically significant mutation A1555G (12S rRNA) was found in two families (from Yakutia and St Peresburg) with hearing loss, probably caused by treatment with aminoglucosides, and in the population sample of Yakuts with a frequency of 0.83%. Further research is needed to confirm the role in hearing impairment of mutations 961insC, 961insC(n), 961delTinsC(n), T961G, T1095C (12S rRNA) and G7444A, A7445C (tRNA(Ser(UGN revealed in the patients. In addition, in the patients and the population groups, polymorphic mt DNA variants were detected, which are characteristic also of other Eurasian populations both in spectrum and frequency.

  1. Measurement of jet p T correlations in Pb + Pb and pp collisions at s NN = 2.76   TeV with the ATLAS detector

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aaboud, M.; Aad, G.; Abbott, B.

    Here, measurements of dijet correlations in Pb + Pb and pp collisions at a nucleon–nucleon centre-of-mass energy of √ sNN = 2.76TeV are presented. The measurements are performed with the ATLAS detector at the Large Hadron Collider using Pb + Pb and pp data samples corresponding to integrated luminosities of 0.14nb –1 and 4.0pb –1, respectively. Jets are reconstructed using the anti-κ t algorithm with radius parameter values R = 0.3 and R = 0.4. A background subtraction procedure is applied to correct the jets for the large underlying event present in Pb + Pb collisions. The leading and sub-leadingmore » jet transverse momenta are denoted p T1 and p T2. An unfolding procedure is applied to the two-dimensional ( p T1, p T2) distributions to account for experimental effects in the measurement of both jets.« less

  2. Measurement of jet p T correlations in Pb + Pb and pp collisions at s NN = 2.76   TeV with the ATLAS detector

    DOE PAGES

    Aaboud, M.; Aad, G.; Abbott, B.; ...

    2017-09-29

    Here, measurements of dijet correlations in Pb + Pb and pp collisions at a nucleon–nucleon centre-of-mass energy of √ sNN = 2.76TeV are presented. The measurements are performed with the ATLAS detector at the Large Hadron Collider using Pb + Pb and pp data samples corresponding to integrated luminosities of 0.14nb –1 and 4.0pb –1, respectively. Jets are reconstructed using the anti-κ t algorithm with radius parameter values R = 0.3 and R = 0.4. A background subtraction procedure is applied to correct the jets for the large underlying event present in Pb + Pb collisions. The leading and sub-leadingmore » jet transverse momenta are denoted p T1 and p T2. An unfolding procedure is applied to the two-dimensional ( p T1, p T2) distributions to account for experimental effects in the measurement of both jets.« less

  3. Crystal structures of bis-[(9S,13S,14S)-3-meth-oxy-17-methyl-morphinanium] tetra-chlorido-cobaltate and tetra-chlorido-cuprate.

    PubMed

    Gauchat, Eric; Nazarenko, Alexander Y

    2017-01-01

    (9 S ,13 S ,14 S )-3-Meth-oxy-17-methyl-morphinan (dextromethorphan) forms two isostructural salts with ( a ) tetra-chlorido-cobaltate, namely bis-[(9 S ,13 S ,14 S )-3-meth-oxy-17-methyl-morphinanium] tetra-chlorido-cobaltate, (C 18 H 26 NO) 2 [CoCl 4 ], and ( b ) tetra-chlorido-cuprate, namely bis-[(9 S ,13 S ,14 S )-3-meth-oxy-17-methyl-morphinanium] tetra-chlorido-cuprate, (C 18 H 26 NO) 2 [CuCl 4 ]. The distorted tetra-hedral anions are located on twofold rotational axes. The dextromethorphan cation can be described as being composed of two ring systems, a tetra-hydro-naphthalene system A + B and a deca-hydro-isoquinolinium subunit C + D , that are nearly perpendicular to one another: the angle between mean planes of the A + B and C + D moieties is 78.8 (1)° for ( a ) and 79.0 (1)° for ( b ). Two symmetry-related cations of protonated dextromethorphan are connected to the tetra-chlorido-cobaltate (or tetra-chlorido-cuprate) anions via strong N-H⋯Cl hydrogen bonds, forming neutral ion associates. These associates are packed in the (001) plane with no strong attractive bonding between them. Both compounds are attractive crystalline forms for unambiguous identification of the dextromethorphan and, presumably, of its optical isomer, levomethorphan.

  4. Identification of butyrylcholinesterase adducts after inhibition with isomalathion using mass spectrometry: difference in mechanism between (1R)- and (1S)-stereoisomers.

    PubMed

    Doorn, J A; Schall, M; Gage, D A; Talley, T T; Thompson, C M; Richardson, R J

    2001-10-15

    Previous kinetic studies found that butyrylcholinesterase (BChE) inhibited by (1R)-isomalathions readily reactivated, while enzyme inactivated by (1S)-isomers did not. This study tested the hypothesis that (1R)- and (1S)-isomers inhibit BChE by different mechanisms, yielding distinct adducts identifiable by peptide mass mapping with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Equine BChE (EBChE) was inhibited to <10% of control activity with each isomer of isomalathion and the reference compound isoparathion methyl. Control and treated enzyme was digested with trypsin, and peptides were fractionated with HPLC. Separated and unseparated peptides were analyzed with MALDI-TOF-MS. Identity of an organophosphorus peptide adduct was confirmed by fragmentation using postsource decay analysis. EBChE inhibited by (1R)-isomalathions or (S)-isoparathion methyl readily reactivated after oxime treatment with 30-40% activity recovered. Enzyme inactivated by (1S)-isomalathions or (R)-isoparathion methyl recovered <2% and <5% activity, respectively, after oxime treatment. MALDI-TOF-MS analysis revealed that inhibition of EBChE by (1R)-isomalathions and (R)- or (S)-isoparathion methyl yielded O,S-dimethyl phosphate adducts. Enzyme inactivated by (1S)-isomalathions produced only O-methyl phosphate adduct. EBChE modified by (1R)-isomalathions or either enantiomer of isoparathion methyl yielded an O-methyl phosphate adduct as well. The results indicate that EBChE inhibition by (1R)-isomalathions proceeds with loss of diethyl thiosuccinate, but inactivation by (1S)-isomers occurs with loss of thiomethyl as the primary leaving group followed by rapid expulsion of diethyl thiosuccinate to yield an aged enzyme. Furthermore, the data suggest that aging of the O,S-dimethyl phosphate adduct occurs via an S(N)2 process with loss of thiomethyl. Copyright 2001 Academic Press.

  5. Evidence for e + e - → γ η c ( 1 S ) at center-of-mass energies between 4.01 and 4.60 GeV

    DOE PAGES

    Ablikim, M.; Achasov, M. N.; Ahmed, S.; ...

    2017-09-06

    In this paper, we present first evidence for the process e +e - → γη c(1S) at six center-of-mass energies between 4.01 and 4.60 GeV using data collected by the BESIII experiment operating at BEPCII. We measure the Born cross section at each energy using a combination of twelve η c(1S) decay channels. We also combine all six energies under various assumptions for the energy-dependence of the cross section. Finally, if the process is assumed to proceed via the Y (4260), we measure a peak Born cross section σ peak (e +e - → γη c(1S)) = 2.11 ± 0.49(stat.)more » ± 0.36(syst.) pb with a statistical significance of 4.2σ.« less

  6. Evidence for e + e - → γ η c ( 1 S ) at center-of-mass energies between 4.01 and 4.60 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ablikim, M.; Achasov, M. N.; Ahmed, S.

    In this paper, we present first evidence for the process e +e - → γη c(1S) at six center-of-mass energies between 4.01 and 4.60 GeV using data collected by the BESIII experiment operating at BEPCII. We measure the Born cross section at each energy using a combination of twelve η c(1S) decay channels. We also combine all six energies under various assumptions for the energy-dependence of the cross section. Finally, if the process is assumed to proceed via the Y (4260), we measure a peak Born cross section σ peak (e +e - → γη c(1S)) = 2.11 ± 0.49(stat.)more » ± 0.36(syst.) pb with a statistical significance of 4.2σ.« less

  7. Anisotropy of cosmic rays above 10(14) eV

    NASA Technical Reports Server (NTRS)

    Wdowczyk, J.; Wolfendale, A. W.

    1985-01-01

    A survey is made of the anisotropy of cosmic rays at energies above 10 to the 14th power eV. It is concluded that cosmic gamma-rays may have an effect in the range 10 to the 14 power - 10 to the 16th power eV, above which protons dominate. Evidence is presented for an excess in the general direction of the Galactic plane which grows with increasing energy until about 10 to the 19th power eV, indicating a Galactic origin for these particles. At higher energies an Extragalactic origin is indicated.

  8. 48 CFR 52.203-14 - Display of Hotline Poster(s).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 2 2013-10-01 2013-10-01 false Display of Hotline Poster... Clauses 52.203-14 Display of Hotline Poster(s). As prescribed in 3.1004(b), insert the following clause: Display of Hotline Poster(s) (DEC 2007) (a) Definition. United States, as used in this clause, means the...

  9. 48 CFR 52.203-14 - Display of Hotline Poster(s).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Display of Hotline Poster... Clauses 52.203-14 Display of Hotline Poster(s). As prescribed in 3.1004(b), insert the following clause: Display of Hotline Poster(s) (DEC 2007) (a) Definition. United States, as used in this clause, means the...

  10. 48 CFR 52.203-14 - Display of Hotline Poster(s).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 2 2011-10-01 2011-10-01 false Display of Hotline Poster... Clauses 52.203-14 Display of Hotline Poster(s). As prescribed in 3.1004(b), insert the following clause: Display of Hotline Poster(s) (DEC 2007) (a) Definition. United States, as used in this clause, means the...

  11. 48 CFR 52.203-14 - Display of Hotline Poster(s).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 2 2014-10-01 2014-10-01 false Display of Hotline Poster... Clauses 52.203-14 Display of Hotline Poster(s). As prescribed in 3.1004(b), insert the following clause: Display of Hotline Poster(s) (DEC 2007) (a) Definition. United States, as used in this clause, means the...

  12. 48 CFR 52.203-14 - Display of Hotline Poster(s).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 2 2012-10-01 2012-10-01 false Display of Hotline Poster... Clauses 52.203-14 Display of Hotline Poster(s). As prescribed in 3.1004(b), insert the following clause: Display of Hotline Poster(s) (DEC 2007) (a) Definition. United States, as used in this clause, means the...

  13. Biofidelic Three-Dimensional Brain Surrogate Models of mTBI-Induced Alzheimer’s Disease Pathology

    DTIC Science & Technology

    2016-10-01

    incurred during combat in Vietnam by US forces, Acta Chir. Scand. Suppl. 508 (1981) 351–356. [10] J. Grafman, B.S. Jonas, A. Martin , A.M. Salazar, H...29 (16) (2012) 2564–2575. [92] B.R. Huber, J.S. Meabon, T.J. Martin , P.D. Mourad, R. Bennett, B.C. Kraemer, I. Cernak, E.C. Petrie, M.J. Emery, E.R...cerebral vasculature to blast injury in a rat model of mild traumatic brain injury, Acta Neuropathol. Commun. 2 (1) (2014) 1. [122] J.M. Petras , R.A

  14. Word Frequency Analysis MOS: 11H. Skill Levels 1 & 2.

    DTIC Science & Technology

    1981-05-01

    I k,4 L t qs 1’ F £U 19 L ’A T 19 5 S r4 19 SQUARE I 1 I i f1 ,41 0 ItLf tD ;- 1 ASSEMBLY ILtl LI’IC 0 iA!,A (.E laID Is EVERY T IC :,.% .IMUtl I nXT...1iwl15ll’G 2 1 ULEUTLR 2 uORtRNfC 2 ’L’ i ,T,.10 2 L 4:.E/14JSH 2p Ls , 01 -.A’LM NT 2 L:’ ZfOET t Te 2~ LI V1 2AL 2 L- E1𔄃TLC2 LA 2 -i’ A JAJ , At 2...11 9 .4’? S ~P ’~II9 1.$ S3 C,: y.T! ON 1; 1 LT 1:1:%L r c " tD S; FI IL 9 1,0q 9 Pq 1 !’. 9 rrInT P. ’"JlLL0 1;1 9; k.I..) J I Ptr1.CS I 9 t,! ’U1E

  15. The external pore loop interacts with S6 and S3-S4 linker in domain 4 to assume an essential role in gating control and anticonvulsant action in the Na+ channel

    PubMed Central

    Yang, Ya-Chin; Hsieh, Jui-Yi

    2009-01-01

    Carbamazepine, phenytoin, and lamotrigine are widely prescribed anticonvulsants in neurological clinics. These drugs bind to the same receptor site, probably with the diphenyl motif in their structure, to inhibit the Na+ channel. However, the location of the drug receptor remains controversial. In this study, we demonstrate close proximity and potential interaction between an external aromatic residue (W1716 in the external pore loop) and an internal aromatic residue (F1764 in the pore-lining part of the sixth transmembrane segment, S6) of domain 4 (D4), both being closely related to anticonvulsant and/or local anesthetic binding to the Na+ channel. Double-mutant cycle analysis reveals significant cooperativity between the two phenyl residues for anticonvulsant binding. Concomitant F1764C mutation evidently decreases the susceptibility of W1716C to external Cd2+ and membrane-impermeable methanethiosulfonate reagents. Also, the W1716E/F1764R and G1715E/F1764R double mutations significantly alter the selectivity for Na+ over K+ and markedly shift the activation curve, respectively. W1716 and F1764 therefore very likely form a link connecting the outer and inner compartments of the Na+ channel pore (in addition to the selectivity filter). Anticonvulsants and local anesthetics may well traverse this “S6 recess” without trespassing on the selectivity filter. Furthermore, we found that Y1618K, a point mutation in the S3-4 linker (the extracellular extension of D4S4), significantly alters the consequences of carbamazepine binding to the Na+ channel. The effect of Y1618K mutation, however, is abolished by concomitant point mutations in the vicinity of Y1618, but not by those in the internally located inactivation machinery, supporting a direct local rather than a long-range allosteric action. Moreover, Y1618 could interact with D4 pore residues W1716 and L1719 to have a profound effect on both channel gating and anticonvulsant action. We conclude that there are direct

  16. The external pore loop interacts with S6 and S3-S4 linker in domain 4 to assume an essential role in gating control and anticonvulsant action in the Na(+) channel.

    PubMed

    Yang, Ya-Chin; Hsieh, Jui-Yi; Kuo, Chung-Chin

    2009-08-01

    Carbamazepine, phenytoin, and lamotrigine are widely prescribed anticonvulsants in neurological clinics. These drugs bind to the same receptor site, probably with the diphenyl motif in their structure, to inhibit the Na(+) channel. However, the location of the drug receptor remains controversial. In this study, we demonstrate close proximity and potential interaction between an external aromatic residue (W1716 in the external pore loop) and an internal aromatic residue (F1764 in the pore-lining part of the sixth transmembrane segment, S6) of domain 4 (D4), both being closely related to anticonvulsant and/or local anesthetic binding to the Na(+) channel. Double-mutant cycle analysis reveals significant cooperativity between the two phenyl residues for anticonvulsant binding. Concomitant F1764C mutation evidently decreases the susceptibility of W1716C to external Cd(2+) and membrane-impermeable methanethiosulfonate reagents. Also, the W1716E/F1764R and G1715E/F1764R double mutations significantly alter the selectivity for Na(+) over K(+) and markedly shift the activation curve, respectively. W1716 and F1764 therefore very likely form a link connecting the outer and inner compartments of the Na(+) channel pore (in addition to the selectivity filter). Anticonvulsants and local anesthetics may well traverse this "S6 recess" without trespassing on the selectivity filter. Furthermore, we found that Y1618K, a point mutation in the S3-4 linker (the extracellular extension of D4S4), significantly alters the consequences of carbamazepine binding to the Na(+) channel. The effect of Y1618K mutation, however, is abolished by concomitant point mutations in the vicinity of Y1618, but not by those in the internally located inactivation machinery, supporting a direct local rather than a long-range allosteric action. Moreover, Y1618 could interact with D4 pore residues W1716 and L1719 to have a profound effect on both channel gating and anticonvulsant action. We conclude that there

  17. Bulk superconductivity in bismuth oxysulfide Bi4O4S3.

    PubMed

    Singh, Shiva Kumar; Kumar, Anuj; Gahtori, Bhasker; Shruti; Sharma, Gyaneshwar; Patnaik, Satyabrata; Awana, Veer P S

    2012-10-10

    A very recent report on the observation of superconductivity in Bi(4)O(4)S(3) [Mizuguchi, Y.; http://arxiv.org/abs/1207.3145] could potentially reignite the search for superconductivity in a broad range of layered sulfides. We report here the synthesis of Bi(4)O(4)S(3) at 500 °C by a vacuum encapsulation technique and its basic characterizations. The as-synthesized Bi(4)O(4)S(3) was contaminated with small amounts of Bi(2)S(3) and Bi impurities. The majority phase was found to be tetragonal (space group I4/mmm) with lattice parameters a = 3.9697(2) Å and c = 41.3520(1) Å. Both AC and DC magnetization measurements confirmed that Bi(4)O(4)S(3) is a bulk superconductor with a superconducting transition temperature (T(c)) of 4.4 K. Isothermal magnetization (M-H) measurements indicated closed loops with clear signatures of flux pinning and irreversible behavior. The lower critical field (H(c1)) at 2 K for the new superconductor was found to be ~15 Oe. Magnetotransport measurements showed a broadening of the resistivity (ρ) and a decrease in T(c) (ρ = 0) with increasing magnetic field. The extrapolated upper critical field H(c2)(0) was ~31 kOe with a corresponding Ginzburg-Landau coherence length of ~100 Å . In the normal state, the ρ ~ T(2) dependence was not indicated. Hall resistivity data showed a nonlinear magnetic field dependence. Our magnetization and electrical transport measurements substantiate the appearance of bulk superconductivity in as-synthesized Bi(4)O(4)S(3). On the other hand, Bi heat-treated at the same temperature is not superconducting, thus excluding the possibility of impurity-driven superconductivity in the newly discovered superconductor Bi(4)O(4)S(3).

  18. Core body temperature during competition in the heat: National Boys' 14s Junior Championships.

    PubMed

    Bergeron, Michael F; McLeod, Kathryn S; Coyle, John F

    2007-11-01

    To examine on-court core body temperature (T(C)) and sweat loss, as well as pre- and post-play hydration status, in elite adolescent tennis players during a national championships event in a hot climate. Eight healthy, fit, young male tennis players (mean (SD) age 13.9 (0.9) years; mass 56.0 (10.7) kg; height 169.2 (14.7) cm) were evaluated during first-round singles competition at the National Boys' 14s Junior Championships in the heat (wet-bulb globe temperature (WBGT) 29.6 (0.4) degrees C). Five of those same players were also evaluated during a same-day doubles match (WBGT 31.3 (0.5) degrees C). During doubles (4.37 (0.35) h after singles), pre-play urine specific gravity (USG) (1.025 (0.002); p = 0.06) and total sweat loss (1.9 (0.2) litres; p = 0.10) tended to be higher before and during doubles, respectively, compared to singles. However, percentage change in body mass (-0.5 (0.3) %) tended to be comparatively less (p = 0.08), even though the doubles matches were generally longer (106.6 (11.2) vs 78.8 (10.9) min; p = 0.09) and the degree minutes total was greater (p = 0.04). T(C) increased (p<0.001) during singles and remained elevated, even after 10 min following the end of play. Notably, pre-play (singles) USG was strongly associated (p = 0.005) with the players' final T(C) (38.7 (0.3) degrees C) recorded at the end of singles play. Junior tennis players who begin a match not well hydrated could have progressively increasing thermal strain and a greater risk for exertional heat illness as the match advances.

  19. Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae.

    PubMed

    Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

    2018-05-18

    The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.

  20. U.S. EPA, Pesticide Product Label, RCI CHLOROPHEN 49-411, 10/05/1972

    EPA Pesticide Factsheets

    2011-04-14

    ... factory for n!ost uses ot.her th;111 s:l('ci fic:ltion v;()cd prC'scr\\-ut ion. ... ',' t j. , 1 " ( : j', ~ ) I: I, din :', u n () II t 11 '... ... r}' and \\\\' (' lIs (' d S (l ned fen ce post ...