Sample records for t7 expression vector
-
Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
2017-12-16
To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).
-
Nakashima, N; Tamura, T
2013-06-01
Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.
-
Di Bonito, Paola; Chiozzini, Chiara; Arenaccio, Claudia; Anticoli, Simona; Manfredi, Francesco; Olivetta, Eleonora; Ferrantelli, Flavia; Falcone, Emiliana; Ruggieri, Anna; Federico, Maurizio
2017-01-01
We recently proved that exosomes engineered in vitro to deliver high amounts of HPV E7 upon fusion with the Nef mut exosome-anchoring protein elicit an efficient anti-E7 cytotoxic T lymphocyte immune response. However, in view of a potential clinic application of this finding, our exosome-based immunization strategy was faced with possible technical difficulties including industrial manufacturing, cost of production, and storage. To overcome these hurdles, we designed an as yet unproven exosome-based immunization strategy relying on delivery by intramuscular inoculation of a DNA vector expressing Nef mut fused with HPV E7. In this way, we predicted that the expression of the Nef mut /E7 vector in muscle cells would result in a continuous source of endogenous (ie, produced by the inoculated host) engineered exosomes able to induce an E7-specific immune response. To assess this hypothesis, we first demonstrated that the injection of a Nef mut /green fluorescent protein-expressing vector led to the release of fluorescent exosomes, as detected in plasma of inoculated mice. Then, we observed that mice inoculated intramuscularly with a vector expressing Nef mut /E7 developed a CD8 + T-cell immune response against both Nef and E7. Conversely, no CD8 + T-cell responses were detected upon injection of vectors expressing either the wild-type Nef isoform of E7 alone, most likely a consequence of their inefficient exosome incorporation. The production of immunogenic exosomes in the DNA-injected mice was formally demonstrated by the E7-specific CD8 + T-cell immune response we detected in mice inoculated with exosomes isolated from plasma of mice inoculated with the Nef mut /E7 vector. Finally, we provide evidence that the injection of Nef mut /E7 DNA led to the generation of effective antigen-specific cytotoxic T lymphocytes whose activity was likely part of the potent, therapeutic antitumor effect we observed in mice implanted with TC-1 tumor cells. In summary, we established a novel method to generate immunogenic exosomes in vivo by the intramuscular inoculation of DNA vectors expressing the exosome-anchoring protein Nef mut and its derivatives.
-
Engineering T7 bacteriophage as a potential DNA vaccine targeting delivery vector.
Xu, Hai; Bao, Xi; Wang, Yiwei; Xu, Yue; Deng, Bihua; Lu, Yu; Hou, Jibo
2018-03-20
DNA delivery with bacteriophage by surface-displayed mammalian cell penetrating peptides has been reported. Although, various phages have been used to facilitate DNA transfer by surface displaying the protein transduction domain of human immunodeficiency virus type 1 Tat protein (Tat peptide), no similar study has been conducted using T7 phage. In this study, we engineeredT7 phage as a DNA targeting delivery vector to facilitate cellular internalization. We constructed recombinant T7 phages that displayed Tat peptide on their surface and carried eukaryotic expression box (EEB) as a part of their genomes (T7-EEB-Tat). We demonstrated that T7 phage harboring foreign gene insertion had packaged into infective progeny phage particles. Moreover, when mammalian cells that were briefly exposed to T7-EEB-Tat, expressed a significant higher level of the marker gene with the control cells infected with the wide type phage without displaying Tat peptides. These data suggested that the potential of T7 phage as an effective delivery vector for DNA vaccine transfer.
-
A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter
Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang
2009-01-01
RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553
-
Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A
2009-12-30
Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.
-
2009-01-01
Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112
-
Sánchez-Sampedro, L; Mejías-Pérez, E; S Sorzano, Carlos Óscar; Nájera, J L; Esteban, M
2016-07-15
The NYVAC poxvirus vector is used as vaccine candidate for HIV and other diseases, although there is only limited experimental information on its immunogenicity and effectiveness for use against human pathogens. Here we defined the selective advantage of NYVAC vectors in a mouse model by comparing the immune responses and protection induced by vectors that express the LACK (Leishmania-activated C-kinase antigen), alone or with insertion of the viral host range gene C7L that allows the virus to replicate in human cells. Using DNA prime/virus boost protocols, we show that replication-competent NYVAC-LACK that expresses C7L (NYVAC-LACK-C7L) induced higher-magnitude polyfunctional CD8(+) and CD4(+) primary adaptive and effector memory T cell responses (IFNγ, TNFα, IL-2, CD107a) to LACK antigen than non-replicating NYVAC-LACK. Compared to NYVAC-LACK, the NYVAC-LACK-C7L-induced CD8(+) T cell population also showed higher proliferation when stimulated with LACK antigen. After a challenge by subcutaneous Leishmania major metacyclic promastigotes, NYVAC-LACK-C7L-vaccinated mouse groups showed greater protection than the NYVAC-LACK-vaccinated group. Our results indicate that the type and potency of immune responses induced by LACK-expressing NYVAC vectors is improved by insertion of the C7L gene, and that a replication-competent vector as a vaccine renders greater protection against a human pathogen than a non-replicating vector. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard
2017-06-06
Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.
-
Oliveira-Souza, Wellington P; Bronze, Fellipe; Broos, Jaap; Marcondes, Marcelo F M; Oliveira, Vitor
2017-10-21
Biosynthetic incorporation of non-canonic amino acids is an attractive strategy to introduce new properties in recombinant proteins. Trp analogs can be incorporated in recombinant proteins replacing regular Trp during protein translation into a Trp-auxotrophic cell host. This straightforward method however, is limited to few analogs recognized and accepted by the cellular protein production machinery. 5-hydroxy-tryptophan (5OH-Trp) can be bio-incorporated using E. coli as expression host however; we have experienced very low incorporation yields - amount of protein containing regular Trp/amount of protein containing the Trp analog - during expressions of 5OH-Trp labeled proteins. Furthermore, this low incorporation yield were verified especially when the widely-used vectors based on the T7 RNA polymerase were used. Testing different 5OH-Trp incorporation protocols we verified that in these T7-based systems, the production of the T7 RNA polymerase is driven by the same elements - lac promoter/IPTG - as the target protein. Consequently, the bio-incorporation of the 5OH-Trp residues also occurs in this crucial enzyme, but, the produced T7 RNA polymerase labeled with 5OH-Trp is inactive or much less active. In the present work, we describe an efficient method to overcome this mentioned problem and bio-incorporate 5OH-Trp in proteins expressed in E. coli., using vectors based on the T7 RNA polymerase-T7 promoter. The two-step induction protocol here described showed incorporation efficiencies of 5OH-Trp higher than 90%. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Singh, Shailbala; Toro, Haroldo; Tang, De-Chu; Briles, Worthie E.; Yates, Linda M.; Kopulos, Renee T.; Collisson, Ellen W.
2010-01-01
Avian influenza virus (AIV) specific CD8+ T lymphocyte responses stimulated by intramuscular administration of an adenovirus (Ad) vector expressing either HA or NP were evaluated in chickens following ex vivo stimulation by non-professional antigen presenting cells. The CD8+ T lymphocyte responses were AIV specific, MHC-I restricted, and cross-reacted with heterologousH7N2 AIV strain. Specific effector responses, at 10 days post-inoculation (p.i.), were undetectable at 2 weeks p.i., and memory responses were detected from 3 to 8 weeks p.i. Effector memory responses, detected 1 week following a booster inoculation, were significantly greater than the primary responses and, within 7 days, declined to undetectable levels. Inoculation of an Ad-vector expressing human NP resulted in significantly greater MHC restricted, activation of CD8+ T cell responses specific for AIV. Decreases in all responses with time were most dramatic with maximum activation of T cells as observed following effector and effector memory responses. PMID:20557918
-
Mathison, Megumi; Singh, Vivek P; Chiuchiolo, Maria J; Sanagasetti, Deepthi; Mao, Yun; Patel, Vivekkumar B; Yang, Jianchang; Kaminsky, Stephen M; Crystal, Ronald G; Rosengart, Todd K
2017-02-01
The reprogramming of cardiac fibroblasts into induced cardiomyocyte-like cells improves ventricular function in myocardial infarction models. Only integrating persistent expression vectors have thus far been used to induce reprogramming, potentially limiting its clinical applicability. We therefore tested the reprogramming potential of nonintegrating, acute expression adenoviral (Ad) vectors. Ad or lentivirus vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) were validated in vitro. Sprague-Dawley rats then underwent coronary ligation and Ad-mediated administration of vascular endothelial growth factor to generate infarct prevascularization. Three weeks later, animals received Ad or lentivirus encoding G, M, or T (AdGMT or LentiGMT) or an equivalent dose of a null vector (n = 11, 10, and 10, respectively). Outcomes were analyzed by echocardiography, magnetic resonance imaging, and histology. Ad and lentivirus vectors provided equivalent G, M, and T expression in vitro. AdGMT and LentiGMT both likewise induced expression of the cardiomyocyte marker cardiac troponin T in approximately 6% of cardiac fibroblasts versus <1% cardiac troponin T expression in AdNull (adenoviral vector that does not encode a transgene)-treated cells. Infarcted myocardium that had been treated with AdGMT likewise demonstrated greater density of cells expressing the cardiomyocyte marker beta myosin heavy chain 7 compared with AdNull-treated animals. Echocardiography demonstrated that AdGMT and LentiGMT both increased ejection fraction compared with AdNull (AdGMT: 21% ± 3%, LentiGMT: 14% ± 5%, AdNull: -0.4% ± 2%; P < .05). Ad vectors are at least as effective as lentiviral vectors in inducing cardiac fibroblast transdifferentiation into induced cardiomyocyte-like cells and improving cardiac function in postinfarct rat hearts. Short-term expression Ad vectors may represent an important means to induce cardiac cellular reprogramming in humans. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.
-
Chen, X; Li, Y; Xiong, K; Wagner, T E
1994-01-01
A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020
-
Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John
2010-06-20
We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.
-
Inhibition of IGF1-R overcomes IGFBP7-induced chemotherapy resistance in T-ALL.
Bartram, Isabelle; Erben, Ulrike; Ortiz-Tanchez, Jutta; Blunert, Katja; Schlee, Cornelia; Neumann, Martin; Heesch, Sandra; Baldus, Claudia D
2015-10-08
T-cell acute lymphoblastic leukemia (T-ALL) is a genetically heterogeneous disease with the need for treatment optimization. Previously, high expression of Insulin-like growth factor binding protein 7 (IGFBP7), a member of the IGF system, was identified as negative prognostic factor in adult T-ALL patients. Since aberrant IGFBP7 expression was observed in a variety of neoplasia and was relevant for prognosis in T-ALL, we investigated the functional role of IGFBP7 in Jurkat and Molt-4 cells as in vitro models for T-ALL. Jurkat and Molt-4 cells were stably transfected with an IGFBP7 over-expression vector or the empty vector as control. Proliferation of the cells was assessed by WST-1 assays and cell cycle status was measured by flow-cytometry after BrDU/7-AAD staining. The effect of IGFBP7 over-expression on sensitivity to cytostatic drugs was determined in AnnexinV/7-AAD assays. IGF1-R protein expression was measured by Western Blot and flow-cytometric analysis. IGF1-R associated gene expression profiles were generated from microarray gene expression data of 86 T-ALL patients from the Microarrays Innovations in Leukemia (MILE) multicenter study. IGFBP7-transfected Jurkat cells proliferated less, leading to a longer survival in a nutrient-limited environment. Both IGFBP7-transfected Jurkat and Molt-4 cells showed an arrest in the G0/G1 cell cycle phase. Furthermore, Jurkat IGFBP7-transfected cells were resistant to vincristine and asparaginase treatment. Surface expression and whole protein measurement of IGF1-R protein expression showed a reduced abundance of the receptor after IGFBP7 transfection in Jurkat cells. Interestingly, combination of the IGF1-R inhibitor NPV-AEW541 restored sensitivity to vincristine in IGFBP7-transfected cells. Additionally, IGF1-R associated GEP revealed an up-regulation of important drivers of T-ALL pathogenesis and regulators of chemo-resistance and apoptosis such as NOTCH1, BCL-2, PRKCI, and TP53. This study revealed a proliferation inhibiting effect of IGFBP7 by G0/G1 arrest and a drug resistance-inducing effect of IGFBP7 against vincristine and asparaginase in T-ALL. These results provide a model for the previously observed association between high IGFBP7 expression and chemotherapy failure in T-ALL patients. Since the resistance against vincristine was abolished by IGF1-R inhibition, IGFBP7 could serve as biomarker for patients who may benefit from therapies including IGF1-R inhibitors in combination with chemotherapy.
-
Zhang, Chao; Shan, Liwei; Su, Shuaikun; Nan, Yanni; Guo, Zhongyu; Fan, Sanhong
2012-07-01
Wheat grain peroxidase 1 (WP1) belonged to class III plant peroxidase with cofactor heme, which not only has antifungal activity, but also influences the processing quality of flour. In order to enhance functional expression of WP1 in prokaryotic system by increasing endogenous heme synthesis, we constructed a recombinant plasmid pACYC-A-L containing hemA and hemL of Esherichia coli. Then, we co-transformed it into host strain T7 Express with secretive expression vector (pMAL-p4x-WP1) or non-secretive expression vector (pET21a-MBP-WP1), respectively. The MBP-WP1 fusion protein was further purified by amylose affinity chromatography and its peroxidase activity was assayed using 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) as substrate. At 12 h after induction at 28 degree, the extracellular 5-aminolevulinic acid (5-ALA) production of T7 Express/pACYC-A-L was up to 146.73 mg/L, simultaneously the extracellular porphrins also increased dramatically. The peroxidase activity of functional MBP-WP1 obtained from T7 Express/ (pACYC-A-L + pMAL-p4x-WP1) was 14.6-folds of that purified from T7 Express/ pET21a-MBP-WP1. This study not only successfully enhanced functional expression of wheat peroxidase 1 in Esherichia coli, but also provided beneficial references for other important proteins with cofactor heme.
-
Krause, A; Whu, W Z; Qiu, J; Wafadari, D; Hackett, N R; Sharma, A; Crystal, R G; Worgall, S
2013-01-01
Replication-deficient adenoviral (Ad) vectors of non-human serotypes can serve as Ad vaccine platforms to circumvent pre-existing anti-human Ad immunity. We found previously that, in addition to that feature, a non-human primate-based AdC7 vector expressing outer membrane protein F of P. aeruginosa (AdC7OprF) was more potent in inducing lung mucosal and protective immunity compared to a human Ad5-based vector. In this study we analysed if genetic modification of the AdC7 fibre to display an integrin-binding arginine–glycine–aspartic acid (RGD) sequence can further enhance lung mucosal immunogenicity of AdC7OprF. Intratracheal immunization of mice with either AdC7OprF.RGD or AdC7OprF induced robust serum levels of anti-OprF immunoglobulin (Ig)G up to 12 weeks that were higher compared to immunization with the human vectors Ad5OprF or Ad5OprF.RGD. OprF-specific cellular responses in lung T cells isolated from mice immunized with AdC7OprF.RGD and AdC7OprF were similar for T helper type 1 (Th1) [interferon (IFN)-γ in CD8+ and interleukin (IL)-12 in CD4+], Th2 (IL-4, IL-5 and IL-13 in CD4+) and Th17 (IL-17 in CD4+). Interestingly, AdC7OprF.RGD induced more robust protective immunity against pulmonary infection with P. aeruginosa compared to AdC7OprF or the control Ad5 vectors. The enhanced protective immunity induced by AdC7OprF.RGD was maintained in the absence of alveolar macrophages (AM) or CD1d natural killer T cells. Together, the data suggest that addition of RGD to the fibre of an AdC7-based vaccine is useful to enhance its mucosal protective immunogenicity. PMID:23607394
-
Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald
2015-01-01
HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides, adenoviral vector priming modulated the cytokine-expression profile of the protein-induced CD4+ T cells. Each regimen induced HIV-1-specific T-cell responses in systemic/local tissues in mice. This suggests that prime-boost regimens combining adjuvanted protein and low-seroprevalent chimpanzee adenoviral vectors represent an attractive vaccination strategy for clinical evaluation.
-
Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald
2015-01-01
HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN (‘A’), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 (‘P’), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides, adenoviral vector priming modulated the cytokine-expression profile of the protein-induced CD4+ T cells. Each regimen induced HIV-1-specific T-cell responses in systemic/local tissues in mice. This suggests that prime-boost regimens combining adjuvanted protein and low-seroprevalent chimpanzee adenoviral vectors represent an attractive vaccination strategy for clinical evaluation. PMID:25856308
-
Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H
2016-01-01
The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.
-
Tong, Alex W; Nemunaitis, John; Su, Dan; Zhang, Yuan; Cunningham, Casey; Senzer, Neil; Netto, George; Rich, Dawn; Mhashilkar, Abner; Parker, Karen; Coffee, Keith; Ramesh, Rajagopal; Ekmekcioglu, Suhendan; Grimm, Elizabeth A; van Wart Hood, Jill; Merritt, James; Chada, Sunil
2005-01-01
The mda-7 gene (approved gene symbol IL24) is a novel tumor suppressor gene with tumor-apoptotic and immune-activating properties. We completed a Phase I dose-escalation clinical trial, in which a nonreplicating adenoviral construct expressing the mda-7 transgene (INGN 241; Ad-mda7) was administered intratumorally to 22 patients with advanced cancer. Excised tumors were evaluated for vector-specific DNA and RNA, transgenic MDA-7 expression, and biological effects. Successful gene transfer as assessed by DNA- and RT-PCR was demonstrated in 100% of patients evaluated. DNA analyses demonstrated a dose-dependent penetration of INGN 241 (up to 4 x 10(8) copies/mug DNA at the 2 x 10(12) vp dose). A parallel distribution of vector DNA, vector RNA, MDA-7 protein expression, and apoptosis induction was observed in all tumors, with signals decreasing with distance away from the injection site. Additional evidence for bioactivity of INGN 241 was illustrated via regulation of the MDA-7 target genes beta-catenin, iNOS, and CD31. Transient increases (up to 20-fold) of serum IL-6, IL-10, and TNF-alpha were observed. Significantly higher elevations of IL-6 and TNF-alpha were observed in patients who responded clinically to INGN 241. Patients also showed marked increases of CD3+CD8+ T cells posttreatment, suggesting that INGN 241 increased systemic TH1 cytokine production and mobilized CD8+ T cells. Intratumoral delivery of INGN 241 induced apoptosis in a large volume of tumor and elicited tumor-regulatory and immune-activating events that are consistent with the preclinical features of MDA-7/IL-24.
-
Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S
2017-04-01
Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.
-
Ghanbari Safari, Maryam; Baesi, Kazem; Hosseinkhani, Saman
2017-03-01
MicroRNAs are small noncoding RNAs that regulate gene expression by repressing translation of target cellular transcripts. Increasing evidences indicate that miRNAs have different expression profiles and play crucial roles in numerous cellular processes. Delivery and expression of transgenes for cancer therapy must be specific for tumors to avoid killing of healthy tissues. Many investigators have shown that transgene expression can be suppressed in normal cells using vectors that are responsive to microRNA regulation. To overcome this problem, miR-145 that exhibits downregulation in many types of cancer cells was chosen for posttranscriptional regulatory systems mediated by microRNAs. In this study, a psiCHECK-145T vector carrying four tandem copies of target sequences of miR-145 into 3'-UTR of the Renilla luciferase gene was constructed. Renilla luciferase activity from the psiCHECK-145T vector was 57% lower in MCF10A cells with high miR-145 expression as compared to a control condition. Additionally, overexpression of miR-145 in MCF-7 cells with low expression level of miR-145 showed more than 76% reduction in the Renilla luciferase activity from the psiCHECK-145T vector. Inclusion of miR-145 target sequences into the 3'-UTR of the Renilla luciferase gene is a feasible strategy for restricting transgene expression in a breast cancer cell line while sparing a breast normal cell line. © 2015 International Union of Biochemistry and Molecular Biology, Inc.
-
Genomic Approaches for Detection and Treatment of Breast Cancer
2007-07-01
The T7Select 10-3b system of lytic phage display is a mid-copy vector that displays between 5-15 copies on the surface of the T7 capsid. The natural... Phage are amplified on a bacterial host that carries an ampicillin-resistant plasmid expressing additional 10A capsid protein from a T7 promoter. We... phage display library of coding fragments encompassing all open reading frames of the human genome. We designed approximately 467,000 overlapping
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jambor de Sousa, Ulrike L.; Koss, Michael D.; Fillies, Marion
2005-12-16
To test the cellular response to an increased fatty acid oxidation, we generated a vector for an inducible expression of the rate-limiting enzyme carnitine palmitoyl-transferase 1{alpha} (CPT1{alpha}). Human embryonic 293T kidney cells were transiently transfected and expression of the CPT1{alpha} transgene in the tet-on vector was activated with doxycycline. Fatty acid oxidation was measured by determining the conversion of supplemented, synthetic cis-10-heptadecenoic acid (C17:1n-7) to C15:ln-7. CPT1{alpha} over-expression increased mitochondrial long-chain fatty acid oxidation about 6-fold. Addition of palmitic acid (PA) decreased viability of CPT1{alpha} over-expressing cells in a concentration-dependent manner. Both, PA and CPT1{alpha} over-expression increased cell death. Interestingly,more » PA reduced total cell number only in cells over-expressing CPT1{alpha}, suggesting an effect on cell proliferation that requires PA translocation across the mitochondrial inner membrane. This inducible expression system should be well suited to study the roles of CPT1 and fatty acid oxidation in lipotoxicity and metabolism in vivo.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasek, Marta; Boeggeman, Elizabeth; Ramakrishnan, Boopathy
The expression of recombinant proteins in Escherichia coli often leads to inactive aggregated proteins known as the inclusion bodies. To date, the best available tool has been the use of fusion tags, including the carbohydrate-binding protein; e.g., the maltose-binding protein (MBP) that enhances the solubility of recombinant proteins. However, none of these fusion tags work universally with every partner protein. We hypothesized that galectins, which are also carbohydrate-binding proteins, may help as fusion partners in folding the mammalian proteins in E. coli. Here we show for the first time that a small soluble lectin, human galectin-1, one member of amore » large galectin family, can function as a fusion partner to produce soluble folded recombinant human glycosyltransferase, {beta}-1,4-galactosyltransferase-7 ({beta}4Gal-T7), in E. coli. The enzyme {beta}4Gal-T7 transfers galactose to xylose during the synthesis of the tetrasaccharide linker sequence attached to a Ser residue of proteoglycans. Without a fusion partner, {beta}4Gal-T7 is expressed in E. coli as inclusion bodies. We have designed a new vector construct, pLgals1, from pET-23a that includes the sequence for human galectin-1, followed by the Tev protease cleavage site, a 6x His-coding sequence, and a multi-cloning site where a cloned gene is inserted. After lactose affinity column purification of galectin-1-{beta}4Gal-T7 fusion protein, the unique protease cleavage site allows the protein {beta}4Gal-T7 to be cleaved from galectin-1 that binds and elutes from UDP-agarose column. The eluted protein is enzymatically active, and shows CD spectra comparable to the folded {beta}4Gal-T1. The engineered galectin-1 vector could prove to be a valuable tool for expressing other proteins in E. coli.« less
-
Construction of two vectors for gene expression in Trichoderma reesei.
Lv, Dandan; Wang, Wei; Wei, Dongzhi
2012-01-01
We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.
-
[Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].
Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min
2014-03-01
To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.
-
Tršan, Tihana; Vuković, Kristina; Filipović, Petra; Brizić, Ana Lesac; Lemmermann, Niels A W; Schober, Kilian; Busch, Dirk H; Britt, William J; Messerle, Martin; Krmpotić, Astrid; Jonjić, Stipan
2017-08-01
Designing CD8 + T-cell vaccines, which would provide protection against tumors is still considered a great challenge in immunotherapy. Here we show the robust potential of cytomegalovirus (CMV) vector expressing the NKG2D ligand RAE-1γ as CD8 + T cell-based vaccine against malignant tumors. Immunization with the CMV vector expressing RAE-1γ, delayed tumor growth or even provided complete protection against tumor challenge in both prophylactic and therapeutic settings. Moreover, a potent tumor control in mice vaccinated with this vector can be further enhanced by blocking the immune checkpoints TIGIT and PD-1. CMV vector expressing RAE-1γ potentiated expansion of KLRG1 + CD8 + T cells with enhanced effector properties. This vaccination was even more efficient in neonatal mice, resulting in the expansion and long-term maintenance of epitope-specific CD8 + T cells conferring robust resistance against tumor challenge. Our data show that immunomodulation of CD8 + T-cell responses promoted by herpesvirus expressing a ligand for NKG2D receptor can provide a powerful platform for the prevention and treatment of CD8 + T-cell sensitive tumors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Ye, Xing-Guo; Qin, Hua
2007-01-01
Obtaining marker-free plants with high efficiency will benefit the environmental release of transgenic crops. To achieve this point, a binary vector pNB35SVIP1 with three T-DNAs was constructed by using several mediate plasmids, in which one copy of bar gene expression cassette and two copies of VIP1 gene expression cassette were included. EHA101 Agrobacterium strain harboring the final construct was applied to transform soybean (Glycine max) cotyledon nodes. Through 2 - 3 months regeneration and selection on 3 - 5mg/L glufosinate containing medium, transgenic soybean plants were confirmed to be obtained at 0.83% - 3.16%, and co-transformation efficiency of both gene in the same individual reached up to 86.4%, based on southern blot test. By the analysis of PCR, southern blot and northern blot combining with leaf painting of herbicide in T1 progenies, 41 plants were confirmed to be eliminated of bar gene with the frequency of 7.6% . Among the T1 populations tested, the loss of the alien genes happened in 22.7% lines, the silence of bar gene took place in 27.3% lines, and VIP1 gene silence existed in 37.1% marker-free plants. The result also suggested that the plasmid with three T-DNAs might be an ideal vector to generate maker-free genetic modified organism.
-
Kianmehr, Anvarsadat; Golavar, Raziyeh; Rouintan, Mandana; Mahrooz, Abdolkarim; Fard-Esfahani, Pezhman; Oladnabi, Morteza; Khajeniazi, Safoura; Mostafavi, Seyede Samaneh; Omidinia, Eskandar
2016-02-01
Darbepoetin alfa is an engineered and hyperglycosylated analog of recombinant human erythropoietin (EPO) which is used as a drug in treating anemia in patients with chronic kidney failure and cancer. This study desribes the secretory expression of a codon-optimized recombinant form of darbepoetin alfa in Leishmania tarentolae T7-TR. Synthetic codon-optimized gene was amplified by PCR and cloned into the pLEXSY-I-blecherry3 vector. The resultant expression vector, pLEXSYDarbo, was purified, digested, and electroporated into the L. tarentolae. Expression of recombinant darbepoetin alfa was evaluated by ELISA, reverse-transcription PCR (RT-PCR), Western blotting, and biological activity. After codon optimization, codon adaptation index (CAI) of the gene raised from 0.50 to 0.99 and its GC% content changed from 56% to 58%. Expression analysis confirmed the presence of a protein band at 40 kDa. Furthermore, reticulocyte experiment results revealed that the activity of expressed darbepoetin alfa was similar to that of its equivalent expressed in Chinese hamster ovary (CHO) cells. These data suggested that the codon optimization and expression in L. tarentolae host provided an efficient approach for high level expression of darbepoetin alfa. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B
1997-01-01
We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population. PMID:9032306
-
Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B
1997-03-01
We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population.
-
Forbes, Emily K.; de Cassan, Simone C.; Llewellyn, David; Biswas, Sumi; Goodman, Anna L.; Cottingham, Matthew G.; Long, Carole A.; Pleass, Richard J.; Hill, Adrian V. S.; Hill, Fergal; Draper, Simon J.
2012-01-01
Viral vectored vaccines have been shown to induce both T cell and antibody responses in animals and humans. However, the induction of even higher level T cell responses may be crucial in achieving vaccine efficacy against difficult disease targets, especially in humans. Here we investigate the oligomerization domain of the α-chain of C4b-binding protein (C4 bp) as a candidate T cell “molecular adjuvant” when fused to malaria antigens expressed by human adenovirus serotype 5 (AdHu5) vectored vaccines in BALB/c mice. We demonstrate that i) C-terminal fusion of an oligomerization domain can enhance the quantity of antigen-specific CD4+ and CD8+ T cell responses induced in mice after only a single immunization of recombinant AdHu5, and that the T cells maintain similar functional cytokine profiles; ii) an adjuvant effect is observed for AdHu5 vectors expressing either the 42 kDa C-terminal domain of Plasmodium yoelii merozoite surface protein 1 (PyMSP142) or the 83 kDa ectodomain of P. falciparum strain 3D7 apical membrane antigen 1 (PfAMA1), but not a candidate 128kDa P. falciparum MSP1 biallelic fusion antigen; iii) following two homologous immunizations of AdHu5 vaccines, antigen-specific T cell responses are further enhanced, however, in both BALB/c mice and New Zealand White rabbits no enhancement of functional antibody responses is observed; and iv) that the T cell adjuvant activity of C4 bp is not dependent on a functional Fc-receptor γ-chain in the host, but is associated with the oligomerization of small (<80 kDa) antigens expressed by recombinant AdHu5. The oligomerization domain of C4 bp can thus adjuvant T cell responses induced by AdHu5 vectors against selected antigens and its clinical utility as well as mechanism of action warrant further investigation. PMID:22984589
-
Mathison, Megumi; Singh, Vivek P; Gersch, Robert P; Ramirez, Maricela O; Cooney, Austin; Kaminsky, Stephen M; Chiuchiolo, Maria J; Nasser, Ahmed; Yang, Jianchang; Crystal, Ronald G; Rosengart, Todd K
2014-10-01
The in situ reprogramming of cardiac fibroblasts into induced cardiomyocytes by the administration of gene transfer vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) has been shown to improve ventricular function in myocardial infarction models. The efficacy of this strategy could, however, be limited by the need for fibroblast targets to be infected 3 times--once by each of the 3 transgene vectors. We hypothesized that a polycistronic "triplet" vector encoding all 3 transgenes would enhance postinfarct ventricular function compared with use of "singlet" vectors. After validation of the polycistronic vector expression in vitro, adult male Fischer 344 rats (n=6) underwent coronary ligation with or without intramyocardial administration of an adenovirus encoding all 3 major vascular endothelial growth factor (VEGF) isoforms (AdVEGF-All6A positive), followed 3 weeks later by the administration to AdVEGF-All6A-positive treated rats of singlet lentivirus encoding G, M, or T (1×10(5) transducing units each) or the same total dose of a GMT "triplet" lentivirus vector. Western blots demonstrated that triplet and singlet vectors yielded equivalent GMT transgene expression, and fluorescence activated cell sorting demonstrated that triplet vectors were nearly twice as potent as singlet vectors in generating induced cardiomyocytes from cardiac fibroblasts. Echocardiography demonstrated that GMT triplet vectors were more effective than the 3 combined singlet vectors in enhancing ventricular function from postinfarct baselines (triplet, 37%±10%; singlet, 13%±7%; negative control, 9%±5%; P<.05). These data have confirmed that the in situ administration of G, M, and T induces postinfarct ventricular functional improvement and that GMT polycistronic vectors enhance the efficacy of this strategy. Copyright © 2014 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.
-
Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou
2012-01-01
Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.
-
Bacteriophage T7 RNA polymerase-based expression in Pichia pastoris.
Hobl, Birgit; Hock, Björn; Schneck, Sandra; Fischer, Reinhard; Mack, Matthias
2013-11-01
A novel Pichia pastoris expression vector (pEZT7) for the production of recombinant proteins employing prokaryotic bacteriophage T7 RNA polymerase (T7 RNAP) (EC 2.7.7.6) and the corresponding promoter pT7 was constructed. The gene for T7 RNAP was stably introduced into the P. pastoris chromosome 2 under control of the (endogenous) constitutive P. pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter (pGAP). The gene product T7 RNAP was engineered to contain a nuclear localization signal, which directed recombinant T7 RNAP to the P. pastoris nucleus. To promote translation of uncapped T7 RNAP derived transcripts, the internal ribosomal entry site from hepatitis C virus (HCV-IRES) was inserted directly upstream of the multiple cloning site of pEZT7. A P. pastoris autonomous replicating sequence (PARS1) was integrated into pEZT7 enabling propagation and recovery of plasmids from P. pastoris. Rapid amplification of 5' complementary DNA ends (5' RACE) experiments employing the test plasmid pEZT7-EGFP revealed that transcripts indeed initiated at pT7. HCV-IRES mediated translation of the latter mRNAs, however, was not observed. Surprisingly, HCV-IRES and the reverse complement of PARS1 (PARS1rc) were both found to display significant promoter activity as shown by 5' RACE. Copyright © 2013 Elsevier Inc. All rights reserved.
-
USDA-ARS?s Scientific Manuscript database
Genetically modified T36 Citrus tristeza virus (T36-mCTV) is showing promise in Florida to mitigate huanglongbing (HLB) by expressing antimicrobial peptides and RNAi against the presumed pathogen, “Candidatus Liberibacter asiaticus” (CLas), and its vector, the Asian citrus psyllid (ACP). To this end...
-
Jin, Chuan; Fotaki, Grammatiki; Ramachandran, Mohanraj; Nilsson, Berith; Essand, Magnus; Yu, Di
2016-07-01
Chimeric antigen receptor (CAR) T-cell therapy is a new successful treatment for refractory B-cell leukemia. Successful therapeutic outcome depends on long-term expression of CAR transgene in T cells, which is achieved by delivering transgene using integrating gamma retrovirus (RV) or lentivirus (LV). However, uncontrolled RV/LV integration in host cell genomes has the potential risk of causing insertional mutagenesis. Herein, we describe a novel episomal long-term cell engineering method using non-integrating lentiviral (NILV) vector containing a scaffold/matrix attachment region (S/MAR) element, for either expression of transgenes or silencing of target genes. The insertional events of this vector into the genome of host cells are below detection level. CD19 CAR T cells engineered with a NILV-S/MAR vector have similar levels of CAR expression as T cells engineered with an integrating LV vector, even after numerous rounds of cell division. NILV-S/MAR-engineered CD19 CAR T cells exhibited similar cytotoxic capacity upon CD19(+) target cell recognition as LV-engineered T cells and are as effective in controlling tumor growth in vivo We propose that NILV-S/MAR vectors are superior to current options as they enable long-term transgene expression without the risk of insertional mutagenesis and genotoxicity. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
-
Han, Ye; Chang, Qin A.; Virag, Tamas; West, Neva C.; George, David; Castro, Maria G.; Bohn, Martha C.
2010-01-01
The ability to safely control transgene expression from viral vectors is a long-term goal in the gene therapy field. We have previously reported tight regulation of GFP expression in rat brain using a self-regulating tet-off rAAV vector. The immune responses against tet regulatory elements observed by other groups in nonhuman primates after intramuscular injection of tet-on encoding vectors raise concerns about the clinical value of tet-regulated vectors. However, previous studies have not examined immune responses following injection of AAV vectors into brain. Therefore, rat striatum was injected with tet-off rAAV harboring a therapeutic gene for Parkinson's disease, either hAADC or hGDNF. The expression of each gene was tightly controlled by the tet-off regulatory system. Using an ELISA developed with purified GST-tTA protein, no detectable immunogenicity against tTA was observed in sera of rats that received an intrastriatal injection of either vector. In contrast, sera from rats intradermally injected with an adenovirus containing either tTA or rtTA, as positive controls, had readily detectable antibodies. These observations suggest that tet-off rAAV vectors do not elicit an immune response when injected into rat brain and that these may offer safer vectors for Parkinson's disease than vectors with constitutive expression. PMID:20164859
-
García-Arriaza, Juan; Perdiguero, Beatriz; Heeney, Jonathan L.; Seaman, Michael S.; Montefiori, David C.; Yates, Nicole L.; Tomaras, Georgia D.; Ferrari, Guido; Foulds, Kathryn E.; Roederer, Mario; Self, Steven G.; Borate, Bhavesh; Gottardo, Raphael; Phogat, Sanjay; Tartaglia, Jim; Barnett, Susan W.; Burke, Brian; Cristillo, Anthony D.; Weiss, Deborah E.; Lee, Carter; Kibler, Karen V.; Jacobs, Bertram L.; Wagner, Ralf; Ding, Song; Pantaleo, Giuseppe
2017-01-01
ABSTRACT The nonreplicating attenuated poxvirus vector NYVAC expressing clade C(CN54) HIV-1 Env(gp120) and Gag-Pol-Nef antigens (NYVAC-C) showed limited immunogenicity in phase I clinical trials. To enhance the capacity of the NYVAC vector to trigger broad humoral responses and a more balanced activation of CD4+ and CD8+ T cells, here we compared the HIV-1-specific immunogenicity elicited in nonhuman primates immunized with two replicating NYVAC vectors that have been modified by the insertion of the K1L and C7L vaccinia virus host range genes and express the clade C(ZM96) trimeric HIV-1 gp140 protein or a Gag(ZM96)-Pol-Nef(CN54) polyprotein as Gag-derived virus-like particles (termed NYVAC-C-KC). Additionally, one NYVAC-C-KC vector was generated by deleting the viral gene B19R, an inhibitor of the type I interferon response (NYVAC-C-KC-ΔB19R). An immunization protocol mimicking that of the RV144 phase III clinical trial was used. Two groups of macaques received two doses of the corresponding NYVAC-C-KC vectors (weeks 0 and 4) and booster doses with NYVAC-C-KC vectors plus the clade C HIV-1 gp120 protein (weeks 12 and 24). The two replicating NYVAC-C-KC vectors induced enhanced and similar HIV-1-specific CD4+ and CD8+ T cell responses, similar levels of binding IgG antibodies, low levels of IgA antibodies, and high levels of antibody-dependent cellular cytotoxicity responses and HIV-1-neutralizing antibodies. Small differences within the NYVAC-C-KC-ΔB19R group were seen in the magnitude of CD4+ and CD8+ T cells, the induction of some cytokines, and the neutralization of some HIV-1 isolates. Thus, replication-competent NYVAC-C-KC vectors acquired relevant immunological properties as vaccine candidates against HIV/AIDS, and the viral B19 molecule exerts some control of immune functions. IMPORTANCE It is of special importance to find a safe and effective HIV/AIDS vaccine that can induce strong and broad T cell and humoral immune responses correlating with HIV-1 protection. Here we developed novel replicating poxvirus NYVAC-based HIV/AIDS vaccine candidates expressing clade C HIV-1 antigens, with one of them lacking the vaccinia virus B19 protein, an inhibitor of the type I interferon response. Immunization of nonhuman primates with these novel NYVAC-C-KC vectors and the protein component gp120 elicited high levels of T cell and humoral immune responses, with the vector containing a deletion in B19R inducing a trend toward a higher magnitude of CD4+ and CD8+ T cell responses and neutralization of some HIV-1 strains. These poxvirus vectors could be considered HIV/AIDS vaccine candidates based on their activation of potential immune correlates of protection. PMID:28179536
-
Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...
2016-02-04
Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana
Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less
-
Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun
2016-02-01
A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.
-
An Exosome-Based Vaccine Platform Imparts Cytotoxic T Lymphocyte Immunity Against Viral Antigens.
Anticoli, Simona; Manfredi, Francesco; Chiozzini, Chiara; Arenaccio, Claudia; Olivetta, Eleonora; Ferrantelli, Flavia; Capocefalo, Antonio; Falcone, Emiliana; Ruggieri, Anna; Federico, Maurizio
2018-04-01
Exosomes are 50-150 nm sized nanovesicles released by all eukaryotic cells. The authors very recently described a method to engineer exosomes in vivo with the E7 protein of Human Papilloma Virus (HPV). This technique consists in the intramuscular injection of a DNA vector expressing HPV-E7 fused at the C-terminus of an exosome-anchoring protein, that is, Nef mut , the authors previously characterized for its high levels of incorporation in exosomes. In this configuration, the ≈11 kDa E7 protein elicited a both strong and effective antigen-specific cytotoxic T lymphocyte (CTL) immunity. Attempting to establish whether this method could have general applicability, the authors expanded the immunogenicity studies toward an array of viral products of various origin and size including Ebola Virus VP24, VP40 and NP, Influenza Virus NP, Crimean-Congo Hemorrhagic Fever NP, West Nile Virus NS3, and Hepatitis C Virus NS3. All antigens appeared stable upon fusion with Nef mut , and are uploaded in exosomes at levels comparable to Nef mut . When injected in mice, DNA vectors expressing the diverse fusion products elicited a well detectable antigen-specific CD8 + T cell response associating with a cytotoxic activity potent enough to kill peptide-loaded and/or antigen-expressing syngeneic cells. These data definitely proven both effectiveness and flexibility of this innovative CTL vaccine platform. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Bonaldo, Myrna C; Martins, Mauricio A; Rudersdorf, Richard; Mudd, Philip A; Sacha, Jonah B; Piaskowski, Shari M; Costa Neves, Patrícia C; Veloso de Santana, Marlon G; Vojnov, Lara; Capuano, Saverio; Rakasz, Eva G; Wilson, Nancy A; Fulkerson, John; Sadoff, Jerald C; Watkins, David I; Galler, Ricardo
2010-04-01
Here we describe a novel vaccine vector for expressing human immunodeficiency virus (HIV) antigens. We show that recombinant attenuated yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 Gag sequences can be used as a vector to generate SIV-specific CD8(+) T-cell responses in the rhesus macaque. Priming with recombinant BCG expressing SIV antigens increased the frequency of these SIV-specific CD8(+) T-cell responses after recombinant YF17D boosting. These recombinant YF17D-induced SIV-specific CD8(+) T cells secreted several cytokines, were largely effector memory T cells, and suppressed viral replication in CD4(+) T cells.
-
Zhang, Yuan; Qiao, Lei; Hu, Xiao; Zhao, Kang; Zhang, Yanwen; Chai, Feng; Pan, Zishu
2016-01-04
Baculovirus has been exploited for use as a novel vaccine vector. To investigate the feasibility and efficacy of recombinant baculoviruses (rBVs) expressing respiratory syncytial virus (RSV) fusion (F) proteins, four constructs (Bac-tF/64, Bac-CF, Bac-CF/tF64 and Bac-CF/tF64-VISA) were generated. Bac-tF64 displays the F ectodomain (tF) on the envelope of rBVs, whereas Bac-CF expresses full-length F protein in transduced mammalian cells. Bac-CF/tF64 not only displays tF on the envelope but also expresses F in cells. Bac-CF/tF64-VISA comprises Bac-CF/tF64 harboring the virus-induced signaling adaptor (VISA) gene. After administration to BALB/c mice, all four vectors elicited RSV neutralizing antibody (Ab), systemic Ab (IgG, IgG1, and IgG2a), and cytokine responses. Compared with Bac-tF64, mice inoculated with Bac-CF and Bac-CF/tF64 exhibited an increased mixed Th1/Th2 cytokine response, increased ratios of IgG2a/IgG1 antibody responses, and reduced immunopathology upon RSV challenge. Intriguingly, co-expression of VISA reduced Th2 cytokine (IL-4, IL-5, and IL-10) production induced by Bac-CF/tF64, thus relieving lung pathology upon a subsequent RSV challenge. Our results indicated that the Bac-CF/tF64 vector incorporated with the VISA molecule may provide an effective vaccine strategy for protection against RSV. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
-
Protein Degradation in a TX-TL Cell-free Expression System Using ClpXP Protease
2014-07-14
function in TX-TL, as well as bacteriophage assembly [2, 6]. Circuits can also be prototyped from basic parts within 8 hours, avoiding cloning and...mRFP, and Venus and variants eGFP-ssrA, mRFP-ssrA, and Venus-ssrA, coding sequences were cloned into a T7-lacO inducible vector containing a N...12672L12677.! 6.! Shin,!J.,!P.!Jardine,!and!V.!Noireaux,!Genome(Replication,(Synthesis,(and( Assembly(of(the( Bacteriophage (T7(in(a(Single(Cell9Free
-
Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia
2012-11-04
To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.
-
Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S
2012-02-01
Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.
-
Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.
2012-01-01
Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659
-
[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].
Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V
2010-01-01
The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.
-
Kortmann, Maike; Kuhl, Vanessa; Klaffl, Simon; Bott, Michael
2015-01-01
Corynebacterium glutamicum has become a favourite model organism in white biotechnology. Nevertheless, only few systems for the regulatable (over)expression of homologous and heterologous genes are currently available, all of which are based on the endogenous RNA polymerase. In this study, we developed an isopropyl-β-d-1-thiogalactopyranosid (IPTG)-inducible T7 expression system in the prophage-free strain C. glutamicum MB001. For this purpose, part of the DE3 region of Escherichia coli BL21(DE3) including the T7 RNA polymerase gene 1 under control of the lacUV5 promoter was integrated into the chromosome, resulting in strain MB001(DE3). Furthermore, the expression vector pMKEx2 was constructed allowing cloning of target genes under the control of the T7lac promoter. The properties of the system were evaluated using eyfp as heterologous target gene. Without induction, the system was tightly repressed, resulting in a very low specific eYFP fluorescence (= fluorescence per cell density). After maximal induction with IPTG, the specific fluorescence increased 450-fold compared with the uninduced state and was about 3.5 times higher than in control strains expressing eyfp under control of the IPTG-induced tac promoter with the endogenous RNA polymerase. Flow cytometry revealed that T7-based eyfp expression resulted in a highly uniform population, with 99% of all cells showing high fluorescence. Besides eyfp, the functionality of the corynebacterial T7 expression system was also successfully demonstrated by overexpression of the C. glutamicum pyk gene for pyruvate kinase, which led to an increase of the specific activity from 2.6 to 135 U mg−1. It thus presents an efficient new tool for protein overproduction, metabolic engineering and synthetic biology approaches with C. glutamicum. PMID:25488698
-
Lasaro, Marcio O; Haut, Larissa H; Zhou, Xiangyang; Xiang, Zhiquan; Zhou, Dongming; Li, Yan; Giles-Davis, Wynetta; Li, Hua; Engram, Jessica C; DiMenna, Lauren J; Bian, Ang; Sazanovich, Marina; Parzych, Elizabeth M; Kurupati, Raj; Small, Juliana C; Wu, Te-Lang; Leskowitz, Rachel M; Klatt, Nicole R; Brenchley, Jason M; Garber, David A; Lewis, Mark; Ratcliffe, Sarah J; Betts, Michael R; Silvestri, Guido; Ertl, Hildegund C
2011-01-01
Despite enormous efforts by the scientific community, an effective HIV vaccine remains elusive. To further address to what degree T cells in absence of antibodies may protect against simian immunodeficiency virus (SIV) disease progression, rhesus macaques were vaccinated intramuscularly with a chimpanzee-derived Ad vector (AdC) serotype 6 and then boosted intramuscularly with a serologically distinct AdC vector of serotype 7 both expressing Gag of SIVmac239. Animals were subsequently boosted intramuscularly with a modified vaccinia Ankara (MVA) virus expressing Gag and Tat of the homologous SIV before mucosal challenge with a high dose of SIVmac239 given rectally. Whereas vaccinated animals showed only a modest reduction of viral loads, their overall survival was improved, in association with a substantial protection from the loss of CD4+ T cells. In addition, the two vaccinated Mamu-A*01+ macaques controlled viral loads to levels below detection within weeks after challenge. These data strongly suggest that T cells, while unable to affect SIV acquisition upon high-dose rectal infection, can reduce disease progression. Induction of potent T-cell responses should thus remain a component of our efforts to develop an efficacious vaccine to HIV-1. PMID:21081905
-
Lasaro, Marcio O; Haut, Larissa H; Zhou, Xiangyang; Xiang, Zhiquan; Zhou, Dongming; Li, Yan; Giles-Davis, Wynetta; Li, Hua; Engram, Jessica C; Dimenna, Lauren J; Bian, Ang; Sazanovich, Marina; Parzych, Elizabeth M; Kurupati, Raj; Small, Juliana C; Wu, Te-Lang; Leskowitz, Rachel M; Klatt, Nicole R; Brenchley, Jason M; Garber, David A; Lewis, Mark; Ratcliffe, Sarah J; Betts, Michael R; Silvestri, Guido; Ertl, Hildegund C
2011-02-01
Despite enormous efforts by the scientific community, an effective HIV vaccine remains elusive. To further address to what degree T cells in absence of antibodies may protect against simian immunodeficiency virus (SIV) disease progression, rhesus macaques were vaccinated intramuscularly with a chimpanzee-derived Ad vector (AdC) serotype 6 and then boosted intramuscularly with a serologically distinct AdC vector of serotype 7 both expressing Gag of SIVmac239. Animals were subsequently boosted intramuscularly with a modified vaccinia Ankara (MVA) virus expressing Gag and Tat of the homologous SIV before mucosal challenge with a high dose of SIVmac239 given rectally. Whereas vaccinated animals showed only a modest reduction of viral loads, their overall survival was improved, in association with a substantial protection from the loss of CD4(+) T cells. In addition, the two vaccinated Mamu-A*01(+) macaques controlled viral loads to levels below detection within weeks after challenge. These data strongly suggest that T cells, while unable to affect SIV acquisition upon high-dose rectal infection, can reduce disease progression. Induction of potent T-cell responses should thus remain a component of our efforts to develop an efficacious vaccine to HIV-1.
-
Meseda, Clement A; Atukorale, Vajini; Soto, Jackeline; Eichelberger, Maryna C; Gao, Jin; Wang, Wei; Weiss, Carol D; Weir, Jerry P
2018-03-29
Influenza subtypes such as H7 have pandemic potential since they are able to infect humans with severe consequences, as evidenced by the ongoing H7N9 infections in China that began in 2013. The diversity of H7 viruses calls for a broadly cross-protective vaccine for protection. We describe the construction of recombinant modified vaccinia virus Ankara (MVA) vectors expressing the hemagglutinin (HA) or neuraminidase (NA) from three H7 viruses representing both Eurasian and North American H7 lineages - A/mallard/Netherlands/12/2000 (H7N3), A/Canada/rv444/2004 (H7N3), and A/Shanghai/02/2013 (H7N9). These vectors were evaluated for immunogenicity and protective efficacy against H7N3 virus in a murine model of intranasal challenge. High levels of H7-, N3-, and N9-specific antibodies, including neutralizing antibodies, were induced by the MVA-HA and MVA-NA vectors. Mice vaccinated with MVA vectors expressing any of the H7 antigens were protected, suggesting cross-protection among H7 viruses. In addition, MVA vectors expressing N3 but not N9 elicited protection against H7N3 virus challenge. Similar outcomes were obtained when immune sera from MVA vector-immunized mice were passively transferred to naïve mice prior to challenge with the H7N3 virus. The results support the further development of an MVA vector platform as a candidate vaccine for influenza strains with pandemic potential.
-
Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos
2017-01-01
During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.
-
Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos
2017-01-01
During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919
-
Kumar, V V; Pichon, C; Refregiers, M; Guerin, B; Midoux, P; Chaudhuri, A
2003-08-01
Presence of endosome-disrupting multiple histidine functionalities in the molecular architecture of cationic polymers, such as polylysine, has previously been demonstrated to significantly enhance their in vitro gene delivery efficiencies. Towards harnessing improved transfection property through covalent grafting of endosome-disrupting single histidine functionality in the molecular structure of cationic lipids, herein, we report on the design, the synthesis and the transfection efficiency of two novel nonglycerol-based histidylated cationic amphiphiles. We found that L-histidine-(N,N-di-n-hexadecylamine)ethylamide (lipid 1) and L-histidine-(N,N-di-n-hexadecylamine,-N-methyl)ethylamide (lipid 2) in combination with cholesterol gave efficient transfections into various cell lines. The transfection efficiency of Chol/lipid 1 lipoplexes into HepG2 cells was two order of magnitude higher than that of FuGENE(TM)6 and DC-Chol lipoplexes, whereas it was similar into A549, 293T7 and HeLa cells. A better efficiency was obtained with Chol/lipid 2 lipoplexes when using the cytosolic luciferase expression vector (pT7Luc) under the control of the bacterial T7 promoter. Membrane fusion activity measurements using fluorescence resonance energy transfer (FRET) technique showed that the histidine head-groups of Chol/lipid 1 liposomes mediated membrane fusion in the pH range 5-7. In addition, the transgene expression results using the T7Luc expression vector convincingly support the endosome-disrupting role of the presently described mono-histidylated cationic transfection lipids and the release of DNA into the cytosol. We conclude that covalent grafting of a single histidine amino acid residue to suitable twin-chain hydrophobic compounds is able to impart remarkable transfection properties on the resulting mono-histidylated cationic amphiphile, presumably via the endosome-disrupting characteristics of the histidine functionalities.
-
Detection and Imaging of Moving Targets with LiMIT SAR Data
2017-03-03
include space time adaptive processing (STAP) or displaced phase center antenna (DPCA) [4]–[7]. Page et al. combined constant acceleration target...motion focusing with space-time adaptive processing (STAP), and included the refocusing parameters in the STAP steering vector. Due to inhomogenous...wavelength λ and slow time t, of a moving target after matched filter and passband equalization processing can be expressed as: P (t) = exp ( −j 4π λ ||~rp
-
Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song
2016-05-01
On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.
-
[Cloning of human CD45 gene and its expression in Hela cells].
Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang
2015-11-01
To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
-
Large-scale Clinical-grade Retroviral Vector Production in a Fixed-Bed Bioreactor
Wang, Xiuyan; Olszewska, Malgorzata; Qu, Jinrong; Wasielewska, Teresa; Bartido, Shirley; Hermetet, Gregory; Sadelain, Michel
2015-01-01
The successful genetic engineering of patient T cells with γ-retroviral vectors expressing chimeric antigen receptors or T-cell receptors for phase II clinical trials and beyond requires the large-scale manufacture of high-titer vector stocks. The production of retroviral vectors from stable packaging cell lines using roller bottles or 10- to 40-layer cell factories is limited by a narrow harvest window, labor intensity, open-system operations, and the requirement for significant incubator space. To circumvent these shortcomings, we optimized the production of vector stocks in a disposable fixed-bed bioreactor using good manufacturing practice–grade packaging cell lines. High-titer vector stocks were harvested over 10 days, representing a much broader harvest window than the 3-day harvest afforded by cell factories. For PG13 and 293Vec packaging cells, the average vector titer and the vector stocks’ yield in the bioreactor were higher by 3.2- to 7.3-fold, and 5.6- to 13.1-fold, respectively, than those obtained in cell factories. The vector production was 10.4 and 18.6 times more efficient than in cell factories for PG13 and 293Vec cells, respectively. Furthermore, the vectors produced from the fixed-bed bioreactors passed the release test assays for clinical applications. Therefore, a single vector lot derived from 293Vec is suitable to transduce up to 500 patients cell doses in the context of large clinical trials using chimeric antigen receptors or T-cell receptors. These findings demonstrate for the first time that a robust fixed-bed bioreactor process can be used to produce γ-retroviral vector stocks scalable up to the commercialization phase. PMID:25751502
-
Tsukahara, T; Iwase, N; Kawakami, K; Iwasaki, M; Yamamoto, C; Ohmine, K; Uchibori, R; Teruya, T; Ido, H; Saga, Y; Urabe, M; Mizukami, H; Kume, A; Nakamura, M; Brentjens, R; Ozawa, K
2015-02-01
Engineered T-cell therapy using a CD19-specific chimeric antigen receptor (CD19-CAR) is a promising strategy for the treatment of advanced B-cell malignancies. Gene transfer of CARs to T-cells has widely relied on retroviral vectors, but transposon-based gene transfer has recently emerged as a suitable nonviral method to mediate stable transgene expression. The advantages of transposon vectors compared with viral vectors include their simplicity and cost-effectiveness. We used the Tol2 transposon system to stably transfer CD19-CAR into human T-cells. Normal human peripheral blood lymphocytes were co-nucleofected with the Tol2 transposon donor plasmid carrying CD19-CAR and the transposase expression plasmid and were selectively propagated on NIH3T3 cells expressing human CD19. Expanded CD3(+) T-cells with stable and high-level transgene expression (~95%) produced interferon-γ upon stimulation with CD19 and specifically lysed Raji cells, a CD19(+) human B-cell lymphoma cell line. Adoptive transfer of these T-cells suppressed tumor progression in Raji tumor-bearing Rag2(-/-)γc(-/-) immunodeficient mice compared with control mice. These results demonstrate that the Tol2 transposon system could be used to express CD19-CAR in genetically engineered T-cells for the treatment of refractory B-cell malignancies.
-
Hodara, Vida L.; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.
2005-01-01
Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that expressed CD154. We found that this recombinant vector directed the expression of CD154 on the surface of infected CD4+ T cells and that expression of CD154 resulted in activation of B cells present in the same cultures. Experimental infection of rhesus macaques resulted in very low viral loads for the CD154-expressing virus and the control virus, indicating that expression of CD154 did not result in increased viral replication. Analyses of the anti-SIV immune responses and the phenotype of lymphocytes in blood and lymphoid tissues showed changes that occurred during the acute phase of infection only in animals infected with the CD154-expressing SIV, but that became indistinguishable from those seen in animals infected with the control virus at later time points. We conclude that the level of expression of CD154 in itself is not responsible for affecting the immune response to an attenuated virus. Considering that the CD154-expressing SIV vector and the virus control did not carry an active nef gene, our results suggest that, in CD4+ T cells infected with wild-type virus, Nef is the viral factor that interferes with the immune mechanisms that regulate expression of CD154. PMID:15795254
-
Takayama, Eiji; Ono, Takeshi; Carnero, Elena; Umemoto, Saori; Yamaguchi, Yoko; Kanayama, Atsuhiro; Oguma, Takemi; Takashima, Yasuhiro; Tadakuma, Takushi; García-Sastre, Adolfo; Miyahira, Yasushi
2010-11-01
We studied some aspects of the quantitative and qualitative features of heterologous recombinant (re) virus-vector-induced, antigen-specific CD8(+) T cells against Trypanosoma cruzi. We used three different, highly attenuated re-viruses, i.e., influenza virus, adenovirus and vaccinia virus, which all expressed a single, T. cruzi antigen-derived CD8(+) T-cell epitope. The use of two out of three vectors or the triple virus-vector vaccination regimen not only confirmed that the re-vaccinia virus, which was placed last in order for sequential immunisation, was an effective booster for the CD8(+) T-cell immunity in terms of the number of antigen-specific CD8(+) T cells, but also demonstrated that (i) the majority of cells exhibit the effector memory (T(EM)) phenotype, (ii) robustly secrete IFN-γ, (iii) express higher intensity of the CD122 molecule and (iv) present protective activity against T. cruzi infection. In contrast, placing the re-influenza virus last in sequential immunisation had a detrimental effect on the quantitative and qualitative features of CD8(+) T cells. The triple virus-vector vaccination was more effective at inducing a stronger CD8(+) T-cell immunity than using two re-viruses. The different quantitative and qualitative features of CD8(+) T cells induced by different immunisation regimens support the notion that the refinement of the best choice of multiple virus-vector combinations is indispensable for the induction of a maximum number of CD8(+) T cells of high quality. Copyright © 2010 Australian Society for Parasitology Inc. All rights reserved.
-
Jiang, Shan; Xie, Qing; Zhang, Wei; Zhou, Xia-Qiu; Jin, You-Xin
2005-01-01
AIM: To prepare and identify specific anti-mouse caspase-12 hammerhead ribozymes in vitro, in order to select a more effective ribozyme against mouse caspase-12 as a potential tool to rescue cells from endoplasmic reticulum stress induced apoptosis. METHODS: Two hammerhead ribozymes directed separately against 138 and 218 site of nucleotide of mouse caspase-12 mRNA were designed by computer software, and their DNA sequences were synthesized. The synthesized ribozymes were cloned into an eukaryotic expression vector-neorpBSKU6 and embedded in U6 SnRNA context for further study. Mouse caspase-12 gene segment was cloned into PGEM-T vector under the control of T7 RNA polymerase promoter (containing gene sequence from positions nt 41 to nt 894) as target. In vitro transcription both the ribozymes and target utilize T7 promoter. The target was labeled with [α-32P]UTP, while ribozymes were not labeled. After gel purification the RNAs were dissolved in RNase free water. Ribozyme and target were incubated for 90 min at 37°C in reaction buffer (40 mmol/L Tris-HCL, pH 7.5, 10 mmol/L Mg2+). Molar ratio of ribozyme vs target was 30:1. Samples were analyzed on 6% PAGE (containing 8 mol/L urea). RESULTS: Both caspase-12 and ribozyme gene sequences were successfully cloned into expression vector confirmed by sequencing. Ribozymes and caspase-12 mRNA were obtained by in vitro transcription. Cleavage experiment showed that in a physiological similar condition (37°C, pH 7.5), Rz138 and Rz218 both cleaved targets at predicted sites, for Rz138 the cleavage efficiency was about 100%, for Rz218 the value was 36.66%. CONCLUSION: Rz138 prepared in vitro can site specific cleave mouse caspase-12 mRNA with an excellent efficiency. It shows a potential to suppress the expression of caspase-12 in vivo, thus provided a new way to protect cells from ER stress induced apoptosis. PMID:15996037
-
Highly efficient gene transfer in naive human T cells with a murine leukemia virus-based vector.
Dardalhon, V; Jaleco, S; Rebouissou, C; Ferrand, C; Skander, N; Swainson, L; Tiberghien, P; Spits, H; Noraz, N; Taylor, N
2000-08-01
Retroviral vectors based on the Moloney murine leukemia virus (MuLV) have become the primary tool for gene delivery into hematopoietic cells, but clinical trials have been hampered by low transduction efficiencies. Recently, we and others have shown that gene transfer of MuLV-based vectors into T cells can be significantly augmented using a fibronectin-facilitated protocol. Nevertheless, the relative abilities of naive (CD45RA(+)) and memory (CD45RO(+)) lymphocyte subsets to be transduced has not been assessed. Although naive T cells demonstrate a restricted cytokine profile following antigen stimulation and a decreased susceptibility to infection with human immunodeficiency virus, it was not clear whether they could be efficiently infected with a MuLV vector. This study describes conditions that permitted gene transfer of an enhanced green fluorescent protein-expressing retroviral vector in more than 50% of naive umbilical cord (UC) blood and peripheral blood (PB) T cells following CD3/CD28 ligation. Moreover, treatment of naive T cells with interleukin-7 resulted in the maintenance of a CD45RA phenotype and gene transfer levels approached 20%. Finally, it was determined that parameters for optimal transduction of CD45RA(+) T cells isolated from PB and UC blood differed: transduction of the UC cells was significantly increased by the presence of autologous mononuclear cells (24.5% versus 56.5%). Because naive T cells harbor a receptor repertoire that allows them to respond to novel antigens, the development of protocols targeting their transduction is crucial for gene therapy applications. This approach will also allow the functions of exogenous genes to be evaluated in primary nontransformed naive T cells.
-
Soong, Ruey-Shyang; Song, Liwen; Trieu, Janson; Knoff, Jayne; He, Liangmei; Tsai, Ya-Chea; Huh, Warner; Chang, Yung-Nien; Cheng, Wen-Fang; Roden, Richard B S; Wu, T-C; Trimble, Cornelia L; Hung, Chien-Fu
2014-11-01
Imiquimod is a Toll-like receptor 7 agonist used topically to treat external genital warts and basal cell carcinoma. We examined the combination of topical imiquimod with intramuscular administration of CRT/E7, a therapeutic human papillomavirus (HPV) vaccine comprised of a naked DNA vector expressing calreticulin fused to HPV16 E7. Using an orthotopic HPV16 E6/E7(+) syngeneic tumor, TC-1, as a model of high-grade cervical/vaginal/vulvar intraepithelial neoplasia, we assessed if combining CRT/E7 vaccination with cervicovaginal deposition of imiquimod could result in synergistic activities promoting immune-mediated tumor clearance. Imiquimod induced cervicovaginal accumulation of activated E7-specific CD8(+) T cells elicited by CRT/E7 vaccination. Recruitment was not dependent upon the specificity of the activated CD8(+) T cells, but was significantly reduced in mice lacking the IFNγ receptor. Intravaginal imiquimod deposition induced upregulation of CXCL9 and CXCL10 mRNA expression in the genital tract, which are produced in response to IFNγ receptor signaling and attract cells expressing their ligand, CXCR3. The T cells attracted by imiquimod to the cervicovaginal tract expressed CXCR3 as well as CD49a, an integrin involved in homing and retention of CD8(+) T cells at mucosal sites. Our results indicate that intramuscular CRT/E7 vaccination in conjunction with intravaginal imiquimod deposition recruits antigen-specific CXCR3(+) CD8(+) T cells to the genital tract. Several therapeutic HPV vaccination clinical trials using a spectrum of DNA vaccines, including vaccination in concert with cervical imiquimod, are ongoing. Our study identifies a mechanism by which these strategies could provide therapeutic benefit. Our findings support accumulating evidence that manipulation of the tumor microenvironment can enhance the therapeutic efficacy of strategies that induce tumor-specific T cells. ©2014 American Association for Cancer Research.
-
Mendes, Érica Araújo; Fonseca, Flavio G; Casério, Bárbara M; Colina, Janaína P; Gazzinelli, Ricardo Tostes; Caetano, Braulia C
2013-01-01
The use of recombinant viral vectors expressing T. gondii antigens is a safe and efficient approach to induce immune response against the parasite and a valuable tool for vaccine development. We have previously protected mice from toxoplasmosis by immunizing the animals with an adenovirus expressing the protein SAG1 (AdSAG1) of T. gondii. We are now looking for ways to improve the vaccination strategy and enhance protection. One limitation of homologous vaccinations (sequential doses of the same vector) is induction of anti-vector immune response that blocks cell transduction, restricts transgene expression and, consequently, compromises the overall outcome of vaccination. One way to avert the effects of anti-vector response is to use different viruses in prime and boost (heterologous vaccination). Bearing this in mind, we generated a modified Vaccinia Virus Ankara encoding SAG1 (MVASAG1), to be tested as boost agent after prime with AdSAG1. Although minor differences were observed in the magnitude of the anti-SAG1 immune response induced by each vaccination protocol, the heterologous immunization with AdSAG1 followed by MVASAG1 resulted in improved capacity to control brain cyst formation in a model of chronic toxoplasmosis in C57BL/6 mice.
-
Zhao, Yangbing; Moon, Edmund; Carpenito, Carmine; Paulos, Chrystal M; Liu, Xiaojun; Brennan, Andrea L; Chew, Anne; Carroll, Richard G; Scholler, John; Levine, Bruce L; Albelda, Steven M; June, Carl H
2010-11-15
Redirecting T lymphocyte antigen specificity by gene transfer can provide large numbers of tumor-reactive T lymphocytes for adoptive immunotherapy. However, safety concerns associated with viral vector production have limited clinical application of T cells expressing chimeric antigen receptors (CAR). T lymphocytes can be gene modified by RNA electroporation without integration-associated safety concerns. To establish a safe platform for adoptive immunotherapy, we first optimized the vector backbone for RNA in vitro transcription to achieve high-level transgene expression. CAR expression and function of RNA-electroporated T cells could be detected up to a week after electroporation. Multiple injections of RNA CAR-electroporated T cells mediated regression of large vascularized flank mesothelioma tumors in NOD/scid/γc(-/-) mice. Dramatic tumor reduction also occurred when the preexisting intraperitoneal human-derived tumors, which had been growing in vivo for >50 days, were treated by multiple injections of autologous human T cells electroporated with anti-mesothelin CAR mRNA. This is the first report using matched patient tumor and lymphocytes showing that autologous T cells from cancer patients can be engineered to provide an effective therapy for a disseminated tumor in a robust preclinical model. Multiple injections of RNA-engineered T cells are a novel approach for adoptive cell transfer, providing flexible platform for the treatment of cancer that may complement the use of retroviral and lentiviral engineered T cells. This approach may increase the therapeutic index of T cells engineered to express powerful activation domains without the associated safety concerns of integrating viral vectors. Copyright © 2010 AACR.
-
Zhao, Yangbing; Moon, Edmund; Carpenito, Carmine; Paulos, Chrystal M.; Liu, Xiaojun; Brennan, Andrea L; Chew, Anne; Carroll, Richard G.; Scholler, John; Levine, Bruce L.; Albelda, Steven M.; June, Carl H.
2010-01-01
Redirecting T lymphocyte antigen specificity by gene transfer can provide large numbers of tumor reactive T lymphocytes for adoptive immunotherapy. However, safety concerns associated with viral vector production have limited clinical application of T cells expressing chimeric antigen receptors (CARs). T lymphocytes can be gene modified by RNA electroporation without integration-associated safety concerns. To establish a safe platform for adoptive immunotherapy, we first optimized the vector backbone for RNA in vitro transcription to achieve high level transgene expression. CAR expression and function of RNA-electroporated T cells could be detected up to a week post electroporation. Multiple injections of RNA CAR electroporated T cells mediated regression of large vascularized flank mesothelioma tumors in NOD/scid/γc(−/−) mice. Dramatic tumor reduction also occurred when the pre-existing intraperitoneal human-derived tumors, that had been growing in vivo for over 50 days, were treated by multiple injections of autologous human T cells electroporated with anti-mesothelin CAR mRNA. This is the first report using matched patient tumor and lymphocytes demonstrating that autologous T cells from cancer patients can be engineered to provide an effective therapy for a disseminated tumor in a robust preclinical model. Multiple injections of RNA engineered T cells are a novel approach for adoptive cell transfer, providing flexible platform for the treatment of cancer that may complement the use of retroviral and lentiviral engineered T cells. This approach may increase the therapeutic index of T cells engineered to express powerful activation domains without the associated safety concerns of integrating viral vectors. PMID:20926399
-
Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.
2001-01-01
Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351
-
Production of SV40-derived vectors.
Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N
2010-06-01
Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.
-
Beinfeld, Margery C; Vishnuvardhan, Daesety; Blum, Alissa; Reynolds, Nicole; Fannous, Sanya; Kitagawa, Kouki; Marchand, James E
2006-04-01
Two different RNAi methods were used to inhibit the expression of prohormone convertase 1 (PC1) in At-T20 cells. Transient transfection of double stranded RNA and stable expression of a vector expressing hairpin-loop RNA targeting PC1 reduced cholecystokinin (CCK) secretion from At-T20 cells. PC1 mRNA and protein were also decreased in the vector transfected cells. This treatment caused a shift in the forms of cholecystokinin (CCK) secreted, decreasing CCK 22 and increasing CCK 8. Stable expression of RNAi effectively decreased PC1 expression. The observed decrease in CCK seen with these RNAi treatments further supports a role for PC1 in CCK processing in these cells.
-
Terrón-González, L; Medina, C; Limón-Mortés, M C; Santero, E
2013-01-01
The extraordinary potential of metagenomic functional analyses to identify activities of interest present in uncultured microorganisms has been limited by reduced gene expression in surrogate hosts. We have developed vectors and specialized E. coli strains as improved metagenomic DNA heterologous expression systems, taking advantage of viral components that prevent transcription termination at metagenomic terminators. One of the systems uses the phage T7 RNA-polymerase to drive metagenomic gene expression, while the other approach uses the lambda phage transcription anti-termination protein N to limit transcription termination. A metagenomic library was constructed and functionally screened to identify genes conferring carbenicillin resistance to E. coli. The use of these enhanced expression systems resulted in a 6-fold increase in the frequency of carbenicillin resistant clones. Subcloning and sequence analysis showed that, besides β-lactamases, efflux pumps are not only able contribute to carbenicillin resistance but may in fact be sufficient by themselves to convey carbenicillin resistance.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meador, Lydia R.
Showing modest efficacy, the RV144 HIV-1 vaccine clinical trial utilized a non-replicating canarypox viral vector and a soluble gp120 protein boost. Here we built upon the RV144 strategy by developing a novel combination of a replicating, but highly-attenuated Vaccinia virus vector, NYVAC-KC, and plant-produced HIV-1 virus-like particles (VLPs). Both components contained the full-length Gag and a membrane anchored truncated gp41 presenting the membrane proximal external region with its conserved broadly neutralizing epitopes in the pre-fusion conformation. We tested different prime/boost combinations of these components in mice and showed that the group primed with NYVAC-KC and boosted with both the viralmore » vectors and plant-produced VLPs have the most robust Gag-specific CD8 T cell responses, at 12.7% of CD8 T cells expressing IFN-γ in response to stimulation with five Gag epitopes. The same immunization group elicited the best systemic and mucosal antibody responses to Gag and dgp41 with a bias towards IgG1. - Highlights: • We devised a prime/boost anti HIV-1 vaccination strategy modeled after RV144. • We used plant-derived virus-like particles (VLPs) consisting of Gag and dgp41. • We used attenuated, replicating vaccinia virus vectors expressing the same antigens. • The immunogens elicited strong cellular and humoral immune responses.« less
-
Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul
2014-01-01
CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967
-
Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases
Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.
2016-01-01
Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570
-
Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.
Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D
2016-01-01
Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.
-
In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering
Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang
2017-01-01
Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270
-
In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.
Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang
2017-01-01
Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.
-
Advances in the T7 phage display system (Review).
Deng, Xiangying; Wang, Li; You, Xiaolong; Dai, Pei; Zeng, Yanhua
2018-01-01
The present review describes the advantages and updated applications of the T7 phage display system in bioscience and medical science. Current phage display systems are based on various bacteriophage vectors, including M13, T7, T4 and f1. Of these, the M13 phage display is the most frequently used, however, the present review highlights the advantages of the T7 system. As a phage display platform, M13 contains single‑stranded DNA, while the T7 phage consists of double‑stranded DNA, which exhibits increased stability and is less prone to mutation during replication. Additional characteristics of the T7 phage include the following: The T7 phage does not depend on a protein secretion pathway in the lytic cycle; expressed peptides and proteins are usually located on the C‑terminal region of capsid protein gp10B, which avoids problems associated with steric hindrance; and T7 phage particles exhibit high stability under various extreme conditions, including high temperature and low pH, which facilitates effective high‑throughput affinity elutriation. Recent applications of the T7 phage display system have been instrumental in uncovering mechanisms of molecular interaction, particularly in the fields of antigen discovery, vaccine development, protein interaction, and cancer diagnosis and treatment.
-
Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying
2008-02-01
To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.
-
Chen, Haoming; Yao, Hengmei; Huang, Lu; Shen, Qi; Jia, William; Xue, Jinglun
2006-12-01
1. Haematopoietic stem cells (HSC) are an attractive target for gene therapy. Gene transfer to HSC can provide a potential cure for many inherited diseases. Moreover, recombinant lentiviral vectors can transfer genes efficiently to HSC. In the present study, we used the recombinant lentiviruses FUGW (Flip, ubiquitin promoter, GFP and WRE vector) and FUXW (Flip, ubiquitin promoter, F IX and WRE vector), which carry the enhanced green fluorescent protein (EGFP) and human factor IX (hFIX) gene, respectively, to infect HSC. 2. High titres of recombinant lentivirus were prepared from 293T cells by calcium phosphate-mediated transient cotransfection. Murine mononuclear cells (MNC) separated from murine bone marrow and HSC separated by magnetic cell sorting were cultured in vitro. Cells they were infected by the recombinant lentiviruses FUGW and FUXW. The expression of EGFP was observed under a fluorescent microscope and was analysed by fluorescence-activated cell sorting, whereas the expression of hFIX was detected by ELISA. 3. The results show that the lentiviral vectors can efficiently infect murine HSC in vitro and that transduction was more efficient following cytokine treatment with interleukin (IL)-3, IL-6 and stem cell factor. 4. Haematopoietic stem cells infected with lentivirus FUXW were transplanted into [(60)Co]-irradiated non-obese diabetic/severe combined immunodeficiency (NOD-SCID) mice. The expression of hFIX in the blood plasma of the transplanted mice reached a peak of 44.9 +/- 7.6 ng/mL on Day 7. An assay of transaminase levels and a histological study of the liver showed that there was no significant damage following HSC transplantation to mice. 5. The results of the present study suggest that transplantation of HSC results in the persistant expression of hFIX in mice, which may be useful in haemophilia B gene therapy.
-
Vande Velde, G; Rangarajan, J R; Toelen, J; Dresselaers, T; Ibrahimi, A; Krylychkina, O; Vreys, R; Van der Linden, A; Maes, F; Debyser, Z; Himmelreich, U; Baekelandt, V
2011-06-01
The development of in vivo imaging protocols to reliably track transplanted cells or to report on gene expression is critical for treatment monitoring in (pre)clinical cell and gene therapy protocols. Therefore, we evaluated the potential of lentiviral vectors (LVs) and adeno-associated viral vectors (AAVs) to express the magnetic resonance imaging (MRI) reporter gene ferritin in the rodent brain. First, we compared the induction of background MRI contrast for both vector systems in immune-deficient and immune-competent mice. LV injection resulted in hypointense (that is, dark) changes of T(2)/T(2)(*) (spin-spin relaxation time)-weighted MRI contrast at the injection site, which can be partially explained by an inflammatory response against the vector injection. In contrast to LVs, AAV injection resulted in reduced background contrast. Moreover, AAV-mediated ferritin overexpression resulted in significantly enhanced contrast to background on T(2)(*)-weighted MRI. Although sensitivity associated with the ferritin reporter remains modest, AAVs seem to be the most promising vector system for in vivo MRI reporter gene imaging.
-
Loh, Joy; Popkin, Daniel L.; Droit, Lindsay; Braaten, Douglas C.; Zhao, Guoyan; Zhang, Xin; Vachharajani, Punit; Myers, Nancy; Hansen, Ted H.
2012-01-01
Herpesviruses are thought to be highly genetically stable, and their use as vaccine vectors has been proposed. However, studies of the human gammaherpesvirus, Epstein-Barr virus, have found viral isolates containing mutations in HLA class I-restricted epitopes. Using murine gammaherpesvirus 68 expressing ovalbumin (OVA), we examined the stability of a gammaherpesvirus antigenic locus under strong CD8 T cell selection in vivo. OVA-specific CD8 T cells selected viral isolates containing mutations in the OVA locus but minimal alterations in other genomic regions. Thus, a CD8 T cell response to a gammaherpesvirus-expressed antigen that is not essential for replication or pathogenesis can result in selective mutation of that antigen in vivo. This finding may have relevance for the use of herpesvirus vectors for chronic antigen expression in vivo. PMID:22171269
-
Lamikanra, Abigail; Pan, Zhen-Kun; Isaacs, Stuart N.; Wu, Tzyy-Choou; Paterson, Yvonne
2001-01-01
Using vaccinia virus as a live vector, we show that the expression of human papillomavirus type 16 (HPV-16) E7 fused to a nonhemolytic portion of the Listeria monocytogenes virulence factor, listeriolysin O (LLO), induces an immune response that causes the regression of established HPV-16 immortalized tumors in C57BL/6 mice. The vaccinia virus construct expressing LLO fused to E7 (VacLLOE7) was compared with two previously described vaccinia virus constructs: one that expresses unmodified E7 (VacE7) and another that expresses E7 in a form designed to direct it to intracellular lysosomal compartments and improve major histocompatibility complex class II-restricted responses (VacSigE7LAMP-1). C57BL/6 mice bearing established HPV-16 immortalized tumors of 5 or 8 mm were treated with each of these vaccines. Fifty percent of the mice treated with VacLLOE7 remained tumor free 2 months after tumor inoculation, whereas 12 to 25% of the mice were tumor free after treatment with VacSigE7LAMP-1 (depending on the size of the tumor). No mice were tumor free in the group given VacE7. Compared to VacE7, VacSigE7LAMP-1 and VacLLOE7 resulted in increased numbers of H2-Db-specific tetramer-positive CD8+ T cells in mouse spleens that produced gamma interferon and tumor necrosis factor alpha upon stimulation with RAHYNIVTF peptide. In addition, the highest frequency of tetramer-positive T cells was seen in the tumor sites of mice treated with VacLLOE7. An increased efficiency of E7-specific lysis by splenocytes from mice immunized with VacLLOE7 was also observed. These results indicate that the fusion of E7 with LLO not only enhances antitumor therapy by improving the tumoricidal function of E7-specific CD8+ T cells but may also increase the number of antigen-specific CD8+ T cells in the tumor, the principle site of antigen expression. PMID:11559797
-
Humbert, Olivier; Gisch, Don W; Wohlfahrt, Martin E; Adams, Amie B; Greenberg, Phil D; Schmitt, Tom M; Trobridge, Grant D; Kiem, Hans-Peter
2016-08-01
Lentiviral vectors (LVs) pseudotyped with vesicular stomatitis virus envelope glycoprotein (VSV-G) have demonstrated great promise in gene therapy trials employing hematopoietic stem cell and T-cells. The VSV-G envelope confers broad tropism and stability to the vector but is toxic when constitutively expressed, which has impeded efforts to generate stable producer cell lines. We previously showed that cocal pseudotyped LVs offer an excellent alternative to VSV-G vectors because of their broad tropism and resistance to human serum inactivation. In this study, we demonstrate that cocal LVs transduce CD34(+) and CD4(+) T-cells more efficiently than VSV-G LVs and share the same receptor(s) for cell entry. 293T-cells stably expressing the cocal envelope produced significantly higher LV titers than VSV-G expressing cells. We developed cocal pseudotyped, third-generation, self-inactivating LV producer cell lines for a GFP reporter and for a WT1 tumor-specific T-cell receptor, which achieved concentrated titers above 10(8) IU/ml and were successfully adapted for growth in suspension, serum-free culture. The resulting LVs were at least as effective as standard LVs in transducing CD34(+) and CD4(+) T-cells. Our stable cocal LV producer cell lines should facilitate the production of large-scale, high titer clinical grade vectors.
-
Puthumana, Jayesh; Prabhakaran, Priyaja; Philip, Rosamma; Singh, I S Bright
2015-12-01
In an attempt of in vitro transformation, transfection mediated expression of Simian virus-40 (T) antigen (SV40-T) and transduction mediated expression of Adenovirus type 12 early region 1A (12S E1A) oncogene were performed in Penaeus monodon lymphoid cells. pSV3-neo vector encoding SV40-T oncogene and a recombinant baculovirus BacP2-12S E1A-GFP encoding 12S E1A oncogene under the control of hybrid promoters were used. Electroporation and lipofection mediated transformation of SV40-T in lymphoid cells confirmed the transgene expression by phenotypic variation and the expression of GFP in co-transfection experiment. The cells transfected by lipofection (≥ 5%) survived for 14 days with lower toxicity (30%), whilst on electroporation, most of the cells succumbed to death (60%) and survived cells lived up to 7 days. Transduction efficiency in primary lymphoid cells was more than 80% within 14 days of post-transduction, however, an incubation period of 7 days post-transduction was observed without detectable expression of 12S E1A. High level of oncogenic 12S E1A expression were observed after 14 day post-transduction and the proliferating cells survived for more than 90 days with GFP expression, however, without in vitro transformation and immortalization. The study put forth the requirement of transduction mediated 'specific' oncogene expression along with telomerase activation and epigenetic induction for the immortalization and establishment of shrimp cell line. Copyright © 2015. Published by Elsevier Ltd.
-
Dardalhon, V; Jaleco, S; Kinet, S; Herpers, B; Steinberg, M; Ferrand, C; Froger, D; Leveau, C; Tiberghien, P; Charneau, P; Noraz, N; Taylor, N
2001-07-31
Differences in the immunological reactivity of umbilical cord (UC) and adult peripheral blood (APB) T cells are poorly understood. Here, we show that IL-7, a cytokine involved in lymphoid homeostasis, has distinct regulatory effects on APB and UC lymphocytes. Neither naive nor memory APB CD4(+) cells proliferated in response to IL-7, whereas naive UC CD4(+) lymphocytes underwent multiple divisions. Nevertheless, both naive and memory IL-7-treated APB T cells progressed into the G(1b) phase of the cell cycle, albeit at higher levels in the latter subset. The IL-7-treated memory CD4(+) lymphocyte population was significantly more susceptible to infection with an HIV-1-derived vector than dividing CD4(+) UC lymphocytes. However, activation through the T cell receptor rendered UC lymphocytes fully susceptible to HIV-1-based vector infection. These data unveil differences between UC and APB CD4(+) T cells with regard to IL-7-mediated cell cycle progression and HIV-1-based vector infectivity. This evidence indicates that IL-7 differentially regulates lymphoid homeostasis in adults and neonates.
-
Dardalhon, Valérie; Jaleco, Sara; Kinet, Sandrina; Herpers, Bjorn; Steinberg, Marcos; Ferrand, Christophe; Froger, Delphine; Leveau, Christelle; Tiberghien, Pierre; Charneau, Pierre; Noraz, Nelly; Taylor, Naomi
2001-01-01
Differences in the immunological reactivity of umbilical cord (UC) and adult peripheral blood (APB) T cells are poorly understood. Here, we show that IL-7, a cytokine involved in lymphoid homeostasis, has distinct regulatory effects on APB and UC lymphocytes. Neither naive nor memory APB CD4+ cells proliferated in response to IL-7, whereas naive UC CD4+ lymphocytes underwent multiple divisions. Nevertheless, both naive and memory IL-7-treated APB T cells progressed into the G1b phase of the cell cycle, albeit at higher levels in the latter subset. The IL-7-treated memory CD4+ lymphocyte population was significantly more susceptible to infection with an HIV-1-derived vector than dividing CD4+ UC lymphocytes. However, activation through the T cell receptor rendered UC lymphocytes fully susceptible to HIV-1-based vector infection. These data unveil differences between UC and APB CD4+ T cells with regard to IL-7-mediated cell cycle progression and HIV-1-based vector infectivity. This evidence indicates that IL-7 differentially regulates lymphoid homeostasis in adults and neonates. PMID:11470908
-
Epigenetic Alterations Associated With CCCTC-Binding Factor Deregulation in Prostate Cancer
2011-07-01
HPV16 E6 and/or E7 prostate cell lines. We have established stable cell lines containing inducible CTCF shRNA in pTRIPZ vector in PPC-1, LNCaPs, 293T...and non-tumorigenic HPV16 E6 and/or E7 prostate cell lines. We are in process of conducting CTCF knockdown experiments using transient transfection...which express high levels of endogenous CTCF and in non- tumorigenic HPV16 E6 and/or E7 prostate cell lines. We see efficient knockdown of CTCF
-
He, Zuoping; Luo, Peifang; Hu, Feihuan; Weng, Yunceng; Wang, Wenjing; Li, Chengyao
2016-04-01
To construct eukaryotic expression vectors carrying Brucella melitensis outer membrane protein 19 (OMP19), express them in transfected Huh7.5.1 and JEG-3 cells, and analyze their role in cell apoptosis. Brucella melitensis lipidated OMP19 (L-OMP19) gene and unlipidated OMP19 (U-OMP19) gene were amplified by PCR and inserted into the vector pZeroBack/blunt. The correct L-OMP19 and U-OMP19 genes verified by XbaI and BamHI double digestion and sequencing were cloned into the lentivirus expression vector pHAGE-CMV-MCS-IZsGreen to construct vectors pHAGE-L-OMP19 and pHAGE-U-OMP19, which were separately transfected into 293FT cells, Huh7.5.1 and JEG-3 cells. L-OMP19 and U-OMP19 in the cells were detected by Western blotting and immunofluorescence technique. Flow cytometry combined with annexin V-PE/7-AAD staining was used to detect the cell apoptosis. The lentiviral vectors pHAGE-L-OMP19 and pHAGE-U-OMP19 were constructed correctly and the recombinant lipoproteins L-OMP19 and U-OMP19 expressed in the above cells were well recognized by the specific antibodies against L-OMP19 in Western blotting and immunofluorescence technique. L-OMP19 and U-OMP19 induced JEG-3 cell death, but did not induce the apoptosis of Huh7.5.1 cells. The eukaryotic expression vectors of L-OMP19 and U-OMP19 have been constructed successfully. Recombinant lipoproteins L-OMP19 and U-OMP19 expressed in cells have a good antigenicity, which could be used as experimental materials for the research on the relationship between host cells and lipoproteins in Brucella infection.
-
Habu, Yuichiro; Miyano-Kurosaki, Naoko; Kitano, Michiko; Endo, Yumihiko; Yukita, Masakazu; Ohira, Shigeru; Takaku, Hiroaki; Nashimoto, Masayuki; Takaku, Hiroshi
2005-01-01
The tRNA 3′-processing endoribonuclease (tRNase Z or 3′ tRNase; EC 3.1.26.11) is an essential enzyme that removes the 3′ trailer from pre-tRNA. The long form (tRNase ZL) can cleave a target RNA in vitro at the site directed by an appropriate small-guide RNA (sgRNA). Here, we investigated whether this sgRNA/tRNase ZL strategy could be applied to gene therapy for AIDS. We tested the ability of four sgRNA-expression plasmids to inhibit HIV-1 gene expression in COS cells, using a transient-expression assay. The three sgRNAs guide inhibition of HIV-1 gene expression in cultured COS cells. Analysis of the HIV-1 mRNA levels suggested that sgRNA directed the tRNase ZL to mediate the degradation of target RNA. The observation that sgRNA was localized primarily in nuclei suggests that tRNase ZL cleaves the HIV-1 mRNA when complexed with sgRNA in this location. We also examined the ability of two retroviral vectors expressing sgRNA to suppress HIV-1 expression in HIV-1-infected Jurkat T cells. sgRNA-SL4 suppressed HIV-1 expression almost completely in infected cells for up to 18 days. These results suggest that the sgRNA/tRNase ZL approach is effective in downregulating HIV-1 gene expression. PMID:15647506
-
Adenoviral Gene Delivery to Primary Human Cutaneous Cells and Burn Wounds
Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars
2006-01-01
The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determined up to 30 days. Expression was quantified by FACS analysis and fluorimeter. Cytotoxicity was measured using the trypan blue exclusion method. 45 male Sprague Dawley rats received 2 × 108 pfu of Ad5-CMV-LacZ or carrier control intradermally into either superficial partial thickness scald burn or unburned skin. Animals were euthanized after 48 h, 7 or 14 days posttreatment. Transgene expression was assessed using immunohistochemistry and bioluminescent assays. The highest transfection rate was observed 48 h posttransfection: 79% for HKC, 70% for HFB, and 48% for HaCaT. The eGFP expression was detectable in all groups over 30 days (P > 0.05). Cytotoxic effects of the adenoviral vector were observed for HFB after 10 days and HaCaT after 30 days. Reporter gene expression in vivo was significantly higher in burned skin compared with unburned skin (P = 0,004). Gene expression decreases from 2 to 7 days with no significant expression after 14 days. This study demonstrates that effective adenoviral-mediated gene transfer of epidermal primary cells and cell-lines is feasible. Ex vivo gene transfer in epithelial cells might have promise for the use in severely burned patients who receive autologous keratinocyte sheets. Transient cutaneous gene delivery in burn wounds using adenoviral vectors causes significant concentrations in the wound tissue for at least 1 week. Based on these findings, we hypothesize that transient cutaneous adenoviral gene delivery of wound healing promoting factors has potential for clinical application. PMID:17225867
-
Adenoviral gene delivery to primary human cutaneous cells and burn wounds.
Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars
2006-01-01
The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determined up to 30 days. Expression was quantified by FACS analysis and fluorimeter. Cytotoxicity was measured using the trypan blue exclusion method. 45 male Sprague Dawley rats received 2x10(8) pfu of Ad5-CMV-LacZ or carrier control intradermally into either superficial partial thickness scald burn or unburned skin. Animals were euthanized after 48 h, 7 or 14 days posttreatment. Transgene expression was assessed using immunohistochemistry and bioluminescent assays. The highest transfection rate was observed 48 h posttransfection: 79% for HKC, 70% for HFB, and 48% for HaCaT. The eGFP expression was detectable in all groups over 30 days (P>0.05). Cytotoxic effects of the adenoviral vector were observed for HFB after 10 days and HaCaT after 30 days. Reporter gene expression in vivo was significantly higher in burned skin compared with unburned skin (P=0,004). Gene expression decreases from 2 to 7 days with no significant expression after 14 days. This study demonstrates that effective adenoviral-mediated gene transfer of epidermal primary cells and cell-lines is feasible. Ex vivo gene transfer in epithelial cells might have promise for the use in severely burned patients who receive autologous keratinocyte sheets. Transient cutaneous gene delivery in burn wounds using adenoviral vectors causes significant concentrations in the wound tissue for at least 1 week. Based on these findings, we hypothesize that transient cutaneous adenoviral gene delivery of wound healing promoting factors has potential for clinical application.
-
Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser
2008-01-01
In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440
-
Pan, Jian-ping; Weng, Yue-song; Wu, Qian-qian
2006-09-01
To investigate the anti-metastatic effect of vascular endothelial growth factor receptor 2 extracellular domain gene-modified dendritic cell (DC-sVEGFR-2) vaccination. Dendritic cells (DC) were electroporated with pcDNA3. 1/sVEGFR-2 plasmid DNA. Expression of sVEGFR-2 was determined by ELISA. For immunization, C57BL/6 mice were intravenously injected three times with 1 x 10(5) cells per mouse of DC, pcDNA3. 1-transfected DC (DC-vector) , DC-sVEGFR-2, or 100 microl of PBS at 7-day intervals. At 10 days after the last immunization, the immunized mice were subjected to assessment of cytotoxic T lymphocyte ( CTL) response to VEGFR-2, alginate bead analysis of tumor cell-induced angiogenesis, and observation of the anti-metastatic effect in B16 melanoma metastasis model. CTL activity was determined by a standard 4-h 51Cr release assay against VEGFR-2 + vascular endothelial cell line H5V, 3LL cells stably transfected with pcDNA3. 1/sVEGFR-2 (3LL,-sVEGFR-2), and VEGFR-2- cell lines EL-4 and 3LL. Monoclonal antibodies GK1.5 anti-CD4 and 2.43 anti-CD8 were used to deplete in vivo CD4 + T cells and CD8' T cells, respectively. DC-sVEGFR-2 could effectively express sVEGFR-2, whereas DC-vector and DC could not. Immunization of mice with DC-sVEGFR-2 significantly induce CTL activity against VEGFR-2 + cell lines H5V and 3LL-sVEGFR-2, however, no significant CTL activity was observed when VEGFR-2- syngeneic cell lines EL-4 and 3LL. were used as target cells, implying this CTL activity was VEGFR-2 specific. Alginate bead analysis of in vivo neoangiogenesis showed that the inhibition reached 50% in mice vaccinated with DC-sVEGFR-2 compared with mice vaccinated with DC, DC-vector or PBS. Anti-metastatic experiment showed that profound reduction in pulmonary metastases was found in mice immunized with DC-sVEGFR-2, while mice immunized with PBS, DC, DC-vector developed extensive pulmonary metastases. The number of tumor nodules on lung surface decreased by 81.9% in mice immunized with DC-sVEGFR-2 when compared with mice immunized with DC-vector (49.7+/-12.7 vs. 9.0+/-3.2). In vivo T cell subset depletion experiments showed that the anti-metastatic effect of DC-sVEGFR-2 vaccination was abrogated in CD8 + T cell-depleted but not in CD4+ T cell-depleted mice. Immunization of mice with DC-sVEGFR-2 could break self-tolerance and induce a significant CTL response to VEGFR-2, leading to profound inhibition of tumor-cell induced angiogenesis and metastasis. This anti-metastatic effect is mainly mediated by CD8+ T cells.
-
Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dunn, J.J.; Barbour, A.G.
1996-11-05
A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface proteinmore » A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.« less
-
Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7
Dunn, John J.; Barbour, Alan G.
1996-11-05
A method is provided herein for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed.
-
Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7
Dunn, J.J.; Barbour, A.G.
1996-11-05
A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.
-
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
-
Gene therapy using retrovirus vectors: vector development and biosafety at clinical trials.
Doi, Knayo; Takeuchi, Yasuhiro
2015-01-01
Retrovirus vectors (gammaretroviral and lentiviral vectors) have been considered as promising tools to transfer therapeutic genes into patient cells because they can permanently integrate into host cellular genome. To treat monogenic, inherited diseases, retroviral vectors have been used to add correct genes into patient cells. Conventional gammaretroviral vectors achieved successful results in clinical trials: treated patients had therapeutic gene expression in target cells and had improved symptoms of diseases. However, serious side-effects of leukemia occurred, caused by retroviral insertional mutagenesis (IM). These incidences stressed the importance of monitoring vector integration sites in patient cells as well as of re-consideration on safer vectors. More recently lentiviral vectors which can deliver genes into non-dividing cells started to be used in clinical trials including neurological disorders, showing their efficacy. Vector integration site analysis revealed that lentiviruses integrate less likely to near promoter regions of oncogenes than gammaretroviruses and no adverse events have been reported in lentiviral vector-mediated gene therapy clinical trials. Therefore lentiviral vectors have promises to be applied to a wide range of common diseases in near future. For example, T cells from cancer patients were transduced to express chimeric T cell receptors recognizing their tumour cells enhancing patients' anti-cancer immunity.
-
2015-11-20
between tweets and profiles as follow, • TFIDF Score, which calculates the cosine similarity between a tweet and a profile in vector space model with...TFIDF weight of terms. Vector space model is a model which represents a document as a vector. Tweets and profiles can be expressed as vectors, ~ T = (t...gain(Tr i ) (13) where Tr is the returned tweet sets, gain() is the score func- tion for a tweet. Not interesting, spam/ junk tweets receive a gain of 0
-
Hewitt, Stephen N.; Choi, Ryan; Kelley, Angela; Crowther, Gregory J.; Napuli, Alberto J.; Van Voorhis, Wesley C.
2011-01-01
Despite recent advances, the expression of heterologous proteins in Escherichia coli for crystallization remains a nontrivial challenge. The present study investigates the efficacy of maltose-binding protein (MBP) fusion as a general strategy for rescuing the expression of target proteins. From a group of sequence-verified clones with undetectable levels of protein expression in an E. coli T7 expression system, 95 clones representing 16 phylogenetically diverse organisms were selected for recloning into a chimeric expression vector with an N-terminal histidine-tagged MBP. PCR-amplified inserts were annealed into an identical ligation-independent cloning region in an MBP-fusion vector and were analyzed for expression and solubility by high-throughput nickel-affinity binding. This approach yielded detectable expression of 72% of the clones; soluble expression was visible in 62%. However, the solubility of most proteins was marginal to poor upon cleavage of the MBP tag. This study offers large-scale evidence that MBP can improve the soluble expression of previously non-expressing proteins from a variety of eukaryotic and prokaryotic organisms. While the behavior of the cleaved proteins was disappointing, further refinements in MBP tagging may permit the more widespread use of MBP-fusion proteins in crystallographic studies. PMID:21904041
-
A New Genetic Vaccine Platform Based on an Adeno-Associated Virus Isolated from a Rhesus Macaque ▿
Lin, Jianping; Calcedo, Roberto; Vandenberghe, Luk H.; Bell, Peter; Somanathan, Suryanarayan; Wilson, James M.
2009-01-01
We created a hybrid adeno-associated virus (AAV) from two related rhesus macaque isolates, called AAVrh32.33, and evaluated it as a vaccine carrier for human immunodeficiency virus type 1 (HIV-1) and type A influenza virus antigens. The goal was to overcome the limitations of vaccines based on other AAVs, which generate dysfunctional T-cell responses and are inhibited by antibodies found in human sera. Injection of a Gag-expressing AAVrh32.33 vector into mice resulted in a high-quality CD8+ T-cell response. The resulting Gag-specific T cells express multiple cytokines at high levels, including interleukin-2, with many having memory phenotypes; a subsequent boost with an adenovirus vector yielded a brisk expansion of Gag-specific T cells. A priming dose of AAVrh32.33 led to high levels of Gag antibodies, which exceed levels found after injection of adenovirus vectors. Importantly, passive transfer of pooled human immunoglobulin into mice does not interfere with the efficacy of AAVrh32.33 expressing nucleoproteins from influenza virus, as measured by protection to a lethal dose of influenza virus, which is consistent with the very low seroprevalence to this virus in humans. Studies of macaques with vectors expressing gp140 from HIV-1 (i.e., with AAVrh32.33 as the prime and simian adenovirus type 24 as the boost) demonstrated results similar to those for mice with high-level and high-quality CD8+ T-cell responses to gp140 and high-titered neutralizing antibodies to homologous HIV-1. The biology of this novel AAV hybrid suggests that it should be a preferred genetic vaccine carrier, capable of generating robust T- and B-cell responses. PMID:19812149
-
Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich
2005-12-01
Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.
-
Petit, Nicolas; Dorgham, Karim; Levacher, Béatrice; Burlion, Aude; Gorochov, Guy; Marodon, Gilles
2014-08-01
Numerous strategies targeting early and late steps of the HIV life cycle have been proposed for gene therapy. However, targeting viral and host determinants of HIV entry is the only strategy that would prevent viral DNA-mediated CD4(+) cell death while diminishing the possibility for the virus to escape. To this end, we devised a bicistronic lentiviral vector expressing the membrane-bound form of the T20 fusion inhibitor, referred to as the C46 peptide, and a CCR5 superagonist, modified to sequester CCR5 away from the cell surface, referred to as the P2-CCL5 intrakine. We tested the effects of the vector on HIV infection and replication, using the human CEMR5 cell line expressing CD4 and CCR5, and primary human T cells. Transduced cells expressed the C46 peptide, detected with the 2F5 monoclonal antibody by flow cytometry. Expression of the P2-CCL5 intrakine correlates with lower levels of cell surface CCR5. Complete protection against HIV infection could be observed in cells expressing the protective transgenes. Importantly, we show that the combination of the transgenes was more potent than either transgene alone, showing the interest of expressing two entry inhibitors to inhibit HIV infection. Last, genetically modified cells possessed a selective advantage over nonmodified cells on HIV challenge in vitro, showing that modified cells were protected from HIV-induced cell death. Our results demonstrate that lentiviral vectors coexpressing the T20 fusion inhibitor and the P2-CCL5 intrakine represent promising tools for HIV gene therapy.
-
A Rapid Method for Engineering Recombinant Polioviruses or Other Enteroviruses.
Bessaud, Maël; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis
2016-01-01
The cloning of large enterovirus RNA sequences is labor-intensive because of the frequent instability in bacteria of plasmidic vectors containing the corresponding cDNAs. In order to circumvent this issue we have developed a PCR-based method that allows the generation of highly modified or chimeric full-length enterovirus genomes. This method relies on fusion PCR which enables the concatenation of several overlapping cDNA amplicons produced separately. A T7 promoter sequence added upstream the fusion PCR products allows its transcription into infectious genomic RNAs directly in transfected cells constitutively expressing the phage T7 RNA polymerase. This method permits the rapid recovery of modified viruses that can be subsequently amplified on adequate cell-lines.
-
[Establishment of RAW264.7 cell strain stably expressing RFP-GFP-LC3].
Wang, Wan; Zhang, Qing; Zhao, Runpeng; Xu, Xuewei; Xing, Yingru; Zhang, Rongbo; Wu, Jing; Hu, Dong
2015-09-01
To establish murine macrophage RAW264.7 cell strain with stable expression of red fluorescent protein-green fluorescent protein-microtubule associated protein light chain 3 (RFP-GFP-LC3). A lentiviral vector containing RFP-GFP-LC3 gene was constructed and then packaged in HEK293T cells with the packaging plasmids. The viral supernatant was collected to infect RAW264.7 cells. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 was screened with puromycin and analyzed with flow cytometry and fluorescent microscopy for infection efficiency. The number of RFP-GFP-LC3 puncta was observed using florescence microscopy following starvation treatment. The recombinant lentivirus pLV-CMV-RFP-GFP-LC3 was successfully constructed. The RAW264.7 cells with stable expression of RFP-GFP-LC3 were obtained by viral infection and puromycin screening. Fluorescent microscopy and flow cytometry demonstrated the expression rates of RFP and GFP reached to 100%. The number of autophagic puncta significantly increased after starvation treatment. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 has been successfully constructed, which provides a reliable cellular platform for autophagy research.
-
Wang, Yuchen; Sima, Linshan; Lv, Jie; Huang, Suiyuan; Liu, Ying; Wang, Jiao; Krupovic, Mart; Chen, Xiangdong
2016-07-15
The temperate haloarchaeal virus SNJ1 displays lytic and lysogenic life cycles. During the lysogenic cycle, the virus resides in its host, Natrinema sp. strain J7-1, in the form of an extrachromosomal circular plasmid, pHH205. In this study, a 3.9-kb region containing seven predicted genes organized in two operons was identified as the minimal replicon of SNJ1. Only RepA, encoded by open reading frame 11-12 (ORF11-12), was found to be essential for replication, and its expression increased during the lytic cycle. Sequence analysis suggested that RepA is a distant homolog of HUH endonucleases, a superfamily that includes rolling-circle replication initiation proteins from various viruses and plasmids. In addition to RepA, two genetic elements located within both termini of the 3.9-kb replicon were also required for SNJ1 replication. SNJ1 genome and SNJ1 replicon-based shuttle vectors were present at 1 to 3 copies per chromosome. However, the deletion of ORF4 significantly increased the SNJ1 copy number, suggesting that the product of ORF4 is a negative regulator of SNJ1 abundance. Shuttle vectors based on the SNJ1 replicon were constructed and validated for stable expression of heterologous proteins, both in J7 derivatives and in Natrinema pallidum JCM 8980(T), suggesting their broad applicability as genetic tools for Natrinema species. Archaeal viruses exhibit striking morphological diversity and unique gene content. In this study, the minimal replicon of the temperate haloarchaeal virus SNJ1 was identified. A number of ORFs and genetic elements controlling virus genome replication, maintenance, and copy number were characterized. In addition, based on the replicon, a novel expression shuttle vector has been constructed and validated for protein expression and purification in Natrinema sp. CJ7 and Natrinema pallidum JCM 8980(T) This study not only provided mechanistic and functional insights into SNJ1 replication but also led to the development of useful genetic tools to investigate SNJ1 and other viruses infecting Natrinema species as well as their hosts. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
-
Amici, Carla; Visintin, Michela; Verachi, Francesca; Paolini, Francesca; Percario, Zulema; Di Bonito, Paola; Mandarino, Angela; Affabris, Elisabetta; Venuti, Aldo; Accardi, Luisa
2016-01-01
Single-chain variable fragments (scFvs) expressed as “intracellular antibodies” (intrabodies) can target intracellular antigens to hamper their function efficaciously and specifically. Here we use an intrabody targeting the E6 oncoprotein of Human papillomavirus 16 (HPV16) to address the issue of a non-invasive therapy for HPV cancer patients. A scFv against the HPV16 E6 was selected by Intracellular Antibody Capture Technology and expressed as I7nuc in the nucleus of HPV16-positive SiHa, HPV-negative C33A and 293T cells. Colocalization of I7nuc and recombinant E6 was observed in different cell compartments, obtaining evidence of E6 delocalization ascribable to I7nuc. In SiHa cells, I7nuc expressed by pLNCX retroviral vector was able to partially inhibit degradation of the main E6 target p53, and induced p53 accumulation in nucleus. When analyzing in vitro activity on cell proliferation and survival, I7nuc was able to decrease growth inducing late apoptosis and necrosis of SiHa cells. Finally, I7nuc antitumor activity was demonstrated in two pre-clinical models of HPV tumors. C57BL/6 mice were injected subcutaneously with HPV16-positive TC-1 or C3 tumor cells, infected with pLNCX retroviral vector expressing or non-expressing I7nuc. All the mice injected with I7nuc-expressing cells showed a clear delay in tumor onset; 60% and 40% of mice receiving TC-1 and C3 cells, respectively, remained tumor-free for 17 weeks of follow-up, whereas 100% of the controls were tumor-bearing 20 days post-inoculum. Our data support the therapeutic potential of E6-targeted I7nuc against HPV tumors. PMID:26788990
-
Distinct susceptibility of HIV vaccine vector-induced CD4 T cells to HIV infection
Niu, Qingli; Hou, Wei; Churchyard, Gavin; Nitayaphan, Sorachai; Pitisuthithum, Punnee; Rerks-Ngarm, Supachai; Franchini, Genoveffa
2018-01-01
The concerns raised from adenovirus 5 (Ad5)-based HIV vaccine clinical trials, where excess HIV infections were observed in some vaccine recipients, have highlighted the importance of understanding host responses to vaccine vectors and the HIV susceptibility of vector-specific CD4 T cells in HIV vaccination. Our recent study reported that human Ad5-specific CD4 T cells induced by Ad5 vaccination (RV156A trial) are susceptible to HIV. Here we further investigated the HIV susceptibility of vector-specific CD4 T cells induced by ALVAC, a canarypox viral vector tested in the Thai trial RV144, as compared to Ad5 vector-specific CD4 T cells in the HVTN204 trial. We showed that while Ad5 vector-specific CD4 T cells were readily susceptible to HIV, ALVAC-specific CD4 T cells in RV144 PBMC were substantially less susceptible to both R5 and X4 HIV in vitro. The lower HIV susceptibility of ALVAC-specific CD4 T cells was associated with the reduced surface expression of HIV entry co-receptors CCR5 and CXCR4 on these cells. Phenotypic analyses identified that ALVAC-specific CD4 T cells displayed a strong Th1 phenotype, producing higher levels of IFN-γ and CCL4 (MIP-1β) but little IL-17. Of interest, ALVAC and Ad5 vectors induced distinct profiles of vector-specific CD8 vs. CD4 T-cell proliferative responses in PBMC, with ALVAC preferentially inducing CD8 T-cell proliferation, while Ad5 vector induced CD4 T-cell proliferation. Depletion of ALVAC-, but not Ad5-, induced CD8 T cells in PBMC led to a modest increase in HIV infection of vector-specific CD4 T cells, suggesting a role of ALVAC-specific CD8 T cells in protecting ALVAC-specific CD4 T cells from HIV. Taken together, our data provide strong evidence for distinct HIV susceptibility of CD4 T cells induced by different vaccine vectors and highlight the importance of better evaluating anti-vector responses in HIV vaccination. PMID:29474461
-
[Construction of transgenic tobacco expressing popW and analysis of its biological phenotype].
Wang, Cui; Liu, Hongxia; Cao, Jing; Wang, Chao; Guo, Jianhua
2014-04-01
In a previous study, we cloned popW from Ralstonia solanacearum strain ZJ3721, coding PopW, a new harpin protein. The procaryotically expressed PopW can induce resistance to Tobacco mosaic virus (TMV), enhance growth and improve quality of tobacco, when sprayed onto tobacco leaves. Here, we constructed an expression vector pB- popW by cloning popW into the bionary vector pBI121 and transformed it into Agrobacterium tumefaciens strain EHA105 via freeze-thaw method. Tobacco (Nicotiana tobacum cv. Xanthi nc.) transformation was conducted by infection of tobacco leaf discs with recombinant A. tumefaciens. After screening on MS medium containing kanamycin, PCR and RT-PCR analysis, 21 T3 lines were identified as positive transgenic. Genomic intergration and expression of the transferred gene were determined by PCR and RT-PCR. And GUS staining analysis indicated that the protein expressed in transgenic tobacco was bioactive and exhibited different expression levels among lines. Disease bioassays showed that the transgenic tobacco had enhanced resistance to TMV with biocontrol efficiency up to 54.25%. Transgenic tobacco also exhibited enhanced plant growth, the root length of 15 d old seedlings was 1.7 times longer than that of wild type tobacco. 60 d after transplanting to pots, the height, fresh weight and dry weight of transgenic tobacco were 1.4, 1.7, 1.8 times larger than that of wild type tobacco, respectively.
-
Zuo, Qisheng; Jin, Kai; Wang, Yingjie; Song, Jiuzhou; Zhang, Yani; Li, Bichun
2017-08-01
We previously found that C1EIS is preferentially expressed in Chicken spermatogonial stem cells (SSCs) by RNA sequencing (RNA-seq), so our current study focused on C1EIS's role in Chicken embryonic stem cells (ESCs) differentiation into male germ cells. We constructed a CRISPR/Cas9 vector targeting C1EIS. T7 endonuclease I (T7EI) digestion method and sequencing of TA cloning were used to detect the knock-out efficiency of the Single guide RNA (sgRNA) after the cas9/gRNA vector transfected into D fibroblasts 1(DF-1), ESCs, and Chicken embryos. The results showed that CRISPR/Cas9 gene knockout efficiency is about 40%. Differentiation of the targeted ESCs into SSCs was inhibited at the embryoid body stage due to C1EIS deficiency. Immunofluorescent staining revealed that the mutagenized ESCs (RA (Retinoic Acid) with C1EIS Knock out) expressed lower levels of integrin α6 and integrin β1 compared to wild type cells. Quantitative real-time PCR (QRT-PCR) revealed Oct4 and Sox2 expression significantly increased, contrarily integrin β1 and Stra8 expression significantly decreased than RA induced group and RA with C1EIS Overexpression. During retinoic acid-induced differentiation, knockout of C1EIS in ESCs inhibited formation of SSC-like cells, suggesting C1EIS plays a vital role in promoting differentiation of avian ESCs to SSCs by regulating expression of multiple pluripotency-related genes. J. Cell. Biochem. 118: 2380-2386, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
-
Balakrishnan, R; Bolten, B; Backman, K C
1994-01-28
A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.
-
Ramsingh, Arlene I.; Gray, Steven J.; Reilly, Andrew; Koday, Michael; Bratt, Debbie; Koday, Merika Treants; Murnane, Robert; Hu, Yuhui; Messer, Anne
2018-01-01
A critical issue in transgene delivery studies is immune reactivity to the transgene- encoded protein and its impact on sustained gene expression. Here, we test the hypothesis that immunomodulation by rapamycin can decrease immune reactivity after intrathecal AAV9 delivery of a transgene (GFP) in non-human primates, resulting in sustained GFP expression in the CNS. We show that rapamycin treatment clearly reduced the overall immunogenicity of the AAV9/GFP vector by lowering GFP- and AAV9-specific antibody responses, and decreasing T cell responses including cytokine and cytolytic effector responses. Spinal cord GFP protein expression was sustained for twelve weeks, with no toxicity. Immune correlates of robust transgene expression include negligible GFP-specific CD4 and CD8 T cell responses, absence of GFP-specific IFN-γ producing T cells, and absence of GFP-specific cytotoxic T cells, which support the hypothesis that decreased T cell reactivity results in sustained transgene expression. These data strongly support the use of modest doses of rapamycin to modulate immune responses for intrathecal gene therapies, and potentially a much wider range of viral vector-based therapeutics. PMID:29874260
-
Cytoplasmic bacteriophage display system
Studier, F.W.; Rosenberg, A.H.
1998-06-16
Disclosed are display vectors comprising DNA encoding a portion of a structural protein from a cytoplasmic bacteriophage, joined covalently to a protein or peptide of interest. Exemplified are display vectors wherein the structural protein is the T7 bacteriophage capsid protein. More specifically, in the exemplified display vectors the C-terminal amino acid residue of the portion of the capsid protein is joined to the N-terminal residue of the protein or peptide of interest. The portion of the T7 capsid protein exemplified comprises an N-terminal portion corresponding to form 10B of the T7 capsid protein. The display vectors are useful for high copy number display or lower copy number display (with larger fusion). Compositions of the type described herein are useful in connection with methods for producing a virus displaying a protein or peptide of interest. 1 fig.
-
Cytoplasmic bacteriophage display system
Studier, F. William; Rosenberg, Alan H.
1998-06-16
Disclosed are display vectors comprising DNA encoding a portion of a structural protein from a cytoplasmic bacteriophage, joined covalently to a protein or peptide of interest. Exemplified are display vectors wherein the structural protein is the T7 bacteriophage capsid protein. More specifically, in the exemplified display vectors the C-terminal amino acid residue of the portion of the capsid protein is joined to the N-terminal residue of the protein or peptide of interest. The portion of the T7 capsid protein exemplified comprises an N-terminal portion corresponding to form 10B of the T7 capsid protein. The display vectors are useful for high copy number display or lower copy number display (with larger fusion). Compositions of the type described herein are useful in connection with methods for producing a virus displaying a protein or peptide of interest.
-
Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F
2007-12-01
This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 10(7) transformants/microg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive P(pampS) promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by approximately 91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains.
-
2008-06-01
verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus
-
Hsu, Cary; Jones, Stephanie A.; Cohen, Cyrille J.; Zheng, Zhili; Kerstann, Keith; Zhou, Juhua; Robbins, Paul F.; Peng, Peter D.; Shen, Xinglei; Gomes, Theotonius J.; Dunbar, Cynthia E.; Munroe, David J.; Stewart, Claudia; Cornetta, Kenneth; Wangsa, Danny; Ried, Thomas; Rosenberg, Steven A.
2007-01-01
Malignancies arising from retrovirally transduced hematopoietic stem cells have been reported in animal models and human gene therapy trials. Whether mature lymphocytes are susceptible to insertional mutagenesis is unknown. We have characterized a primary human CD8+ T-cell clone, which exhibited logarithmic ex vivo growth in the absence of exogenous cytokine support for more than 1 year after transduction with a murine leukemia virus–based vector encoding the T-cell growth factor IL-15. Phenotypically, the clone was CD28−, CD45RA−, CD45RO+, and CD62L−, a profile consistent with effector memory T lymphocytes. After gene transfer with tumor-antigen–specific T-cell receptors, the clone secreted IFN-γ upon encountering tumor targets, providing further evidence that they derived from mature lymphocytes. Gene-expression analyses revealed no evidence of insertional activation of genes flanking the retroviral insertion sites. The clone exhibited constitutive telomerase activity, and the presence of autocrine loop was suggested by impaired cell proliferation following knockdown of IL-15Rα expression. The generation of this cell line suggests that nonphysiologic expression of IL-15 can result in the long-term in vitro growth of mature human T lymphocytes. The cytokine-independent growth of this line was a rare event that has not been observed in other IL-15 vector transduction experiments or with any other integrating vector system. It does not appear that the retroviral vector integration sites played a role in the continuous growth of this cell clone, but this remains under investigation. PMID:17353346
-
Genomic Approaches for Detection and Treatment of Breast Cancer
2006-07-01
display vectors to allow for both lytic and filamentous versions of the library. For lytic phage display, we chose the T7 -based vector T7Select®10-3b... phage , which do not display a FLAG epitope (data not shown). These data suggest that peptides can be displayed on the surface of T7 using this system...Auto-Antibodies as Breast Cancer Biomarkers To identify auto-antibodies that could be used as breast cancer biomarkers, we are generating a phage
-
Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa
2010-03-01
Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.
-
Chen, Po Ting; Shaw, Jei-Fu; Chao, Yun-Peng; David Ho, Tuan-Hua; Yu, Su-May
2010-05-12
Bacillus subtilis is most commonly employed for secretion of recombinant proteins. To circumvent the problems caused by using plasmids, the T7 expression system known for its high efficiency was rebuilt in B. subtilis. Accordingly, a markerless and replicon-free method was developed for genomic insertion of DNAs. By the act of homologous recombination via the guide DNA, a suicidal vector carrying the gene of interest was integrated into genomic loci of bacteria. Removal of the inserted selection marker and replicon flanked by FRT sites was mediated by the FLP recombinase. By using the mentioned system, B. subtilis strain PT5 was constructed to harbor a genomic copy of the spac promoter-regulated T7 gene 1 located at wprA (encoding the cell wall-associated protease). Similarly, the T7 promoter-driven nattokinase or endoglucanase E1 of Thermomonospora fusca genes were also integrated into mpr (encoding an extracellular protease) of strain PT5. Consequently, the integrant PT5/Mmp-T7N or PT5/MT1-E1 resulted in a "clean" producer strain deprived of six proteases. After 24 h, the strain receiving induction was able to secret nattokinase and endoglucanase E1 with the volumetric activity reaching 10860 CU/mL and 8.4 U/mL, respectively. This result clearly indicates the great promise of the proposed approach for high secretion of recombinant proteins in B. subtilis.
-
Huang, Ke jian; Wu, Wei dong; Jiang, Tao; Cao, Jun; Feng, Zhen zhong; Qiu, Zheng jun
2011-01-01
Aims Transducer and activator of transcription-3 (STAT3) plays an important role in tumor cell invasion and metastasis. The aim of the present study was to investigate the effects of STAT3 knockdown in nude mouse xenografts of pancreatic cancer cells and underlying gene expression. Methods A STAT3 shRNA lentiviral vector was constructed and infected into SW1990 cells. qRT-PCR and western immunoblot were performed to detect gene expression. Nude mouse xenograft assays were used to assess changes in phenotypes of these stable cells in vivo. HE staining was utilized to evaluate tumor cell invasion and immunohistochemistry was performed to analyze gene expression. Results STAT3 shRNA successfully silenced expression of STAT3 mRNA and protein in SW1990 cells compared to control cells. Growth rate of the STAT3-silenced tumor cells in nude mice was significantly reduced compared to in the control vector tumors and parental cells-generated tumors. Tumor invasion into the vessel and muscle were also suppressed in the STAT3-silenced tumors compared to controls. Collagen IV expression was complete and continuous surrounding the tumors of STAT3-silenced SW1990 cells, whereas collagen IV expression was incomplete and discontinuous surrounding the control tumors. Moreover, microvessel density was significantly lower in STAT3-silenced tumors than parental or control tumors of SW1990 cells. In addition, MMP-7 expression was reduced in STAT3-silenced tumors compared to parental SW1990 xenografts and controls. In contrast, expression of IL-1β and IgT7α was not altered. Conclusion These data clearly demonstrate that STAT3 plays an important role in regulation of tumor growth, invasion, and angiogenesis, which could be act by reducing MMP-7 expression in pancreatic cancer cells. PMID:21991388
-
Reverse Genetics of Newcastle Disease Virus.
Cardenas-Garcia, Stivalis; Afonso, Claudio L
2017-01-01
Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.
-
Zhao, Yue; Ruan, Xiangyan; Wang, Husheng; Li, Xue; Gu, Muqing; Wang, Lijuan; Li, Yanglu; Seeger, Harald; Mueck, Alfred O
2017-08-01
During menopausal hormone therapy (MHT) a possible increase in breast cancer risk is thought to depend mainly on the progestogen component. In vitro studies have shown that the progesterone receptor membrane component 1 (PGRMC1) is important for tumor proliferation induced by progestogens. The primary aim of this study was to compare for the first time the natural progestogen, progesterone (P), with a synthetic progestogen, norethisterone (NET), using a xenograft model. MCF7 cells, transfected with PGRMC1 plasmid or empty vector, were injected into nude mice and estradiol (E2) pellets were implanted. After 12days, NET or P or placebo pellets were implanted. Tumor volumes in all groups (6 mice/group) were monitored for 6-7 weeks. Immunohistochemical expression of PGRMC1 and KI-67 was assessed. These experiments were repeated using T47D cells. Compared with the control condition, E2 and sequential E2/NET combination increased xenograft tumor growth with MCF7 and T47D cells that transgenically expressed PGRMC1 (p<0.01); progesterone did not increase growth. Breast cancer cells transfected with empty vectors did not respond to either progestogen. Comparing KI-67 and PGRMC1 expression, the Pearson correlation was r=0.848, p=0.002. E2 plus NET increases tumor growth in human breast cancer cells overexpressing PGRMC1, but there is no change with progesterone. To our knowledge, this is the first comparison of both progestogens in vivo using nude mice, which are frequently used in xenograft models. Clinical trials are needed to determine whether women with overexpression of PGRMC1 are at increased risk of breast cancer if NET instead of progesterone is used in MHT. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto
2016-01-01
An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299
-
Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa
2008-10-01
A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view.
-
Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan
2014-01-01
In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961
-
Fishbein, Ilia; Forbes, Scott P.; Chorny, Michael; Connolly, Jeanne M.; Adamo, Richard F.; Corrales, Ricardo; Alferiev, Ivan S.; Levy, Robert J.
2013-01-01
The use of arterial stents and other medical implants as a delivery platform for surface immobilized gene vectors allows for safe and efficient localized expression of therapeutic transgenes. In this study we investigate the use of hydrolysable cross-linkers with distinct kinetics of hydrolysis for delivery of gene vectors from polyallylamine bisphosphonate-modified metal surfaces. Three cross-linkers with the estimated t1/2 of ester bonds hydrolysis of 5, 12 and 50 days demonstrated a cumulative 20%, 39% and 45% vector release, respectively, after 30 days exposure to physiological buffer at 37°C. Transgene expression in endothelial and smooth muscles cells transduced with substrate immobilized adenovirus resulted in significantly different expression profiles for each individual cross-linker. Furthermore, immobilization of adenoviral vectors effectively extended their transduction effectiveness beyond the initial phase of release. Transgene expression driven by adenovirus-tethered stents in rat carotid arteries demonstrated that a faster rate of cross-linker hydrolysis resulted in higher expression levels at day 1, which declined by day 8 after stent implantation, while inversely, slower hydrolysis was associated with increased arterial expression at day 8 in comparison with day 1. In conclusion, adjustable release of transduction-competent adenoviral vectors from metallic surfaces can be achieved, both in vitro and in vivo, through surface immobilization of adenoviral vectors using hydrolysable cross-linkers with structure-specific release kinetics. PMID:23777912
-
Barcia, Carlos; Gerdes, Christian; Xiong, Wei-Dong; Thomas, Clare E.; Liu, Chunyan; Kroeger, Kurt M.; Castro, Maria G.; Lowenstein, Pedro R.
2007-01-01
First-generation adenovirus can be engineered with powerful promoters to drive expression of therapeutic transgenes. Numerous clinical trials for glioblastoma multiforme using first generation adenoviral vectors have either been performed or are ongoing, including an ongoing, Phase III, multicenter trial in Europe and Israel (Ark Therapeutics, Inc.). Although in the absence of anti-adenovirus immune responses expression in the brain lasts 6–18 months, systemic infection with adenovirus induces immune responses that inhibit dramatically therapeutic transgene expression from first generation adenoviral vectors, thus, potentially compromising therapeutic efficacy. Here, we show evidence of an immunization threshold for the dose that generates an immune response strong enough to eliminate transgene expression from the CNS. For the systemic immunization to eliminate transgene expression from the brain, ≥1 × 107 infectious units (iu) of adenovirus need to be used as immunogen. Furthermore, this immune response eliminates >90% of transgene expression from 1 × 107–1 × 10³ iu of vector injected into the striatum 60 days earlier. Importantly, elimination of transgene expression is independent of the nature of the promoter that drives transgene expression and is accompanied by brain infiltration of CD8+ T cells and macrophages. In conclusion, once the threshold for systemic immunization (i.e. 1 × 107 iu) is crossed, the immune response eliminates transgene expression by >90% even from brains that receive as little as 1000 iu of adenoviral vectors, independently of the type of promoter that drives expression. PMID:18084640
-
Fonseca, Jairo Andres; Cabrera-Mora, Monica; Kashentseva, Elena A; Villegas, John Paul; Fernandez, Alejandra; Van Pelt, Amelia; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto
2016-01-01
A malaria vaccine is a public health priority. In order to produce an effective vaccine, a multistage approach targeting both the blood and the liver stage infection is desirable. The vaccine candidates also need to induce balanced immune responses including antibodies, CD4+ and CD8+ T cells. Protein-based subunit vaccines like RTS,S are able to induce strong antibody response but poor cellular reactivity. Adenoviral vectors have been effective inducing protective CD8+ T cell responses in several models including malaria; nonetheless this vaccine platform exhibits a limited induction of humoral immune responses. Two approaches have been used to improve the humoral immunogenicity of recombinant adenovirus vectors, the use of heterologous prime-boost regimens with recombinant proteins or the genetic modification of the hypervariable regions (HVR) of the capsid protein hexon to express B cell epitopes of interest. In this study, we describe the development of capsid modified Ad5 vectors that express a promiscuous Plasmodium yoelii T helper epitope denominated PyT53 within the hexon HVR2 region. Several regimens were tested in mice to determine the relevance of the hexon modification in enhancing protective immune responses induced by the previously described protein-based multi-stage experimental vaccine PyCMP. A heterologous prime-boost immunization regime that combines a hexon modified vector with transgenic expression of PyCMP followed by protein immunizations resulted in the induction of robust antibody and cellular immune responses in comparison to a similar regimen that includes a vector with unmodified hexon. These differences in immunogenicity translated into a better protective efficacy against both the hepatic and red blood cell stages of P. yoelii. To our knowledge, this is the first time that a hexon modification is used to deliver a promiscuous T cell epitope. Our data support the use of such modification to enhance the immunogenicity and protective efficacy of adenoviral based malaria vaccines.
-
Bacterial delivery of RNAi effectors: transkingdom RNAi.
Lage, Hermann; Krühn, Andrea
2010-08-18
RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.
-
1992-02-01
Division (Code RM) ONERA Office of Aeronautics & Space Technology 29 ave de la Division Leclerc NASA Hq 92320 Chfitillon Washington DC 20546 France United...Vector of thickness variables. V’ = [ t2 ........ tN Vector of thickness changes. AV ’= [rt, 5t2 ......... tNJ TI 7-9 Vector of strain derivatives. F...ds, ds, I d, 1i’,= dt, dr2 ........ dt--N Vector of buckling derivatives. dX d). , dt1 dt2 dtN Then 5F= Vs’i . AV and SX V,’. AV The linearised
-
Plasmodium parasite as an effective hepatocellular carcinoma antigen glypican-3 delivery vector.
Liu, Quan; Yang, Yijun; Tan, Xuefang; Tao, Zhu; Adah, Dickson; Yu, Songlin; Lu, Junnan; Zhao, Siting; Qin, Limei; Qin, Li; Chen, Xiaoping
2017-04-11
We have previously demonstrated that malaria parasite infection has an anti-tumor effect in a mouse model. This research aimed to investigate the possibility of using Plasmodium parasite as a novel vaccine vector for hepatocellular carcinoma (HCC) immunotherapy. We constructed a Plasmodium yoelii 17XNL strain (P.y) expressing murine glypican-3 (GPC3) protein (P.y-GPC3), and examined its therapeutic potency in a murine Hepa1-6-induced hepatoma model that highly expressed GPC3 protein. The prerequisites for invoking a CD8+ T cell response were assessed after P.y-based immunization, which included obviously increased concentrations of T helper cell type 1 (Th1)-associated cytokines, such as IL-2, IFN-γ and TNF-α, in serum and preferential expansion of the CD8α+ dendritic cell (DC) subset with higher expression of CD80 and CD86 molecules. Compared with uninfected and wild-type P.y-infected mice, a significant GPC3-specific cytotoxic T lymphocyte (CTL) response was detected in P.y-GPC3 vaccinated mice. Furthermore, P.y-GPC3-based vaccination dramatically inhibited Hepa1-6-induced tumor growth in the implanted HCC and prolonged the survival of tumor-bearing mice. We concluded that a Plasmodium-based vector is highly efficient in inducing tumor antigen-specific T cell-mediated immunity and protection against tumor cells. More broadly, this strategy supported our hypothesis that Plasmodium parasites, as novel therapeutic antigen vectors, may be applicable to tumor immunotherapy for patients with HCC.
-
Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra
2009-01-01
The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778
-
Engineered Lentivector Targeting of Dendritic Cells for In Vivo Immunization
Yang, Lili; Yang, Haiguang; Rideout, Kendra; Cho, Taehoon; Joo, Kye il; Ziegler, Leslie; Elliot, Abigail; Walls, Anthony; Yu, Dongzi; Baltimore, David; Wang, Pin
2008-01-01
We report a method of inducing antigen production in dendritic cells (DCs) by in vivo targeting with lentiviral vectors that specifically bind to the DC surface protein, DC-SIGN. To target the DCs, the lentivector was enveloped with a viral glycoprotein from Sindbis virus, engineered to be DC-SIGN-specific. In vitro, this lentivector specifically transduced DCs and induced DC maturation. A remarkable frequency (up to 12%) of ovalbumin (OVA)-specific CD8+ T cells and a significant antibody response were observed 2 weeks following injection of a targeted lentiviral vector encoding an OVA transgene into naïve mice. These mice were solidly protected against the growth of the OVA-expressing E.G7 tumor and this methodology could even induce regression of an established tumor. Thus, lentiviral vectors targeting DCs provide a simple method of producing effective immunity and may provide an alternative route for immunization with protein antigens. PMID:18297056
-
Srivastava, Preeti; Deb, J K
2002-07-02
A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ilgu, Muslum
A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.
-
Stornaiuolo, Anna; Piovani, Bianca Maria; Bossi, Sergio; Zucchelli, Eleonora; Corna, Stefano; Salvatori, Francesca; Mavilio, Fulvio; Bordignon, Claudio; Rizzardi, Gian Paolo; Bovolenta, Chiara
2013-08-01
Over the last two decades, several attempts to generate packaging cells for lentiviral vectors (LV) have been made. Despite different technologies, no packaging clone is currently employed in clinical trials. We developed a new strategy for LV stable production based on the HEK-293T progenitor cells; the sequential insertion of the viral genes by integrating vectors; the constitutive expression of the viral components; and the RD114-TR envelope pseudotyping. We generated the intermediate clone PK-7 expressing constitutively gag/pol and rev genes and, by adding tat and rd114-tr genes, the stable packaging cell line RD2-MolPack, which can produce LV carrying any transfer vector (TV). Finally, we obtained the RD2-MolPack-Chim3 producer clone by transducing RD2-MolPack cells with the TV expressing the anti-HIV transgene Chim3. Remarkably, RD114-TR pseudovirions have much higher potency when produced by stable compared with transient technology. Most importantly, comparable transduction efficiency in hematopoietic stem cells (HSC) is obtained with 2-logs less physical particles respect to VSV-G pseudovirions produced by transient transfection. Altogether, RD2-MolPack technology should be considered a valid option for large-scale production of LV to be used in gene therapy protocols employing HSC, resulting in the possibility of downsizing the manufacturing scale by about 10-fold in respect to transient technology.
-
USDA-ARS?s Scientific Manuscript database
We previously demonstrated that an adenovirus-based FMDV serotype A24 subunit vaccine, Ad5-A24, expressed under the control of a cytomegalovirus promoter (CMV) can protect swine and bovines against homologous challenge, but swine vaccinated with an Ad5-vectored FMDV O1 Campos vaccine, Ad5-O1Campos (...
-
Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.
2011-01-01
Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234
-
Nygårdas, Michaela; Paavilainen, Henrik; Müther, Nadine; Nagel, Claus-Henning; Röyttä, Matias; Sodeik, Beate; Hukkanen, Veijo
2013-01-01
Herpes simplex virus type 1 (HSV-1) has properties that can be exploited for the development of gene therapy vectors. The neurotropism of HSV enables delivery of therapeutic genes to the nervous system. Using a bacterial artificial chromosome (BAC), we constructed an HSV-1(17+)-based replicative vector deleted of the neurovirulence gene γ134.5, and expressing leukemia inhibitory factor (LIF) as a transgene for treatment of experimental autoimmune encephalomyelitis (EAE). EAE is an inducible T-cell mediated autoimmune disease of the central nervous system (CNS) and is used as an animal model for multiple sclerosis. Demyelination and inflammation are hallmarks of both diseases. LIF is a cytokine that has the potential to limit demyelination and oligodendrocyte loss in CNS autoimmune diseases and to affect the T-cell mediated autoimmune response. In this study SJL/J mice, induced for EAE, were treated with a HSV-LIF vector intracranially and the subsequent changes in disease parameters and immune responses during the acute disease were investigated. Replicating HSV-LIF and its DNA were detected in the CNS during the acute infection, and the vector spread to the spinal cord but was non-virulent. The HSV-LIF significantly ameliorated the EAE and contributed to a higher number of oligodendrocytes in the brains when compared to untreated mice. The HSV-LIF therapy also induced favorable changes in the expression of immunoregulatory cytokines and T-cell population markers in the CNS during the acute disease. These data suggest that BAC-derived HSV vectors are suitable for gene therapy of CNS disease and can be used to test the therapeutic potential of immunomodulatory factors for treatment of EAE. PMID:23700462
-
Lin, Chao-Fen; Lo, Ta-Chun; Kuo, Yang-Cheng; Lin, Thy-Hou
2013-04-01
An integration vector capable of stably integrating and maintaining in the chromosomes of several lactobacilli over hundreds of generations has been constructed. The major integration machinery used is based on the ΦAT3 integrase (int) and attP sequences determined previously. A novel core sequence located at the 3' end of the tRNA(leu) gene is identified in Lactobacillus fermentum ATCC 14931 as the integration target by the integration vector though most of such sequences found in other lactobacilli are similar to that determined previously. Due to the lack of an appropriate attB site in Lactococcus lactis MG1363, the integration vector is found to be unable to integrate into the chromosome of the strain. However, such integration can be successfully restored by cotransforming the integration vector with a replicative one harboring both attB and erythromycin resistance sequences into the strain. Furthermore, the integration vector constructed carries a promoter region of placT from the chromosome of Lactobacillus rhamnosus TCELL-1 which is used to express green fluorescence and luminance protein genes in the lactobacilli studied.
-
Fibrinolysis in Tumor Associated Angiogenesis
2005-07-01
tPA expression in mammary vessel assays and in animals with use of retroviral vectors to deliver antisense RNA . We still intend to use that strategy...pads of nude mice. RNA obtained from tumor- and mam- mary fat pad-associated endothelial cells was used to synthesize cDNA and cDNA libraries, which... RNA (mRNA) for tPA and MT1-MMP, with some upregulation of uPA expression. BODY 1. Confirm differential expression of tPA and MT1-MIP with GAPDH control
-
Chattopadhyay, M; Krisky, D; Wolfe, D; Glorioso, JC; Mata, M; Fink, DJ
2005-01-01
We examined the utility of herpes simplex virus (HSV) vector-mediated gene transfer of vascular endothelial growth factor (VEGF) in a mouse model of diabetic neuropathy. A replication-incompetent HSV vector with VEGF under the control of the HSV ICP0 promoter (vector T0VEGF) was constructed. T0VEGF expressed and released VEGF from primary dorsal root ganglion (DRG) neurons in vitro, and following subcutaneous inoculation in the foot, expressed VEGF in DRG and nerve in vivo. At 2 weeks after induction of diabetes, subcutaneous inoculation of T0VEGF prevented the reduction in sensory nerve amplitude characteristic of diabetic neuropathy measured 4 weeks later, preserved autonomic function measured by pilocarpine-induced sweating, and prevented the loss of nerve fibers in the skin and reduction of neuropeptide calcitonin gene-related peptide and substance P in DRG neurons of the diabetic mice. HSV-mediated transfer of VEGF to DRG may prove useful in treatment of diabetic neuropathy. PMID:15843809
-
Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.
2003-01-01
In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432
-
Stark, Felicity C.; McCluskie, Michael J.; Krishnan, Lakshmi
2016-01-01
Homologous prime-boost vaccinations with live vectors typically fail to induce repeated strong CD8+ T cell responses due to the induction of anti-vector immunity, highlighting the need for alternative delivery vehicles. The unique ether lipids of archaea may be constituted into liposomes, archaeosomes, which do not induce anti-carrier responses, making them an ideal candidate for use in repeat vaccination systems. Herein, we evaluated in mice the maximum threshold of antigen-specific CD8+ T cell responses that may be induced by multiple homologous immunizations with ovalbumin (OVA) entrapped in archaeosomes derived from the ether glycerolipids of the archaeon Methanobrevibacter smithii (MS-OVA). Up to three immunizations with MS-OVA administered in optimized intervals (to allow for sufficient resting of the primed cells prior to boosting), induced a potent anti-OVA CD8+ T cell response of up to 45% of all circulating CD8+ T cells. Additional MS-OVA injections did not add any further benefit in increasing the memory of CD8+ T cell frequency. In contrast, OVA expressed by Listeria monocytogenes (LM-OVA), an intracellular bacterial vector failed to evoke a boosting effect after the second injection, resulting in significantly reduced antigen-specific CD8+ T cell frequencies. Furthermore, repeated vaccination with MS-OVA skewed the response increasingly towards an effector memory (CD62low) phenotype. Vaccinated animals were challenged with B16-OVA at late time points after vaccination (+7 months) and were afforded protection compared to control. Therefore, archaeosomes constituted a robust particulate delivery system to unravel the kinetics of CD8+ T cell response induction and memory maintenance and constitute an efficient vaccination regimen optimized for tumor protection. PMID:27869670
-
Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A
2014-01-01
We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.
-
Wave functions of the Q .Q interaction in terms of unitary 9-j coefficients
NASA Astrophysics Data System (ADS)
Zamick, Larry; Harper, Matthew
2015-03-01
We obtain wave functions for two protons and two neutrons in the g9 /2 shell expressed as column vectors with amplitudes D (Jp,Jn) . When we use a quadrupole-quadrupole interaction (Q .Q ) we get, in many cases, a very strong overlap with wave functions given by a single set of unitary 9-j coefficients—U 9 j =<(jj ) 2 j(jjJB|(jj ) Jp(jj ) Jn) I> . Here JB=9 for even I T =0 states. For both even and odd T =1 states we take JB equal to 8 whilst for odd I ,T =0 we take JB to be 7. We compare the Q .Q results with those of a more realistic interaction.
-
Rodríguez, Dolores; González-Aseguinolaza, Gloria; Rodríguez, Juan R.; Vijayan, Aneesh; Gherardi, Magdalena; Rueda, Paloma; Casal, J. Ignacio; Esteban, Mariano
2012-01-01
With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs) carrying the CD8+ T cell epitope (SYVPSAEQI) of the circumsporozoite (CS) protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS), and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8+ T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV) vectors from the Western Reserve (WR) and modified virus Ankara (MVA) strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria. PMID:22529915
-
Rodríguez, Dolores; González-Aseguinolaza, Gloria; Rodríguez, Juan R; Vijayan, Aneesh; Gherardi, Magdalena; Rueda, Paloma; Casal, J Ignacio; Esteban, Mariano
2012-01-01
With the aim to develop an efficient and cost-effective approach to control malaria, we have generated porcine parvovirus-like particles (PPV-VLPs) carrying the CD8(+) T cell epitope (SYVPSAEQI) of the circumsporozoite (CS) protein from Plasmodium yoelii fused to the PPV VP2 capsid protein (PPV-PYCS), and tested in prime/boost protocols with poxvirus vectors for efficacy in a rodent malaria model. As a proof-of concept, we have characterized the anti-CS CD8(+) T cell response elicited by these hybrid PPV-VLPs in BALB/c mice after immunizations with the protein PPV-PYCS administered alone or in combination with recombinant vaccinia virus (VACV) vectors from the Western Reserve (WR) and modified virus Ankara (MVA) strains expressing the entire P. yoelii CS protein. The results of different immunization protocols showed that the combination of PPV-PYCS prime/poxvirus boost was highly immunogenic, inducing specific CD8+ T cell responses to CS resulting in 95% reduction in liver stage parasites two days following sporozoite challenge. In contrast, neither the administration of PPV-PYCS alone nor the immunization with the vectors given in the order poxvirus/VLPs was as effective. The immune profile induced by VLPs/MVA boost was associated with polyfunctional and effector memory CD8+ T cell responses. These findings highlight the use of recombinant parvovirus PPV-PYCS particles as priming agents and poxvirus vectors, like MVA, as booster to enhance specific CD8+ T cell responses to Plasmodium antigens and to control infection. These observations are relevant in the design of T cell-inducing vaccines against malaria.
-
Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti
2014-08-01
To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.
-
CYTOMEGALOVIRUS VECTORS VIOLATE CD8+ T CELL EPITOPE RECOGNITION PARADIGMS
Hansen, Scott G.; Sacha, Jonah B.; Hughes, Colette M.; Ford, Julia C.; Burwitz, Benjamin J.; Scholz, Isabel; Gilbride, Roxanne M.; Lewis, Matthew S.; Gilliam, Awbrey N.; Ventura, Abigail B.; Malouli, Daniel; Xu, Guangwu; Richards, Rebecca; Whizin, Nathan; Reed, Jason S.; Hammond, Katherine B.; Fischer, Miranda; Turner, John M.; Legasse, Alfred W.; Axthelm, Michael K.; Edlefsen, Paul T.; Nelson, Jay A.; Lifson, Jeffrey D.; Früh, Klaus; Picker, Louis J.
2013-01-01
CD8+ T cell responses focus on a small fraction of pathogen- or vaccine-encoded peptides, and for some pathogens, these restricted recognition hierarchies limit the effectiveness of anti-pathogen immunity. We found that simian immunodeficiency virus (SIV) protein-expressing Rhesus Cytomegalovirus (RhCMV) vectors elicit SIV-specific CD8+ T cells that recognize unusual, diverse and highly promiscuous epitopes, including dominant responses to epitopes restricted by class II major histocompatibility complex (MHC) molecules. Induction of canonical SIV epitope-specific CD8+ T cell responses is suppressed by the RhCMV-encoded Rh189 (US11) gene, and the promiscuous MHC class I- and class II-restricted CD8+ T cell responses only occur in the absence of the Rh157.4-.6 (UL128-131) genes. Thus, CMV vectors can be genetically programmed to achieve distinct patterns of CD8+ T cell epitope recognition. PMID:23704576
-
Sun, Y; Qian, C; Peng, D; Prieto, J
2000-01-01
To investigate the cooperative effect of B7-1 and IL-12 in the induction of antitumor activity, we have developed retroviral vectors encoding human B7-1, murine IL-12, or both B7-1 and IL-12 coordinately. Murine transformed liver cells (BNL) were engineered to stably express B7-1, IL-12, or both by infection with corresponding retroviruses. No tumor was observed in 20, 75, and 95% of mice receiving, respectively, B7-1-, IL-12-, and B7-1/IL-12-modified tumor cells after 250 days of inoculation. In contrast, injection of parental BNL or BNL/Neo cells resulted in lethal tumor progression in all mice. Protection against rechallenge with parental tumor cells was observed only in mice who had rejected BNL/IL-12, but not in animals that rejected BNL/B7-1 or BNL/B7-1-IL-12. Growth of parental tumor cells was significantly delayed by simultaneous injection in a distant site of irradiated tumor cells engineered to express IL-12 or both B7-1 and IL-12 but not B7-1 alone. BNL/B7-1 and BNL/B7-1-IL-12 showed similar efficacy in these experiments. Antitumor immunity induced by B7, with or without IL-12, was found to depend mainly on CD4+ T cells with a minor contribution of a non-T cell mechanism; whereas the effect of IL-12 was dependent on CD8+ T cells and on non-T cell effectors. Immunization of mice with IL-12-modified BNL cells induced secretion of a Thl pattern of cytokines while immunization with cells expressing both IL-12 and B7-1 resulted in inhibition of IFN-gamma production. Immunization with BNL/B7-1-IL-12 cells in the presence of anti-human B7-1 MAb resulted in restoration of IFN-gamma production to the levels found in animals injected with BNL/IL-12 cells. To summarize, in our model coexpression of B7-1 and IL-12 in tumor cells does not result in improved antitumoral activity as compared with expression of IL-12 alone. This may be related to the fact that B7-1 changes the mechanisms of antitumor immunity and inhibits IFN-gamma production induced by IL-12 in vivo.
-
Tyrosine Mutation in AAV9 Capsid Improves Gene Transfer to the Mouse Lung.
Martini, Sabrina V; Silva, Adriana L; Ferreira, Debora; Rabelo, Rafael; Ornellas, Felipe M; Gomes, Karina; Rocco, Patricia R M; Petrs-Silva, Hilda; Morales, Marcelo M
2016-01-01
Adeno-associated virus (AAV) vectors are being increasingly used as the vector of choice for in vivo gene delivery and gene therapy for many pulmonary diseases. Recently, it was shown that phosphorylation of surface-exposed tyrosine residues from AAV capsid targets the viral particles for ubiquitination and proteasome-mediated degradation, and mutations of these tyrosine residues lead to highly efficient vector transduction in vitro and in vivo in different organs. In this study, we evaluated the pulmonary transgene expression efficacy of AAV9 vectors containing point mutations in surface-exposed capsid tyrosine residues. Eighteen C57BL/6 mice were randomly assigned into three groups: (1) a control group (CTRL) animals underwent intratracheal (i.t.) instillation of saline, (2) the wild-type AAV9 group (WT-AAV9, 1010 vg), and (3) the tyrosine-mutant Y731F AAV9 group (M-AAV9, 1010 vg), which received (i.t.) self-complementary AAV9 vectors containing the DNA sequence of enhanced green fluorescence protein (eGFP). Four weeks after instillation, lung mechanics, morphometry, tissue cellularity, gene expression, inflammatory cytokines, and growth factor expression were analyzed. No significant differences were observed in lung mechanics and morphometry among the experimental groups. However, the number of polymorphonuclear cells was higher in the WT-AAV9 group than in the CTRL and M-AAV9 groups, suggesting that the administration of tyrosine-mutant AAV9 vectors was better tolerated. Tyrosine-mutant AAV9 vectors significantly improved transgene delivery to the lung (30%) compared with their wild-type counterparts, without eliciting an inflammatory response. Our results provide the impetus for further studies to exploit the use of AAV9 vectors as a tool for pulmonary gene therapy. © 2016 The Author(s) Published by S. Karger AG, Basel.
-
Lu, Ying; McNearney, Terry A; Wilson, Steven P; Yeomans, David C; Westlund, Karin N
2008-03-01
This study assessed enkephalin expression induced by intra-articular application of recombinant, enkephalin-encoding herpes virus (HSV-1) and the impact of expression on nociceptive behaviours and synovial lining inflammation in arthritic rats. Replication-conditional HSV-1 recombinant vectors with cDNA encoding preproenkephalin (HSV-ENK), or control transgene beta-galactosidase cDNA (HSV-beta-gal; control) were injected into knee joints with complete Freund's adjuvant (CFA). Joint temperatures, circumferences and nociceptive behaviours were monitored on days 0, 7, 14 and 21 post CFA and vector treatments. Lumbar (L4-6) dorsal root ganglia (DRG) and spinal cords were immunostained for met-enkephalin (met-ENK), beta-gal, HSV-1 proteins and Fos. Joint tissues were immunostained for met-ENK, HSV-1 proteins, and inflammatory mediators Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and cyclo-oxygenase-2, or stained with haematoxylin and eosin for histopathology. Compared to exuberant synovial hypertrophy and inflammatory cell infiltration seen in arthritic rats treated with CFA only or CFA and HSV-beta-gal, the CFA- and HSV-ENK-treated arthritic rats had: (i) striking preservation of synovial membrane cytoarchitecture with minimal inflammatory cell infiltrates; (ii) significantly improved nociceptive behavioural responses to mechanical and thermal stimuli; (iii) normalized Fos staining in lumbar dorsal horn; and (iv) significantly increased met-ENK staining in ipsilateral synovial tissue, lumbar DRG and spinal cord. The HSV-1 and transgene product expression were confined to ipsilateral lumbar DRG (HSV-1, met-ENK, beta-gal). Only transgene product (met-ENK and beta-gal) was seen in lumbar spinal cord sections. Targeted delivery of enkephalin-encoding HSV-1 vector generated safe, sustained opioid-induced analgesia with protective anti-inflammatory blunting in rat inflammatory arthritis.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kusabuka, Hotaka; Fujiwara, Kento; Tokunaga, Yusuke
Adoptive immunotherapy using chimeric antigen receptor-expressing T (CAR-T) cells has attracted attention as an efficacious strategy for cancer treatment. To prove the efficacy and safety of CAR-T cell therapy, the elucidation of immunological mechanisms underlying it in mice is required. Although a retroviral vector (Rv) is mainly used for the introduction of CAR to murine T cells, gene transduction efficiency is generally less than 50%. The low transduction efficiency causes poor precision in the functional analysis of CAR-T cells. We attempted to improve the Rv gene transduction protocol to more efficiently generate functional CAR-T cells by optimizing the period ofmore » pre-cultivation and antibody stimulation. In the improved protocol, gene transduction efficiency to murine T cells was more than 90%. In addition, almost all of the prepared murine T cells expressed CAR after puromycin selection. These CAR-T cells had antigen-specific cytotoxic activity and secreted multiple cytokines by antigen stimulation. We believe that our optimized gene transduction protocol for murine T cells contributes to the advancement of T cell biology and development of immunotherapy using genetically engineered T cells. - Highlights: • We established highly efficient gene transduction protocols for murine T cells. • CD8{sup +} CAR-T cells had antigen-specific cytotoxic activity. • CD4{sup +} CAR-T cells secreted multiple cytokines by antigen stimulation. • This finding can contribute to the development of T-cell biology and immunotherapy.« less
-
Peterson, Jennifer K; Bartsch, Sarah M; Lee, Bruce Y; Dobson, Andrew P
2015-10-22
Chagas disease (caused by Trypanosoma cruzi) is the most important neglected tropical disease (NTD) in Latin America, infecting an estimated 5.7 million people in the 21 countries where it is endemic. It is one of the NTDs targeted for control and elimination by the 2020 London Declaration goals, with the first goal being to interrupt intra-domiciliary vector-borne T. cruzi transmission. A key question in domestic T. cruzi transmission is the role that synanthropic animals play in T. cruzi transmission to humans. Here, we ask, (1) do synanthropic animals need to be targeted in Chagas disease prevention policies?, and (2) how does the presence of animals affect the efficacy of vector control? We developed a simple mathematical model to simulate domestic vector-borne T. cruzi transmission and to specifically examine the interaction between the presence of synanthropic animals and effects of vector control. We used the model to explore how the interactions between triatomine bugs, humans and animals impact the number and proportion of T. cruzi-infected bugs and humans. We then examined how T. cruzi dynamics change when control measures targeting vector abundance are introduced into the system. We found that the presence of synanthropic animals slows the speed of T. cruzi transmission to humans, and increases the sensitivity of T. cruzi transmission dynamics to vector control measures at comparable triatomine carrying capacities. However, T. cruzi transmission is amplified when triatomine carrying capacity increases with the abundance of syntathoropic hosts. Our results suggest that in domestic T. cruzi transmission scenarios where no vector control measures are in place, a reduction in synanthropic animals may slow T. cruzi transmission to humans, but it would not completely eliminate transmission. To reach the 2020 goal of interrupting intra-domiciliary T. cruzi transmission, it is critical to target vector populations. Additionally, where vector control measures are in place, synanthropic animals may be beneficial.
-
Vectors for co-expression of an unrestricted number of proteins
Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad
2007-01-01
A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810
-
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
-
Marchant, Axelle; Mougel, Florence; Jacquin-Joly, Emmanuelle; Costa, Jane; Almeida, Carlos Eduardo; Harry, Myriam
2016-01-01
Background In Latin America, the bloodsucking bugs Triatominae are vectors of Trypanosoma cruzi, the parasite that causes Chagas disease. Chemical elimination programs have been launched to control Chagas disease vectors. However, the disease persists because native vectors from sylvatic habitats are able to (re)colonize houses—a process called domiciliation. Triatoma brasiliensis is one example. Because the chemosensory system allows insects to interact with their environment and plays a key role in insect adaption, we conducted a descriptive and comparative study of the chemosensory transcriptome of T. brasiliensis samples from different ecotopes. Methodology/Principal Finding In a reference transcriptome built using de novo assembly, we found transcripts encoding 27 odorant-binding proteins (OBPs), 17 chemosensory proteins (CSPs), 3 odorant receptors (ORs), 5 transient receptor potential channel (TRPs), 1 sensory neuron membrane protein (SNMPs), 25 takeout proteins, 72 cytochrome P450s, 5 gluthatione S-transferases, and 49 cuticular proteins. Using protein phylogenies, we showed that most of the OBPs and CSPs for T. brasiliensis had well supported orthologs in the kissing bug Rhodnius prolixus. We also showed a higher number of these genes within the bloodsucking bugs and more generally within all Hemipterans compared to the other species in the super-order Paraneoptera. Using both DESeq2 and EdgeR software, we performed differential expression analyses between samples of T. brasiliensis, taking into account their environment (sylvatic, peridomiciliary and domiciliary) and sex. We also searched clusters of co-expressed contigs using HTSCluster. Among differentially expressed (DE) contigs, most were under-expressed in the chemosensory organs of the domiciliary bugs compared to the other samples and in females compared to males. We clearly identified DE genes that play a role in the chemosensory system. Conclusion/Significance Chemosensory genes could be good candidates for genes that contribute to adaptation or plastic rearrangement to an anthropogenic system. The domiciliary environment probably includes less diversity of xenobiotics and probably has more stable abiotic parameters than do sylvatic and peridomiciliary environments. This could explain why both detoxification and cuticle protein genes are less expressed in domiciliary bugs. Understanding the molecular basis for how vectors adapt to human dwellings may reveal new tools to control disease vectors; for example, by disrupting chemical communication. PMID:27792774
-
Marchant, Axelle; Mougel, Florence; Jacquin-Joly, Emmanuelle; Costa, Jane; Almeida, Carlos Eduardo; Harry, Myriam
2016-10-01
In Latin America, the bloodsucking bugs Triatominae are vectors of Trypanosoma cruzi, the parasite that causes Chagas disease. Chemical elimination programs have been launched to control Chagas disease vectors. However, the disease persists because native vectors from sylvatic habitats are able to (re)colonize houses-a process called domiciliation. Triatoma brasiliensis is one example. Because the chemosensory system allows insects to interact with their environment and plays a key role in insect adaption, we conducted a descriptive and comparative study of the chemosensory transcriptome of T. brasiliensis samples from different ecotopes. In a reference transcriptome built using de novo assembly, we found transcripts encoding 27 odorant-binding proteins (OBPs), 17 chemosensory proteins (CSPs), 3 odorant receptors (ORs), 5 transient receptor potential channel (TRPs), 1 sensory neuron membrane protein (SNMPs), 25 takeout proteins, 72 cytochrome P450s, 5 gluthatione S-transferases, and 49 cuticular proteins. Using protein phylogenies, we showed that most of the OBPs and CSPs for T. brasiliensis had well supported orthologs in the kissing bug Rhodnius prolixus. We also showed a higher number of these genes within the bloodsucking bugs and more generally within all Hemipterans compared to the other species in the super-order Paraneoptera. Using both DESeq2 and EdgeR software, we performed differential expression analyses between samples of T. brasiliensis, taking into account their environment (sylvatic, peridomiciliary and domiciliary) and sex. We also searched clusters of co-expressed contigs using HTSCluster. Among differentially expressed (DE) contigs, most were under-expressed in the chemosensory organs of the domiciliary bugs compared to the other samples and in females compared to males. We clearly identified DE genes that play a role in the chemosensory system. Chemosensory genes could be good candidates for genes that contribute to adaptation or plastic rearrangement to an anthropogenic system. The domiciliary environment probably includes less diversity of xenobiotics and probably has more stable abiotic parameters than do sylvatic and peridomiciliary environments. This could explain why both detoxification and cuticle protein genes are less expressed in domiciliary bugs. Understanding the molecular basis for how vectors adapt to human dwellings may reveal new tools to control disease vectors; for example, by disrupting chemical communication.
-
Horynová, Milada; Takahashi, Kazuo; Hall, Stacy; Renfrow, Matthew B; Novak, Jan; Raška, Milan
2012-02-01
The human UDP-N-acetyl-α-d-galactosamine:polypeptide N-acetylgalactosaminyl-transferase 2 (GalNAc-T2) is one of the key enzymes that initiate synthesis of hinge-region O-linked glycans of human immunoglobulin A1 (IgA1). We designed secreted soluble form of human GalNAc-T2 as a fusion protein containing mouse immunoglobulin light chain kappa secretory signal and expressed it using baculovirus and mammalian expression vectors. The recombinant protein was secreted by insect cells Sf9 and human HEK 293T cells in the culture medium. The protein was purified from the media using affinity Ni-NTA chromatography followed by stabilization of purified protein in 50mM Tris-HCl buffer at pH 7.4. Although the purity of recombinant GalNAc-T2 was comparable in both expression systems, the yield was higher in Sf9 insect expression system (2.5mg of GalNAc-T2 protein per 1L culture medium). The purified soluble recombinant GalNAc-T2 had an estimated molecular mass of 65.8kDa and its amino-acid sequence was confirmed by mass-spectrometric analysis. The enzymatic activity of Sf9-produced recombinant GalNAc-T2 was determined by the quantification of enzyme-mediated attachment of GalNAc to synthetic IgA1 hinge-region peptide as the acceptor and UDP-GalNAc as the donor. In conclusion, murine immunoglobulin kappa secretory signal was used for production of secreted enzymatically active GalNAc-T2 in insect baculovirus expression system. Copyright © 2011 Elsevier Inc. All rights reserved.
-
Fox, I J; Chowdhury, N R; Gupta, S; Kondapalli, R; Schilsky, M L; Stockert, R J; Chowdhury, J R
1995-03-01
Viral vectors and protein carriers utilizing asialoglycoprotein receptor (ASGR)-mediated endocytosis are being developed to transfer genes for the correction of bilirubin-UDP-glucuronosyltransferase (bilirubin-UGT) deficiency. Ex vivo evaluation of these gene transfer vectors would be facilitated by a cell system that lacks bilirubin-UGT, but expresses differentiated liver functions, including ASGR. We immortalized primary Gunn rat hepatocytes by transduction with a recombinant Moloney murine leukemia virus expressing a thermolabile mutant SV40 large T antigen (tsA58). At 33 degrees C, the immortalized hepatocyte clones expressed SV40 large T antigen, synthesized DNA, and doubled in number every 2 to 3 days. At this temperature, differentiated hepatocyte markers, e.g., albumin, ASGR, and androsterone-UGT, were expressed at 5% to 10% of the levels found in primary hepatocytes maintained in culture for 24 hours. Glutathione-S-transferase Yp (GST-Yp), an oncofetal protein, was expressed in these cells at 33 degrees C, but was undetectable in primary hepatocytes. In contrast, when the cells were cultured at 39 degrees C or 37 degrees C, the large T antigen was degraded, DNA synthesis and cell growth stopped, and morphologic characteristics of differentiated hepatocytes were observed. The expression of albumin, ASGR, and androsterone-UGT, and their corresponding mRNAs, increased to 25% to 40% of the level in primary hepatocytes, whereas GST-Yp expression decreased. Functionality of ASGR was demonstrated by internalization of Texas red-labeled asialoorosomucoid, and binding and degradation of 125I-asialoorosomucoid. After liposome-mediated transfer of a plasmid containing the coding region of human bilirubin-UGT1, driven by the SV40 large T promoter, active human bilirubin-UGT1 was expressed in these cells. The immortalized cells were not tumorigenic after transplantation into severe combined immunodeficiency mice. These conditionally immortalized cells will be useful for ex vivo evaluation of bilirubin-UGT gene transfer vectors.
-
Alroy, Karen A; Huang, Christine; Gilman, Robert H; Quispe-Machaca, Victor R; Marks, Morgan A; Ancca-Juarez, Jenny; Hillyard, Miranda; Verastegui, Manuela; Sanchez, Gerardo; Cabrera, Lilia; Vidal, Elisa; Billig, Erica M W; Cama, Vitaliano A; Náquira, César; Bern, Caryn; Levy, Michael Z
2015-05-01
Vector-borne transmission of Trypanosoma cruzi is seen exclusively in the Americas where an estimated 8 million people are infected with the parasite. Significant research in southern Peru has been conducted to understand T. cruzi infection and vector control, however, much less is known about the burden of infection and epidemiology in northern Peru. A cross-sectional study was conducted to estimate the seroprevalence of T. cruzi infection in humans (n=611) and domestic animals [dogs (n=106) and guinea pigs (n=206)] in communities of Cutervo Province, Peru. Sampling and diagnostic strategies differed according to species. An entomological household study (n=208) was conducted to identify the triatomine burden and species composition, as well as the prevalence of T. cruzi in vectors. Electrocardiograms (EKG) were performed on a subset of participants (n=90 T. cruzi infected participants and 170 age and sex-matched controls). The seroprevalence of T. cruzi among humans, dogs, and guinea pigs was 14.9% (95% CI: 12.2-18.0%), 19.8% (95% CI: 12.7-28.7%) and 3.3% (95% CI: 1.4-6.9%) respectively. In one community, the prevalence of T. cruzi infection was 17.2% (95% CI: 9.6-24.7%) among participants < 15 years, suggesting recent transmission. Increasing age, positive triatomines in a participant's house, and ownership of a T. cruzi positive guinea pig were independent correlates of T. cruzi infection. Only one species of triatomine was found, Panstrongylus lignarius, formerly P. herreri. Approximately forty percent (39.9%, 95% CI: 33.2-46.9%) of surveyed households were infested with this vector and 14.9% (95% CI: 10.4-20.5%) had at least one triatomine positive for T. cruzi. The cardiac abnormality of right bundle branch block was rare, but only identified in seropositive individuals. Our research documents a substantial prevalence of T. cruzi infection in Cutervo and highlights a need for greater attention and vector control efforts in northern Peru.
-
The Sequential Implementation of Array Processors when there is Directional Uncertainty
1975-08-01
University of Washington kindly supplied office space and ccputing facilities. -The author hat, benefited greatly from discussions with several other...if i Q- inverse of Q I L general observation space R general vector of observation _KR general observation vector of dimension K Exiv] "Tf -- ’ -"-T’T...7" i ’i ’:"’ - ’ ; ’ ’ ’ ’ ’ ’" ’"- Glossary of Symbols (continued) R. ith observation 1 Rm real vector space of dimension m R(T) autocorrelation
-
Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang
2002-09-01
To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.
-
[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].
Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng
2015-12-01
To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.
-
Xu, Kun; Song, Yufeng; Dai, Lianpan; Zhang, Yongli; Lu, Xuancheng; Xie, Yijia; Zhang, Hangjie; Cheng, Tao; Wang, Qihui; Huang, Qingrui; Bi, Yuhai; Liu, William J; Liu, Wenjun; Li, Xiangdong; Qin, Chuan; Shi, Yi; Yan, Jinghua; Zhou, Dongming; Gao, George F
2018-03-15
The recent outbreak of Zika virus (ZIKV) has emerged as a global health concern. ZIKV can persist in human semen and be transmitted by sexual contact, as well as by mosquitoes, as seen for classical arboviruses. We along with others have previously demonstrated that ZIKV infection leads to testis damage and infertility in mouse models. So far, no prophylactics or therapeutics are available; therefore, vaccine development is urgently demanded. Recombinant chimpanzee adenovirus has been explored as the preferred vaccine vector for many pathogens due to the low preexisting immunity against the vector among the human population. Here, we developed a ZIKV vaccine based on recombinant chimpanzee adenovirus type 7 (AdC7) expressing ZIKV M/E glycoproteins. A single vaccination of AdC7-M/E was sufficient to elicit potent neutralizing antibodies and protective immunity against ZIKV in both immunocompetent and immunodeficient mice. Moreover, vaccinated mice rapidly developed neutralizing antibody with high titers within 1 week postvaccination, and the elicited antiserum could cross-neutralize heterologous ZIKV strains. Additionally, ZIKV M- and E-specific T cell responses were robustly induced by AdC7-M/E. Moreover, one-dose inoculation of AdC7-M/E conferred mouse sterilizing immunity to eliminate viremia and viral burden in tissues against ZIKV challenge. Further investigations showed that vaccination with AdC7-M/E completely protected against ZIKV-induced testicular damage. These data demonstrate that AdC7-M/E is highly effective and represents a promising vaccine candidate for ZIKV control. IMPORTANCE Zika virus (ZIKV) is a pathogenic flavivirus that causes severe clinical consequences, including congenital malformations in fetuses and Guillain-Barré syndrome in adults. Vaccine development is a high priority for ZIKV control. In this study, to avoid preexisting anti-vector immunity in humans, a rare serotype chimpanzee adenovirus (AdC7) expressing the ZIKV M/E glycoproteins was used for ZIKV vaccine development. Impressively, AdC7-M/E exhibited exceptional performance as a ZIKV vaccine, as follows: (i) protective efficacy by a single vaccination, (ii) rapid development of a robust humoral response, (iii) durable immune responses, (iv) robust T cell responses, and (v) sterilizing immunity achieved by a single vaccination. These advantages of AdC7-M/E strongly support its potential application as a promising ZIKV vaccine in the clinic. Copyright © 2018 American Society for Microbiology.
-
NASA Astrophysics Data System (ADS)
Niederman, Thomas M. J.; Ghogawala, Zoher; Carter, Bob S.; Tompkins, Hillary S.; Russell, Margaret M.; Mulligan, Richard C.
2002-05-01
The demonstration that angiogenesis is required for the growth of solid tumors has fueled an intense interest in the development of new therapeutic strategies that target the tumor vasculature. Here we report the development of an immune-based antiangiogenic strategy that is based on the generation of T lymphocytes that possess a killing specificity for cells expressing vascular endothelial growth factor receptors (VEGFRs). To target VEGFR-expressing cells, recombinant retroviral vectors were generated that encoded a chimeric T cell receptor comprised of VEGF sequences linked to intracellular signaling sequences derived from the chain of the T cell receptor. After transduction of primary murine CD8 lymphocytes by such vectors, the transduced cells were shown to possess an efficient killing specificity for cells expressing the VEGF receptor, Flk-1, as measured by in vitro cytotoxicity assays. After adoptive transfer into tumor-bearing mice, the genetically modified cytotoxic T lymphocytes strongly inhibited the growth of a variety of syngeneic murine tumors and human tumor xenografts. An increased effect on in vivo tumor growth inhibition was seen when this therapy was combined with the systemic administration of TNP-470, a conventional angiogenesis inhibitor. The utilization of the immune system to target angiogenic markers expressed on tumor vasculature may prove to be a powerful means for controlling tumor growth.
-
Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome
Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio
2012-01-01
The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016
-
Khan, Rishi L; Gonye, Gregory E; Gao, Guang; Schwaber, James S
2006-01-01
Background Using microarrays by co-hybridizing two samples labeled with different dyes enables differential gene expression measurements and comparisons across slides while controlling for within-slide variability. Typically one dye produces weaker signal intensities than the other often causing signals to be undetectable. In addition, undetectable spots represent a large problem for two-color microarray designs and most arrays contain at least 40% undetectable spots even when labeled with reference samples such as Stratagene's Universal Reference RNAs™. Results We introduce a novel universal reference sample that produces strong signal for all spots on the array, increasing the average fraction of detectable spots to 97%. Maximizing detectable spots on the reference image channel also decreases the variability of microarray data allowing for reliable detection of smaller differential gene expression changes. The reference sample is derived from sequence contained in the parental EST clone vector pT7T3D-Pac and is called vector RNA (vRNA). We show that vRNA can also be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This reference sample can be made inexpensively in large quantities as a renewable resource that is consistent across experiments. Conclusion Results of this study show that vRNA provides a useful universal reference that yields high signal for almost all spots on a microarray, reduces variation and allows for comparisons between experiments and laboratories. Further, it can be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This type of reference allows for detection of small changes in differential expression while reference designs in general allow for large-scale multivariate experimental designs. vRNA in combination with reference designs enable systems biology microarray experiments of small physiologically relevant changes. PMID:16677381
-
Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid
2015-01-01
Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221
-
Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM
2012-01-01
Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534
-
Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.
Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F
2000-12-01
Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.
-
Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh
2015-01-01
Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441
-
Riabov, V.; Tretyakova, I.; Alexander, R. B.; Pushko, P.; Klyushnenkova, E. N.
2015-01-01
The goal of this study was to determine if an alphavirus-based vaccine encoding human Prostate-Specific Antigen (PSA) could generate an effective anti-tumor immune response in a stringent mouse model of prostate cancer. DR2bxPSA F1 male mice expressing human PSA and HLA-DRB1*1501 transgenes were vaccinated with virus-like particle vector encoding PSA (VLPV-PSA) followed by the challenge with Transgenic Adenocarcinoma of Mouse Prostate cells engineered to express PSA (TRAMP-PSA). PSA-specific cellular and humoral immune responses were measured before and after tumor challenge. PSA and CD8 reactivity in the tumors was detected by immunohistochemistry. Tumor growth was compared in vaccinated and control groups. We found that VLPV-PSA could infect mouse dendritic cells in vitro and induce a robust PSA-specific immune response in vivo. A substantial proportion of splenic CD8+ T cells (19.6±7.4%) produced IFNγ in response to the immunodominant peptide PSA65–73. In the blood of vaccinated mice, 18.4±4.1% of CD8+ T cells were PSA-specific as determined by the staining with H-2Db/PSA65–73 dextramers. VLPV-PSA vaccination also strongly stimulated production of IgG2a/b anti-PSA antibodies. Tumors in vaccinated mice showed low levels of PSA expression and significant CD8 T cell infiltration. Tumor growth in VLPV-PSA vaccinated mice was significantly delayed at early time points (p=0.002, Gehan-Breslow test). Our data suggest that TC-83-based VLPV-PSA vaccine can efficiently overcome immune tolerance to PSA, mediate rapid clearance of PSA-expressing tumor cells and delay tumor growth. The VLPV-PSA vaccine will undergo further testing for the immunotherapy of prostate cancer. PMID:26319744
-
Kapczynski, Darrell R; Esaki, Motoyuki; Dorsey, Kristi M; Jiang, Haijun; Jackwood, Mark; Moraes, Mauro; Gardin, Yannick
2015-02-25
Vaccination is an important tool in the protection of poultry against avian influenza (AI). For field use, the overwhelming majority of AI vaccines produced are inactivated whole virus formulated into an oil emulsion. However, recombinant vectored vaccines are gaining use for their ability to induce protection against heterologous isolates and ability to overcome maternal antibody interference. In these studies, we compared protection of chickens provided by a turkey herpesvirus (HVT) vector vaccine expressing the hemagglutinin (HA) gene from a clade 2.2 H5N1 strain (A/swan/Hungary/4999/2006) against homologous H5N1 as well as heterologous H5N1 and H5N2 highly pathogenic (HP) AI challenge. The results demonstrated all vaccinated birds were protected from clinical signs of disease and mortality following homologous challenge. In addition, oral and cloacal swabs taken from challenged birds demonstrated that vaccinated birds had lower incidence and titers of viral shedding compared to sham-vaccinated birds. Following heterologous H5N1 or H5N2 HPAI challenge, 80-95% of birds receiving the HVT vector AI vaccine at day of age survived challenge with fewer birds shedding virus after challenge than sham vaccinated birds. In vitro cytotoxicity analysis demonstrated that splenic T lymphocytes from HVT-vector-AI vaccinated chickens recognized MHC-matched target cells infected with H5, as well as H6, H7, or H9 AI virus. Taken together, these studies provide support for the use of HVT vector vaccines expressing HA to protect poultry against multiple lineages of HPAI, and that both humoral and cellular immunity induced by live vaccines likely contributes to protection. Published by Elsevier Ltd.
-
Unzu, C; Melero, I; Hervás-Stubbs, S; Sampedro, A; Mancheño, U; Morales-Kastresana, A; Serrano-Mendioroz, I; de Salamanca, R E; Benito, A; Fontanellas, A
2015-11-01
Helper-dependent adenoviral (HDA) vectors constitute excellent gene therapy tools for metabolic liver diseases. We have previously shown that an HDA vector encoding human porphobilinogen deaminase (PBGD) corrects acute intermittent porphyria mice. Now, six non-human primates were injected in the left hepatic lobe with the PBGD-encoding HDA vector to study levels and persistence of transgene expression. Intrahepatic administration of 5 × 10(12) viral particles kg(-1) (10(10) infective units kg(-1)) of HDA only resulted in transient (≈14 weeks) transgene expression in one out of three individuals. In contrast, a more prolonged 90-day immunosuppressive regimen (tacrolimus, mycophenolate, rituximab and steroids) extended meaningful transgene expression for over 76 weeks in two out of two cases. Transgene expression under immunosuppression (IS) reached maximum levels 6 weeks after HDA administration and gradually declined reaching a stable plateau within the therapeutic range for acute porphyria. The non-injected liver lobes also expressed the transgene because of vector circulation. IS controlled anticapsid T-cell responses and decreased the induction of neutralizing antibodies. Re-administration of HDA-hPBGD at week +78 achieved therapeutically meaningful transgene expression only in those animals receiving IS again at the time of this second vector exposure. Overall, immunity against adenoviral capsids poses serious hurdles for long-term HDA-mediated liver transduction, which can be partially circumvented by pharmacological IS.
-
On diagrammatic technique for nonlinear dynamical systems
NASA Astrophysics Data System (ADS)
Semenyakin, Mykola
2014-11-01
In this paper, we investigate phase flows over ℂn and ℝn generated by vector fields V = ∑ Pi∂i where Pi are finite degree polynomials. With the convenient diagrammatic technique, we get expressions for evolution operators ev{V|t} : x(0) ↦ x(t) through the series in powers of x(0) and t, represented as sum over all trees of a particular type. Estimates are made for the radius of convergence in some particular cases. The phase flows behavior in the neighborhood of vector field fixed points are examined. Resonance cases are considered separately.
-
Uhlig, Katharina M.; Schülke, Stefan; Scheuplein, Vivian A. M.; Malczyk, Anna H.; Reusch, Johannes; Kugelmann, Stefanie; Muth, Anke; Koch, Vivian; Hutzler, Stefan; Bodmer, Bianca S.; Schambach, Axel; Buchholz, Christian J.; Waibler, Zoe; Scheurer, Stephan
2015-01-01
ABSTRACT To induce and trigger innate and adaptive immune responses, antigen-presenting cells (APCs) take up and process antigens. Retroviral particles are capable of transferring not only genetic information but also foreign cargo proteins when they are genetically fused to viral structural proteins. Here, we demonstrate the capacity of lentiviral protein transfer vectors (PTVs) for targeted antigen transfer directly into APCs and thereby induction of cytotoxic T cell responses. Targeting of lentiviral PTVs to APCs can be achieved analogously to gene transfer vectors by pseudotyping the particles with truncated wild-type measles virus (MV) glycoproteins (GPs), which use human SLAM (signaling lymphocyte activation molecule) as a main entry receptor. SLAM is expressed on stimulated lymphocytes and APCs, including dendritic cells. SLAM-targeted PTVs transferred the reporter protein green fluorescent protein (GFP) or Cre recombinase with strict receptor specificity into SLAM-expressing CHO and B cell lines, in contrast to broadly transducing vesicular stomatitis virus G protein (VSV-G) pseudotyped PTVs. Primary myeloid dendritic cells (mDCs) incubated with targeted or nontargeted ovalbumin (Ova)-transferring PTVs stimulated Ova-specific T lymphocytes, especially CD8+ T cells. Administration of Ova-PTVs into SLAM-transgenic and control mice confirmed the observed predominant induction of antigen-specific CD8+ T cells and demonstrated the capacity of protein transfer vectors as suitable vaccines for the induction of antigen-specific immune responses. IMPORTANCE This study demonstrates the specificity and efficacy of antigen transfer by SLAM-targeted and nontargeted lentiviral protein transfer vectors into antigen-presenting cells to trigger antigen-specific immune responses in vitro and in vivo. The observed predominant activation of antigen-specific CD8+ T cells indicates the suitability of SLAM-targeted and also nontargeted PTVs as a vaccine for the induction of cytotoxic immune responses. Since cytotoxic CD8+ T lymphocytes are a mainstay of antitumoral immune responses, PTVs could be engineered for the transfer of specific tumor antigens provoking tailored antitumoral immunity. Therefore, PTVs can be used as safe and efficient alternatives to gene transfer vectors or live attenuated replicating vector platforms, avoiding genotoxicity or general toxicity in highly immunocompromised patients, respectively. Thereby, the potential for easy envelope exchange allows the circumventing of neutralizing antibodies, e.g., during repeated boost immunizations. PMID:26085166
-
Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.
Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W
2001-06-01
A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.
-
Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María
2018-04-01
Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9 vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.
-
Migita, M; Medin, J A; Pawliuk, R; Jacobson, S; Nagle, J W; Anderson, S; Amiri, M; Humphries, R K; Karlsson, S
1995-01-01
The gene transfer efficiency of human hematopoietic stem cells is still inadequate for efficient gene therapy of most disorders. To overcome this problem, a selectable retroviral vector system for gene therapy has been developed for gene therapy of Gaucher disease. We constructed a bicistronic retroviral vector containing the human glucocerebrosidase (GC) cDNA and the human small cell surface antigen CD24 (243 bp). Expression of both cDNAs was controlled by the long terminal repeat enhancer/promoter of the Molony murine leukemia virus. The CD24 selectable marker was placed downstream of the GC cDNA and its translation was enhanced by inclusion of the long 5' untranslated region of encephalomyocarditis virus internal ribosomal entry site. Virus-producing GP+envAM12 cells were created by multiple supernatant transductions to create vector producer cells. The vector LGEC has a high titer and can drive expression of GC and the cell surface antigen CD24 simultaneously in transduced NIH 3T3 cells and Gaucher skin fibroblasts. These transduced cells have been successfully separated from untransduced cells by fluorescence-activated cell sorting, based on cell surface expression of CD24. Transduced and sorted NIH 3T3 cells showed higher GC enzyme activity than the unsorted population, demonstrating coordinated expression of both genes. Fibroblasts from Gaucher patients were transduced and sorted for CD24 expression, and GC enzyme activity was measured. The transduced sorted Gaucher fibroblasts had a marked increase in enzyme activity (149%) compared with virgin Gaucher fibroblasts (17% of normal GC enzyme activity). Efficient transduction of CD34+ hematopoietic progenitors (20-40%) was accomplished and fluorescence-activated cell sorted CD24(+)-expressing progenitors generated colonies, all of which (100%) were vector positive. The sorted, CD24-expressing progenitors generated erythroid burst-forming units, colony-forming units (CFU)-granulocyte, CFU-macrophage, CFU-granulocyte/macrophage, and CFU-mix hematopoietic colonies, demonstrating their ability to differentiate into these myeloid lineages in vitro. The transduced, sorted progenitors raised the GC enzyme levels in their progeny cells manyfold compared with untransduced CD34+ progenitors. Collectively, this demonstrates the development of high titer, selectable bicistronic vectors that allow isolation of transduced hematopoietic progenitors and cells that have been metabolically corrected. Images Fig. 2 Fig. 3 PMID:8618847
-
Fowl adenovirus serotype 9 vectored vaccine for protection of avian influenza virus
USDA-ARS?s Scientific Manuscript database
A fowl adenovirus serotype 9, a non-pathogenic large double stranded DNA virus, was developed as a viral vector to express influenza genes as a potential vaccine. Two separate constructs were developed that expressed either the hemagglutinin gene of A/Chicken/Jalisco/2012 (H7) or A/ Chicken/Iowa/20...
-
Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M
2014-08-01
Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.
-
Friedman, Kevin M; Garrett, Tracy E; Evans, John W; Horton, Holly M; Latimer, Howard J; Seidel, Stacie L; Horvath, Christopher J; Morgan, Richard A
2018-05-01
B-cell maturation antigen (BCMA) expression has been proposed as a marker for the identification of malignant plasma cells in patients with multiple myeloma (MM). Nearly all MM tumor cells express BCMA, while normal tissue expression is restricted to plasma cells and a subset of mature B cells. Consistent BCMA expression was confirmed on MM biopsies (29/29 BCMA+), and it was further demonstrated that BCMA is expressed in a substantial number of lymphoma samples, as well as primary chronic lymphocytic leukemia B cells. To target BCMA using redirected autologous T cells, lentiviral vectors (LVV) encoding chimeric antigen receptors (CARs) were constructed with four unique anti-BCMA single-chain variable fragments, fused to the CD137 (4-1BB) co-stimulatory and CD3ζ signaling domains. One LVV, BB2121, was studied in detail, and BB2121 CAR-transduced T cells (bb2121) exhibited a high frequency of CAR + T cells and robust in vitro activity against MM cell lines, lymphoma cell lines, and primary chronic lymphocytic leukemia peripheral blood. Based on receptor quantification, bb2121 recognized tumor cells expressing as little as 222 BCMA molecules per cell. The in vivo pharmacology of anti-BCMA CAR T cells was studied in NSG mouse models of human MM, Burkitt lymphoma, and mantle cell lymphoma, where mice received a single intravenous administration of vehicle, control vector-transduced T cells, or anti-BCMA CAR-transduced T cells. In all models, the vehicle and control CAR T cells failed to inhibit tumor growth. In contrast, treatment with bb2121 resulted in rapid and sustained elimination of the tumors and 100% survival in all treatment models. Together, these data support the further development of anti-BCMA CAR T cells as a potential treatment for not only MM but also some lymphomas.
-
Roca-Acevedo, G; Picollo, M I; Capriotti, N; Sierra, I; Santo-Orihuela, P L
2015-09-01
Chagas disease is a zoonosis transmitted to man by blood-sucking triatomine bugs found in the Americas. Triatoma infestans (Klug, 1834) is the main vector of Chagas' disease in Argentina. The control of this illness relies heavily on vector control through the use of insecticide. However, resistance to pyrethroid insecticides associated with ineffective field treatments has been increasingly reported in T. infestans from Argentina and Bolivia. There are few reports on the expression and causes of resistance in eggs of resistant populations, and even fewer studies on insecticide resistance throughout embryonic development. In this study, we explore the biochemical and molecular mechanisms potentially associated with the deltamethrin resistance assessed in the developing eggs of the Argentinean (Campo Largo) and Bolivian (Entre Ríos) T. infestans populations.We found measurable activity of monooxigenases and pyrethroid esterases throughout embryonic development. The pyrethroid esterase activity grew steadily throughout development in all the studied populations and was highest in eggs 12 d old. Mean enzyme activity increased from 13.6 to 16.3 and 22.2 picomol 7-hydroxycoumarin/min (7-OHC) in eggs of 4-, 7-, and 12 d old from the susceptible reference bug colony. Mean activity of resistant populations increased from 16.0 to 25.9 picomol 7-OHC/min in eggs of 4- to 12 d old in Entre Ríos population, and from 15.9 to 28.9 picomol 7-OHC/min in Campo Largo population. Molecular analysis of susceptible and resistant developing eggs detected L1014F mutation in both resistant populations, but no L925I mutation was found in any of the studied populations.Higher esterase activity and L1014F presence justify the resistance to pyrethroid throughout developing eggs of both studied T. infestans populations. The description of resistance profiles including resistance mechanisms involved will allow a rational design of campaigns for the control of Chagas disease transmission. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
-
Regulated Expression of Adenoviral Vectors-Based Gene Therapies
Curtin, James F.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Muhammad, A. K. M.; Kroeger, Kurt; Mondkar, Sonali; Liu, Chunyan; Bondale, Niyati; Lowenstein, Pedro R.; Castro, Maria G.
2008-01-01
Summary Regulatable promoter systems allow gene expression to be tightly controlled in vivo. This is highly desirable for the development of safe, efficacious adenoviral vectors that can be used to treat human diseases in the clinic. Ideally, regulatable cassettes should have minimal gene expression in the “OFF” state, and expression should quickly reach therapeutic levels in the “ON” state. In addition, the components of regulatable cassettes should be non-toxic at physiological concentrations and should not be immunogenic, especially when treating chronic illness that requires long-lasting gene expression. In this chapter, we will describe in detail protocols to develop and validate first generation (Ad) and high-capacity adenoviral (HC-Ad) vectors that express therapeutic genes under the control of the TetON regulatable system. Our laboratory has successfully used these protocols to regulate the expression of marker genes, immune stimulatory genes, and toxins for cancer gene therapeutics, i.e., glioma that is a deadly form of brain cancer. We have shown that this third generation TetON regulatable system, incorporating a doxycycline (DOX)-sensitive rtTA2S-M2 inducer and tTSKid silencer, is non-toxic, relatively non-immunogenic, and can tightly regulate reporter transgene expression downstream of a TRE promoter from adenoviral vectors in vitro and also in vivo. PMID:18470649
-
Heuermann, D; Haas, R
1998-03-01
A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.
-
Gerits, Annelies; Vancraeyenest, Pascaline; Vreysen, Samme; Laramée, Marie-Eve; Michiels, Annelies; Gijsbers, Rik; Van den Haute, Chris; Moons, Lieve; Debyser, Zeger; Baekelandt, Veerle; Arckens, Lutgarde; Vanduffel, Wim
2015-01-01
Abstract. Viral vector-mediated expression of genes (e.g., coding for opsins and designer receptors) has grown increasingly popular. Cell-type specific expression is achieved by altering viral vector tropism through crosspackaging or by cell-specific promoters driving gene expression. Detailed information about transduction properties of most recombinant adeno-associated viral vector (rAAV) serotypes in macaque cortex is gradually becoming available. Here, we compare transduction efficiencies and expression patterns of reporter genes in two macaque neocortical areas employing different rAAV serotypes and promoters. A short version of the calmodulin-kinase-II (CaMKIIα0.4) promoter resulted in reporter gene expression in cortical neurons for all tested rAAVs, albeit with different efficiencies for spread: rAAV2/5>>rAAV2/7>rAAV2/8>rAAV2/9>>rAAV2/1 and proportion of transduced cells: rAAV2/1>rAAV2/5>rAAV2/7=rAAV2/9>rAAV2/8. In contrast to rodent studies, the cytomegalovirus (CMV) promoter appeared least efficient in macaque cortex. The human synapsin-1 promoter preceded by the CMV enhancer (enhSyn1) produced homogeneous reporter gene expression across all layers, while two variants of the CaMKIIα promoter resulted in different laminar transduction patterns and cell specificities. Finally, differences in expression patterns were observed when the same viral vector was injected in two neocortical areas. Our results corroborate previous findings that reporter-gene expression patterns and efficiency of rAAV transduction depend on serotype, promoter, cortical layer, and area. PMID:26839901
-
Zhang, Yu; Cao, Qianda; Wang, Mingshu; Jia, Renyong; Chen, Shun; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Zhao, Xinxin; Chen, Xiaoyue; Cheng, Anchun
2017-12-01
To explore the RNA-dependent RNA polymerase (RdRP) function of the 3D protein of duck hepatitis A virus type 1 (DHAV-1), the gene was cloned into the pET-32a(+) vector for prokaryotic expression. The 3' untranslated region (3' UTR) of DHAV-1 together with a T7 promoter was cloned into the pMD19-T vector for in vitro transcription of 3' UTR RNA, which was further used as a template in RNA-dependent RNA polymerization. In this study, three methods were applied to analyze the RdRP function of the 3D protein: (1) ammonium molybdate spectrophotometry to detect pyrophosphate produced during polymerization; (2) quantitative reverse transcription PCR (RT-qPCR) to investigate the changes in RNA quantity during polymerization; and (3) electrophoresis mobility shift assay to examine the interaction between the 3D protein and 3' UTR. The results showed the 3D protein was successfully expressed in bacteria culture supernatant in a soluble form, which could be purified by affinity chromatography. In 3D enzymatic activity assays, pyrophosphate and RNA were produced, the amounts of which increased based on approximative kinetics, and binding of the 3D protein to the 3' UTR was observed. These results indicate that prokaryotically expressed soluble DHAV-13D protein can bind to a viral genomic 3' UTR and exhibit RdRP activity.
-
Schneider, Eberhard; Märker, Tina; Daser, Angelika; Frey-Mahn, Gabriele; Beyer, Vera; Farcas, Ruxandra; Schneider-Rätzke, Brigitte; Kohlschmidt, Nicolai; Grossmann, Bärbel; Bauss, Katharina; Napiontek, Ulrike; Keilmann, Annerose; Bartsch, Oliver; Zechner, Ulrich; Wolfrum, Uwe; Haaf, Thomas
2009-02-15
A homozygous reciprocal translocation, 46,XY,t(10;11),t(10;11), was detected in a boy with non-syndromic congenital sensorineural hearing impairment. Both parents and their four other children were heterozygous translocation carriers, 46,XX,t(10;11) and 46,XY,t(10;11), respectively. Fluorescence in situ hybridization of region-specific clones to patient chromosomes was used to localize the breakpoints within bacterial artificial chromosome (BAC) RP11-108L7 on chromosome 10q24.3 and within BAC CTD-2527F12 on chromosome 11q23.3. Junction fragments were cloned by vector ligation and sequenced. The chromosome 10 breakpoint was identified within the PDZ domain containing 7 (PDZD7) gene, disrupting the open reading frame of transcript PDZD7-C (without PDZ domain) and the 5'-untranslated region of transcript PDZD7-D (with one PDZ and two prolin-rich domains). The chromosome 11 breakpoint was localized in an intergenic segment. Reverse transcriptase-polymerase chain reaction analysis revealed PDZD7 expression in the human inner ear. A murine Pdzd7 transcript that is most similar in structure to human PDZD7-D is known to be expressed in the adult inner ear and retina. PDZD7 shares sequence homology with the PDZ domain-containing genes, USH1C (harmonin) and DFNB31 (whirlin). Allelic mutations in harmonin and whirlin can cause both Usher syndrome (USH1C and USH2D, respectively) and congenital hearing impairment (DFNB18 and DFNB31, respectively). Protein-protein interaction assays revealed the integration of PDZD7 in the protein network related to the human Usher syndrome. Collectively, our data provide strong evidence that PDZD7 is a new autosomal-recessive deafness-causing gene and also a prime candidate gene for Usher syndrome.
-
Wang, Hao; Jin, Weitao; Li, Haibin
2018-02-20
The present study investigated the molecular mechanisms underlying the 4A > C and -349C > T single nucleotide polymorphisms (SNPs) in bone morphogenetic protein receptor type IA (BMPR-IA) gene, which significantly associated with the occurrence and the extent of ossification of the posterior longitudinal ligament (OPLL) in the cervical spine. The SNPs in BMPR-IA gene were genotyped, and the association with the occurrence and severity of OPLL were evaluated in 356 OPLL patients and 617 non-OPLL controls. In stably transfected mouse embryonic mesenchymal stem cells (C3H10T1/2), the expression levels of the BMPR-IA gene and Smad4 protein as well as phosphorylated Smad1/5/8 were detected by Western blotting. In addition, the alkaline phosphatase (ALP) and osteocalcin (OC) activity of osteogenesis specificity protein was assessed using the ALP quantitation and osteocalcin radioimmunoassay kit, respectively. The 4A > C and the -349C > T polymorphisms of BMPR-IA gene were significantly associated with the development of OPLL in the cervical spine. The C allele type in 4A > C polymorphism significantly increases the occurrence and the extent of OPLL. The T allele type in -349C > T polymorphism significantly increases the susceptibility to OPLL, but not the extent of OPLL. The current results further validate our previous observations. The expression levels of BMPR-IA gene were significantly increased in pcDNA3.1/BMPR-IA (mutation type, MT -349C > T; MT 4A > C; MT -349C > T and 4A > C) vector-transfected C3H10T1/2 cells compared to the wild type (WT) vector-transfected cells. The levels of phosphorylated Smad1/5/8 and ALP activity were significantly increased in pcDNA3.1/BMPR-IA (MT -349C > T) vector-transfected C3H10T1/2 cells compared to the WT vector-transfected cells. However, no significant differences were observed in the protein levels of phosphorylated Smad1/5/8 and the ALP activity between MT A/C and WT vector-transfected cells. In addition, no significant differences were observed in the Smad4 protein levels among the experimental groups, as well as in the OC activity between WT vector-transfected and MT C/T, MT A/C, MT C/T and MT A/C vector-transfected cells. Our results suggest that Smad signaling pathway may play important roles in the pathological process of OPLL induced by SNPs in BMPR-IA gene. These results will help to clarify the molecular mechanisms underlying the SNP and gene susceptibility to OPLL.
-
Verification of 2A peptide cleavage.
Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A
2012-02-01
The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. The easiest and most effective way to assess 2A cleavage is to perform transient transfection of 293T cells (human embryonic kidney cells) followed by western blot analysis, as described in this protocol. 293T cells are easy to grow and can be efficiently transfected with a variety of vectors. Cleavage can be assessed by detection with antibodies against the target proteins or anti-2A serum.
-
Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J
2016-10-01
Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.
-
[Preparation and characterization of monoclonal antibodies against Micrococcus luteus Rpf domain].
Fan, Ai-lin; Shi, Chang-hong; Su, Ming-quan; Ma, Jing; Bai, Yin-lan; Cheng, Xiao-dong; Xu, Zhi-kai; Hao, Xiao-ke
2008-05-01
To express Micrococcus luteus Rpf domain in prokaryotic cells and prepare monoclonal antibodies against Rpf domain. The gene encoding Micrococcus luteus Rpf domain was amplified from genome of Micrococcus luteus by polymerase chain reaction(PCR), and inserted into cloning vector pUC-19. After sequenced, Micrococcus luteus Rpf domain gene was subcloned into the expression vector pPro-EXHT and transfected into E.coli DH5alpha. After induced by IPTG, the bacteria controlled by T7 promoter expressed the fused Micrococcus luteus Rpf domain protein with a hexahistidine tail at its N-terminal and the target protein was purified under denaturing conditions. Using this protein as antigen to immunize the BALB/c mice and prepare monoclonal antibodies against Micrococcus luteus Rpf domain. Then specifities and relative affinities of mAbs were identified by ELISA. The fusion protein was purified by metal chelate affinity chromatography under denaturing condition. Three cloned mAbs were prepared from the mice immunized by Rpf domain. All of them could recognize Rpf domain. specifically. The prepared mAbs against Rpf domain have strong specificity with high titers, which provides useful tools for further study of the function of Rpf domain in TB prevention.
-
Kojima, Yasutaka; Otsuki, Naoki; Kubo, Mie; Kitamoto, Junko; Takata, Eri; Saito, Hiroki; Kosaka, Kyoko; Morishita, Naoya; Uehara, Natsumi; Shirakawa, Toshiro; Nibu, Ken-Ich
2018-05-24
Human papillomavirus (HPV) infection has been identified as an etiologic factor of head and neck cancers (HNCs). We explored the potential use of antisense HPV RNA transcripts for gene therapy and its effect in combination with cisplatin (CDDP) for HPV-positive HNCs. We introduced the antisense RNA transcripts of the E6 and E7 genes of HPV type 16 into UM-SCC-47 cells harboring HPV 16 and YCU-T892 cells that were HPV-negative using a recombinant adenoviral vector, Ad-E6/E7-AS. We then analyzed the effects of the introduction of Ad-E7-AS on cell and tumor growth and the synergistic effect with CDDP in vitro and in vivo. After infection of Ad-E6/E7-AS, the cellular growth of UM-SCC-47 cells were suppressed, but not that of YCU-T892 cells. E7 protein expression was suppressed, and p53 and pRb protein expression increased after infection of Ad-E7-AS. Cell growth and tumorigenicity were greatly suppressed in combination with CDDP compared with Ad-E7-AS or CDDP treatment alone in vitro. Ad-E7-AS combined with CDDP treatment significantly reduced the volumes of established subcutaneous tumors. Transfection with HPV 16 E7 antisense RNA combined with CDDP treatment might be a potentially useful approach to the therapy of HPV 16-positive HNC.
-
Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F.
2007-01-01
This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 107 transformants/μg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive PpampS promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by ∼91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains. PMID:17933941
-
Piechaczek, C; Fetzer, C; Baiker, A; Bode, J; Lipps, H J
1999-01-01
We have developed an episomal replicating expression vector in which the SV40 gene coding for the large T-antigen was replaced by chromosomal scaffold/matrix attached regions. Southern analysis as well as vector rescue experiments in CHO cells and in Escherichia coli demonstrate that the vector replicates episomally in CHO cells. It occurs in a very low copy number in the cells and is stably maintained over more than 100 generations without selection pressure. PMID:9862961
-
Analysis of miRNA expression profile based on SVM algorithm
NASA Astrophysics Data System (ADS)
Ting-ting, Dai; Chang-ji, Shan; Yan-shou, Dong; Yi-duo, Bian
2018-05-01
Based on mirna expression spectrum data set, a new data mining algorithm - tSVM - KNN (t statistic with support vector machine - k nearest neighbor) is proposed. the idea of the algorithm is: firstly, the feature selection of the data set is carried out by the unified measurement method; Secondly, SVM - KNN algorithm, which combines support vector machine (SVM) and k - nearest neighbor (k - nearest neighbor) is used as classifier. Simulation results show that SVM - KNN algorithm has better classification ability than SVM and KNN alone. Tsvm - KNN algorithm only needs 5 mirnas to obtain 96.08 % classification accuracy in terms of the number of mirna " tags" and recognition accuracy. compared with similar algorithms, tsvm - KNN algorithm has obvious advantages.
-
Beverly, Levi J; Podsypanina, Katrina
2016-02-01
Since the introduction of retroviral vector technology, permanent genetic marking of cells has considerably contributed to the understanding of different physiological and disease processes in vivo. Recent marking strategies aim to elucidate the contribution of cells on the clonal level, and the advent of fluorescent proteins has opened new avenues for the in vivo analysis of gene-marked cells. Gene-modified cells are easily identifiable (e.g., via the introduced fluorescent protein) within whole organ structures, allowing one to measure the contribution of transduced cells to malignant outgrowth. In our laboratory, we use the tetracycline-inducible system to study oncogene cooperation in metastatic progression. We use bicistronic retroviruses expressing the tetracycline transactivator (tTA) and the candidate gene (MIT-gene) or the tTA alone (MIT-Rx) to infect primary mammary cells from mice harboring tetracycline-inducible transgenes. This allows for constitutive expression of the candidate gene and tTA-dependent expression of the inducible oncogene. We also use MIG-based vectors, which allow for constitutive expression of the candidate gene and a green fluorescent protein. Here we describe how to produce retroviral particles carrying both MIT- and MIG-based vectors. Because of the fragility of the retroviral envelope, we do not attempt to concentrate the virus, and we directly use packaging cell media to infect primary epithelial cells (either normal or tumor). Infected cells can be transplanted into recipient mice to investigate metastatic colonization. © 2016 Cold Spring Harbor Laboratory Press.
-
Zheng, W Y; Wang, Y; Zhang, Z C; Yan, F
2015-10-05
We examined the immunological characteristics of outer membrane protein omp31 of goat Brucella and its monoclonal antibody. Genomic DNA from the M5 strain of goat Brucella was amplified by polymerase chain reaction and cloned into the prokaryotic expression vector pGEX-4T-1. The expression and immunological characteristics of the fusion protein GST-omp31 were subjected to preliminary western blot detection with goat Brucella rabbit immune serum. The Brucella immunized BALB/c mouse serum was detected using purified protein. The high-potency mouse splenocytes and myeloma Sp2/0 cells were fused. Positive clones were screened by enzyme-linked immunosorbent assay to establish a hybridoma cell line. Mice were inoculated intraperitoneally with hybridoma cells to prepare ascites. The mAb was purified using the n-caprylic acid-ammonium sulfate method. The characteristics of mAb were examined using western blotting and enzyme-linked immunosorbent assay. A 680-base pair band was observed after polymerase chain reaction. Enzyme digestion identification and sequencing showed that the pGEX-4T-1-omp31 prokaryotic expression vector was successfully established; a target band of approximately 57 kDa with an apparent molecular weight consistent with the size of the target fusion protein. At 25°C, the expression of soluble expression increased significantly; the fusion protein GST-omp31 was detected by western blotting. Anti-omp31 protein mAb was obtained from 2 strains of Brucella. The antibody showed strong specificity and sensitivity and did not cross-react with Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Mycobacterium tuberculosis, or Bacillus pyocyaneus. The pGEX-4T-1-omp31 prokaryotic expression vector was successfully established and showed good immunogenicity. The antibody also showed strong specificity and good sensitivity.
-
Hopkins, Richard; Bridgeman, Anne; Bourne, Charles; Mbewe-Mvula, Alice; Sadoff, Jerald C; Both, Gerald W; Joseph, Joan; Fulkerson, John; Hanke, Tomáš
2011-12-01
The desire to induce HIV-1-specific responses soon after birth to prevent breast milk transmission of HIV-1 led us to propose a vaccine regimen which primes HIV-1-specific T cells using a recombinant Mycobacterium bovis bacillus Calmette-Guérin (rBCG) vaccine. Because attenuated live bacterial vaccines are typically not sufficiently immunogenic as stand-alone vaccines, rBCG-primed T cells will likely require boost immunization(s). Here, we compared modified Danish (AERAS-401) and Pasteur lysine auxotroph (222) strains of BCG expressing the immunogen HIVA for their potency to prime HIV-1-specific responses in adult BALB/c mice and examined four heterologous boosting HIVA vaccines for their immunogenic synergy. We found that both BCG.HIVA(401) and BCG.HIVA(222) primed HIV-1-specific CD8(+) T-cell-mediated responses. The strongest boosts were delivered by human adenovirus-vectored HAdV5.HIVA and sheep atadenovirus-vectored OAdV7.HIVA vaccines, followed by poxvirus MVA.HIVA; the weakest was plasmid pTH.HIVA DNA. The prime-boost regimens induced T cells capable of efficient in vivo killing of sensitized target cells. We also observed that the BCG.HIVA(401) and BCG.HIVA(222) vaccines have broadly similar immunologic properties, but display a number of differences mainly detected through distinct profiles of soluble intercellular signaling molecules produced by immune splenocytes in response to both HIV-1- and BCG-specific stimuli. These results encourage further development of the rBCG prime-boost regimen. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Recombinant raccoon pox vaccine protects mice against lethal plague
Osorio, J.E.; Powell, T.D.; Frank, R.S.; Moss, K.; Haanes, E.J.; Smith, S.R.; Rocke, T.E.; Stinchcomb, D.T.
2003-01-01
Using a raccoon poxvirus (RCN) expression system, we have developed new recombinant vaccines that can protect mice against lethal plague infection. We tested the effects of a translation enhancer (EMCV-IRES) in combination with a secretory (tPA) signal or secretory (tPA) and membrane anchoring (CHV-gG) signals on in vitro antigen expression of F1 antigen in tissue culture and the induction of antibody responses and protection against Yersinia pestis challenge in mice. The RCN vector successfully expressed the F1 protein of Y. pestis in vitro. In addition, the level of expression was increased by the insertion of the EMCV-IRES and combinations of this and the secretory signal or secretory and anchoring signals. These recombinant viruses generated protective immune responses that resulted in survival of 80% of vaccinated mice upon challenge with Y. pestis. Of the RCN-based vaccines we tested, the RCN-IRES-tPA-YpF1 recombinant construct was the most efficacious. Mice vaccinated with this construct withstood challenge with as many as 1.5 million colony forming units of Y. pestis (7.7×104 LD50). Interestingly, vaccination with F1 fused to the anchoring signal (RCN-IRES-tPA-YpF1-gG) elicited significant anti-F1 antibody titers, but failed to protect mice from plague challenge. Our studies demonstrate, in vitro and in vivo, the potential importance of the EMCV-IRES and secretory signals in vaccine design. These molecular tools provide a new approach for improving the efficacy of vaccines. In addition, these novel recombinant vaccines could have human, veterinary, and wildlife applications in the prevention of plague.
-
Stark, Felicity C; McCluskie, Michael J; Krishnan, Lakshmi
2016-11-17
Homologous prime-boost vaccinations with live vectors typically fail to induce repeated strong CD8⁺ T cell responses due to the induction of anti-vector immunity, highlighting the need for alternative delivery vehicles. The unique ether lipids of archaea may be constituted into liposomes, archaeosomes, which do not induce anti-carrier responses, making them an ideal candidate for use in repeat vaccination systems. Herein, we evaluated in mice the maximum threshold of antigen-specific CD8⁺ T cell responses that may be induced by multiple homologous immunizations with ovalbumin (OVA) entrapped in archaeosomes derived from the ether glycerolipids of the archaeon Methanobrevibacter smithii (MS-OVA). Up to three immunizations with MS-OVA administered in optimized intervals (to allow for sufficient resting of the primed cells prior to boosting), induced a potent anti-OVA CD8⁺ T cell response of up to 45% of all circulating CD8⁺ T cells. Additional MS-OVA injections did not add any further benefit in increasing the memory of CD8⁺ T cell frequency. In contrast, OVA expressed by Listeria monocytogenes (LM-OVA), an intracellular bacterial vector failed to evoke a boosting effect after the second injection, resulting in significantly reduced antigen-specific CD8⁺ T cell frequencies. Furthermore, repeated vaccination with MS-OVA skewed the response increasingly towards an effector memory (CD62 low ) phenotype. Vaccinated animals were challenged with B16-OVA at late time points after vaccination (+7 months) and were afforded protection compared to control. Therefore, archaeosomes constituted a robust particulate delivery system to unravel the kinetics of CD8⁺ T cell response induction and memory maintenance and constitute an efficient vaccination regimen optimized for tumor protection.
-
Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho
2017-09-15
Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.
-
Alroy, Karen A.; Huang, Christine; Gilman, Robert H.; Quispe-Machaca, Victor R.; Marks, Morgan A.; Ancca-Juarez, Jenny; Hillyard, Miranda; Verastegui, Manuela; Sanchez, Gerardo; Cabrera, Lilia; Vidal, Elisa; Billig, Erica M. W.; Cama, Vitaliano A.; Náquira, César; Bern, Caryn; Levy, Michael Z.
2015-01-01
Background Vector-borne transmission of Trypanosoma cruzi is seen exclusively in the Americas where an estimated 8 million people are infected with the parasite. Significant research in southern Peru has been conducted to understand T. cruzi infection and vector control, however, much less is known about the burden of infection and epidemiology in northern Peru. Methodology A cross-sectional study was conducted to estimate the seroprevalence of T. cruzi infection in humans (n=611) and domestic animals [dogs (n=106) and guinea pigs (n=206)] in communities of Cutervo Province, Peru. Sampling and diagnostic strategies differed according to species. An entomological household study (n=208) was conducted to identify the triatomine burden and species composition, as well as the prevalence of T. cruzi in vectors. Electrocardiograms (EKG) were performed on a subset of participants (n=90 T. cruzi infected participants and 170 age and sex-matched controls). The seroprevalence of T. cruzi among humans, dogs, and guinea pigs was 14.9% (95% CI: 12.2 – 18.0%), 19.8% (95% CI: 12.7- 28.7%) and 3.3% (95% CI: 1.4 – 6.9%) respectively. In one community, the prevalence of T. cruzi infection was 17.2% (95% CI: 9.6 - 24.7%) among participants < 15 years, suggesting recent transmission. Increasing age, positive triatomines in a participant's house, and ownership of a T. cruzi positive guinea pig were independent correlates of T. cruzi infection. Only one species of triatomine was found, Panstrongylus lignarius, formerly P. herreri. Approximately forty percent (39.9%, 95% CI: 33.2 - 46.9%) of surveyed households were infested with this vector and 14.9% (95% CI: 10.4 - 20.5%) had at least one triatomine positive for T. cruzi. The cardiac abnormality of right bundle branch block was rare, but only identified in seropositive individuals. Conclusions Our research documents a substantial prevalence of T. cruzi infection in Cutervo and highlights a need for greater attention and vector control efforts in northern Peru. PMID:26000770
-
HSP60, a protein downregulated by IGFBP7 in colorectal carcinoma
2010-01-01
Background In our previous study, it was well defined that IGFBP7 was an important tumor suppressor gene in colorectal cancer (CRC). We aimed to uncover the downstream molecules responsible for IGFBP7's behaviour in this study. Methods Differentially expressed protein profiles between PcDNA3.1(IGFBP7)-transfected RKO cells and the empty vector transfected controls were generated by two-dimensional gel electrophoresis (2-DE) and mass spectrometry (MS) identification. The selected differentially expressed protein induced by IGFBP7 was confirmed by western blot and ELISA. The biological behaviour of the protein was explored by cell growth assay and colony formation assay. Results Six unique proteins were found differentially expressed in PcDNA3.1(IGFBP7)-transfected RKO cells, including albumin (ALB), 60 kDa heat shock protein(HSP60), Actin cytoplasmic 1 or 2, pyruvate kinase muscle 2(PKM2), beta subunit of phenylalanyl-tRNA synthetase(FARSB) and hypothetical protein. The downregulation of HSP60 by IGFBP7 was confirmed by western blot and ELISA. Recombinant human HSP60 protein could increase the proliferation rate and the colony formation ability of PcDNA3.1(IGFBP7)-RKO cells. Conclusion HSP60 was an important downstream molecule of IGFBP7. The downregulation of HSP60 induced by IGFBP7 may be, at least in part, responsible for IGFBP7's tumor suppressive biological behaviour in CRC. PMID:20433702
-
Chi-Wei Lan, John; Chang, Chih-Kai; Wu, Ho-Shing
2014-09-01
A mutant gene of rumen phytase (phyA-7) was cloned into pET23b(+) vector and expressed in the Escherichia coli BL21 under the control of the T7 promoter. The study of fermentation conditions includes the temperature impacts of mutant phytase expression, the effect of carbon supplements over induction stage, the inferences of acetic acid accumulation upon enzyme expression and the comparison of one-stage and two-stage operations in batch mode. The maximum value of phytase activity was reached 107.0 U mL(-1) at induction temperature of 30°C. Yeast extract supplement demonstrated a significant increase on both protein concentration and phytase activity. The acetic acid (2 g L(-1)) presented in the modified synthetic medium demonstrated a significant decrease on expressed phytase activity. A two-stage batch operation enhanced the level of phytase activity from 306 to 1204 U mL(-1) in the 20 L of fermentation scale. An overall 3.7-fold improvement in phytase yield (35,375.72-1,31,617.50 U g(-1) DCW) was achieved in the two-stage operation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
-
Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V
2007-06-15
A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.
-
Decade-Long Safety and Function of Retroviral-Modified Chimeric Antigen Receptor T-cells
Scholler, John; Brady, Troy L.; Binder-Scholl, Gwendolyn; Hwang, Wei-Ting; Plesa, Gabriela; Hege, Kristen M.; Vogel, Ashley N.; Kalos, Michael; Riley, James L.; Deeks, Steven G.; Mitsuyasu, Ronald T.; Bernstein, Wendy B.; Aronson, Naomi E.; Levine, Bruce L.; Bushman, Frederic D.; June, Carl H.
2015-01-01
The success of adoptive T cell gene transfer for treatment of cancer and HIV is predicated on generating a response that is both durable and safe. Here we report long term results from three clinical trials to evaluate gammaretroviral vector engineered T-cells for HIV. The vector encoded a chimeric antigen receptor (CAR) comprised of CD4 linked to the CD3-ζ signaling chain (CD4ζ). CAR T-cells were detected in 98% of samples tested for at least 11 years post-infusion at frequencies that exceed average T cell levels after most vaccine approaches. The CD4ζ transgene retained expression and function. There was no evidence of vector-induced immortalization of cells as integration site distributions showed no evidence of persistent clonal expansion or enrichment for integration sites near genes implicated in growth control or transformation. The CD4ζ T cells have stable levels of engraftment, with decay half-lives that exceed 16 years, in marked contrast to previous trials testing engineered T cells. These findings indicate that host immunosuppression prior to T cell transfer is not required in order to achieve long term persistence of gene-modified T cells. Further, our results emphasize the safety of T cells modified by retroviral gene transfer in clinical application, as measured in >500 patient years of follow up. Thus, previous safety issues with integrating viral vectors are hematopoietic stem cell or transgene intrinsic, and not a general feature of retroviral vectors. Engineered T cells are a promising form of synthetic biology for long term delivery of protein based therapeutics. These results provide a framework to guide the therapy of a wide spectrum of human diseases. PMID:22553251
-
Carozza, Marlène; Rodrigues, Valérie; Unterfinger, Yves; Galea, Sandra; Coulpier, Muriel; Klonjkowski, Bernard; Thiaucourt, François; Totté, Philippe; Richardson, Jennifer
2015-01-01
Contagious bovine pleuropneumonia (CBPP), caused by Mycoplasma mycoides subsp. mycoides small colony type (MmmSC), is a devastating respiratory disease of cattle. In sub-Saharan Africa, where CBPP is enzootic, live attenuated vaccines are deployed but afford only short-lived protection. In cattle, recovery from experimental MmmSC infection has been associated with the presence of CD4(+) T lymphocytes that secrete interferon gamma in response to MmmSC, and in particular to the lipoprotein A (LppA) antigen. In an effort to develop a better vaccine against CBPP, a viral vector (Ad5-LppA) that expressed LppA was generated from human adenovirus type 5. The LppA-specific immune responses elicited by the Ad5-LppA vector were evaluated in mice, and compared to those elicited by recombinant LppA formulated with a potent adjuvant. Notably, a single administration of Ad5-LppA, but not recombinant protein, sufficed to elicit a robust LppA-specific humoral response. After a booster administration, both vector and recombinant protein elicited strong LppA-specific humoral and cell-mediated responses. Ex vivo stimulation of splenocytes induced extensive proliferation of CD4(+) T cells for mice immunized with vector or protein, and secretion of T helper 1-associated and proinflammatory cytokines for mice immunized with Ad5-LppA. Our study - by demonstrating the potential of a viral-vectored prototypic vaccine to elicit prompt and robust immune responses against a major antigen of MmmSC - represents a first step in developing a recombinant vaccine against CBPP. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Douillard, François P; Mahony, Jennifer; Campanacci, Valérie; Cambillau, Christian; van Sinderen, Douwe
2011-09-01
Over the last 10 years, the NIsin Controlled Expression (NICE) system has been extensively used in the food-grade bacterium Lactococcus lactis subsp. cremoris to produce homologous and heterologous proteins for academic and biotechnological purposes. Although various L. lactis molecular tools have been developed, no expression vectors harboring the popular Gateway recombination system are currently available for this widely used cloning host. In this study, we constructed two expression vectors that combine the NICE and the Gateway recombination systems and we tested their applicability by recombining and over-expressing genes encoding structural proteins of lactococcal phages Tuc2009 and TP901-1. Over-expressed phage proteins were analyzed by immunoblotting and purified by His-tag affinity chromatography with protein productions yielding 2.8-3.7 mg/l of culture. This therefore is the first description of L. lactis NICE expression vectors which integrate the Gateway cloning technology and which are suitable for the production of sufficient amounts of proteins to facilitate subsequent structural and functional analyses. Copyright © 2011 Elsevier Inc. All rights reserved.
-
Chromosomal integration of adenoviral vector DNA in vivo.
Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan
2010-10-01
So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.
-
Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin
2016-01-01
Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.
-
Jin, Qingwen; Marsh, Jon; Cornetta, Kenneth; Alkhatib, Ghalib
2009-01-01
It has previously been demonstrated that there are two distinct mechanisms for genetic resistance to human immunodeficiency virus type 1 (HIV-1) conferred by the CCR5Δ32 gene: the loss of wild-type CCR5 surface expression and the generation of CCR5Δ32 protein, which interacts with CXCR4. To analyse the protective effects of long-term expression of the CCR5Δ32 protein, recombinant lentiviral vectors were used to deliver the CCR5Δ32 gene into human cell lines and primary peripheral blood mononuclear cells that had been immortalized by human T-cell leukemia virus type 1. Blasticidin S-resistant cell lines expressing the lentivirus-encoded CCR5Δ32 showed a significant reduction in HIV-1 Env-mediated fusion assays. It was shown that CD4+ T lymphocytes expressing the lentivirus-encoded CCR5Δ32 gene were highly resistant to infection by a primary but not by a laboratory-adapted X4 strain, suggesting different infectivity requirements. In contrast to previous studies that analysed the CCR5Δ32 protective effects in a transient expression system, this study showed that long-term expression of CCR5Δ32 conferred resistance to HIV-1 despite cell-surface expression of the HIV co-receptors. The results suggest an additional unknown mechanism for generating the CCR5Δ32 resistance phenotype and support the hypothesis that the CCR5Δ32 protein acts as an HIV-suppressive factor by altering the stoichiometry of the molecules involved in HIV-1 entry. The lentiviral-CCR5Δ32 vectors offer a method of generating HIV-resistant cells by delivery of the CCR5Δ32 gene that may be useful for stem cell- or T-cell-based gene therapy for HIV-1 infection. PMID:18796731
-
Dekhtiarenko, Iryna; Ratts, Robert B; Blatnik, Renata; Lee, Lian N; Fischer, Sonja; Borkner, Lisa; Oduro, Jennifer D; Marandu, Thomas F; Hoppe, Stephanie; Ruzsics, Zsolt; Sonnemann, Julia K; Mansouri, Mandana; Meyer, Christine; Lemmermann, Niels A W; Holtappels, Rafaela; Arens, Ramon; Klenerman, Paul; Früh, Klaus; Reddehase, Matthias J; Riemer, Angelika B; Cicin-Sain, Luka
2016-12-01
Cytomegalovirus (CMV) elicits long-term T-cell immunity of unparalleled strength, which has allowed the development of highly protective CMV-based vaccine vectors. Counterintuitively, experimental vaccines encoding a single MHC-I restricted epitope offered better immune protection than those expressing entire proteins, including the same epitope. To clarify this conundrum, we generated recombinant murine CMVs (MCMVs) encoding well-characterized MHC-I epitopes at different positions within viral genes and observed strong immune responses and protection against viruses and tumor growth when the epitopes were expressed at the protein C-terminus. We used the M45-encoded conventional epitope HGIRNASFI to dissect this phenomenon at the molecular level. A recombinant MCMV expressing HGIRNASFI on the C-terminus of M45, in contrast to wild-type MCMV, enabled peptide processing by the constitutive proteasome, direct antigen presentation, and an inflation of antigen-specific effector memory cells. Consequently, our results indicate that constitutive proteasome processing of antigenic epitopes in latently infected cells is required for robust inflationary responses. This insight allows utilizing the epitope positioning in the design of CMV-based vectors as a novel strategy for enhancing their efficacy.
-
Blatnik, Renata; Lee, Lian N.; Fischer, Sonja; Borkner, Lisa; Oduro, Jennifer D.; Marandu, Thomas F.; Hoppe, Stephanie; Ruzsics, Zsolt; Sonnemann, Julia K.; Meyer, Christine; Holtappels, Rafaela; Arens, Ramon; Früh, Klaus; Reddehase, Matthias J.; Riemer, Angelika B.; Cicin-Sain, Luka
2016-01-01
Cytomegalovirus (CMV) elicits long-term T-cell immunity of unparalleled strength, which has allowed the development of highly protective CMV-based vaccine vectors. Counterintuitively, experimental vaccines encoding a single MHC-I restricted epitope offered better immune protection than those expressing entire proteins, including the same epitope. To clarify this conundrum, we generated recombinant murine CMVs (MCMVs) encoding well-characterized MHC-I epitopes at different positions within viral genes and observed strong immune responses and protection against viruses and tumor growth when the epitopes were expressed at the protein C-terminus. We used the M45-encoded conventional epitope HGIRNASFI to dissect this phenomenon at the molecular level. A recombinant MCMV expressing HGIRNASFI on the C-terminus of M45, in contrast to wild-type MCMV, enabled peptide processing by the constitutive proteasome, direct antigen presentation, and an inflation of antigen-specific effector memory cells. Consequently, our results indicate that constitutive proteasome processing of antigenic epitopes in latently infected cells is required for robust inflationary responses. This insight allows utilizing the epitope positioning in the design of CMV-based vectors as a novel strategy for enhancing their efficacy. PMID:27977791
-
Krenciute, Giedre; Prinzing, Brooke L; Yi, Zhongzhen; Wu, Meng-Fen; Liu, Hao; Dotti, Gianpietro; Balyasnikova, Irina V; Gottschalk, Stephen
2017-07-01
Glioblastoma (GBM) is the most aggressive primary brain tumor in adults and is virtually incurable with conventional therapies. Immunotherapy with T cells expressing GBM-specific chimeric antigen receptors (CAR) is an attractive approach to improve outcomes. Although CAR T cells targeting GBM antigens, such as IL13 receptor subunit α2 (IL13Rα2), HER2, and EGFR variant III (EGFRvIII), have had antitumor activity in preclinical models, early-phase clinical testing has demonstrated limited antiglioma activity. Transgenic expression of IL15 is an appealing strategy to enhance CAR T-cell effector function. We tested this approach in our IL13Rα2-positive glioma model in which limited IL13Rα2-CAR T-cell persistence results in recurrence of antigen-positive gliomas. T cells were genetically modified with retroviral vectors encoding IL13Rα2-CARs or IL15 (IL13Rα2-CAR.IL15 T cells). IL13Rα2-CAR.IL15 T cells recognized glioma cells in an antigen-dependent fashion, had greater proliferative capacity, and produced more cytokines after repeated stimulations in comparison with IL13Rα2-CAR T cells. No autonomous IL13Rα2-CAR.IL15 T-cell proliferation was observed; however, IL15 expression increased IL13Rα2-CAR T-cell viability in the absence of exogenous cytokines or antigen. In vivo , IL13Rα2-CAR.IL15 T cells persisted longer and had greater antiglioma activity than IL13Rα2-CAR T cells, resulting in a survival advantage. Gliomas recurring after 40 days after T-cell injection had downregulated IL13Rα2 expression, indicating that antigen loss variants occur in the setting of improved T-cell persistence. Thus, CAR T cells for GBM should not only be genetically modified to improve their proliferation and persistence, but also to target multiple antigens. Summary: Glioblastoma responds imperfectly to immunotherapy. Transgenic expression of IL15 in T cells expressing CARs improved their proliferative capacity, persistence, and cytokine production. The emergence of antigen loss variants highlights the need to target multiple tumor antigens. Cancer Immunol Res; 5(7); 571-81. ©2017 AACR . ©2017 American Association for Cancer Research.
-
Immunogencity of HSA-L7/L12 (Brucella abortus ribosomal protein) in an animal model.
Pakzad, Iraj; Rezaee, Abbas; Rasaee, Mohammad Javad; Tabbaraee, Bahman; Delpisheh, Ali
2009-03-01
The immunogenic Brucella abortus ribosomal protein L7/L12 is a promising candidate antigen for the development of subunit vaccines against brucellosis. This study was aimed to evaluate the protection of recombinant Human Serum Albumin (HAS)-L7/L12 fusion protein in Balb/c mice. The amplified L7/L12 gene was cloned in pYHSA5 vector, pYHSA5-L7/L12 construct was transformed in Saccharomyces cerevisiae and the expressed protein from supernatant was purified by affinity chromatography. Balb/c mice were immunized in five groups by tHSA-L7/L12 fusion protein (group 1), Brucella abortus S19 (group 2), HSA (group 3), recombinant L7/L12 (group 4), PBS (group 5). ELISA to detect antibody production, LTT test to assess antigen specific lymphocyte response were conducted prior to virulent B. abortus strain 544 challenge two weeks after the last injection. Bacterial counts from spleens of immunized mice were done four weeks after challenge. In ELISA tests, the specific antibodies exhibited a dominance of immunoglobulin IgG1 over IgG2a. In addition, the tHSA-L7/L12 fusion protein and L7/L12 elicited a strong T-cell proliferative response upon restimulation in vitro with recombinant tHSA-L7/L12 and L7/L12, suggesting the induction of a cellular immunity response in vivo. However, there was no significant difference in proliferative response of L7/L12 and tHSA-L7/L12 fusion protein (p>0.05). The L7/L12 and tHSA-L7/L12 fusion protein vaccines could also induce significant protection against challenge with the virulent strain B. abortus 544 in Balb/c mice (p< or =0.05). The tHSA-L7/L12 fusion protein, similar to L7/L12 has the ability to induce antigen specific lymphocyte proliferation, stimulate humoral immunity and engender protection.
-
High-capacity 'gutless' adenoviral vectors.
Kochanek, S; Schiedner, G; Volpers, C
2001-10-01
Adenoviral vectors are promising gene transfer vehicles for different gene therapy applications. High-capacity adenoviral (HC-Ad) vectors address some of the problems that have been observed with replication-defective, E1-deleted first-generation adenoviral vectors: toxicity and immunogenicity due to viral gene expression and 7 to 8 kb capacity limit for the transport of therapeutic DNA. This review summarizes HC-Ad vector-related publications from the past 18 months that are mainly concerned with vector design/production and in vivo applications in different murine models.
-
Tissue plasminogen activator (tPA) as a reporter gene in transient gene expression.
Cheng, S M; Lee, S G; Kalyan, N K; McCloud, S; Levner, M; Hung, P P
1987-01-01
Using the gene coding for tissue plasminogen activator (tPA) as a reporter gene, a transient gene expression system has been established. Vectors containing the full-length cDNA of tPA with its signal sequences were introduced into mammalian recipient cells by a modified gene transfer procedure. Thirty hours after transfection, the secreted tPA was found in serum-free medium and measured by a fibrin-agarose plate assay (FAPA). In this assay, tPA converts plasminogen into plasmin which then degrades high-Mr fibrin to produce cleared zones. The sizes of these zones correspond to quantities of tPA. The combination of transient tPA expression system and the FAPA provides a quick, sensitive, quantitative and non-destructive method to examine the strength of eukaryotic regulatory elements in tissue-culture cells.
-
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
-
Zhu, Lijuan; Liao, Wenjun; Zhu, Huifen; Lei, Ping; Wang, Zhihua; Shao, Jingfang; Zhang, Yue; Shen, Guanxin
2006-01-01
The expression vector of SmIg scFv fragment was constructed in patient with B cell chronic lymphocyte leukemia (B-CLL) and expressed in E. coli to obtain scFv fragment, and the effect of the protein on the proliferation of stimulated peripheral blood mononuclear cells (PBMC) was investigated in vitro. Two pairs of primers were designed, and variable region genes of light chain and heavy chain were amplified by PCR respectively from the pGEM-T vectors previously constructed in our laboratory which containing light chain gene or Fd fragment of heavy chain gene. The PCR product was digested, purified and inserted into pHEN2 vector to construct the soluble expression vector pHEN2-scFv. After the induction by IPTG, the scFv protein was identified by SDS-PAGE electrophoresis and purified by Ni-NTA-Chromatography. MTT was used to determine the effect of purified protein on the proliferation of stimulated PBMC in vitro. Plasmid PCR and restriction enzyme digestion of pHEN2-scFv revealed the pHEN2-scFv vector was constructed successfully. Id-scFv protein was expressed in positive clone after induced by IPTG. SDS-PAGE analysis showed that the relative molecular weight of fusion protein was about 30 kD (1 kD= 0.9921 ku), which was consistent with the theoretically predicted value. Proliferation of PBMC could be induced by purified Id-scFv. It was suggested that the expression vector of SmIg scFv fragment was constructed successfully, and scFv protein was expressed and secreted from E. coli, which could induce proliferation of PBMC. This may lay an experimental foundation for further research of Id-HSP complex vaccine for B-CLL.
-
2011-01-01
Background Bioluminescent tumor cell lines are experimental tools of major importance for cancer investigation, especially imaging of tumors in xenografted animals. Stable expression of exogenous luciferase in tumor cells combined to systemic injection of luciferin provides an excellent signal/background ratio for external optical imaging. Therefore, there is a need to rationalize and speed up the production of luciferase-positive tumor cell lines representative of multiple tumor phenotypes. For this aim we have designed a fusion gene linking the luciferase 2 protein to the c-terminus of a truncated form of the rat CD2 protein (tCD2-luc2). To allow simultaneous assessment of the wild-type luciferase 2 in a context of tCD2 co-expression, we have made a bicistronic construct for concomitant but separate expression of these two proteins (luc2-IRES-tCD2). Both the mono- and bi-cistronic constructs were transduced in lymphoid and epithelial cells using lentiviral vectors. Results The tCD2-luc2 chimera behaves as a type I membrane protein with surface presentation of CD2 epitopes. One of these epitopes reacts with the OX34, a widely spread, high affinity monoclonal antibody. Stably transfected cells are sorted by flow cytometry on the basis of OX34 staining. In vitro and, moreover, in xenografted tumors, the tCD2-luc2 chimera retains a substantial and stable luciferase activity, although not as high as the wild-type luciferase expressed from the luc2-IRES-tCD2 construct. Expression of the tCD2-luc2 chimera does not harm cell and tumor growth. Conclusion Lentiviral transduction of the chimeric tCD2-luc2 fusion gene allows selection of cell clones with stable luciferase expression in less than seven days without antibiotic selection. We believe that it will be helpful to increase the number of tumor cell lines available for in vivo imaging and assessment of novel therapeutic modalities. On a longer term, the tCD2-luc2 chimera has the potential to be expressed from multi-cassette vectors in combination with various inserts of interest. PMID:21435248
-
Production and first-in-man use of T cells engineered to express a HSVTK-CD34 sort-suicide gene.
Zhan, Hong; Gilmour, Kimberly; Chan, Lucas; Farzaneh, Farzin; McNicol, Anne Marie; Xu, Jin-Hua; Adams, Stuart; Fehse, Boris; Veys, Paul; Thrasher, Adrian; Gaspar, Hubert; Qasim, Waseem
2013-01-01
Suicide gene modified donor T cells can improve immune reconstitution after allogeneic haematopoietic stem cell transplantation (SCT), but can be eliminated in the event of graft versus host disease (GVHD) through the administration of prodrug. Here we report the production and first-in-man use of mismatched donor T cells modified with a gamma-retroviral vector expressing a herpes simplex thymidine kinase (HSVTK):truncated CD34 (tCD34) suicide gene/magnetic selection marker protein. A stable packaging cell line was established to produce clinical grade vector pseudotyped with the Gibbon Ape Leukaemia Virus (GALV). T cells were transduced in a closed bag system following activation with anti-CD3/CD28 beads, and enriched on the basis of CD34 expression. Engineered cells were administered in two escalating doses to three children receiving T-depleted, CD34 stem cell selected, mismatched allogeneic grafts. All patients had pre-existing viral infections and received chemotherapy conditioning without serotherapy. In all three subjects cell therapy was tolerated without acute toxicity or the development of acute GVHD. Circulating gene modified T cells were detectable by flow cytometry and by molecular tracking in all three subjects. There was resolution of virus infections, concordant with detectable antigen-specific T cell responses and gene modified cells persisted for over 12 months. These findings highlight the suitability of tCD34 as a GMP compliant selection marker and demonstrate the feasibility, safety and immunological potential of HSVTK-tCD34 suicide gene modified donor T cells. ClinicalTrials.gov NCT01204502
-
Singh, Harjeet; Huls, Helen; Cooper, Laurence JN
2014-01-01
Summary The advent of efficient approaches to the genetic modification of T cells has provided investigators with clinically appealing approaches to improve the potency of tumor-specific clinical grade T cells. For example, gene therapy has been successfully used to enforce expression of chimeric antigen receptors (CAR) that provide T cells with ability to directly recognize tumor-associated antigens without the need for presentation by human leukocyte antigen. Gene transfer of CARs can be undertaken using viral-based and non-viral approaches. We have advanced DNA vectors derived from the Sleeping Beauty (SB) system to avoid the expense and manufacturing difficulty associated with transducing T cells with recombinant viral vectors. After electroporation, the transposon/transposase system improves the efficiency of integration of plasmids used to express CAR and other transgenes in T cells. The SB system combined with artificial antigen-presenting cells (aAPC) can selectively propagate and thus retrieve CAR+ T cells suitable for human application. This review describes the translation of the SB system and aAPC for use in clinical trials and highlights how a nimble and cost-effective approach to developing genetically modified T cells can be used to implement clinical trials infusing next-generation T cells with improved therapeutic potential. PMID:24329797
-
Jave-Suarez, Luis F; Langbein, Lutz; Winter, Hermelita; Praetzel, Silke; Rogers, Michael A; Schweizer, Juergen
2004-03-01
Previous work had shown that most members of the complex human hair keratin family were expressed in terminal scalp hairs. An exception to this rule was the type I hair keratin hHa7, which was only detected in some but not all vellus hairs of the human scalp (Langbein et al, 1999). Here we show that hHa7 exhibits constitutive expression in medullary cells of all types of male and female sexual hairs. Medullated beard, axillary, and pubic hairs arise during puberty from small, unmedullated vellus hairs under the influence of circulating androgens. This suggested an androgen-controlled expression of the hHa7 gene. Further evidence for this assumption was provided by the demonstration of androgen receptor (AR) expression in the nuclei of medullary cells of beard hairs. Moreover, homology search for the semipalindromic androgen receptor-binding element (ARE) consensus sequence GG(A)/(T)ACAnnnTGTTCT in the proximal hHa7 promoter revealed three putative ARE motifs. Electrophoretic mobility shift assays demonstrated the specific binding of AR to all three hHa7 AREs. Their function as AR-responsive elements, either individually or in concert within the hHa7 promoter, could be further confirmed by transfection studies with or without an AR expression vector in PtK2 and prostate PC3-Arwt cells, respectively in the presence or absence of a synthetic androgen. Our study detected hHa7 as the first gene in hair follicle trichocytes whose expression appears to be directly regulated by androgens. As such, hHa7 represents a marker for androgen action on hair follicles and might be a suitable tool for investigations of androgen-dependent hair disorders.
-
2013-01-01
Background Chagas disease is most often transmitted to humans by Trypanosoma cruzi infected triatomine bugs, and remains a significant cause of morbidity and mortality in Central and South America. Control of Chagas disease has relied mainly on vector eradication. However, development of insect resistance has prompted us to develop a paratransgenic strategy to control vectorial transmission of T. cruzi. Here, the potential role of recombinant endoglucanases as anti-trypanosomal agents for paratransgenic application is examined. The surface of T. cruzi is covered by a thick coat of mucin-like glycoproteins that have been proposed to play a role in the binding of T. cruzi to the membrane surface of the vector gut. We hypothesize that disruption of these glycoconjugates could arrest parasite development in the vector and abort the transmission cycle. In this work, we examine the effects of recombinant Arthrobacter luteus β-1, 3-glucanase expressed via Rhodococcus rhodnii on T. cruzi Sylvio II strain. Methods and results The coding sequence for β-1, 3-glucanase was cloned in-frame to a heterologous promoter/signal sequence from the Mycobacterium kansasii alpha antigen gene resident in an E. coli/R. rhodnii shuttle vector. The resulting construct was confirmed by sequencing, and electroporated into R. rhodnii. Expression products from positive clones were purified from log phase cultures followed by dialysis into physiological buffers. Lysates and media were quantitated by ELISA against rabbit antibody specific to β-1,3-glucanase. Glucanase-positive samples were applied to live T. cruzi parasites in culture and viability accessed by spectrophotometric and fluorescent microscopic measurements. R. rhodnii-expressed β-1,3-glucanase exhibited toxicity against T. cruzi compared to controls when applied at 5 and 10% of the total culture volume. The decrease in cell viability ranged from a maximum of 50% for the media treatments to 80% for the filtered lysates. Conclusions These results suggest that recombinant β-glucanase could be a powerful addition to the arsenal of effector molecules for paratransgenic control of Chagas disease. In future studies, the ability of β-glucanase to function in combination with other effector molecules will be explored. Dual targeting of T. cruzi should not only slow resistance but also permit synergistic or additive lethal effects on T. cruzi. PMID:23497594
-
Jose, Christo; Klein, Nicole; Wyss, Sarah; Fieck, Annabeth; Hurwitz, Ivy; Durvasula, Ravi
2013-03-14
Chagas disease is most often transmitted to humans by Trypanosoma cruzi infected triatomine bugs, and remains a significant cause of morbidity and mortality in Central and South America. Control of Chagas disease has relied mainly on vector eradication. However, development of insect resistance has prompted us to develop a paratransgenic strategy to control vectorial transmission of T. cruzi. Here, the potential role of recombinant endoglucanases as anti-trypanosomal agents for paratransgenic application is examined. The surface of T. cruzi is covered by a thick coat of mucin-like glycoproteins that have been proposed to play a role in the binding of T. cruzi to the membrane surface of the vector gut. We hypothesize that disruption of these glycoconjugates could arrest parasite development in the vector and abort the transmission cycle. In this work, we examine the effects of recombinant Arthrobacter luteus β-1, 3-glucanase expressed via Rhodococcus rhodnii on T. cruzi Sylvio II strain. The coding sequence for β-1, 3-glucanase was cloned in-frame to a heterologous promoter/signal sequence from the Mycobacterium kansasii alpha antigen gene resident in an E. coli/R. rhodnii shuttle vector. The resulting construct was confirmed by sequencing, and electroporated into R. rhodnii. Expression products from positive clones were purified from log phase cultures followed by dialysis into physiological buffers. Lysates and media were quantitated by ELISA against rabbit antibody specific to β-1,3-glucanase. Glucanase-positive samples were applied to live T. cruzi parasites in culture and viability accessed by spectrophotometric and fluorescent microscopic measurements. R. rhodnii-expressed β-1,3-glucanase exhibited toxicity against T. cruzi compared to controls when applied at 5 and 10% of the total culture volume. The decrease in cell viability ranged from a maximum of 50% for the media treatments to 80% for the filtered lysates. These results suggest that recombinant β-glucanase could be a powerful addition to the arsenal of effector molecules for paratransgenic control of Chagas disease. In future studies, the ability of β-glucanase to function in combination with other effector molecules will be explored. Dual targeting of T. cruzi should not only slow resistance but also permit synergistic or additive lethal effects on T. cruzi.
-
Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages
Studier, F. William; Dubendorff, John W.
1998-01-01
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.
-
Cloning and expression of autogenes encoding RNA poly,erases of T7-like bacteriophages
Studier, F. William; Dubendorff, John W.
1998-01-01
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grassmann, R.; Dengler, C.; Mueller-Fleckenstein, I.
1989-05-01
The role of the X region of the genome of the human T-cell leukemia virus type I (HTLV-I) in the immortalization of lymphocytes has been difficult to distinguish from its role in viral replication as this region encodes at least two genes, tax and rex, required for replication and the expression of viral proteins. To determine whether the X region does encode immortalizing functions, a fragment of the HTLV-I provirus capable of expressing known X-region proteins was inserted into the genome of a transformation-defective, replication-competent Herpesvirus saimiri. Infection of fresh mitogen-activated human cord blood and thymocytes yielded immortal T-cell linesmore » that had the same phenotype (CD4{sup +}, Cd5{sup +}, HLA class II{sup +}, interleukin 2 receptor {alpha}-chain +) as lymphocytes transformed by cocultivation with HTLV-I. These experiments demonstrate that the X region encodes the functions of HTLV-I that immortalize a distinct subpopulation of human T cells. The experiments also demonstrate the utility of the H. saimiri vector for the transduction of heterologous genes into human T cells.« less
-
[RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].
Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli
2017-08-25
This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.
-
[Construction and eukaryotic expression of PVAX1-hPV58mE6E7fcGB composite gene vaccine].
Wang, He; Yu, Jiyun; Li, Li
2013-10-01
To construct and express a composite gene vaccine for human papillomavirus 58(HPV58)-associated cervical cancer, we inserted HPV58mE6E7 fusion gene into pCI-Fc-GPI eukaryotic expression vector, constructing a recombinant plasmid named pCI-sig-HPV58mE6E7-Fc-GPI. Then we further inserted fragment of sig-HPV58mE6E7Fc-GPI into the novel vaccine vector PVAX1-IRES-GM/B7, constructing PVAX1-HPV58mE6E7FcGB composite gene vaccine. PVAX1-HPV58mE6E7FcGB vaccine was successfully constructed and identified by restriction endonuclease and sequencing analysis. Eukaryotic expression of fusion antigen sig-HPV58mE6E7-Fc-GPI and molecular ad-juvant GM-CSF and B7. 1 were proved to be realized at the same time by flow cytometry and immunofluorescence. So PVAX1-HPV58mE6E7FcGB can be taken as a candidate of therapeutic vaccine for HPV58-associated tumors and their precancerous transformations.
-
Kallert, Sandra M.; Darbre, Stephanie; Bonilla, Weldy V.; Kreutzfeldt, Mario; Page, Nicolas; Müller, Philipp; Kreuzaler, Matthias; Lu, Min; Favre, Stéphanie; Kreppel, Florian; Löhning, Max; Luther, Sanjiv A.; Zippelius, Alfred; Merkler, Doron; Pinschewer, Daniel D.
2017-01-01
Viral infections lead to alarmin release and elicit potent cytotoxic effector T lymphocyte (CTLeff) responses. Conversely, the induction of protective tumour-specific CTLeff and their recruitment into the tumour remain challenging tasks. Here we show that lymphocytic choriomeningitis virus (LCMV) can be engineered to serve as a replication competent, stably-attenuated immunotherapy vector (artLCMV). artLCMV delivers tumour-associated antigens to dendritic cells for efficient CTL priming. Unlike replication-deficient vectors, artLCMV targets also lymphoid tissue stroma cells expressing the alarmin interleukin-33. By triggering interleukin-33 signals, artLCMV elicits CTLeff responses of higher magnitude and functionality than those induced by replication-deficient vectors. Superior anti-tumour efficacy of artLCMV immunotherapy depends on interleukin-33 signalling, and a massive CTLeff influx triggers an inflammatory conversion of the tumour microenvironment. Our observations suggest that replicating viral delivery systems can release alarmins for improved anti-tumour efficacy. These mechanistic insights may outweigh safety concerns around replicating viral vectors in cancer immunotherapy. PMID:28548102
-
Shi, Meiqing; Hao, Siguo; Su, Liping; Zhang, Xueshu; Yuan, Jinying; Guo, Xuling; Zheng, Changyu; Xiang, Jim
2005-08-01
The CXC chemokine SDF-1 has been characterized as a T-cell chemoattractant both in vitro and in vivo. To determine whether SDF-1 expression within tumors can influence tumor growth, we transfected an expression vector pCI-SDF-1 for SDF-1 into J558 myeloma cells and tested their ability to form tumors in BALB/c. Production of biologically active SDF-1 (1.2 ng/mL) was detected in the culture supernatants of cells transfected with the expression vector pCI-SDF-1. J558 cells gave rise to a 100% tumor incidence, whereas SDF-1-expressing J558/SDF-1 tumors invariably regressed in BALB/c mice and became infiltrated with CD4(+) and CD8(+) T cells. Regression of the J558/SDF-1 tumors was dependent on both CD4(+) and CD8(+) T-cells. Our data also indicate that TIT cells containing both CD4(+) and CD8(+) T-cells within J558/SDF-1 tumors express the SDF-1 receptor CXCR4, and that SDF-1 specifically chemoattracts these cells in vitro. Furthermore, immunization of mice with engineered J558/SDF-1 cells elicited the most potent protective immunity against 0.5 x 10(6) cells J558 tumor challenge in vivo, compared to immunization with the J558 alone, and this antitumor immunity mediated by J558/SDF-1 tumor cell vaccination in vivo appeared to be dependent on CD8(+) CTL. Thus, SDF-1 has natural adjuvant activities that may augment antitumor responses through their effects on T-cells and thereby could be important in gene transfer immunotherapies for some cancers.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buarque, Diego S.; Spindola, Leticia M.N.; Martins, Rafael M.
2011-09-23
Highlights: {yields} Tigutcystatin inhibits Trypanosoma cruzi cysteine proteases with high specificity. {yields} Tigutcystatin expression is up-regulated in response to T. cruzi infection. {yields} It is the first cysteine proteases inhibitor characterized from a triatomine insect. -- Abstract: The insect Triatoma infestans is a vector of Trypanosoma cruzi, the etiological agent of Chagas disease. A cDNA library was constructed from T. infestans anterior midgut, and 244 clones were sequenced. Among the EST sequences, an open reading frame (ORF) with homology to a cystatin type 2 precursor was identified. Then, a 288-bp cDNA fragment encoding mature cystatin (lacking signal peptide) named Tigutcystatinmore » was cloned fused to a N-terminal His tag in pET-14b vector, and the protein expressed in Escherichia coli strain Rosetta gami. Tigutcystatin purified and cleaved by thrombin to remove His tag presented molecular mass of 11 kDa and 10,137 Da by SDS-PAGE and MALDI-TOF mass spectrometry, respectively. Purified Tigutcystatin was shown to be a tight inhibitor towards cruzain, a T. cruzi cathepsin L-like enzyme (K{sub i} = 3.29 nM) and human cathepsin L (K{sub i} = 3.78 nM). Tissue specific expression analysis showed that Tigutcystatin was mostly expressed in anterior midgut, although amplification in small intestine was also detected by semi quantitative RT-PCR. qReal time PCR confirmed that Tigutcystatin mRNA is significantly up-regulated in anterior midgut when T. infestans is infected with T. cruzi. Together, these results indicate that Tigutcystatin may be involved in modulation of T. cruzi in intestinal tract by inhibiting parasite cysteine proteases, which represent the virulence factors of this protozoan.« less
-
Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding
2011-07-01
To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.
-
Herzog, Roland W; Fields, Paul A; Arruda, Valder R; Brubaker, Jeff O; Armstrong, Elina; McClintock, Darryl; Bellinger, Dwight A; Couto, Linda B; Nichols, Timothy C; High, Katherine A
2002-07-20
Intramuscular injection of an adeno-associated virus (AAV) vector has resulted in vector dose-dependent, stable expression of canine factor IX (cF.IX) in hemophilia B dogs with an F.IX missense mutation (Herzog et al., Nat. Med. 1999;5:56-63). The use of a species-specific transgene allowed us to study risks and characteristics of antibody formation against the therapeutic transgene product. We analyzed seven dogs that had been injected at a single time point at multiple intramuscular sites with varying vector doses (dose per kilogram, dose per animal, dose per site). Comparison of individual animals suggests an increased likelihood of inhibitory anti-cF.IX (inhibitor) development with increased vector doses, with dose per site showing the strongest correlation with the risk of inhibitor formation. In six of seven animals, such immune responses were either absent or transient, and therefore did not prevent sustained systemic expression of cF.IX. Transient inhibitory/neutralizing anti-cF.IX responses occurred at vector doses of 2 x 10(12)/site, whereas a 6-fold higher dose resulted in a longer lasting, higher titer inhibitor. Anti-cF.IX was efficiently blocked in an eighth animal that was injected with a high vector dose per site, but in addition received transient immune suppression. Inhibitor formation was characterized by synthesis of two IgG subclasses and in vitro proliferation of lymphocytes to cF.IX antigen, indicating a helper T cell-dependent mechanism. Anti-cF.IX formation is likely influenced by the extent of local antigen presentation and may be avoided by limited vector doses or by transient immune modulation.
-
Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup
2018-05-11
Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Liang, Xiao; Li, Chenmeng; Wang, Wenya; Li, Qiang
2018-05-18
Metabolic engineering and synthetic biology usually require universal expression systems for stable and efficient gene expression in various organisms. In this study, a host-independent and stable T7 expression system had been developed by integrating T7 RNA polymerase and its cognate transcriptional units in single plasmid. The expression of T7 RNA polymerase was restricted below its lethal threshold using a T7 RNA polymerase antisense gene cassette, which allowed long periods of cultivation and protein production. In addition, by designing ribosome binding sites, we further tuned the expression capacity of this novel T7 system within a wide range. This host-independent expression system efficiently expressed genes in five different Gram-negative strains and one Gram-positive strain and was also shown to be applicable in a real industrial d- p-hydroxyphenylglycine production system.
-
Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen
2018-06-21
Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.
-
Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages
Studier, F.W.; Dubendorff, J.W.
1998-10-20
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.
-
Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages
Studier, F.W.; Dubendorff, J.W.
1998-11-03
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.
-
2013-01-01
Background Expression of miR-17-92 enhances T-cell survival and interferon (IFN)-γ production. We previously reported that miR-17-92 is down-regulated in T-cells derived from glioblastoma (GBM) patients. We hypothesized that transgene-derived co-expression of miR17-92 and chimeric antigen receptor (CAR) in T-cells would improve the efficacy of adoptive transfer therapy against GBM. Methods We constructed novel lentiviral vectors for miR-17-92 (FG12-EF1a-miR-17/92) and a CAR consisting of an epidermal growth factor receptor variant III (EGFRvIII)-specific, single-chain variable fragment (scFv) coupled to the T-cell receptor CD3ζ chain signaling module and co-stimulatory motifs of CD137 (4-1BB) and CD28 in tandem (pELNS-3C10-CAR). Human T-cells were transduced with these lentiviral vectors, and their anti-tumor effects were evaluated both in vitro and in vivo. Results CAR-transduced T-cells (CAR-T-cells) exhibited potent, antigen-specific, cytotoxic activity against U87 GBM cells that stably express EGFRvIII (U87-EGFRvIII) and, when co-transduced with miR-17-92, exhibited improved survival in the presence of temozolomide (TMZ) compared with CAR-T-cells without miR-17-92 co-transduction. In mice bearing intracranial U87-EGFRvIII xenografts, CAR-T-cells with or without transgene-derived miR-17-92 expression demonstrated similar levels of therapeutic effect without demonstrating any uncontrolled growth of CAR-T-cells. However, when these mice were re-challenged with U87-EGFRvIII cells in their brains, mice receiving co-transduced CAR-T-cells exhibited improved protection compared with mice treated with CAR-T-cells without miR-17-92 co-transduction. Conclusion These results warrant the development of novel CAR-T-cell strategies that incorporate miR-17-92 to improve therapeutic potency, especially in patients with GBM. PMID:24829757
-
Ohno, Masasuke; Ohkuri, Takayuki; Kosaka, Akemi; Tanahashi, Kuniaki; June, Carl H; Natsume, Atsushi; Okada, Hideho
2013-01-01
Expression of miR-17-92 enhances T-cell survival and interferon (IFN)-γ production. We previously reported that miR-17-92 is down-regulated in T-cells derived from glioblastoma (GBM) patients. We hypothesized that transgene-derived co-expression of miR17-92 and chimeric antigen receptor (CAR) in T-cells would improve the efficacy of adoptive transfer therapy against GBM. We constructed novel lentiviral vectors for miR-17-92 (FG12-EF1a-miR-17/92) and a CAR consisting of an epidermal growth factor receptor variant III (EGFRvIII)-specific, single-chain variable fragment (scFv) coupled to the T-cell receptor CD3ζ chain signaling module and co-stimulatory motifs of CD137 (4-1BB) and CD28 in tandem (pELNS-3C10-CAR). Human T-cells were transduced with these lentiviral vectors, and their anti-tumor effects were evaluated both in vitro and in vivo. CAR-transduced T-cells (CAR-T-cells) exhibited potent, antigen-specific, cytotoxic activity against U87 GBM cells that stably express EGFRvIII (U87-EGFRvIII) and, when co-transduced with miR-17-92, exhibited improved survival in the presence of temozolomide (TMZ) compared with CAR-T-cells without miR-17-92 co-transduction. In mice bearing intracranial U87-EGFRvIII xenografts, CAR-T-cells with or without transgene-derived miR-17-92 expression demonstrated similar levels of therapeutic effect without demonstrating any uncontrolled growth of CAR-T-cells. However, when these mice were re-challenged with U87-EGFRvIII cells in their brains, mice receiving co-transduced CAR-T-cells exhibited improved protection compared with mice treated with CAR-T-cells without miR-17-92 co-transduction. These results warrant the development of novel CAR-T-cell strategies that incorporate miR-17-92 to improve therapeutic potency, especially in patients with GBM.
-
Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection
Eyquem, Justin; Mansilla-Soto, Jorge; Giavridis, Theodoros; van der Stegen, Sjoukje J. C.; Hamieh, Mohamad; Cunanan, Kristen M.; Odak, Ashlesha; Gönen, Mithat; Sadelain, Michel
2017-01-01
Chimeric antigen receptors (CARs) are synthetic receptors that redirect and reprogram T cells to mediate tumour rejection1. The most successful CARs used to date are those targeting CD19 (ref. 2), which offer the prospect of complete remission in patients with chemorefractory or relapsed B-cell malignancies3. CARs are typically transduced into the T cells of a patient using γ-retroviral4 vectors or other randomly integrating vectors5, which may result in clonal expansion, oncogenic transformation, variegated transgene expression and transcriptional silencing6–8. Recent advances in genome editing enable efficient sequence-specific interventions in human cells9,10, including targeted gene delivery to the CCR5 and AAVS1 loci11,12. Here we show that directing a CD19-specific CAR to the T-cell receptor α constant (TRAC) locus not only results in uniform CAR expression in human peripheral blood T cells, but also enhances T-cell potency, with edited cells vastly outperforming conventionally generated CAR T cells in a mouse model of acute lymphoblastic leukaemia. We further demonstrate that targeting the CAR to the TRAC locus averts tonic CAR signalling and establishes effective internalization and re-expression of the CAR following single or repeated exposure to antigen, delaying effector T-cell differentiation and exhaustion. These findings uncover facets of CAR immunobiology and underscore the potential of CRISPR/Cas9 genome editing to advance immunotherapies. PMID:28225754
-
Li, Jingquan; Xu, Yongping; Wang, Xitao; Li, Yuan; Wang, Lili; Li, Xiaoyu
2016-06-01
The purpose of this study was to construct a single-chain variable fragment (scFv) antibody from chicken egg yolk immunoglobulin (IgY) by means of genetic engineering and subsequent panning for a specific antibody against Staphylococcus aureus. We amplified the scFv using blood and spleen obtained from 100-day-old Roman chickens immunized with inactivated S. aureus and subsequently constructed a T7 phage display antibody library using phage display technology. Four non-repeated blood scFv and 6 spleen scFv were obtained following 3 rounds of panning of the T7 phage display antibody library, enzyme-linked immunosorbent assay and sequencing. These 10 scFv were cloned into the prokaryotic expression vector pCold I with expression induced at a low temperature. Four soluble proteins were obtained. Among them, soluble protein SFV6 derived from the spleen showed good reactivity against S. aureus using indirect ELISA and produced a particularly strong antibacterial effect in vitro. We were successful in isolating a highly specific scFv antibody against S. aureus from the spleen phage display library. This study provides a simple and rapid method for the quick preparation of a large number of antibodies against S. aureus and provides the foundation for the positioning of antibodies in the organism and the study of the antibacterial mechanism through which the antibody functions. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Liu, Jun; Luo, Yan; Liu, Qingqing; Zheng, Liming; Yang, Zhongcai; Wang, Yongsheng; Su, Jianmin; Quan, Fusheng; Zhang, Yong
2013-03-01
Transgenic animals that express antimicrobial agents in their milk can inhibit bacterial pathogens that cause mastitis. Our objective was to produce human β-defensin-3 (HBD3) transgenic embryos by nuclear transfer using goat mammary epithelial cells (GMECs) as donor cells. Three GMEC lines (GMEC1, GMEC2, and GMEC3) were transfected with a HBD3 mammary-specific expression vector by electroporation. There was a difference (P < 0.05) in the rate of geneticin-resistant colony formation among cell lines GMEC1, GMEC2, and GMEC3 (39 and 47 vs. 19 colonies per 3 × 10(6) cells, respectively). After inducing expression, the mRNA and protein of HBD3 were detected by reverse transcription polymerase chain reaction and Western blot analysis in transgenic cells. Transgenic clonal cells expressing HBD3 were used as donor cells to investigate development of cloned embryos. There were no significant differences in rates of cleavage or blastocyst formation of cloned embryos from transgenic (GMEC1T2 and GMEC2T3) and nontransgenic (GMEC1 and GMEC2) GMECs (72.3 ± 5.0%, 69.5 ± 2.3%, 61.8 ± 4.8%, and 70.0 ± 2%; and 16.8 ± 0.5%, 17.5 ± 0.7%, 16.7 ± 0.9%, and 17.5 ± 0.6%, respectively). However, the fusion rate, cleavage rate, and blastocyst formation rate of cloned embryos from a transgenic clonal cell line (GMEC2T6, 50.7 ± 2.1%, 55.5 ± 2.0%, and 11.1 ± 0.6%) were lower than those of other groups (P < 0.05). We concluded that genetic modification of GMECs might not influence the in vitro development of cloned embryos, but that some of the transgenic clonal cells were not suitable for nuclear transfer to produce transgenic goats, because of low developmental rates. However, transgenic GMECs expressing HBD3 might be used as donor cells for producing transgenic goats that express increased concentrations of β-defensins in their milk. Copyright © 2013 Elsevier Inc. All rights reserved.
-
pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana
2017-01-01
The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. PMID:27856772
-
Training Extract, AFSC 113X0B, Flight Engineer, Helicopter Qualified.
1982-12-01
TRAINING .................................................................. 1I0 SE. GENERAL rLIGHT RULES A 9 C t | 7. PeRFORM INSPECIIOIS 12 7A... TRAINING .................................................................. lIC 6E. GENERAL FLIGHT RULES A a C...ME"BERS PERFORMING I-A I PROGRAM GENERATED VECTOR IMEMBERS/ NO TYPE VECTOR MEAN - SC DESCRIPTION I TN. SEP J.6 2.J TRAINING EMPHASIS RATINSS I IIOS
-
Li, Hui; Li, Rong; Zhong, Sen; Ren, Hong; Deng, Cun-liang; Shi, Xiao-ling; Wang, Ming-yong
2006-04-01
To construct and express a chimeric Mtb8.4 with signal peptide (MS)/hIL12 eukaryotic expression plasmid, and to study the immunogenicity of the MS/hIL-12 chimeric genetic vaccines. The MS/hIL-12 chimeric gene was amplified by polymerase chain reaction (PCR) and cloned into the eukaryotic expression vector pCI-neo. The correct pCI-neo-MS/hIL12 (pMSI) recombinant plasmid was identified by PCR, restricted enzyme digestion and DNA sequencing. COS-7 cells were transfected with pMSI constructs by cationic liposome. After 48 hours, mRNA of the target gene was detected by RT-PCR, and hIL-12 protein in culture supernatant and cell lysates was detected by Western blot. C57BL/6N mice were vaccinated with MS/hIL-12 chimeric gene vaccine for three times at 3 week intervals. Four weeks after the final inoculation, three mice were sacrificed for measurement of the cytokine response and cytotoxic T lymphocyte (CTL) induction. The accuracy of plasmid construction was confirmed by a number of molecular biological techniques. Transfection of COS-7 cells with plasmids pMSI lead to transient expression of fusion proteins. The IFN-gamma and IL-2 titers were (1,521 +/- 48) ng/L and (755 +/- 41) ng/L in MS/hIL-12 chimeric gene vaccine group, (820 +/- 50) ng/L and (297 +/- 31) ng/L in MS gene vaccine group, (1,487 +/- 40) ng/L and (767 +/- 50) ng/L in BCG group, (121 +/- 16) ng/L and (62 +/- 10) ng/L in vacant vector group, and (48 +/- 16) ng/L and (32 +/- 17) ng/L in PBS group respectively. The levels of IFN-gamma and IL-2 in MS/hIL-12 chimeric gene vaccine group were higher than those of MS gene vaccine group, vacant vector group and PBS group (P < 0.01) and was similar to the BCG group (P > 0.05). The level of IL-4 in BCG group [(91 +/- 11) ng/L] increased significantly as compared to other groups (P < 0.01). When effector-cell-to-target-cell ratio (E:T ratio) were 100:1, 50:1, and 10:1 respectively, the CTL activity was 77.5%, 51.2%, 30.3% in MS/hIL-12 chimeric gene vaccine group, 56.2%, 37.8%, 11.5% in MS gene vaccine group, 28.9%, 21.4%, 9.8% in BCG group. The cytotoxicity in MS/hIL-12 chimeric gene vaccine group was higher than that of other groups (P < 0.01). When used to construct the chimeric gene vaccine, hIL-12 could improve the immunogenicity of MS gene vaccine.
-
A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN
Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.
2017-01-01
We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548
-
A multi-purpose toolkit to enable advanced genome engineering in plants
Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...
2017-05-18
Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less
-
A multi-purpose toolkit to enable advanced genome engineering in plants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier
Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less
-
Xie, Li; Yan, Min; Wang, Xiaonan; Ye, Jing; Mi, Kai; Yan, Shanshan; Niu, Xianglian; Li, Hongjun; Sun, Maosheng
2015-12-02
NSP4 and VP7 are important functional proteins of rotavirus. Proper combination of viral gene expression is favorable to improving the protection effect of subunit vaccine. In the present study, We evaluated the immunogenicity and efficacy of the bicistronic recombinant adenovirus (rAd-NSP4-VP7) and two single-gene expressing adenoviruses (rAd-NSP4, rAd-VP7). The three adenovirus vaccines were used to immunize mice by intramuscular or intranasal administration. The data showed significant increases in serum antibodies, T lymphocyte subpopulations proliferation, and cytokine secretions of splenocyte in all immunized groups. However, the serum IgA and neutralizing antibody levels of the rAd-NSP4-VP7 or rAd-VP7 groups were significantly higher than those of the rAd-NSP4, while the splenocyte numbers of IFN-γ secretion in the rAd-NSP4-VP7 or rAd-NSP4 groups was greater than that of the rAd-VP7. Furthermore, the efficacy evaluation in a suckling mice model indicated that only rAd-NSP4-VP7 conferred significant protection against rotavirus shedding challenge. These results suggest that the co-expression of NSP4 and VP7 in an adenovirus vector induce both humoral and cell-mediated immune responses efficiently, and provide potential efficacy for protection against rotavirus disease. It is possible to represent an efficacious subunits vaccine strategy for control of rotavirus infection and transmission. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Alexander, Jeff; Mendy, Jason; Vang, Lo; Avanzini, Jenny B.; Garduno, Fermin; Manayani, Darly J.; Ishioka, Glenn; Farness, Peggy; Ping, Li-Hua; Swanstrom, Ronald; Parks, Robert; Liao, Hua-Xin; Haynes, Barton F.; Montefiori, David C.; LaBranche, Celia; Smith, Jonathan; Gurwith, Marc; Mayall, Tim
2013-01-01
Background There is a well-acknowledged need for an effective AIDS vaccine that protects against HIV-1 infection or limits in vivo viral replication. The objective of these studies is to develop a replication-competent, vaccine vector based on the adenovirus serotype 4 (Ad4) virus expressing HIV-1 envelope (Env) 1086 clade C glycoprotein. Ad4 recombinant vectors expressing Env gp160 (Ad4Env160), Env gp140 (Ad4Env140), and Env gp120 (Ad4Env120) were evaluated. Methods The recombinant Ad4 vectors were generated with a full deletion of the E3 region of Ad4 to accommodate the env gene sequences. The vaccine candidates were assessed in vitro following infection of A549 cells for Env-specific protein expression and for posttranslational transport to the cell surface as monitored by the binding of broadly neutralizing antibodies (bNAbs). The capacity of the Ad4Env vaccines to induce humoral immunity was evaluated in rabbits for Env gp140 and V1V2-specific binding antibodies, and HIV-1 pseudovirus neutralization. Mice immunized with the Ad4Env160 vaccine were assessed for IFNγ T cell responses specific for overlapping Env peptide sets. Results Robust Env protein expression was confirmed by western blot analysis and recognition of cell surface Env gp160 by multiple bNAbs. Ad4Env vaccines induced humoral immune responses in rabbits that recognized Env 1086 gp140 and V1V2 polypeptide sequences derived from 1086 clade C, A244 clade AE, and gp70 V1V2 CASE A2 clade B fusion protein. The immune sera efficiently neutralized tier 1 clade C pseudovirus MW965.26 and neutralized the homologous and heterologous tier 2 pseudoviruses to a lesser extent. Env-specific T cell responses were also induced in mice following Ad4Env160 vector immunization. Conclusions The Ad4Env vaccine vectors express high levels of Env glycoprotein and induce both Env-specific humoral and cellular immunity thus supporting further development of this new Ad4 HIV-1 Env vaccine platform in Phase 1 clinical trials. PMID:24312658
-
A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons
Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.
2011-01-01
Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582
-
AAV capsid CD8+ T-cell epitopes are highly conserved across AAV serotypes
Hui, Daniel J; Edmonson, Shyrie C; Podsakoff, Gregory M; Pien, Gary C; Ivanciu, Lacramioara; Camire, Rodney M; Ertl, Hildegund; Mingozzi, Federico; High, Katherine A; Basner-Tschakarjan, Etiena
2015-01-01
Adeno-associated virus (AAV) has become one of the most promising vectors in gene transfer in the last 10 years with successful translation to clinical trials in humans and even market approval for a first gene therapy product in Europe. Administration to humans, however, revealed that adaptive immune responses against the vector capsid can present an obstacle to sustained transgene expression due to the activation and expansion of capsid-specific T cells. The limited number of peripheral blood mononuclear cells (PBMCs) obtained from samples within clinical trials allows for little more than monitoring of T-cell responses. We were able to identify immunodominant major histocompatibility complex (MHC) class I epitopes for common human leukocyte antigen (HLA) types by using spleens isolated from subjects undergoing splenectomy for non-malignant indications as a source of large numbers of lymphocytes and restimulating them with single AAV capsid peptides in vitro. Further experiments confirmed that these epitopes are naturally processed and functionally relevant. The design of more effective and less immunogenic AAV vectors, and precise immune monitoring of vector-infused subjects, are facilitated by these findings. PMID:26445723
-
AAV capsid CD8+ T-cell epitopes are highly conserved across AAV serotypes.
Hui, Daniel J; Edmonson, Shyrie C; Podsakoff, Gregory M; Pien, Gary C; Ivanciu, Lacramioara; Camire, Rodney M; Ertl, Hildegund; Mingozzi, Federico; High, Katherine A; Basner-Tschakarjan, Etiena
2015-01-01
Adeno-associated virus (AAV) has become one of the most promising vectors in gene transfer in the last 10 years with successful translation to clinical trials in humans and even market approval for a first gene therapy product in Europe. Administration to humans, however, revealed that adaptive immune responses against the vector capsid can present an obstacle to sustained transgene expression due to the activation and expansion of capsid-specific T cells. The limited number of peripheral blood mononuclear cells (PBMCs) obtained from samples within clinical trials allows for little more than monitoring of T-cell responses. We were able to identify immunodominant major histocompatibility complex (MHC) class I epitopes for common human leukocyte antigen (HLA) types by using spleens isolated from subjects undergoing splenectomy for non-malignant indications as a source of large numbers of lymphocytes and restimulating them with single AAV capsid peptides in vitro. Further experiments confirmed that these epitopes are naturally processed and functionally relevant. The design of more effective and less immunogenic AAV vectors, and precise immune monitoring of vector-infused subjects, are facilitated by these findings.
-
Expression of the functional recombinant human glycosyltransferase GalNAcT2 in Escherichia coli.
Lauber, Jennifer; Handrick, René; Leptihn, Sebastian; Dürre, Peter; Gaisser, Sabine
2015-01-13
Recombinant protein-based therapeutics have become indispensable for the treatment of many diseases. They are produced using well-established expression systems based on bacteria, yeast, insect and mammalian cells. The majority of therapeutic proteins are glycoproteins and therefore the post-translational attachment of sugar residues is required. The development of an engineered Escherichia coli-based expression system for production of human glycoproteins could potentially lead to increased yields, as well as significant decreases in processing time and costs. This work describes the expression of functional human-derived glycosyltransferase UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAcT2) in a recombinant E. coli strain. For expression, a codon-optimised gene encoding amino acids 52-571 of GalNAcT2 lacking the transmembrane N-terminal domain was inserted into a pET-23 derived vector encoding a polyhistidine-tag which was translationally fused to the N-terminus of the glycosyltransferase (HisDapGalNAcT2). The glycosyltransferase was produced in E. coli using a recently published expression system. Soluble HisDapGalNAcT2 produced in SHuffle® T7 host cells was purified using nickel affinity chromatography and was subsequently analysed by size exclusion chromatography coupled to multi-angle light scattering (SEC-MALS) and circular dichroism spectroscopy to determine molecular mass, folding state and thermal transitions of the protein. The activity of purified HisDapGalNAcT2 was monitored using a colorimetric assay based on the release of phosphate during transfer of glycosyl residues to a model acceptor peptide or, alternatively, to the granulocyte-colony stimulating growth factor (G-CSF). Modifications were assessed by Matrix Assisted Laser Desorption Ionization Time-of-flight Mass Spectrometry analysis (MALDI-TOF-MS) and Electrospray Mass Spectrometry analysis (ESI-MS). The results clearly indicate the glycosylation of the acceptor peptide and of G-CSF. In the present work, we isolated a human-derived glycosyltransferase by expressing soluble HisDapGalNAcT2 in E. coli. The functional activity of the enzyme was shown in vitro. Further investigations are needed to assess the potential of in vivo glycosylation in E. coli.
-
Ali, Imran; Asghar, Rehana; Ahmed, Sajjad; Sajjad, Muhammad; Tariq, Muhammad; Waheed Akhtar, M
2015-03-01
The sequence and structure of mRNA plays an important role in solubility and expression of the translated protein. To divulge the role of mRNA secondary structure and its thermodynamics in the expression level of the recombinant endoglucanase in Escherichia coli, 5'-end of the mRNA was thermodynamically optimized. Molecular engineering was done by introducing two silent synonymous mutations at positions +5 (UCU with UCC) and +7 (UUC with UUU) of the 5'-end of mRNA to relieve hybridization with ribosomal binding site. Two variants of glycoside hydrolase family six endoglucanase, wild type (cel6A.wt) and mutant (cel6A.mut) from Thermobifida fusca were expressed and characterized in E. coli using T7 promoter-based expression vector; pET22b(+). Enhanced expression level of engineered construct (Cel6A.mut) with ∆G = -2.7 kcal mol(-1)was observed. It showed up to ~45 % higher expression as compared to the wild type construct (Cel6A.wt) having ∆G = -7.8 kcal mol(-1) and ~25 % expression to the total cell proteins. Heterologous protein was purified by heating the recombinant E. coli BL21 (DE3) CodonPlus at 60 °C. The optimum pH for enzyme activity was six and optimum temperature was 60 °C. Maximum activity was observed 4.5 Umg(-1) on CMC. Hydrolytic activity was also observed on insoluble substrates, i.e. RAC (2.8 Umg(-1)), alkali treated bagass (1.7 Umg(-1)), filter paper (1.2 Umg(-1)) and BMCC (0.3 Umg(-1)). Metal ions affect endoglucanase activity in different ways. Only Fe(2+) exhibited 20.8 % stimulatory effects on enzyme activity. Enzyme activity was profoundly inhibited by Hg2(+) (91.8 %).
-
2014-01-01
and distance between all of the vector ambiguity pairs for the combined N−sequences. To simplify our derivation, we define the center of ambiguity (COA...modulo N . The resulting structure of the N sequences ensures that two successive RSNS vectors (paired terms from all N sequences) when considered...represented by a vector , Xh = [x1,h, x2,h, . . . , xN,h] T , of N paired integers from each se- quence at h. For example, a left-shifted, three-sequence
-
Zhang, Yan; Jiang, Qiang; Huang, Jinming; Ju, Zhihua; Wang, Xiuge; Zhong, Jifeng; Wang, Changfa
2016-01-01
Inner centromere protein (INCENP) plays an important role in mitosis and meiosis as the main member of chromosomal passenger protein complex (CPC). To investigate the functional markers of the INCENP gene associated with semen quality, the single nucleotide polymorphisms (SNPs) g.19970 A>G and g.34078 T>G were identified and analyzed. The new splice variant INCENP-TV is characterized by the deletion of exon 12. The g.19970 A>G in the exonic splicing enhancer (ESE) motif region results in an aberrant splice variant by constructing two minigene expression vectors using the pSPL3 exon capturing vector and transfecting vectors into MLTC-1 cells. INCENP-TV was more highly expressed than INCENP-reference in adult bull testes. The g.34078 T>G located in the binding region of bta-miR-378 could affect the expression of INCENP, which was verified by luciferase assay. To analyze comprehensively the correlation of SNPs with sperm quality, haplotype combinations constructed by g.19970 A>G and g.34078 T>G, as well as g.-692 C>T and g.-556 G>T reported in our previous studies, were analyzed. The bulls with H1H12 and H2H2 exhibited a higher ejaculate volume than those with H2H10 and H9H12, respectively (P < 0.05). Bulls with H11H11 and H2H10 exhibited higher initial sperm motility than those with H2H2 (P < 0.05). The expression levels of INCENP in bulls with H1H12 and H11H11 were significantly higher than those in bulls with H9H12 (P < 0.05), as determined by qRT-PCR. Findings suggest that g.19970 A>G and g.34078 T>G in INCENP both of which appear to change the molecular and biological characteristics of the mRNA transcribed from the locus may serve as a biomarkers of male bovine fertility by affecting alternative splicing mode and binding affinity with the target bta-miR-378. PMID:27669152
-
B7-H1 expression is associated with expansion of regulatory T cells in colorectal carcinoma
Hua, Dong; Sun, Jing; Mao, Yong; Chen, Lu-Jun; Wu, Yu-Yu; Zhang, Xue-Guang
2012-01-01
AIM: To investigate the expression of B7-H1 in human colorectal carcinoma (CRC) to define its regulating effects on T cells in tumor microenvironment. METHODS: One hundred and two paraffin blocks and 33 fresh samples of CRC tissues were subject to this study. Immunohistochemistry was performed for B7-H1 and CD3 staining in CRC tissues. Ficoll-Hypaque density gradient centrifugation was used to isolate peripheral blood mononuclear cells of fresh CRC tissues; flow cytometry and immunofluorescence staining were used for detection of regulatory T cells. Data was analyzed with statistical software. RESULTS: Costimulatory molecule B7-H1 was found strongly expressed in CRC tissues, localized in tumor cell membrane and cytoplasm, while weak or none expression of B7-H1 was detected in pared normal colorectal tissues. Meanwhile, CD3 positive T cells were found congregated in CRC tumor nest and stroma. Statistic analysis showed that B7-H1 expression level was negatively correlated to the total T cell density in tumor nest (P < 0.0001) and tumor stroma (P = 0.0200) of 102 cases of CRC tissues. Among the total T cells, a variable amount of regulatory T cells with a clear Foxp3+ (forkhead box P3) staining could be detected in CRC tissues and patients’ blood. Interestingly, in the 33 samples (15 cases of B7-H1high CRC tissues and 18 cases of B7-H1low CRC tissues) of freshly isolated mononuclear cells from CRC tissues, the percentages of CD4+Foxp3+ and CD8+Foxp3+ regulatory T cells were found remarkably higher in B7-H1high CRC tissues than in B7-H1low CRC tissues (P = 0.0024, P = 0.0182), indicating that B7-H1 expression was involved in proliferation of regulatory T cell. No significant difference was found in CRC peripheral blood (P = 0.0863, P = 0.0678). PD-1 is the specific ligand for B7-H1 pathway transferring inhibitory signal to T cell, which is expressed by activated T cell. Our further analysis of PD-1 expression on T cells in CRC tissues showed that conventional T cells (CD4+Foxp3-/CD8+Foxp3-), which was thought to contribute to the anti-tumor immune response, highly expressed PD-1; while regulatory T cells (CD4+Foxp3+/CD8+Foxp3-) almost failed to express PD-1. The average percentage of PD-1 expression on regulatory T cells was significantly higher than the percentage of PD-1 on conventional T cells (CD4+Foxp3- T cell, P < 0.0001; CD8+Foxp3- T cell, P < 0.0001). The diverse expression of PD-1 might lead to different fate of T cell subsets in B7-H1 over-expression CRC tumor microenvironment. CONCLUSION: B7-H1 expression in tumor cells can inhibit the conventional T cell proliferation in tumor microenvironment through the PD-1 expression on conventional T cells. PMID:22408358
-
Bolton, Diane L; Santra, Sampa; Swett-Tapia, Cindy; Custers, Jerome; Song, Kaimei; Balachandran, Harikrishnan; Mach, Linh; Naim, Hussein; Kozlowski, Pamela A; Lifton, Michelle; Goudsmit, Jaap; Letvin, Norman; Roederer, Mario; Radošević, Katarina
2012-09-07
Licensed live attenuated virus vaccines capable of expressing transgenes from other pathogens have the potential to reduce the number of childhood immunizations by eliciting robust immunity to multiple pathogens simultaneously. Recombinant attenuated measles virus (rMV) derived from the Edmonston Zagreb vaccine strain was engineered to express simian immunodeficiency virus (SIV) Gag protein for the purpose of evaluating the immunogenicity of rMV as a vaccine vector in rhesus macaques. rMV-Gag immunization alone elicited robust measles-specific humoral and cellular responses, but failed to elicit transgene (Gag)-specific immune responses, following aerosol or intratracheal/intramuscular delivery. However, when administered as a priming vaccine to a heterologous boost with recombinant adenovirus serotype 5 expressing the same transgene, rMV-Gag significantly enhanced Gag-specific T lymphocyte responses following rAd5 immunization. Gag-specific humoral responses were not enhanced, however, which may be due to either the transgene or the vector. Cellular response priming by rMV against the transgene was highly effective even when using a suboptimal dose of rAd5 for the boost. These data demonstrate feasibility of using rMV as a priming component of heterologous prime-boost vaccine regimens for pathogens requiring strong cellular responses. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Regulation of Id2 expression in EL4 T lymphoma cells overexpressing growth hormone.
Weigent, Douglas A
2009-01-01
In previous studies, we have shown that overexpression of growth hormone (GH) in cells of the immune system upregulates proteins involved in cell growth and protects from apoptosis. Here, we report that overexpression of GH in EL4 T lymphoma cells (GHo) also significantly increased levels of the inhibitor of differentiation-2 (Id2). The increase in Id2 was suggested in both Id2 promoter luciferase assays and by Western analysis for Id2 protein. To identify the regulatory elements that mediate transcriptional activation by GH in the Id2 promoter, promoter deletion analysis was performed. Deletion analysis revealed that transactivation involved a 301-132bp region upstream to the Id2 transcriptional start site. The pattern in the human GHo Jurkat T lymphoma cell line paralleled that found in the mouse GHo EL4 T lymphoma cell line. Significantly less Id2 was detected in the nucleus of GHo EL4 T lymphoma cells compared to vector alone controls. Although serum increased the levels of Id2 in control vector alone cells, no difference was found in the total levels of Id2 in GHo EL4 T lymphoma cells treated with or without serum. The increase in Id2 expression in GHo EL4 T lymphoma cells measured by Id2 promoter luciferase expression and Western blot analysis was blocked by the overexpression of a dominant-negative mutant of STAT5. The results suggest that in EL4 T lymphoma cells overexpressing GH, there is an upregulation of Id2 protein that appears to involve STAT protein activity.
-
Amani, Jafar; Mousavi, Seyed Latif; Rafati, Sima; Salmanian, Ali Hatef
2011-04-01
Transgenic plants offer the possibility to produce and deliver an oral immunogen on a large-scale with low production costs and minimal purification or enrichment. Cattles are important reservoirs of Escherichia coli O157:H7 and developing a specific immunity in animals would be invaluable. Intimin, Tir, and EspA proteins are the virulence factors expressed by LEE locus of enterohemorrhagic E. coli. We hypothesized that the chimeric recombinant forms of these effectors delivered as an edible-base vaccine would reduce colonization of bacteria in mice. A synthetic gene (eit) composed of espA (e), eae (i) and tir (t) attached by linkers was constructed. The gene was codon optimized and cloned into plant expression vectors adjacent to CaMV35S and FAE promoters for expression in tobacco and canola plants. Of total soluble protein 0.2% and 0.3% (in average) were detected in transgenic tobacco leaves and canola seeds respectively. Mice immunized either subcutaneously or orally with recombinant EIT and challenged with E. coli O157:H7 significantly exhibited reduced bacterial shedding. Application of transgenic plants containing trivalent immunogen is an effective tool for protection against E. coli O157:H7. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
-
Initial geomagnetic field model from Magsat vector data
NASA Technical Reports Server (NTRS)
Langel, R. A.; Mead, G. D.; Lancaster, E. R.; Estes, R. H.; Fabiano, E. B.
1980-01-01
Magsat data from the magnetically quiet days of November 5-6, 1979, were used to derive a thirteenth degree and order spherical harmonic geomagnetic field model, MGST(6/80). The model utilized both scalar and high-accuracy vector data and fit that data with root-mean-square deviations of 8.2, 6.9, 7.6 and 7.4 nT for the scalar magnitude, B(r), B(theta), and B(phi), respectively. The model includes the three first-order coefficients of the external field. Comparison with averaged Dst indicates that zero Dst corresponds with 25 nT of horizontal field from external sources. When compared with earlier models, the earth's dipole moment continues to decrease at a rate of about 26 nT/yr. Evaluation of earlier models with Magsat data shows that the scalar field at the Magsat epoch is best predicted by the POGO(2/72) model but that the WC80, AWC/75 and IGS/75 are better for predicting vector fields.
-
Jiménez, Juan J; Diep, Dzung B; Borrero, Juan; Gútiez, Loreto; Arbulu, Sara; Nes, Ingolf F; Herranz, Carmen; Cintas, Luis M; Hernández, Pablo E
2015-10-15
Bacteriocins produced by lactic acid bacteria (LAB) attract considerable interest as natural and nontoxic food preservatives and as therapeutics whereas the bacteriocin-producing LAB are considered potential probiotics for food, human and veterinary applications, and in the animal production field. Within LAB the lactobacilli are increasingly used as starter cultures for food preservation and as probiotics. The lactobacilli are also natural inhabitants of the gastrointestinal (GI) tract and attractive vectors for delivery of therapeutic peptides and proteins, and for production of bioactive peptides. Research efforts for production of bacteriocins in heterologous hosts should be performed if the use of bacteriocins and the LAB bacteriocin-producers is ever to meet the high expectations deposited in these antimicrobial peptides. The recombinant production and functional expression of bacteriocins by lactobacilli would have an additive effect on their probiotic functionality. The heterologous production of the bacteriocin enterocin A (EntA) was evaluated in different Lactobacillus spp. after fusion of the versatile Sec-dependent signal peptide (SP usp45 ) to mature EntA plus the EntA immunity gene (entA + entiA) (fragment UAI), and their cloning into plasmid vectors that permitted their inducible (pSIP409 and pSIP411) or constitutive (pMG36c) production. The amount, antimicrobial activity (AA) and specific antimicrobial activity (SAA) of the EntA produced by Lactobacillus sakei Lb790, Lb. plantarum NC8 and Lb. casei CECT475 transformed with the recombinant plasmids pSIP409UAI, pSIP411UAI and pMGUAI varied depending of the expression vector and the host strain. The Lb. casei CECT475 recombinant strains produced the largest amounts of EntA, with the highest AA and SAA. Supernatants from Lb. casei CECT (pSIP411UAI) showed a 4.9-fold higher production of EntA with a 22.8-fold higher AA and 4.7-fold higher SAA than those from Enterococcus faecium T136, the natural producer of EntA. Moreover, supernatants from Lb. casei CECT475 (pSIP411UAI) showed a 15.7- to 59.2-fold higher AA against Listeria spp. than those from E. faecium T136. Lb. casei CECT457 (pSIP411UAI) may be considered a promising recombinant host and cell factory for the production and functional expression of the antilisterial bacteriocin EntA.
-
Wen, Yong; Lan, Jing; Huang, Haiyun; Yu, Meijiao; Cui, Jun; Liang, Jin; Jiang, Baoqi; Xu, Xin
2012-09-01
To establish human periodontal ligament stem cells (hPDLSC) with high and stable expression of enhanced green fluorescent protein (eGFP) and to obtain an ideal vector expression system that suitable for gene therapy in periodontal tissue engineering. hPDLSCs were transfected with eGFP for 48h via different MOI (25, 50, 100, 200 and 400) by lentiviral vector, the transfection efficiency was evaluated by fluorescent microscopy and flow cytometry, and transfected hPDLSCs proliferation was evaluated by MTT. Pluripotent, differentiation capacity and ALP expression status were determined further. Osteoblast-associated genes expressions for osteogenesis were evaluated by quantitative-PCR. In addition, rat molar periodontal fenestration defect model was used for evaluating periodontal tissue engineering. The transfection efficiency after 48h were 44.7%, 60.9%, 71.7%, 85.8%, and 86.9% respectively. There was no significant effect of transfection (at different MOI levels of 25, 50, 100, and 200) on the proliferation of hPDLSCs (designated as eGFP-hPDLSCs) compared with hPDLSCs (P>0.05). However, proliferation of eGFP hPDLSCs at MOI 400 became slower (P<0.05). Both eGFP hPDLSCs and hPDLSCs were able to differentiate into osteocytes and adipocytes under certain conditioned media. At 7 days, expression levels of COL-1, RUNX2 in hPDLSCS were higher than those in eGFP hPDLSCs (P<0.05); expression levels of ALP and OPN in eGFP hPDLSCs were similar to those in hPDLSCs (P>0.05). Newly regenerated bone formation was observed in the defect model used. Among the transfection conditions, 48h transfection at MOI 200 is optimal for labelling hPDLSCs with eGFP in a lentiviral vector. There is no change in capability of the eGFP hPDLSCs osteogenesis. The lentiviral vector with eGFP is an appropriate expression vector system and hPDLSCs are ideal seeding cells for gene therapy in periodontal tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Long-term reversal of diabetes in non-obese diabetic mice by liver-directed gene therapy.
Ren, Binhai; O'Brien, Bronwyn A; Byrne, Michelle R; Ch'ng, Edwin; Gatt, Prudence N; Swan, M Anne; Nassif, Najah T; Wei, Ming Q; Gijsbers, Rik; Debyser, Zeger; Simpson, Ann M
2013-01-01
Type 1 diabetes (T1D) results from an autoimmune attack against the insulin-producing β-cells of the pancreas. The present study aimed to reverse T1D by gene therapy. We used a novel surgical technique, which involves isolating the liver from the circulation before the delivery of a lentiviral vector carrying furin-cleavable human insulin (INS-FUR) or empty vector to the livers of diabetic non-obese diabetic mice (NOD). This was compared with the direct injection of the vector into the portal circulation. Mice were monitored for body weight and blood glucose. Intravenous glucose tolerance tests were performed. Expression of insulin and pancreatic transcription factors was determined by the reverse transcriptase-polymerase chain reaction and immunohistochemistry and immunoelectron microscopy was used to localise insulin. Using the novel surgical technique, we achieved long-term transduction (42% efficiency) of hepatocytes, restored normoglycaemia for 150 days (experimental endpoint) and re-established normal glucose tolerance. We showed the expression of β-cell transcription factors, murine insulin, glucagon and somatostatin, and hepatic storage of insulin in granules. The expression of hepatic markers, C/EBP-β, G6PC, AAT and GLUI was down-regulated in INS-FUR-treated livers. Liver function tests remained normal, with no evidence of intrahepatic inflammation or autoimmune destruction of the insulin-secreting liver tissue. By comparison, direct injection of INS-FUR reduced blood glucose levels, and no pancreatic transdifferentiation or normal glucose tolerance was observed. This gene therapy protocol has, for the first time, permanently reversed T1D with normal glucose tolerance in NOD mice and, as such, represents a novel therapeutic strategy for the treatment of T1D. Copyright © 2013 John Wiley & Sons, Ltd.
-
Computational Investigation of the Aerodynamic Effects on Fluidic Thrust Vectoring
NASA Technical Reports Server (NTRS)
Deere, K. A.
2000-01-01
A computational investigation of the aerodynamic effects on fluidic thrust vectoring has been conducted. Three-dimensional simulations of a two-dimensional, convergent-divergent (2DCD) nozzle with fluidic injection for pitch vector control were run with the computational fluid dynamics code PAB using turbulence closure and linear Reynolds stress modeling. Simulations were computed with static freestream conditions (M=0.05) and at Mach numbers from M=0.3 to 1.2, with scheduled nozzle pressure ratios (from 3.6 to 7.2) and secondary to primary total pressure ratios of p(sub t,s)/p(sub t,p)=0.6 and 1.0. Results indicate that the freestream flow decreases vectoring performance and thrust efficiency compared with static (wind-off) conditions. The aerodynamic penalty to thrust vector angle ranged from 1.5 degrees at a nozzle pressure ratio of 6 with M=0.9 freestream conditions to 2.9 degrees at a nozzle pressure ratio of 5.2 with M=0.7 freestream conditions, compared to the same nozzle pressure ratios with static freestream conditions. The aerodynamic penalty to thrust ratio decreased from 4 percent to 0.8 percent as nozzle pressure ratio increased from 3.6 to 7.2. As expected, the freestream flow had little influence on discharge coefficient.
-
Xie, Lining; Moroi, Yoichi; Tsuji, Gaku; Liu, Min; Hayashida, Sayaka; Takahara, Masakazu; Fukagawa, Shuji; Takeuchi, Satoshi; Shan, Baoen; Nakahara, Takeshi; Uchi, Hiroshi; Yokomizo, Takehiko; Furue, Masutaka
2010-12-01
CD10 is a neutral endopeptidase, which cleaves various peptide substrates including substance P. CD10 expression has been detected in peritumoral fibroblasts (Fb) within the invasive area of various cancers such as squamous cell carcinoma (SCC). However, the biological significance of CD10-bearing Fb remains largely unknown. We examined dynamic interactions of Fb with tumorigenic A431 SCC cells or non-tumorigenic HaCaT squamous cells. The SCC and HaCaT cells did not synthesize CD10, while Fb constitutively expressed CD10. When co-cultured, SCC markedly upregulated fibroblastic CD10 expression compared with HaCaT, which was mainly attributable to SCC-derived interleukin-1α (IL-1α). Both SCC and Fb autonomously secreted substance P, which eventually enhanced the invasive capacity of SCC in a matrigel invasion assay by upregulating matrix metalloproteinase (MMP)-1 and MMP-2, but not MMP-9. Transfection of siRNA for CD10 successfully knocked down the CD10 expression in Fb (CD10ND-Fb). In the presence of CD10ND-Fb, substance P levels in supernatants as well as MMP production and the invasive potency of SCC were significantly augmented compared with control scramble RNA-transfected Fb. We also transfected CD10 vector to Fb and found that the matrigel invasive ability of SCC cells was downregulated co-cultured with CD10 vector-transfected Fb rather than empty vector-transfected Fb. In conclusion, the CD10-bearing Fb generated by SCC-derived IL-1 inhibited the invasive capacity of SCC by diminishing the microenvironmental concentration of substance P. © 2010 Japanese Cancer Association.
-
Genetic Adjuvantation of Recombinant MVA with CD40L Potentiates CD8 T Cell Mediated Immunity
Lauterbach, Henning; Pätzold, Juliane; Kassub, Ronny; Bathke, Barbara; Brinkmann, Kay; Chaplin, Paul; Suter, Mark; Hochrein, Hubertus
2013-01-01
Modified vaccinia Ankara (MVA) is a safe and promising viral vaccine vector that is currently investigated in several clinical and pre-clinical trials. In contrast to inactivated or sub-unit vaccines, MVA is able to induce strong humoral as well as cellular immune responses. In order to further improve its CD8 T cell inducing capacity, we genetically adjuvanted MVA with the coding sequence of murine CD40L, a member of the tumor necrosis factor superfamily. Immunization of mice with this new vector led to strongly enhanced primary and memory CD8 T cell responses. Concordant with the enhanced CD8 T cell response, we could detect stronger activation of dendritic cells and higher systemic levels of innate cytokines (including IL-12p70) early after immunization. Interestingly, acquisition of memory characteristics (i.e., IL-7R expression) was accelerated after immunization with MVA-CD40L in comparison to non-adjuvanted MVA. Furthermore, the generated cytotoxic T-lymphocytes (CTLs) also showed improved functionality as demonstrated by intracellular cytokine staining and in vivo killing activity. Importantly, the superior CTL response after a single MVA-CD40L immunization was able to protect B cell deficient mice against a fatal infection with ectromelia virus. Taken together, we show that genetic adjuvantation of MVA can change strength, quality, and functionality of innate and adaptive immune responses. These data should facilitate a rational vaccine design with a focus on rapid induction of large numbers of CD8 T cells able to protect against specific diseases. PMID:23986761
-
Rosario, Maximillian; Hopkins, Richard; Fulkerson, John; Borthwick, Nicola; Quigley, Máire F.; Joseph, Joan; Douek, Daniel C.; Greenaway, Hui Yee; Venturi, Vanessa; Gostick, Emma; Price, David A.; Both, Gerald W.; Sadoff, Jerald C.; Hanke, Tomáš
2010-01-01
Mycobacterium bovis bacillus Calmette-Guérin (BCG), which elicits a degree of protective immunity against tuberculosis, is the most widely used vaccine in the world. Due to its persistence and immunogenicity, BCG has been proposed as a vector for vaccines against other infections, including HIV-1. BCG has a very good safety record, although it can cause disseminated disease in immunocompromised individuals. Here, we constructed a recombinant BCG vector expressing HIV-1 clade A-derived immunogen HIVA using the recently described safer and more immunogenic BCG strain AERAS-401 as the parental mycobacterium. Using routine ex vivo T-cell assays, BCG.HIVA401 as a stand-alone vaccine induced undetectable and weak CD8 T-cell responses in BALB/c mice and rhesus macaques, respectively. However, when BCG.HIVA401 was used as a priming component in heterologous vaccination regimens together with recombinant modified vaccinia virus Ankara-vectored MVA.HIVA and ovine atadenovirus-vectored OAdV.HIVA vaccines, robust HIV-1-specific T-cell responses were elicited. These high-frequency T-cell responses were broadly directed and capable of proliferation in response to recall antigen. Furthermore, multiple antigen-specific T-cell clonotypes were efficiently recruited into the memory pool. These desirable features are thought to be associated with good control of HIV-1 infection. In addition, strong and persistent T-cell responses specific for the BCG-derived purified protein derivative (PPD) antigen were induced. This work is the first demonstration of immunogenicity for two novel vaccine vectors and the corresponding candidate HIV-1 vaccines BCG.HIVA401 and OAdV.HIVA in nonhuman primates. These results strongly support their further exploration. PMID:20375158
-
Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan
2013-10-10
Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.
-
Alimolaei, Mojtaba; Golchin, Mehdi; Daneshvar, Hamid
2016-06-01
Clostridium perfringens type D infects ruminants and causes the enterotoxemia disease by ε-toxin. A mutated ε-toxin gene lacking toxicity was designed, synthesized, and cloned into the pT1NX vector and electroporated into Lactobacillus casei competent cells to yield LC-pT1NX-ε recombinant strain. BALB/c mice, immunized orally with this strain, highly induced mucosal, humoral, and cell-mediated immune responses and developed a protection against 200 MLD/ml of the activated ε-toxin. This study showed that the LC-pT1NX-ε could be a promising vaccine candidate against the enterotoxemia disease. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Yamanaka, Atsushi; Pitaksajjakul, Pannamthip; Ramasoota, Pongrama; Konishi, Eiji
2015-11-09
Most candidate dengue vaccines currently under development induce neutralizing antibodies, which are considered important for immunoprotection. However, the concomitant induction of infection-enhancing antibodies is an unavoidable concern. In contrast, a neutralizing antibody developed for passive immunotherapy has been engineered to eliminate its enhancing activity. Therefore, a strategy for the long-term expression of enhancing-activity-free neutralizing antibodies may resolve this concern. A mouse monoclonal antibody, 7F4, of the IgG3 subclass and with no detectable enhancing activity, was selected as the model neutralizing antibody to evaluate the potential of this strategy. Equal amounts of commercial vector (pFUSE)-based plasmids containing 7F4 heavy (H)- or light (L)-chain variable region genes were mixed and used for the cotransfection of 293T cells and co-delivery into ICR and BALB/c mice. The recombinant plasmids were designed to express IgG2b or IgG3 subclass antibodies (p7F4G2b or p7F4G3, respectively). 293T cells transfected with 2 μg of p7F4G2b or p7F4G3 produced approximately 15,000 or 800 ng/ml IgG in the culture fluids, respectively. The dose is expressed as the total amount of H- and L-chain plasmids. Neutralizing antibody was detected dose-dependently in ICR mice inoculated with 50-200 μg of p7F4G2b. A 1:2 dilution of sera from ICR and BALB/c mice inoculated with 100 μg of p7F4G3 showed average plaque reduction levels of >70% on day 3 and >90% on days 5-9. BALB/c mice maintained detectable neutralizing antibody for at least 3 months. The neutralizing antibody expressed by p7F4G3 in mice showed no enhancing activity. Although the expression of neutralizing antibodies from immunoglobulin genes is a type of passive immunization, its durability can be utilized as a dengue vaccine strategy. This "proof-of-concept" study using a mouse model demonstrates that the enhancing-activity-free characteristic of this strategy augurs well for dengue vaccine development, although further improvement is required. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Saldaña, Azael; Pineda, Vanessa; Martinez, Inri; Santamaria, Giovanna; Santamaria, Ana Maria; Miranda, Aracelis; Calzada, Jose E.
2012-01-01
Background Chagas disease was originally reported in Panama in 1931. Currently, the best knowledge of this zoonosis is restricted to studies done in historically endemic regions. However, little is known about the distribution and epidemiology of Chagas disease in other rural areas of the country. Methods and Findings A cross-sectional descriptive study was carried out between May 2005 – July 2008 in four rural communities of the Santa Fe District, Veraguas Province. The study included an entomologic search to collect triatomines, bloodmeal type identification and infection rate with trypanosomes in collected vectors using a dot- blot and PCR analysis, genotyping of circulating Trypanosoma cruzi (mini-exon gene PCR analysis) and the detection of chagasic antibodies among inhabitants. The vector Rhodnius pallescens was more frequently found in La Culaca and El Pantano communities (788 specimens), where it was a sporadic household visitor. These triatomines presented darker coloration and larger sizescompared with typical specimens collected in Central Panama. Triatoma dimidiata was more common in Sabaneta de El Macho (162 specimens). In one small sub-region (El Macho), 60% of the houses were colonized by this vector. Of the examined R. pallescens, 54.7.0% (88/161) had fed on Didelphis marsupialis, and 24.6% (34/138) of T. dimidiata specimens collected inside houses were positive for human blood. R. pallescens presented an infection index with T. cruzi of 17.7% (24/136), with T. rangeli of 12.5% (17/136) and 50.7% (69/136) were mixed infections. In 117 T. dimidiata domestic specimens the infection index with T. cruzi was 21.4%. Lineage I of T. cruzi was confirmed circulating in these vectors. A T. cruzi infection seroprevalence of 2.3% (24/1,056) was found in this population. Conclusions This is the first report of Chagas disease endemicity in Santa Fe District, and it should be considered a neglected public health problem in this area of Panama. PMID:22558095
-
Pan, Jun; Lin, Xiang-Jin; Ling, Zhi-Heng; Cai, You-Zhi
2015-05-01
To evaluate the effect of down-regulation of Nav1.7 on the activation of astrocytes and microglia in DRG of rats with cancer pain, and explore the transmission of the nociceptive information. Lentiviral vector harboring RNAi sequence targeting the Nav1.7 gene was constructed, and Walker 256 breast cancer cell and morphine was injected to build the bone cancer pain model and morphine tolerance model in rats. Lentiviral vector was injected. Rats in each model were divided into 4 groups: model group, PBS group, vehicle group and LV-Nav1.7 group. The expression levels of GFAP and OX42 in dorsal root ganglia (DRG) were measured. After the animal model was built, the level of Nav1.7, GFAP and OX42 was improved obviously with the time prolonged, which was statistically significant (P<0.05). The expression level of GFAP and OX42 in the DRG in the LV-Nav1.7 group declined obviously compared to the model group, PBS group and vehicle group (P<0.05). Intrathecal injection of Navl.7 shRNA lentiviral vector can reduce the expression of Nav1.7 and inhibit the activation of astrocytes and microglia in DRG. The effort is also effective in morphine tolerance bone cancer pain model rats. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
-
Amann, Ralf; Rohde, Jörg; Wulle, Ulrich; Conlee, Douglas; Raue, Rudiger; Martinon, Olivier; Rziha, Hanns-Joachim
2013-02-01
The present study describes the generation of a new Orf virus (ORFV) recombinant, D1701-V-RabG, expressing the rabies virus (RABV) glycoprotein that is correctly presented on the surface of infected cells without the need of replication or production of infectious recombinant virus. One single immunization with recombinant ORFV can stimulate high RABV-specific virus-neutralizing antibody (VNA) titers in mice, cats, and dogs, representing all nonpermissive hosts for the ORFV vector. The protective immune response against severe lethal challenge infection was analyzed in detail in mice using different dosages, numbers, and routes for immunization with the ORFV recombinant. Long-term levels of VNA could be elicited that remained greater than 0.5 IU per ml serum, indicative for the protective status. Single applications of higher doses (10(7) PFU) can be sufficient to confer complete protection against intracranial (i.c.) challenge, whereas booster immunization was needed for protection by the application of lower dosages. Anamnestic immune responses were achieved by each of the seven tested routes of inoculation, including oral application. Finally, in vivo antibody-mediated depletion of CD4-positive and/or CD8-posititve T cell subpopulations during immunization and/or challenge infection attested the importance of CD4 T cells for the induction of protective immunity by D1701-V-RabG. This report demonstrates another example of the potential of the ORFV vector and also indicates the capability of the new recombinant for vaccination of animals.
-
Quinn, Kylie M.; Costa, Andreia Da; Yamamoto, Ayako; Berry, Dana; Lindsay, Ross W.B.; Darrah, Patricia A.; Wang, Lingshu; Cheng, Cheng; Kong, Wing-Pui; Gall, Jason G.D.; Nicosia, Alfredo; Folgori, Antonella; Colloca, Stefano; Cortese, Riccardo; Gostick, Emma; Price, David A.; Gomez, Carmen E.; Esteban, Mariano; Wyatt, Linda S.; Moss, Bernard; Morgan, Cecilia; Roederer, Mario; Bailer, Robert T.; Nabel, Gary J.; Koup, Richard A.; Seder, Robert A.
2013-01-01
Recombinant adenoviral vectors (rAds) are the most potent recombinant vaccines for eliciting CD8+ T cell-mediated immunity in humans; however, prior exposure from natural adenoviral infection can decrease such responses. Here we show low seroreactivity in humans against simian- (sAd11, sAd16), or chimpanzee-derived (chAd3, chAd63) compared to human-derived (rAd5, rAd28, rAd35) vectors across multiple geographic regions. We then compared the magnitude, quality, phenotype and protective capacity of CD8+ T cell responses in mice vaccinated with rAds encoding SIV Gag. Using a dose range (1 × 107 to 109 PU), we defined a hierarchy among rAd vectors based on the magnitude and protective capacity of CD8+ T cell responses, from most to least as: rAd5 and chAd3, rAd28 and sAd11, chAd63, sAd16, and rAd35. Selection of rAd vector or dose could modulate the proportion and/or frequency of IFNγ+TNFα+IL-2+ and KLRG1+CD127- CD8+ T cells, but strikingly ~30–80% of memory CD8+ T cells co-expressed CD127 and KLRG1. To further optimise CD8+ T cell responses, we assessed rAds as part of prime-boost regimens. Mice primed with rAds and boosted with NYVAC generated Gag-specific responses that approached ~60% of total CD8+ T cells at peak. Alternatively, priming with DNA or rAd28 and boosting with rAd5 or chAd3 induced robust and equivalent CD8+ T cell responses compared to prime or boost alone. Collectively, these data provide the immunologic basis for using specific rAd vectors alone or as part of prime-boost regimens to induce CD8+ T cells for rapid effector function or robust long-term memory, respectively. PMID:23390298
-
Protection of Chickens against Avian Influenza with Non-Replicating Adenovirus-Vectored Vaccine
Toro, Haroldo; Tang, De-chu C.; Suarez, David L.; Shi, Z.
2009-01-01
Protective immunity against avian influenza (AI) virus was elicited in chickens by single-dose vaccination with a replication competent adenovirus (RCA) -free human adenovirus (Ad) vector encoding an H7 AI hemagglutinin (AdChNY94.H7). Chickens vaccinated in ovo with an Ad vector encoding an AI H5 (AdTW68.H5) previously described, which were subsequently vaccinated intramuscularly with AdChNY94.H7 post-hatch, responded with robust antibody titers against both the H5 and H7 AI proteins. Antibody responses to Ad vector in ovo vaccination follow a dose-response kinetic. The use of a synthetic AI H5 gene codon optimized to match the chicken cell tRNA pool was more potent than the cognate H5 gene. The use of Ad-vectored vaccines to increase resistance of chicken populations against multiple AI strains could reduce the risk of an avian-originating influenza pandemic in humans. PMID:18384919
-
B7-H1 expression is associated with expansion of regulatory T cells in colorectal carcinoma.
Hua, Dong; Sun, Jing; Mao, Yong; Chen, Lu-Jun; Wu, Yu-Yu; Zhang, Xue-Guang
2012-03-07
To investigate the expression of B7-H1 in human colorectal carcinoma (CRC) to define its regulating effects on T cells in tumor microenvironment. One hundred and two paraffin blocks and 33 fresh samples of CRC tissues were subject to this study. Immunohistochemistry was performed for B7-H1 and CD3 staining in CRC tissues. Ficoll-Hypaque density gradient centrifugation was used to isolate peripheral blood mononuclear cells of fresh CRC tissues; flow cytometry and immunofluorescence staining were used for detection of regulatory T cells. Data was analyzed with statistical software. Costimulatory molecule B7-H1 was found strongly expressed in CRC tissues, localized in tumor cell membrane and cytoplasm, while weak or none expression of B7-H1 was detected in pared normal colorectal tissues. Meanwhile, CD3 positive T cells were found congregated in CRC tumor nest and stroma. Statistic analysis showed that B7-H1 expression level was negatively correlated to the total T cell density in tumor nest (P < 0.0001) and tumor stroma (P = 0.0200) of 102 cases of CRC tissues. Among the total T cells, a variable amount of regulatory T cells with a clear Foxp3⁺ (forkhead box P3) staining could be detected in CRC tissues and patients' blood. Interestingly, in the 33 samples (15 cases of B7-H1(high) CRC tissues and 18 cases of B7-H1(low) CRC tissues) of freshly isolated mononuclear cells from CRC tissues, the percentages of CD4⁺Foxp3⁺ and CD8⁺Foxp3⁺ regulatory T cells were found remarkably higher in B7-H1(high) CRC tissues than in B7-H1(low) CRC tissues (P = 0.0024, P = 0.0182), indicating that B7-H1 expression was involved in proliferation of regulatory T cell. No significant difference was found in CRC peripheral blood (P = 0.0863, P = 0.0678). PD-1 is the specific ligand for B7-H1 pathway transferring inhibitory signal to T cell, which is expressed by activated T cell. Our further analysis of PD-1 expression on T cells in CRC tissues showed that conventional T cells (CD4⁺Foxp3⁻/CD8⁺Foxp3⁻), which was thought to contribute to the anti-tumor immune response, highly expressed PD-1; while regulatory T cells (CD4⁺Foxp3⁺/CD8⁺Foxp3⁻) almost failed to express PD-1. The average percentage of PD-1 expression on regulatory T cells was significantly higher than the percentage of PD-1 on conventional T cells (CD4⁺Foxp3⁻ T cell, P < 0.0001; CD8⁺Foxp3⁻ T cell, P < 0.0001). The diverse expression of PD-1 might lead to different fate of T cell subsets in B7-H1 over-expression CRC tumor microenvironment. B7-H1 expression in tumor cells can inhibit the conventional T cell proliferation in tumor microenvironment through the PD-1 expression on conventional T cells.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamata, Masakazu, E-mail: masa3k@ucla.edu; Kim, Patrick Y.; Ng, Hwee L.
Chimeric antigen receptors (CARs) are artificially engineered receptors that confer a desired specificity to immune effector T cells. As an HIV-1-specific CAR, CD4ζ CAR has been extensively tested in vitro as well as in clinical trials. T cells modified with this CAR mediated highly potent anti-HIV-1 activities in vitro and were well-tolerated in vivo, but exerted limited effects on viral load and reservoir size due to poor survival and/or functionality of the transduced cells in patients. We hypothesize that ectopic expression of CD4ζ on CD8{sup +} T cells renders them susceptible to HIV-1 infection, resulting in poor survival of those cells. To testmore » this possibility, highly purified CD8{sup +} T cells were genetically modified with a CD4ζ-encoding lentiviral vector and infected with HIV-1. CD8{sup +} T cells were vulnerable to HIV-1 infection upon expression of CD4ζ as evidenced by elevated levels of p24{sup Gag} in cells and culture supernatants. Concurrently, the number of CD4ζ-modified CD8{sup +} T cells was reduced relative to control cells upon HIV-1 infection. To protect these cells from HIV-1 infection, we co-expressed two anti-HIV-1 shRNAs previously developed by our group together with CD4ζ. This combination vector was able to suppress HIV-1 infection without impairing HIV-1-dependent effector activities of CD4ζ. In addition, the number of CD4ζ-modified CD8{sup +} T cells maintained similar levels to that of the control even under HIV-1 infection. These results suggest that protecting CD4ζ-modified CD8{sup +} T cells from HIV-1 infection is required for prolonged HIV-1-specific immune surveillance. - Highlights: • Ectopic expression of CD4ζ CAR in CD8{sup +} T cells renders them susceptible to HIV-1 infection. • Co-expression of two anti-HIV-1 shRNAs protects CD4ζ CAR-modified CD8{sup +} T cells from HIV-1 infection. • Protecting CD4ζ CAR-modified CD8{sup +} T cells from HIV-1 infection suppresses its cytopathic effect.« less
-
Detection of osteoclastic cell-cell fusion through retroviral vector packaging.
Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi
2004-11-01
Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.
-
Matassov, Demetrius; Marzi, Andrea; Latham, Terri; Xu, Rong; Ota-Setlik, Ayuko; Feldmann, Friederike; Geisbert, Joan B.; Mire, Chad E.; Hamm, Stefan; Nowak, Becky; Egan, Michael A.; Geisbert, Thomas W.; Eldridge, John H.; Feldmann, Heinz; Clarke, David K.
2015-01-01
Previously, recombinant vesicular stomatitis virus (rVSV) pseudotypes expressing Ebolavirus glycoproteins (GPs) in place of the VSV G protein demonstrated protection of nonhuman primates from lethal homologous Ebolavirus challenge. Those pseudotype vectors contained no additional attenuating mutations in the rVSV genome. Here we describe rVSV vectors containing a full complement of VSV genes and expressing the Ebola virus (EBOV) GP from an additional transcription unit. These rVSV vectors contain the same combination of attenuating mutations used previously in the clinical development pathway of an rVSV/human immunodeficiency virus type 1 vaccine. One of these rVSV vectors (N4CT1-EBOVGP1), which expresses membrane-anchored EBOV GP from the first position in the genome (GP1), elicited a balanced cellular and humoral GP-specific immune response in mice. Guinea pigs immunized with a single dose of this vector were protected from any signs of disease following lethal EBOV challenge, while control animals died in 7–9 days. Subsequently, N4CT1-EBOVGP1 demonstrated complete, single-dose protection of 2 macaques following lethal EBOV challenge. A single sham-vaccinated macaque died from disease due to EBOV infection. These results demonstrate that highly attenuated rVSV vectors expressing EBOV GP may provide safer alternatives to current EBOV vaccines. PMID:26109675
-
Identification of Small Molecules Targeting the Posttranscriptional Control of ERG Expression
2012-10-01
ied. To establish a cell line expressing lucife rase-ERG fusion protein, the vector along pRL-CMV-Rluc expressing Renilla luciferase gene was...expanded, and examined for the e xpression of t wo different luciferases. A clone expressing both Firefly luciferase and Renilla luciferase was selected...treated with the individual chemical at 10 μM for 24 h. The dual luciferase activities were measured. The ratio of Firefly to Renilla lu ciferase
-
Development of an Expression Vector to Overexpress or Downregulate Genes in Curvularia protuberata.
Liu, Chengke; Cleckler, Blake; Morsy, Mustafa
2018-05-05
Curvularia protuberata , an endophytic fungus in the Ascomycota, provides plants with thermotolerance only when it carries a mycovirus known as Curvularia thermotolerance virus (CThTV), and forms a three-way symbiotic relationship among these organisms. Under heat stress, several genes are expressed differently between virus-free C. protuberata (VF) and C. protuberata carrying CThTV (AN). We developed an expression vector, pM2Z-fun, carrying a zeocin resistance gene driven by the ToxA promoter, to study gene functions in C. protuberata to better understand this three-way symbiosis. Using this new 3.7-kb vector, five genes that are differentially expressed in C. protuberata —including genes involved in the trehalose, melanin, and catalase biosynthesis pathways—were successfully overexpressed or downregulated in VF or AN C. protuberata strains, respectively. The VF overexpression lines showed higher metabolite and enzyme activity than in the control VF strain. Furthermore, downregulation of expression of the same genes in the AN strain resulted in lower metabolite and enzyme activity than in the control AN strain. The newly generated expression vector, pM2Z-fun, has been successfully used to express target genes in C. protuberata and will be useful in further functional expression studies in other Ascomycota fungi.
-
Tsutsui, Hiroki; Higashiyama, Tetsuya
2017-01-01
The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
-
Ren, Shoufeng; Wei, Qimei; Cai, Liya; Yang, Xuejing; Xing, Cuicui; Tan, Feng; Leavenworth, Jianmei W.; Liang, Shaohui; Liu, Wenquan
2018-01-01
Ebola virus (EBOV) causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP) is the major protective antigen of EBOV, and can generate virus-like particles (VLPs) by co-expression with matrix protein (VP40). In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention. PMID:29375526
-
Wenying, Wei; Jinyu, Han; Wen, Xu
2004-01-01
The specific position of a group in the molecule has been considered, and a group vector space method for estimating enthalpy of vaporization at the normal boiling point of organic compounds has been developed. Expression for enthalpy of vaporization Delta(vap)H(T(b)) has been established and numerical values of relative group parameters obtained. The average percent deviation of estimation of Delta(vap)H(T(b)) is 1.16, which show that the present method demonstrates significant improvement in applicability to predict the enthalpy of vaporization at the normal boiling point, compared the conventional group methods.
-
Caussy, Cyrielle; Charrière, Sybil; Marçais, Christophe; Di Filippo, Mathilde; Sassolas, Agnès; Delay, Mireille; Euthine, Vanessa; Jalabert, Audrey; Lefai, Etienne; Rome, Sophie; Moulin, Philippe
2014-01-01
APOA5 c.∗158C>T (rs2266788), located in the 3′ UTR, belongs to APOA5 haplotype 2 (APOA5∗2), which is strongly associated with plasma triglyceride levels and modulates the occurrence of both moderate and severe hypertriglyceridemia. Individuals with APOA5∗2 display reduced APOA5 expression at the posttranscriptional level. However, the functionality of this haplotype remains unclear. We hypothesized that the hypertriglyceridemic effects of APOA5∗2 could involve miRNA regulation in the APOA5 3′ UTR. Bioinformatic studies have identified the creation of a potential miRNA binding site for liver-expressed miR-485-5p (MIRN485-5p) in the mutant APOA5 3′ UTR with the c.∗158C allele. In human embryonic kidney 293T (HEK293T) cells cotransfected with an APOA5 3′ UTR luciferase reporter vector and a miR485-5p precursor, c.∗158C allele expression was significantly decreased. Moreover, in HuH-7 cells endogenously expressing miR-485-5p, we observed that luciferase activity was significantly lower in the presence of the c.∗158C allele than in the presence of the c.∗158T allele, which was completely reversed by a miR-485-5p inhibitor. We demonstrated that the rare c.∗158C APOA5 allele creates a functional target site for liver-expressed miR-485-5p. Therefore, we propose that the well-documented hypertriglyceridemic effect of APOA5∗2 involves an APOA5 posttranscriptional downregulation mediated by miR-485-5p. PMID:24387992
-
Ceglarek, Izabela; Piotrowicz, Agnieszka; Lecion, Dorota; Miernikiewicz, Paulina; Owczarek, Barbara; Hodyra, Katarzyna; Harhala, Marek; Górski, Andrzej; Dąbrowska, Krystyna
2013-11-14
Practical applications of bacteriophages in medicine and biotechnology induce a great need for technologies of phage purification. None of the popular methods offer solutions for separation of a phage from another similar phage. We used affinity chromatography combined with competitive phage display (i) to purify T4 bacteriophage from bacterial debris and (ii) to separate T4 from other contaminating bacteriophages. In 'competitive phage display' bacterial cells produced both wild types of the proteins (expression from the phage genome) and the protein fusions with affinity tags (expression from the expression vectors). Fusion proteins were competitively incorporated into the phage capsid. It allowed effective separation of T4 from a contaminating phage on standard affinity resins.
-
Ceglarek, Izabela; Piotrowicz, Agnieszka; Lecion, Dorota; Miernikiewicz, Paulina; Owczarek, Barbara; Hodyra, Katarzyna; Harhala, Marek; Górski, Andrzej; Dąbrowska, Krystyna
2013-01-01
Practical applications of bacteriophages in medicine and biotechnology induce a great need for technologies of phage purification. None of the popular methods offer solutions for separation of a phage from another similar phage. We used affinity chromatography combined with competitive phage display (i) to purify T4 bacteriophage from bacterial debris and (ii) to separate T4 from other contaminating bacteriophages. In ‘competitive phage display’ bacterial cells produced both wild types of the proteins (expression from the phage genome) and the protein fusions with affinity tags (expression from the expression vectors). Fusion proteins were competitively incorporated into the phage capsid. It allowed effective separation of T4 from a contaminating phage on standard affinity resins. PMID:24225840
-
Jere, Khuzwayo C.; O'Neill, Hester G.; Potgieter, A. Christiaan; van Dijk, Alberdina A.
2014-01-01
Rotavirus virus-like particles (RV-VLPs) are potential alternative non-live vaccine candidates due to their high immunogenicity. They mimic the natural conformation of native viral proteins but cannot replicate because they do not contain genomic material which makes them safe. To date, most RV-VLPs have been derived from cell culture adapted strains or common G1 and G3 rotaviruses that have been circulating in communities for some time. In this study, chimaeric RV-VLPs were generated from the consensus sequences of African rotaviruses (G2, G8, G9 or G12 strains associated with either P[4], P[6] or P[8] genotypes) characterised directly from human stool samples without prior adaptation of the wild type strains to cell culture. Codon-optimised sequences for insect cell expression of genome segments 2 (VP2), 4 (VP4), 6 (VP6) and 9 (VP7) were cloned into a modified pFASTBAC vector, which allowed simultaneous expression of up to four genes using the Bac-to-Bac Baculovirus Expression System (BEVS; Invitrogen). Several combinations of the genome segments originating from different field strains were cloned to produce double-layered RV-VLPs (dRV-VLP; VP2/6), triple-layered RV-VLPs (tRV-VLP; VP2/6/7 or VP2/6/7/4) and chimaeric tRV-VLPs. The RV-VLPs were produced by infecting Spodoptera frugiperda 9 and Trichoplusia ni cells with recombinant baculoviruses using multi-cistronic, dual co-infection and stepwise-infection expression strategies. The size and morphology of the RV-VLPs, as determined by transmission electron microscopy, revealed successful production of RV-VLPs. The novel approach of producing tRV-VLPs, by using the consensus insect cell codon-optimised nucleotide sequence derived from dsRNA extracted directly from clinical specimens, should speed-up vaccine research and development by by-passing the need to adapt rotaviruses to cell culture. Other problems associated with cell culture adaptation, such as possible changes in epitopes, can also be circumvented. Thus, it is now possible to generate tRV-VLPs for evaluation as non-live vaccine candidates for any human or animal field rotavirus strain. PMID:25268783
-
In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.
Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A
2008-01-01
Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.
-
Tay, Szun Szun; Wong, Yik Chun; McDonald, David M; Wood, Nicole A W; Roediger, Ben; Sierro, Frederic; Mcguffog, Claire; Alexander, Ian E; Bishop, G Alex; Gamble, Jennifer R; Weninger, Wolfgang; McCaughan, Geoffrey W; Bertolino, Patrick; Bowen, David G
2014-06-24
CD8 T-cell responses to liver-expressed antigens range from deletional tolerance to full effector differentiation resulting in overt hepatotoxicity. The reasons for these heterogeneous outcomes are not well understood. To identify factors that govern the fate of CD8 T cells activated by hepatocyte-expressed antigen, we exploited recombinant adenoassociated viral vectors that enabled us to vary potential parameters determining these outcomes in vivo. Our findings reveal a threshold of antigen expression within the liver as the dominant factor determining T-cell fate, irrespective of T-cell receptor affinity or antigen cross-presentation. Thus, when a low percentage of hepatocytes expressed cognate antigen, high-affinity T cells developed and maintained effector function, whereas, at a high percentage, they became functionally exhausted and silenced. Exhaustion was not irreversibly determined by initial activation, but was maintained by high intrahepatic antigen load during the early phase of the response; cytolytic function was restored when T cells primed under high antigen load conditions were transferred into an environment of low-level antigen expression. Our study reveals a hierarchy of factors dictating the fate of CD8 T cells during hepatic immune responses, and provides an explanation for the different immune outcomes observed in a variety of immune-mediated liver pathologic conditions.
-
Xu, Ying; Yang, Enzhuo; Wang, Jianguang; Li, Rui; Li, Guanghua; Liu, Guoyuan; Song, Na; Huang, Qi; Kong, Cong; Wang, Honghai
2014-10-01
To prevent the global spread of tuberculosis (TB), more effective vaccines and vaccination strategies are urgently needed. As a result of the success of bacillus Calmette-Guérin (BCG) in protecting children against miliary and meningeal TB, the majority of individuals will have been vaccinated with BCG; hence, boosting BCG-primed immunity will probably be a key component of future vaccine strategies. In this study, we compared the ability of DNA-, protein- and lentiviral vector-based vaccines that express the antigens Ag85B and Rv3425 to boost the effects of BCG in the context of immunity and protection against Mycobacterium tuberculosis in C57BL/6 mice. Our results demonstrated that prime-boost BCG vaccination with a lentiviral vector expressing the antigens Ag85B and Rv3425 significantly enhanced immune responses, including T helper type 1 and CD8(+) cytotoxic T lymphocyte responses, compared with DNA- and protein-based vaccines. However, lentivirus-vectored and DNA-based vaccines greatly improved the protective efficacy of BCG against M. tuberculosis, as indicated by a lack of weight loss and significantly reduced bacterial loads and histological damage in the lung. Our study suggests that the use of lentiviral or DNA vaccines containing the antigens Ag85B and Rv3425 to boost BCG is a good choice for the rational design of an efficient vaccination strategy against TB. © 2014 John Wiley & Sons Ltd.
-
van Til, Niek P; Sarwari, Roya; Visser, Trudi P; Hauer, Julia; Lagresle-Peyrou, Chantal; van der Velden, Guus; Malshetty, Vidyasagar; Cortes, Patricia; Jollet, Arnaud; Danos, Olivier; Cassani, Barbara; Zhang, Fang; Thrasher, Adrian J; Fontana, Elena; Poliani, Pietro L; Cavazzana, Marina; Verstegen, Monique M A; Villa, Anna; Wagemaker, Gerard
2014-04-01
Recombination-activating gene 1 (RAG1) deficiency results in severe combined immunodeficiency (SCID) caused by a complete lack of T and B lymphocytes. If untreated, patients succumb to recurrent infections. We sought to develop lentiviral gene therapy for RAG1-induced SCID and to test its safety. Constructs containing the viral spleen-focus-forming virus (SF), ubiquitous promoters, or cell type-restricted promoters driving sequence-optimized RAG1 were compared for efficacy and safety in sublethally preconditioned Rag1(-/-) mice undergoing transplantation with transduced bone marrow progenitors. Peripheral blood CD3(+) T-cell reconstitution was achieved with SF, ubiquitous promoters, and cell type-restricted promoters but 3- to 18-fold lower than that seen in wild-type mice, and with a compromised CD4(+)/CD8(+) ratio. Mitogen-mediated T-cell responses and T cell-dependent and T cell-independent B-cell responses were not restored, and T-cell receptor patterns were skewed. Reconstitution of mature peripheral blood B cells was approximately 20-fold less for the SF vector than in wild-type mice and often not detectable with the other promoters, and plasma immunoglobulin levels were abnormal. Two months after transplantation, gene therapy-treated mice had rashes with cellular tissue infiltrates, activated peripheral blood CD44(+)CD69(+) T cells, high plasma IgE levels, antibodies against double-stranded DNA, and increased B cell-activating factor levels. Only rather high SF vector copy numbers could boost T- and B-cell reconstitution, but mRNA expression levels during T- and B-cell progenitor stages consistently remained less than wild-type levels. These results underline that further development is required for improved expression to successfully treat patients with RAG1-induced SCID while maintaining low vector copy numbers and minimizing potential risks, including autoimmune reactions resembling Omenn syndrome. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
-
Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells.
Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G; Martin, Francisco
2016-11-17
Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny.
-
Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells
Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G.; Martin, Francisco
2016-01-01
Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny. PMID:27853296
-
Bayer, Wibke; Tenbusch, Matthias; Lietz, Ruth; Johrden, Lena; Schimmer, Simone; Uberla, Klaus; Dittmer, Ulf; Wildner, Oliver
2010-02-01
We present a new type of adenoviral vector that both encodes and displays a vaccine antigen on the capsid, thus combining in itself gene-based and protein vaccination; this vector resulted in an improved vaccination outcome in the Friend virus (FV) model. For presentation of the envelope protein gp70 of Friend murine leukemia virus on the adenoviral capsid, gp70 was fused to the adenovirus capsid protein IX. When compared to vaccination with conventional FV Env- and Gag-encoding adenoviral vectors, vaccination with the adenoviral vector that encodes and displays pIX-gp70 combined with an FV Gag-encoding vector resulted in significantly improved protection against systemic FV challenge infection, with highly controlled viral loads in plasma and spleen. This improved protection correlated with improved neutralizing antibody titers and stronger CD4(+) T-cell responses. Using a vector that displays gp70 without encoding it, we found that while the antigen display on the capsid alone was sufficient to induce high levels of binding antibodies, in vivo expression was necessary for the induction of neutralizing antibodies. This new type of adenovirus-based vaccine could be a valuable tool for vaccination.
-
Bortolotto, Luis Felipe Buso; Barbosa, Flávia Regina; Silva, Gabriel; Bitencourt, Tamires Aparecida; Beleboni, Rene Oliveira; Baek, Seung Joon; Marins, Mozart; Fachin, Ana Lúcia
2017-01-01
Chalcones are precursors of flavonoids that exhibit structural heterogeneity and potential antitumor activity. The objective of this study was to characterize the cytotoxicity of trans-chalcone and licochalcone A (LicoA 1 ) against a breast cancer cell line (MCF-7) and normal murine fibroblasts (3T3). Also the mechanisms of the anti-cancer activity of these two compounds were studied. The alkaline comet assay revealed dose-dependent genotoxicity, which was more responsive against the tumor cell line, compared to the 3T3 mouse fibroblast cell line. Flow cytometry showed that the two chalcones caused the cell cycle arrest in the G1 phase and induced apoptosis in MCF-7 cells. Using PCR Array, we found that trans-chalcone and LicoA trigger apoptosis mediated by the intrinsic pathway as demonstrated by the inhibition of Bcl-2 and induction of Bax. In western blot assay, the two chalcones reduced the expression of cell death-related proteins such as Bcl-2 and cyclin D1 and promoted the cleavage of PARP. However, only trans-chalcone induced the expression of the CIDEA gene and protein in these two experiments. Furthermore, transient transfections of MCF-7 using a construction of a promoter-luciferase vector showed that trans-chalcone induced the expression of the CIDEA promoter activity in 24 and 48h. In conclusion, the results showed that trans-chalcone promoted high induction of the CIDEA promoter gene and protein, which is related to DNA fragmentation during apoptosis. Copyright © 2016. Published by Elsevier Masson SAS.
-
Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A
1989-10-01
A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.
-
Climent, Núria; Guerra, Susana; García, Felipe; Rovira, Cristina; Miralles, Laia; Gómez, Carmen Elena; Piqué, Núria; Gil, Cristina; Gatell, José María; Esteban, Mariano; Gallart, Teresa
2011-01-01
Currently, MVA virus vectors carrying HIV-1 genes are being developed as HIV-1/AIDS prophylactic/therapeutic vaccines. Nevertheless, little is known about the impact of these vectors on human dendritic cells (DC) and their capacity to present HIV-1 antigens to human HIV-specific T cells. This study aimed to characterize the interaction of MVA and MVA expressing the HIV-1 genes Env-Gag-Pol-Nef of clade B (referred to as MVA-B) in human monocyte-derived dendritic cells (MDDC) and the subsequent processes of HIV-1 antigen presentation and activation of memory HIV-1-specific T lymphocytes. For these purposes, we performed ex vivo assays with MDDC and autologous lymphocytes from asymptomatic HIV-infected patients. Infection of MDDC with MVA-B or MVA, at the optimal dose of 0.3 PFU/MDDC, induced by itself a moderate degree of maturation of MDDC, involving secretion of cytokines and chemokines (IL1-ra, IL-7, TNF-α, IL-6, IL-12, IL-15, IL-8, MCP-1, MIP-1α, MIP-1β, RANTES, IP-10, MIG, and IFN-α). MDDC infected with MVA or MVA-B and following a period of 48 h or 72 h of maturation were able to migrate toward CCL19 or CCL21 chemokine gradients. MVA-B infection induced apoptosis of the infected cells and the resulting apoptotic bodies were engulfed by the uninfected MDDC, which cross-presented HIV-1 antigens to autologous CD8+ T lymphocytes. MVA-B-infected MDDC co-cultured with autologous T lymphocytes induced a highly functional HIV-specific CD8+ T cell response including proliferation, secretion of IFN-γ, IL-2, TNF-α, MIP-1β, MIP-1α, RANTES and IL-6, and strong cytotoxic activity against autologous HIV-1-infected CD4+ T lymphocytes. These results evidence the adjuvant role of the vector itself (MVA) and support the clinical development of prophylactic and therapeutic anti-HIV vaccines based on MVA-B. PMID:21625608
-
Singpiel, Alena; Kramer, Julia; Maus, Regina; Stolper, Jennifer; Bittersohl, Lara Friederike; Gauldie, Jack; Kolb, Martin; Welte, Tobias; Sparwasser, Tim; Maus, Ulrich A
2018-03-01
Granulocyte macrophage-colony stimulating factor (GM-CSF) is a hematopoietic growth factor involved in differentiation, survival and activation of myeloid and non-myeloid cells with important implications for lung antibacterial immunity. Here we examined the effect of pulmonary adenoviral vector-mediated delivery of GM-CSF (AdGM-CSF) on anti-mycobacterial immunity in M. bovis BCG infected mice. Exposure of M. bovis BCG infected mice to AdGM-CSF either applied on 6h, or 6h and 7days post-infection substantially increased alveolar recruitment of iNOS and IL-12 expressing macrophages, and significantly increased accumulation of IFNγ pos T cells and particularly regulatory T cells (Tregs). This was accompanied by significantly reduced mycobacterial loads in the lungs of mice. Importantly, diphtheria toxin-induced depletion of Tregs did not influence mycobacterial loads, but accentuated immunopathology in AdGM-CSF-exposed mice infected with M. bovis BCG. Together, the data demonstrate that AdGM-CSF therapy improves lung protective immunity against M. bovis BCG infection in mice independent of co-recruited Tregs, which however critically contribute to limit lung immunopathology in BCG-infected mice. These data may be relevant to the development of immunomodulatory strategies to limit immunopathology-based lung injury in tuberculosis in humans. Copyright © 2017 Elsevier GmbH. All rights reserved.
-
Sen, Dwaipayan; Gadkari, Rupali A; Sudha, Govindarajan; Gabriel, Nishanth; Kumar, Yesupatham Sathish; Selot, Ruchita; Samuel, Rekha; Rajalingam, Sumathi; Ramya, V.; Nair, Sukesh C.; Srinivasan, Narayanaswamy; Srivastava, Alok
2013-01-01
Abstract Recombinant adeno-associated virus vectors based on serotype 8 (AAV8) have shown significant promise for liver-directed gene therapy. However, to overcome the vector dose dependent immunotoxicity seen with AAV8 vectors, it is important to develop better AAV8 vectors that provide enhanced gene expression at significantly low vector doses. Since it is known that AAV vectors during intracellular trafficking are targeted for destruction in the cytoplasm by the host–cellular kinase/ubiquitination/proteasomal machinery, we modified specific serine/threonine kinase or ubiquitination targets on the AAV8 capsid to augment its transduction efficiency. Point mutations at specific serine (S)/threonine (T)/lysine (K) residues were introduced in the AAV8 capsid at the positions equivalent to that of the effective AAV2 mutants, generated successfully earlier. Extensive structure analysis was carried out subsequently to evaluate the structural equivalence between the two serotypes. scAAV8 vectors with the wild-type (WT) and each one of the S/T→Alanine (A) or K-Arginine (R) mutant capsids were evaluated for their liver transduction efficiency in C57BL/6 mice in vivo. Two of the AAV8-S→A mutants (S279A and S671A), and a K137R mutant vector, demonstrated significantly higher enhanced green fluorescent protein (EGFP) transcript levels (∼9- to 46-fold) in the liver compared to animals that received WT-AAV8 vectors alone. The best performing AAV8 mutant (K137R) vector also had significantly reduced ubiquitination of the viral capsid, reduced activation of markers of innate immune response, and a concomitant two-fold reduction in the levels of neutralizing antibody formation in comparison to WT-AAV8 vectors. Vector biodistribution studies revealed that the K137R mutant had a significantly higher and preferential transduction of the liver (106 vs. 7.7 vector copies/mouse diploid genome) when compared to WT-AAV8 vectors. To further study the utility of the K137R-AAV8 mutant in therapeutic gene transfer, we delivered human coagulation factor IX (h.FIX) under the control of liver-specific promoters (LP1 or hAAT) into C57BL/6 mice. The circulating levels of h.FIX:Ag were higher in all the K137R-AAV8 treated groups up to 8 weeks post-hepatic gene transfer. These studies demonstrate the feasibility of the use of this novel AAV8 vectors for potential gene therapy of hemophilia B. PMID:23442071
-
Aswad, Fred; Dennert, Gunther
2006-09-01
Contact of T lymphocytes with nicotinamide adenine dinucleotide (NAD) or ATP causes cell death that requires expression of purinergic receptor P2X(7) (P2X(7)R). T cell subsets differ in their responses to NAD and ATP, which awaits a mechanistic explanation. Here, we show that sensitivity to ATP correlates with P2X(7)R expression levels in CD4 cells, CD8 cells and CD4(+)CD25(+) cells from both C57BL/6 and BALB/c mice. But P2X(7)R ligands do not only induce cell death but also shedding of CD62L. It is shown here that in CD62L(high) T cells, CD62L shedding correlates with low expression of P2X(7)Rs and lower cell death, whereas in CD62L(low) cells P2X(7)R expression and death are higher. The possibility is therefore investigated that P2X(7)Rs induce T cell activation. Experiments show that spontaneous T cell proliferation is somewhat higher in cells expressing P2X(7)Rs, but this effect we suggest is caused by P2X(7)R expression on accessory cells.
-
Yasmin, Nusrat; Saleem, Mahjabeen; Naz, Mamoona; Gul, Roquyya; Rehman, Hafiz Muzzammel
2017-01-01
A thaumatin-like protein gene from Basrai banana was cloned and expressed in Escherichia coli . Amplified gene product was cloned into pTZ57R/T vector and subcloned into expression vector pET22b(+) and resulting pET22b-basrai TLP construct was introduced into E. coli BL21. Maximum protein expression was obtained at 0.7 mM IPTG concentration after 6 hours at 37°C. Western blot analysis showed the presence of approximately 20 kDa protein in induced cells. Basrai antifungal TLP was tried as pharmacological agent against fungal disease. Independently Basrai antifungal protein and amphotericin B exhibited their antifungal activity against A. fumigatus ; however combined effect of both agents maximized activity against the pathogen. Docking studies were performed to evaluate the antimicrobial potential of TLP against A. fumigatus by probing binding pattern of antifungal protein with plasma membrane ergosterol of targeted fungal strain. Ice crystallization primarily damages frozen food items; however addition of antifreeze proteins limits the growth of ice crystal in frozen foods. The potential of Basrai TLP protein, as an antifreezing agent, in controlling the ice crystal formation in frozen yogurt was also studied. The scope of this study ranges from cost effective production of pharmaceutics to antifreezing and food preserving agent as well as other real life applications.
-
Yasmin, Nusrat; Naz, Mamoona; Gul, Roquyya; Rehman, Hafiz Muzzammel
2017-01-01
A thaumatin-like protein gene from Basrai banana was cloned and expressed in Escherichia coli. Amplified gene product was cloned into pTZ57R/T vector and subcloned into expression vector pET22b(+) and resulting pET22b-basrai TLP construct was introduced into E. coli BL21. Maximum protein expression was obtained at 0.7 mM IPTG concentration after 6 hours at 37°C. Western blot analysis showed the presence of approximately 20 kDa protein in induced cells. Basrai antifungal TLP was tried as pharmacological agent against fungal disease. Independently Basrai antifungal protein and amphotericin B exhibited their antifungal activity against A. fumigatus; however combined effect of both agents maximized activity against the pathogen. Docking studies were performed to evaluate the antimicrobial potential of TLP against A. fumigatus by probing binding pattern of antifungal protein with plasma membrane ergosterol of targeted fungal strain. Ice crystallization primarily damages frozen food items; however addition of antifreeze proteins limits the growth of ice crystal in frozen foods. The potential of Basrai TLP protein, as an antifreezing agent, in controlling the ice crystal formation in frozen yogurt was also studied. The scope of this study ranges from cost effective production of pharmaceutics to antifreezing and food preserving agent as well as other real life applications. PMID:28875151
-
Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.
2015-01-01
Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769
-
Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J
2015-01-01
Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.
-
CCC CGA is a weak translational recoding site in Escherichia coli.
Shu, Ping; Dai, Huacheng; Mandecki, Wlodek; Goldman, Emanuel
2004-12-08
Previously published experiments had indicated unexpected expression of a control vector in which a beta-galactosidase reporter was in the +1 reading frame relative to the translation start. This control vector contained the codon pair CCC CGA in the zero reading frame, raising the possibility that ribosomes rephased on this sequence, with peptidyl-tRNA(Pro) pairing with CCC in the +1 frame. This putative rephasing might also be exacerbated by the rare CGA Arg codon in the second position due to increased vacancy of the ribosomal A-site. To test this hypothesis, a series of site-directed mutants was constructed, including mutations in both the first and second codons of this codon pair. The results show that interrupting the continuous run of C residues with synonymous codon changes essentially abolishes the frameshift. Further, changing the rare Arg codon to a common Arg codon also reduces the frequency of the frameshift. These results provide strong support for the hypothesis that CCC CGA in the zero frame is indeed a weak translational frameshift site in Escherichia coli, with a 1-2% efficiency. Because the vector sequence also contains another CCC triplet in the +1 reading frame starting within the next codon after the CGA, our data also support possible contribution to expression of a +7 nucleotide ribosome hop into the same +1 reading frame. We also confirm here a previous report that CCC UGA is a translational frameshift site, in these experiments, with about 5% efficiency.
-
Jiang, Yanfen; Kulkarni, Raveendra R; Parreira, Valeria R; Poppe, Cornelius; Roland, Kenneth L; Prescott, John F
2010-10-01
This study assessed the protective efficacy of oral vaccination with 2 experimental attenuated Salmonella Typhimurium-vectored vaccines for necrotic enteritis in protecting chickens against intestinal colonization by common serovars of Salmonella belonging to the 4 major serogroups affecting chickens. Birds were vaccinated orally with 1 × 10⁸ colony-forming units (CFU) of 1 of the vaccine strains χ9241 and χ9352, which express a plasmid-encoded partial recombinant hypothetical protein gene (tHP) of Clostridium perfringens, at days 1 and 7 of age, and then were challenged at 14 d of age with 10⁶ CFU of Salmonella serovars Anatum, Enteritidis, Heidelberg, Kentucky, or Typhimurium (representative serovars of serogroups B, C, D, and E). Birds were necropsied at 4 wk of age, and samples were collected to determine reduction in tissue and intestinal colonization. The chickens vaccinated with χ9241-tHP showed reduced colonization by Salmonella Enteritidis (serogroup D) and by Salmonella Heidelberg and Salmonella Typhimurium (serogroup B) compared with the control birds. No reduction in colonization was observed in the chickens vaccinated with χ9352-tHP. There was an association between the efficacy of these vaccine strains in protecting against necrotic enteritis, assessed on an earlier occasion, and their efficacy in protecting against Salmonella colonization. Thus, the choice of an attenuated Salmonella Typhimurium vaccine vector for delivery of heterologous antigens to chickens should be based partly on the vaccine's value in protecting against colonization by serovars within serogroups B and D. Such vectors would have the additional benefit of reducing colonization of important Salmonella serovars.
-
Jiang, Yanfen; Kulkarni, Raveendra R.; Parreira, Valeria R.; Poppe, Cornelius; Roland, Kenneth L.; Prescott, John F.
2010-01-01
This study assessed the protective efficacy of oral vaccination with 2 experimental attenuated Salmonella Typhimurium-vectored vaccines for necrotic enteritis in protecting chickens against intestinal colonization by common serovars of Salmonella belonging to the 4 major serogroups affecting chickens. Birds were vaccinated orally with 1 × 108 colony-forming units (CFU) of 1 of the vaccine strains χ9241 and χ9352, which express a plasmid-encoded partial recombinant hypothetical protein gene (tHP) of Clostridium perfringens, at days 1 and 7 of age, and then were challenged at 14 d of age with 106 CFU of Salmonella serovars Anatum, Enteritidis, Heidelberg, Kentucky, or Typhimurium (representative serovars of serogroups B, C, D, and E). Birds were necropsied at 4 wk of age, and samples were collected to determine reduction in tissue and intestinal colonization. The chickens vaccinated with χ9241-tHP showed reduced colonization by Salmonella Enteritidis (serogroup D) and by Salmonella Heidelberg and Salmonella Typhimurium (serogroup B) compared with the control birds. No reduction in colonization was observed in the chickens vaccinated with χ9352-tHP. There was an association between the efficacy of these vaccine strains in protecting against necrotic enteritis, assessed on an earlier occasion, and their efficacy in protecting against Salmonella colonization. Thus, the choice of an attenuated Salmonella Typhimurium vaccine vector for delivery of heterologous antigens to chickens should be based partly on the vaccine’s value in protecting against colonization by serovars within serogroups B and D. Such vectors would have the additional benefit of reducing colonization of important Salmonella serovars. PMID:21197226
-
Rampias, Theodore; Boutati, Eleni; Pectasides, Eirini; Sasaki, Clarence; Kountourakis, Panteleimon; Weinberger, Paul; Psyrri, Amanda
2010-03-01
We sought to determine the role of human papillomavirus (HPV) E6 and E7 oncogenes in nuclear beta-catenin accumulation, a hallmark of activated canonical Wnt signaling pathway. We used HPV16-positive oropharyngeal cancer cell lines 147T and 090, HPV-negative cell line 040T, and cervical cell lines SiHa (bearing integrated HPV16) and HeLa (bearing integrated HPV18) to measure the cytoplasmic and nuclear beta-catenin levels and the beta-catenin/Tcf transcriptional activity before and after E6/E7 gene silencing. Repression of HPV E6 and E7 genes induced a substantial reduction in nuclear beta-catenin levels. Luciferase assay showed that transcriptional activation of Tcf promoter by beta-catenin was lower after silencing. The protein levels of beta-catenin are tightly regulated by the ubiquitin/proteasome system. We therefore performed expression analysis of regulators of beta-catenin degradation and nuclear transport and showed that seven in absentia homologue (Siah-1) mRNA and protein levels were substantially upregulated after E6/E7 repression. Siah-1 protein promotes the degradation of beta-catenin through the ubiquitin/proteasome system. To determine whether Siah-1 is important for the proteasomal degradation of beta-catenin in HPV16-positive oropharyngeal cancer cells, we introduced a Siah-1 expression vector into 147T and 090 cells and found substantial reduction of endogenous beta-catenin in these cells. Thus, E6 and E7 are involved in beta-catenin nuclear accumulation and activation of Wnt signaling in HPV-induced cancers. In addition, we show the significance of the endogenous Siah-1-dependent ubiquitin/proteasome pathway for beta-catenin degradation and its regulation by E6/E7 viral oncoproteins in HPV16-positive oropharyngeal cancer cells.
-
Semiflexible polymer dynamics with a bead-spring model
NASA Astrophysics Data System (ADS)
Barkema, Gerard T.; Panja, Debabrata; van Leeuwen, J. M. J.
2014-11-01
We study the dynamical properties of semiflexible polymers with a recently introduced bead-spring model. We focus on double-stranded DNA (dsDNA). The two parameters of the model, T* and ν, are chosen to match its experimental force-extension curve. In comparison to its groundstate value, the bead-spring Hamiltonian is approximated in the first order by the Hessian that is quadratic in the bead positions. The eigenmodes of the Hessian provide the longitudinal (stretching) and transverse (bending) eigenmodes of the polymer, and the corresponding eigenvalues match well with the established phenomenology of semiflexible polymers. At the Hessian approximation of the Hamiltonian, the polymer dynamics is linear. Using the longitudinal and transverse eigenmodes, for the linearized problem, we obtain analytical expressions of (i) the autocorrelation function of the end-to-end vector, (ii) the autocorrelation function of a bond (i.e. a spring, or a tangent) vector at the middle of the chain, and (iii) the mean-square displacement of a tagged bead in the middle of the chain, as the sum over the contributions from the modes—the so-called ‘mode sums’. We also perform simulations with the full dynamics of the model. The simulations yield numerical values of the correlations functions (i-iii) that agree very well with the analytical expressions for the linearized dynamics. This does not however mean that the nonlinearities are not present. In fact, we also study the mean-square displacement of the longitudinal component of the end-to-end vector that showcases strong nonlinear effects in the polymer dynamics, and we identify at least an effective t7/8 power-law regime in its time-dependence. Nevertheless, in comparison to the full mean-square displacement of the end-to-end vector the nonlinear effects remain small at all times—it is in this sense we state that our results demonstrate that the linearized dynamics suffices for dsDNA fragments that are shorter than or comparable to the persistence length. Our results are consistent with those of the wormlike chain (WLC) model, the commonly used descriptive tool of semiflexible polymers.
-
Ramsey, Janine M.; Gutiérrez-Cabrera, Ana E.; Salgado-Ramírez, Liliana; Peterson, A. Townsend; Sánchez-Cordero, Victor; Ibarra-Cerdeña, Carlos N.
2012-01-01
Traditional methods for Chagas disease prevention are targeted at domestic vector reduction, as well as control of transfusion and maternal-fetal transmission. Population connectivity of Trypanosoma cruzi-infected vectors and hosts, among sylvatic, ecotone and domestic habitats could jeopardize targeted efforts to reduce human exposure. This connectivity was evaluated in a Mexican community with reports of high vector infestation, human infection, and Chagas disease, surrounded by agricultural and natural areas. We surveyed bats, rodents, and triatomines in dry and rainy seasons in three adjacent habitats (domestic, ecotone, sylvatic), and measured T. cruzi prevalence, and host feeding sources of triatomines. Of 12 bat and 7 rodent species, no bat tested positive for T. cruzi, but all rodent species tested positive in at least one season or habitat. Highest T. cruzi infection prevalence was found in the rodents, Baiomys musculus and Neotoma mexicana. In general, parasite prevalence was not related to habitat or season, although the sylvatic habitat had higher infection prevalence than by chance, during the dry season. Wild and domestic mammals were identified as bloodmeals of T. pallidipennis, with 9% of individuals having mixed human (4.8% single human) and other mammal species in bloodmeals, especially in the dry season; these vectors tested >50% positive for T. cruzi. Overall, ecological connectivity is broad across this matrix, based on high rodent community similarity, vector and T. cruzi presence. Cost-effective T. cruzi, vector control strategies and Chagas disease transmission prevention will need to consider continuous potential for parasite movement over the entire landscape. This study provides clear evidence that these strategies will need to include reservoir/host species in at least ecotones, in addition to domestic habitats. PMID:23049923
-
Zallocchi, Marisa; Binley, Katie; Lad, Yatish; Ellis, Scott; Widdowson, Peter; Iqball, Sharifah; Scripps, Vicky; Kelleher, Michelle; Loader, Julie; Miskin, James; Peng, You-Wei; Wang, Wei-Min; Cheung, Linda; Delimont, Duane; Mitrophanous, Kyriacos A; Cosgrove, Dominic
2014-01-01
Usher syndrome type 1B is a combined deaf-blindness condition caused by mutations in the MYO7A gene. Loss of functional myosin VIIa in the retinal pigment epithelia (RPE) and/or photoreceptors leads to blindness. We evaluated the impact of subretinally delivered UshStat, a recombinant EIAV-based lentiviral vector expressing human MYO7A, on photoreceptor function in the shaker1 mouse model for Usher type 1B that lacks a functional Myo7A gene. Subretinal injections of EIAV-CMV-GFP, EIAV-RK-GFP (photoreceptor specific), EIAV-CMV-MYO7A (UshStat) or EIAV-CMV-Null (control) vectors were performed in shaker1 mice. GFP and myosin VIIa expression was evaluated histologically. Photoreceptor function in EIAV-CMV-MYO7A treated eyes was determined by evaluating α-transducin translocation in photoreceptors in response to low light intensity levels, and protection from light induced photoreceptor degeneration was measured. The safety and tolerability of subretinally delivered UshStat was evaluated in macaques. Expression of GFP and myosin VIIa was confirmed in the RPE and photoreceptors in shaker1 mice following subretinal delivery of the EIAV-CMV-GFP/MYO7A vectors. The EIAV-CMV-MYO7A vector protected the shaker1 mouse photoreceptors from acute and chronic intensity light damage, indicated by a significant reduction in photoreceptor cell loss, and restoration of the α-transducin translocation threshold in the photoreceptors. Safety studies in the macaques demonstrated that subretinal delivery of UshStat is safe and well-tolerated. Subretinal delivery of EIAV-CMV-MYO7A (UshStat) rescues photoreceptor phenotypes in the shaker1 mouse. In addition, subretinally delivered UshStat is safe and well-tolerated in macaque safety studies These data support the clinical development of UshStat to treat Usher type 1B syndrome.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, C.-J.; Hsu, C.-C.; Department of Surgery, Chi-Mei Medical Center, Taipei, Taiwan
2009-03-06
CD133-expressing glioma cells play a critical role in tumor recovery after treatment and are resistant to radiotherapy. Herein, we demonstrated that glioblastoma-derived CD133-positive cells (GBM-CD133{sup +}) are capable of self-renewal and express high levels of embryonic stem cell genes and SirT1 compared to GBM-CD133{sup -} cells. To evaluate the role of SirT1 in GBM-CD133{sup +}, we used a lentiviral vector expressing shRNA to knock-down SirT1 expression (sh-SirT1) in GBM-CD133{sup +}. Silencing of SirT1 significantly enhanced the sensitivity of GBM-CD133{sup +} to radiation and increased the level of radiation-mediated apoptosis. Importantly, knock-down of SirT1 increased the effectiveness of radiotherapy in themore » inhibition of tumor growth in nude mice transplanted with GBM-CD133{sup +}. Kaplan-Meier survival analysis indicated that the mean survival rate of GBM-CD133{sup +} mice treated with radiotherapy was significantly improved by Sh-SirT1 as well. In sum, these results suggest that SirT1 is a potential target for increasing the sensitivity of GBM and glioblastoma-associated cancer stem cells to radiotherapy.« less
-
Let-7b promotes alpaca hair growth via transcriptional repression of TGFβR I.
Yan, Shen; Yu, Zhang; Ning, Liu; Hai-Dong, Wang; Jian-Shan, Xie; Shu-Yuan, Gao; Jia-Qi, Cheng; Xiu-Ju, Yu; Ting, Wang; Chang-Sheng, Dong; Xiao-Yan, He
2016-02-10
The young male alpaca ear and the back skins were used to investigate the effect of transforming growth factor receptor-β I (TGFβR I) on alpaca hair follicles and hair growth. The expression level and location of TGFβR I in alpaca ear and dorsal skin were detected through real-time quantitative PCR (RT-PCR) and paraffin section immunohistochemical technique (ICC-P). The results shown TGFβR I was lower expression in back skin compared to ear skin and the mean density of the positive reaction in ear skin was significantly higher than back skin. The targeted relationship with let-7b was detected using the dual-luciferase reporter vector of TGFβR I, which showed a significant target relationship between let-7b and TGFβR I. After transfection with let-7b eukaryotic expression vector, the relative mRNA expression of TGFβR I in alpaca skin fibroblasts did not differ, while the relative protein level was significantly decreased. In summary, a higher TGFβR I expression level in the ear skin suggests that TGFβR I may inhibit coat hair elongation. Further studies showed TGFβR I protein was downregulated by let-7b through transcriptional repression. Copyright © 2015 Elsevier B.V. All rights reserved.
-
2013-01-01
Background Interruption of vector-borne transmission of Trypanosoma cruzi remains an unrealized objective in many Latin American countries. The task of vector control is complicated by the emergence of vector insects in urban areas. Methods Utilizing data from a large-scale vector control program in Arequipa, Peru, we explored the spatial patterns of infestation by Triatoma infestans in an urban and peri-urban landscape. Multilevel logistic regression was utilized to assess the associations between household infestation and household- and locality-level socio-environmental measures. Results Of 37,229 households inspected for infestation, 6,982 (18.8%; 95% CI: 18.4 – 19.2%) were infested by T. infestans. Eighty clusters of infestation were identified, ranging in area from 0.1 to 68.7 hectares and containing as few as one and as many as 1,139 infested households. Spatial dependence between infested households was significant at distances up to 2,000 meters. Household T. infestans infestation was associated with household- and locality-level factors, including housing density, elevation, land surface temperature, and locality type. Conclusions High levels of T. infestans infestation, characterized by spatial heterogeneity, were found across extensive urban and peri-urban areas prior to vector control. Several environmental and social factors, which may directly or indirectly influence the biology and behavior of T. infestans, were associated with infestation. Spatial clustering of infestation in the urban context may both challenge and inform surveillance and control of vector reemergence after insecticide intervention. PMID:24171704
-
Breitler, Jean-Christophe; Meynard, Donaldo; Van Boxtel, Jos; Royer, Monique; Bonnot, François; Cambillau, Laurence; Guiderdoni, Emmanuel
2004-06-01
A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the green fluorescent protein (gfp) reporter gene while the second T-DNA, delimited by Agrobacterium rhizogenes borders, bears the phosphinothricin acetyl transferase (bar) gene, featuring the gene of interest. 82-90% of the hygromycin-resistant primary transformants exhibited tolerance to ammonium glufosinate mediated by the bar gene suggesting very high co-transformation frequency in the three cultivars. All of the regenerated plants were analyzed by Southern blot which confirmed co-integration of the T-DNAs at frequencies consistent with those of co-expression and allowed determination of copy number for each gene as well as detection of two different vector backbone fragments extending between the two T-DNAs. Hygromycin susceptible, ammonium glufosinate tolerant phenotypes represented 14.4, 17.4 and 14.3% of the plants in T1 progenies of ZZ321, Ariete and KDML105 primary transformants, respectively. We developed a statistical model for deducing from the observed copy number of each T-DNA in T0 plants and phenotypic segregations in T1 progenies the most likely constitution and linkage of the T-DNA integration locus. Statistical analysis identified in 40 out of 42 lines a most likely linkage configuration theoretically allowing genetic separation of the two T-DNA types and out segregation of the T-DNA bearing the bar gene. Overall, though improvements of the technology would be beneficial, the 2 T-DNA system appeared to be a useful approach to generate selectable marker-free rice plants with a consistent frequency among cultivars.
-
Zhang, Qiaojuan; Hsia, Shao-Chung
2017-01-01
Infection of sensory neurons by herpes simplex virus (HSV)-1 disrupts electrical excitability, altering pain sensory transmission. Because of their low threshold for activation, functional expression of T-type Ca2+ channels regulates various cell functions, including neuronal excitability and neuronal communication. In this study, we have tested the effect of HSV-1 infection on the functional expression of T-type Ca2+ channels in differentiated ND7-23 sensory-like neurons. Voltage-gated Ca2+ currents were measured using whole cell patch clamp recordings in differentiated ND7-23 neurons under various culture conditions. Differentiation of ND7-23 cells evokes a significant increase in T-type Ca2+ current densities. Increased T-type Ca2+ channel expression promotes the morphological differentiation of ND7-23 cells and triggers a rebound depolarization. HSV-1 infection of differentiated ND7-23 cells causes a significant loss of T-type Ca2+ channels from the membrane. HSV-1 evoked reduction in the functional expression of T-type Ca2+ channels is mediated by several factors, including decreased expression of Cav3.2 T-type Ca2+ channel subunits and disruption of endocytic transport. Decreased functional expression of T-type Ca2+ channels by HSV-1 infection requires protein synthesis and viral replication, but occurs independently of Egr-1 expression. These findings suggest that infection of neuron-like cells by HSV-1 causes a significant disruption in the expression of T-type Ca2+ channels, which can results in morphological and functional changes in electrical excitability. PMID:28639215
-
Leary, T P; Gao, Y; Splitter, G A
1992-07-01
The desire to obtain authentically glycosylated viral protein products in sufficient quantity for immunological study has led to the use of eucaryotic expression vectors for protein production. An additional advantage is that these protein products can be studied individually in the absence of their native viral environment. We have cloned a complementary DNA (cDNA) encoding bovine herpes virus-1 (BHV-1) glycoprotein 1 (gpI) into the eucaryotic expression vector, pZipNeo SVX1. Since this protein is normally embedded within the membrane of BHV-1 infected cells, we removed sequences encoding the transmembrane domain of the native protein. After transfection of the plasmid construct into the canine osteosarcoma cell line, D17, or Madin-Darby bovine kidney (MDBK) cells, a truncated BHV-1 (gpI) was secreted into the culture medium as demonstrated by radioimmunoprecipitation and SDS-PAGE. Both a CD4+ T-lymphocyte line specific for BHV-1 and freshly isolated T lymphocytes could recognize and respond to the secreted recombinant gpI. Further, recombinant gpI could elicit both antibody and cellular responses in cattle when used as an immunogen. Having established constitutively glycoprotein producing cell lines, future studies in vaccine evaluation of gpI will be facilitated.
-
Trypanosoma cruzi and Chagas' Disease in the United States
Bern, Caryn; Kjos, Sonia; Yabsley, Michael J.; Montgomery, Susan P.
2011-01-01
Summary: Chagas' disease is caused by the protozoan parasite Trypanosoma cruzi and causes potentially life-threatening disease of the heart and gastrointestinal tract. The southern half of the United States contains enzootic cycles of T. cruzi, involving 11 recognized triatomine vector species. The greatest vector diversity and density occur in the western United States, where woodrats are the most common reservoir; other rodents, raccoons, skunks, and coyotes are also infected with T. cruzi. In the eastern United States, the prevalence of T. cruzi is highest in raccoons, opossums, armadillos, and skunks. A total of 7 autochthonous vector-borne human infections have been reported in Texas, California, Tennessee, and Louisiana; many others are thought to go unrecognized. Nevertheless, most T. cruzi-infected individuals in the United States are immigrants from areas of endemicity in Latin America. Seven transfusion-associated and 6 organ donor-derived T. cruzi infections have been documented in the United States and Canada. As improved control of vector- and blood-borne T. cruzi transmission decreases the burden in countries where the disease is historically endemic and imported Chagas' disease is increasingly recognized outside Latin America, the United States can play an important role in addressing the altered epidemiology of Chagas' disease in the 21st century. PMID:21976603
-
JC Virus Mediates Invasion and Migration in Colorectal Metastasis
Link, Alexander; Shin, Sung Kwan; Nagasaka, Takeshi; Balaguer, Francesc; Koi, Minoru; Jung, Barbara; Boland, C. Richard; Goel, Ajay
2009-01-01
Introduction JC Virus (JCV), a human polyomavirus, is frequently present in colorectal cancers (CRCs). JCV large T-Ag (T-Ag) expressed in approximately half of all CRC's, however, its functional role in CRC is poorly understood. We hypothesized that JCV T-Ag may mediate metastasis in CRC cells through increased migration and invasion. Material and Methods CRC cell lines (HCT116 and SW837) were stably transfected with JCV early transcript sequences cloned into pCR3 or empty vectors. Migration and invasion assays were performed using Boyden chambers. Global gene expression analysis was performed to identify genetic targets and pathways altered by T-Ag expression. Microarray results were validated by qRT-PCR, protein expression analyses and immunohistochemistry. Matching primary CRCs and liver metastases from 33 patients were analyzed for T-Ag expression by immunohistochemistry. Results T-Ag expressing cell lines showed 2 to 3-fold increase in migration and invasion compared to controls. JCV T-Ag expression resulted in differential expression of several genetic targets, including genes that mediate cell migration and invasion. Pathway analysis suggested a significant involvement of these genes with AKT and MAPK signaling. Treatment with selective PI3K/AKT and MAPK pathway inhibitors resulted in reduced migration and invasion. In support of our in-vitro results, immunohistochemical staining of the advanced stage tumors revealed frequent JCV T-Ag expression in metastatic primary tumors (92%) as well as in their matching liver metastasis (73%). Conclusion These data suggest that JCV T-Ag expression in CRC associates with a metastatic phenotype, which may partly be mediated through the AKT/MAPK signaling pathway. Frequent expression of JCV T-Ag in CRC liver metastasis provides further clues supporting a mechanistic role for JCV as a possible mediator of cellular motility and invasion in CRC. PMID:19997600
-
Angius, Federica; Ilioaia, Oana; Amrani, Amira; Suisse, Annabelle; Rosset, Lindsay; Legrand, Amélie; Abou-Hamdan, Abbas; Uzan, Marc; Zito, Francesca; Miroux, Bruno
2018-06-05
Membrane protein (MP) overproduction is one of the major bottlenecks in structural genomics and biotechnology. Despite the emergence of eukaryotic expression systems, bacteria remain a cost effective and powerful tool for protein production. The T7 RNA polymerase (T7RNAP)-based expression system is a successful and efficient expression system, which achieves high-level production of proteins. However some foreign MPs require a fine-tuning of their expression to minimize the toxicity associated with their production. Here we report a novel regulation mechanism for the T7 expression system. We have isolated two bacterial hosts, namely C44(DE3) and C45(DE3), harboring a stop codon in the T7RNAP gene, whose translation is under the control of the basal nonsense suppressive activity of the BL21(DE3) host. Evaluation of hosts with superfolder green fluorescent protein (sfGFP) revealed an unprecedented tighter control of transgene expression with a marked accumulation of the recombinant protein during stationary phase. Analysis of a collection of twenty MP fused to GFP showed an improved production yield and quality of several bacterial MPs and of one human monotopic MP. These mutant hosts are complementary to the other existing T7 hosts and will increase the versatility of the T7 expression system.
-
Dystrophin Immunity in Duchenne’s Muscular Dystrophy
Mendell, Jerry R.; Campbell, Katherine; Rodino-Klapac, Louise; Sahenk, Zarife; Shilling, Chris; Lewis, Sarah; Bowles, Dawn; Gray, Steven; Li, Chengwen; Galloway, Gloria; Malik, Vinod; Coley, Brian; Clark, K. Reed; Li, Juan; Xiao, Xiao; Samulski, Jade; McPhee, Scott W.; Samulski, R. Jude; Walker, Christopher M.
2010-01-01
SUMMARY We report on delivery of a functional dystrophin transgene to skeletal muscle in six patients with Duchenne’s muscular dystrophy. Dystrophin-specific T cells were detected after treatment, providing evidence of transgene expression even when the functional protein was not visualized in skeletal muscle. Circulating dystrophin-specific T cells were unexpectedly detected in two patients before vector treatment. Revertant dystrophin fibers, which expressed functional, truncated dystrophin from the deleted endogenous gene after spontaneous in-frame splicing, contained epitopes targeted by the autoreactive T cells. The potential for T-cell immunity to self and nonself dystrophin epitopes should be considered in designing and monitoring experimental therapies for this disease. (Funded by the Muscular Dystrophy Association and others; ClinicalTrials.gov number, NCT00428935.) PMID:20925545
-
Vitelli, Alessandra; Quirion, Mary R; Lo, Chia-Yun; Misplon, Julia A; Grabowska, Agnieszka K; Pierantoni, Angiolo; Ammendola, Virginia; Price, Graeme E; Soboleski, Mark R; Cortese, Riccardo; Colloca, Stefano; Nicosia, Alfredo; Epstein, Suzanne L
2013-01-01
Among approximately 1000 adenoviruses from chimpanzees and bonobos studied recently, the Pan Adenovirus type 3 (PanAd3, isolated from a bonobo, Pan paniscus) has one of the best profiles for a vaccine vector, combining potent transgene immunogenicity with minimal pre-existing immunity in the human population. In this study, we inserted into a replication defective PanAd3 a transgene expressing a fusion protein of conserved influenza antigens nucleoprotein (NP) and matrix 1 (M1). We then studied antibody and T cell responses as well as protection from challenge infection in a mouse model. A single intranasal administration of PanAd3-NPM1 vaccine induced strong antibody and T cell responses, and protected against high dose lethal influenza virus challenge. Thus PanAd3 is a promising candidate vector for vaccines, including universal influenza vaccines.
-
Magini, Diletta; Giovani, Cinzia; Mangiavacchi, Simona; Maccari, Silvia; Cecchi, Raffaella; Ulmer, Jeffrey B.; De Gregorio, Ennio; Geall, Andrew J.; Brazzoli, Michela; Bertholet, Sylvie
2016-01-01
Current hemagglutinin (HA)-based seasonal influenza vaccines induce vaccine strain-specific neutralizing antibodies that usually fail to provide protection against mismatched circulating viruses. Inclusion in the vaccine of highly conserved internal proteins such as the nucleoprotein (NP) and the matrix protein 1 (M1) was shown previously to increase vaccine efficacy by eliciting cross-reactive T-cells. However, appropriate delivery systems are required for efficient priming of T-cell responses. In this study, we demonstrated that administration of novel self-amplifying mRNA (SAM®) vectors expressing influenza NP (SAM(NP)), M1 (SAM(M1)), and NP and M1 (SAM(M1-NP)) delivered with lipid nanoparticles (LNP) induced robust polyfunctional CD4 T helper 1 cells, while NP-containing SAM also induced cytotoxic CD8 T cells. Robust expansions of central memory (TCM) and effector memory (TEM) CD4 and CD8 T cells were also measured. An enhanced recruitment of NP-specific cytotoxic CD8 T cells was observed in the lungs of SAM(NP)-immunized mice after influenza infection that paralleled with reduced lung viral titers and pathology, and increased survival after homologous and heterosubtypic influenza challenge. Finally, we demonstrated for the first time that the co-administration of RNA (SAM(M1-NP)) and protein (monovalent inactivated influenza vaccine (MIIV)) was feasible, induced simultaneously NP-, M1- and HA-specific T cells and HA-specific neutralizing antibodies, and enhanced MIIV efficacy against a heterologous challenge. In conclusion, systemic administration of SAM vectors expressing conserved internal influenza antigens induced protective immune responses in mice, supporting the SAM® platform as another promising strategy for the development of broad-spectrum universal influenza vaccines. PMID:27525409
-
BGL7 beta-glucosidase and nucleic acids encoding the same
Dunn-Coleman, Nigel; Ward, Michael
2013-01-29
The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.
-
BGL7 beta-glucosidase and nucleic acids encoding the same
Dunn-Coleman, Nigel; Ward, Michael
2015-04-14
The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.
-
BGL7 beta-glucosidase and nucleic acids encoding the same
Dunn-Coleman, Nigel; Ward, Michael
2014-03-25
The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.
-
Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene
NASA Technical Reports Server (NTRS)
Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.
1997-01-01
Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.
-
Schwarz, Alexandra; Helling, Stefan; Collin, Nicolas; Teixeira, Clarissa R.; Medrano-Mercado, Nora; Hume, Jen C. C.; Assumpção, Teresa C.; Marcus, Katrin; Stephan, Christian; Meyer, Helmut E.; Ribeiro, José M. C.; Billingsley, Peter F.; Valenzuela, Jesus G.; Sternberg, Jeremy M.; Schaub, Günter A.
2009-01-01
Background Triatomines are vectors of Trypanosoma cruzi, the etiological agent of Chagas disease in Latin America. The most effective vector, Triatoma infestans, has been controlled successfully in much of Latin America using insecticide spraying. Though rarely undertaken, surveillance programs are necessary in order to identify new infestations and estimate the intensity of triatomine bug infestations in domestic and peridomestic habitats. Since hosts exposed to triatomines develop immune responses to salivary antigens, these responses can be evaluated for their usefulness as epidemiological markers to detect infestations of T. infestans. Methodology/Principal Findings T. infestans salivary proteins were separated by 2D-gel electrophoresis and tested for their immunogenicity by Western blotting using sera from chickens and guinea pigs experimentally exposed to T. infestans. From five highly immunogenic protein spots, eight salivary proteins were identified by nano liquid chromatography-electrospray ionization-tandem mass spectrometry (nanoLC-ESI-MS/MS) and comparison to the protein sequences of the National Center for Biotechnology Information (NCBI) database and expressed sequence tags of a unidirectionally cloned salivary gland cDNA library from T. infestans combined with the NCBI yeast protein sub-database. The 14.6 kDa salivary protein [gi|149689094] was produced as recombinant protein (rTiSP14.6) in a mammalian cell expression system and recognized by all animal sera. The specificity of rTiSP14.6 was confirmed by the lack of reactivity to anti-mosquito and anti-sand fly saliva antibodies. However, rTiSP14.6 was recognized by sera from chickens exposed to four other triatomine species, Triatoma brasiliensis, T. sordida, Rhodnius prolixus, and Panstrongylus megistus and by sera of chickens from an endemic area of T. infestans and Chagas disease in Bolivia. Conclusions/Significance The recombinant rTiSP14.6 is a suitable and promising epidemiological marker for detecting the presence of small numbers of different species of triatomines and could be developed for use as a new tool in surveillance programs, especially to corroborate vector elimination in Chagas disease vector control campaigns. PMID:19841746
-
D'Archivio, Simon; Medina, Mathieu; Cosson, Alain; Chamond, Nathalie; Rotureau, Brice; Minoprio, Paola; Goyard, Sophie
2011-01-01
Trypanosoma vivax is one of the most common parasites responsible for animal trypanosomosis, and although this disease is widespread in Africa and Latin America, very few studies have been conducted on the parasite's biology. This is in part due to the fact that no reproducible experimental methods had been developed to maintain the different evolutive forms of this trypanosome under laboratory conditions. Appropriate protocols were developed in the 1990s for the axenic maintenance of three major animal Trypanosoma species: T. b. brucei, T. congolense and T. vivax. These pioneer studies rapidly led to the successful genetic manipulation of T. b. brucei and T. congolense. Advances were made in the understanding of these parasites' biology and virulence, and new drug targets were identified. By contrast, challenging in vitro conditions have been developed for T. vivax in the past, and this per se has contributed to defer both its genetic manipulation and subsequent gene function studies. Here we report on the optimization of non-infective T. vivax epimastigote axenic cultures and on the process of parasite in vitro differentiation into metacyclic infective forms. We have also constructed the first T. vivax specific expression vector that drives constitutive expression of the luciferase reporter gene. This vector was then used to establish and optimize epimastigote transfection. We then developed highly reproducible conditions that can be used to obtain and select stably transfected mutants that continue metacyclogenesis and are infectious in immunocompetent rodents. PMID:22216367
-
Keefer, Michael C.; Frey, Sharon E.; Elizaga, Marnie; Metch, Barbara; De Rosa, Stephen C.; Barroso, Paulo F.; Tomaras, Georgia; Cardinali, Massimo; Goepfert, Paul; Kalichman, Artur; Philippon, Valérie; McElrath, M. Juliana; Jin, Xia; Ferrari, Guido; Defawe, Olivier D.; Mazzara, Gail P.; Montefiori, David; Pensiero, Michael; Panicali, Dennis L.; Corey, Lawrence
2011-01-01
We evaluated replication-defective poxvirus vectors (modified vaccinia Ankara [MVA] and fowlpox [FPV]) in a homologous and heterologous vector prime-boost vaccination regimen containing matching HIV inserts (MVA-HIV and FPV-HIV) given at months 0, 1, 3, 5 and 7 in 150 healthy HIV-negative vaccinia-naïve participants. FPV-HIV alone was poorly immunogenic, while the high dose (109 pfu/2ml) of MVA-HIV alone elicited maximal responses after two injections: CD4+ and CD8+ T-cell responses in 26/55 (47.3%) and 5/60 (8.3%) of participants, respectively and IFN-γ ELISpot responses in 28/62 (45.2%). The infrequent CD8+ T-cell responses following MVA-HIV priming were boosted only by the heterologous (FPV-HIV) construct in 14/27 [51.9%] of participants post-4th vaccination. Alternatively, HIV envelope-specific binding antibodies were demonstrated in approximately two-thirds of recipients of the homologous boosting regimen, but in less than 20% of subjects after the heterologous vector boost. Thus, a heterologous poxvirus vector prime-boost regimen can induce an HIV-specific CD8+ T-cell and CD4+ T-cell responses, which may be an important feature of an optimal regimen for preventive HIV vaccination. PMID:21216311
-
Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.
Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi
2018-01-26
Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.
-
Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-12-20
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-09-30
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
-
NASA Astrophysics Data System (ADS)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Ambrogi, F.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Grossmann, J.; Hrubec, J.; Jeitler, M.; König, A.; Krammer, N.; Krätschmer, I.; Liko, D.; Madlener, T.; Mikulec, I.; Pree, E.; Rabady, D.; Rad, N.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Spanring, M.; Spitzbart, D.; Waltenberger, W.; Wittmann, J.; Wulz, C.-E.; Zarucki, M.; Chekhovsky, V.; Mossolov, V.; Suarez Gonzalez, J.; De Wolf, E. A.; Di Croce, D.; Janssen, X.; Lauwers, J.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; De Bruyn, I.; De Clercq, J.; Deroover, K.; Flouris, G.; Lontkovskyi, D.; Lowette, S.; Moortgat, S.; Moreels, L.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Roskas, C.; Salva, S.; Tytgat, M.; Verbeke, W.; Zaganidis, N.; Bakhshiansohi, H.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Melo De Almeida, M.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Torres Da Silva De Araujo, F.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Misheva, M.; Rodozov, M.; Shopova, M.; Stoykova, S.; Sultanov, G.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Gao, X.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Jiang, C. H.; Leggat, D.; Liao, H.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Yazgan, E.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Courbon, B.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Starodumov, A.; Susa, T.; Ather, M. W.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; Assran, Y.; Elgammal, S.; Mahrous, A.; Dewanjee, R. K.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Faure, J. L.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Negro, G.; Rander, J.; Rosowsky, A.; Sahin, M. Ö.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Charlot, C.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Lobanov, A.; Martin Blanco, J.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Stahl Leiton, A. G.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Le Bihan, A.-C.; Tonon, N.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fay, J.; Finco, L.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sordini, V.; Vander Donckt, M.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Albert, A.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Teyssier, D.; Thüer, S.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bermúdez Martínez, A.; Bin Anuar, A. A.; Borras, K.; Botta, V.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Guthoff, M.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Raspereza, A.; Roland, B.; Savitskyi, M.; Saxena, P.; Shevchenko, R.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wen, Y.; Wichmann, K.; Wissing, C.; Zenaiev, O.; Bein, S.; Blobel, V.; Centis Vignali, M.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hinzmann, A.; Hoffmann, M.; Karavdina, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Kurz, S.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sonneveld, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Kassel, F.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Karathanasis, G.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Evangelou, I.; Foudas, C.; Kokkas, P.; Mallios, S.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Triantis, F. A.; Csanad, M.; Filipovic, N.; Pasztor, G.; Bencze, G.; Hajdu, C.; Horvath, D.; Hunyadi, Á.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Dhingra, N.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Singh, J. B.; Walia, G.; Kumar, Ashok; Shah, Aashaq; Bhardwaj, A.; Chauhan, S.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhardwaj, R.; Bhattacharya, R.; Bhattacharya, S.; Bhawandeep, U.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhattacharya, S.; Chatterjee, S.; Das, P.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Errico, F.; Fiore, L.; Iaselli, G.; Lezki, S.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Chatterjee, K.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Panizzi, L.; Robutti, E.; Tosi, S.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pauwels, K.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Khan, W. A.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Montecassiano, F.; Pantano, D.; Pozzobon, N.; Ronchese, P.; Rossin, R.; Torassa, E.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Ressegotti, M.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Biasini, M.; Bilei, G. M.; Cecchi, C.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Manoni, E.; Mantovani, G.; Mariani, V.; Menichelli, M.; Rossi, A.; Santocchia, A.; Spiga, D.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Borrello, L.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Fedi, G.; Giannini, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Manca, E.; Mandorli, G.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Daci, N.; Del Re, D.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, J.; Lee, S.; Lee, S. W.; Moon, C. S.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Moon, D. H.; Oh, G.; Brochero Cifuentes, J. A.; Goh, J.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Kim, J. S.; Lee, H.; Lee, K.; Nam, K.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Choi, Y.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Reyes-Almanza, R.; Ramirez-Sanchez, G.; Duran-Osuna, M. C.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Rabadan-Trejo, R. I.; Lopez-Fernandez, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Pyskir, A.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Calpas, B.; Di Francesco, A.; Faccioli, P.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Stepennov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chistov, R.; Danilov, M.; Parygin, P.; Philippov, D.; Polikarpov, S.; Tarkovskii, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Perfilov, M.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Cerrada, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Álvarez Fernández, A.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Erice, C.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vischia, P.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Chazin Quero, B.; Curras, E.; Duarte Campderros, J.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Martinez Ruiz del Arbol, P.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Baillon, P.; Ball, A. H.; Barney, D.; Bianco, M.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chapon, E.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fallavollita, F.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Glege, F.; Gulhan, D.; Gundacker, S.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Karacheban, O.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Selvaggi, M.; Sharma, A.; Silva, P.; Sphicas, P.; Stakia, A.; Steggemann, J.; Stoye, M.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Verweij, M.; Wardle, N.; Zeuner, W. D.; Bertl, W.; Caminada, L.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bachmair, F.; Bäni, L.; Berger, P.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Klijnsma, T.; Lustermann, W.; Mangano, B.; Marionneau, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Reichmann, M.; Schönenberger, M.; Shchutska, L.; Tavolaro, V. R.; Theofilatos, K.; Vesterbacka Olsson, M. L.; Wallny, R.; Zhu, D. H.; Aarrestad, T. K.; Amsler, C.; Canelli, M. F.; De Cosa, A.; Del Burgo, R.; Donato, S.; Galloni, C.; Hreus, T.; Kilminster, B.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Takahashi, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Paganis, E.; Psallidas, A.; Steen, A.; Tsai, J. f.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Adiguzel, A.; Boran, F.; Cerci, S.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kayis Topaksu, A.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Sunar Cerci, D.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Karapinar, G.; Ocalan, K.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Tekten, S.; Yetkin, E. A.; Agaras, M. N.; Atay, S.; Cakir, A.; Cankocak, K.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Davignon, O.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; O'Brien, D.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Auzinger, G.; Bainbridge, R.; Breeze, S.; Buchmuller, O.; Bundock, A.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Elwood, A.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Matsushita, T.; Nash, J.; Nikitenko, A.; Palladino, V.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Shtipliyski, A.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Winterbottom, D.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Smith, C.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Pazzini, J.; Piperov, S.; Sagir, S.; Syarif, R.; Yu, D.; Band, R.; Brainerd, C.; Burns, D.; Calderon De La Barca Sanchez, M.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Squires, M.; Stolp, D.; Tos, K.; Tripathi, M.; Wang, Z.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wang, L.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Hashemi, B.; Holzner, A.; Klein, D.; Kole, G.; Krutelyov, V.; Letts, J.; Macneill, I.; Masciovecchio, M.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Lawhorn, J. M.; Newman, H. B.; Nguyen, T.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhang, Z.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Mudholkar, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Apyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Canepa, A.; Cerati, G. B.; Cheung, H. W. K.; Chlebana, F.; Cremonesi, M.; Duarte, J.; Elvira, V. D.; Freeman, J.; Gecse, Z.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Schneider, B.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Joshi, Y. R.; Linn, S.; Markowitz, P.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Martinez, G.; Perry, T.; Prosper, H.; Saha, A.; Santra, A.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Cavanaugh, R.; Chen, X.; Evdokimov, O.; Gerber, C. E.; Hangal, D. A.; Hofman, D. J.; Jung, K.; Kamin, J.; Sandoval Gonzalez, I. D.; Tonjes, M. B.; Trauger, H.; Varelas, N.; Wang, H.; Wu, Z.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Royon, C.; Sanders, S.; Schmitz, E.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Loukas, N.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Benaglia, A.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Higginbotham, S.; Lange, D.; Luo, J.; Marlow, D.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Malik, S.; Norberg, S.; Barker, A.; Barnes, V. E.; Das, S.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Peng, C. C.; Schulte, J. F.; Sun, J.; Wang, F.; Xie, W.; Cheng, T.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Ciesielski, R.; Goulianos, K.; Mesropian, C.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Montalvo, R.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Castaneda Hernandez, A.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Damgov, J.; De Guio, F.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Harr, R.; Karchin, P. E.; Sturdy, J.; Zaleski, S.; Brodski, M.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Hussain, U.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration
2018-06-01
A search is presented for single production of a vector-like quark (T) decaying to a Z boson and a top quark, with the Z boson decaying leptonically and the top quark decaying hadronically. The search uses data collected by the CMS experiment in proton-proton collisions at a center-of-mass energy of 13 TeV in 2016, corresponding to an integrated luminosity of 35.9fb-1. The presence of forward jets is a particular characteristic of single production of vector-like quarks that is used in the analysis. For the first time, different T quark width hypotheses are studied, from negligibly small to 30% of the new particle mass. At the 95% confidence level, the product of cross section and branching fraction is excluded above values in the range 0.26-0.04 pb for T quark masses in the range 0.7-1.7 TeV, assuming a negligible width. A similar sensitivity is observed for widths of up to 30% of the T quark mass. The production of a heavy Z‧ boson decaying to Tt, with T → tZ, is also searched for, and limits on the product of cross section and branching fractions for this process are set between 0.13 and 0.06 pb for Z‧ boson masses in the range from 1.5 to 2.5 TeV.
-
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi
2010-06-20
Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZ{alpha}-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cellsmore » as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.« less
-
Cell Type-Specific Regulation of Immunological Synapse Dynamics by B7 Ligand Recognition
Brzostek, Joanna; Gascoigne, Nicholas R. J.; Rybakin, Vasily
2016-01-01
B7 proteins CD80 (B7-1) and CD86 (B7-2) are expressed on most antigen-presenting cells and provide critical co-stimulatory or inhibitory input to T cells via their T-cell-expressed receptors: CD28 and CTLA-4. CD28 is expressed on effector T cells and regulatory T cells (Tregs), and CD28-dependent signals are required for optimum activation of effector T cell functions. CD28 ligation on effector T cells leads to formation of distinct molecular patterns and induction of cytoskeletal rearrangements at the immunological synapse (IS). CD28 plays a critical role in recruitment of protein kinase C (PKC)-θ to the effector T cell IS. CTLA-4 is constitutively expressed on the surface of Tregs, but it is expressed on effector T cells only after activation. As CTLA-4 binds to B7 proteins with significantly higher affinity than CD28, B7 ligand recognition by cells expressing both receptors leads to displacement of CD28 and PKC-θ from the IS. In Tregs, B7 ligand recognition leads to recruitment of CTLA-4 and PKC-η to the IS. CTLA-4 plays a role in regulation of T effector and Treg IS stability and cell motility. Due to their important roles in regulating T-cell-mediated responses, B7 receptors are emerging as important drug targets in oncology. In this review, we present an integrated summary of current knowledge about the role of B7 family receptor–ligand interactions in the regulation of spatial and temporal IS dynamics in effector and Tregs. PMID:26870040
-
Silk-Elastinlike Copolymers for Breast Cancer Gene Therapy
2005-05-01
linearized expression vector were mixed hydrolysis of the sample in 6 N HCI at 110 ’C for 20 h. at a high monomer-to-vector molar ratio in the presence of...measurements were taken for each sample GAGTA(GA(GTGC(GGTGTA(GAGTTCCTGCGATrT’GC( for calculation of q. TAcCAC(;AGTA(;(;CGTACCGCGAGG’AGGAGTGCC(;,GGTC The...P (Pro), proline ; Q (Gln), steps are to examine the influence of polymer molecular glutamine; Q, weight equilibrium swelling ratios of hydrogels
-
Overcoming codon-usage bias in heterologous protein expression in Streptococcus gordonii.
Lee, Song F; Li, Yi-Jing; Halperin, Scott A
2009-11-01
One of the limitations facing the development of Streptococcus gordonii into a successful vaccine vector is the inability of this bacterium to express high levels of heterologous proteins. In the present study, we have identified 12 codons deemed as rare codons in S. gordonii and seven other streptococcal species. tRNA genes encoding 10 of the 12 rare codons were cloned into a plasmid. The plasmid was transformed into strains of S. gordonii expressing the fusion protein SpaP/S1, the anti-complement receptor 1 (CR1) single-chain variable fragment (scFv) antibody, or the Toxoplasma gondii cyclophilin C18 protein. These three heterologous proteins contained high percentages of amino acids encoded by rare codons. The results showed that the production of SpaP/S1, anti-CR1 scFv and C18 increased by 2.7-, 120- and 10-fold, respectively, over the control strains. In contrast, the production of the streptococcal SpaP protein without the pertussis toxin S1 fragment was not affected by tRNA gene supplementation, indicating that the increased production of SpaP/S1 protein was due to the ability to overcome the limitation caused by rare codons required for the S1 fragment. The increase in anti-CR1 scFv production was also observed in Streptococcus mutans following tRNA gene supplementation. Collectively, the findings in the present study demonstrate for the first time, to the best of our knowledge, that codon-usage bias exists in Streptococcus spp. and the limitation of heterologous protein expression caused by codon-usage bias can be overcome by tRNA supplementation.
-
Target-specific copper hybrid T7 phage particles.
Dasa, Siva Sai Krishna; Jin, Qiaoling; Chen, Chin-Tu; Chen, Liaohai
2012-12-18
Target-specific nanoparticles have attracted significant attention recently, and have greatly impacted life and physical sciences as new agents for imaging, diagnosis, and therapy, as well as building blocks for the assembly of novel complex materials. While most of these particles are synthesized by chemical conjugation of an affinity reagent to polymer or inorganic nanoparticles, we are promoting the use of phage particles as a carrier to host organic or inorganic functional components, as well as to display the affinity reagent on the phage surface, taking advantage of the fact that some phages host well-established vectors for protein expression. An affinity reagent can be structured in a desired geometry on the surface of phage particles, and more importantly, the number of the affinity reagent molecules per phage particle can be precisely controlled. We previously have reported the use of the T7 phage capsid as a template for synthesizing target-specific metal nanoparticles. In this study herein, we reported the synthesis of nanoparticles using an intact T7 phage as a scaffold from which to extend 415 copies of a peptide that contains a hexahistidine (6His) motif for capture of copper ions and staging the conversion of copper ions to copper metal, and a cyclic Arginine-Glycine-Aspartic Acid (RGD4C) motif for targeting integrin and cancer cells. We demonstrated that the recombinant phage could load copper ions under low bulk copper concentrations without interfering with its target specificity. Further reduction of copper ions to copper metal rendered a very stable copper hybrid T7 phage, which prevents the detachment of copper from phage particles and maintains the phage structural integrity even under harsh conditions. Cancer cells (MCF-7) can selectively uptake copper hybrid T7 phage particles through ligand-mediated transmembrane transportation, whereas normal control cells (MCF-12F) uptake 1000-fold less. We further demonstrated that copper hybrid T7 phage could be endocytosed by cancer cells in culture.
-
Wang, Kai; Huang, Qi; Yang, Zhiwei; Qi, Kezong; Liu, Hongmei; Chen, Hongjun
2017-08-01
We generated an alternative reverse genetics (RG) system based on a synthesized swine 45S rRNA promoter to rescue the H3N2 subtype swine influenza virus. All eight flanking segment cassettes of A/swine/Henan/7/2010 (H3N2) were amplified with ambisense expression elements from RG plasmids. All segments were then recombined with the pHC2014 vector, which contained the synthesized swine 45S rRNA promoter (spol1) and its terminal sequence (t1) in a pcDNA3 backbone. As a result, we obtained a set of RG plasmids carrying the corresponding eight-segment cassettes. We efficiently generated the H3N2 virus after transfection into 293T/PK15, PK15, and 293T cells. The efficiency of spol1-driven influenza virus rescue in PK15 cells was similar to that in 293T cells by titration using the human pol1 RG system. Our approach suggests that an alternative spol1-based RG system can produce influenza viruses.
-
Krasnykh, Victor; Belousova, Natalya; Korokhov, Nikolay; Mikheeva, Galina; Curiel, David T.
2001-01-01
The utility of adenovirus (Ad) vectors for gene therapy is restricted by their inability to selectively transduce disease-affected tissues. This limitation may be overcome by the derivation of vectors capable of interacting with receptors specifically expressed in the target tissue. Previous attempts to alter Ad tropism by genetic modification of the Ad fiber have had limited success due to structural conflicts between the fiber and the targeting ligand. Here we present a strategy to derive an Ad vector with enhanced targeting potential by a radical replacement of the fiber protein in the Ad capsid with a chimeric molecule containing a heterologous trimerization motif and a receptor-binding ligand. Our approach, which capitalized upon the overall structural similarity between the human Ad type 5 (Ad5) fiber and bacteriophage T4 fibritin proteins, has resulted in the generation of a genetically modified Ad5 incorporating chimeric fiber-fibritin proteins targeted to artificial receptor molecules. Gene transfer studies employing this novel viral vector have demonstrated its capacity to efficiently deliver a transgene payload to the target cells in a receptor-specific manner. PMID:11287567
-
Kim, Jung-Sik; Cho, Bon-A; Sim, Ji Hyun; Shah, Kamini; Woo, Connie M; Lee, Eun Bong; Lee, Dong-Sup; Kang, Jae Seung; Lee, Wang Jae; Park, Chung-Gyu; Craft, Joe; Kang, Insoo; Kim, Hang-Rae
2012-09-01
Human effector memory (EM) CD8(+) T cells include IL-7Rα(high) and IL-7Rα(low) cells with distinct cellular characteristics, including the expression of cytotoxic molecules. Both NK cells and the NK cell-associated molecule 2B4 that is expressed on CD8(+) T cells promote cytotoxicity. Here we analysed the expression of 2B4 on IL-7Rα(high) and IL-7Rα(low) EM CD8(+) T cells and its contribution to cytotoxicity. We also analysed the frequency of IL-7Rα(high) and IL-7Rα(low) EM CD8(+) T cells in patients with SLE or lupus and in healthy individuals given the potential role of cytotoxic CD8(+) T cells in the pathogenesis of lupus. We used flow cytometry to measure the expression of 2B4 on IL-7Rα(high) and IL-7Rα(low) EM CD8(+) T cells as well as the frequency of these cell populations in the peripheral blood of healthy individuals and patients with SLE. Also, 2B4-mediated cytotoxicity was quantitated in IL-7Rα(high) and IL-7Rα(low) EM CD8(+) T cells using target cells with CD48 antigen. We found that IL-7Rα(high) EM CD8(+) T cells had higher levels of 2B4 expression compared with IL-7Rα(low) EM CD8(+) T cells. Triggering 2B4 enhanced the cytotoxic function of IL-7Rα(low) EM CD8(+) T cells against target cells. We also noticed that patients with SLE had an increased frequency of IL-7Rα(low) EM CD8(+) T cells that correlated with disease manifestation. Our findings show that SLE patients have increased IL-7Rα(low) EM CD8(+) T cells, possibly contributing to tissue damage through 2B4-mediated cytotoxicity.
-
Foamy virus–mediated gene transfer to canine repopulating cells
Kiem, Hans-Peter; Allen, James; Trobridge, Grant; Olson, Erik; Keyser, Kirsten; Peterson, Laura; Russell, David W.
2007-01-01
Foamy virus (FV) vectors are particularly attractive gene-transfer vectors for stem-cell gene therapy because they form a stable transduction intermediate in quiescent cells and can efficiently transduce hematopoietic stem cells. Here, we studied the use of FV vectors to transduce long-term hematopoietic repopulating cells in the dog, a clinically relevant large animal model. Mobilized canine peripheral blood (PB) CD34+ cells were transduced with an enhanced green fluorescent protein (EGFP)–expressing FV vector in an 18-hour transduction protocol. All 3 dogs studied had rapid neutrophil engraftment to greater than 500/μL with a median of 10 days. Transgene expression was detected in all cell lineages (B cells, T cells, granulocytes, red blood cells, and platelets), indicating multilineage engraftment of transduced cells. Up to 19% of blood cells were EGFP+, and this was confirmed at the DNA level by real-time polymerase chain reaction (PCR) and Southern blot analysis. These transduction rates were higher than the best results we obtained previously with lentiviral vectors in a similar transduction protocol. Integration site analysis also demonstrated polyclonal repopulation and the transduction of multipotential hematopoietic repopulating cells. These data suggest that FV vectors should be useful for stem-cell gene therapy, particularly for applications in which short transduction protocols are critical. PMID:16968897
-
Montenegro, Diego; Cunha, Ana Paula da; Ladeia-Andrade, Simone; Vera, Mauricio; Pedroso, Marcel; Junqueira, Angela
2017-10-01
Chagas disease (CD), caused by the protozoan Trypanosoma cruzi, is a neglected human disease. It is endemic to the Americas and is estimated to have an economic impact, including lost productivity and disability, of 7 billion dollars per year on average. To assess vulnerability to vector-borne transmission of T. cruzi in domiciliary environments within an area undergoing domiciliary vector interruption of T. cruzi in Colombia. Multi-criteria decision analysis [preference ranking method for enrichment evaluation (PROMETHEE) and geometrical analysis for interactive assistance (GAIA) methods] and spatial statistics were performed on data from a socio-environmental questionnaire and an entomological survey. In the construction of multi-criteria descriptors, decision-making processes and indicators of five determinants of the CD vector pathway were summarily defined, including: (1) house indicator (HI); (2) triatominae indicator (TI); (3) host/reservoir indicator (Ho/RoI); (4) ecotope indicator (EI); and (5) socio-cultural indicator (S-CI). Determination of vulnerability to CD is mostly influenced by TI, with 44.96% of the total weight in the model, while the lowest contribution was from S-CI, with 7.15%. The five indicators comprise 17 indices, and include 78 of the original 104 priority criteria and variables. The PROMETHEE and GAIA methods proved very efficient for prioritisation and quantitative categorisation of socio-environmental determinants and for better determining which criteria should be considered for interrupting the man-T. cruzi-vector relationship in endemic areas of the Americas. Through the analysis of spatial autocorrelation it is clear that there is a spatial dependence in establishing categories of vulnerability, therefore, the effect of neighbors' setting (border areas) on local values should be incorporated into disease management for establishing programs of surveillance and control of CD via vector. The study model proposed here is flexible and can be adapted to various eco-epidemiological profiles and is suitable for focusing anti-T. cruzi serological surveillance programs in vulnerable human populations.
-
Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu
2009-04-01
This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.
-
Mukhopadhya, Indrani; Murray, Graeme I; Duncan, Linda; Yuecel, Raif; Shattock, Robin; Kelly, Charles; Iannelli, Francesco; Pozzi, Gianni; El-Omar, Emad M; Hold, Georgina L; Hijazi, Karolin
2016-09-06
CD4+ T lymphocytes in the colorectal mucosa are key in HIV-1 transmission and dissemination. As such they are also the primary target for antiretroviral (ARV)-based rectal microbicides for pre-exposure prophylaxis. Drug transporters expressed in mucosal CD4+ T cells determine ARV distribution across the cell membrane and, most likely, efficacy of microbicides. We describe transporters for antiretroviral drugs in colorectal mucosal CD4+ T lymphocytes and compare gene expression with circulating α4β7+CD4+ T cells, which traffic to the intestine and have been shown to be preferentially infected by HIV-1. Purified total CD4+ T cells were obtained from colorectal tissue and blood samples by magnetic separation. CD4+ T cells expressing α4β7 integrin were isolated by fluorescence-activated cell sorting from peripheral blood mononuclear cells of healthy volunteers. Expressions of 15 efflux and uptake drug transporter genes were quantified using Taqman qPCR assays. Expression of efflux transporters MRP3, MRP5, and BCRP and uptake transporter CNT2 were significantly higher in colorectal CD4+ T cells compared to circulating CD4+ T cells (p = 0.01-0.03). Conversely, circulating α4β7+CD4+ T cells demonstrated significantly higher expression of OATPD compared to colorectal CD4+ T cells (p = 0.001). To the best of our knowledge this is the first report of drug transporter gene expression in colorectal CD4+ and peripheral α4β7+CD4+ T cells. The qualitative and quantitative differences in drug transporter gene expression profiles between α4β7+CD4+ T cells and total mucosal CD4+ T cells may have significant implications for the efficacy of rectally delivered ARV-microbicides. Most notably, we have identified efflux drug transporters that could be targeted by selective inhibitors or beneficial drug-drug interactions to enhance intracellular accumulation of antiretroviral drugs.
-
Sena-Esteves, Miguel; Saeki, Yoshinaga; Camp, Sara M.; Chiocca, E. Antonio; Breakefield, Xandra O.
1999-01-01
We report here on the development and characterization of a novel herpes simplex virus type 1 (HSV-1) amplicon-based vector system which takes advantage of the host range and retention properties of HSV–Epstein-Barr virus (EBV) hybrid amplicons to efficiently convert cells to retrovirus vector producer cells after single-step transduction. The retrovirus genes gag-pol and env (GPE) and retroviral vector sequences were modified to minimize sequence overlap and cloned into an HSV-EBV hybrid amplicon. Retrovirus expression cassettes were used to generate the HSV-EBV-retrovirus hybrid vectors, HERE and HERA, which code for the ecotropic and the amphotropic envelopes, respectively. Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit. Transfection of 293T/17 cells with amplicon plasmids yielded retrovirus titers between 106 and 107 transducing units/ml, while infection of the same cells with amplicon vectors generated maximum titers 1 order of magnitude lower. Retrovirus titers were dependent on the extent of transduction by amplicon vectors for the same cell line, but different cell lines displayed varying capacities to produce retrovirus vectors even at the same transduction efficiencies. Infection of human and dog primary gliomas with this system resulted in the production of retrovirus vectors for more than 1 week and the long-term retention and increase in transgene activity over time in these cell populations. Although the efficiency of this system still has to be determined in vivo, many applications are foreseeable for this approach to gene delivery. PMID:10559361
-
Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.
2008-01-01
Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809
-
Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19
Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.
1998-01-01
A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273
-
Choice of costimulatory domains and of cytokines determines CAR T-cell activity in neuroblastoma
Quintarelli, Concetta; Orlando, Domenico; Boffa, Iolanda; Guercio, Marika; Petretto, Andrea; Lavarello, Chiara; Sinibaldi, Matilde; Weber, Gerrit; Del Bufalo, Francesca; Giorda, Ezio; Scarsella, Marco; Petrini, Stefania; Pagliara, Daria; Locatelli, Franco
2018-01-01
ABSTRACT Chimeric antigen receptor (CAR) T-cell therapy has been shown to be dramatically effective in the treatment of B-cell malignancies. However, there are still substantial obstacles to overcome, before similar responses can be achieved in patients with solid tumors. We evaluated both in vitro and in a preclinical murine model the efficacy of different 2nd and 3rd generation CAR constructs targeting GD2, a disial-ganglioside expressed on the surface of neuroblastoma (NB) tumor cells. In order to address potential safety concerns regarding clinical application, an inducible safety switch, namely inducible Caspase-9 (iC9), was also included in the vector constructs. Our data indicate that a 3rd generation CAR incorporating CD28.4-1BB costimulatory domains is associated with improved anti-tumor efficacy as compared with a CAR incorporating the combination of CD28.OX40 domains. We demonstrate that the choice of 4-1BB signaling results into significant amelioration of several CAR T-cell characteristics, including: 1) T-cell exhaustion, 2) basal T-cell activation, 3) in vivo tumor control and 4) T-cell persistence. The fine-tuning of T-cell culture conditions obtained using IL7 and IL15 was found to be synergic with the CAR.GD2 design in increasing the anti-tumor activity of CAR T cells. We also demonstrate that activation of the suicide gene iC9, included in our construct without significantly impairing neither CAR expression nor anti-tumor activity, leads to a prompt induction of apoptosis of GD2.CAR T cells. Altogether, these findings are instrumental in optimizing the function of CAR T-cell products to be employed in the treatment of children with NB. PMID:29872565
-
Expression of adhA from different organisms in Clostridium thermocellum.
Zheng, Tianyong; Cui, Jingxuan; Bae, Hye Ri; Lynd, Lee R; Olson, Daniel G
2017-01-01
Clostridium thermocellum is a cellulolytic anaerobic thermophile that is a promising candidate for consolidated bioprocessing of lignocellulosic biomass into biofuels such as ethanol. It was previously shown that expressing Thermoanaerobacterium saccharolyticum adhA in C. thermocellum increases ethanol yield.In this study, we investigated expression of adhA genes from different organisms in Clostridium thermocellum . Based on sequence identity to T. saccharolyticum adhA , we chose adhA genes from 10 other organisms: Clostridium botulinum , Methanocaldococcus bathoardescens , Thermoanaerobacterium ethanolicus , Thermoanaerobacter mathranii , Thermococcus strain AN1, Thermoanaerobacterium thermosaccharolyticum , Caldicellulosiruptor saccharolyticus , Fervidobacterium nodosum , Marinitoga piezophila , and Thermotoga petrophila . All 11 adhA genes (including T. saccharolyticum adhA ) were expressed in C. thermocellum and fermentation end products were analyzed. All 11 adhA genes increased C. thermocellum ethanol yield compared to the empty-vector control. C. botulinum and T. ethanolicus adhA genes generated significantly higher ethanol yield than T. saccharolyticum adhA . Our results indicated that expressing adhA is an effective method of increasing ethanol yield in wild-type C. thermocellum , and that this appears to be a general property of adhA genes.
-
Macías, David; Oya, Ricardo; Saniger, Luisa; Martín, Francisco; Luque, Francisco
2009-11-01
Despite the efficient HIV-1 replication blockage achieved with current highly active antiretroviral therapy (HAART) therapies, HIV-1 persists in the body and survives in a latent state that can last for the entire life of the patient. A long-lived reservoir of latently infected CD4(+) memory T cells represents the most important sanctuary for the virus and the greatest obstacle for viral eradication. In this work, we present an initial step toward a gene therapy approach aimed at the activation of latent provirus to induce the death of latently infected T cells. Latent HIV-1 infection is characterized by the failure of viral gene expression as a consequence of uninitiated or aborted transcription. We have constructed an HIV-1-based lentiviral vector (p5p53RTAT3) that expresses the viral trans-activating protein Tat in a drug-regulated manner and p53 in a Rev-dependent manner. We have demonstrated that the Tat-expressed protein from p5p53RTAT3 vector reactivates latent HIV-1 proviruses in J1.1 and ACH-2 cell lines and promotes p53-induced apoptosis in the presence of Rev. Our system was able to trigger the trans-activation of the provirus 5' long terminal repeat (LTR), stimulate the expression of the Rev protein from a tat-defective provirus, and provoke apoptosis selectively in the cells transfected with a tat-defective HIV-1 provirus in contrast to those with no HIV-1 provirus. However, the Rev-dependent p53 killing of latently infected cells was not effective enough for complete elimination of the awakened HIV-1 viruses. In summary, we have developed a vector system that is efficient in activating latent HIV-1 proviruses but that needs further improvement to kill infected cells.
-
Jonnalagadda, Mahesh; Brown, Christine E; Chang, Wen-Chung; Ostberg, Julie R; Forman, Stephen J; Jensen, Michael C
2013-01-01
Gene transfer and drug selection systems that enforce ongoing transgene expression in vitro and in vivo which are compatible with human pharmaceutical drugs are currently underdeveloped. Here, we report on the utility of incorporating human enzyme muteins that confer resistance to the lymphotoxic/immunosuppressive drugs methotrexate (MTX) and mycophenolate mofetil (MMF) in a multicistronic lentiviral vector for in vivo T lymphocyte selection. We found that co-expression of human dihydrofolate reductase (DHFR(FS); L22F, F31S) and inosine monophosphate dehydrogenase II (IMPDH2(IY); T333I, S351Y) conferred T cell resistance to the cytocidal and anti-proliferative effects of these drugs at concentrations that can be achieved clinically (up to 0.1 µM MTX and 1.0 µM MPA). Furthermore, using a immunodeficient mouse model that supports the engraftment of central memory derived human T cells, in vivo selection studies demonstrate that huEGFRt(+)DHFR(FS+)IMPDH2(IY+) T cells could be enriched following adoptive transfer either by systemic administration of MTX alone (4.4 -fold), MMF alone (2.9-fold), or combined MTX and MMF (4.9-fold). These findings demonstrate the utility of both DHFR(FS)/MTX and IMPDH2(IY)/MMF for in vivo selection of lentivirally transduced human T cells. Vectors incorporating these muteins in combination with other therapeutic transgenes may facilitate the selective engraftment of therapeutically active cells in recipients.
-
Interleukin 18 secretion and its effect in improving Chimeric Antigen Receptors efficiency
NASA Astrophysics Data System (ADS)
Kim, Jae-Kun
Clinical trials have shown that chimeric antigen receptor T cells modified to target cancer cells expressing a surface antigen found on immature B-cells. The purpose of this experiment is to take a pro-inflammatory cytokine, and analyze its effect in improving the efficiency of the T cells. IL-18 has been previously shown to recruit T cells to the tumor site and improve their secretion of cytotoxic cytokines. A human model of the proposed armored T cell has been created and has shown success in combating cancer cells in vitro. The next step is to design and produce a murine model to test in vivo in immunocompetent mice. This research project aimed to create two models: one utilizing 2A peptides and another utilizing IRES elements as a multicistronic vector. Both models would require the insertion of the desired genes into SFG backbones. IRES, a DNA element which acts as a binding site for the transcriptional machinery to recognize which part of the DNA to transcribe, commonly found in bicistronic vectors, is large with 500-600 base pairs, and has a lower transgene expression rate. P2A is smaller, only consisting of about 20 amino acids, and typically has a higher transgene expression rate, which may or may not result in higher effectiveness of the model. I would like to thank Dr. Renier Brentjens for being a mentor who cared about giving his interns as much educational value as possible.
-
Ghosh-Choudhury, N; Butcher, M; Ghosh, H P
1990-03-01
A DNA fragment of the herpes simplex virus type 1 genome encoding glycoprotein C (gC-1) has been cloned into different eukaryotic expression vectors for transient and stable expression of the glycoprotein in a number of cell lines. All of these expression vectors use a non-HSV promoter, such as the adenovirus major late promoter or murine leukemia virus long terminal repeat promoter to express gC-1 in COS and CHO cells or 3T3 cells. The gC-1 protein synthesized was fully glycosylated with both N- and O-linked oligosaccharides. Synthesis of the mature 120K gC-1 glycoprotein involved partially glycosylated 100K and 105K proteins and the non-glycosylated 70K protein as intermediate molecules. Immunofluorescence studies showed that the expressed gC-1 was localized intracellularly in the nuclear envelope as well as on the cell surface. The expressed gC-1 was biologically active and could act as a receptor for the complement component C3b in the absence of other HSV proteins.
-
Assaying the Stability and Inactivation of AAV Serotype 1 Vectors
Howard, Douglas B.; Harvey, Brandon K.
2017-01-01
Adeno-associated virus (AAV) vectors are a commonplace tool for gene delivery ranging from cell culture to human gene therapy. One feature that makes AAV a desirable vector is its stability, in regard to both the duration of transgene expression and retention of infectivity as a viral particle. This study examined the stability of AAV serotype 1 (AAV1) vectors under different conditions. First, transducibility after storage at 4°C decreased 20% over 7 weeks. Over 10 freeze–thaw cycles, the resulting transduction efficiency became variable at 60–120% of a single thaw. Using small stainless steel slugs to mimic a biosafety cabinet or metal lab bench surface, it was found that an AAV1 vector can be reconstituted after 6 days of storage at room temperature. The stability of AAV is a desired feature, but effective decontamination procedures must be available for safety and experimental integrity. Multiple disinfectants commonly used in the laboratory for ability to inactivate an AAV1 vector were tested, and it was found that autoclaving, 0.25% peracetic acid, iodine, or 10% Clorox bleach completely prevented AAV-mediated transgene expression. These data suggest that peracetic acid should be used for inactivating AAV1 vectors on metal-based surfaces or instruments in order to avoid inadvertent transgene expression in human cells or cross-contamination of instruments. PMID:28192678
-
Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping
2015-08-15
A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Highly repressible expression system for cloning genes that specify potentially toxic proteins.
O'Connor, C D; Timmis, K N
1987-01-01
A highly repressible expression vector system that allows the cloning of potentially deleterious genes has been constructed. Undesired expression of a cloned gene was prevented (i) at the level of initiation of transcription, by the presence of the strong but highly repressible leftward promoter of bacteriophage lambda, lambda pL, and (ii) at the level of transcript elongation or translation, through synthesis of antisense RNA complementary to the mRNA of the cloned gene. The system was tested by measuring the inhibition of expression of traT, the gene for the TraT major outer membrane lipoprotein. Direct detection and functional assays indicated that an essentially complete inhibition of traT expression was obtained. As a further test of the system, the gene encoding the EcoRI restriction endonuclease was cloned in the absence of the gene of the corresponding protective EcoRI modification methylase. Transformants harboring this construct were only viable when both repression controls were operational. Images PMID:2443481
-
MicroRNA Let-7b inhibits keratinocyte migration in cutaneous wound healing by targeting IGF2BP2.
Wu, Yan; Zhong, Julia Li; Hou, Ning; Sun, Yaolan; Ma, Benting; Nisar, Muhammad Farrukh; Teng, Yan; Tan, Zhaoli; Chen, Keping; Wang, Youliang; Yang, Xiao
2017-02-01
Wound healing is a complex process which involves proliferation and migration of keratinocyte for closure of epidermal injuries. A member of microRNA family, let-7b, has been expressed in mammalian skin, but its exact role in keratinocyte migration is still not in knowledge. Here, we showed that let-7b regulates keratinocyte migration by targeting the insulin-like growth factor IGF2BP2. Overexpression of let-7b led to reduced HaCaT cell migration, while knockdown of let-7b resulted in enhanced migration. Furthermore, let-7b was decreased during wound healing in wild-type mice, which led us to construct the transgenic mice with overexpression of let-7b in skin. The re-epithelialization of epidermis of let-7b transgenic mice was reduced during wound healing. Using bioinformatics prediction software and a reporter gene assay, we found that IGF2BP2 was a target of let-7b, which contributes to keratinocyte migration. Introduction of an expression vector of IGF2BP2 also rescued let-7b-induced migration deficiency, which confirms that IGF2BP2 is an important target for let-7b regulation. Our findings suggest that let-7b significantly delayed the re-epithelialization possibly due to reduction of keratinocyte migration and restraints IGF2BP2 during skin wound healing. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
-
Giuraniuc, Claudiu V.; MacPherson, Murray; Saka, Yasushi
2013-01-01
Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene’s functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology. PMID:23675537
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sirunyan, A. M.; et al.
2018-06-10
A search is presented for single production of a vector-like quark (T) decaying to a Z boson and a top quark, with the Z boson decaying leptonically and the top quark decaying hadronically. The search uses data collected by the CMS experiment in proton–proton collisions at a center-of-mass energy of 13 TeV in 2016, corresponding to an integrated luminosity of 35.9 fb -1. The presence of forward jets is a particular characteristic of single production of vector-like quarks that is used in the analysis. For the first time, different T quark width hypotheses are studied, from negligibly small to 30%more » of the new particle mass. At the 95% confidence level, the product of cross section and branching fraction is excluded above values in the range 0.26–0.04 pb for T quark masses in the range 0.7–1.7 TeV, assuming a negligible width. A similar sensitivity is observed for widths of up to 30% of the T quark mass. The production of a heavy Z' boson decaying to Tt, with T→ tZ , is also searched for, and limits on the product of cross section and branching fractions for this process are set between 0.13 and 0.06 pb for Z' boson masses in the range from 1.5 to 2.5 TeV.« less
-
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...
2018-04-23
Here, a search is presented for single production of a vector-like quark (T) decaying to a Z boson and a top quark, with the Z boson decaying leptonically and the top quark decaying hadronically. The search uses data collected by the CMS experiment in proton–proton collisions at a center-of-mass energy of 13 TeV in 2016, corresponding to an integrated luminosity of 35.9 fb -1. The presence of forward jets is a particular characteristic of single production of vector-like quarks that is used in the analysis. For the first time, different T quark width hypotheses are studied, from negligibly small tomore » 30% of the new particle mass. At the 95% confidence level, the product of cross section and branching fraction is excluded above values in the range 0.26–0.04 pb for T quark masses in the range 0.7–1.7 TeV, assuming a negligible width. A similar sensitivity is observed for widths of up to 30% of the T quark mass. The production of a heavy Z' boson decaying to Tt, with T→ tZ , is also searched for, and limits on the product of cross section and branching fractions for this process are set between 0.13 and 0.06 pb for Z' boson masses in the range from 1.5 to 2.5 TeV.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.
Here, a search is presented for single production of a vector-like quark (T) decaying to a Z boson and a top quark, with the Z boson decaying leptonically and the top quark decaying hadronically. The search uses data collected by the CMS experiment in proton–proton collisions at a center-of-mass energy of 13 TeV in 2016, corresponding to an integrated luminosity of 35.9 fb -1. The presence of forward jets is a particular characteristic of single production of vector-like quarks that is used in the analysis. For the first time, different T quark width hypotheses are studied, from negligibly small tomore » 30% of the new particle mass. At the 95% confidence level, the product of cross section and branching fraction is excluded above values in the range 0.26–0.04 pb for T quark masses in the range 0.7–1.7 TeV, assuming a negligible width. A similar sensitivity is observed for widths of up to 30% of the T quark mass. The production of a heavy Z' boson decaying to Tt, with T→ tZ , is also searched for, and limits on the product of cross section and branching fractions for this process are set between 0.13 and 0.06 pb for Z' boson masses in the range from 1.5 to 2.5 TeV.« less
-
Kader, Muhamuda; Bixler, Sandra; Roederer, Mario; Veazey, Ronald; Mattapallil, Joseph J.
2009-01-01
Background CD4 T cell depletion in the mucosa has been well documented during acute HIV and SIV infections. The demonstration the HIV/SIV can use the α4β7 receptor for viral entry suggests that these viruses selectively target CD4 T cells in the mucosa that express high levels of α4β7 receptor. Methods Mucosal samples obtained from SIV infected rhesus macaques during the early phase of infection were used for immunophenotypic analysis. CD4 T cell subsets were sorted based on the expression of β7 and CD95 to quantify the level of SIV infection in different subsets of CD4 T cells. Changes in IL-17, IL-21, IL-23 and TGFβ mRNA expression was determined using Taqman PCR. Results CD4 T cells in the mucosa were found to harbor two major population of cells; ~25% of CD4 T cells expressed the α4+β7hi phenotype, whereas the rest of the 75% expressed an α4+β7int phenotype. Both the subsets were predominantly CD28+Ki-67− HLA-DR− but CD69+, and expressed detectable levels of CCR5 on their surface. Interestingly, however, α4+β7hiCD4 T cells were found to harbor more SIV than the α4+β7int subsets at day 10 pi. Early infection was associated with a dramatic increase in the expression of IL-17, and IL-17 promoting cytokines IL-21, IL-23, and TGFβ that stayed high even after the loss of mucosal CD4 T cells. Conclusions Our results suggest that the differential expression of the α4β7 receptor contributes to the differences in the extent of infection in CD4 T cell subsets in the mucosa. Early infection associated dysregulation of the IL-17 network in mucosal tissues involves other non-Th-17 cells that likely contributes to the pro-inflammatory environment in the mucosa during acute stages of SIV infection. PMID:19863675
-
Çuburu, Nicolas; Wang, Kening; Goodman, Kyle N; Pang, Yuk Ying; Thompson, Cynthia D; Lowy, Douglas R; Cohen, Jeffrey I; Schiller, John T
2015-01-01
No herpes simplex virus 2 (HSV-2) vaccine has been licensed for use in humans. HSV-2 glycoproteins B (gB) and D (gD) are targets of neutralizing antibodies and T cells, but clinical trials involving intramuscular (i.m.) injection of HSV-2 gB and gD in adjuvants have not been effective. Here we evaluated intravaginal (ivag) genetic immunization of C57BL/6 mice with a replication-defective human papillomavirus pseudovirus (HPV PsV) expressing HSV-2 gB (HPV-gB) or gD (HPV-gD) constructs to target different subcellular compartments. HPV PsV expressing a secreted ectodomain of gB (gBsec) or gD (gDsec), but not PsV expressing a cytoplasmic or membrane-bound form, induced circulating and intravaginal-tissue-resident memory CD8(+) T cells that were able to secrete gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α) as well as moderate levels of serum HSV neutralizing antibodies. Combined immunization with HPV-gBsec and HPV-gDsec (HPV-gBsec/gDsec) vaccines conferred longer survival after vaginal challenge with HSV-2 than immunization with HPV-gBsec or HPV-gDsec alone. HPV-gBsec/gDsec ivag vaccination was associated with a reduced severity of genital lesions and lower levels of viral shedding in the genital tract after HSV-2 challenge. In contrast, intramuscular vaccination with a soluble truncated gD protein (gD2t) in alum and monophosphoryl lipid A (MPL) elicited high neutralizing antibody titers and improved survival but did not reduce genital lesions and viral shedding. Vaccination combining ivag HPV-gBsec/gDsec and i.m. gD2t-alum-MPL improved survival and reduced genital lesions and viral shedding. Finally, high levels of circulating HSV-2-specific CD8(+) T cells, but not serum antibodies, correlated with reduced viral shedding. Taken together, our data underscore the potential of HPV PsV as a platform for a topical mucosal vaccine to control local manifestations of primary HSV-2 infection. Genital herpes is a highly prevalent chronic disease caused by HSV infection. To date, there is no licensed vaccine against HSV infection. This study describes intravaginal vaccination with a nonreplicating HPV-based vector expressing HSV glycoprotein antigens. The data presented in this study underscore the potential of HPV-based vectors as a platform for the induction of genital-tissue-resident memory T cell responses and the control of local manifestations of primary HSV infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Çuburu, Nicolas; Wang, Kening; Goodman, Kyle N.; Pang, Yuk Ying; Thompson, Cynthia D.; Lowy, Douglas R.; Cohen, Jeffrey I.
2014-01-01
ABSTRACT No herpes simplex virus 2 (HSV-2) vaccine has been licensed for use in humans. HSV-2 glycoproteins B (gB) and D (gD) are targets of neutralizing antibodies and T cells, but clinical trials involving intramuscular (i.m.) injection of HSV-2 gB and gD in adjuvants have not been effective. Here we evaluated intravaginal (ivag) genetic immunization of C57BL/6 mice with a replication-defective human papillomavirus pseudovirus (HPV PsV) expressing HSV-2 gB (HPV-gB) or gD (HPV-gD) constructs to target different subcellular compartments. HPV PsV expressing a secreted ectodomain of gB (gBsec) or gD (gDsec), but not PsV expressing a cytoplasmic or membrane-bound form, induced circulating and intravaginal-tissue-resident memory CD8+ T cells that were able to secrete gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α) as well as moderate levels of serum HSV neutralizing antibodies. Combined immunization with HPV-gBsec and HPV-gDsec (HPV-gBsec/gDsec) vaccines conferred longer survival after vaginal challenge with HSV-2 than immunization with HPV-gBsec or HPV-gDsec alone. HPV-gBsec/gDsec ivag vaccination was associated with a reduced severity of genital lesions and lower levels of viral shedding in the genital tract after HSV-2 challenge. In contrast, intramuscular vaccination with a soluble truncated gD protein (gD2t) in alum and monophosphoryl lipid A (MPL) elicited high neutralizing antibody titers and improved survival but did not reduce genital lesions and viral shedding. Vaccination combining ivag HPV-gBsec/gDsec and i.m. gD2t-alum-MPL improved survival and reduced genital lesions and viral shedding. Finally, high levels of circulating HSV-2-specific CD8+ T cells, but not serum antibodies, correlated with reduced viral shedding. Taken together, our data underscore the potential of HPV PsV as a platform for a topical mucosal vaccine to control local manifestations of primary HSV-2 infection. IMPORTANCE Genital herpes is a highly prevalent chronic disease caused by HSV infection. To date, there is no licensed vaccine against HSV infection. This study describes intravaginal vaccination with a nonreplicating HPV-based vector expressing HSV glycoprotein antigens. The data presented in this study underscore the potential of HPV-based vectors as a platform for the induction of genital-tissue-resident memory T cell responses and the control of local manifestations of primary HSV infection. PMID:25320297
-
A new molecular evolution model for limited insertion independent of substitution.
Lèbre, Sophie; Michel, Christian J
2013-10-01
We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.
-
Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying
2009-04-01
This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.
-
5-Lipoxygenase contributes to PPARγ activation in macrophages in response to apoptotic cells.
von Knethen, Andreas; Sha, Lisa K; Kuchler, Laura; Heeg, Annika K; Fuhrmann, Dominik; Heide, Heinrich; Wittig, Ilka; Maier, Thorsten J; Steinhilber, Dieter; Brüne, Bernhard
2013-12-01
Macrophage polarization to an anti-inflammatory phenotype upon contact with apoptotic cells is a contributing hallmark to immune suppression during the late phase of sepsis. Although the peroxisome proliferator-activated receptor γ (PPARγ) supports this macrophage phenotype switch, it remains elusive how apoptotic cells activate PPARγ. Assuming that a molecule causing PPARγ activation in macrophages originates in the cell membrane of apoptotic cells we analyzed lipid rafts from apoptotic, necrotic, and living human Jurkat T cells which showed the presence of 5-lipoxygenase (5-LO) in lipid rafts of apoptotic cells only. Incubating macrophages with lipid rafts of apoptotic, but not necrotic or living cells, induced PPAR responsive element (PPRE)-driven mRuby reporter gene expression in RAW 264.7 macrophages stably transduced with a 4xPPRE containing vector. Experiments with lipid rafts of apoptotic murine EL4 T cells revealed similar results. To verify the involvement of 5-LO in activating PPARγ in macrophages, Jurkat T cells were incubated with the 5-LO inhibitor MK-866 prior to induction of apoptosis, which failed to induce mRuby expression. Similar results were obtained with lipid rafts of apoptotic EL4 T cells preexposed to the 5-LO inhibitors zileuton and CJ-13610. Interestingly, Jurkat T cells overexpressing 5-LO failed to activate PPARγ in macrophages, while their 5-LO overexpressing apoptotic counterparts did. Our results suggest that during apoptosis 5-LO gets associated with lipid rafts and synthesizes ligands that in turn stimulate PPARγ in macrophages. © 2013.
-
2009-10-22
ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES...MONITORING AGENCY NAME( S ) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM( S ) 11. SPONSOR/MONITOR’S REPORT NUMBER( S ) 12. DISTRIBUTION/AVAILABILITY STATEMENT...fusion protein C*-BR( S )-Y* expression vector pET/C*-CyaA1488-1680-Y*, nonfluorescent CFP expression vector pET/CFP*, and the maltose binding protein-RTX
-
Efficacy and safety of a modified vaccinia Ankara (MVA) vectored plague vaccine in mice
Brewoo, Joseph N.; Powell, Tim D.; Stinchcomb, Dan T.; Osorio, Jorge E.
2010-01-01
The efficacy and safety of plague vaccines based on the modified vaccinia Ankara (MVA) viral vector was evaluated. MVA recombinants were constructed expressing Yersinia pestis antigens under the translational control of the encephalomyocarditis virus (EMCV) internal ribosomal entry site (IRES) and/or fused to the tissue plasminogen activator (tPA) secretory signal. A MVA/Y. pestis recombinant that expressed a truncated version of the low-calcium response V antigen (MVA/IRES/tPA/V307), conferred significant protection (87.5%–100%) against intranasal or intraperitoneal challenge with CO92 (encapsulated) or Java 9 (non-encapsulated) strains of Y pestis, respectively. In contrast, a MVA/Y. pestis recombinant that expressed the full-length V antigen provided only 37.5% protection against challenge with CO92 or Java 9 strains, respectively. Interestingly, a MVA/Y. pestis recombinant that expressed the capsular protein (F1) did not elicit significant antibody titers but still conferred 50% and 25% protection against CO92 or Java 9 challenge, respectively. The MVA/Y. pestis recombinant viruses did not demonstrate any mortality or morbidity in SCID mice. Based on their safety and efficacy in mice, these MVA/Y. pestis recombinants are candidates for further development as biodefense and public health vaccines. PMID:20638759
-
Retrovirus-mediated siRNA targeting TRPM7 gene induces apoptosis in RBL-2H3 cells.
Ng, N-M; Jiang, S-P; Lv, Z-Q
2012-09-01
Calcium signaling is important for both normal physiologic processes and pathology of various diseases. Transient receptor potential melastatin 7 (TRPM7) gene has been reported to be a potential candidate for calcium influx. The present study aimed to investigate the possible role of TRPM7 channels in apoptosis in rat basophilic leukemia mast cell line (RBL-2H3), which is widely used in mast cell-associated studies. A recombinant retrovirus vector siRNA targeting rat TRPM7 gene was constructed and identified. Cellular survival was assessed by MTT. Cell apoptosis was evaluated by flow cytometry and TUNEL-FITC/Hoechst 33258 staining. The transfection efficiency by retrovirus vector was about 60%-70%. Transfection with TRPM7 siRNA significantly reduced TRPM7 expression both at mRNA and protein levels. Suppression of TRPM7 expression by siRNA led to significantly decreased cellular survival rates and increased apoptosis rates in RBL-2H3 cells. This study indicates that TRPM7 is involved in the apoptosis process in RBL-2H3 cells.
-
Kratzer, Ramona F; Espenlaub, Sigrid; Hoffmeister, Andrea; Kron, Matthias W; Kreppel, Florian
2017-01-01
Adenovirus-based vectors are promising tools for genetic vaccination. However, several obstacles have to be overcome prior to a routine clinical application of adenovirus-based vectors as efficacious vectored vaccines. The linear trisaccharide epitope αGal (alpha-Gal) with the carbohydrate sequence galactose-α-1,3-galactosyl-β-1,4-N-acetylglucosamine has been described as a potent adjuvant for recombinant or attenuated vaccines. Humans and α-1,3-galactosyltransferase knockout mice do not express this epitope. Upon exposure of α-1,3-galactosyltransferase-deficient organisms to αGal in the environment, large amounts of circulating anti-Gal antibodies are produced consistently. Immunocomplexes formed between recombinant αGal-decorated vaccines and anti-Gal antibodies exhibit superior immunogenicity. We studied the effects of the trisaccharide epitope on CD8 T cell responses that are directed specifically to vector-encoded transgenic antigens. For that, covalently αGal-decorated adenovirus vectors were delivered to anti-Gal α-1,3-galactosyltransferase knockout mice. We generated replication-defective, E1-deleted adenovirus type 5 vectors that were decorated with αGal at the hexon hypervariable regions 1 or 5, at fiber knob, or at penton base. Surprisingly, none of the adenovirus immunocomplexes being formed from αGal-decorated adenovirus vectors and anti-Gal immunoglobulins improved the frequencies of CD8 T cell responses against the transgenic antigen ovalbumin. Humoral immunity directed to the adenovirus vector was neither increased. However, our data indicated that decoration of Ad vectors with the αGal epitope is a powerful tool to analyze the fate of adenovirus immunocomplexes in vivo.
-
Tang, F; Xu, L; Yan, R; Song, X; Li, X
2012-12-01
Plasmids expressing macrophage migration inhibitory factor (MIF) of Trichinella spiralis (TsMIF), multi-cystatin-like domain protein (MCD-1) of T. spiralis (TsMCD-1), or co-expressing TsMIF and TsMCD-1 were constructed with a pVAX1 vector. Their ability to generate a protective immune response against T. spiralis infection was evaluated in BALB/c mice. Groups of mice were immunized twice at 2-week intervals with 100 μg of recombinant plasmids pVAX1-Tsmif, pVAX1-Tsmcd-1 or pVAX1-Tsmif-Tsmcd-1. Control animals were immunized with phosphate-buffered saline (PBS) or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17) and CD4+/CD8+ T cells were monitored. Challenge infection was performed 2 weeks following the second immunization and worm burden was assayed at 35 days post-challenge. Vaccination with pVAX1-Tsmif induced moderate serum IFN-γ and increases of CD4+ and CD8+ T cells, but no specific immunoglobulin antibody response. Vaccination with pVAX1-Tsmcd-1 induced a predominant Th1 antibody (IgG2a and IgG2b) response and strong levels of serum IFN-γ, and increases of CD4+ T cells. Importantly, co-expression of TsMIF and TsMCD-1 in DNA immunization produced more serum IFN-γ and markedly enhanced CD4+ and CD8+ T cells than the single DNA vaccine of the two genes. Challenge infection demonstrated that immunization with pVAX1-Tsmif-Tsmcd-1 reduced worm burdens (by 23.17%; P < 0.05).
-
Rees, Robert C; McArdle, Stephanie; Mian, Shahid; Li, Geng; Ahmad, Murrium; Parkinson, Richard; Ali, Selman A
2002-02-01
Disabled infectious single cycle-herpes simplex viruses (DISC-HSV) have been shown to be safe for use in humans and may be considered efficacious as vectors for immunogene therapy in cancer. Preclinical studies show that DISC-HSV is an efficient delivery system for cytokine genes and antigens. DISC-HSV infects a high proportion of cells, resulting in rapid gene expression for at least 72 h. The DISC-HSV-mGM-CSF vector, when inoculated into tumors, induces tumor regression in a high percentage of animals, concomitant with establishing a cytotoxic T-cell response, which is MHC class I restricted and directed against peptides of known tumor antigens. The inherent properties of DISC-HSV makes it a suitable vector for consideration in human immunogene therapy trials.
-
alpha(4)beta(7) independent pathway for CD8(+) T cell-mediated intestinal immunity to rotavirus.
Kuklin, N A; Rott, L; Darling, J; Campbell, J J; Franco, M; Feng, N; Müller, W; Wagner, N; Altman, J; Butcher, E C; Greenberg, H B
2000-12-01
Rotavirus (RV), which replicates exclusively in cells of the small intestine, is the most important cause of severe diarrhea in young children worldwide. Using a mouse model, we show that expression of the intestinal homing integrin alpha(4)ss(7) is not essential for CD8(+) T cells to migrate to the intestine or provide immunity to RV. Mice deficient in ss7 expression (ss7(-/-)) and unable to express alpha(4)ss(7) integrin were found to clear RV as quickly as wild-type (wt) animals. Depletion of CD8(+) T cells in ss7(-/-) animals prolonged viral shedding, and transfer of immune ss7(-/-) CD8(+) T cells into chronically infected Rag-2-deficient mice resolved RV infection as efficiently as wt CD8(+) T cells. Paradoxically, alpha(4)ss(7)(hi) memory CD8(+) T cells purified from wt mice that had been orally immunized cleared RV more efficiently than alpha(4)ss(7)(low) CD8(+) T cells. We explained this apparent contradiction by demonstrating that expression of alpha(4)ss(7) on effector CD8(+) T cells depends upon the site of initial antigen exposure: oral immunization generates RV-specific CD8(+) T cells primarily of an alpha(4)ss(7)(hi) phenotype, but subcutaneous immunization yields both alpha(4)ss(7)(hi) and alpha(4)ss(7)(low) immune CD8(+) T cells with anti-RV effector capabilities. Thus, alpha(4)ss(7) facilitates normal intestinal immune trafficking to the gut, but it is not required for effective CD8(+) T cell immunity.
-
Effects of protein tyrosine phosphatase-PEST are reversed by Akt in T cells.
Arimura, Yutaka; Shimizu, Kazuhiko; Koyanagi, Madoka; Yagi, Junji
2014-12-01
T cell activation is regulated by a balance between phosphorylation and dephosphorylation that is under the control of kinases and phosphatases. Here, we examined the role of a non-receptor-type protein tyrosine phosphatase, PTP-PEST, using retrovirus-mediated gene transduction into murine T cells. Based on observations of vector markers (GFP or Thy1.1), exogenous PTP-PEST-positive CD4(+) T cells appeared within 2 days after gene transduction; the percentage of PTP-PEST-positive cells tended to decrease during a resting period in the presence of IL-2 over the next 2 days. These vector markers also showed much lower expression intensities, compared with control cells, suggesting a correlation between the percent reduction and the low marker expression intensity. A catalytically inactive PTP-PEST mutant also showed the same tendency, and stepwise deletion mutants gradually lost their ability to induce the above phenomenon. On the other hand, these PTP-PEST-transduced cells did not have an apoptotic phenotype. No difference in the total cell numbers was found in the wells of a culture plate containing VEC- and PTP-PEST-transduced T cells. Moreover, serine/threonine kinase Akt, but not the anti-apoptotic molecules Bcl-2 and Bcl-XL, reversed the phenotype induced by PTP-PEST. We discuss the novel mechanism by which Akt interferes with PTP-PEST. Copyright © 2014 Elsevier Inc. All rights reserved.
-
García-Arriaza, Juan; Perdiguero, Beatriz; Heeney, Jonathan; Seaman, Michael; Montefiori, David C.; Labranche, Celia; Yates, Nicole L.; Shen, Xiaoying; Tomaras, Georgia D.; Ferrari, Guido; Foulds, Kathryn E.; McDermott, Adrian; Kao, Shing-Fen; Roederer, Mario; Hawkins, Natalie; Self, Steve; Yao, Jiansheng; Farrell, Patrick; Phogat, Sanjay; Tartaglia, Jim; Barnett, Susan W.; Burke, Brian; Cristillo, Anthony; Weiss, Deborah; Lee, Carter; Kibler, Karen; Jacobs, Bert; Asbach, Benedikt; Wagner, Ralf; Ding, Song; Pantaleo, Giuseppe
2015-01-01
ABSTRACT We compared the HIV-1-specific cellular and humoral immune responses elicited in rhesus macaques immunized with two poxvirus vectors (NYVAC and ALVAC) expressing the same HIV-1 antigens from clade C, Env gp140 as a trimeric cell-released protein and a Gag-Pol-Nef polyprotein as Gag-induced virus-like particles (VLPs) (referred to as NYVAC-C and ALVAC-C). The immunization protocol consisted of two doses of the corresponding poxvirus vector plus two doses of a combination of the poxvirus vector and a purified HIV-1 gp120 protein from clade C. This immunogenicity profile was also compared to that elicited by vaccine regimens consisting of two doses of the ALVAC vector expressing HIV-1 antigens from clades B/E (ALVAC-vCP1521) plus two doses of a combination of ALVAC-vCP1521 and HIV-1 gp120 protein from clades B/E (similar to the RV144 trial regimen) or clade C. The results showed that immunization of macaques with NYVAC-C stimulated at different times more potent HIV-1-specific CD4+ T-cell responses and induced a trend toward higher-magnitude HIV-1-specific CD8+ T-cell immune responses than did ALVAC-C. Furthermore, NYVAC-C induced a trend toward higher levels of binding IgG antibodies against clade C HIV-1 gp140, gp120, or murine leukemia virus (MuLV) gp70-scaffolded V1/V2 and toward best cross-clade-binding IgG responses against HIV-1 gp140 from clades A, B, and group M consensus, than did ALVAC-C. Of the linear binding IgG responses, most were directed against the V3 loop in all immunization groups. Additionally, NYVAC-C and ALVAC-C also induced similar levels of HIV-1-neutralizing antibodies and antibody-dependent cellular cytotoxicity (ADCC) responses. Interestingly, binding IgA antibody levels against HIV-1 gp120 or MuLV gp70-scaffolded V1/V2 were absent or very low in all immunization groups. Overall, these results provide a comprehensive survey of the immunogenicity of NYVAC versus ALVAC expressing HIV-1 antigens in nonhuman primates and indicate that NYVAC may represent an alternative candidate to ALVAC in the development of a future HIV-1 vaccine. IMPORTANCE The finding of a safe and effective HIV/AIDS vaccine immunogen is one of the main research priorities. Here, we generated two poxvirus-based HIV vaccine candidates (NYVAC and ALVAC vectors) expressing the same clade C HIV-1 antigens in separate vectors, and we analyzed in nonhuman primates their immunogenicity profiles. The results showed that immunization with NYVAC-C induced a trend toward higher HIV-1-specific cellular and humoral immune responses than did ALVAC-C, indicating that this new NYVAC vector could be a novel optimized HIV/AIDS vaccine candidate for human clinical trials. PMID:26041302
-
Tabor, S; Richardson, C C
1985-01-01
The RNA polymerase gene of bacteriophage T7 has been cloned into the plasmid pBR322 under the inducible control of the lambda PL promoter. After induction, T7 RNA polymerase constitutes 20% of the soluble protein of Escherichia coli, a 200-fold increase over levels found in T7-infected cells. The overproduced enzyme has been purified to homogeneity. During extraction the enzyme is sensitive to a specific proteolysis, a reaction that can be prevented by a modification of lysis conditions. The specificity of T7 RNA polymerase for its own promoters, combined with the ability to inhibit selectively the host RNA polymerase with rifampicin, permits the exclusive expression of genes under the control of a T7 RNA polymerase promoter. We describe such a coupled system and its use to express high levels of phage T7 gene 5 protein, a subunit of T7 DNA polymerase. Images PMID:3156376
-
Xie, Peiyi; Hu, Xiaojun; Li, Dan; Xie, Sidong; Zhou, Zhiyang; Meng, Xiaochun; Shan, Hong
2018-05-14
The purposes of this study were to construct immortalized human bone marrow mesenchymal stem cells (UE7T-13) with overexpression of the hepatocyte nuclear factor4α (hHNF4α) and luciferase2-mKate2 dual-fusion reporter gene, further investigate their impact on treating acute liver injury (ALI) in rats, and track their biodistribution and survival by bioluminescence imaging (BLI). The hHNF4α and luciferase2-mKate2 genes were transduced by a lentiviral vector into UE7T-13 cells (named E7-hHNF4α-R cells), and expression was verified by immunofluorescence, RT-PCR, and flow cytometry. E7-hGFP-R cells expressing the luciferase2-mKate2/hGFP gene served as a negative group. A correlation between the bioluminescence signal and cell number was detected by BLI. The ALI rats were established and divided into three groups: PBS, E7-hGFP-R, and E7-hHNF4α-R. After transplantation of 2.0 × 10 6 cells, BLI was used to dynamically track their biodistribution and survival. The restoration of biological functions was assessed by serum biochemical and histological analyses. Stable high-level expression of hHNF4α and mKate2 protein was established in the E7-hHNF4α-R cells in vitro. The E7-hHNF4α-R cells strongly expressed hGFP, hHNF4α, and mKate2 proteins, and the hHNF4α gene. hGFP-mKate2 dual-positive cell expression reached approximately 93 %. BLI verified that a linear relationship existed between the cell number and bioluminescence signal (R 2 = 0.9991). The cells improved liver function in vivo after transplantation into the ALI rat liver, as evidenced by the fact that AST and ALT temporarily returned to normal levels in the recipient ALI rats. The presence of the transplanted E7-hGFP-R and E7-hHNF4α-R cells in recipient rat livers was confirmed by BLI and immunohistochemistry. However, the cells were cleared by the immune system a short time after transplantation into ALI rats with a normal immune system. Our data revealed that the E7-hHNF4α-R cells can transiently improve damaged liver function and were rapidly cleared by the immune system. In addition, BLI is a useful tool to track transplanted cell biodistribution and survival.
-
He, Wei; Racine, Jeremy J; Johnston, Heather F; Li, Xiaofan; Li, Nainong; Cassady, Kaniel; Liu, Can; Deng, Ruishu; Martin, Paul; Forman, Stephen; Zeng, Defu
2014-07-01
We reported previously that anti-CD3 mAb treatment before hematopoietic cell transplantation (HCT) prevented graft-versus-host disease (GVHD) and preserved graft-versus-leukemia (GVL) effects in mice. These effects were associated with downregulated donor T cell expression of tissue-specific homing and chemokine receptors, marked reduction of donor T cell migration into GVHD target tissues, and deletion of CD103(+) dendritic cells (DCs) in mesenteric lymph nodes (MLN). MLN CD103(+) DCs and peripheral lymph node (PLN) DCs include CCR7(+) and CCR7(-) subsets, but the role of these DC subsets in regulating donor T cell expression of homing and chemokine receptors remain unclear. Here, we show that recipient CCR7(+), but not CCR7(-), DCs in MLN induced donor T cell expression of gut-specific homing and chemokine receptors in a retinoid acid-dependent manner. CCR7 regulated activated DC migration from tissue to draining lymph node, but it was not required for the ability of DCs to induce donor T cell expression of tissue-specific homing and chemokine receptors. Finally, anti-CD3 treatment depleted CCR7(+) but not CCR7(-) DCs by inducing sequential expansion and apoptosis of CCR7(+) DCs in MLN and PLN. Apoptosis of CCR7(+) DCs was associated with DC upregulation of Fas expression and natural killer cell but not T, B, or dendritic cell upregulation of FasL expression in the lymph nodes. These results suggest that depletion of CCR7(+) host-type DCs, with subsequent inhibition of donor T cell migration into GVHD target tissues, can be an effective approach in prevention of acute GVHD and preservation of GVL effects. Copyright © 2014 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
-
Functional analysis of the sea urchin-derived arylsulfatase (Ars)-element in mammalian cells.
Watanabe, Satoshi; Watanabe, Sachiko; Sakamoto, Naoaki; Sato, Masahiro; Akasaka, Koji
2006-09-01
An insulator is a DNA sequence that has both enhancer-blocking activity, through its ability to modify the influence of neighboring cis-acting elements, and a barrier function that protects a transgene from being silenced by surrounding chromatin. Previously, we isolated and characterized a 582-bp-long element from the sea urchin arylsulfatase gene (Ars). This Ars-element was effective in sea urchin and Drosophila embryos and in plant cells. To investigate Ars-element activity in mammalian cells, we placed the element between the cytomegalovirus enhancer and a luciferase (luc) expression cassette. In contrast to controls lacking the Ars-element, NIH3T3 and 293T cells transfected with the element-containing construct displayed reduced luciferase activities. The Ars-element therefore acts as an enhancer-blocking element in mammalian cells. We assessed the barrier activity of the Ars-element using vectors in which a luc expression cassette was placed between two elements. Transfection experiments demonstrated that luc activity in these vectors was approximately ten-fold higher than in vectors lacking elements. Luc activities were well maintained even after 12 weeks in culture. Our observations demonstrate that the Ars-element has also a barrier activity. These results indicated that the Ars-element act as an insulator in mammalian cells.
-
Engineering HSV-1 vectors for gene therapy.
Goins, William F; Huang, Shaohua; Cohen, Justus B; Glorioso, Joseph C
2014-01-01
Virus vectors have been employed as gene transfer vehicles for various preclinical and clinical gene therapy applications, and with the approval of Glybera (alipogene tiparvovec) as the first gene therapy product as a standard medical treatment (Yla-Herttuala, Mol Ther 20: 1831-1832, 2013), gene therapy has reached the status of being a part of standard patient care. Replication-competent herpes simplex virus (HSV) vectors that replicate specifically in actively dividing tumor cells have been used in Phase I-III human trials in patients with glioblastoma multiforme, a fatal form of brain cancer, and in malignant melanoma. In fact, T-VEC (talimogene laherparepvec, formerly known as OncoVex GM-CSF) displayed efficacy in a recent Phase III trial when compared to standard GM-CSF treatment alone (Andtbacka et al. J Clin Oncol 31: sLBA9008, 2013) and may soon become the second FDA-approved gene therapy product used in standard patient care. In addition to the replication-competent oncolytic HSV vectors like T-VEC, replication-defective HSV vectors have been employed in Phase I-II human trials and have been explored as delivery vehicles for disorders such as pain, neuropathy, and other neurodegenerative conditions. Research during the last decade on the development of HSV vectors has resulted in the engineering of recombinant vectors that are totally replication defective, nontoxic, and capable of long-term transgene expression in neurons. This chapter describes methods for the construction of recombinant genomic HSV vectors based on the HSV-1 replication-defective vector backbones, steps in their purification, and their small-scale production for use in cell culture experiments as well as preclinical animal studies.
-
Sun, Dian Xing; Hu, Da Rong; Wu, Guang Hui; Hu, Xue Ling; Li, Juan; Fan, Gong Ren
2002-08-01
To explore the possibility of using HBV as a gene delivery vector, and to test the anti-HBV effects by intracellular combined expression of antisense RNA and dominant negative mutants of core protein. Full length of mutant HBV genome, which expresses core-partial P fusion protein and/or antisense RNA, was transfected into HepG2.2.15 cell lines. Positive clones were selected and mixed in respective groups with hygromycin in the culture medium. HBsAg and HBeAg, which exist in the culture medium, were tested by ELISA method. Intracellular HBc related HBV DNA was examined by dot blot hybridization. The existence of recombinant HBV virion in the culture medium was examined by PCR. Free of packaging signal, HBV genome, which express the HBV structural proteins including core, pol and preS/S proteins, was inserted into pCI-neo vector. HepG2 cell lines were employed to transfect with the construct. G418 selection was done at the concentration of 400mug/ml in the culture medium. The G418-resistant clones with the best expression of HBsAg and HBcAg were theoretically considered as packaging cell lines and propagated under the same conditions. It was transfected with plasmid pMEP-CPAS and then selected with G418 and hygromycin in the culture medium. The existence of recombinant HBV virion in the culture medium was examined by PCR. The mean inhibitory rates of HBsAg were 2.74% 3.83%, 40.08 2.05% (t=35.5, P<0.01), 66.54% 4.45% (t=42.3, P<0.01), and 73.68% 5.07% (t=51.9, P<0.01) in group 2.2.15-pMEP4, 2.2.15-CP, 2.2.15-SAS, and 2.2.15-CPAS, respectively. The mean inhibitory rates of HBeAg were 4.46% 4.25%, 52.86% 1.32% (t=36.2, P<0.01), 26.36% 1.69% (t=22.3, P<0.01), and 59.28% 2.10% (t=39.0, P<0.01), respectively. The inhibitory rates of HBc related HBV DNA were 0, 82.0%, 59.9%, and 96.6%, respectively. Recombinant HB virion was detectable in the culture medium of all the three treatment groups. G418-resistant HBV packaging cell line, which harbored an HBV mutant whose packaging signal had been deleted, was generated. Expression of HBsAg and HBcAg was detectable. Transfected with plasmid pMEP-CPAS, it was found to secrete recombinant HB virion and no wild-type HBV was detectable in the culture medium. It has stronger anti-HBV effects by combined expression of antisense RNA and dominant negative mutants than by individual expression of them. With the help of wild-type HBV, the modified HBV genome can form and secret HBV like particles, which provides evidence that the antiviral gene will be hepatotropic expression and the antiviral effects will be amplified. The packaging cell line can provide packaging for replication-defective HBV, but with low efficiency.
-
Quinde-Calderón, Leonardo; Rios-Quituizaca, Paulina; Solorzano, Luis; Dumonteil, Eric
2016-01-01
To describe the current situation of Chagas disease in Ecuador and to evaluate the impact of vector control for the period 2004-2014. Since 2004, the Ministry of Public Health has formalized activities for the surveillance and control of Chagas disease and we analyzed here available records. More than 200 000 houses were surveyed, and 2.6% were found to be infested (95% CI: 2.6-2.7), and more than 51 000 houses were sprayed with residual insecticide, with important yearly variations. A total of 915 cases of T. cruzi infection were registered. The Amazon region is emerging as a high priority area, where nearly half of T. cruzi infection cases originate. The costal region and the southern highland valleys remain important high-risk area. Vector control efforts over the past 10 years have been effective in the coastal region, where T. dimidiata predominates, and resulted in important reductions in house infestation indices in many areas, even reaching negligible levels in some parishes. Vector efforts need to be sustained and expanded for the elimination of T. dimidiata to be feasible. Novel vector control interventions need to be designed to reduce intrusion by several triatomine species present in the Amazon region and southern Ecuador. Strong political commitment is needed to sustain current achievements and improve the national coverage of these programmes. © 2015 John Wiley & Sons Ltd.
-
Braun, Stephen E.; Taube, Ran; Zhu, Quan; Wong, Fay Eng; Murakami, Akikazu; Kamau, Erick; Dwyer, Markryan; Qiu, Gang; Daigle, Janet; Carville, Angela; Johnson, R. Paul
2012-01-01
Abstract We evaluated the potential of an anti–human immunodeficiency virus (HIV) Tat intrabody (intracellular antibody) to promote the survival of CD4+ cells after chimeric simian immunodeficiency virus (SIV)/HIV (SHIV) infection in rhesus macaques. Following optimization of stimulation and transduction conditions, purified CD4+ T cells were transduced with GaLV-pseudotyped retroviral vectors expressing either an anti-HIV-1 Tat or a control single-chain intrabody. Ex vivo intrabody-gene marking was highly efficient, averaging four copies per CD4+ cell. Upon reinfusion of engineered autologous CD4+ cells into two macaques, high levels of gene marking (peak of 0.6% and 6.8% of peripheral blood mononuclear cells (PBMCs) and 0.3% or 2.2% of the lymph node cells) were detected in vivo. One week post cell infusion, animals were challenged with SHIV 89.6p and the ability of the anti-HIV Tat intrabody to promote cell survival was evaluated. The frequency of genetically modified CD4+ T cells progressively decreased, concurrent with loss of CD4+ cells and elevated viral loads in both animals. However, CD4+ T cells expressing the therapeutic anti-Tat intrabody exhibited a relative survival advantage over an 8- and 21-week period compared with CD4+ cells expressing a control intrabody. In one animal, this survival benefit of anti-Tat transduced cells was associated with a reduction in viral load. Overall, these results indicate that a retrovirus-mediated anti-Tat intrabody provided significant levels of gene marking in PBMCs and peripheral tissues and increased relative survival of transduced cells in vivo. PMID:22734618
-
Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.
Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L
1986-09-01
The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.
-
Papapetrou, Eirini P; Kovalovsky, Damian; Beloeil, Laurent; Sant'angelo, Derek; Sadelain, Michel
2009-01-01
MicroRNAs (miRNAs) are small, noncoding RNAs that regulate gene expression by targeting complementary sequences, referred to as miRNA recognition elements (MREs), typically located in the 3' untranslated region of mRNAs. miR-181a is highly expressed in developing thymocytes and markedly downregulated in post-thymic T cells. We investigated whether endogenous miR-181a can be harnessed to segregate expression of chimeric antigen receptors (CARs) and TCRs between developing and mature T cells. Lentiviral-encoded antigen receptors were tagged with a miR-181a-specific MRE and transduced into mouse BM cells that were used to generate hematopoietic chimeras. Expression of a CAR specific for human CD19 (hCD19) was selectively suppressed in late double-negative and double-positive thymocytes, coinciding with the peak in endogenous miR-181a expression. Receptor expression was fully restored in post-thymic resting and activated T cells, affording protection against a subsequent challenge with hCD19+ tumors. Hematopoietic mouse chimeras engrafted with a conalbumin-specific TCR prone to thymic clonal deletion acquired peptide-specific T cell responsiveness only when the vector-encoded TCR transcript was similarly engineered to be subject to regulation by miR-181a. These results demonstrate the potential of miRNA-regulated transgene expression in stem cell-based therapies, including cancer immunotherapy.
-
Li, X Y; Liu, F; Hu, Y F; Xia, M; Cheng, B J; Zhu, S W; Ma, Q
2015-12-21
The ectopic expression of cellulase in biomass can reduce the cost of biofuel conversion. This trait modification technique is highly beneficial for biofuel production. In this study, we isolated an endo-1,4-beta-glucanase gene (EGV) from Trichoderma reesei and inserted this gene downstream of a fragment encoding the signal peptide Apo-SP in a modified pCAMBIA1301 vector to obtain an Apo-SP and AsRed fusion protein. Transient expression of this fusion protein in onion epidermal cells showed that the Apo-SP signal was localized to the plastids. EGV transgenic rice plants that did not carry screening marker genes were obtained through overexpression of the pDTB double T-DNA vector. Western blotting showed that EGV was expressed in the dry straw of T0 generation transgenic rice plants and in fresh leaves of the T1 generation. More importantly, our results also showed that the peptide product of EGV in the transgenic plants folded correctly and was capable of digesting the cellulase substrate CMC. Additionally, cellulase activity remained stable in the straw that had been dried at room temperature for three months. This study presents an important technical approach for the development of transgenic rice straw that has stable cellulase activity and can be used for biofuel conversion.
-
Chung, Tai-Chun; Jones, Charles H; Gollakota, Akhila; Kamal Ahmadi, Mahmoud; Rane, Snehal; Zhang, Guojian; Pfeifer, Blaine A
2015-05-04
Bactofection offers a gene delivery option particularly useful in the context of immune modulation. The bacterial host naturally attracts recognition and cellular uptake by antigen presenting cells (APCs) as the initial step in triggering an immune response. Moreover, depending on the bacterial vector, molecular biology tools are available to influence and/or overcome additional steps and barriers to effective antigen presentation. In this work, molecular engineering was applied using Escherichia coli as a bactofection vector. In particular, the bacteriophage ΦX174 lysis E (LyE) gene was designed for variable expression across strains containing different levels of lysteriolysin O (LLO). The objective was to generate a bacterial vector with improved attenuation and delivery characteristics. The resulting strains exhibited enhanced gene and protein release and inducible cellular death. In addition, the new vectors demonstrated improved gene delivery and cytotoxicity profiles to RAW264.7 macrophage APCs.
-
A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.
Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya
2014-03-01
Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Sharma, Sherven; Batra, Raj K; Yang, Seok Chul; Hillinger, Sven; Zhu, Li; Atianzar, Kimberly; Strieter, Robert M; Riedl, Karen; Huang, Min; Dubinett, Steven M
2003-11-01
The antitumor efficiency of dendritic cells transduced with an adenovirus vector expressing interleukin (IL)-7 (DC-AdIL-7) was evaluated in a murine model of spontaneous bronchoalveolar cell carcinoma. These transgenic mice (CC-10 TAg), expressing the SV40 large T antigen under the Clara cell promoter, develop bilateral multifocal pulmonary adenocarcinomas and die at 4 months as a result of progressive pulmonary tumor burden. Injection of DC-AdIL-7 in the axillary lymph node region (ALNR) weekly for 3 weeks led to a marked reduction in tumor burden with extensive lymphocytic infiltration of the tumors and enhanced survival. The antitumor responses were accompanied by the enhanced elaboration of interferon (IFN)-gamma and IL-12 as well as an increase in the antiangiogenic chemokines, IFN-gamma-inducible protein 10 (IP-10/CXCL10) and monokine induced by IFN-gamma (MIG/CXCL9). In contrast, production of the immunosuppressive mediators IL-10, transforming growth factor (TGF)-beta, prostaglandin E(2) (PGE(2)), and the proangiogenic modulator vascular endothelial growth factor (VEGF) decreased in response to DC-AdIL-7 treatment. Significant reduction in tumor burden in a model in which tumors develop in an organ-specific manner provides a strong rationale for further evaluation of DC-AdIL-7 in regulation of tumor immunity and its use in lung cancer genetic immunotherapy.
-
Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian
2017-06-05
Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.
-
2013-01-01
Background Molecular markers allow rapid identification of biologically important germplasm/s having desired character. Previously we have reported a genotype specific molecular marker, Balco1128 [GenBank ID EU258678] of Bambusa balcooa containing an ORF (375 bp) having high similarity with receptor like cytoplasmic kinase of Arabidopsis and Oryza. Balco1128 was found to be associated only with bamboo genotypes endowed with high cellulose and low lignin contents of fibers. Under the above backdrop, it was necessitated to characterize this genetic marker for better understanding of its biological significance in context of superior quality fiber development. Results The full length cDNA (3342 bp) of BbKst, a serine-threonine protein kinase was isolated from B. balcooa comprising of six LRR domains at the N-terminal end and a kinase domain at the C-terminal end. Bacteria-expressed BbKst-kinase domain (3339 bp long) showed Mg2+ dependent kinase activity at pH 7.0, 28°C. Bioinformatics study followed by phospho-amino analysis further confirmed that BbKst-kinase belongs to the serine/threonine protein kinase family. Transcript analysis of the BbKst gene following RNA slot blot hybridization and qPCR revealed higher expression of BbKst during initiation and elongation stages of fiber development. Tissue specific expression studies showed much higher expression of BbKst transcript in stems and internodes of B. balcooa than in leaves and rhizomes. Southern analysis revealed single copy insertion of BbKst in most of the Agrobacterium mediated transgenic tobacco plants. Real-time PCR detected 150-200 fold enhanced expression of BbKst in different T1 tobacco lines than that of the vector transformed plants. Heterologous expression of BbKst under control of 35S promoter in transgenic tobacco showed high cellulose deposition in the xylem fibers. Number of xylary fibers was higher in transgenic T0 and T1 plants than that of empty-vector transformed tobacco plants offering enhanced mechanical strength to the transgenic plants, which was also substantiated by their strong upright phenotypes, significantly higher cellulose contents, flexibility coefficient, slenderness ratio, and lower Runkel ratio of the fibers. Conclusions This finding clearly demonstrated that BbKst gene (GenBank ID JQ432560) encodes a serine/threonine protein kinase. BbKst induced higher cellulose deposition/synthesis in transgenic tobacco plants, an important attribute of fiber quality bestowing additional strength to the plant. PMID:24015925
-
Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen
2015-12-01
To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.
-
Yan, Yuzhao; Yu, Tenghua; Tu, Gang; Liu, Manran; Yuan, Jie; Yang, Guanglun
2015-09-01
To construct a lentiviral vector (Lenti-GPER-shRNA) targeting G-protein coupled estrogen receptor (GPER) and explore the role of GPER in the effect of tamoxifen on cell proliferation and apoptosis in breast cancer associated fibroblasts (BCAFs). The target sequence of GPER gene and negative control were cloned into lentiviral vectors. The recombinant lentivirus and control were extracted after HEK293T cells were transfected with the recombinant vector and helper vectors. After infection of BCAFs with the GPER lentiviral vector under the best interfering condition, GPER expression was detected by real-time quantitative PCR and Western blotting. BCAFs were divided into negative control group, GPER-RNAi group, negative control combined with tamoxifen (10(-8) mmol/L) group and GPER-RNAi combined with tamoxifen (10(-8) mmol/L) group. CCK-8 assay was used to detect the proliferation and annexin V-fluorescein isothiocyanate/propidium iodide (annexin V-FITC/PI) combined with flow cytometry was used to detect the apoptosis of BCAFs after the treatment of tamoxifen. Lenti-GPER-shRNA significantly interfered the expression of GPER in BCAFs. Tamoxifen promoted the growth of BCAFs, which could be attenuated by knockdown of GPER. Moreover, the apoptosis of BCAFs was reduced by tamoxifen, which was also reversed by knockdown of GPER. Lenti-GPER-shRNA could effectively silence the GPER expression in BCAFs. The ability of tamoxifen to accelerate cell proliferation and decrease cell apoptosis could be weakened by knockdown of GPER.
-
Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei
2006-11-01
To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.
-
Macé, K; Aguilar, F; Wang, J S; Vautravers, P; Gómez-Lechón, M; Gonzalez, F J; Groopman, J; Harris, C C; Pfeifer, A M
1997-07-01
Epidemiological evidence has been supporting a relationship between dietary aflatoxin B1 (AFB1) exposure, development of human primary hepatocellular carcinoma (HCC) and mutations in the p53 tumor suppressor gene. However, the correlation between the observed p53 mutations, the AFB1 DNA adducts and their activation pathways has not been elucidated. Development of relevant cellular in vitro models, taking into account species and tissue specificity, could significantly contribute to the knowledge of cytotoxicity and genotoxicity mechanisms of chemical procarcinogens, such as AFB1, in humans. For this purpose a non-tumorigenic SV40-immortalized human liver epithelial cell line (THLE cells) which retained most of the phase II enzymes, but had markedly reduced phase I activities was used for stable expression of the human CYP1A2, CYP2A6, CYP2B6 and CYP3A4 cDNA. The four genetically engineered cell lines (T5-1A2, T5-2A6, T5-2B6 and T5-3A4) produced high levels of the specific CYP450 proteins and showed comparable or higher catalytic activities related to the CYP450 expression when compared to human hepatocytes. The T5-1A2, T5-2A6, T5-2B6 and T5-3A4 cell lines exhibited a very high sensitivity to the cytotoxic effects of AFB1 and were approximately 125-, 2-, 2- and 15-fold, respectively, more sensitive than the control T5-neo cells, transfected with an expressing vector which does not contain CYP450 cDNA. In the CYP450-expressing cells, nanomolar doses of AFB1-induced DNA adduct formation including AFB1-N7-guanine, -pyrimidyl and -diol adducts. In addition, the T5-1A2 cells showed AFM1-DNA adducts. At similar levels of total DNA adducts, both the T5-1A2 and T5-3A4 cells showed, at codon 249 of the p53 gene, AGG to AGT transversions at a relative frequency of 15x10(-6). In contrast, only the T5-3A4 cells showed CCC to ACC transversion at codon 250 at a high frequency, whereas the second most frequent mutations found in the T5-1A2 cells were C to T transitions at the first and second position of the codon 250. No significant AFB1-induced p53 mutations could be detected in the T5-2A6 cells. Therefore, the differential expression of specific CYP450 genes in human hepatocytes can modulate the cytotoxicity, DNA adduct levels and frequency of p53 mutations produced by AFB1.
-
Yang, Jeong In; Park, Chanho; Kho, Inseong; Lee, Sujin; Suh, Kyung-Suk; Kim, Tae Jin
2017-12-01
We previously reported peritoneal innate-like integrin α4 (CD49d) high CD4 + T cells that provided help for B-1a cells. Here we analyzed the expression of various integrin chains on the peritoneal and pleural integrin α4 high CD4 + T cells and investigated the functional heterogeneity of the subpopulations based on the integrin expression. Pleural cavity contained a lower ratio of integrin α4 high CD4 + T cells to integrin α4 low CD4 + T cells than peritoneal cavity, but the pleural integrin α4 high CD4 + T cells have the same characteristics of the peritoneal integrin α4 high CD4 + T cells. Most of integrin α4 high CD4 + T cells were integrin β1 high β7 - , but a minor population of integrin α4 high CD4 + T cells was integrin β1 + β7 + . Interestingly, the integrin α4 high β1 high β7 - CD4 + T cells expressed high levels of integrin α4β1 and α6β1, whereas integrin α4 high β1 + β7 + CD4 + T cells expressed high levels of integrin α4β1 and α4β7, suggesting an alternative expression of integrin α6β1 or α4β7 in combination with α4β1 in respective major and minor populations of integrin α4 high CD4 + T cells. The minor population, integrin α4 high β1 + β7 + CD4 + T cells, were different from the integrin α4 high β1 high β7 - CD4 + T cells in that they secreted a smaller amount of Th1 cytokines upon stimulation and expressed lower levels of Th1-related chemokine receptors CCR5 and CXCR3 than the integrin α4 high β 1 high β 7 - CD4 + T cells. In summary, the innate-like integrin α4 high CD4 + T cells could be divided into 2 populations, integrin α4β1 + α6β1 + α4β7 - and α4β1 + α6β1 - α4β7 + cells. The functional significance of serosal integrin α4β7 + CD4 + T cells needed to be investigated especially in view of mucosal immunity.
-
Kanagavelu, Saravana; Termini, James M; Gupta, Sachin; Raffa, Francesca N; Fuller, Katherine A; Rivas, Yaelis; Philip, Sakhi; Kornbluth, Richard S; Stone, Geoffrey W
2014-01-01
Adenoviral vectored vaccines have shown considerable promise but could be improved by molecular adjuvants. Ligands in the TNF superfamily (TNFSF) are potential adjuvants for adenoviral vector (Ad5) vaccines based on their central role in adaptive immunity. Many TNFSF ligands require aggregation beyond the trimeric state (multi-trimerization) for optimal biological function. Here we describe Ad5 vaccines for HIV-1 Gag antigen (Ad5-Gag) adjuvanted with the TNFSF ligands 4-1BBL, BAFF, GITRL and CD27L constructed as soluble multi-trimeric proteins via fusion to Surfactant Protein D (SP-D) as a multimerization scaffold. Mice were vaccinated with Ad5-Gag combined with Ad5 expressing one of the SP-D-TNFSF constructs or single-chain IL-12p70 as adjuvant. To evaluate vaccine-induced protection, mice were challenged with vaccinia virus expressing Gag (vaccinia-Gag) which is known to target the female genital tract, a major route of sexually acquired HIV-1 infection. In this system, SP-D-4-1BBL or SP-D-BAFF led to significantly reduced vaccinia-Gag replication when compared to Ad5-Gag alone. In contrast, IL-12p70, SP-D-CD27L and SP-D-GITRL were not protective. Histological examination following vaccinia-Gag challenge showed a dramatic lymphocytic infiltration into the uterus and ovaries of SP-D-4-1BBL and SP-D-BAFF-treated animals. By day 5 post challenge, proinflammatory cytokines in the tissue were reduced, consistent with the enhanced control over viral replication. Splenocytes had no specific immune markers that correlated with protection induced by SP-D-4-1BBL and SP-D-BAFF versus other groups. IL-12p70, despite lack of anti-viral efficacy, increased the total numbers of splenic dextramer positive CD8+ T cells, effector memory T cells, and effector Gag-specific CD8+ T cells, suggesting that these markers are poor predictors of anti-viral immunity in this model. In conclusion, soluble multi-trimeric 4-1BBL and BAFF adjuvants led to strong protection from vaccinia-Gag challenge, but the protection was independent of standard immune markers. Soluble multi-trimeric SP-D-4-1BBL and SP-D-BAFF provide a novel technology to enhance adenoviral vector vaccines against HIV-1.
-
Tabynov, Kaissar; Yespembetov, Bolat; Sansyzbay, Abylai
2014-10-14
The present study provides the first information about the protection of a novel influenza viral vector vaccine expressing the Brucella proteins ribosomal L7/L12 or Omp16 containing the adjuvant Montanide Gel01 in pregnant heifers. Immunization of pregnant heifers was conducted via the conjunctival (n=10) or subcutaneous (n=10) route using cross prime and booster vaccination schedules at an interval of 28 days. The vector vaccine was evaluated in comparison with positive control groups vaccinated with Brucella abortus S19 (n=10) or B. abortus RB51 (n=10) and a negative (PBS+Montanide Gel01; n=10) control group. Via both the conjunctival or subcutaneous route, evaluation of protectiveness against abortion, effectiveness of vaccination and index of infection (in heifers and their fetuses or calves) demonstrated the vector vaccine provided good protection against B. abortus 544 infection compared to the negative control group (PBS+Montanide Gel01) and comparable protection to commercial vaccines B. abortus S19 or B. abortus RB51. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-09-01
Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier Inc. All rights reserved.
-
AAV-mediated targeting of gene expression to the peri-infarct region in rat cortical stroke model.
Mätlik, Kert; Abo-Ramadan, Usama; Harvey, Brandon K; Arumäe, Urmas; Airavaara, Mikko
2014-10-30
For stroke patients the recovery of cognitive and behavioral functions is often incomplete. Functional recovery is thought to be mediated largely by connectivity rearrangements in the peri-infarct region. A method for manipulating gene expression in this region would be useful for identifying new recovery-enhancing treatments. We have characterized a way of targeting adeno-associated virus (AAV) vectors to the peri-infarct region of cortical ischemic lesion in rats 2days after middle cerebral artery occlusion (MCAo). We used magnetic resonance imaging (MRI) to show that the altered properties of post-ischemic brain tissue facilitate the spreading of intrastriatally injected nanoparticles toward the infarct. We show that subcortical injection of green fluorescent protein-encoding dsAAV7-GFP resulted in transduction of cells in and around the white matter tract underlying the lesion, and in the cortex proximal to the lesion. A similar result was achieved with dsAAV7 vector encoding the cerebral dopamine neurotrophic factor (CDNF), a protein with therapeutic potential. Viral vector-mediated intracerebral gene delivery has been used before in rodent models of ischemic injury. However, the method of targeting gene expression to the peri-infarct region, after the initial phase of ischemic cell death, has not been described before. We demonstrate a straightforward and robust way to target AAV vector-mediated over-expression of genes to the peri-infarct region in a rat stroke model. This method will be useful for studying the action of specific proteins in peri-infarct region during the recovery process. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao
2015-02-01
The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.
-
Mutant Alpha-Synuclein Causes Age-Dependent Neuropathology in Monkey Brain
Yang, Weili; Wang, Guohao; Wang, Chuan-En; Guo, Xiangyu; Yin, Peng; Gao, Jinquan; Tu, Zhuchi; Wang, Zhengbo; Wu, Jing; Hu, Xintian; Li, Shihua
2015-01-01
Parkinson's disease (PD) is an age-dependent neurodegenerative disease that often occurs in those over age 60. Although rodents and small animals have been used widely to model PD and investigate its pathology, their short life span makes it difficult to assess the aging-related pathology that is likely to occur in PD patient brains. Here, we used brain tissues from rhesus monkeys at 2–3, 7–8, and >15 years of age to examine the expression of Parkin, PINK1, and α-synuclein, which are known to cause PD via loss- or gain-of-function mechanisms. We found that α-synuclein is increased in the older monkey brains, whereas Parkin and PINK1 are decreased or remain unchanged. Because of the gain of toxicity of α-synuclein, we performed stereotaxic injection of lentiviral vectors expressing mutant α-synuclein (A53T) into the substantia nigra of monkeys and found that aging also increases the accumulation of A53T in neurites and its associated neuropathology. A53T also causes more extensive reactive astrocytes and axonal degeneration in monkey brain than in mouse brain. Using monkey brain tissues, we found that A53T interacts with neurofascin, an adhesion molecule involved in axon subcellular targeting and neurite outgrowth. Aged monkey brain tissues show an increased interaction of neurofascin with A53T. Overexpression of A53T causes neuritic toxicity in cultured neuronal cells, which can be attenuated by transfected neurofascin. These findings from nonhuman primate brains reveal age-dependent pathological and molecular changes that could contribute to the age-dependent neuropathology in PD. PMID:26019347
-
Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza
2015-01-01
Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938
-
Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.
Dad, A-B K; Ramakrishna, S; Song, M; Kim, H
2014-11-01
Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.
-
Kita-Matsuo, Hiroko; Barcova, Maria; Prigozhina, Natalie; Salomonis, Nathan; Wei, Karen; Jacot, Jeffrey G.; Nelson, Brandon; Spiering, Sean; Haverslag, René; Kim, Changsung; Talantova, Maria; Bajpai, Ruchi; Calzolari, Diego; Terskikh, Alexey; McCulloch, Andrew D.; Price, Jeffrey H.; Conklin, Bruce R.; Chen, H. S. Vincent; Mercola, Mark
2009-01-01
Background Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes. Methodology/Principal Findings Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK) promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and α-myosin heavy chain (αMHC) promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function. Conclusion/Significance The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications. PMID:19352491
-
Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin
2015-01-01
Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.
-
Targeted Screening Strategies to Detect Trypanosoma cruzi Infection in Children
Levy, Michael Z.; Kawai, Vivian; Bowman, Natalie M.; Waller, Lance A.; Cabrera, Lilia; Pinedo-Cancino, Viviana V.; Seitz, Amy E.; Steurer, Frank J.; Cornejo del Carpio, Juan G.; Cordova-Benzaquen, Eleazar; Maguire, James H.; Gilman, Robert H.; Bern, Caryn
2007-01-01
Background Millions of people are infected with Trypanosoma cruzi, the causative agent of Chagas disease in Latin America. Anti-trypanosomal drug therapy can cure infected individuals, but treatment efficacy is highest early in infection. Vector control campaigns disrupt transmission of T. cruzi, but without timely diagnosis, children infected prior to vector control often miss the window of opportunity for effective chemotherapy. Methods and Findings We performed a serological survey in children 2–18 years old living in a peri-urban community of Arequipa, Peru, and linked the results to entomologic, spatial and census data gathered during a vector control campaign. 23 of 433 (5.3% [95% CI 3.4–7.9]) children were confirmed seropositive for T. cruzi infection by two methods. Spatial analysis revealed that households with infected children were very tightly clustered within looser clusters of households with parasite-infected vectors. Bayesian hierarchical mixed models, which controlled for clustering of infection, showed that a child's risk of being seropositive increased by 20% per year of age and 4% per vector captured within the child's house. Receiver operator characteristic (ROC) plots of best-fit models suggest that more than 83% of infected children could be identified while testing only 22% of eligible children. Conclusions We found evidence of spatially-focal vector-borne T. cruzi transmission in peri-urban Arequipa. Ongoing vector control campaigns, in addition to preventing further parasite transmission, facilitate the collection of data essential to identifying children at high risk of T. cruzi infection. Targeted screening strategies could make integration of diagnosis and treatment of children into Chagas disease control programs feasible in lower-resource settings. PMID:18160979
-
Comparative analysis of B7-1 and B7-2 costimulatory ligands: expression and function
1994-01-01
Antigen-specific T cell activation requires the engagement of the T cell receptor (TCR) with antigen as well as the engagement of appropriate costimulatory molecules. The most extensively characterized pathway of costimulation has been that involving the interaction of CD28 and CTLA4 on the T cell with B7 (now termed B7-1) on antigen presenting cells. Recently, B7-2 a second costimulatory ligand for CTLA4, was described, demonstrating the potential complexity of costimulatory interactions. This report examines and compares the expression and function of B7-1 and B7-2. Overall these results indicate that (a) B7-1 and B7-2 can be expressed by multiple cell types, including B cells, T cells, macrophages, and dendritic cells, all of which are therefore candidate populations for delivering costimulatory signals mediated by these molecules; (b) stimulating B cells with either LPS or anti-IgD-dextran induced expression of both B7- 1 and B7-2, and peak expression of both costimulatory molecules occurred after 18-42 h of culture. Expression of B7-2 on these B cell populations was significantly higher than expression of B7-1 at all times assayed after stimulation; (c) blocking of B7-2 costimulatory activity inhibited TCR-dependent T cell proliferation and cytokine production, without affecting early consequences of TCR signaling such as induction of CD69 or interleukin 2 receptor alpha (IL-2R alpha); and (d) expression of B7-1 and of B7-2 can be regulated by a variety of stimuli. Moreover, expression of B7-1 and B7-2 can be independently regulated by the same stimulus, providing an additional complexity in the mechanisms available for regulating costimulation and hence immune response. PMID:7519245
-
Bai, Dou; Zhu, Wei; Zhang, Yu; Long, Ling; Zhu, Naishuo
2015-01-01
Adenoviruses (Ad) are once potential and promising vectors for gene delivery, but the immunogenicity attenuates its transfer efficiency. Cytotoxic T lymphocyte antigen 4 (CTLA-4) can inhibit T cell immunity. Thus, we aimed to study the effect of CTLA-4 in the process of Ad-mediated gene transfer. The C57BL/6 mice were injected by Ad vectors at twice, and CTLA-4 was administrated after the first Ad injection. Then, the CD3(+)CD4(+) T cells and circulating levels of IL-2, IL-4, and anti-Ad IgG were decreased by CTLA-4, while Ad generated immune responses. The green fluorescence protein (GFP) expressions of tissues were enhanced by CTLA-4 till injection of Ad at twice. Our results indicate that CTLA-4 can inhibit humoral and cellular immunity by adenovirus generation to enhance GFP delivery, and provide a potential way to assist in Ad-mediated gene transfer.
-
Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.
Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-08-01
Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
-
Designing a Soluble Near Full-Length HIV-1 GP41 Trimer
2012-11-26
envelope; gp41 trimer; bacteriophage T4 display; prehairpin fusion intermediate. Background: The envelope glycoprotein gp41 is a key component of...protein into trimers and defined oligomers. These gp41 trimers were displayed on bacteriophage T4 capsid nanoparticles by attaching to the small...Construction of the Expression Vectors —All the gp41 constructs were generated by splicing-by- overlap extension PCR using wild-type HXB2 gp41 DNA
-
TPD52: A Novel Vaccine Target for Prostate Cancer
2009-09-01
Headquarters Services , Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302...3T3 and 3T3.V (transfected with empty vector) served as negative controls. GAPDH expression served as an internal reference control. B. Western blot... internal reference control. Representative of three separate experiments. Murine TPD52–Induced Metastasis Mol Cancer Res 2007;5(2). February 2007 135 To
-
Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo
2018-01-09
Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.
-
A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle
NASA Astrophysics Data System (ADS)
Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo
2003-04-01
From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ono, Kenji; Fuma, Kazuya; Tabata, Kaori
Magnetic resonance imaging (MRI) is a minimally invasive way to provide high spatial resolution tomograms. However, MRI has been considered to be useless for gene expression imaging compared to optical imaging. In this study, we used a ferritin reporter, binding with biogenic iron, to make it a powerful tool for gene expression imaging in MRI studies. GL261 mouse glioma cells were over-expressed with dual-reporter ferritin-DsRed under {beta}-actin promoter, then gene expression was observed by optical imaging and MRI in a brain tumor model. GL261 cells expressing ferritin-DsRed fusion protein showed enhanced visualizing effect by reducing T2-weighted signal intensity for inmore » vitro and in vivo MRI studies, as well as DsRed fluorescence for optical imaging. Furthermore, a higher contrast was achieved on T2-weighted images when permeating the plasma membrane of ferritin-DsRed-expressing GL261. Thus, a ferritin expression vector can be used as an MRI reporter to monitor in vivo gene expression.« less
-
Cysteine-dependent immune regulation by TRX and MIF/GIF family proteins.
Kondo, Norihiko; Ishii, Yasuyuki; Son, Aoi; Sakakura-Nishiyama, Junko; Kwon, Yong-Won; Tanito, Masaki; Nishinaka, Yumiko; Matsuo, Yoshiyuki; Nakayama, Toshinori; Taniguchi, Masaru; Yodoi, Junji
2004-03-29
Thioredoxin (TRX) superfamily proteins that contain a conserved redox-active site -Cys-Xa.a.-Xa.a.-Cys- includes proinflammatory cytokine, macrophage migration inhibiting factor (MIF) and the immune regulatory cytokine, glycosylation inhibiting factor (GIF) in which Cys-60 is cysteinylated. In this report, we have analyzed the functional interaction between TRX and MIF/GIF. The stable Jurkat T cell line transfected with human TRX gene (TRX-transfectant) was highly resistant to hydrogen peroxide-induced apoptosis, but not the cell line transfected with vector (mock-transfectant). The expression level of MIF/GIF protein of TRX-transfectant was lower than that of mock-transfectant. Conversely, the expression level of intracellular TRX protein in CD4(+)-T cells derived from MIF -/- mice were significantly higher than that from background BALB/c mice. These findings collectively suggest that oxidative stress-induced apoptosis on T lymphocytes might be protected by the reciprocal regulation of TRX and MIF/GIF expression.
-
Regulated expression of the rat recombinant P2X(3) receptor in stably transfected CHO-K1 tTA cells.
Lachnit, W G; Oglesby, I B; Gever, J R; Gever, M; Huang, C; Li, X C; Jin, H; McGivern, J G; Ford, A P
2000-07-03
In this report, the regulatable expression by tetracycline of the rat recombinant P2X(3) receptor in stably transfected Chinese hamster ovary (CHO-K1) expressing the tetracycline-controlled transactivator (tTA) is described. cDNA encoding the rat P2X(3)-receptor was subcloned into pTRE (a tetracycline-repressible expression vector) which was used to transfect stably CHO-K1 tTA cells. Using whole cell patch clamp techniques, 100 microM ATP evoked inward currents of 2.9+/-1.6 nA in transfected cells grown in the absence of tetracycline (tet-). The P2X(3) receptor protein was detectable by immunoblot as early as 24 h and protein expression levels continued to increase as much as 192 h following activation of tTA by the removal of the antibiotic. Saturation binding isotherms using [35S]ATP gamma S yielded a pK(d) of 8.2+/-0.1 and a B(max) of 31.9+/-3.5 pmol/mg protein in tet- cell membranes and a pK(d) of 8.1+/-0.1 and a B(max) of 5.8+/-0.8 pmol/mg protein in tet+ cell membranes. The agonist ligands 2MeSATP and alpha beta MeATP displaced the binding of [35S]ATP gamma S in tet- cell membranes with very high affinity, yielding pIC(50) values of 9.4+/-0.2 and 7.5+/-0. 2, respectively. In tet+ cell membrane, displacement of [35S]ATP gamma S by 2MeSATP and alpha beta MeATP was of much lower affinity (pIC(50) values of 7.8 and 6.2, respectively). ATP, ADP and UTP showed similar displacement of [35S]ATP gamma S binding in tet- and tet+ cell membranes. In other experiments, cytosolic Ca(2+) was monitored using the fluorescent indicator, fluo-3. Increases in cytosolic Ca(2+) were elicited by 100 nM alpha beta MeATP in tet- cells while no increases in cytosolic Ca(2+) were detected below 100 microM alpha beta MeATP in either tet+ cells or untransfected cells. These calcium responses to alpha beta MeATP had a pEC(50) of 6.7 and were transient, returning to baseline within 120 s. Suramin produced concentration-dependent, parallel, dextral shifts of E/[A] curves to alpha beta MeATP yielding a pK(B) of 5.6. PPADS produced non-parallel, dextral shifts of E/[A] curves to alpha beta MeATP which were insurmountable. These results show for the first time, expression of a functional, homomeric recombinant rat P2X(3) receptor which is under regulated expression in a stably transfected mammalian cell line.
-
Bacteriophage 5' untranslated regions for control of plastid transgene expression.
Yang, Huijun; Gray, Benjamin N; Ahner, Beth A; Hanson, Maureen R
2013-02-01
Expression of foreign proteins from transgenes incorporated into plastid genomes requires regulatory sequences that can be recognized by the plastid transcription and translation machinery. Translation signals harbored by the 5' untranslated region (UTR) of plastid transcripts can profoundly affect the level of accumulation of proteins expressed from chimeric transgenes. Both endogenous 5' UTRs and the bacteriophage T7 gene 10 (T7g10) 5' UTR have been found to be effective in combination with particular coding regions to mediate high-level expression of foreign proteins. We investigated whether two other bacteriophage 5' UTRs could be utilized in plastid transgenes by fusing them to the aadA (aminoglycoside-3'-adenyltransferase) coding region that is commonly used as a selectable marker in plastid transformation. Transplastomic plants containing either the T7g1.3 or T4g23 5' UTRs fused to Myc-epitope-tagged aadA were successfully obtained, demonstrating the ability of these 5' UTRs to regulate gene expression in plastids. Placing the Thermobifida fusca cel6A gene under the control of the T7g1.3 or T4g23 5' UTRs, along with a tetC downstream box, resulted in poor expression of the cellulase in contrast with high-level accumulation while using the T7g10 5' UTR. However, transplastomic plants with the bacteriophage 5' UTRs controlling the aadA coding region exhibited fewer undesired recombinant species than plants containing the same marker gene regulated by the Nicotiana tabacum psbA 5' UTR. Furthermore, expression of the T7g1.3 and T4g23 5' UTR::aadA fusions downstream of the cel6A gene provided sufficient spectinomycin resistance to allow selection of homoplasmic transgenic plants and had no effect on Cel6A accumulation.
-
Qu, Bo; Sheng, Guan-Nan; Yu, Fei; Chen, Guan-Nan; Lv, Qi; Mao, Zhong-Peng; Guo, Long; Lv, Yi
2016-11-20
To explore the inhibitory effect of migration-inducing gene 7 (Mig-7) gene silencing induced by retroviral-mediated small hairpin RNA (shRNA) on vasculogenic mimicry (VM), invasion and metastasis of human hepatocellular carcinoma (HCC) cells in vitro. Two target sequences (Mig-7 shRNA-1 and Mig-7 shRNA-2) and one negative control sequence (Mig-7 shRNA-N) were synthesized. The recombinant retroviral vectors carrying Mig-7 shRNA were constructed, and HCC cell line MHCC-97H were transfected with Mig-7 shRNA-1, Mig-7 shRNA-2, Mig-7 shRNA-N, or the empty vector, or treated with 125 µg/mL recombinant human endostatin (ES). Mig-7 expression in the treated cells was detected using semi-quantitative PCR and Western blotting. The inhibitory effect of Mig-7 silencing on VM formation was investigated in a 3-dimensional cell culture system; the changes in cell adhesion, invasion and migration were assessed with intercellular adhesion assay, Transwell invasion assay and Transwell migration assay, respectively. The expression of Mig-7 at both mRNA and protein levels decreased significantly, VM formation, invasion and metastasis were suppressed, while intercellular adhesion increased significantly in MHCC-97H cells in Mig-7 shRNA-1 and Mig-7 shRNA-2 groups (P<0.05); such changes were not observed in cells transfected with Mig-7 shRNA-N or the empty vector, nor in cells treated with ES. Mig-7 silencing by retroviral-mediated shRNA significantly inhibits VM formation, invasion and metastasis and increases the intercellular adhesion of the HCC cells, while ES does not have such inhibitory effects.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takeshita, Harunori; Kitano, Masayasu, E-mail: mkitano6@hyo-med.ac.jp; Iwasaki, Tsuyoshi
Highlights: Black-Right-Pointing-Pointer MH7A cells and CD4{sup +} T cells expressed S1P1 and RANKL. Black-Right-Pointing-Pointer S1P increased RANKL expression in MH7A cells and CD4{sup +} T cells. Black-Right-Pointing-Pointer The effect of S1P in MH7A cells was inhibited by specific Gi/Go inhibitors. -- Abstract: Sphingosine 1-phosphate (S1P)/S1P receptor 1 (S1P1) signaling plays an important role in synovial cell proliferation and inflammatory gene expression by rheumatoid arthritis (RA) synoviocytes. The purpose of this study is to clarify the role of S1P/S1P1 signaling in the expression of receptor activator of NF-{kappa}B ligand (RANKL) in RA synoviocytes and CD4{sup +} T cells. We demonstrated MH7Amore » cells, a human RA synovial cell line, and CD4{sup +} T cells expressed S1P1 and RANKL. Surprisingly, S1P increased RANKL expression in MH7A cells and CD4{sup +} T cells in a dose-dependent manner. Moreover, S1P enhanced RANKL expression induced by stimulation with TNF-{alpha} in MH7A cells and CD4{sup +} T cells. These effects of S1P in MH7A cells were inhibited by pretreatment with PTX, a specific Gi/Go inhibitor. These findings suggest that S1P/S1P1 signaling may play an important role in RANKL expression by MH7A cells and CD4{sup +} T cells. S1P/S1P1 signaling of RA synoviocytes is closely connected with synovial hyperplasia, inflammation, and RANKL-induced osteoclastogenesis in RA. Thus, regulation of S1P/S1P1 signaling may become a novel therapeutic target for RA.« less
-
Carbonaro, Denise A; Zhang, Lin; Jin, Xiangyang; Montiel-Equihua, Claudia; Geiger, Sabine; Carmo, Marlene; Cooper, Aaron; Fairbanks, Lynette; Kaufman, Michael L; Sebire, Neil J; Hollis, Roger P; Blundell, Michael P; Senadheera, Shantha; Fu, Pei-Yu; Sahaghian, Arineh; Chan, Rebecca Y; Wang, Xiaoyan; Cornetta, Kenneth; Thrasher, Adrian J; Kohn, Donald B; Gaspar, H Bobby
2014-01-01
Gene transfer into autologous hematopoietic stem cells by γ-retroviral vectors (gRV) is an effective treatment for adenosine deaminase (ADA)–deficient severe combined immunodeficiency (SCID). However, current gRV have significant potential for insertional mutagenesis as reported in clinical trials for other primary immunodeficiencies. To improve the efficacy and safety of ADA-SCID gene therapy (GT), we generated a self-inactivating lentiviral vector (LV) with a codon-optimized human cADA gene under the control of the short form elongation factor-1α promoter (LV EFS ADA). In ADA−/− mice, LV EFS ADA displayed high-efficiency gene transfer and sufficient ADA expression to rescue ADA−/− mice from their lethal phenotype with good thymic and peripheral T- and B-cell reconstitution. Human ADA-deficient CD34+ cells transduced with 1–5 × 107 TU/ml had 1–3 vector copies/cell and expressed 1–2x of normal endogenous levels of ADA, as assayed in vitro and by transplantation into immune-deficient mice. Importantly, in vitro immortalization assays demonstrated that LV EFS ADA had significantly less transformation potential compared to gRV vectors, and vector integration-site analysis by nrLAM-PCR of transduced human cells grown in immune-deficient mice showed no evidence of clonal skewing. These data demonstrated that the LV EFS ADA vector can effectively transfer the human ADA cDNA and promote immune and metabolic recovery, while reducing the potential for vector-mediated insertional mutagenesis. PMID:24256635
-
Skin vaccination with live virus vectored microneedle arrays induce long lived CD8(+) T cell memory.
Becker, Pablo D; Hervouet, Catherine; Mason, Gavin M; Kwon, Sung-Yun; Klavinskis, Linda S
2015-09-08
A simple dissolvable microneedle array (MA) platform has emerged as a promising technology for vaccine delivery, due to needle-free injection with a formulation that preserves the immunogenicity of live viral vectored vaccines dried in the MA matrix. While recent studies have focused largely on design parameters optimized to induce primary CD8(+) T cell responses, the hallmark of a vaccine is synonymous with engendering long-lasting memory. Here, we address the capacity of dried MA vaccination to programme phenotypic markers indicative of effector/memory CD8(+) T cell subsets and also responsiveness to recall antigen benchmarked against conventional intradermal (ID) injection. We show that despite a slightly lower frequency of dividing T cell receptor transgenic CD8(+) T cells in secondary lymphoid tissue at an early time point, the absolute number of CD8(+) T cells expressing an effector memory (CD62L(-)CD127(+)) and central memory (CD62L(+)CD127(+)) phenotype during peak expansion were comparable after MA and ID vaccination with a recombinant human adenovirus type 5 vector (AdHu5) encoding HIV-1 gag. Similarly, both vaccination routes generated CD8(+) memory T cell subsets detected in draining LNs for at least two years post-vaccination capable of responding to secondary antigen. These data suggest that CD8(+) T cell effector/memory generation and long-term memory is largely unaffected by physical differences in vaccine delivery to the skin via dried MA or ID suspension. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Sirunyan, A.M.; et al.
2018-06-10
A search is presented for single production of a vector-like quark (T) decaying to a Z boson and a top quark, with the Z boson decaying leptonically and the top quark decaying hadronically. The search uses data collected by the CMS experiment in proton–proton collisions at a center-of-mass energy of 13 TeV in 2016, corresponding to an integrated luminosity of 35.9 fb−1 . The presence of forward jets is a particular characteristic of single production of vector-like quarks that is used in the analysis. For the first time, different T quark width hypotheses are studied, from negligibly small to 30%more » of the new particle mass. At the 95% confidence level, the product of cross section and branching fraction is excluded above values in the range 0.26–0.04 pb for T quark masses in the range 0.7–1.7 TeV, assuming a negligible width. A similar sensitivity is observed for widths of up to 30% of the T quark mass. The production of a heavy Z′ boson decaying to Tt, with T→tZ , is also searched for, and limits on the product of cross section and branching fractions for this process are set between 0.13 and 0.06 pb for Z′ boson masses in the range from 1.5 to 2.5 TeV.« less
-
The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.
Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua
2014-01-24
This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.
-
Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang
2012-01-01
Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115
-
Tsagmo Ngoune, Jean M.; Njiokou, Flobert; Loriod, Béatrice; Kame-Ngasse, Ginette; Fernandez-Nunez, Nicolas; Rioualen, Claire; van Helden, Jacques; Geiger, Anne
2017-01-01
Our previous transcriptomic analysis of Glossina palpalis gambiensis experimentally infected or not with Trypanosoma brucei gambiense aimed to detect differentially expressed genes (DEGs) associated with infection. Specifically, we selected candidate genes governing tsetse fly vector competence that could be used in the context of an anti-vector strategy, to control human and/or animal trypanosomiasis. The present study aimed to verify whether gene expression in field tsetse flies (G. p. palpalis) is modified in response to natural infection by trypanosomes (T. congolense), as reported when insectary-raised flies (G. p. gambiensis) are experimentally infected with T. b. gambiense. This was achieved using the RNA-seq approach, which identified 524 DEGs in infected vs. non-infected tsetse flies, including 285 downregulated genes and 239 upregulated genes (identified using DESeq2). Several of these genes were highly differentially expressed, with log2 fold change values in the vicinity of either +40 or −40. Downregulated genes were primarily involved in transcription/translation processes, whereas encoded upregulated genes governed amino acid and nucleotide biosynthesis pathways. The BioCyc metabolic pathways associated with infection also revealed that downregulated genes were mainly involved in fly immunity processes. Importantly, our study demonstrates that data on the molecular cross-talk between the host and the parasite (as well as the always present fly microbiome) recorded from an experimental biological model has a counterpart in field flies, which in turn validates the use of experimental host/parasite couples. PMID:28804485
-
β-cell-specific IL-2 therapy increases islet Foxp3+Treg and suppresses type 1 diabetes in NOD mice.
Johnson, Mark C; Garland, Alaina L; Nicolson, Sarah C; Li, Chengwen; Samulski, R Jude; Wang, Bo; Tisch, Roland
2013-11-01
Interleukin-2 (IL-2) is a critical cytokine for the homeostasis and function of forkhead box p3-expressing regulatory T cells (Foxp3(+)Tregs). Dysregulation of the IL-2-IL-2 receptor axis is associated with aberrant Foxp3(+)Tregs and T cell-mediated autoimmune diseases such as type 1 diabetes. Treatment with recombinant IL-2 has been reported to enhance Foxp3(+)Tregs and suppress different models of autoimmunity. However, efficacy of IL-2 therapy is dependent on achieving sufficient levels of IL-2 to boost tissue-resident Foxp3(+)Tregs while avoiding the potential toxic effects of systemic IL-2. With this in mind, adeno-associated virus (AAV) vector gene delivery was used to localize IL-2 expression to the islets of NOD mice. Injection of a double-stranded AAV vector encoding IL-2 driven by a mouse insulin promoter (dsAAVmIP-IL2) increased Foxp3(+)Tregs in the islets but not the draining pancreatic lymph nodes. Islet Foxp3(+)Tregs in dsAAVmIP-IL2-treated NOD mice exhibited enhanced fitness marked by increased expression of Bcl-2, proliferation, and suppressor function. In contrast, ectopic IL-2 had no significant effect on conventional islet-infiltrating effector T cells. Notably, β-cell-specific IL-2 expression suppressed late preclinical type 1 diabetes in NOD mice. Collectively, these findings demonstrate that β-cell-specific IL-2 expands an islet-resident Foxp3(+)Tregs pool that effectively suppresses ongoing type 1 diabetes long term.
-
IL-7 and CD4 T Follicular Helper Cells in HIV-1 Infection.
Chiodi, Francesca; Bekele, Yonas; Lantto Graham, Rebecka; Nasi, Aikaterini
2017-01-01
IL-7 was previously shown to upregulate the expression of molecules important for interaction of CD4+ T cells with B cells. It is poorly studied whether IL-7 has a role in the biology of T follicular helper (Tfh) cells and whether IL-7 dysregulates the expression of B-cell costimulatory molecules on Tfh cells. We review the literature and provide arguments in favor of IL-7 being involved in the biology of human Tfh cells. The CD127 IL-7 receptor is expressed on circulating Tfh and non-Tfh cells, and we show that IL-7, but not IL-6 or IL-21, upregulates the expression of CD70 and PD-1 on these cells. We conclude that IL-7, a cytokine whose level is elevated during HIV-1 infection, may have a role in increased expression of B cell costimulatory molecules on Tfh cells and lead to abnormal B cell differentiation.
-
Lahiji, Armin; Kučerová-Levisohn, Martina; Lovett, Jordana; Holmes, Roxanne; Zúñiga-Pflücker, Juan Carlos; Ortiz, Benjamin D.
2013-01-01
Locus Control Regions (LCR) are cis-acting gene regulatory elements with the unique, integration site-independent ability to transfer the characteristics of their locus-of-origin’s gene expression pattern to a linked transgene in mice. LCR activities have been discovered in numerous T cell lineage expressed gene loci. These elements can be adapted to the design of stem cell gene therapy vectors that direct robust therapeutic gene expression to the T cell progeny of engineered stem cells. Currently, transgenic mice provide the only experimental approach that wholly supports all the critical aspects of LCR activity. Herein we report manifestation of all key features of mouse T cell receptor (TCR)-α gene LCR function in T cells derived in vitro from mouse embryonic stem cells (ESC). High level, copy number-related TCRα LCR-linked reporter gene expression levels are cell type-restricted in this system, and upregulated during the expected stage transition of T cell development. We further report that de novo introduction of TCRα LCR linked transgenes into existing T cell lines yields incomplete LCR activity. Together, these data indicate that establishing full TCRα LCR activity requires critical molecular events occurring prior to final T-lineage determination. This study additionally validates a novel, tractable and more rapid approach for the study of LCR activity in T cells, and its translation to therapeutic genetic engineering. PMID:23720809
-
Wanarska, Marta; Hildebrandt, Piotr; Kur, Józef
2007-01-01
The pLysN plasmid containing the T7 lysozyme gene under control of the lac promoter was constructed to facilitate cell disintegration after expression of recombinant proteins in arabinose-induced expression systems. The usefulness of this plasmid was tested in Escherichia coli TOP10 and E. coli LMG194 cells carrying pBADMHADgeSSB plasmid containing Deinococcus geothermalis SSB protein gene under control of the araBAD promoter. The results showed that low-level expression of T7 lysozyme did not interfere with the target SSB protein production, and that the freezing-thawing treatment was sufficient for disruption of the E. coli cells producing low amounts of T7 lysozyme.
-
Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C
1990-01-01
Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285
-
Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C
1990-01-01
Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schulte, Reiner; Suh, You-Suk; Sauermann, Ulrike
2009-01-20
We investigated the immunogenicity and efficacy of a bimodal prime/boost vaccine regimen given by various routes in the Simian immunodeficiency virus (SIV) rhesus monkey model for AIDS. Twelve animals were immunized with SIV DNA-vectors followed by the application of a recombinant adenovirus (rAd5) expressing the same genes either intramuscularly (i.m.) or by oropharyngeal spray. The second rAd5-application was given i.m. All vaccinees plus six controls were challenged orally with SIVmac239 12 weeks post-final immunization. Both immunization strategies induced strong SIV Gag-specific IFN-{gamma} and T-cell proliferation responses and mediated a conservation of CD4{sup +} memory T-cells and a reduction of viralmore » load during peak viremia following infection. Interestingly, the mucosal group was superior to the systemic group regarding breadth and strength of SIV-specific T-cell responses and exhibited lower vector specific immune responses. Therefore, our data warrant the inclusion of mucosal vector application in a vaccination regimen which makes it less invasive and easier to apply.« less
-
Parvovirus-like particles as vaccine vectors.
Casal, J I; Rueda, P; Hurtado, A
1999-09-01
A wide array of systems have been developed to improve "classic" vaccines. The use of small polypeptides able to elicit potent antibody and cytotoxic responses seems to have enormous potential in the design of safer vaccines. While peptide coupling to large soluble proteins such as keyhole limpet hemocyanin is the current method of choice for eliciting antibody responses and insertion in live viruses for cytotoxic T-lymphocyte responses, alternative cheaper and/or safer methods will clearly be required in the future. Virus-like particles constitute very immunogenic molecules that allow for covalent coupling of the epitopes of interest in a simple way. In this article, we detail the methodology employed for the preparation of efficient virus vectors as delivery systems. We used parvovirus as the model for the design of new vaccine vectors. Recently parvovirus-like particles have been engineered to express foreign polypeptides in certain positions, resulting in the production of large quantities of highly immunogenic peptides, and to induce strong antibody, helper-T-cell, and cytotoxic T-lymphocyte responses. We discuss the different alternatives and the necessary steps to carry out this process, placing special emphasis on the flow of decisions that need to be made during the project. Copyright 1999 Academic Press.
-
Protective efficacy of a Toxoplasma gondii rhoptry protein 13 plasmid DNA vaccine in mice.
Wang, Pei-Yuan; Yuan, Zi-Guo; Petersen, Eskild; Li, Jie; Zhang, Xiu-Xiang; Li, Xiu-Zhen; Li, Hao-Xin; Lv, Zhi-Cheng; Cheng, Tian; Ren, Di; Yang, Gui-Lian; Lin, Rui-Qing; Zhu, Xing-Quan
2012-12-01
Toxoplasma gondii is an obligate intracellular parasite infecting humans and other warm-blooded animals, resulting in serious public health problems and economic losses worldwide. Rhoptries are involved in T. gondii invasion and host cell interaction and have been implicated as important virulence factors. In the present study, a DNA vaccine expressing rhoptry protein 13 (ROP13) of T. gondii inserted into eukaryotic expression vector pVAX I was constructed, and the immune protection it induced in Kunming mice was evaluated. Kunming mice were immunized intramuscularly with pVAX-ROP13 and/or with interleukin-18 (IL-18). Then, we evaluated the immune response using a lymphoproliferative assay, cytokine and antibody measurements, and the survival times of mice challenged with the virulent T. gondii RH strain (type I) and the cyst-forming PRU strain (type II). The results showed that pVAX-ROP13 alone or with pVAX/IL-18 induced a high level of specific anti-T. gondii antibodies and specific lymphocyte proliferative responses. Coinjection of pVAX/IL-18 significantly increased the production of gamma interferon (IFN-γ), IL-2, IL-4, and IL-10. Further, challenge experiments showed that coimmunization of pVAX-ROP13 with pVAX/IL-18 significantly (P < 0.05) increased survival time (32.3 ± 2.7 days) compared with pVAX-ROP13 alone (24.9 ± 2.3 days). Immunized mice challenged with T. gondii cysts (strain PRU) had a significant reduction in the number of brain cysts, suggesting that ROP13 could trigger a strong humoral and cellular response against T. gondii cyst infection and that it is a potential vaccine candidate against toxoplasmosis, which provided the foundation for further development of effective vaccines against T. gondii.
-
Vector modifications to eliminate transposase expression following piggyBac-mediated transgenesis
Chakraborty, Syandan; Ji, HaYeun; Chen, Jack; Gersbach, Charles A.; Leong, Kam W.
2014-01-01
Transgene insertion plays an important role in gene therapy and in biological studies. Transposon-based systems that integrate transgenes by transposase-catalyzed “cut-and-paste” mechanism have emerged as an attractive system for transgenesis. Hyperactive piggyBac transposon is particularly promising due to its ability to integrate large transgenes with high efficiency. However, prolonged expression of transposase can become a potential source of genotoxic effects due to uncontrolled transposition of the integrated transgene from one chromosomal locus to another. In this study we propose a vector design to decrease post-transposition expression of transposase and to eliminate the cells that have residual transposase expression. We design a single plasmid construct that combines the transposase and the transpositioning transgene element to share a single polyA sequence for termination. Consequently, the separation of the transposase element from the polyA sequence after transposition leads to its deactivation. We also co-express Herpes Simplex Virus thymidine kinase (HSV-tk) with the transposase. Therefore, cells having residual transposase expression can be eliminated by the administration of ganciclovir. We demonstrate the utility of this combination transposon system by integrating and expressing a model therapeutic gene, human coagulation Factor IX, in HEK293T cells. PMID:25492703
-
Koul, Bhupendra; Yadav, Reena; Sanyal, Indraneel; Amla, Devindra Vijay
2015-01-01
Bt-cry1Ac gene has been reputedly effective against Helicoverpa armigera a notorious lepidopteran pest. Reports on the expression of full-length and truncated cry1Ac genes in plants for effective resistance against Helicoverpa sp. have been documented however, their performance is still ambiguous. Moreover, the question remains to be addressed that truncation of 3' end of the native gene was documented and suggested for active insecticidal toxin production while the most successful transgenic event(s) of commercialized-cotton are based on full-length of the cry gene. Therefore, we performed a comparative study on the efficacy of the two versions of cry1Ac genes (full-length: 3,510 bp and truncated: 1,845 bp) in T0 and T1 transgenic tomato plants and analyzed the extent of protection against H. armigera and also compared the results with our previous findings related to a successful transgenic tomato line Ab25E, expressing cry1Ab gene. The integration of cry1Ac gene(s) in T0 transgenic plants and its inheritance in T1 progeny was observed by PCR, RT-PCR and Southern blot hybridization analysis while, the toxin integrity, expression and toxicity was monitored by Western immunoassay, DAS-ELISA and insect bioassay respectively. An average transformation frequency and Bt-Cry protein content of 16.93 ± 2.10 and 0.0020-0.0128% of total soluble protein (TSP) was obtained with pRD400 vector (Trcry1Ac) while, a much lower value of 9.30 ± 2.041 and 0.0001 - 0.0026% of TSP was observed with pNBRI-1 vector (Flcry1Ac), respectively. The promising Trcry1Ac T0 transgenic plants and their T1 progeny gave full protection from H. armigera. Although Flcry1Ac gene showed lower transformation frequency and lower expression, it showed higher toxicity to H. armigera when compared with truncated Trcry1Ac gene. The full-length cry1Ac gene can be redesigned for higher expression and performance in dicots or a hybrid gene could be designed having a blend of strong receptor binding and stable expression characteristics for enhanced efficacy and toxicity to the susceptible insects.
-
Montenegro, Diego; da Cunha, Ana Paula; Ladeia-Andrade, Simone; Vera, Mauricio; Pedroso, Marcel; Junqueira, Angela
2017-01-01
BACKGROUND Chagas disease (CD), caused by the protozoan Trypanosoma cruzi, is a neglected human disease. It is endemic to the Americas and is estimated to have an economic impact, including lost productivity and disability, of 7 billion dollars per year on average. OBJECTIVES To assess vulnerability to vector-borne transmission of T. cruzi in domiciliary environments within an area undergoing domiciliary vector interruption of T. cruzi in Colombia. METHODS Multi-criteria decision analysis [preference ranking method for enrichment evaluation (PROMETHEE) and geometrical analysis for interactive assistance (GAIA) methods] and spatial statistics were performed on data from a socio-environmental questionnaire and an entomological survey. In the construction of multi-criteria descriptors, decision-making processes and indicators of five determinants of the CD vector pathway were summarily defined, including: (1) house indicator (HI); (2) triatominae indicator (TI); (3) host/reservoir indicator (Ho/RoI); (4) ecotope indicator (EI); and (5) socio-cultural indicator (S-CI). FINDINGS Determination of vulnerability to CD is mostly influenced by TI, with 44.96% of the total weight in the model, while the lowest contribution was from S-CI, with 7.15%. The five indicators comprise 17 indices, and include 78 of the original 104 priority criteria and variables. The PROMETHEE and GAIA methods proved very efficient for prioritisation and quantitative categorisation of socio-environmental determinants and for better determining which criteria should be considered for interrupting the man-T. cruzi-vector relationship in endemic areas of the Americas. Through the analysis of spatial autocorrelation it is clear that there is a spatial dependence in establishing categories of vulnerability, therefore, the effect of neighbors’ setting (border areas) on local values should be incorporated into disease management for establishing programs of surveillance and control of CD via vector. CONCLUSIONS The study model proposed here is flexible and can be adapted to various eco-epidemiological profiles and is suitable for focusing anti-T. cruzi serological surveillance programs in vulnerable human populations. PMID:28953999
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wanjalla, Celestine N.; Goldstein, Elizabeth F.; Wirblich, Christoph
2012-05-10
Inflammatory cytokines have a significant role in altering the innate and adaptive arms of immune responses. Here, we analyzed the effect of GM-CSF on a RABV-vaccine vector co-expressing HIV-1 Gag. To this end, we immunized mice with RABV expressing HIV-1 Gag and GM-CSF and analyzed the primary and recall CD8{sup +} T cell responses. We observed a statistically significant increase in antigen presenting cells (APCs) in the spleen and draining lymph nodes in response to GM-CSF. Despite the increase in APCs, the primary and memory anti HIV-1 CD8{sup +} T cell response was significantly lower. This was partly likely duemore » to lower levels of proliferation in the spleen. Animals treated with GM-CSF neutralizing antibodies restored the CD8{sup +} T cell response. These data define a role of GM-CSF expression, in the regulation of the CD8{sup +} T cell immune responses against RABV and has implications in the use of GM-CSF as a molecular adjuvant in vaccine development.« less
-
Unrestricted Hepatocyte Transduction with Adeno-Associated Virus Serotype 8 Vectors in Mice
Nakai, Hiroyuki; Fuess, Sally; Storm, Theresa A.; Muramatsu, Shin-ichi; Nara, Yuko; Kay, Mark A.
2005-01-01
Recombinant adeno-associated virus (rAAV) vectors can mediate long-term stable transduction in various target tissues. However, with rAAV serotype 2 (rAAV2) vectors, liver transduction is confined to only a small portion of hepatocytes even after administration of extremely high vector doses. In order to investigate whether rAAV vectors of other serotypes exhibit similar restricted liver transduction, we performed a dose-response study by injecting mice with β-galactosidase-expressing rAAV1 and rAAV8 vectors via the portal vein. The rAAV1 vector showed a blunted dose-response similar to that of rAAV2 at high doses, while the rAAV8 vector dose-response remained unchanged at any dose and ultimately could transduce all the hepatocytes at a dose of 7.2 × 1012 vector genomes/mouse without toxicity. This indicates that all hepatocytes have the ability to process incoming single-stranded vector genomes into duplex DNA. A single tail vein injection of the rAAV8 vector was as efficient as portal vein injection at any dose. In addition, intravascular administration of the rAAV8 vector at a high dose transduced all the skeletal muscles throughout the body, including the diaphragm, the entire cardiac muscle, and substantial numbers of cells in the pancreas, smooth muscles, and brain. Thus, rAAV8 is a robust vector for gene transfer to the liver and provides a promising research tool for delivering genes to various target organs. In addition, the rAAV8 vector may offer a potential therapeutic agent for various diseases affecting nonhepatic tissues, but great caution is required for vector spillover and tight control of tissue-specific gene expression. PMID:15596817
-
NASA Astrophysics Data System (ADS)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Ambrogi, F.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Grossmann, J.; Hrubec, J.; Jeitler, M.; König, A.; Krammer, N.; Krätschmer, I.; Liko, D.; Madlener, T.; Mikulec, I.; Pree, E.; Rabady, D.; Rad, N.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Spanring, M.; Spitzbart, D.; Waltenberger, W.; Wittmann, J.; Wulz, C.-E.; Zarucki, M.; Chekhovsky, V.; Mossolov, V.; Suarez Gonzalez, J.; De Wolf, E. A.; Di Croce, D.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; De Bruyn, I.; De Clercq, J.; Deroover, K.; Flouris, G.; Lontkovskyi, D.; Lowette, S.; Moortgat, S.; Moreels, L.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Roskas, C.; Salva, S.; Tytgat, M.; Verbeke, W.; Zaganidis, N.; Bakhshiansohi, H.; Bondu, O.; Brochet, S.; Bruno, G.; Caputo, C.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Melo De Almeida, M.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Torres Da Silva De Araujo, F.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Misheva, M.; Rodozov, M.; Shopova, M.; Stoykova, S.; Sultanov, G.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Gao, X.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Jiang, C. H.; Leggat, D.; Liao, H.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Yazgan, E.; Zhang, H.; Zhang, S.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Courbon, B.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Starodumov, A.; Susa, T.; Ather, M. W.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; El-khateeb, E.; Elgammal, S.; Ellithi Kamel, A.; Dewanjee, R. K.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Faure, J. L.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Negro, G.; Rander, J.; Rosowsky, A.; Sahin, M. Ö.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Charlot, C.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Lobanov, A.; Martin Blanco, J.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Stahl Leiton, A. G.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Le Bihan, A.-C.; Tonon, N.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fay, J.; Finco, L.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sordini, V.; Vander Donckt, M.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Zhukov, V.; Albert, A.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Teyssier, D.; Thüer, S.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bermúdez Martínez, A.; Bin Anuar, A. A.; Borras, K.; Botta, V.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Guthoff, M.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Raspereza, A.; Roland, B.; Savitskyi, M.; Saxena, P.; Shevchenko, R.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wen, Y.; Wichmann, K.; Wissing, C.; Zenaiev, O.; Bein, S.; Blobel, V.; Centis Vignali, M.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hinzmann, A.; Hoffmann, M.; Karavdina, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Kurz, S.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sonneveld, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Kassel, F.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Karathanasis, G.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Kousouris, K.; Evangelou, I.; Foudas, C.; Kokkas, P.; Mallios, S.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Triantis, F. A.; Csanad, M.; Filipovic, N.; Pasztor, G.; Veres, G. I.; Bencze, G.; Hajdu, C.; Horvath, D.; Hunyadi, Á.; Sikler, F.; Veszpremi, V.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Dhingra, N.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Singh, J. B.; Walia, G.; Kumar, Ashok; Shah, Aashaq; Bhardwaj, A.; Chauhan, S.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Bhardwaj, R.; Bhattacharya, R.; Bhattacharya, S.; Bhawandeep, U.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhattacharya, S.; Chatterjee, S.; Das, P.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Errico, F.; Fiore, L.; Iaselli, G.; Lezki, S.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Chatterjee, K.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Robutti, E.; Tosi, S.; Benaglia, A.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pauwels, K.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Khan, W. A.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Lujan, P.; Meneguzzo, A. T.; Pozzobon, N.; Ronchese, P.; Rossin, R.; Simonetto, F.; Torassa, E.; Ventura, S.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Ressegotti, M.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Biasini, M.; Bilei, G. M.; Cecchi, C.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Manoni, E.; Mantovani, G.; Mariani, V.; Menichelli, M.; Rossi, A.; Santocchia, A.; Spiga, D.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Boccali, T.; Borrello, L.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Fedi, G.; Giannini, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Manca, E.; Mandorli, G.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Daci, N.; Del Re, D.; Di Marco, E.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, J.; Lee, S.; Lee, S. W.; Moon, C. S.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Moon, D. H.; Oh, G.; Brochero Cifuentes, J. A.; Goh, J.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Kim, J. S.; Lee, H.; Lee, K.; Nam, K.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Choi, Y.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Reyes-Almanza, R.; Ramirez-Sanchez, G.; Duran-Osuna, M. C.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Rabadan-Trejo, R. I.; Lopez-Fernandez, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Pyskir, A.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Di Francesco, A.; Faccioli, P.; Galinhas, B.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Seixas, J.; Strong, G.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Stepennov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chistov, R.; Danilov, M.; Parygin, P.; Philippov, D.; Polikarpov, S.; Tarkovskii, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Perfilov, M.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Cerrada, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Moran, D.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Álvarez Fernández, A.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Cuevas, J.; Erice, C.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Vischia, P.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Chazin Quero, B.; Curras, E.; Duarte Campderros, J.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Martinez Ruiz del Arbol, P.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Baillon, P.; Ball, A. H.; Barney, D.; Bianco, M.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chapon, E.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Dobson, M.; Dorney, B.; du Pree, T.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fallavollita, F.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Glege, F.; Gulhan, D.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Karacheban, O.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Mulders, M.; Neugebauer, H.; Ngadiuba, J.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Selvaggi, M.; Sharma, A.; Silva, P.; Sphicas, P.; Stakia, A.; Steggemann, J.; Stoye, M.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Verweij, M.; Zeuner, W. D.; Bertl, W.; Caminada, L.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bachmair, F.; Bäni, L.; Berger, P.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Klijnsma, T.; Lustermann, W.; Mangano, B.; Marionneau, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Reichmann, M.; Schönenberger, M.; Shchutska, L.; Tavolaro, V. R.; Theofilatos, K.; Vesterbacka Olsson, M. L.; Wallny, R.; Zhu, D. H.; Aarrestad, T. K.; Amsler, C.; Canelli, M. F.; De Cosa, A.; Del Burgo, R.; Donato, S.; Galloni, C.; Hreus, T.; Kilminster, B.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Takahashi, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Paganis, E.; Psallidas, A.; Steen, A.; Tsai, J. f.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Bakirci, M. N.; Boran, F.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Eskut, E.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Karapinar, G.; Ocalan, K.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Tekten, S.; Yetkin, E. A.; Agaras, M. N.; Atay, S.; Cakir, A.; Cankocak, K.; Grynyov, B.; Levchuk, L.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Davignon, O.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Auzinger, G.; Bainbridge, R.; Breeze, S.; Buchmuller, O.; Bundock, A.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Elwood, A.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Matsushita, T.; Nash, J.; Nikitenko, A.; Palladino, V.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Shtipliyski, A.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wardle, N.; Winterbottom, D.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Smith, C.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Pazzini, J.; Piperov, S.; Sagir, S.; Syarif, R.; Yu, D.; Band, R.; Brainerd, C.; Burns, D.; Calderon De La Barca Sanchez, M.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Stolp, D.; Tos, K.; Tripathi, M.; Wang, Z.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Regnard, S.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wang, L.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Hashemi, B.; Holzner, A.; Klein, D.; Kole, G.; Krutelyov, V.; Letts, J.; Macneill, I.; Masciovecchio, M.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Lawhorn, J. M.; Newman, H. B.; Nguyen, T.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhang, Z.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Mudholkar, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Apyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Canepa, A.; Cerati, G. B.; Cheung, H. W. K.; Chlebana, F.; Cremonesi, M.; Duarte, J.; Elvira, V. D.; Freeman, J.; Gecse, Z.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Schneider, B.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Joshi, Y. R.; Linn, S.; Markowitz, P.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Martinez, G.; Perry, T.; Prosper, H.; Saha, A.; Santra, A.; Sharma, V.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Cavanaugh, R.; Chen, X.; Evdokimov, O.; Gerber, C. E.; Hangal, D. A.; Hofman, D. J.; Jung, K.; Kamin, J.; Sandoval Gonzalez, I. D.; Tonjes, M. B.; Trauger, H.; Varelas, N.; Wang, H.; Wu, Z.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Royon, C.; Sanders, S.; Schmitz, E.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Loukas, N.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Higginbotham, S.; Lange, D.; Luo, J.; Marlow, D.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Malik, S.; Norberg, S.; Barker, A.; Barnes, V. E.; Das, S.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Peng, C. C.; Schulte, J. F.; Sun, J.; Wang, F.; Xie, W.; Cheng, T.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Ciesielski, R.; Goulianos, K.; Mesropian, C.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Montalvo, R.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Castaneda Hernandez, A.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Damgov, J.; De Guio, F.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Padeken, K.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Hirosky, R.; Joyce, M.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Wang, Y.; Wolfe, E.; Xia, F.; Harr, R.; Karchin, P. E.; Sturdy, J.; Zaleski, S.; Brodski, M.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Hussain, U.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration
2018-04-01
A search is presented for the production of vector-like quark pairs, T T ‾ or Y Y ‾, with electric charge of 2/3 (T) or - 4 / 3 (Y), in proton-proton collisions at √{ s } = 13TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8fb-1. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak (≈7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.
-
Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro
2014-11-01
During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.
-
Recombinant modified vaccinia virus Ankara-based malaria vaccines.
Sebastian, Sarah; Gilbert, Sarah C
2016-01-01
A safe and effective malaria vaccine is a crucial part of the roadmap to malaria elimination/eradication by the year 2050. Viral-vectored vaccines based on adenoviruses and modified vaccinia virus Ankara (MVA) expressing malaria immunogens are currently being used in heterologous prime-boost regimes in clinical trials for induction of strong antigen-specific T-cell responses and high-titer antibodies. Recombinant MVA is a safe and well-tolerated attenuated vector that has consistently shown significant boosting potential. Advances have been made in large-scale MVA manufacture as high-yield producer cell lines and high-throughput purification processes have recently been developed. This review describes the use of MVA as malaria vaccine vector in both preclinical and clinical studies in the past 5 years.
-
Kaneda, Toshio; Honda, Asako; Hakozaki, Atsushi; Fuse, Tetsuya; Muto, Akihiro; Yoshida, Tadashi
2007-05-01
In Graves' disease, the overstimulation of the thyroid gland and hyperthyroidism are caused by autoantibodies directed against the TSH receptor (TSHR) that mimics the action of TSH. The establishment of an animal model is an important step to study the pathophysiology of autoimmune hyperthyroidism and for immunological analysis. In this study, we adopted the technique of electroporation (EP) for genetic immunization to achieve considerable enhancement of in vivo human TSHR (hTSHR) expression and efficient induction of hyperthyroidism in mice. In a preliminary study using beta-galactosidase (beta-gal) expression vectors, beta-gal introduced into the muscle by EP showed over 40-fold higher enzymatic activity than that introduced via previous direct gene transfer methods. The sustained hTSHR mRNA expression derived from cDNA transferred by EP was detectable in muscle tissue for at least 2 wk by RT-PCR. Based on these results, we induced hyperthyroidism via two expression vectors inserted with hTSHR or hTSHR289His cDNA. Consequently, 12.0-31.8% BALB/c mice immunized with hTSHR and 79.2-95.7% immunized with hTSHR289His showed high total T(4) levels due to the TSHR-stimulating antibody after three to four times repeated immunization by EP, and thyroid follicles of which were hyperplastic and had highly irregular epithelium. Moreover, TSHR-stimulating antibody surprisingly persisted more than 8 months after the last immunization. These results demonstrate that genetic immunization by in vivo EP is more efficient than previous procedures, and that it is useful for delineating the pathophysiology of Graves' disease.
-
USDA-ARS?s Scientific Manuscript database
The licensed oral, live-attenuated bacterial vaccine for typhoid fever, Salmonella Typhi strain Ty21a, has also been utilized as a vaccine delivery platform for expression of diverse foreign antigens that stimulate protection against shigellosis, anthrax, plague, or human papilloma virus. However, T...
-
Chung, T; Huang, J S; Mukherjee, J J; Crilly, K S; Kiss, Z
2000-05-01
In mammalian cells, growth factors, oncogenes, and carcinogens stimulate phosphocholine (PCho) synthesis by choline kinase (CK), suggesting that PCho may regulate cell growth. To validate the role of PCho in mitogenesis, we determined the effects of insulin, insulin-like growth factor I (IGF-I), and other growth factors on DNA synthesis in NIH 3T3 fibroblast sublines highly expressing human choline kinase (CK) without increasing phosphatidylcholine synthesis. In serum-starved CK expressor cells, insulin and IGF-I stimulated DNA synthesis, p70 S6 kinase (p70 S6K) activity, phosphatidylinositol 3-kinase (PI3K) activity, and activating phosphorylation of p42/p44 mitogen-activated protein kinases (MAPK) to greater extents than in the corresponding vector control cells. Furthermore, the CK inhibitor hemicholinium-3 (HC-3) inhibited insulin- and IGF-I-induced DNA synthesis in the CK overexpressors, but not in the vector control cells. The results indicate that high cellular levels of PCho potentiate insulin- and IGF-I-induced DNA synthesis by MAPK- and p70 S6K-regulated mechanisms.
-
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Tumor Regression and Delayed Onset Toxicity Following B7-H4 CAR T Cell Therapy
Smith, Jenessa B; Lanitis, Evripidis; Dangaj, Denarda; Buza, Elizabeth; Poussin, Mathilde; Stashwick, Caitlin; Scholler, Nathalie; Powell, Daniel J
2016-01-01
B7-H4 protein is frequently overexpressed in ovarian cancer. Here, we engineered T cells with novel B7-H4-specific chimeric antigen receptors (CARs) that recognized both human and murine B7-H4 to test the hypothesis that B7-H4 CAR T cell therapy can be applied safely in preclinical models. B7-H4 CAR T cells specifically secreted IFN-γ and lysed B7-H4(+) targets. In vivo, B7-H4 CAR T cells displayed antitumor reactivity against B7-H4(+) human ovarian tumor xenografts. Unexpectedly, B7-H4 CAR T cell treatment reproducibly showed delayed, lethal toxicity 6–8 weeks after therapy. Comprehensive assessment of murine B7-H4 protein distribution uncovered expression in ductal and mucosal epithelial cells in normal tissues. Postmortem analysis revealed the presence of widespread histologic lesions that correlated with B7-H4(+) expression, and were inconsistent with graft versus host disease. Lastly, expression patterns of B7-H4 protein in normal human tissue were comparable to distribution in mice, advancing our understanding of B7-H4. We conclude that B7-H4 CAR therapy mediates control of cancer outgrowth. However, long-term engraftment of B7-H4 CAR T cells mediates lethal, off-tumor toxicity that is likely due to wide expression of B7-H4 in healthy mouse organs. This model system provides a unique opportunity for preclinical evaluation of safety approaches that limit CAR-mediated toxicity after tumor destruction in vivo. PMID:27439899
-
Mwando, Nelson L; Tamiru, Amanuel; Nyasani, Johnson O; Obonyo, Meshack A O; Caulfield, John C; Bruce, Toby J A; Subramanian, Sevgan
2018-06-02
Maize lethal necrosis is one of the most devastating diseases of maize causing yield losses reaching up to 90% in sub-Saharan Africa. The disease is caused by a combination of maize chlorotic mottle virus (MCMV) and any one of cereal viruses in the Potyviridae group such as sugarcane mosaic virus. MCMV has been reported to be transmitted mainly by maize thrips (Frankliniella williamsi) and onion thrips (Thrips tabaci). To better understand the role of thrips vectors in the epidemiology of the disease, we investigated behavioral responses of F. williamsi and T. tabaci, to volatiles collected from maize seedlings infected with MCMV in a four-arm olfactometer bioassay. Volatile profiles from MCMV-infected and healthy maize plants were compared by gas chromatography (GC) and GC coupled mass spectrometry analyses. In the bioassays, both sexes of F. williamsi and male T. tabaci were significantly attracted to volatiles from maize plants infected with MCMV compared to healthy plants and solvent controls. Moreover, volatile analysis revealed strong induction of (E)-4,8-dimethyl-1,3,7-nonatriene, methyl salicylate and (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene in MCMV-infected maize seedlings. Our findings demonstrate MCMV induces changes in volatile profiles of host plants to elicit attraction of thrips vectors. The increased vector contact rates with MCMV-infected host plants could enhance virus transmission if thrips feed on the infected plants and acquire the pathogen prior to dispersal. Uncovering the mechanisms mediating interactions between vectors, host plants and pathogens provides useful insights for understanding the vector ecology and disease epidemiology, which in turn may contribute in designing integrated vector management strategies.
-
Engineered T cells for pancreatic cancer treatment
Katari, Usha L; Keirnan, Jacqueline M; Worth, Anna C; Hodges, Sally E; Leen, Ann M; Fisher, William E; Vera, Juan F
2011-01-01
Objective Conventional chemotherapy and radiotherapy produce marginal survival benefits in pancreatic cancer, underscoring the need for novel therapies. The aim of this study is to develop an adoptive T cell transfer approach to target tumours expressing prostate stem cell antigen (PSCA), a tumour-associated antigen that is frequently expressed by pancreatic cancer cells. Methods Expression of PSCA on cell lines and primary tumour samples was confirmed by immunohistochemistry. Healthy donor- and patient-derived T cells were isolated, activated in vitro using CD3/CD28, and transduced with a retroviral vector encoding a chimeric antigen receptor (CAR) targeting PSCA. The ability of these cells to kill tumour cells was analysed by chromium-51 (Cr51) release. Results Prostate stem cell antigen was expressed on >70% of the primary tumour samples screened. Activated, CAR-modified T cells could be readily generated in clinically relevant numbers and were specifically able to kill PSCA-expressing pancreatic cancer cell lines with no non-specific killing of PSCA-negative target cells, thus indicating the potential efficacy and safety of this approach. Conclusions Prostate stem cell antigen is frequently expressed on pancreatic cancer cells and can be targeted for immune-mediated destruction using CAR-modified, adoptively transferred T cells. The safety and efficacy of this approach indicate that it deserves further study and may represent a promising novel treatment for patients with pancreatic cancer. PMID:21843265
-
NASA Astrophysics Data System (ADS)
Lau, Yun-Fai; Kan, Yuet Wai
1983-09-01
We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.
-
Epidermal Growth Factor-Dependent Transformation by a Human EGF Receptor Proto-Oncogene
NASA Astrophysics Data System (ADS)
Velu, Thierry J.; Beguinot, Laura; Vass, William C.; Willingham, Mark C.; Merlino, Glenn T.; Pastan, Ira; Lowy, Douglas R.
1987-12-01
The epidermal growth factor (EGF) receptor gene EGFR has been placed in a retrovirus vector to examine the growth properties of cells that experimentally overproduce a full-length EGF receptor. NIH 3T3 cells transfected with the viral DNA or infected with the corresponding rescued retrovirus developed a fully transformed phenotype in vitro that required both functional EGFR expression and the presence of EGF in the growth medium. Cells expressing 4 × 105 EGF receptors formed tumors in nude mice, while control cells did not. Therefore, the EGFR retrovirus, which had a titer on NIH 3T3 cells that was greater than 107 focus-forming units per milliliter, can efficiently transfer and express this gene, and increased numbers of EGF receptors can contribute to the transformed phenotype.
-
Mooij, Petra; Balla-Jhagjhoorsingh, Sunita S; Koopman, Gerrit; Beenhakker, Niels; van Haaften, Patricia; Baak, Ilona; Nieuwenhuis, Ivonne G; Kondova, Ivanela; Wagner, Ralf; Wolf, Hans; Gómez, Carmen E; Nájera, José L; Jiménez, Victoria; Esteban, Mariano; Heeney, Jonathan L
2008-03-01
Poxvirus vectors have proven to be highly effective for boosting immune responses in diverse vaccine settings. Recent reports reveal marked differences in the gene expression of human dendritic cells infected with two leading poxvirus-based human immunodeficiency virus (HIV) vaccine candidates, New York vaccinia virus (NYVAC) and modified vaccinia virus Ankara (MVA). To understand how complex genomic changes in these two vaccine vectors translate into antigen-specific systemic immune responses, we undertook a head-to-head vaccine immunogenicity and efficacy study in the pathogenic HIV type 1 (HIV-1) model of AIDS in Indian rhesus macaques. Differences in the immune responses in outbred animals were not distinguished by enzyme-linked immunospot assays, but differences were distinguished by multiparameter fluorescence-activated cell sorter analysis, revealing a difference between the number of animals with both CD4(+) and CD8(+) T-cell responses to vaccine inserts (MVA) and those that elicit a dominant CD4(+) T-cell response (NYVAC). Remarkably, vector-induced differences in CD4(+)/CD8(+) T-cell immune responses persisted for more than a year after challenge and even accompanied antigenic modulation throughout the control of chronic infection. Importantly, strong preexposure HIV-1/simian immunodeficiency virus-specific CD4(+) T-cell responses did not prove deleterious with respect to accelerated disease progression. In contrast, in this setting, animals with strong vaccine-induced polyfunctional CD4(+) T-cell responses showed efficacies similar to those with stronger CD8(+) T-cell responses.
-
Di Mario, Giuseppina; Sciaraffia, Ester; Facchini, Marzia; Gubinelli, Francesco; Soprana, Elisa; Panigada, Maddalena; Bernasconi, Valentina; Garulli, Bruno; Siccardi, Antonio; Donatelli, Isabella; Castrucci, Maria R
2017-03-01
The emergence of novel strains of influenza A viruses with hemagglutinins (HAs) that are antigenically distinct from those circulating in humans, and thus have pandemic potential, pose concerns and call for the development of more broadly protective influenza vaccines. In the present study, modified vaccinia virus Ankara (MVA) encoding internal influenza antigens were evaluated for their immunogenicity and ability to protect HLA-A2.1 transgenic (AAD) mice from infection with influenza viruses. MVAs expressing NP (MVA-NP), M1 (MVA-M1) or polymerase PB1 (MVA-PB1) of A/California/4/09 (CA/09) virus were generated and used to immunize AAD mice. Antibodies and CD8+T cell responses were assessed by ELISA and ELISPOT, respectively, and challenge experiments were performed by infecting vaccinated mice with CA/09 virus. CD8+T cells specific to immunodominant and subdominant epitopes on the internal influenza proteins were elicited by MVA-based vectors in AAD mice, whereas influenza-specific antibodies were detected only in MVA-NP-immunized mice. Both M1- and NP-based MVA vaccines, regardless of whether they were applied individually or in combination, conferred protection against lethal influenza virus challenge. Our data further emphasize the promising potential of MVA vector expressing internal antigens toward the development of a universal influenza vaccine.
-
Zeng, Dingyuan; Lin, Jiajing; He, Hongying; Tan, Guangping; Lan, Ying; Jiang, Fuyan; Sheng, Shuting
2018-02-01
The present study aimed to investigate the therapeutic effect and safety of targeted use of Fas-expressing adenoviruses combined with γδ T cell-mediated killing to treat human ovarian cancer xenografts in BALB/c mice. Shuttle plasmids containing control elements of human telomerase reverse transcriptase promoter and two-step transcriptional amplification system were constructed and packaged into adenovirus-5 vectors to generate expression of an exogenous Fas gene. A mouse xenograft model of human ovarian carcinoma was constructed. A total of 35 BALB/c mice were randomly divided into five groups, which were injected with PBS, γδ T cells, Fas-expressing adenoviruses, taxol, or Fas-expressing adenovirus and γδ T cells. The weight and volume of tumors in mice in each group was monitored. Tissue sections of the various tissues of mice in the Fas-expressing adenovirus and γδ T cells group was compared with those in the PBS group to evaluate the safety of Fas-expressing adenovirus and γδ T cells in the treatment of human ovarian cancer xenograft tumors. The results of the present study indicated that mice in all treatment groups were alive at the end of the treatment course. Tumor weight and volume was the highest in the PBS group, followed successively by the adenovirus group, the γδ T cell group, the adenovirus and γδ T cell group, and the taxol group. The weight and volume inhibition rate in adenovirus and γδ T cell group were significantly higher compared with in the PBS group (P<0.05). Pathological observation of tissue samples revealed that none of vital organs in the adenovirus and γδ T cell group developed any evident morphological changes during treatment, when compared with healthy controls. In conclusion, the combined therapy with Fas-expressing adenoviruses and γδ T cells is efficient and safe for the treatment of mouse human ovarian carcinoma xenografts.
-
A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.
Lèbre, Sophie; Michel, Christian J
2010-12-01
We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.
-
USDA-ARS?s Scientific Manuscript database
A bacterial endo-polygalacturonase (endo-PGase) gene from the plant pathogen Pectobacterium carotovorum was cloned into pGAPZaA vector and constitutively expressed in Pichia pastoris. The recombinant endo-PGase secreted by the Pichia clone showed a 1.7 fold increase when the culture medium included ...
-
Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Moroney-Rasmussen, Terri; Alvarez, Xavier; Lackner, Andrew A; Veazey, Ronald S
2010-12-15
Suppression of dendritic cell (DC) function in HIV-1 infection is thought to contribute to inhibition of immune responses and disease progression, but the mechanism of this suppression remains undetermined. Using the rhesus macaque model, we show B7-H1 (programmed death [PD]-L1) is expressed on lymphoid and mucosal DCs (both myeloid DCs and plasmacytoid DCs), and its expression significantly increases after SIV infection. Meanwhile, its receptor, PD-1, is upregulated on T cells in both peripheral and mucosal tissues and maintained at high levels on SIV-specific CD8(+) T cell clones in chronic infection. However, both B7-H1 and PD-1 expression in SIV controllers was similar to that of controls. Expression of B7-H1 on both peripheral myeloid DCs and plasmacytoid DCs positively correlated with levels of PD-1 on circulating CD4(+) and CD8(+) T cells, viremia, and declining peripheral CD4(+) T cell levels in SIV-infected macaques. Importantly, blocking DC B7-H1 interaction with PD-1(+) T cells could restore SIV-specific CD4(+) and CD8(+) T cell function as evidenced by increased cytokine secretion and proliferative capacity. Combined, the results indicate that interaction of B7-H1-PD-1 between APCs and T cells correlates with impairment of CD4(+) Th cells and CTL responses in vivo, and all are associated with disease progression in SIV infection. Blockade of this pathway may have therapeutic implications for HIV-infected patients.
-
Hodgson, Susanne H; Ewer, Katie J; Bliss, Carly M; Edwards, Nick J; Rampling, Thomas; Anagnostou, Nicholas A; de Barra, Eoghan; Havelock, Tom; Bowyer, Georgina; Poulton, Ian D; de Cassan, Simone; Longley, Rhea; Illingworth, Joseph J; Douglas, Alexander D; Mange, Pooja B; Collins, Katharine A; Roberts, Rachel; Gerry, Stephen; Berrie, Eleanor; Moyle, Sarah; Colloca, Stefano; Cortese, Riccardo; Sinden, Robert E; Gilbert, Sarah C; Bejon, Philip; Lawrie, Alison M; Nicosia, Alfredo; Faust, Saul N; Hill, Adrian V S
2015-04-01
Circumsporozoite protein (CS) is the antigenic target for RTS,S, the most advanced malaria vaccine to date. Heterologous prime-boost with the viral vectors simian adenovirus 63 (ChAd63)-modified vaccinia virus Ankara (MVA) is the most potent inducer of T-cells in humans, demonstrating significant efficacy when expressing the preerythrocytic antigen insert multiple epitope-thrombospondin-related adhesion protein (ME-TRAP). We hypothesized that ChAd63-MVA containing CS may result in a significant clinical protective efficacy. We conducted an open-label, 2-site, partially randomized Plasmodium falciparum sporozoite controlled human malaria infection (CHMI) study to compare the clinical efficacy of ChAd63-MVA CS with ChAd63-MVA ME-TRAP. One of 15 vaccinees (7%) receiving ChAd63-MVA CS and 2 of 15 (13%) receiving ChAd63-MVA ME-TRAP achieved sterile protection after CHMI. Three of 15 vaccinees (20%) receiving ChAd63-MVA CS and 5 of 15 (33%) receiving ChAd63-MVA ME-TRAP demonstrated a delay in time to treatment, compared with unvaccinated controls. In quantitative polymerase chain reaction analyses, ChAd63-MVA CS was estimated to reduce the liver parasite burden by 69%-79%, compared with 79%-84% for ChAd63-MVA ME-TRAP. ChAd63-MVA CS does reduce the liver parasite burden, but ChAd63-MVA ME-TRAP remains the most promising antigenic insert for a vectored liver-stage vaccine. Detailed analyses of parasite kinetics may allow detection of smaller but biologically important differences in vaccine efficacy that can influence future vaccine development. NCT01623557. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.
-
Rampling, Tommy; Ewer, Katie J.; Bowyer, Georgina; Bliss, Carly M.; Edwards, Nick J.; Wright, Danny; Payne, Ruth O.; Venkatraman, Navin; de Barra, Eoghan; Snudden, Claudia M.; Poulton, Ian D.; de Graaf, Hans; Sukhtankar, Priya; Roberts, Rachel; Ivinson, Karen; Weltzin, Rich; Rajkumar, Bebi-Yassin; Wille-Reece, Ulrike; Lee, Cynthia K.; Ockenhouse, Christian F.; Sinden, Robert E.; Gerry, Stephen; Lawrie, Alison M.; Vekemans, Johan; Morelle, Danielle; Lievens, Marc; Ballou, Ripley W.; Cooke, Graham S.; Faust, Saul N.; Gilbert, Sarah; Hill, Adrian V. S.
2016-01-01
Background. The need for a highly efficacious vaccine against Plasmodium falciparum remains pressing. In this controlled human malaria infection (CHMI) study, we assessed the safety, efficacy and immunogenicity of a schedule combining 2 distinct vaccine types in a staggered immunization regimen: one inducing high-titer antibodies to circumsporozoite protein (RTS,S/AS01B) and the other inducing potent T-cell responses to thrombospondin-related adhesion protein (TRAP) by using a viral vector. Method. Thirty-seven healthy malaria-naive adults were vaccinated with either a chimpanzee adenovirus 63 and modified vaccinia virus Ankara–vectored vaccine expressing a multiepitope string fused to TRAP and 3 doses of RTS,S/AS01B (group 1; n = 20) or 3 doses of RTS,S/AS01B alone (group 2; n = 17). CHMI was delivered by mosquito bites to 33 vaccinated subjects at week 12 after the first vaccination and to 6 unvaccinated controls. Results. No suspected unexpected serious adverse reactions or severe adverse events related to vaccination were reported. Protective vaccine efficacy was observed in 14 of 17 subjects (82.4%) in group 1 and 12 of 16 subjects (75%) in group 2. All control subjects received a diagnosis of blood-stage malaria parasite infection. Both vaccination regimens were immunogenic. Fourteen protected subjects underwent repeat CHMI 6 months after initial CHMI; 7 of 8 (87.5%) in group 1 and 5 of 6 (83.3%) in group 2 remained protected. Conclusions. The high level of sterile efficacy observed in this trial is encouraging for further evaluation of combination approaches using these vaccine types. Clinical Trials Registration. NCT01883609. PMID:27307573
-
Rampling, Tommy; Ewer, Katie J; Bowyer, Georgina; Bliss, Carly M; Edwards, Nick J; Wright, Danny; Payne, Ruth O; Venkatraman, Navin; de Barra, Eoghan; Snudden, Claudia M; Poulton, Ian D; de Graaf, Hans; Sukhtankar, Priya; Roberts, Rachel; Ivinson, Karen; Weltzin, Rich; Rajkumar, Bebi-Yassin; Wille-Reece, Ulrike; Lee, Cynthia K; Ockenhouse, Christian F; Sinden, Robert E; Gerry, Stephen; Lawrie, Alison M; Vekemans, Johan; Morelle, Danielle; Lievens, Marc; Ballou, Ripley W; Cooke, Graham S; Faust, Saul N; Gilbert, Sarah; Hill, Adrian V S
2016-09-01
The need for a highly efficacious vaccine against Plasmodium falciparum remains pressing. In this controlled human malaria infection (CHMI) study, we assessed the safety, efficacy and immunogenicity of a schedule combining 2 distinct vaccine types in a staggered immunization regimen: one inducing high-titer antibodies to circumsporozoite protein (RTS,S/AS01B) and the other inducing potent T-cell responses to thrombospondin-related adhesion protein (TRAP) by using a viral vector. Thirty-seven healthy malaria-naive adults were vaccinated with either a chimpanzee adenovirus 63 and modified vaccinia virus Ankara-vectored vaccine expressing a multiepitope string fused to TRAP and 3 doses of RTS,S/AS01B (group 1; n = 20) or 3 doses of RTS,S/AS01B alone (group 2; n = 17). CHMI was delivered by mosquito bites to 33 vaccinated subjects at week 12 after the first vaccination and to 6 unvaccinated controls. No suspected unexpected serious adverse reactions or severe adverse events related to vaccination were reported. Protective vaccine efficacy was observed in 14 of 17 subjects (82.4%) in group 1 and 12 of 16 subjects (75%) in group 2. All control subjects received a diagnosis of blood-stage malaria parasite infection. Both vaccination regimens were immunogenic. Fourteen protected subjects underwent repeat CHMI 6 months after initial CHMI; 7 of 8 (87.5%) in group 1 and 5 of 6 (83.3%) in group 2 remained protected. The high level of sterile efficacy observed in this trial is encouraging for further evaluation of combination approaches using these vaccine types. NCT01883609. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.
-
Argibay, Hernán D; Orozco, M Marcela; Cardinal, M Victoria; Rinas, Miguel A; Arnaiz, María; Mena Segura, Carlos; Gürtler, Ricardo E
2016-09-01
Establishing the putative links between sylvatic and domestic transmission cycles of Trypanosoma cruzi, the etiological agent of Chagas disease, is of public health relevance. We conducted three surveys to assess T. cruzi infection in wild mammals from a rural and a preserved area in Misiones Province, Northeastern Argentina, which had recently been declared free of vector- and blood-borne transmission of human T. cruzi infection. A total of 200 wild mammals were examined by xenodiagnosis (XD) and/or polymerase chain reaction (PCR) amplification of the hyper-variable region of kinetoplast DNA minicircles of T. cruzi (kDNA-PCR). The overall prevalence of T. cruzi infection was 8%. Nine (16%) of 57 Didelphis albiventris opossums and two (7%) of 29 Desmodus rotundus vampire bats were positive by both XD and kDNA-PCR. Additionally, one D. rotundus positive for T. cruzi by kDNA-PCR tested positive by satellite-DNA-PCR (SAT-DNA-PCR). The T. cruzi-infected bats were captured indoors and in the yard of a vacant dwelling. All D. albiventris were infected with TcI and both XD-positive D. rotundus by TcII. Fifty-five opossum cubs within the marsupium were negative by XD. The mean infectiousness to the vector was 62% in D. albiventris and 50% in D. rotundus. Mice experimentally infected with a parasite isolate from a vampire bat displayed lesions typically caused by T. cruzi. Our study documents the presence of the genotype TcII in a sylvatic host for the first time in Argentina, and the occurrence of two transmission cycles of T. cruzi in a district free of domestic vector-borne transmission.
-
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
-
Ohs, Inga; Windmann, Sonja; Wildner, Oliver; Dittmer, Ulf; Bayer, Wibke
2013-01-01
Interleukins (IL) are cytokines with stimulatory and modulatory functions in the immune system. In this study, we have chosen interleukins which are involved in the enhancement of TH2 responses and B cell functions to analyze their potential to improve a prophylactic adenovirus-based anti-retroviral vaccine with regard to antibody and virus-specific CD4+ T cell responses. Mice were vaccinated with an adenoviral vector which encodes and displays the Friend Virus (FV) surface envelope protein gp70 (Ad.pIXgp70) in combination with adenoviral vectors encoding the interleukins IL4, IL5, IL6, IL7 or IL23. Co-application of Ad.pIXgp70 with Ad.IL5, Ad.IL6 or Ad.IL23 resulted in improved protection with high control over FV-induced splenomegaly and reduced viral loads. Mice co-immunized with adenoviral vectors encoding IL5 or IL23 showed increased neutralizing antibody responses while mice co-immunized with Ad.IL6 or Ad.IL23 showed improved FV-specific CD4+ T cell responses compared to mice immunized with Ad.pIXgp70 alone. We show that the co-application of adenoviral vectors encoding specific interleukins is suitable to improve the vaccination efficacy of an anti-retroviral vaccine. Improved protection correlated with improved CD4+ T cell responses and especially with higher neutralizing antibody titers. The co-application of selected interleukin-encoding adenoviral vectors is a valuable tool for vaccination with regard to enhancement of antibody mediated immunity. PMID:24349306
-
A trans-acting enhancer modulates estrogen-mediated transcription of reporter genes in osteoblasts.
Sasaki-Iwaoka, H; Maruyama, K; Endoh, H; Komori, T; Kato, S; Kawashima, H
1999-02-01
The presence of bone-specific estrogen agonists and discovery of the osteoblast-specific transcription factor (TF), Cbfa1, together with the discovery of synergism between a TF Pit-1 and estrogen receptor alpha (ERalpha) on rat prolactin gene, led to investigation of Cbfa1 in the modulation of osteoblast-specific actions of estrogen. Reverse transcribed-polymerase chain reaction demonstrated expression of Cbfa1 in the osteoblastic cell lines, MG63, ROS17/2.8, and MC3T3E1, but not in nonosteoblastic cell lines, MCF7, C3H10T1/2, and HeLa. An ER expression vector and a series of luciferase (Luc) reporter plasmids harboring the Cbfa1 binding site OSE2 (the osteoblast-specific cis element in the osteocalcin promoter) and palindromic estrogen response elements (EREs) were cotransfected into both osteoblastic and nonosteoblastic cells. OSE2 worked as a cis- acting element in osteoblastic cells but not nonosteoblastic cells, whereas EREs were cis- acting in all cell lines. Synergistic transactivation was observed in osteoblastic cells only when both ERE and OSE2 were placed in juxtaposition to the promoter. Forced expression of Cbfa1 in C3H10T1/2 cells also induced synergism. Tamoxifen, a partial agonist/antagonist of estrogen, acted as an osteoblast-specific agonist in cells transfected with a promoter containing ERE and acted synergistically with a promoter containing the ERE-OSE2 enhancer combination. These results support the idea that bone-specific TFs modulate the actions of estrogen in a tissue-specific manner.
-
2006-11-22
multiple muta- tions were not studied, (iii) a vaccinia virus (VACV)- T7 system was used for transient expression, (iv) pseudotyped retrovi- ruses were used...those studies produced little to no detectable GP1 or GP2 in the transient VACV- T7 expression assays, whereas in our studies with the DNA con- structs...type GP2 was detected in pseudotyped retroviruses, a result seemingly in conflict with these authors’ findings with the VACV- T7 expression. Although
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less
-
A simple and reliable multi-gene transformation method for switchgrass.
Ogawa, Yoichi; Shirakawa, Makoto; Koumoto, Yasuko; Honda, Masaho; Asami, Yuki; Kondo, Yasuhiro; Hara-Nishimura, Ikuko
2014-07-01
A simple and reliable Agrobacterium -mediated transformation method was developed for switchgrass. Using this method, many transgenic plants carrying multiple genes-of-interest could be produced without untransformed escape. Switchgrass (Panicum virgatum L.) is a promising biomass crop for bioenergy. To obtain transgenic switchgrass plants carrying a multi-gene trait in a simple manner, an Agrobacterium-mediated transformation method was established by constructing a Gateway-based binary vector, optimizing transformation conditions and developing a novel selection method. A MultiRound Gateway-compatible destination binary vector carrying the bar selectable marker gene, pHKGB110, was constructed to introduce multiple genes of interest in a single transformation. Two reporter gene expression cassettes, GUSPlus and gfp, were constructed independently on two entry vectors and then introduced into a single T-DNA region of pHKGB110 via sequential LR reactions. Agrobacterium tumefaciens EHA101 carrying the resultant binary vector pHKGB112 and caryopsis-derived compact embryogenic calli were used for transformation experiments. Prolonged cocultivation for 7 days followed by cultivation on media containing meropenem improved transformation efficiency without overgrowth of Agrobacterium, which was, however, not inhibited by cefotaxime or Timentin. In addition, untransformed escape shoots were completely eliminated during the rooting stage by direct dipping the putatively transformed shoots into the herbicide Basta solution for a few seconds, designated as the 'herbicide dipping method'. It was also demonstrated that more than 90 % of the bar-positive transformants carried both reporters delivered from pHKGB112. This simple and reliable transformation method, which incorporates a new selection technique and the use of a MultiRound Gateway-based binary vector, would be suitable for producing a large number of transgenic lines carrying multiple genes.
-
Gene Therapy with the Sleeping Beauty Transposon System.
Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán
2017-11-01
The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Zhou, Yunying; Zhang, Qishu; Gao, Ge; Zhang, Xiaoli; Liu, Yafei; Yuan, Shoudao
2016-01-01
ABSTRACT The E7 oncoprotein of the high-risk human papillomavirus (HPV) plays a major role in HPV-induced carcinogenesis. E7 abrogates the G1 cell cycle checkpoint and induces genomic instability, but the mechanism is not fully understood. In this study, we performed RNA sequencing (RNA-seq) to characterize the transcriptional profile of keratinocytes expressing HPV 16 (HPV-16) E7. At the transcriptome level, 236 genes were differentially expressed between E7 and vector control cells. A subset of the differentially expressed genes, most of them novel to E7-expressing cells, was further confirmed by real-time PCR. Of interest, the activities of multiple transcription factors were altered in E7-expressing cells. Through bioinformatics analysis, pathways altered in E7-expressing cells were investigated. The upregulated genes were enriched in cell cycle and DNA replication, as well as in the DNA metabolic process, transcription, DNA damage, DNA repair, and nucleotide metabolism. Specifically, we focused our studies on the gene encoding WDHD1 (WD repeat and high mobility group [HMG]-box DNA-binding protein), one of the genes that was upregulated in E7-expressing cells. WDHD1 is a component of the replisome that regulates DNA replication. Recent studies suggest that WDHD1 may also function as a DNA replication initiation factor as well as a G1 checkpoint regulator. We found that in E7-expressing cells, the steady-state level of WDHD1 protein was increased along with the half-life. Moreover, downregulation of WDHD1 reduced E7-induced G1 checkpoint abrogation and rereplication, demonstrating a novel function for WDHD1. These studies shed light on mechanisms by which HPV induces genomic instability and have therapeutic implications. IMPORTANCE The high-risk HPV types induce cervical cancer and encode an E7 oncoprotein that plays a major role in HPV-induced carcinogenesis. However, the mechanism by which E7 induces carcinogenesis is not fully understood; specific anti-HPV agents are not available. In this study, we performed RNA-seq to characterize transcriptional profiling of keratinocytes expressing HPV-16 E7 and identified more than 200 genes that were differentially expressed between E7 and vector control cells. Through bioinformatics analysis, pathways altered in E7-expressing cells were identified. Significantly, the WDHD1 gene, one of the genes that is upregulated in E7-expressing cells, was found to play an important role in E7-induced G1 checkpoint abrogation and rereplication. These studies shed light on mechanisms by which HPV induces genomic instability and have therapeutic implications. PMID:27099318
-
Modulation of let-7 miRNAs controls the differentiation of effector CD8 T cells
Wells, Alexandria C; Daniels, Keith A; Angelou, Constance C; Fagerberg, Eric; Burnside, Amy S; Markstein, Michele; Alfandari, Dominique; Welsh, Raymond M; Pobezinskaya, Elena L; Pobezinsky, Leonid A
2017-01-01
The differentiation of naive CD8 T cells into effector cytotoxic T lymphocytes upon antigen stimulation is necessary for successful antiviral, and antitumor immune responses. Here, using a mouse model, we describe a dual role for the let-7 microRNAs in the regulation of CD8 T cell responses, where maintenance of the naive phenotype in CD8 T cells requires high levels of let-7 expression, while generation of cytotoxic T lymphocytes depends upon T cell receptor-mediated let-7 downregulation. Decrease of let-7 expression in activated T cells enhances clonal expansion and the acquisition of effector function through derepression of the let-7 targets, including Myc and Eomesodermin. Ultimately, we have identified a novel let-7-mediated mechanism, which acts as a molecular brake controlling the magnitude of CD8 T cell responses. DOI: http://dx.doi.org/10.7554/eLife.26398.001 PMID:28737488
-
ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.
2009-01-01
Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605
-
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
-
The tripartite leader sequence is required for ectopic expression of HAdV-B and HAdV-E E3 CR1 genes.
Bair, Camden R; Kotha Lakshmi Narayan, Poornima; Kajon, Adriana E
2017-05-01
The unique repertoire of genes that characterizes the early region 3 (E3) of the different species of human adenovirus (HAdV) likely contributes to their distinct pathogenic traits. The function of many E3 CR1 proteins remains unknown possibly due to unidentified intrinsic properties that make them difficult to express ectopically. This study shows that the species HAdV-B- and HAdV-E-specific E3 CR1 genes can be expressed from vectors carrying the HAdV tripartite leader (TPL) sequence but not from traditional mammalian expression vectors. Insertion of the TPL sequence upstream of the HAdV-B and HAdV-E E3 CR1 open reading frames was sufficient to rescue protein expression from pCI-neo constructs in transfected 293T cells. The detection of higher levels of HAdV-B and HAdV-E E3 CR1 transcripts suggests that the TPL sequence may enhance gene expression at both the transcriptional and translational levels. Our findings will facilitate the characterization of additional AdV E3 proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Nemoto, Yasuhiro; Kanai, Takanori; Takahara, Masahiro; Oshima, Shigeru; Nakamura, Tetsuya; Okamoto, Ryuichi; Tsuchiya, Kiichiro; Watanabe, Mamoru
2013-01-01
Objective Interleukin (IL)-7 is mainly produced in bone marrow (BM) that forms the niche for B cells. We previously demonstrated that BM also retains pathogenic memory CD4 T cells in murine models of inflammatory bowel disease (IBD). However, it remains unknown whether BM-derived IL-7 is sufficient for the development of IBD and which cells form the niche for colitogenic memory CD4 T cells in BM. Design To address these questions, we developed mice in which IL-7 expression was specific for BM, and identified colitis-associated IL-7-expressing mesenchymal stem cells (MSC) in the BM. Results IL-7–/–×RAG-1–/– mice injected with BM cells from IL-7+/+×RAG-1–/– mice, but not from IL-7–/–×RAG-1–/– mice, expressed IL-7 in BM, but not in their colon, and developed colitis when injected with CD4+CD45RBhigh T cells. Cultured BM MSC stably expressed a higher level of IL-7 than that of primary BM cells. IL-7-sufficient, but not IL-7-deficient, BM MSC supported upregulation of Bcl-2 in, and homeostatic proliferation of, colitogenic memory CD4 T cells in vitro. Notably, IL-7–/–×RAG-1–/– mice transplanted with IL-7-sufficient, but not IL-7-deficient, BM MSC expressed IL-7 in BM, but not in their colon, and developed colitis when transplanted with CD4+CD45RBhigh T cells. Conclusions We demonstrate for the first time that BM MSC are a major source of IL-7 and play a pathological role in IBD by forming the niche for colitogenic CD4 memory T cells in BM. PMID:23144054
-
Construction of recombinant FGFR1 containing full-length gene and its potential application.
Zhou, Yali; Luo, Wenjuan; Zheng, Lei; Li, Miao; Zhang, Yanmin
2010-07-01
FGFR1, one of the four fibroblast growth factor receptors, has been found to be over-expressed in many cancers. In this study, a full-length expression plasmid for FGFR1 was obtained by fragment amplification. The amplified PCR product was then digested and inserted into the pcDNA3.1(+) vector. A recombinant eukaryotic expression vector containing the complete CDS region of FGFR1 was successfully constructed. After it was transfected to Hek293 cell, the expression of the FGFR1 receptor in recombinant Hek293/FGFR1 was 18 times higher than that of Hek293 cell. The biological activities of high expression FGFR1 cell (Hek293/FGFR1) were verified by FCM, immunofluorescent, RT-PCR, western blot and cell cycle analysis. Then, Hek293/FGFR1 was used to screen taspine with cell membrane chromatography (CMC). Finally, we analyzed the effects of taspine on Hek293/FGFR1 cell and MCF-7 cell. In conclusion, Hek293/FGFR1 was successfully constructed. The results demonstrate that taspine can down-regulate phosphorylation of FGFR1 and ERK, and inhibit Hek293/FGFR1 and MCF-7 cell proliferation. Copyright 2010 Elsevier Inc. All rights reserved.
-
Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie
2004-01-01
Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153
-
Guo, Lei; Rhen, Turk
2017-10-01
Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.
-
[In vitro function of outer membrane protease T of Escherichia coli K1 pathogenic strain].
Hui, Changye; Guo, Yan; Wu, Shuchi; Peng, Liang; Cao, Hong; Huang, Shenghe
2010-01-01
Plasminogen activation and antimicrobial peptide hydrolysis contribute to pathogens invasion and survival in vivo. To demonstrate the expression of outer membrane protease T in E. coli K1 pathogenic strain E44, its activity of plasminogen activator and protamine hydrolysis. After Benzamidine Sepharose Fast Flow and SOURCE 30Q chromatography, we got E44 outer membrane mixed fraction, and examined its activity of plasminogen activation with chromogenic substrate S-2251 method. An ompT deletion mutant of E44 was constructed by using the suicide vector pCVD442, termed as E44ompT. We examined 0.1 mg/mL cationic antimicrobial peptide protamine susceptibility of E44, ompT mutant strain E44ompT and E44ompT harboring pUCT, which was constructed by inserting complete ompT open reading frame into pUC13. We got about 37 kDa E44 membrane extract, which could activate plasminogen, and activation was membrane extract dose dependent. This confirmed the expression of outer membrane protease T in the outer membrane of E44. E44ompT was, more susceptible to 0.1 mg/mL protamine than E44, and E440mpT was partially complemented by pUCT. Outer membrane protease T is expressed in E. coli K1 pathogenic strain E44, and can activate plasminogen and hydrolyze protamine.