Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and James Watson will not just be exonerated but vindicated as an exemplar of the true morality of science: that scientific communication needs to be allowed to be clear, direct - even crass - in the pursuit of truth. James Watson has been a hero of science for the achievements of his career, and also a martyr for science at the end of his career.
76 FR 58817 - National Boating Safety Advisory Council; Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-22
... and RADM James Watson, USCG Director of Prevention Policy; (2) Receipt and discussion of the following... October 3, 2011. Dated: September 16, 2011. James A. Watson, Rear Admiral, U.S. Coast Guard, Director of...
The Joint Chiefs of Staff and National Policy Volume III 1950-1951, The Korean War: Part One,
1998-01-01
National Policy Volume III 1950-1951 The Korean War Part One James F . Schnabel Robert J. Watson Office of Joint History Office of the Chairman...transferred to other du- ties, Mr. James F . Schnabel assumed responsibility for the volume and planned, Foreword researched, and wrote the...into publishable form. JAMES F . SCHNABEL ROBERT J.WATSON vm Contents 1. Korea in US Policy, 1945-1950 1 The Partition of Korea 1 Establishment
James E. Watson, Jr.: Named to the Health Physics Society
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strom, Daniel J.; Stansbury, Paul S.
At its 2010 Annual Meeting, the Health Physics Society named James E. Watson, Jr. to its Honor Roll of distinguished members. This citation summarizes Professor Jim Watson's life and professional career at the University of North Carolina at Chapel Hill, where he led the Radiological Hygiene program in the School of Public Health for nearly 3 decades. He was President of the Health Physics Society during the 1985-1986 term. He did pioneering work in radiation dose reconstruction for epidemiology as part of the U.S. Department of Energy Health and Mortality Studies.
ERIC Educational Resources Information Center
Fraser, James W.; Watson, Audra M.
2014-01-01
Woodrow Wilson Senior Fellow James W. Fraser and Audra Watson, the Foundation's Director of Mentoring and Induction Strategy, take a look at emerging trends in clinical preparation for new teachers. This new white paper is based on experience with the Woodrow Wilson Teaching Fellowships, and includes observations from some of the colleges and…
Dust Cloud Models: Sensitivity of Calculated Transmittances to Variations in Input Parameters
1981-06-01
Artillery School ATTN: DELEW-M-STO (Dr. Steven Kovel) ATTN: ATSF- CF -R (CPT James M. Watson) White Sands Missile Range, NM 88002 Fort Sill, OK 73503 Office...STEWS-PT-AL (Laurel B. Saunders) ATTN: ATSF- CF -R White Sands Missile Range, RM 88002 Fort Sill, OK 73503 Commander Commandant US Army RAD Coordinator...Army Field Artillery School ATTN: OELEW-M-STO (Dr. Steven Kovel) ATTN: ATSF- CF -R (CPT James M. Watson) White Sands Missile Range, NM 88002 Fort Sill, OK
Discovering Watson's Crick in High School Chemistry.
ERIC Educational Resources Information Center
Whitman, Mark
1984-01-01
High school chemistry students begin the school year by reading and studying "The Double Helix" by James B. Watson. Rationale, objectives, and instructional strategies for this assignment are discussed. Sample discussion questions based on the book are included. (JN)
James Craig Watson (1838-1880)
NASA Astrophysics Data System (ADS)
Broughton, Peter
1996-04-01
Canadians feel a bittersweet pride when young people leave to make their fame and fortune in the United States. The life of the eminent nineteenth century astronomer, J. C. Watson, is another example from history that our brightest and best emigrate when educational and career opportunities are lacking at home.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Breo, D.L.
The best-selling The Double Helix, published 20 years ago, describes the events that had led to the discovery by James Watson and Francis Crick in 1953 of the structure of deoxyribonucleic acid (DNA), the building block of genes and heredity. At the time, the 25-year-old Watson was widely perceived as arrogant, brash, gawky, and intense. Subsequent events did little to change that impression. Today, at age 61, James Dewey Watson is still an angry young man. As director since 1968 of the Cold Spring Harbor Laboratory on Long Island, NY, and as director since 1988 of the National Center formore » Human Genome Research at the National Institutes of Health (NIH), he is coordinating the attempt to decipher biology's deepest secrets: the mapping, sequencing, and defining of the estimated 50,000 to 100,000 human genes arranged over the 23 pairs of chromosomes. The results, expected by early next century, may reveal the chemical script of life and help solve the riddles of inherited genetic diseases and certain cancers.« less
The discovery of the structure of DNA
NASA Astrophysics Data System (ADS)
Squires, G. L.
2003-04-01
On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.
ERIC Educational Resources Information Center
Van Vranken, Nancy S., Ed.
1987-01-01
The field of biotechnology, and specifically recombinant DNA technology, is transforming the way that many feel about the nature and purposes of biology. This newsletter annual supplement contains several articles addressing the topic of biotechnology and the importance that the topic should be given in science classes. James D. Watson's article,…
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
New Hires at the National Cancer Institute at Frederick | Poster
Forty-nine people joined the facility in September and October 2013. The National Cancer Institute welcomes… Aamir Akram Clarissa Alexander Robert Buckheit Brian Chan Kelly Dempsey Christopher Descalzi Ahmed Fahim Devikala Gurusamy Jaewoo Hong Rhushikesh Kulkarni James Shaum Dionysios Watson Yuheng Xi Yi Xiang Thomas Zengeya
Confronting Science: The Dilemma of Genetic Testing.
ERIC Educational Resources Information Center
Zallen, Doris T.
1997-01-01
Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)
Allies and Competitors as Enscripted Audiences in Scientific Writing.
ERIC Educational Resources Information Center
Perry, Susan
A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…
J D Bernal: the sage of science
NASA Astrophysics Data System (ADS)
Brown, Andrew P.
2007-02-01
John Desmond Bernal (1901-1971) was one of the most influential and original scientists of the twentieth century. No less an authority than James Watson has stated that Bernal's genius inspired the birth of molecular biology. By examining Bernal's interactions with others, I attempt to illustrate his personality, brilliance, breadth, foibles and essential humanity.
Reform, Racism and the Centrality of Whiteness: Assessment, Ability and the "New Eugenics"
ERIC Educational Resources Information Center
Gillborn, David
2010-01-01
The Nobel Prize winning scientist James Watson was vilified when his views on the supposedly inherent deficiencies of black people became public. The scientific establishment, mainstream media and politicians joined a chorus of disapproval that would seem to evidence a widespread rejection of the old myths of racially ordered intelligence.…
ERIC Educational Resources Information Center
Mid-Atlantic Teacher Corps Network, Philadelphia, PA.
The conference's keynote address is presented by Bernard C. Watson. Papers include: Vantage from the State Department of Education, by Robert G. Scanlon (Pennsylvania); Minimum Competency: As the Public Sees the Question, by Jacqueline Grennan Wexler; Minimum Competency Testing (MCT): A Tripartite Response from the Profession, by W. James Popham;…
1992-01-01
Norman .................................... University of California, San Diego, CA Dan R . Olsen, Jr ........................................ Brigham...Peter G. Poison .............................................. University of Colorado, Boulder, CO James R . Rhyne ................. IBM T J Watson...and artificial intelligence, among which are: * reasoning about concurrent systems, including program verification ( Barringer , 1985), operating
2012-01-01
Howell, Maj Dean Hudson, LTC Marjorie Johnson, MAJ Colin Meghoo, MAJ Kyle Remick, MAJ Felecia Rivers, LTC James Sebesta, MAJ Leilani Siaki, Maj Adrian K... Stull , CPT Martha Swift, Capt Travis Taylor, Maj Ryan P. Tyner, Maj Gregory Watson, CPT Jennifer G. Ysmael. DISCLOSURE The views expressed in this
77 FR 10604 - Qualification of Drivers; Exemption Applications; Vision
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-22
... renewable two-year period. They are: William M. Arbogast (FL), Cris D. Bush (TN), John E. Cain (NM), Billy C.... Ferguson (VA), Randy M. Garcia (NM), John A. Graham (PA), Henry J. Gregoire, Jr. (MN), Jason L. Hoovan (UT.... Schneider (NM), James Vickery (KY), Norman J. Watson (NC), Lewis H. West, Jr. (MA), Billy R. Wilkey (TX...
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
A 3D-DNA Molecule Made of PlayMais
ERIC Educational Resources Information Center
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
X-Ray Diffraction and the Discovery of the Structure of DNA
ERIC Educational Resources Information Center
Crouse, David T.
2007-01-01
A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
1984-05-01
energy- intensive crop, and agricultural advisors expect alfalfa prices to rise significantly in the future. Sonoma County Dairy Advisor Dr. Richard...Bermon Alfred Heller John Tuteur. Jr James D Hobbs* Volker E#1ee Sonoma County I. Michael Heyman Mrs Robert Watson Alemo County JunO Foote Marilyn...86 ,. Sunnyvale 5 571 Sonoma County 56 21,266 i Class C -- Little or no protection of diked baylands at local level Alameda County 1 228 Alameda 2 71
The Visioceilometer: A Portable Visibility and Cloud Ceiling Height Lidar.
1982-01-01
Artillery School ATTN: STEDP-MT-DA-L ATTN: ATSF- CF -R (CPT James M. Watson) Dugway, UT 84022 Fort Sill, OK 73503 Commander Commandant US Army Dugway Proving...Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN: STEDP-MT-DA-T (Mr. John Trethewey) ATTN: ATSF- CF -R Dugway, UT 84022 Fort...Base, VA 23655 Fort !elvoir, VA 22060 Commander Director US Army INSCOM/Quest Research Corporation US Army Night Vision & ATTN: Mr. Donald Wilmot
NASA Astrophysics Data System (ADS)
Sheehan, William
1996-05-01
The first director of the Washburn Observatory, Watson began his career at the University of Michigan, where he discovered more than a score of asteroids and planned (but did not live to carry out) the first search for a trans-Neptunian planet. He became a strong supporter of Le Verrier's hypothesis that a planet closer to the Sun than Mercury (Vulcan) was causing the anomalous advance of 38" of arc per century of Mercury's perihelion, and mounted a special search for Vulcan at the July 29, 1878 total eclipse, at Separation, Wyoming, recording two strange reddish stars near the Sun which he assumed were intra-Mercurial bodies. With the exception of Lewis Swift at Denver, Colorado, no one else confirmed his observations, and they were sharply criticized by Clinton College (New York) astronomer C. H. F. Peters. Nevertheless, Watson remained absolutely convinced of what he had seen, and his move from Ann Arbor to Madison in 1879 was partly motivated by the prospects of obtaining better instruments with which to further his search for Vulcan, which became the obsession of his later years. He was in the process of constructing an underground solar observatory from which he hoped to see stars near the Sun in broad daylight when he died, unexpectedly, in 1880. Though it is now known that Vulcan does not exist, Watson's observations at the July 1878 eclipse remain problematic; it is probable that he observed at least one and possibly two pygmy comets in the neighborhood of the Sun.
On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.
Teive, Hélio A G
2016-04-01
The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.
Cloud Geometry Analysis of the Smoke Week III Obscuration Trials.
1982-01-01
GRAPIC 1LJu 4 Cf . .444,44 44- 0. 15, 25, TltME( SErs AOEDET. . **** *HEI HT0F CENTER OP MASS ABOVE DET. PT 42 SMOKE III EVENT # 07 1313 Z 08-12-80 STATION...PORTION OF CLOUD ATMOSPHEdIC SCIENCES LABORATORY WHITE SANDS MISSILE RANGE, N.M. 119 CLI-J000000 ) .0 0 1a 40 M M M MMMMMMMM ul zo w -ZIxJ z z w 0 L- CF ... CF -R (CPT James M. Watson) Dugway, UT 84022 Port Sill, OK 73503 Commander Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN
Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories
Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein
2017-01-01
Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker–Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Conclusions: Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence. PMID:28584543
The Effect of Ionospheric Variability on the Accuracy of High Frequency Position Location
1981-08-01
A~~ ~ C~ %. 0 I Cf v. >) LaJ 04) Of T C 4 S- o 0) 0.~ o~~ o V0 Li.. .- 4 U V) (0 .. c-., c X e CO m. Co S.. LC)) C a) 4.0 I~ 0.- 0- CL CJ u W 3 LL X...Field Artillery School ATTN: STEDP-MT-DA-L ATTN: ATSF- CF -R (CPT James M. Watson) Dugway, UT 84022 Fort Sill, OK 73503 Commander Commandant US Army...Commander Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN: STEDP-MT-DA-T (Mr. John Trethewey) ATTN: ATSF- CF -R Dugway, UT 84022
A History and Overview of the Behavioral Neuroscience of Learning and Memory.
Clark, Robert E
2018-01-01
Here, I provide a basic history of important milestones in the development of theories for how the brain accomplishes the phenomenon of learning and memory. Included are the ideas of Plato, René Descartes, Théodule Ribot, William James, Ivan Pavlov, John Watson, Karl Lashley, and others. The modern era of learning and memory research begins with the description of H.M. by Brenda Milner and the gradual discovery that the brain contains multiple learning and memory systems that are supported by anatomically discrete brain structures. Finally, a brief overview is provided for the chapters that are included in current topics in Behavioral Neuroscience-Learning and Memory.
A History and Overview of the Behavioral Neuroscience of Learning and Memory.
Clark, Robert E
2018-01-05
Here, I provide a basic history of important milestones in the development of theories for how the brain accomplishes the phenomenon of learning and memory. Included are the ideas of Plato, René Descartes, Théodule Ribot, William James, Ivan Pavlov, John Watson, Karl Lashley, and others. The modern era of learning and memory research begins with the description of H.M. by Brenda Milner and the gradual discovery that the brain contains multiple learning and memory systems that are supported by anatomically discrete brain structures. Finally, a brief overview is provided for the chapters that are included in current topics in Behavioral Neuroscience-Learning and Memory.
The psychology and physiology of temperament: pragmatism in context.
Bordogna, F
2001-01-01
This paper traces William James's famous "temperament thesis" according to which the philosophical stance that individuals take depends on their "temperaments." It seeks to understand James's conception of temperament by locating James within a set of contemporary investigations that linked the sources of mental, and even higher, intellectual processes to the physiological and organic constitution of the individual. The paper argues that James understood temperament along the reflex-arc model and discusses the implications of that physiological account of temperament for James's overall conception of philosophy.
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-19
... Nuclear Operations, Inc., James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee Nuclear Power Station, Pilgrim Nuclear Power Station, Request for Action AGENCY: Nuclear Regulatory Commission. ACTION: Request... that the NRC take action with regard to James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee...
NASA Astrophysics Data System (ADS)
Crutchfield, James; Wiesner, Karoline
2010-02-01
Is anything ever simple? When confronted with a complicated system, scientists typically strive to identify underlying simplicity, which we articulate as natural laws and fundamental principles. This simplicity is what makes nature appear so organized. Atomic physics, for example, approached a solid theoretical foundation when Niels Bohr uncovered the organization of electronic energy levels, which only later were redescribed as quantum wavefunctions. Charles Darwin's revolutionary idea about the "origin" of species emerged by mapping how species are organized and discovering why they came to be that way. And James Watson and Francis Crick's interpretation of DNA diffraction spectra was a discovery of the structural organization of genetic information - it was neither about the molecule's disorder (thermodynamic entropy) nor about the statistical randomness of its base-pair sequences.
Major Additions to the Linus Pauling Canon
NASA Astrophysics Data System (ADS)
Davenport, Derek A.
2002-08-01
The National Library of Medicine has also just posted a Web site on Linus Pauling in its Profiles of Science series. While by no means as rich as the various Oregon State University sites, it is well worth visiting. There are texts of various speeches (including his Nobel address), many downloadable photographs, correspondence (including a poignant letter to James Watson and Francis Crick concerning their "rival" structures for DNA), and much else besides. There is a certain irony in Linus Pauling being honored by the National Library of Medicine. Ever since his 1949 presidential address to the American Chemical Society, and perhaps earlier, Pauling had been at loggerheads, sometimes acrimoniously so, with the medical establishment. It is easy to imagine him somewhere in the timeless infinitude of the empyrean sporting his characteristic ear-to-ear grin.
NASA Astrophysics Data System (ADS)
Jang, Sa-Han
Galton-Watson branching processes of relevance to human population dynamics are the subject of this thesis. We begin with an historical survey of the invention of the invention of this model in the middle of the 19th century, for the purpose of modelling the extinction of unusual surnames in France and Britain. We then review the principal developments and refinements of this model, and their applications to a wide variety of problems in biology and physics. Next, we discuss in detail the case where the probability generating function for a Galton-Watson branching process is a geometric series, which can be summed in closed form to yield a fractional linear generating function that can be iterated indefinitely in closed form. We then describe the matrix method of Keyfitz and Tyree, and use it to determine how large a matrix must be chosen to model accurately a Galton-Watson branching process for a very large number of generations, of the order of hundreds or even thousands. Finally, we show that any attempt to explain the recent evidence for the existence thousands of generations ago of a 'mitochondrial Eve' and a 'Y-chromosomal Adam' in terms of a the standard Galton-Watson branching process, or indeed any statistical model that assumes equality of probabilities of passing one's genes to one's descendents in later generations, is unlikely to be successful. We explain that such models take no account of the advantages that the descendents of the most successful individuals in earlier generations enjoy over their contemporaries, which must play a key role in human evolution.
ERIC Educational Resources Information Center
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
James Franck and the ÂFranck ReportÂ
, The University of Chicago "James Franck was one of Germany's leading experimental physicists in Spectroscopy and Franck Condon Factors (video) Top Some links on this page may take you to non-federal websites
45 CFR 2490.160 - Communications.
Code of Federal Regulations, 2012 CFR
2012-10-01
... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.160 Communications. (a) The agency shall take appropriate...
Closure properties of Watson-Crick grammars
NASA Astrophysics Data System (ADS)
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
Joint Force Quarterly. Number 33, Winter 2002-03
2003-04-01
by Richard B. Myers 9 A Quiet Revolution: Nuclear Strategy for the 21st Century by James J. Wirtz and James A. Russell 16 Army SOF in Afghanistan...warfighting strategies of attrition or annihilation. The Coalition commander would restrict enemy decisionmaking processes in order to take away options...highlighted the role of precision and ad hoc innovations in the area of time-sensitive targeting Winter 2002–03 / JFQ 5 F/A–18C taking off, Iraqi Freedom
Elevation, west portal. Sign on portal reads Watson Mill Bridge, ...
Elevation, west portal. Sign on portal reads Watson Mill Bridge, est. 1885. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
Different methods and metaphysics in early molecular genetics--a case of disparity of research?
Deichmann, Ute
2008-01-01
The encounter between two fundamentally different approaches in seminal research in molecular biology--the problems, aims, methods and metaphysics--is delineated and analyzed. They are exemplified by the microbiologist Oswald T. Avery who, in line with the reductionist mechanistic metaphysics of Jacques Loeb, attempted to explain basic life phenomena through chemistry; and the theoretical physicist Max Delbrück who, influenced by Bohr's antimechanistic views, preferred to explain these phenomena without chemistry. Avery's and Delbrück's most important studies took place concurrently. Thus analysis of their contrasting approaches lends itself to examination of the Weltanschauungen view concerning the role of fundamental (metaphysical) assumptions in scientific change, that is, the view that empirical research cannot be neutral in regard to the worldviews of the researchers. This study shows that the initial ostensible disparity (non-integratibility) of the two approaches lasted for just a short time. Ironically it was a student of Delbrück's school, James Watson, who (with Crick) proposed a chemical model, the DNA double helix, as a solution to Delbrück's problem. The structure of DNA has not been seriously challenged over the past half century Moreover, Watson's and Crick's work did not call into question the validity of Delbrück's research, but opened it up to entirely new approaches. The case of Avery and Delbrück demonstrates that after initial obstacles were overcome the different fundamental attitudes and the resulting research practices were capable of integration.
What Roles Can Scientists Play in Public Discourse?
NASA Astrophysics Data System (ADS)
Oppenheimer, Michael
2011-04-01
What is a useful and proper role for scientists in the public arena? How can we best discriminate where the boundary lies between expert knowledge and values or political opinion, and how can we properly honor that line? What can we expect in the way of reception for our interventions, and how can we increase their efficacy? Involvement in public policy debates is a common and accepted role for scientists in many disciplines. In the sciences related to public health, it is taken for granted that experts will talk about the implications of their research for public policy, whether in regard to smoking, diet, or disease spread. There is also a remarkable track record of geoscientists taking a lead role in the public arena and actually affecting public policy—F. Sherwood Rowland and Mario Molina collaborated on ozone depletion research at the Department of Chemistry at University of California, Irvine and then went on to make outstanding public contributions, as have James Hansen (at NASA's Goddard Institute for Space Studies); Robert Watson (first at NASA, then at the University of East Anglia); and, of course, the late Stephen Schneider (first at the U.S. National Center for Atmospheric Research, then Stanford) on climate. Some “public” geoscientists have restricted their activities to interpreting science for the wider public, while others have endorsed specific policy initiatives (see Figure 1). I firmly believe that the quality of public discourse and the information reaching policy makers were better for their interventions.
ERIC Educational Resources Information Center
White, John
2004-01-01
In "EPAT", vol. 36, no. 1, 2004, James Muir takes the author and fellow philosophers of education to task for their ignorance of the history of philosophy of education. "[T]oo many currently influential educationists, Professor White in particular, are literally unaware that educational philosophy has a history more than three hundred years in…
Moll, Friedrich H; Halling, Thorsten; Hansson, Nils; Fangerau, Heiner
2017-03-01
In 1902, the Berlin Jewish urologist James Israel was nominated for the Nobel Prize in physiology or medicine. Taking scholar, social, and political aspects into consideration, this biographical essay traces how James Israel gained a sound scientific reputation especially in kidney surgery within Imperial Germany and its antisemitic attitude and how he promoted urology to become a specialty in its own right.
2003-10-30
KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, STS-114 Pilot James Kelly (center) and Mission Specialist Wendy Lawrence, who was recently added to the mission crew, look at the nose cap recently removed from Atlantis. The STS-114 crew is at KSC to take part in equipment familiarization.
Key Understandings in School Mathematics: 1
ERIC Educational Resources Information Center
Watson, Anne
2010-01-01
This article is the first in a series which draws on findings from Nunes, Watson and Bryant (2009): "Key understandings in school mathematics: a report to the Nuffield Foundation." The Nuffield report is soundly based on research about how children learn some of the concepts involved in mathematics. In this series of articles the author takes key…
Teaching beyond "Once Upon a Time."
ERIC Educational Resources Information Center
Ballentine, Darcy; Hill, Lisa
2000-01-01
Argues that the purpose of teaching students to read includes challenging children to take up books that contain "dangerous truths." Discusses two such books: "Forged by Fire" by Sharon Draper and "The Watsons Go to Birmingham--1963" by Christopher Paul Curtis. Includes children's statements regarding why they insist on being able to read good…
Beyond Walls: A Strategic Plan for James White Library.
ERIC Educational Resources Information Center
Andrews Univ., Berrien Springs, MI. James White Library.
The strategic plan for the James White Library of Andrews University uses the phrase "beyond walls," rather than the catchphrase "library without walls," to acknowledge that printed matter is here to stay but that the paradigm in which it operates is open to innovation and exploration. The fundamental changes taking place in…
Dr. John Mather and the James Webb Space Telescope
2017-12-08
Nobel Laureate and James Webb Space Telescope project scientist Dr. John Mather takes a selfie with the telescope. May 4, 2016 was a rare day for JWST, as it briefly faced the cleanroom observation window. The telescope was eventually rotated face-down in prep for the installation of the flight instruments. Credit: Meredith Gibb
The Towers Watson Approach to Improving Corporate Wellness.
Wootton, Adam
2012-06-01
Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.
ERIC Educational Resources Information Center
Gregg, Kevin R.
2006-01-01
In recent years, a number of researchers in the field of second language acquisition have voiced discontent regarding the tendency of second language acquisition (SLA) research to be conducted within a framework of cognitive science (Firth and Wagner, 1997; Atkinson, 2002; Johnson, 2004). Watson-Gegeo (2004) expresses this same discontent, and…
2003-10-30
KENNEDY SPACE CENTER, FLA. - Walking away from the T-38 jet aircraft that brought them to KSC are STS-114 Mission Specialist Wendy Lawrence and Pilot James Kelly. Lawrence is a new addition to the crew. They and other crew members are at KSC to take part in crew equipment and orbiter familiarization.
Weighted Watson-Crick automata
NASA Astrophysics Data System (ADS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-07-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
ERIC Educational Resources Information Center
Manisaligil, Alperen; Bilimoria, Diana
2016-01-01
We describe an in-class activity that helps students improve their skills in media selection and use to reinforce effective communication. The activity builds on media richness and channel expansion theories through an examination of the media selection and use of NBA athlete LeBron James and Cleveland Cavaliers majority owner Dan Gilbert during…
Space perception and William James's metaphysical presuppositions.
Farrell, Martin J
2011-05-01
William James's overtly philosophical work may be more continuous with his psychological work than is sometimes thought. His Essays in Radical Empiricism can be understood as an explicit statement of the absolute presupposition that formed the basis of Jamesian psychology: that direct experience is primary and has to be taken at face value. An examination of James's theory of space perception suggests that, even in his early work, he presupposed the primacy of direct experience, and that later changes in his account of space perception can be understood as making his view more consistent with this presupposition. In his earlier view of space perception, James argued that sensations were directly experienced as spatial, though he accepted that spatial relations between sensations may be constructed by higher order thought. In his later view, however, James argued that spatial relations were just as directly experienced as sensations. The work of T. H. Green may have prompted James to recognize the full consequence of his ideas and to realize that taking experience at face value required that spatial relations be thought of as intrinsic to experience rather than the result of intellectual construction.
Amphiphiles for DNA Supramolecular Assemblies
2005-11-15
to drug or biomolecule delivery systems. In order to take advantage of forces that hold nucleic acid helices together, (Watson- Crick/Hoogsteen...supramolecular assemblies that highlight the underlying principles are evident in numerous biological (e.g., lipids) and synthetic (e.g., nanofibers ) systems.2...3). Additionally, they form hydrogels and organogels. The supramolecular systems obtained are promising in many aspects and could lead to new types
Data Discovery with IBM Watson
NASA Astrophysics Data System (ADS)
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
Race in Play: Understanding the Socio-Cultural World of Student Athletes
ERIC Educational Resources Information Center
James, Carl E.
2005-01-01
Dr. Carl E. James is well known for his work in the area of the Sociology of Sport. Race in Play is on the continuum of his earlier research in the sociology of sport, and youth, race, and education. James takes the reader on an edifying walk through the structural, institutional community which supports and sustains sports, at the same time…
Astronaut James Newman evaluates tether devices in Discovery's payload bay
1993-09-16
Astronaut James H. Newman, mission specialist, uses a 35mm camera to take a picture of fellow astronaut Carl E. Walz (out of frame) in Discovery's cargo bay. The two were engaged in an extravehicular activity (EVA) to test equipment to be used on future EVA's. Newman is tethered to the starboard side, with the orbital maneuvering system (OMS) pod just behind him.
Evolution of the Air Component Commander Post Goldwater-Nichols
2013-06-01
example, before Brigadier General James Mattis led Marine forces in the taking of Kandahar, he spoke with Moseley; and they agreed to conduct the...These separated commands and the division of airpower, along 3 James A. Winnefeld and Dana J...Biography: Lieutenant General Michael C. Short,” July 2000., http://www.af.mil/information/ bios /bio.asp?bioID=7136 (accessed March 20, 2013). 27 Short
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes andmore » fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.« less
2001-02-14
The STS-102 crew watches a slidewire basket speed down the line to the landing area. At left (backs to camera, back to front) are Commander James Wetherbee, Mission Specialists Susan Helms and Paul Richards. At right are (left to right) Mission Specialists Andrew Thomas and James Voss and Pilot James Kelly. Not seen is Mission Specialist Yury Usachev. The crew is taking part in Terminal Countdown Demonstration Test activities, which include the emergency exit training and a simulated launch countdown. STS-102 is the eighth construction flight to the International Space Station, with Space Shuttle Discovery carrying the Multi-Purpose Logistics Module Leonardo. Launch on mission STS-102 is scheduled for March 8
The human genome contracts again.
Pavlichin, Dmitri S; Weissman, Tsachy; Yona, Golan
2013-09-01
The number of human genomes that have been sequenced completely for different individuals has increased rapidly in recent years. Storing and transferring complete genomes between computers for the purpose of applying various applications and analysis tools will soon become a major hurdle, hindering the analysis phase. Therefore, there is a growing need to compress these data efficiently. Here, we describe a technique to compress human genomes based on entropy coding, using a reference genome and known Single Nucleotide Polymorphisms (SNPs). Furthermore, we explore several intrinsic features of genomes and information in other genomic databases to further improve the compression attained. Using these methods, we compress James Watson's genome to 2.5 megabytes (MB), improving on recent work by 37%. Similar compression is obtained for most genomes available from the 1000 Genomes Project. Our biologically inspired techniques promise even greater gains for genomes of lower organisms and for human genomes as more genomic data become available. Code is available at sourceforge.net/projects/genomezip/
ERIC Educational Resources Information Center
Kuntz, Elmer Lee
Relationships were investigated between (1) General Aptitude Test Battery scores and trainee selection criteria in a manpower training program at the James Connally Technical Institute, Waco, Texas, and (2) trainee success in gaining training related employment and a salary increase. Subjects (244 trainees taking eight classes in mechanics,…
2011-10-01
Space Farm 7 Program; NASA Day at the Dell'osso Family Farm, Lathrop,CA for the opening of the Kepler Corn Maze. Lots of fun activities were available and Kepler scientists gave talks and hands on demos to the audience of kids and adults alike to better understand Kepler and it's mission. Eric James, Ames photographer stops to read the Kepler maze know you mission sign. Photo take by Maria James.
76 FR 55425 - Post Office Closing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-07
... the closing of the Watson, Alabama post office has been filed. It identifies preliminary steps and... Postal Service's determination to close the Watson post office in Watson, Alabama. The petition was filed...
STS-101 Mission Specialist Williams takes his seat in Atlantis during TCDT
NASA Technical Reports Server (NTRS)
2000-01-01
STS-101 Mission Specialist Jeffrey N. Williams takes his seat inside Space Shuttle Atlantis before taking part in a simulated launch countdown. The countdown is part of Terminal Countdown Demonstration Test (TCDT) activities that also include emergency egress training and familiarization with the payload. Other crew members taking part are Commander James D. Halsell Jr., Pilot Scott J. 'Doc' Horowitz and Mission Specialists Mary Ellen Weber, James Voss, Susan Helms, and Yuri Usachev of Russia. During their mission to the International Space Station, the STS-101 crew will be delivering logistics and supplies, plus preparing the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch April 24 at 4:15 p.m. from Launch Pad 39A.
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
NASA Astrophysics Data System (ADS)
Zirkel, Jack
Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”
John B. Watson's Legacy: Learning and Environment.
ERIC Educational Resources Information Center
Horowitz, Frances Degen
1992-01-01
Evaluates John B. Watson's contributions to developmental psychology. Watson's insistence on objective methodology in psychology retains its influence, but his extreme environmentalism has been rejected. His concern with the principles of learning is reflected in the work of Hull and Skinner. (BC)
STS-102 crew talks to media at Launch Pad 39B during TCDT
NASA Technical Reports Server (NTRS)
2001-01-01
KENNEDY SPACE CENTER, Fla. -- During Terminal Countdown Demonstration Test activities, the STS-102 crew takes time to talk to the media at the slidewire basket landing near Launch Pad 39B. From left to right are Commander James Wetherbee; Mission Specialists Yury Usachev, Andrew Thomas, James Voss, Susan Helms and Paul Richards; and Pilot James Kelly. Voss, Helms and Usachev are the Expedition Two crew who will be the second resident crew on the International Space Station. They will replace Expedition One, who will return to Earth with Discovery. STS-102 is the eighth construction flight to the International Space Station, with Space Shuttle Discovery carrying the Multi-Purpose Logistics Module Leonardo Launch on mission STS-102 is scheduled for March 8.
STS-102 crew meets with media at Launch Pad 39B during TCDT
NASA Technical Reports Server (NTRS)
2001-01-01
KENNEDY SPACE CENTER, Fla. -- During Terminal Countdown Demonstration Test activities, the STS-102 crew takes time to talk to the media at the slidewire basket landing near Launch Pad 39B. From left to right are Commander James Wetherbee; Mission Specialists Yury Usachev, Andrew Thomas, James Voss, Susan Helms and Paul Richards; and Pilot James Kelly. Voss, Helms and Usachev are the Expedition Two crew who will be the second resident crew on the International Space Station. They will replace Expedition One, who will return to Earth with Discovery. STS-102 is the eighth construction flight to the International Space Station, with Space Shuttle Discovery carrying the Multi-Purpose Logistics Module Leonardo Launch on mission STS-102 is scheduled for March 8.
Oblique perspective of portal, due north. Bridge has gable roof ...
Oblique perspective of portal, due north. Bridge has gable roof clad with wood shingles and has board and batten siding. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
Innovation Symposium 2017: Transforming the Organization
2017-05-31
ones. Innovation can also take the form of discontinuing an inefficient or out-of-date service, system, or process.3 An Exponential Organization...compelling reasons for this goes beyond the burning of fossil fuels to the fact that an electric car has 90 percent fewer parts, making it exponentially...winner, in a showdown of trivial expertise. In 2016, Watson diagnosed a woman’s rare form of leukemia in just 10 minutes after doctors had spent
Fatigue Crack Initiation Mechanics of Metal Aircraft Structures
1988-08-01
Thresholds) (Ref. 6) and are included as Appendix A. In summary, two flow stresses were identified. Microplastic flow takes place in all grains at fully...R.O. Ritchie and E.A. Starke, EMAS, 93-101 (1987). 7. M.R. James and W.L. Morris, "Load Sequence Effects on the Deformation of Isolated Microplastic ...417 (1980). 17. M.R. James and W.L. Morris, "The Effect of Microplastic Surface Deformation on the Growth of Small Cracks," Small Fatigue Cracks, R.O
1985-09-01
technology issue is expected to take years of research (20:11). According to Lt Gen James A. Abrahamson, director of the SDI organization heading up...from occurring (14:79). A Wqhite House Panel known as the (Dr. James ) Fletcher Defensive Technologies Study Group has pointed out that, in the past...Handbook of Artificial Intelligence. Volume I. Los Altos CA: WilliamKaufmann Inc., 1981. 5. Basden , Andrew. "On the Application of Expert Systems,N
Archeological Testing at Fort St. Leon (16PL35), Plaquemines Parish, Louisiana.
1983-05-01
repaired. During the year 1812, President James Madison ordered - Brigadier General James Wilkinson to proceed to New Orleans and take command of the...HUMAN Category and Description # of Pieces Provenience Cranial fragment 1 BHT 5 Vertebral fragment 1 BHT 5 Lumbar vertebra 1 BHT 7 TOTAL 3 Human bone was...Clay 0 1 motor /,Unoxcavated Vertical Scales aft Meters Above MGL. Test Unit 8 W N S . .- 2.00 ____-- 1.50 W MIt0 --- - UW - -- NORTH EAST Z Figure 50
2000-04-19
STS029-04-029 (13-18 March 1989) --- Astronaut Michael L. Coats appears to like the status of the STS-29 flight as he offers a big smile from the commander's station on the flight deck. He takes a momentary break from updating the crew activity plan (CAP) to pose for the photo. This photographic frame was among NASA's third STS-29 photo release. Monday, March 20, 1989. Crew members were astronauts Michael L. Coats, John E. Blaha, James F. Buchli, Robert C. Springer and James P. Bagian. Photo credit: NASA
Oblique perspective, due east by 70 degrees. Note concrete pier, ...
Oblique perspective, due east by 70 degrees. Note concrete pier, added CA. 1930's. Other piers and abutments are heavily mortared rubble stone. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA
Some Lady! A Conversation with Dorothy Watson, Outstanding Educator in the Language Arts.
ERIC Educational Resources Information Center
Bishop, Rudine Sims
2002-01-01
Presents a conversation with Dorothy Watson, the 2002 Outstanding Educator in the Language Arts recipient. Hopes that this profile will provide insight into Dorothy Watson and her intellectual foundations, her humaneness, and her passion for teaching and learning. (SG)
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
78 FR 52230 - Government/Industry Aeronautical Charting Forum Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-22
...: [email protected] . For information relating to the Charting Group, contact Valerie S. Watson...) 427-5155; Email: valerie.s.watson@faa.gov . SUPPLEMENTARY INFORMATION: Pursuant to Sec. 10(a)(2) of... if time permits. Issued in Washington, DC, on August 15, 2013. Valerie S. Watson, Co-Chair...
77 FR 1471 - The Historically Black College and University Capital Financing Advisory Board
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-10
... INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black College and University Capital...; telephone: (202) 219-7037; fax: (202) 502-7852; email: donald.watson@ed.gov . Individuals who use a..., assistance listening devices, or materials in alternative format) should notify Donald Watson at (202) 219...
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-20
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-25
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
Propagation of Species at Risk Atlantic Pigtoe on Military Installations
2010-04-30
adult mussels are constantly being adapted to meet the needs of each species. 6.0. PROCEDURES 6.1. Potential Host Fish Collection In order to...Watson) o VA freshwater mussel web atlas (Watson) o Freshwater gastropod of VA web atlas, Atlantic slope (Watson) 5) Other Issues of Interest
Historical Review of Emergency Tourniquet Use to Stop Bleeding
2012-02-01
comment to, “More lives have been lost than were ever saved by the use of the tourniquet.”49 Watson- Jones concluded that the emergency tourniquet was a dan...in major limb trauma. J Trauma 2008;64: S38–50. 21. Kragh JF Jr, Littrel ML, Jones JA, et al. Battle casualty survival with emergency tourniquet use...Watson- Jones . J Bone Joint Surg 1972;54B:569–75. 48. Watson- Jones R. Fractures and Joint Injuries. London: Livingstone; 1955:121–2. 49. Watson- Jones R
NASA Astrophysics Data System (ADS)
Maling, George C.
2005-09-01
Bill Lang joined IBM in the late 1950s with a mandate from Thomas Watson Jr. himself to establish an acoustics program at IBM. Bill created the facilities in Poughkeepsie, developed the local program, and was the leader in having other IBM locations with development and manufacturing responsibilities construct facilities and hire staff under the Interdivisional Liaison Program. He also directed IBMs acoustics technology program. In the mid-1960s, he led an IEEE standards group in Audio and Electroacoustics, and, with the help of James Cooley, Peter Welch, and others, introduced the fast Fourier transform to the acoustics community. He was the convenor of ISO TC 43 SC1 WG6 that began writing the 3740 series of standards in the 1970s. It was his suggestion to promote professionalism in noise control engineering, and, through meetings with Leo Beranek and others, led the founding of INCE/USA in 1971. He was also a leader of the team that founded International INCE in 1974, and he served as president from 1988 until 1999.
STS-102 crew talks to media at Launch Pad 39B during TCDT
NASA Technical Reports Server (NTRS)
2001-01-01
KENNEDY SPACE CENTER, Fla. -- During Terminal Countdown Demonstration Test activities, the STS-102 crew takes time to talk to the media at the slidewire basket landing near Launch Pad 39B. With the microphone (left) is Commander James Wetherbee; the others are (left to right) Mission Specialists Yury Usachev, Andrew Thomas, James Voss, Susan Helms and Paul Richards; and Pilot James Kelly. STS-102 is the eighth construction flight to the International Space Station, with Space Shuttle Discovery carrying the Multi-Purpose Logistics Module Leonardo. Voss, Helms and Usachev are the Expedition Two crew who will be the second resident crew on the International Space Station. They will replace Expedition One, who will return to Earth with Discovery. Launch on mission STS-102 is scheduled for March 8.
The multiple personalities of Watson and Crick strands
2011-01-01
Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550
75 FR 42081 - The Historically Black College and University Capital Financing Advisory Board
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-20
..., DC. 20001. FOR FURTHER INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black... 6071, Washington, DC 20006; telephone: (202) 219-7037; fax: (202) 502-7852; e-mail: donald.watson@ed...) should notify Donald Watson at 202 219-7037, no later than July 16, 2010. We will attempt to meet...
76 FR 5424 - Motor Carrier Safety Advisory Committee; Request for Nominations
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-31
... FURTHER INFORMATION CONTACT: Ms. Shannon L. Watson, MCSAC Liaison, FMCSA, at 202-385-2395 or via e-mail at Shannon.Watson@dot.gov . SUPPLEMENTARY INFORMATION: I. Background Section 4144 of the Safe, Accountable...://mcsac.fmcsa.dot.gov/ , completed on-line, and e-mailed to Shannon L. Watson, MCSAC liaison, at Shannon...
Five Stage Missile Research Rocket, Wallops Island , 1957
1957-11-19
**Note also copied and numbered as L90-3749. -- L57-4827 caption: Take off of a five-stage missile research rocket from Wallops Island in 1957. The first two stages propelled the model to about 100,000 feet the last three stages were fired on a descending path to simulate the reentry conditions of ballistic missiles. -- Photograph published in Winds of Change, 75th Anniversary NASA publication (page 72), by James Schultz. -- Photograph also published in Engineer in Charge: A History of the Langley Aeronautical Laboratory, 1917-1958 by James R. Hansen (page 380).
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-06
... Affairs Officer) 90 Hennepin Avenue, Minneapolis, Minnesota 55480-0291: 1. Thomas Watson, Grand Forks, North Dakota, as an individual and as trustee, and Thomas Watson and Toby Kommer, Fargo, North Dakota... indirectly acquire control of Bank Forward, Hannaford, North Dakota. In addition, Mr. Watson and Mr. Kommer...
Making IBM's Computer, Watson, Human
ERIC Educational Resources Information Center
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-17
... 20590, phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson..., 1200 New Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Ms. Watson...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-06
..., phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson, Senior... Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Shannon Watson at (202...
Watson and Siri: The Rise of the BI Smart Machine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Troy Hiltbrand
Over the past few years, the industry has seen significant evolution in the area of human computer interaction. The era of the smart machines is upon us, with automation taking on a more advanced role than ever before, permeating into areas that have traditionally only been fulfilled by human beings. This movement has the potential of fundamentally altering the way that business intelligence is executed across the industry and the role that business intelligence has in all aspects of decision making.
2005-07-01
induced selective Biochem Behav 37:825-829 tolerance in the rat. Pharmacol Biochem Behav 39:407-413 Watson NV, Gorzalka BB (1992) Concurrent wet dog shakes...Take S, Hori T, Oomura Y (1992) In vivo measurement wet- dog shake behaviour induced by 5-hydroxytryptophan in of hypothalamic serotonin release by...or the selective D2 antagonist raclopride into the SN was used to assess the differential contributions of these two receptor subtypes on glutamate
STS-102 crew gets emergency exit training at Launch Pad 39B during TCDT
NASA Technical Reports Server (NTRS)
2001-01-01
KENNEDY SPACE CENTER, Fla. -- Getting training on the use of the slidewire basket for emergency exits from the launch pad are STS-102 Mission Specialists Paul Richards and Andrew Thomas. The rest of the crew includes Commander James Wetherbee, Pilot James Kelly and Mission Specialists James Voss, Susan Helms and Yury Usachev. The crew is taking part in Terminal Countdown Demonstration Test activities, which include a simulated launch countdown. STS-102 is the eighth construction flight to the International Space Station, with Space Shuttle Discovery carrying the Multi-Purpose Logistics Module Leonardo. Voss, Helms and Usachev are the Expedition Two crew who will be the second resident crew on the International Space Station. They will replace Expedition One, who will return to Earth with Discovery. Launch on mission STS-102 is scheduled for March 8.
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
Farson, Richard; Keyes, Ralph
2002-08-01
"The fastest way to succeed," IBM's Thomas Watson, Sr., once said, "is to double your failure rate." In recent years, more and more executives have embraced Watson's point of view, coming to understand what innovators have always known: Failure is a prerequisite to invention. But while companies may grasp the value of making mistakes at the level of corporate practices, they have a harder time accepting the idea at the personal level. People are afraid to fail, and corporate culture reinforces that fear. In this article, psychologist and former Harvard Business School professor Richard Farson and coauthor Ralph Keyes discuss how companies can reduce the fear of miscues. What's crucial is the presence of failure-tolerant leaders--executives who, through their words and actions, help employees overcome their anxieties about making mistakes and, in the process, create a culture of intelligent risk-taking that leads to sustained innovation. Such leaders don't just accept productive failure, they promote it. Drawing from their research in business, politics, sports, and science, the authors identify common practices among failure-tolerant leaders. These leaders break down the social and bureaucratic barriers that separate them from their followers. They engage at a personal level with the people they lead. They avoid giving either praise or criticism, preferring to take a nonjudgmental, analytical posture as they interact with staff. They openly admit their own mistakes rather than trying to cover them up or shifting the blame. And they try to root out the destructive competitiveness built into most organizations. Above all else, failure-tolerant leaders push people to see beyond traditional definitions of success and failure. They know that as long as a person views failure as the opposite of success, rather than its complement, he or she will never be able to take the risks necessary for innovation.
Møllendal, Harald; Samdal, Svein; Guillemin, Jean-Claude
2016-03-31
The microwave spectra of mercaptoacetonitrile (HSCH2C≡N) and one deuterated species (DSCH2C≡N) were investigated in the 7.5-124 GHz spectral interval. The spectra of two conformers denoted SC and AP were assigned. The H-S-C-C chain of atoms is synclinal in SC and anti-periplanar in AP. The ground state of SC is split into two substates separated by a comparatively small energy difference resulting in closely spaced transitions with equal intensities. Several transitions of the parent species of SC deviate from Watson's Hamiltonian. Only slight improvements were obtained using a Hamiltonian that takes coupling between the two substates into account. Deviations from Watson's Hamiltonian were also observed for the parent species of AP. However, the spectrum of the deuterated species, which was investigated only for the SC conformer, fits satisfactorily to Watson's Hamiltonian. Relative intensity measurements found SC to be lower in energy than AP by 3.8(3) kJ/mol. The strength of the intramolecular hydrogen bond between the thiol and cyano groups was estimated to be ∼2.1 kJ/mol. The microwave work was augmented by quantum chemical calculations at CCSD and MP2 levels using basis sets of minimum triple-ζ quality. Mercaptoacetonitrile has astrochemical interest, and the spectra presented herein should be useful for a potential identification of this compound in the interstellar medium. Three different ways of generating mercaptoacetonitrile from compounds already found in the interstellar medium were explored by quantum chemical calculations.
ScienceCasts: Readying the Webb Telescope for Launch
2017-04-17
Stringent testing is underway to prove the James Webb Space Telescope can handle an Earth-shaking take-off and still capture the universe’s first light while deeply ensconced in the hyper-cold of space.
NASA Astrophysics Data System (ADS)
Osterbrock, D. E.
1996-05-01
George C. Comstock, the third director of Washburn Observatory, had a long and interesting career at Wisconsin. Born in Madison, he did his undergraduate work at Michigan under James Watson. From him Comstock learned the classical astronomy of stellar positions and celestial mechanics. He had one year of graduate work at Michigan before going to Madison as Watson's assistant in 1880, and remained after the latter's death as E.S. Holden's assistant. At Wisconsin, Comstock also studied law at the UW Law School in his ``spare time", to have an alternate career path. He was admitted to the bar in 1883 but never practiced. From 1885-7 he was on the Ohio State faculty with a summer working at Lick Observatory; then in 1887 became associate director back at Washburn Observatory. Two years later he succeeded to the full directorship, and kept the post until he retired in 1922 at the age of 67. All Comstock's research was in positional astronomy, and he considered his most important work to be the measurement of stellar aberration and atmospheric refraction. He also measured double stars with the 15-inch Washburn refractor. His main duty at UW was teaching, mostly ``practical astronomy" for civil engineering students. Comstock wrote several text books on astronomy, surveying, and least squares. He was the first head of the UW Graduate School, set up by President Charles R. Van Hise in 1904. Comstock was a highly effective administrator, and did much to build up research at UW. His own most successful students were Sidney D. Townley, Joel Stebbins, and Sebastian Albrecht. Because of his legal training, Comstock was involved as an officer in many scientific societies. He was one of the organizers of the AAS, its first secretary, and later its vice president, then president. He retired in 1922, and was succeeded by Stebbins, whom he helped to bring back to Madison from Illinois. After his retirement, Comstock lived in Beloit until his death in 1934.
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
ERIC Educational Resources Information Center
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
NASA Astrophysics Data System (ADS)
Veerakamolmal, Pitipong; Lee, Yung-Joon; Fasano, J. P.; Hale, Rhea; Jacques, Mary
2002-02-01
In recent years, there has been increased focus by regulators, manufacturers, and consumers on the issue of product end of life management for electronics. This paper presents an overview of a conceptual study designed to examine the costs and benefits of several different Product Take Back (PTB) scenarios for used electronics equipment. The study utilized a reverse logistics supply chain model to examine the effects of several different factors in PTB programs. The model was done using the IBM supply chain optimization tool known as WIT (Watson Implosion Technology). Using the WIT tool, we were able to determine a theoretical optimal cost scenario for PTB programs. The study was designed to assist IBM internally in determining theoretical optimal Product Take Back program models and determining potential incentives for increasing participation rates.
James Cronin, CP Violation, and the Pierre Auger Observatory
Lawrence Award in 1976 for major experimental contributions to particle physics including fundamental work Galactic Powerhouses Top Some links on this page may take you to non-federal websites. Their policies may
2003-10-30
KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, STS-114 crew members look at the tiles underneath Atlantis. From center, left to right (in uniform), are Pilot James Kelly, Mission Specialist Soichi Noguchi, Mission Specialists Wendy Lawrence and Stephen Robinson. Accompanying them at left Glenda Laws, EVA Task Leader, with United Space Alliance at Johnson Space Center. Noguchi is with the Japan Aerospace Exploration Agency, JAXA. The STS-114 crew is at KSC to take part in crew equipment and orbiter familiarization.
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Morari, Cristian; Bogdan, Diana; Muntean, Cristina M
2012-11-01
The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.
ERIC Educational Resources Information Center
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
The STS-101 crew takes part in CEIT activities at SPACEHAB.
NASA Technical Reports Server (NTRS)
2000-01-01
Members of the STS-101 crew take part in Crew Equipment Interface Test (CEIT) activities at SPACEHAB, in Cape Canaveral, Fla., where they are learning about some of the equipment they will be working with on their mission to the International Space Station. Mission Specialist Susan Helms holds one component while Commander James Halsell and Mission Specialist Yuri Usachev look on, and Mission Specialists Mary Ellen Weber and Jeffrey Williams discuss another. Also taking part in the CEIT are Pilot Scott Horowitz and Mission Specialist James Voss. The green component on the table is an air duct to be installed in the Russian module Zarya to improve ventilation. The STS-101 crew will be responsible for preparing the Space Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station and deliver logistics and supplies. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch no earlier than April 13 from Launch Pad 39A.
STS-102 crew poses on the FSS at Launch Pad 39B during TCDT
NASA Technical Reports Server (NTRS)
2001-01-01
KENNEDY SPACE CENTER, Fla. -- The STS-102 crew poses for a photo on the 215-foot level of the Fixed Service Structure. Behind them is Space Shuttle Discovery. Standing, left to right, are Mission Specialist Susan Helms, Pilot James Kelly, Mission Specialists Andrew Thomas and Paul Richards, Commander James Wetherbee and Mission Specialists Yury Usachev and James Voss. The crew is taking part in Terminal Countdown Demonstration Test activities, which include emergency exit training and a simulated launch countdown. STS-102 is the eighth construction flight to the International Space Station, with Space Shuttle Discovery carrying the Multi-Purpose Logistics Module Leonardo. Voss, Helms and Usachev are the Expedition Two crew who will be the second resident crew on the International Space Station. They will replace Expedition One, who will return to Earth with Discovery. Launch on mission STS-102 is scheduled for March 8.
L. James Rainwater and the Atomic Nuclei
described the experimental situation for nuclear quadrupole moments. It was a fortuitous situation made even given value after a lapse of time. Top Some links on this page may take you to non-federal websites
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer
2001-10-01
Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES...markers of the invasive phenotype in human breast cancer" Dr Peter H. Watson INTRODUCTION. The acquisition of the ability to invade is the single most
ERIC Educational Resources Information Center
Machiavelli, Nick
1992-01-01
Inspired by the survivalist strategies of James Clavell's protagonist in "King Rat," this article advises administrators how to practice creative insubordination by informally lobbying board members, winking at obstructive rules, and pursuing devious ends in their school's interest. The best administrators take chances, hiding their…
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.
Sawada, Tomohisa; Fujita, Makoto
2010-05-26
Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.
Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression.
Chen, Yanguang
2016-01-01
In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson's statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran's index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China's regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test.
The development of ensemble theory. A new glimpse at the history of statistical mechanics
NASA Astrophysics Data System (ADS)
Inaba, Hajime
2015-12-01
This paper investigates the history of statistical mechanics from the viewpoint of the development of the ensemble theory from 1871 to 1902. In 1871, Ludwig Boltzmann introduced a prototype model of an ensemble that represents a polyatomic gas. In 1879, James Clerk Maxwell defined an ensemble as copies of systems of the same energy. Inspired by H.W. Watson, he called his approach "statistical". Boltzmann and Maxwell regarded the ensemble theory as a much more general approach than the kinetic theory. In the 1880s, influenced by Hermann von Helmholtz, Boltzmann made use of ensembles to establish thermodynamic relations. In Elementary Principles in Statistical Mechanics of 1902, Josiah Willard Gibbs tried to get his ensemble theory to mirror thermodynamics, including thermodynamic operations in its scope. Thermodynamics played the role of a "blind guide". His theory of ensembles can be characterized as more mathematically oriented than Einstein's theory proposed in the same year. Mechanical, empirical, and statistical approaches to foundations of statistical mechanics are presented. Although it was formulated in classical terms, the ensemble theory provided an infrastructure still valuable in quantum statistics because of its generality.
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P < .001). Despite the high correlation, the Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist circumference (general and abdominal obesity) were correlated with the greater TBW overestimation by the Watson formula. We created separate equations for men and women based on weight and waist circumference. The main limitation of our study was the lack of an external validation for our novel estimating equation. Furthermore, though BIS has been validated against traditional reference standards, our assumption that it represents the "gold standard" for body compartment assessment may be flawed. The Watson formula generally overestimates TBW in chronic dialysis recipients, particularly in patients with the highest waist circumference. Widespread reliance on the Watson formula for derivation of TBW may lead to the underestimation of Kt/V urea. .
77 FR 13683 - Government/Industry Aeronautical Charting Forum Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-07
.... Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance & Regulatory..., on February 28, 2012. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum. [FR Doc. 2012-5293...
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding
2008-07-11
Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick
Yusupov, Marat; Yusupova, Gulnara
2014-01-01
The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524
78 FR 12415 - Government/Industry Aeronautical Charting Forum Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-22
... Valerie S. Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance.... Issued in Washington, DC, on February 19, 2013. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum...
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Genetics Home Reference: Alagille syndrome
... my area? Other Names for This Condition Alagille-Watson Syndrome Alagille's syndrome arteriohepatic dysplasia (AHD) cardiovertebral syndrome ... hypoplasia hepatofacioneurocardiovertebral syndrome paucity of interlobular bile ducts Watson-Miller syndrome Related Information How are genetic conditions ...
20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. ...
20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. Gary Stich, operator. - Juniata Shops, Erecting Shop & Machine Shop, East of Fourth Avenue, between Fourth & Fifth Streets, Altoona, Blair County, PA
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
James Webb Space Telescope Sunshield Test Unfolds Seamlessly
2017-12-08
A major test of the sunshield for NASA’s James Webb Space Telescope was conducted recently by Northrop Grumman in Redondo Beach, California. For the first time, the five sunshield test layers were unfolded and separated; unveiling important insights for the engineers and technicians as to how the deployment will take place when the telescope launches into space. “These tests are critical and allow us to see how our modeling works and learn about any modifications we may need to make in our design as we move into sunshield flight production,” said Jim Flynn, Webb sunshield manager. The three-day test took place in July, taking seven engineers and six technicians about 20 hours to complete. On orbit, the sunshield will take several days to unfold. Read more here: 1.usa.gov/1vykZbk Credit: Northrop Grumman/Alex Evers NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram
ERIC Educational Resources Information Center
Quezada, Reyes L.; Diaz, Delia M.; Sanchez, Maria
2003-01-01
Describes barriers to Latino parent involvement in educational activities, factors to consider when involving Latino parents, and two examples of Latino involvement programs in California: Family Literacy Workshop at James Monroe Elementary School, Madera Unified School District, and Parents Take P.A.R.T. (Parent Assisted Reading Training) at…
STS-101 crew members Weber and Williams take their seats in Atlantis during TCDT
NASA Technical Reports Server (NTRS)
2000-01-01
STS-101 Mission Specialists Mary Ellen Weber (left) and Jeffrey N. Williams (right) happily settle into their seats inside Space Shuttle Atlantis for a simulated launch countdown. The countdown is part of Terminal Countdown Demonstration Test (TCDT) activities that also include emergency egress training and familiarization with the payload. Other crew members taking part are Commander James D. Halsell Jr., Pilot Scott J. 'Doc' Horowitz and Mission Specialists James Voss, Susan Helms and Yuri Usachev of Russia. During their mission to the International Space Station, the STS-101 crew will be delivering logistics and supplies, plus preparing the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch April 24 at 4:15 p.m. from Launch Pad 39A.
2003-10-30
KENNEDY SPACE CENTER, FLA. - Members of the STS-114 crew look over flight equipment in the Orbiter Processing Facility. From left are Glenda Laws, EVA Task Leader, with United Space Alliance at Johnson Space Center, Mission Specialists Soichi Noguchi, Andy Thomas, Charles Camarda and Wendy Lawrence. Noguchi is with the Japan Aerospace Exploration Agency, JAXA. Not seen are Mission Commander Eileen Collins, Pilot James Kelly and Mission Specialist Stephen Robinson. The STS-114 crew is at KSC to take part in crew equipment and orbiter familiarization.
2003-10-30
KENNEDY SPACE CENTER, FLA. - The STS-114 mission crew walks through the Orbiter Processing Facility looking at the tiles underneath Atlantis. From left are Mission Specialists Andy Thomas, Stephen Robinson, Soichi Noguchi and Charles Camarda (pointing); Commander Eileen Collins; and Mission Specialist Wendy Lawrence. At far right Glenda Laws, EVA Task Leader, with United Space Alliance at Johnson Space Center. Not seen is Pilot James Kelly. Noguchi is with the Japan Aerospace Exploration Agency, JAXA. The STS-114 crew is at KSC to take part in crew equipment and orbiter familiarization.
Code of Federal Regulations, 2010 CFR
2010-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
76 FR 53924 - Merchant Mariner Medical Advisory Committee
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-30
... and swearing in of the new members; (3) Remarks from Coast Guard Leadership, Rear Admiral J. A. Watson.../presentations; and (3) Closing remarks/plans for next meeting. Dated: August 24, 2011. J. A. Watson, Rear...
Code of Federal Regulations, 2013 CFR
2013-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2011 CFR
2011-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2014 CFR
2014-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
Code of Federal Regulations, 2012 CFR
2012-04-01
... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...
77 FR 40947 - Motor Carrier Safety Advisory Committee (MCSAC): Membership Solicitation
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-11
.... Shannon L. Watson, Senior Advisor to the Associate Administrator for Policy, Federal Motor Carrier Safety....fmcsa.dot.gov/ , completed on-line and emailed to Shannon L. Watson, Senior Advisor to the Associate...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-15
.... Products LLC. 74,606 Watson Laboratories, Inc., Carmel, NY September 3, 2009. Watson Pharmaceuticals...--Enterprise Services), Virtual Workers Across the United States. 74,343 JohnsonDiversey Santa Cruz, CA...
Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching
2008-01-01
C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
How Many Cancers Are Linked with HPV Each Year?
... 24:1548–1556. 3 Viens LJ, Henley SJ, Watson M, Markowitz LE, Thomas CC, Thompson TD, Razzaghi ... Lynch CF, Hernandez BY, Lyu CW, Steinau M, Watson M, Wilkinson EJ, Hopenhayn C, Copeland G, Cozen ...
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 049185 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Olney Ave., Cherry Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880...
21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 50704 017139 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000842 Texas...
Commentary on Malone: Who Founded Behaviorism?
Reese, Hayne W
2015-05-01
Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.
Persuasive Writing and the Student-Run Symposium
ERIC Educational Resources Information Center
Mayer, James C.
2007-01-01
High school teacher James C. Mayer explains how a student-run symposium can promote "risk-taking and participation" and help students practice effective persuasion skills before demonstrating them in writing. The symposium places students in roles that encourage responsibility and ownership for discussion and learning, shifting the classroom…
STS-101 crew members enjoy a snack before getting ready for launch
NASA Technical Reports Server (NTRS)
2000-01-01
In the Operations and Checkout Building, the STS-101 crew gathers for a snack before suiting up for launch. From left are Mission Specialists Mary Ellen Weber and Yuri Usachev of Russia; Pilot Scott J. Horowitz; Commander James D. Halsell Jr.; and Mission Specialists Jeffrey N. Williams, Susan J. Helms and James S. Voss. The mission will take the crew to the International Space Station to deliver logistics and supplies and prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station.
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rebay, S.
This work is devoted to the description of an efficient unstructured mesh generation method entirely based on the Delaunay triangulation. The distinctive characteristic of the proposed method is that point positions and connections are computed simultaneously. This result is achieved by taking advantage of the sequential way in which the Bowyer-Watson algorithm computes the Delaunay triangulation. Two methods are proposed which have great geometrical flexibility, in that they allow us to treat domains of arbitrary shape and topology and to generate arbitrarily nonuniform meshes. The methods are computationally efficient and are applicable both in two and three dimensions. 11 refs.,more » 20 figs., 1 tab.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-05
..., Dallas, Texas 75201-2272: 1. Rebecca Watson Vizard, St. Joseph Louisiana; Michael Rene Vizard, St. Joseph... William Wade Watson, St. Joseph, Louisiana, (collectively known as the ``Vizard Family Group'') to retain...
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
77 FR 29696 - James Edgar Lundeen, Sr., M.D.; Dismissal of Proceeding
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-18
.... \\2\\ In accordance with the Administrative Procedure Act (APA), an agency ``may take official notice... General's Manual on the Administrative Procedure Act 80 (1947) (Wm. W. Gaunt & Sons, Inc., Reprint 1979). In accordance with the APA and DEA's regulations, Respondent is ``entitled on timely request to an...
NASA Astrophysics Data System (ADS)
Rao, Achintya
2017-12-01
Even the most avid physics enthusiast does not necessarily awaken each morning and turn their mind to the various physical processes they will encounter over the course of their day. Yet this is precisely the sort of journey that author James Kakalios takes us on in his book The Physics of Everyday Things.
ERIC Educational Resources Information Center
Dunker, Mary
2004-01-01
Though many people remember the eye-scanner identification device used in James Bond films in the 1980s, the technology remained a fiction until recently. Now, with the need for more secure systems and with the decrease in biometric technology costs, some colleges and universities are taking a close look at this same technology for security…
Algebraic Methods to Design Signals
2015-08-27
sequence pairs with optimal correlation values. 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially balanced incomplete block designs with two...IEEE Transactions Information Theory, Volume: 58, Issue: 11, Nov 2012, Page(s): 6968 – 6978 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially
Riemann tensor of motion vision revisited.
Brill, M
2001-07-02
This note shows that the Riemann-space interpretation of motion vision developed by Barth and Watson is neither necessary for their results, nor sufficient to handle an intrinsic coordinate problem. Recasting the Barth-Watson framework as a classical velocity-solver (as in computer vision) solves these problems.
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial “self,” are all incidental to its humanity. PMID:22942530
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geltman, S.
Recent measurements on CO{sub 2}-laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for {ital E}{sub 0}/2{omega}{sup 2}{lt}1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations inmore » perturbation theory shows that use of the {open_quote}{open_quote}outgoing{close_quote}{close_quote} wave final state gives much better agreement with experiment than does the {open_quote}{open_quote}ingoing{close_quote}{close_quote} wave final state, which is different from the choice made in early bremsstrahlung theory. {copyright} {ital 1996 The American Physical Society.}« less
Charpa, Ulrich
2008-01-01
This article opens with general and historical remarks on philosophy of science's problems with the concept of discovery. Then, drawing upon simple examples of Watson's and Crick's non-philosophical usage, I characterize phrases of the type "x discovers y" semantically. It will subsequently be shown how widespread philosophical discussion on discovery violates the semantic constraints of phrases of the type "x discovers y." Then I provide a philosophical reconstruction of "x discovers y" that is in keeping with the "folk" notion of discovery. The philosophical ingredients of this approach are taken from a certain aspect of action theory and from epistemological reliabilism. The approach draws upon the concept of superior action and connects this concept to progressive research. In contrast to normal actions, superior actions are primarily explained by competencies. This perspective includes reminders of what some nineteenth-century philosopher-scientists had advocated as a competence-oriented view on scientific research. Finally, this approach is applied to the case of Watson's and Crick's discovery.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Making IBM's Computer, Watson, Human.
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial "self," are all incidental to its humanity.
Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration
NASA Technical Reports Server (NTRS)
Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell
2018-01-01
Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.
Albach, R A; Shaffer, J G; Watson, R H
1965-10-01
Albach, Richard A. (Lutheran General Hospital, Park Ridge, Ill.), James G. Shaffer, and Robert H. Watson. Morphology, antigenicity, and nucleic acid content of the Bacteroides sp. used in the culture of Entamoeba histolytica. J. Bacteriol. 90:1045-1053. 1965.-Certain changes in morphology, antigenicity, and nucleic acid content that occur in a culture of Bacteroides sp. in the presence of penicillin G in CLG medium are described. This "variant" is one of seven recovered in several laboratories, all of which are descendants of the original Bacteroides isolated by Shaffer and Frye. Penicillin-inhibited cells of this culture are currently being used in the routine propagation of Entamoeba histolytica in CLG medium. Evidence is presented for the loss of ability to react with antibody in these penicillin-inhibited bacteria in CLG medium, when studied by fluorescent-antibody techniques. The implications of the antigenic changes observed as they pertain to similar antigenic studies of the amoebas are discussed. A pronounced reduction in the ribonucleic acid (RNA) content of such penicillin-inhibited cells was also observed. The potential importance of the changes that occur in the RNA of these cells with respect to considerations of the growth requirements of the amoebas is also discussed.
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
Critical Thinking in Adulthood.
ERIC Educational Resources Information Center
Fulton, Rodney D.
Critical thinking is often defined as that which a particular instrument measures. The most prominent tests are the Watson-Glaser Critical Thinking Appraisal, the Ennis-Weir Critical Thinking Essay Test, and the Cornell Critical Thinking Tests. Watson and Glaser's (1980) view of critical thinking is "a composite of attitudes, knowledge, and…
Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
Taking the Next Step: Confronting the Legacies of Slavery at Historic Sites
ERIC Educational Resources Information Center
Grim, Linnea; Wickens, K. Allison; Jecha, Jackie; Powell, Linda; Hawkins, Callie; Flanagan, Candra
2017-01-01
"Slavery is the ground zero of race relations," declared James and Lois Horton in their groundbreaking book, "Slavery and Public History." Engaging the history and legacy of slavery is a crucial step in understanding current U.S. society especially race relations. Historic sites that have connections to slavery have begun to…
Voss unpacks stowage bags in Destiny module
2001-05-03
ISS002-E-5246 (03 May 2001) --- Astronaut James S. Voss (left), Expedition Two flight engineer, unpacks a stowage bag while cosmonaut Yury V. Usachev, Expedition Two mission commander, takes notes in the U.S. Laboratory / Destiny module of the International Space Station (ISS). This image was recorded with a digital still camera.
The World Bank New Discourse and the 1999 Education Sector Strategy.
ERIC Educational Resources Information Center
de Siqueira, Angela C.
The climate of growing dissatisfaction in the developing world seems to have led to some changes in the World Bank's main discourse. The current World Bank president, James Wolfensohn, pointed out the existence of a "human crisis," besides the overemphasized financial one. He proposed a new development framework taking into account the…
2000-02-25
KENNEDY SPACE CENTER, FLA. -- Members of the STS-101 crew take part in Crew Equipment Interface Test (CEIT) activities at SPACEHAB, in Cape Canaveral, Fla., where they are learning about some of the equipment they will be working with on their mission to the International Space Station. Mission Specialist Susan Helms holds one component while Commander James Halsell and Mission Specialist Yuri Usachev look on, and Mission Specialists Mary Ellen Weber and Jeffrey Williams discuss another. Also taking part in the CEIT are Pilot Scott Horowitz and Mission Specialist James Voss. The green component on the table is an air duct to be installed in the Russian module Zarya to improve ventilation. The STS-101 crew will be responsible for preparing the Space Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station and deliver logistics and supplies. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch no earlier than April 13 from Launch Pad 39A
2000-02-25
KENNEDY SPACE CENTER, FLA. -- Members of the STS-101 crew take part in Crew Equipment Interface Test (CEIT) activities at SPACEHAB, in Cape Canaveral, Fla., where they are learning about some of the equipment they will be working with on their mission to the International Space Station. Mission Specialist Susan Helms holds one component while Commander James Halsell and Mission Specialist Yuri Usachev look on, and Mission Specialists Mary Ellen Weber and Jeffrey Williams discuss another. Also taking part in the CEIT are Pilot Scott Horowitz and Mission Specialist James Voss. The green component on the table is an air duct to be installed in the Russian module Zarya to improve ventilation. The STS-101 crew will be responsible for preparing the Space Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station and deliver logistics and supplies. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch no earlier than April 13 from Launch Pad 39A
2003-10-30
KENNEDY SPACE CENTER, FLA. - Members of the STS-114 crew look over flight equipment in the Orbiter Processing Facility. From left are Mission Commander Eileen Collins; Glenda Laws, EVA Task Leader, with United Space Alliance at Johnson Space Center; and Mission Specialists Soichi Noguchi and Charles Camarda. In the foreground is Mission Specialist Wendy Lawrence. Noguchi is with the Japan Aerospace Exploration Agency, JAXA. Not seen are Pilot James Kelly and Mission Specialists Andy Thomas and Stephen Robinson. The STS-114 crew is at KSC to take part in crew equipment and orbiter familiarization.
The STS-101 crew takes part in CEIT activities at SPACEHAB.
NASA Technical Reports Server (NTRS)
2000-01-01
At SPACEHAB, in Cape Canaveral, Fla., STS-101 Mission Specialists Susan Helms and Yuri Usachev, with Commander James Halsell, handle an air duct to be installed during their mission to the International Space Station. The air duct is for the Russian module Zarya to improve ventilation. At right are Mission Specialists Jeffrey Williams and Mary Ellen Weber. In the background at left is Pilot Scott Horowitz. Not shown is Mission Specialist James Voss. The crew is taking part in Crew Equipment Interface Test (CEIT) activities to learn about some of the equipment they will be working with on their mission to the Space Station. The STS-101 crew will be responsible for preparing the Space Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station and deliver logistics and supplies. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch no earlier than April 13 from Launch Pad 39A.
Kodak Mirror Assembly Tested at Marshall Space Flight Center
NASA Technical Reports Server (NTRS)
2003-01-01
This photo (rear view) is of one of many segments of the Eastman-Kodak mirror assembly being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
2003-04-09
This photo (a frontal view) is of one of many segments of the Eastman-Kodak mirror assembly being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
STS-101 crew enroute to Launch Pad 39A for a second launch attempt
NASA Technical Reports Server (NTRS)
2000-01-01
Waving to onlookers, the STS-101 crew eagerly walk to the waiting Astrovan that will take them to Launch Pad 39A and the second attempt at liftoff of Space Shuttle Atlantis. In their orange launch and entry suits, they are (left to right) Mission Specialists Susan J. Helms, Yuri Usachev, James S. Voss, Mary Ellen Weber and Jeffrey N. Williams; Pilot Scott J. Horowitz; and Commander James D. Halsell Jr. The first launch attempt on April 24 was scrubbed due to unfavorable weather conditions. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. Liftoff is targeted for 3:52 p.m. EDT. The mission is expected to last about 10 days, with Atlantis landing at KSC Saturday, May 6, about 11:53 a.m. EDT.
ERIC Educational Resources Information Center
Moore, J.
2011-01-01
Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…
ERIC Educational Resources Information Center
Watson, David
2014-01-01
In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…
Extreme Scale Computing Studies
2010-12-01
PUBLICATION IN ACCORDANCE WITH ASSIGNED DISTRIBUTION STATEMENT. *//Signature// //Signature// KERRY HILL, Program Manager BRADLEY J ...Research Institute William Carlson Institute for Defense Analyses William Dally Stanford University Monty Denneau IBM T. J . Watson Research...for Defense Analyses William Dally, Stanford University Monty Denneau, IBM T. J . Watson Research Laboratories Paul Franzon, North Carolina State
ERIC Educational Resources Information Center
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
Validating the Watson Glaser Critical Thinking Appraisal
ERIC Educational Resources Information Center
Hassan, Karma El; Madhum, Ghida
2007-01-01
This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Preparation and biomedical applications of programmable and multifunctional DNA nanoflowers
Lv, Yifan; Hu, Rong; Zhu, Guizhi; Zhang, Xiaobing; Mei, Lei; Liu, Qiaoling; Qiu, Liping; Wu, Cuichen; Tan, Weihong
2016-01-01
We describe a comprehensive protocol for the preparation of multifunctional DNA nanostructures termed nanoflowers (NFs), which are self-assembled from long DNA building blocks generated via rolling-circle replication (RCR) of a designed template. NF assembly is driven by liquid crystallization and dense packaging of building blocks, which eliminates the need for conventional Watson-Crick base pairing. As a result of dense DNA packaging, NFs are resistant to nuclease degradation, denaturation or dissociation at extremely low concentrations. By manually changing the template sequence, many different functional moieties including aptamers, bioimaging agents and drug-loading sites could be easily integrated into NF particles, making NFs ideal candidates for a variety of applications in biomedicine. In this protocol, the preparation of multifunctional DNA NFs with highly tunable sizes is described for applications in cell targeting, intracellular imaging and drug delivery. Preparation and characterization of functional DNA NFs takes ~5 d; the following biomedical applications take ~10 d. PMID:26357007
Educational Technologists: Leading Change for a New Paradigm of Education
ERIC Educational Resources Information Center
Aslan, Sinem; Reigeluth, Charles M.
2013-01-01
The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…
Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space
ERIC Educational Resources Information Center
Fukawa-Connelly, Timothy Patrick; Newton, Charlene
2014-01-01
Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…
Music Technology and Musical Creativity: Making Connections
ERIC Educational Resources Information Center
Thompson, Douglas Earl
2012-01-01
This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…
Bringing Precision Medicine to Community Oncologists.
2017-01-01
Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Taking the Edusemiotic Turn: A Body~Mind Approach to Education
ERIC Educational Resources Information Center
Semetsky, Inna
2014-01-01
Educational philosophy in English-speaking countries tends to be informed mainly by analytic philosophy common to Western thinking. A welcome alternative is provided by pragmatism in the tradition of Peirce, James and Dewey. Still, the habit of the so-called linguistic turn has a firm grip in terms of analytic philosophy based on the logic of…
STS-88 Mission Specialist James Newman suits up before launch
NASA Technical Reports Server (NTRS)
1998-01-01
In the Operations and Checkout Building, STS-88 Mission Specialist James H. Newman takes part in a complete suit check before launch. Newman holds a toy dog, 'Pluto,' representing the crew nickname Dog Crew 3 and Newman's nickname, Pluto. Mission STS-88 is expected to launch at 3:56 a.m. EST with the six-member crew aboard Space Shuttle Endeavour on Dec. 3. Endeavour carries the Unity connecting module, which the crew will be mating with the Russian-built Zarya control module already in orbit. In addition to Unity, two small replacement electronics boxes are on board for possible repairs to Zarya batteries. The mission is expected to last 11 days, 19 hours and 49 minutes, landing at 10:17 p.m. EST on Dec. 14.
STS-101 crew have a snack before getting ready for launch again
NASA Technical Reports Server (NTRS)
2000-01-01
In the Operations and Checkout Building, the STS-101 crew gathers for a snack before suiting up for launch for the second time. The previous day's launch attempt was scrubbed due to high cross winds at the Shuttle Landing Facility. From left are Mission Specialists Mary Ellen Weber and Yuri Usachev of Russia; Pilot Scott J. Horowitz; Commander James D. Halsell Jr.; and Mission Specialists Jeffrey N. Williams, Susan J. Helms and James S. Voss. The mission will take the crew to the International Space Station to deliver logistics and supplies and prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station.
Automated problem list generation and physicians perspective from a pilot study.
Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric
2017-09-01
An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
NASA Astrophysics Data System (ADS)
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as analysis of ice cores obtained during the deployment and returned for subsequent study.
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 <-- S0 vibronic spectra of 2PY.U, 2PY.3MU, 2PY.1MU, and 2PY.T were measured using UV laser resonant two-photon ionization (R2PI). The spectra of the Watson-Crick and wobble isomers of 2PY.1MU were separated using UV-UV spectral hole-burning. We identify the different isomers by combining three different diagnostic tools: (1) Selective methylation of the uracil N3-H group, which allows formation of the sugar-edge isomer only, and methylation of the N1-H group, which leads to formation of the Watson-Crick and wobble isomers. (2) The experimental S1 <-- S0 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Development of a New Critical Thinking Test Using Item Response Theory
ERIC Educational Resources Information Center
Wagner, Teresa A.; Harvey, Robert J.
2006-01-01
The authors describe the initial development of the Wagner Assessment Test (WAT), an instrument designed to assess critical thinking, using the 5-faceted view popularized by the Watson-Glaser Critical Thinking Appraisal (WGCTA; G. B. Watson & E. M. Glaser, 1980). The WAT was designed to reduce the degree of successful guessing relative to the…
Watson for Genomics: Moving Personalized Medicine Forward.
Rhrissorrakrai, Kahn; Koyama, Takahiko; Parida, Laxmi
2016-08-01
The confluence of genomic technologies and cognitive computing has brought us to the doorstep of widespread usage of personalized medicine. Cognitive systems, such as Watson for Genomics (WG), integrate massive amounts of new omic data with the current body of knowledge to assist physicians in analyzing and acting on patient's genomic profiles. Copyright © 2016 Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Barker, Jani L.
2010-01-01
Multiethnic children's literature addresses multiple audiences, providing different reading experiences and benefits for each. Using critical race theory as an interpretive tool, this article examines how two African American historical fiction novels, Mildred Taylor's "Roll of Thunder, Hear My Cry" and Christopher Paul Curtis's "The Watsons Go to…
Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors
ERIC Educational Resources Information Center
Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.
2005-01-01
The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
ERIC Educational Resources Information Center
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
ERIC Educational Resources Information Center
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Base pairing and base mis-pairing in nucleic acids
NASA Technical Reports Server (NTRS)
Wang, A. H. J.; Rich, A.
1986-01-01
In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.
View of White Room atop Pad A during Apollo 9 Countdown Demonstration Test
NASA Technical Reports Server (NTRS)
1969-01-01
Interior view of the White Room atop Pad A, Launch Complex 39, Kenndy Space Center, during Apollo 9 Countdown Demonstration Test activity. Standing next to spacecraft hatch is Astronaut James A. McDivitt, commander. Also taking part in the training exercise were Astronauts David R. Scott, command module pilot; and Russell L. Schweickart, lunar module pilot.
Autonomy, Agency and Education: He Tangata, He Tangata, He Tangata
ERIC Educational Resources Information Center
Devine, Nesta; Irwin, Ruth
2005-01-01
In this paper the authors take up James Marshall's work on the individual and autonomy. Their suggestion is that although the liberal notion of the autonomous individual might give us a standard of reference for the freedom of persons, the liberal tradition also circumscribes that freedom by prescribing it both as an attribute of persons and as a…
School Ties: A Psychiatrist's Longtime Commitment to Education
ERIC Educational Resources Information Center
Dubin, Jennifer
2013-01-01
Almost 60 years have passed since Dr. James Comer last saw three of his elementary school friends, yet he vividly remembers them. They were African American boys just like him. They, too, came from two-parent homes, and their fathers also worked in the local steel mill. But unlike Comer and his siblings, these three youngsters did not take an…
Kodak Mirror Assembly Tested at Marshall Space Flight Center
NASA Technical Reports Server (NTRS)
2003-01-01
The Eastman-Kodak mirror assembly is being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). In this photo, an MSFC employee is inspecting one of many segments of the mirror assembly for flaws. MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
Kodak Mirror Assembly Tested at Marshall Space Flight Center
NASA Technical Reports Server (NTRS)
2003-01-01
This photo (a frontal view) is of one of many segments of the Eastman-Kodak mirror assembly being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
Kodak Mirror Assembly Tested at Marshall Space Flight Center
NASA Technical Reports Server (NTRS)
2003-01-01
This photo (a side view) is of one of many segments of the Eastman-Kodak mirror assembly being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
2003-04-09
The Eastman-Kodak mirror assembly is being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). In this photo, an MSFC employee is inspecting one of many segments of the mirror assembly for flaws. MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
2003-04-09
The Eastman-Kodak mirror assembly is being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). In this photo, one of many segments of the mirror assembly is being set up inside the 24-ft vacuum chamber where it will undergo x-ray calibration tests. MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
USDA-ARS?s Scientific Manuscript database
Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...
2014-04-17
Marshall Center Director Patrick Scheuermann and Dr. Lisa Watson-Morgan talk to news media at the April 17 Marshall 2014 Update. Watson-Morgan, the first woman to be named the center's chief engineer, answered questions about progress on the Space Launch System and other projects, and spoke about the importance of attracting young people to science, technology, engineering and mathematics education to maintain a "pipeline" of future engineers.
ERIC Educational Resources Information Center
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
Petrenko, Y M
2015-01-01
Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.
Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S
2017-01-01
Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.
Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression
Chen, Yanguang
2016-01-01
In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson’s statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran’s index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China’s regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test. PMID:26800271
Does Europe have a centre? Reflections on the history of Western and Central Europe
NASA Astrophysics Data System (ADS)
Mout, Nicolette
2006-05-01
Any definition of Central Europe based on geographical and/or historical facts causes difficulties. The line dividing Europe during the Cold War has a very limited use because it does not take into account Central Europe as a special part of the continent. Historians such as Geoffrey Barraclough, Hugh Seton-Watson and Oskar Halecki discussed the idea of a separate identity of Central Europe during the Cold War. Especially after the fall of the Berlin Wall, this discussion was re-opened. From a historian's point of view, the most important contributions came from Piotr Wandycz and Jeno Szucs. An imaginary centre of Europe can only be found in the continent's common history.
James W. Cronin: Raising the Profile of Physics Worldwide
NASA Astrophysics Data System (ADS)
Kampert, Karl-Heinz
James W. Cronin started his career in high energy physics, won the Nobel Prize in Physics in 1980 for the discovery of CP-violation, and amongst others, discovered hard parton scattering phenomena in nuclear collisions, an observation known as the "Cronin-effect". In 1986 he decided to move to cosmic ray physics which lead to the construction of the first 1 km2 class large air-shower array CASA-MIA. In 1991, as his masterpiece, he started building a collaboration to construct an instrument of unprecedented size for studying cosmic rays with energies up to 1020 eV. Construction of the Pierre Auger Observatory began in 2002, was finished in 2008, is taking data since like a "Swiss Clock", as Jim used to call it, and has dramatically advanced our understanding of ultra-high energy cosmic rays.
Magnetic Core-Shell Morphology of Structurally Uniform Magnetite Nanoparticles
NASA Astrophysics Data System (ADS)
Krycka, Kathryn
2011-03-01
Magnetic nanoscale structures are intriguing, in part, because of the exotic properties that emerge compared with bulk. The reduction of magnetic moment per atom in magnetite with decreasing nanoparticle size, for example, has been hypothesized to originate from surface disordering to anisotropy-induced radial canting, which are difficult to distinguish using conventional magnetometry. Small-angle neutron scattering (SANS) is ideal for probing structure, both chemical and magnetic, from nm to microns across an ensemble of particles. Adding polarization analysis (PASANS) of the neutron spin orientation before and after interaction with the scattering particles allows the magnetic structure to be separated into its vector components. Application of this novel technique to 9 nm magnetite nanoparticles closed-packed into face-centered crystallites with order of a micron revealed that at nominal saturation the missing magnetic moments unexpectedly interacted to form well-ordered shells 1.0 to 1.5 nm thick canted perpendicular to their ferrimagnetic cores between 160 to 320 K. These shells additionally displayed intra-particle ``cross-talk'', selecting a common orientation over clusters of tens of nanoparticles. However, the shells disappeared when the external field was removed and interparticle magnetic interactions were negligible (300 K), confirming their magnetic origin. This work has been carried out in collaboration with Ryan Booth, Julie Borchers, Wangchun Chen, Liv Dedon, Thomas Gentile, Charles Hogg, Yumi Ijiri, Mark Laver, Sara Majetich, James Rhyne, and Shannon Watson.
Use of Edible Laminate Layers in Intermediate Moisture Food Rations to Inhibit Moisture Migration
2016-04-29
methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on one side Watson, Inc. Dual-sided HPMC moisture...barrier film Hydroxypropyl methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on both sides...Moisture Barrier (BWMB) film #1 Pullulan*, beeswax, glycerin, propylene glycol, starch , polysorbate 80 Water soluble Watson, Inc. Pullulan BWMB film
"I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"
ERIC Educational Resources Information Center
McNair, Jonda C.
2008-01-01
This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…
ERIC Educational Resources Information Center
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
ERIC Educational Resources Information Center
Watson, Derrick G.; Kunar, Melina A.
2010-01-01
Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys,…
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
Willis, Derek W.
2010-01-01
This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Modelling Effects on Grid Cells of Sensory Input During Self-motion
2016-04-20
input during self-motion Florian Raudies, James R. Hinman and Michael E. Hasselmo Center for Systems Neuroscience , Centre for Memory and Brain...Department of Psychological and Brain Sciences and Graduate Program for Neuroscience , Boston University, 2 Cummington Mall, Boston, MA 02215, USA Visual...Psychological and Brain Sciences and the Centre for Computational Neuroscience and Neural Technology before taking his current position as a Research
China Moves Out: Stepping Stones Toward a New Maritime Strategy
2015-04-01
that participated in the exercise deployed to Pakistan without replenishing food stores, although they did take on fuel.59 Press reporting on the...carried out more than 10 combat-realistic training tasks, including the anti-pirate, joint search and rescue, anti- nuclear and anti-chemical contamination ... Malaysia ) Taiwan Senkaku (Japan) Scarborough (Philippines) James Shoal ( Malaysia ) Table 4. Evolution of PLAN Western Pacific Deployments 36 China
Response to Hostage Taking for Medium and Small Size Law Enforcement Agencies
1992-01-01
Negotiator: Police officer specially trained in persuading a suspect to surrender to police and release hostages unharmed. Hypnosis : An altered state of...states (such as hypnosis and transcendental meditation) experience increased sensory perception. 26 James Frank, Persuasion and Healing (Baltimore...direct stimuli. 35 HYPNOSIS The notion of suggestibility is often linked with the hypnotic state. Hypnosis is defined as an altered state of
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Code of Federal Regulations, 2010 CFR
2010-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2011 CFR
2011-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2014 CFR
2014-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2012 CFR
2012-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Code of Federal Regulations, 2013 CFR
2013-07-01
... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...
Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A
2011-03-07
Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.
Optimal Repair And Replacement Policy For A System With Multiple Components
2016-06-17
Numerical Demonstration To implement the linear program, we use the Python Programming Language (PSF 2016) with the Pyomo optimization modeling language...opre.1040.0133. Hart, W.E., C. Laird, J. Watson, D.L. Woodruff. 2012. Pyomo–optimization modeling in python , vol. 67. Springer Science & Business...Media. Hart, W.E., J. Watson, D.L. Woodruff. 2011. Pyomo: modeling and solving mathematical programs in python . Mathematical Programming Computation 3(3
Perception of Long-Period Complex Sounds
1989-11-27
Richard M. Warren AFOSR Grant No. 88-0320 M CES Guttman, N. & Julesz, B. (1963). Lower limits of auditory periodicity analysis. Journal of the Aostical...order within auditory sequences. Peretion & PsvchobhVsics, 12, 86-90. Watson, C.S., (1987). Uncertainty, informational masking, and the capacity of...immediate memory. In W.A. Yost and C.S. Watson (eds.), Auditory Processing of Camlex Sounds. New Jersey: lawrence Erlbaum Associates, pp. 267-277
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2011 CFR
2011-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2013 CFR
2013-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2014 CFR
2014-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.
Code of Federal Regulations, 2012 CFR
2012-07-01
...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...
STS-101 crew members meet family and friends
NASA Technical Reports Server (NTRS)
2000-01-01
The STS-101 crew gather during a meeting with family and friends at Launch Pad 39A. From left, Mission Specialist Susan J. Helms, Commander James D. Halsell Jr., Mission Specialist Mary Ellen Weber, Pilot Scott J. Horowitz and Mission Specialists Yuri Vladimirovich Usachev, Jeffery N. Williams and James S. Voss. In the background is the Space Shuttle Atlantis on the pad. Mission STS-101 will take the crew to the International Space Station to deliver logistics and supplies, plus prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. The crew will conduct one space walk to perform maintenance on the Space Station as well. This will be the third assembly flight for the Space Station. Launch is targeted for April 24 at about 4:15 p.m. EDT from Launch Pad 39A.
2000-04-24
The STS-101 crew returns to the Operations and Checkout Building after the launch was scrubbed due to cross winds at the KSC Shuttle Landing Facility gusting above 20 knots. Flight rules require cross winds at the SLF to be no greater than 15 knots in case of a contingency Shuttle landing. Shown leaving the Astrovan are (left to right) Mission Specialists James S. Voss and Yury Usachev of Russia; Pilot Scott J. Horowitz; and Commander James D. Halsell Jr. in the doorway. Weather conditions will be reevaluated for another launch try on April 25. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. The mission is expected to last about 10 days
2000-04-24
The STS-101 crew returns to the Operations and Checkout Building after the launch was scrubbed due to cross winds at the KSC Shuttle Landing Facility gusting above 20 knots. Flight rules require cross winds at the SLF to be no greater than 15 knots in case of a contingency Shuttle landing. Shown leaving the Astrovan are (left to right) Mission Specialists James S. Voss and Yury Usachev of Russia; Pilot Scott J. Horowitz; and Commander James D. Halsell Jr. in the doorway. Weather conditions will be reevaluated for another launch try on April 25. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. The mission is expected to last about 10 days
2000-04-24
The STS-101 crew returns to the Operations and Checkout Building after the launch was scrubbed due to cross winds at the KSC Shuttle Landing Facility gusting above 20 knots. Flight rules require cross winds at the SLF to be no greater than 15 knots in case of a contingency Shuttle landing. Shown at left is Commander James D. Halsell Jr. At right is astronaut James Wetherbee, deputy director of the Johnson Space Center. Weather conditions will be reevaluated for another launch try on April 25. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. The mission is expected to last about 10 days
2000-04-24
The STS-101 crew returns to the Operations and Checkout Building after the launch was scrubbed due to cross winds at the KSC Shuttle Landing Facility gusting above 20 knots. Flight rules require cross winds at the SLF to be no greater than 15 knots in case of a contingency Shuttle landing. Shown at left is Commander James D. Halsell Jr. At right is astronaut James Wetherbee, deputy director of the Johnson Space Center. Weather conditions will be reevaluated for another launch try on April 25. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. The mission is expected to last about 10 days
STS-101 crew waves to media after arriving at KSC for 4th launch attempt
NASA Technical Reports Server (NTRS)
2000-01-01
Members of the STS-101 crew wave at media and photographers at KSC's Shuttle Landing Facility after their landing the night of May 14. Standing left to right are Mission Specialists Yuri Usachev, James Voss, Mary Ellen Weber and Jeff Williams; Commander James Halsell; and Pilot Scott Horowitz. Not present is Mission Specialist Susan Helms, who arrived later. The crew will be preparing for the launch on May 18. The mission will take the crew of seven to the International Space Station, delivering logistics and supplies, plus preparing the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station. This will be the third assembly flight for the Space Station. STS-101 is targeted for liftoff at 6:38 a.m. EDT from Launch Pad 39A.
STS-101 crew returns from Launch Pad 39A after launch was scrubbed
NASA Technical Reports Server (NTRS)
2000-01-01
The STS-101 crew returns to the Operations and Checkout Building after the launch was scrubbed due to cross winds at the KSC Shuttle Landing Facility gusting above 20 knots. Flight rules require cross winds at the SLF to be no greater than 15 knots in case of a contingency Shuttle landing. Shown at left is Commander James D. Halsell Jr. At right is astronaut James Wetherbee, deputy director of the Johnson Space Center. Weather conditions will be reevaluated for another launch try on April 25. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. The mission is expected to last about 10 days.
STS-101 crew sits for a snack before the third attempt at launch
NASA Technical Reports Server (NTRS)
2000-01-01
In the Operations and Checkout Building, the STS-101 crew gathers for a snack before suiting up for launch for the third time. The previous two launch attempts were scrubbed due to high cross winds at the Shuttle Landing Facility. From left are Mission Specialists James S. Voss, Susan J. Helms and Jeffrey N. Williams; Commander James D. Halsell Jr.; Pilot Scott J. Horowitz; and Mission Specialists Mary Ellen Weber and Yuri Usachev of Russia. The mission will take the crew to the International Space Station to deliver logistics and supplies and prepare the Station for the arrival of the Zvezda Service Module. Also, the crew will conduct one space walk. This is the third assembly flight to the Space Station. After the 10-day mission, Atlantis is expected to land at KSC May 6 at about 12:03 p.m. EDT.
Astronomy from Space: The Hubble, Herschel and James Webb Space Telescopes
NASA Technical Reports Server (NTRS)
Gardner, Jonathan P.
2009-01-01
Space-based astronomy is going through a renaissance, with three Great Observatories currently flying: Hubble in the visible and ultraviolet, Spitzer in the infrared and Chandra in X-rays. The future looks equally bright. The final servicing mission to Hubble will take place in February 2009 and promises to make the observatory more capable than ever with two new cameras, and refurbishment that will allow it to last at least five years. The upcoming launch of the Herschel Space Telescope will open the far-infrared to explore the cool and dusty Universe. Finally, we look forward to the launch of the James Webb Space Telescope in 2013, which wil provide a successor to both Hubble and Spitzer. In this talk, the author discusses some of the highlights of scientific discovery in the last 10 years and reveals the promise to the next 10 years.
Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing
2008-01-01
complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING
Balancing Value and Risk in Information Sharing Through Obfuscation
2012-09-20
California, Los Angeles Chatschik Bisdikian IBM T.J. Watson Research Center Lance M. Kaplan US Army Research Laboratory Abstract—Fast-paced data-to...AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) IBM T.J. Watson Research...giving us annotations for both the white listed activity detection as well as the black listed activity recognition . We implemented five features
Neutron Diffraction Investigations of Magnetism in BiFeO3 Epitaxial Films
2011-01-01
magnetism;epitaxial thin film;BiFeO3 Daisuke Kan, Wangchun Chen, Shannon Watson, Songxue Chi, Ross Erwin, Garry J. McIntyre, Sylvia C. Capelli, William ...Weinheim 1567wileyonlinelibrary.comAdv. Funct. Mater. 2011, 21, 1567–1574 William Ratcliff II , * Daisuke Kan , * Wangchun Chen , Shannon Watson...15 ] S. W. Lovesey , Theory of Neutron Scattering from Condensed Matter vol. 2 Oxford , New York , 1984 . [ 16 ] W. Gavin Williams
Index of Air Weather Service Technical Publications. Headquarters AWS and Subordinate Units.
1982-07-01
Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. 105-48 "Study of Blowing Dust in the 19th Weather...Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. "On the Origin and Climatology of Noctilucent
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
The Orion Test Capsule and a number of other items used in the c
2013-08-07
The Orion Test Capsule and a number of other items used in the capsule recovery at being transported down the James River on a Navy INLS "Improved Navy Lighterage System" from Fort Eustis from where it was loaded. Its liquid route will take them to Little Creek Amphibious Base in Norfolk, where it will stay until scheduled recovery test will be performed.
1998-12-07
S88-E-5058 (12-08-98) --- Astronaut Jerry L. Ross takes a picture during a 7-hour, 21 minute spacewalk. Astronauts Ross and James H. Newman went on to mate 40 cables and connectors runing 76 feet from the Zarya control module to Unity, with the 35-ton complex towering over Endeavour's cargo bay. The photo was taken with an electronic still camera (ESC) at 00:35:05 GMT, Dec. 8.
Kodak Mirror Assembly Tested at Marshall Space Flight Center
NASA Technical Reports Server (NTRS)
2003-01-01
The Eastman-Kodak mirror assembly is being tested for the James Webb Space Telescope (JWST) project at the X-Ray Calibration Facility at Marshall Space Flight Center (MSFC). In this photo, one of many segments of the mirror assembly is being set up inside the 24-ft vacuum chamber where it will undergo x-ray calibration tests. MSFC is supporting Goddard Space Flight Center (GSFC) in developing the JWST by taking numerous measurements to predict its future performance. The tests are conducted in a vacuum chamber cooled to approximate the super cold temperatures found in space. During its 27 years of operation, the facility has performed testing in support of a wide array of projects, including the Hubble Space Telescope (HST), Solar A, Chandra technology development, Chandra High Resolution Mirror Assembly and science instruments, Constellation X-Ray Mission, and Solar X-Ray Imager, currently operating on a Geostationary Operational Environment Satellite. The JWST is NASA's next generation space telescope, a successor to the Hubble Space Telescope, named in honor of NASA's second administrator, James E. Webb. It is scheduled for launch in 2010 aboard an expendable launch vehicle. It will take about 3 months for the spacecraft to reach its destination, an orbit of 940,000 miles in space.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-14
... Edsel None F534080891 A1F22 Estey, Denise Claire Bond None F534080891 A1F21 Fox, James None F534081226 A1A Fox, James None F534081226 A3 Fox, James None F534081226 A11A1 Fox, James None F534081226 A6A1 Fox, James None F534081226 A4A Fox, James None F534081226 A1B1 Fox, James None F534081226 A11A2A Fox, James...
Return to Flight Crew Activities Resource Reel JSC 1988 2 of 2
NASA Technical Reports Server (NTRS)
2000-01-01
The crew of the STS-114 Discovery continues to answer questions from the news media about the upcoming mission. Commander Collins thanks NASA for enabling the astronauts to express their thoughts and feelings about procedures during spaceflight and she is also very happy to work for NASA. Pilot James Kelly talks about the pictures that they are now able to take of the external tank. Mission Specialists Wendy Lawrence and Steve Robinson discuss the items that they will be bringing up to the International Space Station. Robinson also talks about mementos of the Space Shuttle Columbia crew that they will be taking to the International Space Station.
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-07-01
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that are relevant to femoral neck fracture reduction and fixation. After controlling for age, body mass index, height, and sex, we found the modified Smith-Petersen approach provided a mean of 2.36 cm (95% confidence interval [CI], 0.45-4.28 cm; p = 0.015) additional exposure without rectus femoris tenotomy (p = 0.015) and 3.33 cm (95% CI, 1.42-5.24 cm; p = 0.001) additional exposure with a tenotomy compared with the Watson-Jones approach. The labrum, femoral head, subcapital femoral neck, basicervical femoral neck, and greater trochanter were reliably visible and palpable in both approaches. The lesser trochanter was palpable in all of the modified Smith-Petersen and none of the Watson-Jones approaches (p < 0.001). All modified Smith-Petersen approaches (10 of 10) provided visualization and palpation of the medial femoral neck, whereas visualization of the medial femoral neck was only possible in one of 10 Watson-Jones approaches (p < 0.001) and palpation was possible in eight of 10 Watson-Jones versus all 10 modified Smith-Petersen approaches (p = 0.470). In the hands of surgeons experienced with both surgical approaches to the femoral neck, the modified Smith-Petersen approach, with or without rectus femoris tenotomy, provides superior exposure of the femoral neck and articular surface as well as visualization and palpation of clinically relevant proximal femoral anatomic landmarks compared with the Watson-Jones approach. Open reduction and internal fixation of a femoral neck fracture is typically performed in a young patient (< 60 years old) with the objective of obtaining anatomic reduction that would not be possible by closed manipulation, thus enhancing healing potential. In the hands of surgeons experienced in both approaches, the modified Smith-Petersen approach offers improved direct access for reduction and fixation. Higher quality reductions and fixation are expected to translate to improved healing potential and outcomes. Although our experimental results are promising, further clinical studies are needed to verify if this larger exposure area imparts increased quality of reduction, healing, and improved outcomes compared with other approaches. The learning curve for the exposure is unclear, but the approach has broad applications and is frequently used in other subspecialties such as for direct anterior THA and pediatric septic hip drainage. Surgeons treating femoral neck fractures with open reduction and fixation should familiarize themselves with the modified Smith-Petersen approach.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes
2007-10-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)
2007-01-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer
2000-10-01
Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann CW: J, Schnitt S, Livingston DM: Location of BRCA1 in human breast and Distinct...Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter H. Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter H. Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ray, L.; Hoffmann, G.W.; Thaler, R.M.
The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reactionmore » cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+/sup 208/Pb elastic scattering and compared with experimental data.« less
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.
Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre
2012-01-01
The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274
Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H
2018-05-01
The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Daugirdas, John T; Greene, Tom; Depner, Thomas A; Chumlea, Cameron; Rocco, Michael J; Chertow, Glenn M
2003-09-01
The modeled volume of urea distribution (Vm) in intermittently hemodialyzed patients is often compared with total body water (TBW) volume predicted from population studies of patient anthropometrics (Vant). Using data from the HEMO Study, we compared Vm determined by both blood-side and dialysate-side urea kinetic models with Vant as calculated by the Watson, Hume-Weyers, and Chertow anthropometric equations. Median levels of dialysate-based Vm and blood-based Vm agreed (43% and 44% of body weight, respectively). These volumes were lower than anthropometric estimates of TBW, which had median values of 52% to 55% of body weight for the three formulas evaluated. The difference between the Watson equation for TBW and modeled urea volume was greater in Caucasians (19%) than in African Americans (13%). Correlations between Vm and Vant determined by each of the three anthropometric estimation equations were similar; but Vant derived from the Watson formula had a slightly higher correlation with Vm. The difference between Vm and the anthropometric formulas was greatest with the Chertow equation, less with the Hume-Weyers formula, and least with the Watson estimate. The age term in the Watson equation for men that adjusts Vant downward with increasing age reduced an age effect on the difference between Vant and Vm in men. The findings show that kinetically derived values for V from blood-side and dialysate-side modeling are similar, and that these modeled urea volumes are lower by a substantial amount than anthropometric estimates of TBW. The higher values for anthropometry-derived TBW in hemodialyzed patients could be due to measurement errors. However, the possibility exists that TBW space is contracted in patients with end-stage renal disease (ESRD) or that the TBW space and the urea distribution space are not identical.
Annual Report 2009 (Project Air Force)
2009-01-01
St. James Peter Lowy, Chief Executive Officer, Westfield, LLC Michael Lynton, Chairman and Chief Executive Officer, Sony Pictures Entertainment ...For me, living in D.C. is like living at the county fair and having the rides change every week. New music , new art shows, new movies, in and around...town. I’m a music fan with broad interests. And when I retire, I have the ambition of taking a two-year training course at the National Gallery
MS&G, When Worlds Collide: A Primer for Potential
2006-07-01
managers must take a close look at the feature-set they hope to implement, and as a general rule of thumb, the more un- knowns, risks, and innovations ...James Paul . “What Would a State of the Art Instructional Video Game Look Like?” Innovate , Aug/Sept 2005, vol. 1, no. 6. www.innovateonline.info... Paul , Christopher, et al. Implementing and Evaluating an Innovative Approach to Simulation Training Acquisitions. Rand National Defense Research
The Soviet Stealth Fighter: Check or Checkmate
1988-04-01
pp. 20-31. 25 11. Bussert, Jim and Paul Beaver. "Soviet Submarine Hull Coatings," Defense Electronics (August 1987), pp. 26-27. 12. Canan , James W...Aircraft (January 1987), pp. 50-59. 34. Vorobyov, Ivan , Major-General. "Formula for Victory," Soviet Military Review (November 1986), pp. 14-15. 35...34Stealth Somber Taking Shape," International Combat Aircraft (September 1987), pp. 27-31. Vozobyov, Ivan , Major-General. "New Weapons Require Sound
Taking DoD Contracting From Good to Great
2009-06-01
alone. 3 Defense AT&L: May-June 2009 Charlie E. Williams Jr., who became the director of the Defense Contract Management Agency on May 4, 2008, oversees...contrac- tors. DCMA accepts approximately 750,000 shipments of supplies and some 1,200 aircraft each year in addition to managing over $100 billion...Air Force Maj. Michelle Brunswick, DAU professor of acquisition management ; James P. McNulty, DAU professor of systems acquisition management ; and
STS-109 PLT Carey on middeck with ergometer
2002-03-07
STS109-E-5479 (7 March 2002)-- Astronaut Duane G. Carey, STS-109 pilot, takes a leisurely "spin" on the bicycle ergometer on the mid deck of the Space Shuttle Columbia, while waiting to assist Flight Day 7's assigned space walkers--astronaut James H. Newman and Michael J. Massimino. The extravehicular mobility unit (EMU) space suits of the two can be seen in the background. The image was recorded with a digital still camera.
Mighty Microbes Where Rivers Run
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stegen, James
2016-04-07
Microbes and their influential role in Earth’s climate take center stage in the area where river water and groundwater mix – an area known as the hyporheic zone. PNNL ecologist James Stegen discusses his team’s research in his “laboratory” – the zone along the Columbia, one of the nation’s largest rivers. It’s a squishy, porous lab, better known for soaking feet than serving as the “river’s liver.”
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meadows, B.T.; /Cincinnati U.
A new approach to the analysis of three body decays is presented. Model-independent results are obtained for the S-wave K{pi} amplitude as a function of K{pi} invariant mass. These are compared with results from K{sup -}{pi}{sup +} elastic scattering, and the prediction of the Watson theorem, that the phase behavior be the same below K{eta}' threshold, is tested. Contributions from I = 1/2 and I = 3/2 are not resolved in this study. If I = 1/2 dominates, however, the Watson theorem does not describe these data well.
1997-01-09
Riordan Gerald F. Watson Steven E. Koch Chairman of Advisory Committee Dedication I would like to dedicate, first and foremost, this thesis to the Lord...Officer. Tony was promoted to the rick of Cap(alnin June 1995. While atOffut AFB, he was selected by AFIT to attend North Carolina State University to...advisory committee, Dr. Steven E. Koch (Chairman), Dr. Allen J. Riordan , and Dr. Gerald F. Watson. Their guidance and personal interest in this work
1980-11-01
materials work and sample preparation of D.W. Dong; the technical assistance of F.L. Pesavento and J.A. Calise; the assistance in device fabrication...FILMS D.J. DiMaria R. Ghez D.W. Dong I.B.M. Thomas J. Watson Research Center Yorktown Heights, New York 10598 Technical Assistance of F.L. Pesavento and... Pesavento and J.A. Calise; the assistance with gate metallizations by the Silicon Facility and Central Scientific Services at the T.J. Watson
Flood Plain Information, Mill, Watson, and Lahaska Creeks, Bucks County, Pennsylvania.
1975-05-01
AD-AIOI 592 ARENGINEER DISTRICT PHI LADELPHIA P A F/6 8/8 T7LOOD PLAIN INFORMATION, MIL , WATSON, AND LAI4ASKA CREEKS, SUCK-’ETCIU) UNCLASSIFIED...will be iu LblckW V’ A PREPARED FOR THE BUCKS COUNTY PLANNING COMMISSION p BY CORPS OF ENGINEERS, U.S. ARMY PHILADELPHIA DISTRICT MAY 975 8 1 7 20 055...No. 4655 at Langhorne , Pennsylvania) ..... ................. 8 3 Peak Flows for the Intermediate Regional and Standard Project Floods
Introduction and Overview of the Industrial Interactive Panel Session
NASA Astrophysics Data System (ADS)
Seiler, David
2014-03-01
A unique industrial panel covering the challenges and needs of various industries and how being innovative is important. The session involves two invited industry speakers (24 minutes each) who will set the stage for the interactive round table panel session. The Panel, led by moderator Mark Bernius (Morgan Advanced Materials), consists of the two invited speakers plus an additional five industry panelists. The first thirty minutes of the panel session has the five additional panelists introducing themselves and their work/company. These introductions could include what they or their company does, sharing one or two technical highlights, listing some challenges or needs for physicists, and what innovation breakthroughs are needed in their industries. The final hour of the session will be highly interactive with questions to the panel coming from the moderator, the audience, and the panelists themselves. Questions that might be addressed include: how physicists are or could be critical in advancing innovation; how can AIP/APS/FIAP help industry get the physics help they need to be innovative (knowledge, the right staff, etc.); what role can students and post docs play in advancing industry's mission; etc. We invite you to participate in this interactive session and ask our industry experts your own interesting and challenging questions. The invited speakers are George Thompson, Intel, and Rick Watkins, Nike. The panel members also include Jason Cleveland, Asylum Research; Robert Doering, Texas Instruments; William Gallagher, IBM T.J. Watson Research Center; James Hollenhorst, Agilent Technologies; and Martin Poitzsch, Schlumberger-Doll Research.
Jović, Ozren
2016-12-15
A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Role modeling excellence in clinical nursing practice.
Perry, R N Beth
2009-01-01
Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.
Intramolecular triple helix as a model for regular polyribonucleotide (CAA)(n).
Efimov, Alexander V; Spirin, Alexander S
2009-10-09
The regular (CAA)(n) polyribonucleotide, as well as the omega leader sequence containing (CAA)-rich core, have recently been shown to form cooperatively melted and compact structures. In this report, we propose a structural model for the (CAA)(n) sequence in which the polyribonucleotide chain is folded upon itself, so that it forms an intramolecular triple helix. The triple helix is stabilized by hydrogen bonding between bases thus forming coplanar triads, and by stacking interactions between the base triads. A distinctive feature of the proposed triple helix is that it does not contain the canonical double-helix elements. The difference from the known triple helices is that Watson-Crick hydrogen bond pairings do not take place in the interactions between the bases within the base triads.
viRome: an R package for the visualization and analysis of viral small RNA sequence datasets.
Watson, Mick; Schnettler, Esther; Kohl, Alain
2013-08-01
RNA interference (RNAi) is known to play an important part in defence against viruses in a range of species. Second-generation sequencing technologies allow us to assay these systems and the small RNAs that play a key role with unprecedented depth. However, scientists need access to tools that can condense, analyse and display the resulting data. Here, we present viRome, a package for R that takes aligned sequence data and produces a range of essential plots and reports. viRome is released under the BSD license as a package for R available for both Windows and Linux http://virome.sf.net. Additional information and a tutorial is available on the ARK-Genomics website: http://www.ark-genomics.org/bioinformatics/virome. mick.watson@roslin.ed.ac.uk.
L. Young James Young Postdoctoral Researcher-Chemistry James.Young@nrel.gov | 303-275-4456 Orcid ID http://orcid.org/0000-0001-7291-0079 Dr. James L. Young is a Postdoctoral Researcher at the National -splitting photocathode," Nature Energy (2017). View all NREL publications for James L. Young.
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D
2017-07-11
RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.
Soffer-Dudek, Nirit
2017-01-01
The term "sleep experiences," coined by Watson (2001), denotes an array of unusual nocturnal consciousness phenomena; for example, nightmares, vivid or recurrent dreams, hypnagogic hallucinations, dreams of falling or flying, confusional arousals, and lucid dreams. Excluding the latter, these experiences reflect a single factor of atypical oneiric cognitions ("general sleep experiences"). The current study is an opinionated mini-review on the associations of this factor-measured with the Iowa sleep experiences survey (ISES, Watson, 2001)-with psychopathological symptoms and stress. Findings support a strong relation between psychological distress and general sleep experiences. It is suggested that that they should be viewed as a sleep disturbance; they seem to represent involuntary intrusions of wakefulness into sleep, resulting in aroused sleep. These intrusions may stem from excessively thin boundaries between consciousness states (e.g., "transliminality"), or, conversely, they may follow an attempt at disconnecting mental elements (e.g., dissociation), which paradoxically results in a "rebound effect." The extent to which unusual dreaming is experienced as intrusive, rather than controlled, may explain why general sleep experiences are related to psychopathology, whereas lucid dreams are related to psychological resilience. In conclusion, the exploration of the interplay between psychopathology and sleep should be expanded from focusing almost exclusively on quantitative aspects (e.g., sleep efficiency, latency) to including qualitative conscious experiences which may reflect poor sleep quality. Taking into account nocturnal consciousness-including unusual dreaming and permeable sleep-wake boundaries-may unveil rich information on night-time emotional states and broaden our definition of poor sleep quality.
Development of a Methodology to Optimally Allocate Visual Inspection Time
1989-06-01
Model and then takes into account the costs of the errors. The purpose of the Alternative Model is to not make 104 costly mistakes while meeting the...James Buck, and Virgil Anderson, AIIE Transactions, Volume 11, No.4, December 1979. 26. "Inspection of Sheet Materials - Model and Data", Colin G. Drury ...worker error, the probability of inspector error, and the cost of system error. Paired comparisons of error phenomena from operational personnel are
2001-02-13
STS-102 Commander James Wetherbee drives the M-113 armored carrier that the crew could use to exit the pad if an emergency ever occurred prior to launch. The STS-102 crew is at KSC to take part in Terminal Countdown Demonstration Test activities, which also include a simulated launch countdown. STS-102 is the eighth construction flight to the International Space Station, carrying as payload the Multi-Purpose Logistics Module Leonardo. Launch on mission STS-102 is scheduled for March 8
2016-02-01
frequency...................................................................... 81 Figure 46. Return period analysis at Sewell’s Point (across the mouth ...Return period analysis at Sewell’s Point (across the mouth of the James River from both Langley AFB and Fort Eustis with sea level rise projections...a digital elevation model as an input and calculates the water level necessary to fill each grid cell. In other words , the fill tool takes into
ERIC Educational Resources Information Center
Turner, James P.
This speech by an official of the U.S. Department of Justice reports on the steps that the Department is taking through its Civil Rights Division to enforce the new Fair Housing Act Amendments, and discusses how the Act fosters a cooperative interagency approach to enforcement. Between passage of the Act and its effective date of March 12, 1989,…
2006-09-13
KENNEDY SPACE CENTER, FLA. -- STS117-S-002 -- These six astronauts take a break from traiing to pose for the STS-117 crew portrait. Scheduled to launch aboard the Space Shuttle Atlantis are (from the left) astronauts James F. Reilly II and Steven R. Swanson, mission specialists; Frederick W. (Rick) Sturckow, commander; Lee J. Archambault, pilot; Patrick G. Forrester and John D. (Danny) Olivas, mission specialists. The crew members are attired in training versions of their shuttle launch and entry suits.
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
STS-101 Mission Specialist J.Williams arrives at KSC for TCDT
NASA Technical Reports Server (NTRS)
2000-01-01
STS-101 Mission Specialist Jeffrey Williams arrives at KSC's Shuttle Landing Facility aboard a T-38 jet aircraft flown by STS- 101 Pilot Scott Horowitz. They and the rest of the crew are at KSC to take part in Terminal Countdown Demonstration Test (TCDT) activities that include emergency egress training and a dress rehearsal for launch. The other crew members are Commander James Halsell and Mission Specialists Mary Ellen Weber, James Voss, Susan Helms and Yuri Usachev. During their mission to the International Space Station, the STS-101 crew will be delivering logistics and supplies, plus preparing the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch April 24 at 4:15 p.m. from Launch Pad 39A.
STS-101 crew returns from Launch Pad 39A after launch was scrubbed
NASA Technical Reports Server (NTRS)
2000-01-01
The STS-101 crew returns to the Operations and Checkout Building after the launch was scrubbed due to cross winds at the KSC Shuttle Landing Facility gusting above 20 knots. Flight rules require cross winds at the SLF to be no greater than 15 knots in case of a contingency Shuttle landing. Shown leaving the Astrovan are (left to right) Mission Specialists James S. Voss and Yuri Usachev of Russia; Pilot Scott J. Horowitz; and Commander James D. Halsell Jr. in the doorway. Weather conditions will be reevaluated for another launch try on April 25. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. The mission is expected to last about 10 days.
STS-101 crew gather for snack before launch
NASA Technical Reports Server (NTRS)
2000-01-01
In the Operations and Checkout Building, the STS-101 crew gathers for a snack before suiting up for launch. From left are Mission Specialists Yury Usachev of Russia , Mary Ellen Weber and Jeffrey N. Williams; Commander James D. Halsell Jr.; Pilot Scott J. Horowitz; and Mission Specialists James S. Voss and Susan J. Helms. The mission will take the crew to the International Space Station to deliver logistics and supplies and prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk and will reboost the space station from 230 statute miles to 250 statute miles. This will be the third assembly flight to the Space Station. Liftoff of Space Shuttle Atlantis for the 10-day mission is scheduled for about 6:12 a.m. EDT from Launch Pad 39A. Landing is targeted for May 29 at 2:19 a.m. EDT.
Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian
2011-12-01
We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.
Updating the Standard Spatial Observer for Contrast Detection
NASA Technical Reports Server (NTRS)
Ahumada, Albert J.; Watson, Andrew B.
2011-01-01
Watson and Ahmuada (2005) constructed a Standard Spatial Observer (SSO) model for foveal luminance contrast signal detection based on the Medelfest data (Watson, 1999). Here we propose two changes to the model, dropping the oblique effect from the CSF and using the cone density data of Curcio et al. (1990) to estimate the variation of sensitivity with eccentricity. Dropping the complex images, and using medians to exclude outlier data points, the SSO model now accounts for essentially all the predictable variance in the data, with an RMS prediction error of only 0.67 dB.
2007-05-17
10 Ibid., 532-533. 11 Ibid., 76. 12 James L. Gibson, John M. Ivancevich , and James H. Donnelly, Organizations, 3d ed...Nuclear Age. Edited by Peter Paret. Princeton: Princeton University Press, 1986. Gibson, James L., John M. Ivancevich and James H. Donnelly, Jr
China’s Resource Quest: Securing Access to Natural Resources at Home and Abroad
2011-05-19
James Kynge, China ShakesThe World (London: Phoenix, 2007), 29. 3 Robert D. Kaplan , “The Geography of Chinese Power: How Far Can Beijing Reach on Land...region of the world while making sure that no rival great power dominates another region.”20 Robert Kaplan argues that China is taking the hegemonic...Current History 105, no. 165 (April 2006): 160. 21 Kaplan , 41. 11 rising power, it is keenly aware of the dangers associated with becoming a
2003-01-04
KENNEDY SPACE CENTER, FLA. -- STS-114 Pilot James Kelly and Commander Eileen Collins look over the windshield in Atlantis. They and other crew members are at KSC to take part in Crew Equipment Interface Test activities, which include checking out the payload and orbiter. STS-114 is a utilization and logistics flight (ULF-1) that will carry Multi-Purpose Logistics Module Raffaello and the External Stowage Platform (ESP-2), as well as the Expedition 7 crew, to the International Space Station. Launch is targeted for March 1, 2003.
The U.S. - Japan Security Alliance: Will it Survive in the New World Order?
1991-04-01
34 Washinqton Post, October 17, 1990, p. A-18. 97. Ibid. 98. Henry Cutter, Diet Takes Up Troop Dispatch Plan, ’ Japan Times, October 22-28, 1990. 99. Charles ...11. Auer, James E. "Japanis Defense Policy." Current Histpy. Vol. 87, April 1988, pp. 145-148. Babbage , Ross. "Change in the North Pacific...Smith, Charles . "Stretching Things-." Fara&a Etern.Eonomic Review. November 1, 1990, p. 16. Smith, Charles . "Vacuum Gleaner." Far Eastern Economic
Apollo 11 - Prime and Backup Crews - Geology Training - TX
1969-03-03
S69-25199 (25 Feb. 1969) --- Two Apollo 11 astronauts study a rock specimen during a geological field trip to the Quitman Mountains area near the Fort Quitman ruins in far west Texas. On the left is James A. Lovell Jr., Apollo 11 backup crew commander; and on the right is Fred W. Haise Jr., backup crew lunar module pilot. Lovell holds a camera which was used in simulating taking pictures of actual lunar samples on the surface of the Moon.
2001-04-27
KENNEDY SPACE CENTER, FLA. -- After their arrival at the Shuttle Landing Facility, the STS-104 crew takes time to pose for a photo. Standing, left to right, are Mission Specialist Janet Kavandi, Pilot Charles Hobaugh, Commander Steven Lindsey, and Mission Specialists Michael Gernhardt and James Reilly. They are at KSC to continue Crew Equipment Interface Test activities such as payload familiarization. The airlock is the primary payload on their mission, scheduled to launch no earlier than June 14, 2001, from Launch Pad 39B
Applications of the Galton Watson process to human DNA evolution and demography
NASA Astrophysics Data System (ADS)
Neves, Armando G. M.; Moreira, Carlos H. C.
2006-08-01
We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton-Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman Nbar is constrained to a small range depending on the probability p that a child is a female. Assuming that the value p≈0.488 valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable probability is 2.0492
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
NASA Astrophysics Data System (ADS)
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
Organizational Excellence: Three Keys to the Centralization/Decentralization Debate
2012-02-15
33Sheets, 36. 34Sheets, 55. 35James L. Gibson, John M. Ivancevich and James H. Donnelly, Jr., Organizations: Structure, Processes, Behavior...Accounting Office, 1993. Gibson, James L., John M. Ivancevich and James H. Donnelly, Jr.. Organizations: Structure, Processes, Behavior. Dallas, TX
NASA Astrophysics Data System (ADS)
Chias, P.; Abad, T.
2014-06-01
Medieval town centres and landscapes along the Way of St. James are being affected by renewable energy sources at the architectural, urban and territorial scales. The impact is not only visual, but thermal, accoustic and electromagnetic. Visual impact of solar photovoltaic power plants - which are placed over traditional crops close to the urban borders -, and also wind farms located at the hilltops, are sometimes remarkable. Solar photovoltaic modules are integrated into ancient roofs, and small scale wind turbines are taking up the ancient urban spaces. Among other effects on animal life and vegetation, the rise in temperature, radioelectric interferences, as well as changes in the traditional land uses are noticeable, and a deep analysis is needed. Our main target is to define an integrated methodology which considers all these effects. As a part of our project premises, we work with Open Source programs. We obtained a digital terrain model - 25 m spatial resolution -, and from Corine Land Cover images we got different raster files according to our research targets. Databases where implemented from both remote sensing and measures obtained directly in the field work. We applied GIS based multicriteria decision analysis and weighted linear combination, and then we adapted GRASS tools for a better usability. Our case studies are particularly interesting due to their situation along the Spanish Way of St. James, which is an itinerary named one of UNESCO's World Heritage Sites.
1985-12-13
Her leadership , help, and understanding at crltlcal times will always be remembered. Thank you for help ing me attain this great goal and captu~e a...by Braude §1 ~!- (1955) and Cremer and Watson (1957 ) to be the primary site of endotoxin localization following i.v. injection] were st imulated by...A-specif ic tr iggeri ng r eceptor on murine B lymp hocytes. Eur. J. Immunol. 8:63 . Cremer , N. and D.W. Watson. 1957. Inf luence of s tress on
2011-08-19
A) CD, (B) UV, (C) Tm, and (D) titration experiments of d(iG*)8/d(C)8. d(T/A*/T)n WC WC d(T/A/T)n Watson – Crick (WC) Hoogsteen Symmetrical A...base Figure 7. Triplex formation of the natural T/A/T which has one Watson - Crick (WC)-type and one Hoogsteen-type hydrogen-bondings, and the...Final Report for AOARD Grant FA2386-10-1-4033 “Biological and Nano-technological Applications of Artificial DNAs Made Exclusively of Nonnatutal C
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
NASA Technical Reports Server (NTRS)
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Journey of a molecular biologist.
Nomura, Masayasu
2011-01-01
My journey into a research career began in fermentation biochemistry in an applied science department during the difficult post-World War II time in Japan. Subsequently, my desire to do research in basic science developed. I was fortunate to be a postdoctoral fellow in the United States during the early days of molecular biology. From 1957 to 1960, I worked with three pioneers of molecular biology, Sol Spiegelman, James Watson, and Seymour Benzer. These experiences helped me develop into a basic research scientist. My initial research projects at Osaka University, and subsequently at the University of Wisconsin, Madison, were on the mode of action of colicins as well as on mRNA and ribosomes. Following success in the reconstitution of ribosomal subunits, my efforts focused more on ribosomes, initially on the aspects of structure, function, and in vitro assembly, such as the construction of the 30S subunit assembly map. After this, my laboratory studied the regulation of the synthesis of ribosomes and ribosomal components in Escherichia coli. Our achievements included the discovery of translational feedback regulation of ribosomal protein synthesis and the identification of several repressor ribosomal proteins used in this regulation. In 1984, I moved to the University of California, Irvine, and initiated research on rRNA transcription by RNA polymerase I in the yeast Saccharomyces cerevisiae. The use of yeast genetics combined with biochemistry allowed us to identify genes uniquely involved in rRNA synthesis and to elucidate the mechanism of initiation of transcription. This essay is a reflection on my life as a research scientist.
The 'Biologically-Inspired Computing' Column
NASA Technical Reports Server (NTRS)
Hinchey, Mike
2006-01-01
The field of Biology changed dramatically in 1953, with the determination by Francis Crick and James Dewey Watson of the double helix structure of DNA. This discovery changed Biology for ever, allowing the sequencing of the human genome, and the emergence of a "new Biology" focused on DNA, genes, proteins, data, and search. Computational Biology and Bioinformatics heavily rely on computing to facilitate research into life and development. Simultaneously, an understanding of the biology of living organisms indicates a parallel with computing systems: molecules in living cells interact, grow, and transform according to the "program" dictated by DNA. Moreover, paradigms of Computing are emerging based on modelling and developing computer-based systems exploiting ideas that are observed in nature. This includes building into computer systems self-management and self-governance mechanisms that are inspired by the human body's autonomic nervous system, modelling evolutionary systems analogous to colonies of ants or other insects, and developing highly-efficient and highly-complex distributed systems from large numbers of (often quite simple) largely homogeneous components to reflect the behaviour of flocks of birds, swarms of bees, herds of animals, or schools of fish. This new field of "Biologically-Inspired Computing", often known in other incarnations by other names, such as: Autonomic Computing, Pervasive Computing, Organic Computing, Biomimetics, and Artificial Life, amongst others, is poised at the intersection of Computer Science, Engineering, Mathematics, and the Life Sciences. Successes have been reported in the fields of drug discovery, data communications, computer animation, control and command, exploration systems for space, undersea, and harsh environments, to name but a few, and augur much promise for future progress.
Soffer-Dudek, Nirit
2017-01-01
The term “sleep experiences,” coined by Watson (2001), denotes an array of unusual nocturnal consciousness phenomena; for example, nightmares, vivid or recurrent dreams, hypnagogic hallucinations, dreams of falling or flying, confusional arousals, and lucid dreams. Excluding the latter, these experiences reflect a single factor of atypical oneiric cognitions (“general sleep experiences”). The current study is an opinionated mini-review on the associations of this factor—measured with the Iowa sleep experiences survey (ISES, Watson, 2001)—with psychopathological symptoms and stress. Findings support a strong relation between psychological distress and general sleep experiences. It is suggested that that they should be viewed as a sleep disturbance; they seem to represent involuntary intrusions of wakefulness into sleep, resulting in aroused sleep. These intrusions may stem from excessively thin boundaries between consciousness states (e.g., “transliminality”), or, conversely, they may follow an attempt at disconnecting mental elements (e.g., dissociation), which paradoxically results in a “rebound effect.” The extent to which unusual dreaming is experienced as intrusive, rather than controlled, may explain why general sleep experiences are related to psychopathology, whereas lucid dreams are related to psychological resilience. In conclusion, the exploration of the interplay between psychopathology and sleep should be expanded from focusing almost exclusively on quantitative aspects (e.g., sleep efficiency, latency) to including qualitative conscious experiences which may reflect poor sleep quality. Taking into account nocturnal consciousness—including unusual dreaming and permeable sleep-wake boundaries—may unveil rich information on night-time emotional states and broaden our definition of poor sleep quality. PMID:28539902
STS-113 Post Flight Presentation
NASA Astrophysics Data System (ADS)
2002-01-01
The STS-113 post-flight presentation begins with a view of Mission Specialists Michael E. Lopez-Alegria and John B. Herrington getting suited for the space mission. The STS-113 crew consists of: Commander James D. Wetherbee, Pilot Paul Lockhart, Mission Specialists Michael Lopez-Alegria and John Herrington. Cosmonauts Valery Korzun, and Sergei Treschev, and astronaut Peggy Whitson who are all members of the expedition five crew, and Commander Kenneth Bowersox, Flight Engineers Nikolai Budarin and Donald Pettit, members of Expedition Six. The main goal of this mission is to take Expedition Six up to the International Space Station and Return Expedition Five to the Earth. The second objective is to install the P(1) Truss segment. Three hours prior to launch, the crew of Expedition Six along with James Wetherbee, Paul Lockhart, Michael Lopez-Alegria and John Herrington are shown walking to an astrovan, which takes them to the launch pad. The actual liftoff is presented. Three Extravehicular Activities (EVA)'s are performed on this mission. Michael Lopez-Alegria and John Herrington are shown performing EVA 1 and EVA 2 which include making connections between the P1 and S(0) Truss segments, and installing fluid jumpers. A panoramic view of the ISS with the Earth in the background is shown. The grand ceremony of the crew exchange is presented. The astronauts performing everyday duties such as brushing teeth, washing hair, sleeping, and eating pistachio nuts are shown. The actual landing of the Space Shuttle is presented.
Using New Media to Spread the Word About the James Webb Space Telescope
NASA Astrophysics Data System (ADS)
Masetti, Maggie; Krishnamurthi, A.
2008-05-01
The James Webb Space Telescope is a 6.5 m infrared telescope that will be launched in 2013. This modern telescope will look very different from the simple telescope Galileo used to look up at the skies 400 years ago. Modern technology, coupled with scientific curiosity, is enabling science to help us understand a Universe Galileo had not dreamed of in his time. The International Year of Astronomy presents an excellent opportunity to take the public along on the journey of the development of the Webb Telescope and its technological innovations. In keeping with the cutting-edge nature of the Webb, its education and public outreach (EPO) team is using a variety of new media to engage the public. We will discuss several of our EPO projects including our website, exhibits and displays in Second Life (an internet-based virtual world), and involvement in podcasts. Webb's EPO team is looking to expand past a passive web presence to engage the new and growing internet-savvy audiences. We are making our website more interactive through a variety of means, including a Flash game that allows the user to compare the Webb to a common reflecting telescope. This will enable the user to learn about the changes in telescopes that have come about since Galileo's time. We are also taking advantage of other new media opportunities as they present themselves - we participate in podcasts and have an engaging presence for the Webb Telescope on NASA's "islands” in Second Life.
NASA Astrophysics Data System (ADS)
Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina
2014-06-01
Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were added to the Watson 012 sample by through-flowing basaltic melt. Along with the absence of glass and granophyre, this interconnected network of coarse-grained skeletal plagioclase indicates that the sample cooled slowly at depth within the parent body. The evidence of melt flux indicates that Watson 012 formed in the presence of a gravitational gradient, and thus at significant distance from the centre of the H chondrite parent body (the gravitational gradient at the centre would be zero). Our interpretation is that incipient silicate partial melting in Watson 012 occurred when a region of radiogenically heated H6 material located at considerable depth (possibly at ∼15-20 km from surface) was heated by an additional ca. 200-300 °C in association with a large shock event. Due to insulation at depth within an already hot parent body, the post-shock temperature equilibrated and remained above the solidus long enough for widespread equilibrium-based silicate partial melting, and for melt to migrate. Although the observed melting may have been facilitated by additional heating from an impact event, this is not an example of instantaneous shock melting, which produces thermal disequilibrium at short length scales and distinctly different textures. A small number of H, L and LL chondrites have been previously classified as being of petrologic Type 7; with our new criteria to support that classification, these represent our best opportunity to explore the transition from high temperature sub-solidus metamorphism through the onset of silicate partial melting in three different parent bodies.
Watson: A new link in the IIE iron chain
NASA Technical Reports Server (NTRS)
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
The Darwinian Center to the Vision of William James.
ERIC Educational Resources Information Center
Bredo, Eric
The essence of William James's vision can sometimes be hard to discover due to emotional volatility and exploratory impulsiveness. On the other hand, beneath James's apparent inconsistency was a constancy of purpose that can be easily underestimated. This paper argues that the center of James's vision lay in an interpretation of Darwinism. By…
STS-101 Mission Specialist Williams practices driving an M-113 during TCDT
NASA Technical Reports Server (NTRS)
2000-01-01
Seated on top of an M-113 personnel carrier, Capt. George Hoggard of the KSC/CCAFS Fire Department gives instruction to STS-101 Mission Specialist Yuri Usachev (right), who is in the driver seat. In the rear are Mission Specialists James Voss (holding a camera), Jeffrey N. Williams, Pilot Scott J. 'Doc' Horowitz and Mary Ellen Weber. Other crew members taking part are Commander James D. Halsell Jr. and Mission Specialist Susan J. Helms. The training is part of Terminal Countdown Demonstration Test (TCDT) activities that include emergency egress training and a simulated launch countdown. During their mission to the International Space Station, the STS-101 crew will be delivering logistics and supplies, plus preparing the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk to perform maintenance on the Space Station. This will be the third assembly flight for the Space Station. STS-101 is scheduled to launch April 24 at 4:15 p.m. from Launch Pad 39A.
The "Very Cool" James Webb Space Telescope!
NASA Technical Reports Server (NTRS)
Teague, Peter J. B.
2018-01-01
For over twenty years, scientists, engineers, technicians, and other personnel have been working on the next generation space telescope. As a partnership between NASA (National Aeronautics and Space Administration), CSA (Canadian Space Agency), and ESA (European Space Angency), the James Webb Space Telescope will complement the previous research performed by the Hubble by utilizing a larger primary mirror, which will also be optimized for infrared wavelengths. This combination will allow JWST to collect data and take images of light having traveled over 13.7 billion light years. This presentation will focus on the mission, as well as the contamination control challenges during the integration and testing in the NASA Goddard Spacecraft Systems Development and Integration Facility (SSDIF), one of the largest cleanrooms in the world. Additional information will be presented regarding space simulation testing down to a cool 20 degrees Kelvin [-424 degrees Fahrenheit] that will occur at Johnson Space Center in Houston, TX, and more testing and integration to happen at Northrop Grumman Corp., in Redondo Beach, CA. Launch of the JWST is currently scheduled for the spring of 2019 at Ariane Spaceport in French Guiana, South America.
77 FR 58773 - Drawbridge Operation Regulations; James River, Newport News, VA
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-24
... Operation Regulations; James River, Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Notice of temporary... schedule that governs the US 17/258 Bridge across the James River, mile 5.0, at Newport News, VA. The... 17/258 Bridge over the James River, mile 5.0, at Newport News, VA opens on signal as required by 33...
ERIC Educational Resources Information Center
Bridgers, Lynn; Snarey, John R.
2003-01-01
Using a historical and biographical, then developmental, approach, this article examines William James's spiritual family history by reviewing key events in the life of his father, Henry James, Sr. It pays particular attention to Henry Sr's tumultuous relationship with his own father, William James of Albany, and Henry Sr's subsequent conversion…
Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane
2013-11-01
William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)<-->A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Evans, Melanie
2006-06-26
Carilion Health System needs to change or die, according to its leaders, so the Roanoke, Va., organization is converting from a typical not-for-profit system into a physician-run clinic. The switch is an extreme version of an industrywide push to employ doctors. James Thweatt Jr., left, of rival Lewis-Gale, says his hospital joined the trend when it hired 80 specialists from a failing local clinic.
2000-04-24
While suiting up in the Operations and Checkout Building, STS-101 Mission Specialists (standing) Susan J. Helms, James S. Voss and (sitting) Yuri Usachev of Russia reveal their happiness to be just hours away from launch of Space Shuttle Atlantis. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station
View of White Room atop Pad A during Apollo 9 Countdown Demonstration Test
1969-02-23
S69-25884 (23 Feb. 1969) --- Interior view of the white room atop Pad A, Launch Complex 39, Kennedy Space Center, during Apollo 9 Countdown Demonstration Test activity. Standing next to spacecraft hatch is astronaut James A. McDivitt, commander. Also, taking part in the training exercise were astronauts David R. Scott, command module pilot; and Russell L. Schweickart, lunar module pilot. The Apollo 9 mission will evaluate spacecraft lunar module systems performance during manned Earth-orbital flight. Apollo 9 will be the second manned Saturn V mission.
DNA nanotechnology from the test tube to the cell.
Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg
2015-09-01
The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.
The ν 2and ν 8+ ν 10Bands of CF 2=CH 2
NASA Astrophysics Data System (ADS)
Wang, W. F.; Tan, T. L.; Ong, P. P.
1997-01-01
The high-resolution FTIR spectrum of CF 2=CH 2was measured and analyzed in the Fermi interacting ν 2and ν 8+ ν 10bands around 1735 cm -1. Both bands have strong infrared absorption with an A-type appearance. Watson's A-reduced Hamiltonian in the I rrepresentation was employed in the computation of the energy levels, taking into account the Fermi resonance contribution. A total of 2119 ν 2transitions and 2056 ν 8+ ν 10transitions were eventually assigned with a rms deviation of 0.00075 cm -1. In a nonlinear least-squares fit, accurate rovibrational constants of the upper states were determined with the band origins ν 2= 1728.49829 ± 0.00005 cm -1and ν 8+ ν 10= 1741.50207 ± 0.00004 cm -1. Finally, a set of equilibrium rotational constants of CF 2=CH 2were derived.
Hart, Ailsa L; Lomer, Miranda; Verjee, Azmina; Kemp, Karen; Faiz, Omar; Daly, Ann; Solomon, Julie; McLaughlin, John
2017-02-01
Many uncertainties remain regarding optimal therapies and strategies for the treatment of inflammatory bowel disease. Setting research priorities addressing therapies requires a partnership between health care professionals, patients and organisations supporting patients. We aimed to use the structure of the James Lind Alliance Priority Setting Partnership, which has been used in other disease areas, to identify and prioritise unanswered questions about treatments for inflammatory bowel disease. The James Lind Priority Setting Partnership uses methods agreed and adopted in other disease areas to work with patients and clinicians: to identify uncertainties about treatments; to agree by consensus a prioritised list of uncertainties for research; then to translate these uncertainties into research questions which are amenable to hypothesis testing; and finally to take results to research commissioning bodies to be considered for funding. A total of 1636 uncertainties were collected in the initial survey from 531 respondents, which included 22% health care professionals and 78% patients and carers. Using the rigorously applied processes of the priority setting partnership, this list was distilled down to the top 10 research priorities for inflammatory bowel disease. The top priorities were: identifying treatment strategies to optimise efficacy, safety and cost-effectiveness; and stratifying patients with regard to their disease course and treatment response. Diet and symptom control [pain, incontinence and fatigue] were also topics which were prioritised. A partnership involving multidisciplinary clinicians, patients and organisations supporting patients has identified the top 10 research priorities in the treatment of patients with inflammatory bowel disease. © European Crohn’s and Colitis Organisation 2016.
Poor and Rich in James: A Relevance Theory Approach to James's Use of the Old Testament
ERIC Educational Resources Information Center
Morales, Nelson R.
2015-01-01
The epistle of James was for years a forgotten book in academic circles. In recent decades, however, a renewed focus on early Judaism has generated interest in looking at James with new eyes. Poverty and wealth in the epistle continues to be a point of interest. Other topics, however, are still to be explored. One of these topics is the rhetorical…
Assistant Secretary of Defense for Legislative Affairs
Links Mission Congressional Links Secretary of Defense James Mattis
James Mattis" title=" Secretary of Defense James Mattis" /> The
Test of time: what if little Albert had escaped?
Field, Andy P; Nightingale, Zoë C
2009-04-01
Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.
Applied Meteorology Unit (AMU) Quarterly Report Fourth Quarter FY-14
NASA Technical Reports Server (NTRS)
Bauman, William H.; Crawford, Winifred C.; Watson, Leela R.; Shafer, Jaclyn
2014-01-01
Ms. Crawford completed the final report for the dual-Doppler wind field task. Dr. Bauman completed transitioning the 915-MHz and 50-MHz Doppler Radar Wind Profiler (DRWP) splicing algorithm developed at Marshall Space Flight Center (MSFC) into the AMU Upper Winds Tool. Dr. Watson completed work to assimilate data into model configurations for Wallops Flight Facility (WFF) and Kennedy Space Center/Cape Canaveral Air Force Station (KSC/CCAFS). Ms. Shafer began evaluating the a local high-resolution model she had set up previously for its ability to forecast weather elements that affect launches at KSC/CCAFS. Dr. Watson began a task to optimize the data-assimilated model she just developed to run in real time.
Croce, P J
1999-11-01
In the 5 years before 1878, when his career in psychology was becoming established, William James wrote a series of notes and reviews assessing the work of many of the pioneers in the new field. Adopting a public and confident voice, even while he was privately still uncertain and searching, James criticized the dogmatism of positivist and idealist claims to the study of the human brain and mind. In his short writings of 1873-1877, James started to formulate his own middle path. His first steps on that path show that he did not reject either scientific or philosophic inquiry; instead, he viewed scientific knowledge as a way to understand philosophical questions more deeply. Saving his sharpest critiques for positivism, James endorsed scientific investigation without materialist assmptions. While his career in psychology was still only a hope, James treated science as a means toward humanist insight.
A Giant of Astronomy and a Quantum of Solace - James Bond filming at Paranal
NASA Astrophysics Data System (ADS)
2008-03-01
Cerro Paranal, the 2600m high mountain in the Chilean Atacama Desert that hosts ESO's Very Large Telescope, will be the stage for scenes in the next James Bond movie, "Quantum of Solace". ESO PR Photo 07a/08 ESO PR Photo 07a/08 The Paranal Residencia Looking akin to Mars, with its red sand and lack of vegetation, the Atacama Desert is thought to be the driest place on Earth. Cerro Paranal is home to ESO's Very Large Telescope (VLT), which, with its array of four giant 8.2-m individual telescopes, is the world's most advanced optical observatory. The high-altitude site and extreme dryness make excellent conditions for astronomical observations. "We needed a unique site for a unique set of telescopes, and we found it at Paranal," said Andreas Kaufer, ESO's Paranal Director. "We are very excited that the Bond production team have also chosen this location." The excellent astronomical conditions at Paranal come at a price, however. In this forbidding desert environment, virtually nothing can grow outside. The humidity drops below 10%, there are intense ultraviolet rays from the sun, and the high altitude leaves people short of breath. Living in this extremely isolated place feels like visiting another planet. To make it possible for people to live and work here, a hotel or "Residencia" was built in the base camp, allowing them to escape from the arid outside environment. Here, returning from long shifts at the VLT and other installations on the mountain, they can breathe moist air and relax, sheltered from the harsh conditions outside. The Residencia's award-winning design, including an enclosed tropical garden and pool under a futuristic domed roof, gives its interior a feeling of open space within the protective walls - this is a true "haven in the desert". It is this unique building that serves as the backdrop for the James Bond filming. View Larger Map QUANTUM OF SOLACE producer, Michael G. Wilson said: "The Residencia of Paranal Observatory caught the attention of our director, Marc Forster and production designer, Dennis Gassner, both for its exceptional design and its remote location in the Atacama desert. It is a true oasis and the perfect hide-out for Dominic Greene, our villain, whom 007 is tracking in our new James Bond film." In addition to the shooting at the Residencia, further action will take place at the Paranal airstrip. The film crew present on Paranal includes Englishman Daniel Craig, taking again the role of James Bond, French actor Mathieu Amalric, leading lady Olga Kurylenko, from the Ukraine, as well as acclaimed Mexican actors, Joaquin Cosio and Jesus Ochoa. This cast from across Europe and Latin America mirrors the international staff that works for ESO at Paranal. After leaving Paranal at the end of the week, the film crew will shoot in other locations close to Antofagasta. Other sequences have been filmed in Panama and, following the Chilean locations, the unit will be travelling to Italy and Austria before returning to Pinewood Studios near London in May. QUANTUM OF SOLACE will be released in the UK on 31 October 2008, and in the US and internationally on 7 November 2008.
Berkas, W.R.
1987-01-01
Before upgrading the Southwest Wastewater-Treatment Plant near Springfield, Missouri, to tertiary treatment, adverse water quality conditions resulting from discharge of wastewater effluent to Wilson Creek were documented in the creek and in the James River. About 7 years after the upgrading of the treatment plant, traveltime, reaeration, and water quality characteristics were determined in Wilsons Creek and the James River. Traveltime was measured once in Wilsons Creek and twice in the James River during low-flow conditions. Traveltimes in the James River were estimated for discharge between 55 and 200 cu ft/sec at a site near Boaz. Reaeration coefficients were calculated for five reaches in Wilsons Creek and the James River using the modified-tracer technique. Calculated reaeration coefficients were compared with coefficients predicted by twelve empirical equations and one equation was chosen that best fit the data. Water quality data were collected during two 44-hr periods, August 14 to 16, 1984, and July 23 to 25, 1985. Samples were collected at the outflow of the Southwest Wastewater Treatment Plant at seven sites along Wilsons Creek and the James River. Dissolved-oxygen concentrations in Wilsons Creek and the James River were all larger than Missouri 's water quality standard of 5.0 mg/l. Ammonia concentrations and 5-day carbonaceous biochemical oxygen demands were small, which indicated that the oxygen consumption by oxidizing ammonia and carbonaceous organic materials would be insignificant. Measured streambed oxygen demand in the James River was largest directly downstream from Wilsons Creek. (USGS)
Speculation on Curriculum from the Perspective of William James.
ERIC Educational Resources Information Center
Shubert, William H; Zissis, Georgiana
1988-01-01
This article discusses the implications for curriculum theory, research, and practice of William James' thought. Also considered is the question of what curriculum theory and research might be like if James had garnered greater influence than Thorndike. (IAH)
45 CFR 2490.170 - Compliance procedures.
Code of Federal Regulations, 2014 CFR
2014-10-01
... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...
45 CFR 2490.170 - Compliance procedures.
Code of Federal Regulations, 2013 CFR
2013-10-01
... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...
45 CFR 2400.31 - Selection process.
Code of Federal Regulations, 2013 CFR
2013-10-01
... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION... outstanding applicants from each state for James Madison Fellowships. (b) From among candidates recommended for fellowships by the Fellow Selection Committee, the Foundation will name James Madison Fellows. The...
45 CFR 2400.31 - Selection process.
Code of Federal Regulations, 2014 CFR
2014-10-01
... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION... outstanding applicants from each state for James Madison Fellowships. (b) From among candidates recommended for fellowships by the Fellow Selection Committee, the Foundation will name James Madison Fellows. The...
45 CFR 2400.31 - Selection process.
Code of Federal Regulations, 2012 CFR
2012-10-01
... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION... outstanding applicants from each state for James Madison Fellowships. (b) From among candidates recommended for fellowships by the Fellow Selection Committee, the Foundation will name James Madison Fellows. The...
45 CFR 2490.170 - Compliance procedures.
Code of Federal Regulations, 2012 CFR
2012-10-01
... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...
45 CFR 2490.170 - Compliance procedures.
Code of Federal Regulations, 2011 CFR
2011-10-01
... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...
45 CFR 2490.170 - Compliance procedures.
Code of Federal Regulations, 2010 CFR
2010-10-01
... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...
Salvaging the self in a world without soul: William James's The Principles of psychology.
Coon, D J
2000-05-01
This article explores William James's transformation of the religious soul into the secular self in The Principles of Psychology. Although James's views on the self are familiar to many historians of psychology, the article places his treatment of the self within the broader social and cultural context of a secularizing, industrializing society. There were palpable tensions and anxieties that accompanied the cultural shift, and these are particularly transparent in James's Principles. James attempted the project of secularizing the soul in order to promote a natural science of the mind but with marked ambivalence for the project, because it left out some of the moral and metaphysical questions of great interest to him.
Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua
2010-08-01
Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.
Browne, Kendall C; Trim, Ryan S; Myers, Ursula S; Norman, Sonya B
2015-04-01
Despite high prevalence and concerning associated problems, little effort has been made to conceptualize the construct of posttraumatic guilt. This investigation examined the theoretical model of trauma-related guilt proposed by Kubany and Watson (2003). This model hypothesizes that emotional and physical distress related to trauma memories partially mediates the relationship between guilt cognitions and posttraumatic guilt. Using path analysis, this investigation (a) empirically evaluated relationships hypothesized in Kubany and Watson's model, and (b) extended this conceptualization by evaluating models whereby guilt cognitions, distress, and posttraumatic guilt were related to posttraumatic stress disorder (PTSD) symptoms depression symptom severity. Participants were male U.S. Iraq and Afghanistan veterans (N = 149). Results yielded a significant indirect effect from guilt cognitions to posttraumatic guilt via distress, providing support for Kubany and Watson's model (β = .14). Findings suggested distress may be the strongest correlate of PTSD symptoms (β = .47) and depression symptoms (β = .40), and that guilt cognitions may serve to intensify the relationship between distress and posttraumatic psychopathology. Research is needed to evaluate whether distress specific to guilt cognitions operates differentially on posttraumatic guilt when compared to distress more broadly related to trauma memories. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.
Small-Angle Neutron Scattering Studies of Magnetic Correlation Lengths in Nanoparticle Assemblies
NASA Astrophysics Data System (ADS)
Majetich, Sara
2009-03-01
Small-angle neutron scattering (SANS) measurements of ordered arrays of surfactant-coated magnetic nanoparticle reveal characteristic length scales associated with interparticle and intraparticle magnetic ordering. The high degree of uniformity in the monodisperse nanoparticle size and spacing leads to a pronounced diffraction peak and allows for a straightforward determination of these length scales [1]. There are notable differences in these length scales depending on the particle moment, which depends on the material (Fe, Co, Fe3O4) and diameter, and also on whether the metal particle core is surrounded by an oxide shell. For 8.5 nm particles containing an Fe core and thick Fe3O4 shell, evidence of a spin flop phase is seen in the magnetite shell when a field is applied , but not when the shell thickness is ˜0.5 nm [2]. 8.0 nm particles with an e-Co core and 0.75 nm CoO shell show no exchange bias effects while similar particles with a 2 nm thick shell so significant training effects below 90 K. Polarized SANS studied of 7 nm Fe3O4 nanoparticle assemblies show the ability to resolve the magnetization components in 3D. [4pt] [1] M. Sachan, C. Bonnoit, S. A. Majetich, Y. Ijiri, P. O. Mensah-Bonsu, J. A. Borchers, and J. J. Rhyne, Appl. Phys. Lett. 92, 152503 (2008). [0pt] [2] Yumi Ijiri, Christopher V. Kelly, Julie A. Borchers, James J. Rhyne, Dorothy F. Farrell, Sara A. Majetich, Appl. Phys. Lett. 86, 243102-243104 (2005). [0pt] [3] K. L. Krycka, R. Booth, J. A. Borchers, W. C. Chen, C. Conlon, T. Gentile, C. Hogg, Y. Ijiri, M. Laver, B. B. Maranville, S. A. Majetich, J. Rhyne, and S. M. Watson, Physica B (submitted).
Re-Presenting James Britton: A Symposium.
ERIC Educational Resources Information Center
Tirrell, Mary Kay; And Others
1990-01-01
Presents revised versions of four symposium papers examining the work of linguist, teacher, and educator of teachers James Britton. Includes "James Britton: An Impressionistic Sketch" (Mary Kay Tirrell); "Collaborating with Jimmy Britton" (Gordon M. Pradl); "Rejoicing in the Margins" (John Warnock); and "A…
1. Historic American Buildings Survey James F. and Jean B. ...
1. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 EXTERIOR FROM THE SOUTHEAST Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
2. Historic American Buildings Survey James F. and Jean B. ...
2. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 EXTERIOR FROM THE SOUTHWEST Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics
2016-01-01
Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. Objective To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. Methods The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Results Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix. Conclusions IBMWA is a new alternative for data analytics software that automates descriptive, predictive, and visual analytics. This program is very user-friendly but requires data preprocessing, statistical conceptual understanding, and domain expertise. PMID:27729304
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix. IBMWA is a new alternative for data analytics software that automates descriptive, predictive, and visual analytics. This program is very user-friendly but requires data preprocessing, statistical conceptual understanding, and domain expertise.
Kauss, H.; Jeblick, W.; Ziegler, J.; Krabler, W.
1994-01-01
Suspension-cultured cells of parsley (Petroselinum crispum L.) were used to demonstrate an influence of jasmonic acid methyl ester (JAME) on the elicitation of activated oxygen species. Preincubation of the cell cultures for 1 d with JAME greatly enhanced the subsequent induction by an elicitor preparation from cell walls of Phytophtora megasperma f. sp. glycinea (Pmg elicitor) and by the polycation chitosan. Shorter preincubation times with JAME were less efficient, and the effect was saturated at about 5 [mu]M JAME. Treatment of the crude Pmg elicitor with trypsin abolished induction of activated oxygen species, an effect similar to that seen with elicitation of coumarin secretion. These results suggest that JAME conditioned the parsley suspension cells in a time-dependent manner to become more responsive to elicitation, reminiscent of developmental effects caused by JAME in whole plants. It is interesting that pretreatment of the parsley cultures with 2,6-dichloroisonicotinic and 5-chlorosalicylic acid only slightly enhanced the elicitation of activated oxygen species, whereas these substances greatly enhanced the elicitation of coumarin secretion. Therefore, these presumed inducers of systemic acquired resistance exhibit a specificity different from JAME. PMID:12232189
Global Demographic Change and Its Implications for Military Power
2011-01-01
cent (rather than 9 percent). 11 James W. Vaupel, James R. Carey , and Kaare Christensen, “Aging: It’s Never Too Late,” Science, Vol. 301, No. 5640...3, June 2004, pp. 627–642. 14 Expenses include facility services (hospitalization and nursing home stays), professional services, drugs, dental ...www.census.gov/ipc/www/idb/ Vaupel, James W., James R. Carey , and Kaare Christensen, “Aging: It’s Never Too Late,” Science, Vol. 301, No. 5640, September 19
The STS-101 crew exit the O&C on their way to Launch Pad 39A
NASA Technical Reports Server (NTRS)
2000-01-01
(Nikon D1 Test) The STS-101 crew wave to onlookers as they leave the Operations and Checkout Building enroute for the second time to Launch Pad 39A and another attempt at liftoff of Space Shuttle Atlantis. In their orange launch and entry suits, they are (front line) Pilot Scott J. Horowitz and Commander James D. Halsell Jr.; (second line) Mission Specialists Mary Ellen Weber and Jeffrey N. Williams; and (third line) Mission Specialists Susan J. Helms, Yury Usachev of Russia and James S. Voss The first attempt on April 24 was scrubbed due to unfavorable weather conditions. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station. Liftoff is targeted for 3:52 p.m. EDT. The mission is expected to last about 10 days, with Atlantis landing at KSC Saturday, May 6, about 11:53 a.m. EDT.
Macintyre, Iain
2016-11-01
James Hill was apprenticed to the formidable Edinburgh surgeon, physician and philosopher George Young from whom he learned the value of careful observation and scepticism in medicine. As a surgeon in Dumfries he was able to take advantage of newly established medical journals to publish case reports. His book Cases in Surgery summarised three aspects of his life's work as a surgeon. In it he provides a classical description of the features and transmission of sibbens (endemic syphilis) and suggests from careful clinical observation that sibbens and venereal syphilis were the same disease. His success with treatment of cancer led him to advocate curative rather than palliative excision, a view that ran counter to accepted contemporary practice. Hill's ability to diagnose cerebral compression caused by bleeding following head injury enabled him to treat this successfully by directed trephine and drainage. His results on the treatment of head injury were the best to be published in their day and an important addition to the increasing understanding of the basis of the management of head injury. © The Author(s) 2014.
STS-101 crew members Helms, Voss and Usachev during suitup
NASA Technical Reports Server (NTRS)
2000-01-01
While suiting up in the Operations and Checkout Building, STS-101 Mission Specialists (standing) Susan J. Helms, James S. Voss and (sitting) Yuri Usachev of Russia reveal their happiness to be just hours away from launch of Space Shuttle Atlantis. The mission will take the crew to the International Space Station to deliver logistics and supplies and to prepare the Station for the arrival of the Zvezda Service Module, expected to be launched by Russia in July 2000. Also, the crew will conduct one space walk. This will be the third assembly flight to the Space Station.
Mighty Microbes Where Rivers Run
Stegen, James
2018-01-16
Microbes and their influential role in Earthâs climate take center stage in the area where river water and groundwater mix â an area known as the hyporheic zone. PNNL ecologist James Stegen discusses his teamâs research in his âlaboratoryâ â the zone along the Columbia, one of the nationâs largest rivers. Itâs a squishy, porous lab, better known for soaking feet than serving as the âriverâs liver.â
1996-10-15
JOHNSON SPACE CENTER, HOUSTON, TEXAS -- (JSC STS109-5-002) -- STS-109 CREW PORTRAIT -- Seven astronauts take a break from training for the STS-109 mission to pose for the traditional pre-flight crew portrait. From the left are astronauts Michael J. Massimino, Richard M. Linnehan, Duane G. Carey, Scott D. Altman, Nancy J. Currie, John M. Grunsfeld and James H. Newman. Altman and Carey are commander and pilot, respectively, with the others serving as mission specialists. Grunsfeld is payload commander. The group will be the fourth to visit the Hubble Space Telescope (HST) for performing upgrade and servicing on the giant orbital observatory
1969-03-13
S69-27746 (13 March 1969) --- The Apollo 9 crew awaits the arrival of a recovery helicopter from the USS Guadalcanal, prime recovery ship for the Apollo 9 10-day Earth-orbital space mission. Astronaut James A. McDivitt, commander, stands in hatch of spacecraft. Already in life raft are astronauts Russell L. Schweickart (foreground), lunar module pilot, and David R. Scott, command module pilot. Scott is taking a picture of McDivitt. Splashdown occurred at 12:00:53 p.m. (EST), March 13, 1969, only 4.5 nautical miles from the USS Guadalcanal. U.S. Navy underwater demolition team swimmers assist in the recovery operations.
2014-04-11
CAPE CANAVERAL, Fla. -- At the Marriott Courtyard Hotel in Cocoa Beach, Fla., James Mantovani of the NASA Surface Systems Office at NASA's Kennedy Space Center, speaks to participants in the 4th International Workshop on Lunar and Planetary Compact and Cryogenic Science and Technology Applications. Scientists, engineers and entrepreneurs interested in research on the moon and other planetary surfaces, recently participated in the Workshop. Taking place April 8-11, 2014, the event was designed to foster collaborative work among those interested in solving the challenges of building hardware, software and businesses interested in going back to the moon and exploring beyond. Photo credit: NASA/Daniel Casper
2014-04-11
CAPE CANAVERAL, Fla. -- At the Marriott Courtyard Hotel in Cocoa Beach, Fla., James Mantovani of the NASA Surface Systems Office at NASA's Kennedy Space Center, speaks to participants in the 4th International Workshop on Lunar and Planetary Compact and Cryogenic Science and Technology Applications. Scientists, engineers and entrepreneurs interested in research on the moon and other planetary surfaces, recently participated in the Workshop. Taking place April 8-11, 2014, the event was designed to foster collaborative work among those interested in solving the challenges of building hardware, software and businesses interested in going back to the moon and exploring beyond. Photo credit: NASA/Daniel Casper
Aerial photographic water color variations from pollution in the James River
NASA Technical Reports Server (NTRS)
Bressette, W. E.
1978-01-01
A photographic flight was made over the James River on May 17, 1977. The data show that, in general, James River water has very high sunlight reflectance. In the Bailey Bay area this reflectance is drastically reduced. Also shown is a technique for normalizing off-axis variations in radiance film exposure from camera falloff and uneven sunlight conditions to the nadir value. After data normalization, a spectral analysis is performed that identifies Bailey Creek water in James River water. The spectral results when compared with laboratory spectrometer data indicate that reflectance from James River water is dominated by suspended matter, while the substance most likely responsible for reduced reflectance in Bailey Creek water is dissolved organic carbon.
places to live, work and visit." The newly designated communities are the James Street Commons five geographical wards, and the two neighborhoods represent the city's Central Ward (James Street Preservation and First Lady Michelle Obama are recognizing two of our most exciting neighborhoods, the James
77 FR 32889 - Airworthiness Directives; The Boeing Company Airplanes
Federal Register 2010, 2011, 2012, 2013, 2014
2012-06-04
...., Washington, DC 20590. FOR FURTHER INFORMATION CONTACT: James Sutherland, Aerospace Engineer, Airframe Branch... 98057-3356; phone: 425- 917-6533; fax: 425-917-6590; email: James.Sutherland@faa.gov . SUPPLEMENTARY... more information about this AD, contact James Sutherland, Aerospace Engineer, Airframe Branch, ANM-120S...
77 FR 42962 - Airworthiness Directives; The Boeing Company Airplanes
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-23
... INFORMATION CONTACT: James Sutherland, Aerospace Engineer, Airframe Branch, ANM-120S, FAA, Seattle Aircraft...-6590; email: James.Sutherland@faa.gov . SUPPLEMENTARY INFORMATION: Discussion We issued a notice of... this AD, contact James Sutherland, Aerospace Engineer, Airframe Branch, ANM-120S, FAA, Seattle Aircraft...
37 CFR 360.4 - Compliance with statutory dates.
Code of Federal Regulations, 2012 CFR
2012-07-01
... to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...
37 CFR 360.13 - Compliance with statutory dates.
Code of Federal Regulations, 2013 CFR
2013-07-01
... delivered to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...
37 CFR 360.13 - Compliance with statutory dates.
Code of Federal Regulations, 2012 CFR
2012-07-01
... delivered to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...
37 CFR 360.13 - Compliance with statutory dates.
Code of Federal Regulations, 2014 CFR
2014-07-01
... delivered to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...
37 CFR 360.4 - Compliance with statutory dates.
Code of Federal Regulations, 2013 CFR
2013-07-01
... to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...
37 CFR 360.4 - Compliance with statutory dates.
Code of Federal Regulations, 2014 CFR
2014-07-01
... to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...
3. Historic American Buildings Survey James F. and Jean B. ...
3. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 ORIGINAL MANTELPIECE AND WINDOW SHUTTERS, FIRST FLOOR Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M
2011-01-01
SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010. PMID:22195076
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.
By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of {sup 13}C,{sup 16}O, and {sup 18}O from Penning-trap mass spectrometry, we determine the atomic mass of {sup 17}O to be M[{sup 17}O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of {sup 17}O with the more precise result M[{sup 17}O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of {sup 17}O to better thanmore » 1 part in 10{sup 8}.« less
Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M
2011-01-01
SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010.
Insights to primitive replication derived from structures of small oligonucleotides
NASA Technical Reports Server (NTRS)
Smith, G. K.; Fox, G. E.
1995-01-01
Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.
37 CFR 301.2 - Official addresses.
Code of Federal Regulations, 2011 CFR
2011-07-01
..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...
37 CFR 301.2 - Official addresses.
Code of Federal Regulations, 2013 CFR
2013-07-01
..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...
37 CFR 301.2 - Official addresses.
Code of Federal Regulations, 2014 CFR
2014-07-01
..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...
37 CFR 301.2 - Official addresses.
Code of Federal Regulations, 2012 CFR
2012-07-01
..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...
4. Historic American Buildings Survey James F. and Jean B. ...
4. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 LATE 19th-CENTURY MANTELPIECE IN FIRST FLOOR ROOM Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA
37 CFR 301.2 - Official addresses.
Code of Federal Regulations, 2010 CFR
2010-07-01
..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...
75 FR 62421 - Notice of Lodging of Consent Decree Under the Clean Air Act
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-08
... States of America v. James Valley Ethanol, LLC, Northern Lights Ethanol, LLC, and Poet Plant Management... Ethanol, LLC (``James Valley''), Northern Lights Ethanol, LLC (``Northern Lights''), and POET Plant.... Defendant James Valley owns an ethanol production facility in Brown County, South Dakota, near Groton (the...
75 FR 9904 - James A. Holland; Denial of Hearing; Final Debarment Order
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-04
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2009-N-0205] James A. Holland; Denial of Hearing; Final Debarment Order AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) is denying James A. Holland's request for...
Henry James on the Art of Acting.
ERIC Educational Resources Information Center
Thompson, David W.
Henry James, the nineteenth-century American novelist, also served on occasion as a theatre critic. Between 1875 and 1890 he reviewed several productions in Boston, New York, London, and Paris for "Atlantic Monthly" and other periodicals. The reviews are of interest because of James' high standards regarding acting and his often…
ERIC Educational Resources Information Center
Cooper, Wesley
2003-01-01
James's moral theory, primarily as set out in "The Moral Philosopher and the Moral Life" (in his "The Will To Believe" (1897)), is presented here as having a two-level structure, an empirical or historical level where progress toward greater moral inclusiveness is central, and a metaphysical or end-of-history level--James's "kingdom of…
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-24
... Air Forces Contract Pilot School (Primary), 2700 S. Peterson Ave., Douglas, 13000270 Jones County James, Lemuel and Mary House, 153 James Rd., James, 13000271 Thomas County Hopkins, Judge Henry William..., Inc.--Ouachita Candy Company, Inc., 215 Walnut St., Monroe, 13000275 NEBRASKA Douglas County Olson's...
energy solutions for emission mitigation, international climate change strategies, and renewable energy technical decision making. Andrea's expertise lies in strategic planning, change strategies, and decision
Anomalous cooling and heating - the Mpemba effect and its inverse
NASA Astrophysics Data System (ADS)
Lu, Zhiyue; Raz, Oren
Under certain conditions, it takes a shorter time to cool a hot object than to cool the same object initiated at a lower temperature. This counter-intuitive phenomenon - the 'Mpemba Effect'\\x9D, has been observed in a variety of systems. So far, no generic mechanism was suggested to explain this effect. In the theoretical framework of non-equilibrium thermodynamics, we construct a model to describe this effect and illustrates the fundamental principles behind it. In addition, we predict and demonstrate an inverse Mpemba effect: it can take a shorter time to heat a cold object than a warmer one. We derive sufficient conditions for the occurrences of both the forward and the inverse Mpemba effects, and suggest experiments to further study the non-equilibrium nature of these effects. Z.L. acknowledges financial support from the NSF under Grant DMR-1206971. O.R. acknowledges financial support from the James S. McDonnell Foundation.
NASA Technical Reports Server (NTRS)
Yang, Kan; Glazer, Stuart; Ousley, Wes; Burt, William
2017-01-01
The James Webb Space Telescope (JWST), set to launch in 2018, is NASAs next-generation flagship telescope. The Optical Telescope Element (OTE) and Integrated Science Instrument Module (ISIM) contain all of the optical surfaces and instruments to capture and analyze the telescopes infrared targets. The integrated OTE and ISIM are denoted as OTIS, and will be tested as a single unit in a critical thermal-vacuum test in mid-2017 at NASA Johnson Space Centers Chamber A facility. The payload will be evaluated for workmanship and functionality in a 20K simulated flight environment during this thermal-vacuum test. However, the sheer thermal mass of the OTIS payload as well as the restrictive gradient, rate, and contamination-related constraints placed on test components precludes rapid cooldown or warmup to its steady-state cryo-balance condition. Hardware safety considerations precludes injection of helium gas for free molecular heat transfer. Initial thermal analysis predicted that transient radiative cooldown from ambient temperatures, while meeting all limits and constraints, would take 33.3 days; warmup similarly would take 28.4 days. This paper discusses methods used to reduce transition times from the original predictions through modulation of boundary temperatures and environmental conditions. By optimizing helium shroud transition rates and heater usage, as well as rigorously re-examining previously imposed constraints, savings of up to three days on cooldown and up to a week on warmup can be achieved. The efficiencies gained through these methods allow the JWST thermal test team to create faster cooldown and warmup profiles, thus reducing the overall test duration and cost, while keeping all of the required test operations.
Rehage, Jennifer S.; Loftus, W.F.
2007-01-01
The connectivity between the fish community of estuarine mangroves and that of freshwater habitats upstream remains poorly understood. In the Florida Everglades, mangrove-lined creeks link freshwater marshes to estuarine habitats downstream and may act as dry-season refuges for freshwater fishes. We examined seasonal dynamics in the fish community of ecotonal creeks in the southwestern region of Everglades National Park, specifically Rookery Branch and the North and Watson rivers. Twelve low-order creeks were sampled via electrofishing, gill nets, and minnow traps during the wet season, transition period, and dry season in 2004-2005. Catches were greater in Rookery Branch than in the North and Watson rivers, particularly during the transition period. Community composition varied seasonally in Rookery Branch, and to a greater extent for the larger species, reflecting a pulse of freshwater taxa into creeks as marshes upstream dried periodically. The pulse was short-lived, a later sample showed substantial decreases in freshwater fish numbers. No evidence of a similar influx was seen in the North and Watson rivers, which drain shorter hydroperiod marshes and exhibit higher salinities. These results suggest that head-water creeks can serve as important dry-season refugia. Increased freshwater flow resulting from Everglades restoration may enhance this connectivity. ?? 2007 Rosenstiel School of Marine and Atmospheric Science of the University of Miami.
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker
2001-04-01
Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
8. John and James Dobson Carpet Mill, East and West ...
8. John and James Dobson Carpet Mill, East and West Parcels, site plan, and survey lower left, 1865. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1865, p. 279. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
Gazdik, Gertrude C.; Ross, Robert B.
1982-01-01
The area, on the crest of the Blue Ridge Mountains, is drained by small tributaries of the James River. Altitudes range from 600 ft where U.S. Route 501 crosses the James River to 3,073 ft on Highcock Knob.
Development of an Integrated Mobile Robot System at Carnegie Mellon University: June 1988
1989-07-01
Kevin Dowling, Thad Druffel, James Frazier, Eric Hoffman, Ralph Hyre, James Ladd, James Martin, Clark McDonald, Jim Moody, I’enning Pangels, David ... Simon , Bryon Smith, Eddie Wyatt, Yoshi ""to, Taka Fujimori, nso Kweon, Doug Reece, and Tony Stentz. 3 Section I Introduction Introduction and Overview
James Madison High School. A Curriculum for American Students.
ERIC Educational Resources Information Center
Bennett, William J.
This document presents the Secretary of Education's personal concept of a sound secondary school core curriculum. It is called "James Madison High School" in honor of President James Madison and his strong views that the people, in order to govern properly, must arm themselves with knowledge. The theoretical curriculum consists of four…
[Nicolas Dobo and Pierre Jame about the army medical general Lucian Jame].
Dobo, N; Jame, P
1996-01-01
Lucien Jame was born October the 20th 1891 at Gourdon (Lot). State Police Officer's son, he studied in Lyon at the Military Health School. Called up August the 6th 1914, he shined among many fights and wore a lot of medals. After the armistice he defended his thesis upon "Venereal diseases prophylaxis study". March the 9th 1921, medical Officer in South Algeria, he published some original articles regarding to leprosis, tuberculosis and malaria. After a competitive examination in France, Lucien Jame became a Medical Commanding Officer of Military Health Service in Toulouse where Nicolas Dobo was at his disposal. August the 6th 1943, in the same rank in Algier then in Rabat, Lucien Jame reached the top of his career as Chief Executive of Military Health Service. He planed First French army medical operations through Italy, France and Germany battles. "Grand-Officier de la Légion d'honneur", the Army Medical General Lucien Jame retired but kept on with works dedicated to hygiene and preventive medicine till he died, June the 16th, 1969.
Wright, Ian; Bevin, William
2017-11-25
An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.
The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.
ERIC Educational Resources Information Center
Waddell, Thomas G.; Rybolt, Thomas R.
2003-01-01
Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)
Integration of Statistical and Physical Models of Short Fatigue Crack Growth.
1987-02-01
M.R. James and B.N. Cox, *Fundamental Characterization of Surface Microplasticity ," Final Report on NSF Grant No. DMR-8310652, July 1986. 23. W.L...Dec. 1985. 24. W.L. Morris, B.N. Cox and M.R. James, " Microplastic Deformation of Al 2219- T85 I," to be published in Acta Metall. 25. B.N. Cox, W.L...Morris and M.R. James, "Two-Stage Microplastic Surface Defor- mation in Al 2219-T851," to be published in Acta Metall. 26. W.L. Morris, M.R. James and
DNA-polymer micelles as nanoparticles with recognition ability.
Talom, Renée Mayap; Fuks, Gad; Kaps, Leonard; Oberdisse, Julian; Cerclier, Christel; Gaillard, Cédric; Mingotaud, Christophe; Gauffre, Fabienne
2011-11-25
The Watson-Crick binding of DNA single strands is a powerful tool for the assembly of nanostructures. Our objective is to develop polymer nanoparticles equipped with DNA strands for surface-patterning applications, taking advantage of the DNA technology, in particular, recognition and reversibility. A hybrid DNA copolymer is synthesized through the conjugation of a ssDNA (22-mer) with a poly(ethylene oxide)-poly(caprolactone) diblock copolymer (PEO-b-PCl). It is shown that, in water, the PEO-b-PCl-ssDNA(22) polymer forms micelles with a PCl hydrophobic core and a hydrophilic corona made of PEO and DNA. The micelles are thoroughly characterized using electron microscopy (TEM and cryoTEM) and small-angle neutron scattering. The binding of these DNA micelles to a surface through DNA recognition is monitored using a quartz crystal microbalance and imaged by atomic force microscopy. The micelles can be released from the surface by a competitive displacement event. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brauer, Carolyn S.; Pearson, John C.; Drouin, Brian J.
The spectrum of ethyl cyanide, or propionitrile (CH{sub 3}CH{sub 2}CN), has been repeatedly observed in the interstellar medium with large column densities and surprisingly high temperatures in hot core sources. The construction of new, more sensitive, observatories accessing higher frequencies such as Herschel, ALMA, and SOFIA have made it important to extend the laboratory data for ethyl cyanide to coincide with the capabilities of the new instruments. We report extensions of the laboratory measurements of the rotational spectrum of ethyl cyanide in its ground vibrational state to 1.6 THz. A global analysis of the ground state, which includes all ofmore » the previous data and 3356 newly assigned transitions, has been fitted to within experimental error to J = 132, K = 36, using both Watson A-reduced and Watson S-reduced Hamiltonians.« less
Visible contrast energy metrics for detection and discrimination
NASA Astrophysics Data System (ADS)
Ahumada, Albert J.; Watson, Andrew B.
2013-03-01
Contrast energy was proposed by Watson, Barlow, and Robson (Science, 1983) as a useful metric for representing luminance contrast target stimuli because it represents the detectability of the stimulus in photon noise for an ideal observer. We propose here the use of visible contrast energy metrics for detection and discrimination among static luminance patterns. The visibility is approximated with spatial frequency sensitivity weighting and eccentricity sensitivity weighting. The suggested weighting functions revise the Standard Spatial Observer (Watson and Ahumada, J. Vision, 2005) for luminance contrast detection , extend it into the near periphery, and provide compensation for duration. Under the assumption that the detection is limited only by internal noise, both detection and discrimination performance can be predicted by metrics based on the visible energy of the difference images.
NASA Astrophysics Data System (ADS)
LeGrand, Anne
2017-02-01
The role of medical imaging in global health systems is literally fundamental. Like labs, medical images are used at one point or another in almost every high cost, high value episode of care. CT scans, mammograms, and x-rays, for example, "atlas" the body and help chart a course forward for a patient's care team. Imaging precision has improved as a result of technological advancements and breakthroughs in related medical research. Those advancements also bring with them exponential growth in medical imaging data. As IBM trains Watson to "see" medical images, Ms. Le Grand will discuss recent advances made by Watson Health and explore the potential value of "augmented intelligence" to assist healthcare providers like radiologists and cardiologists, as well as the patients they serve.
ERIC Educational Resources Information Center
Thayer-Bacon, Barbara J.
2017-01-01
In "A Pluralistic Universe," James argues that the world we experience is more than we can describe. Our theories are incomplete, open, and imperfect. Concepts function to try to shape, organize, and describe this open, flowing universe, while the universe continually escapes beyond our artificial boundaries. For James and myself, the…
11. John and James Dobson Carpet Mill, East and West ...
11. John and James Dobson Carpet Mill, East and West parcels, site plan-upper left, elevation-lower left, and survey-right, 1877. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1877, pp. 1095-1096. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
13. John and James Dobson Carpet Mill, East and West ...
13. John and James Dobson Carpet Mill, East and West parcels, site plan-upper left, elevation-upper right, and survey-below, 1885. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1885, pp. 1890-1891. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
9. John and James Dobson Carpet Mill, portion of West ...
9. John and James Dobson Carpet Mill, portion of West parcel, site plan-left, elevation-upper right, and survey-lower right, 1873. Hexamer, Ernest and Son. Hexamer General Surveys 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1873, pp. 670-671. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA
Landscapes of Removal and Resistance: Edwin James's Nineteenth-Century Cross-Cultural Collaborations
ERIC Educational Resources Information Center
Lyndgaard, Kyhl
2010-01-01
The life of Edwin James (1797-1861) is bookended by the Lewis and Clark expedition (1803-6) and the Civil War (1861-65). James's work engaged key national concerns of western exploration, natural history, Native American relocation, and slavery. His principled stands for preservation of lands and animals in the Trans-Mississippi West and his…
, physics and chemistry. (1998-2002) Featured Publications Fu, R., T.L. James, M. Woodhouse. "Economic /10.1039/C3EE40701B. Goodrich, A., P. Hacke, Q. Wang, B. Sopori, R. Margolis, T.L. James, and Woodhouse, M InformationMicrosoft Excel. Woodhouse, M., A. Goodrich, R. Margolis, T.L. James, M. Lokanc, and R. Eggert. "
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-09
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0114] RIN 1625-AA00 Safety Zone; Rocketts Red Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA... Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA in the Federal Register (76 FR 13525...
Toni Wolff-James Kirsch correspondence.
Kirsch, Thomas B
2003-09-01
This paper draws on the letters between Toni Wolff and James Kirsch from 1929-1933 and from 1949-1953 to highlight some aspects of Toni Wolff's relationship with her superviser and former analysand, James Kirsch. Her personality, her approach to her work as analyst, and her relationship with Jung and with colleagues are illustrated with selected quotes from the correspondence.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 2 2014-07-01 2014-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
78 FR 48609 - Safety Zone; James River; Newport News, VA
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-09
...-AA00 Safety Zone; James River; Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Temporary final rule...-0670 to read as follows: Sec. 165.T05-0670 Safety Zone, James River, Newport News, VA. (a) Definitions...'11'' N longitude 076[deg]38'40'' W, located near Fort Eustis in Newport News, VA. (c) Regulations. (1...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 2 2011-07-01 2011-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 2 2013-07-01 2013-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 2 2012-07-01 2012-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...
Introspecting in the Spirit of William James: Comment on Fox, Ericsson, and Best (2011)
ERIC Educational Resources Information Center
Schooler, Jonathan W.
2011-01-01
Fox, Ericsson, and Best's (2011) thoughtful justification of the use of think-aloud protocols for revealing the stream of consciousness comes on the centennial of the death of William James, history's greatest practitioner and advocate of introspection. This confluence naturally invites speculation about how James might have responded to the…
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-27
... Federal Health Care Center Demonstration Project AGENCY: Office of the Secretary, Department of Defense. ACTION: Notice of TRICARE Co-Pay waiver at Captain James A. Lovell Federal Health Care Center... ``TRICARE Co-Pay Waiver at Captain James A. Lovell Federal Health Care (FHCC) Demonstration Project.'' Under...
The Octopus, the Squid and the Tortoise
ERIC Educational Resources Information Center
Caruth, Gail D.; Caruth, Donald L.
2013-01-01
What is the role of the Doctor of Philosophy (PhD) today? This is not a new question. In 1903, William James questioned the value of the degree as an indicator of teaching ability. Unfortunately, the issue James raised has never been resolved. Move forward in time to 1990. Theodore Ziolkowski essentially agreed with James, but raised additional…
Woolley, Torres; Sen Gupta, Tarun; Larkins, Sarah
2018-05-25
The James Cook University medical school's mission is to produce a workforce appropriate for the health needs of northern Australia. James Cook University medical graduate data were obtained via cross-sectional survey of 180 early-career James Cook University medical graduates from 2005-2011 (response rate of 180/298 contactable graduates = 60%). Australian medical practitioner data for 2005-2009 graduates were obtained via the 2015 'Medicine in Australia: Balancing Employment and Life' wave 8 dataset. Comparison of the range of work settings and hours worked by James Cook University medical graduates to Australian medical graduates. Compared to a similar group of Australian medical graduates, James Cook University Bachelor of Medicine, Bachelor of Surgery graduates are significantly more likely to work in government-funded 'public' organisations (hospitals, community health centres, Aboriginal Community Controlled Health Services, government departments, agencies or defence forces). In particular, James Cook University medical graduates were more likely to work in Aboriginal Community Controlled Health Services and community health centres and other state-run primary health care organisations than other Australian medical graduates. James Cook University medical graduates appear to work in a higher proportion of public settings; in particular, primary care settings, than Australian medical graduates. This is an appropriate mix for the predominantly rural and remote geography of Queensland and its associated medical workforce priorities. Reporting medical graduate outcomes by their nature of practice could be an important adjunct to other measures, such as geographic location and choice of specialty. © 2018 National Rural Health Alliance Ltd.
2003-02-07
KENNEDY SPACE CENTER, FLA. - A Columbia Crew Memorial Service is held at the Shuttle Landing Facility for KSC employees and invited guests. NASA Associate Deputy Administrator for Institutions and Asset Management James L. Jennings is at the podium. The Columbia and her crew of seven were lost on Feb. 1, 2003, over East Texas as they returned to Earth after a 16-day research mission. Taking part in the service were NASA Administrator Sean O’Keefe, former KSC Director Robert Crippen, astronaut Jim Halsell, several employees, area clergymen, and members of Patrick Air Force Base. The service concluded with a “Missing Man Formation Fly Over” by NASA T-38 jet aircraft.
Building Worlds and Learning Astronomy on Facebook Part III: Testing, Launch, and Evaluation
NASA Astrophysics Data System (ADS)
Harold, J.; Hines, D.; Vidugiris, E.; Goldman, K. H.
2015-11-01
James Harold (SSI), Dean Hines (STScI/SSI) and a team at the National Center for Interactive Learning at the Space Science Institute are developing Starchitect, an end-to-end stellar and planetary evolution game for the Facebook platform. Supported by NSF and NASA, and based in part on a prototype presented at ASP several years ago, Starchitect uses the “sporadic play” model of games such as Farmville, where players might only take actions a few times a day, but may continue playing for months. This paper is an update to a presentation at last year's ASP conference.
STS-88 in-flight crew portrait
1998-12-14
S88-E-5169 (12-14-98) --- A pre-set electronic still camera (ESC) was used to take one of the traditional in-flight crew portraits for the STS-88 members on Endeavour's mid deck. From the left are Jerry L. Ross, James H. Newman, Robert D. Cabana, Frederick W. (Rick) Sturckow, Nancy J. Currie and Sergei K. Krikalev. Krikalev, representing the Russian Space Agency (RSA), has been assigned as one of the crew members for the first ISS crew. A banner representing the participating countries for ISS and a model of the connected Unity-Zarya modules are in the background. The photo was taken at 23:41:40, Dec. 14.
2014-11-19
John Mather Maniac Lecture, November 19, 2014 Nobel Laureate John Mather presented a Maniac Talk entitled "Creating the Future: Building JWST, what it may find, and what comes next?" In this lecture, John takes a rear view look at how James Webb Space Telescope was started, what it can see and what it might discover. He describes the hardware, what it was designed to observe, and speculate about the surprises it might uncover. He also outlines a possible future of space observatories: what astronomers want to build, what we need to invent, and what they might find, even the chance of discovering life on planets around other stars.
Interfacial Bubble Deformations
NASA Astrophysics Data System (ADS)
Seymour, Brian; Shabane, Parvis; Cypull, Olivia; Cheng, Shengfeng; Feitosa, Klebert
Soap bubbles floating at an air-water experience deformations as a result of surface tension and hydrostatic forces. In this experiment, we investigate the nature of such deformations by taking cross-sectional images of bubbles of different volumes. The results show that as their volume increases, bubbles transition from spherical to hemispherical shape. The deformation of the interface also changes with bubble volume with the capillary rise converging to the capillary length as volume increases. The profile of the top and bottom of the bubble and the capillary rise are completely determined by the volume and pressure differences. James Madison University Department of Physics and Astronomy, 4VA Consortium, Research Corporation for Advancement of Science.
Region 5: Indiana Adequate Letter (11/4/2005)
This is a letter from Stephen Rothblatt, Director, to Kathryn Watson regarding the redesignation petition and maintenance plan for the Jackson County and Greene County 8-hour ozone nonattainment area.
2013-02-15
Matthew James, Andre Carvalho and Michael Hush completed some work analyzing cross-phase modulation using single photon quantum filtering techniques...ANU Michael Hush January – June, 2012, Postdoc, ANU Matthew R. James Professor, Australian National University Ian R. Petersen Professor...appear, IEEE Trans. Aut. Control., 2013. A. R. R. Carvalho, M. R. Hush , and M. R. James, “Cavity driven by a single photon: Conditional dynamics and
ERIC Educational Resources Information Center
Stob, Paul
2012-01-01
On May 31, 1897, William James, one of America's most influential philosophers and psychologists, delivered the first civic oration of his career. The principal orator at the dedication of the Robert Gould Shaw memorial in Boston, James did what commemorative speakers are not supposed to do. He chose to be confrontational and divisive in a…
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-15
... Operation Regulation; James River, Between Isle of Wight and Newport News, VA AGENCY: Coast Guard, DHS... River, mile 5.0, between Isle of Wight and Newport News, VA. This deviation is necessary to facilitate... Isle of Isle and Newport News, VA opens on signal. The James River Bridge has vertical clearances in...
The King James Bible and the Politics of Religious Education: Secular State and Sacred Scripture
ERIC Educational Resources Information Center
Gearon, Liam
2013-01-01
This article provides an outline historical-educational analysis of the King James Bible from its 1611 publication through to its four-hundredth anniversary commemoration in 2011. With particular focus on England, the article traces the educational impact of the King James Bible and charts, in the country of its origin, its progressive decline in…
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-23
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0939] RIN 1625-AA00 Safety Zone; Steam Ship Col. James M. Schoonmaker Relocation Project, Maumee River, Toledo, OH...-0939 as follows: Sec. 165.T09-0939 Safety Zone; Steam Ship Col. James M. Schoonmaker relocation project...
Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho
2018-04-01
Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was relatively robust to spelling and grammatical errors, which were frequent. Implementation of this automated MR contrast determination system as a clinical decision support tool may save considerable time and effort of the radiologist while potentially decreasing error rates, and require no change in order entry or workflow.
Key NASA, USAF and federal officials sign a Memorandum of Agreement on groundwater cleanup
NASA Technical Reports Server (NTRS)
1999-01-01
Walter W. Kovalick Jr., Ph.D., director of Technology Innovation Office for the U.S. Environmental Protection Agency, addresses representatives from Kennedy Space Center, the 45th Space Wing, and various federal environmental agencies gathered to attend a Memorandum of Agreement (MOA) signing, taking place at the site of Launch Complex 34. The MOA formalizes the cooperative efforts of the federal agencies in ground-water cleanup initiatives. NASA, the U.S. Air Force and the agencies have formed a consortium and are participating in a comparative study of three innovative techniques to be used in cleaning a contaminated area of Launch Complex 34. The study will be used to help improve groundwater cleanup processes nationally. Other attendees included Timothy Oppelt, director, National Risk Management Research Laboratory, U.S. Environmental Protection Agency; Tom Heenan, assistant manager of environmental management, Savannah River Site, U.S. Department of Energy; Col. James Heald, Vice Commander, Air Force Research Laboratory, U.S. Air Force; Gerald Boyd, acting deputy assistant secretary, Office of Science and Technology, U.S. Department of Energy; James Fiore, acting deputy assistant secretary, Office of Environmental Restoration, Department of Energy; Brig. Gen. Randall R. Starbuck, Commander 45th Space Wing, U.S. Air Force; and Roy Bridges Jr., director of John F. Kennedy Space Center.
1999-04-06
Walter W. Kovalick Jr., Ph.D., director of Technology Innovation Office for the U.S. Environmental Protection Agency, addresses representatives from Kennedy Space Center, the 45th Space Wing, and various federal environmental agencies gathered to attend a Memorandum of Agreement (MOA) signing, taking place at the site of Launch Complex 34. The MOA formalizes the cooperative efforts of the federal agencies in ground-water cleanup initiatives. NASA, the U.S. Air Force and the agencies have formed a consortium and are participating in a comparative study of three innovative techniques to be used in cleaning a contaminated area of Launch Complex 34. The study will be used to help improve groundwater cleanup processes nationally. Other attendees included Timothy Oppelt, director, National Risk Management Research Laboratory, U.S. Environmental Protection Agency; Tom Heenan, assistant manager of environmental management, Savannah River Site, U.S. Department of Energy; Col. James Heald, Vice Commander, Air Force Research Laboratory, U.S. Air Force; Gerald Boyd, acting deputy assistant secretary, Office of Science and Technology, U.S. Department of Energy; James Fiore, acting deputy assistant secretary, Office of Environmental Restoration, Department of Energy; Brig. Gen. Randall R. Starbuck, Commander 45th Space Wing, U.S. Air Force; and Roy Bridges Jr., director of John F. Kennedy Space Center
Debating Deindustrialization: A Comparative Analysis of Brazil and Mexico
2014-09-01
production costs and import more capital-intensive goods.29 As James Petras describes the cycle, cheap labor-intensive manufacturing decreases in...29 James Petras , “A New International Division of Labor?,” MERIP Reports, no. 94 (February 1, 1981): 28, doi:10.2307...3. Outsourcing James Petras looks at a new international division of labor and outsourcing as possible causes of manufacturing decline within an
Maniac Talk - Dr. James Garvin
2014-05-28
James Garvin Maniac Lecture, 28 May 2014 Dr. James Garvin, Chief Scientist, NASA Goddard Space Flight Center, presented a Maniac Talk entitled "From Brownian Motion to Mars, by way of hockey on the rocks." Jim shared how his passion for rocks and landscapes drove him to promote new remote sensing approaches for measuring their topologies and led to founding of the Mars Science Laboratory and its Curiosity Rover.
Biocides for the Battlefield - Interim Report
2010-09-24
for public release; distribution is unlimited. James H . Wynne Materials Chemistry Branch Chemistry Division Preston a. Fulmer Chemical Dynamics and...b. ABSTRACT c. THIS PAGE 18. NUMBER OF PAGES 17. LIMITATION OF ABSTRACT Biocides for the Battlefield—Interim Report James H . Wynne and Preston A...distribution is unlimited. Unclassified Unclassified Unclassified SAR 25 James H . Wynne (202) 404-4010 The ability to disinfect surfaces and manufacture self
2009-03-03
Army Special Forces. Following a 2008 meeting with Gen James N. Mattis (Commander, US Joint Forces Command), Gen James T. Conway (Commandant, US...CAPABILITY Approved by: , Thesis Committee Chair James B. Martin, Ph.D. , Member Gary J. Bjorge, Ph.D. , Member Robert D...Technology: Information technology, bio -technology, weaponry, increased access to information Demographic Changes: Population growth, youth bulge
2008-03-25
Ivancevich , Fundamentals of Management, 6th ed. (Texas: Business Publications, 1987), 85. Figure 4. Fayol’s 14 Classical Principles of Management Many...Jr., James L. Gibson and John M. Ivancevich , Fundamentals of Management, 6th ed. (Texas: Business Publications, 1987), 182. 36 recognize four by...http://www.the spacereview.com/article/913/1 (accessed 7 September 2007) 59 James H. Donnelly Jr., James L. Gibson and John M. Ivancevich
4. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...
4. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept. 16, 1940 (A) EXTERIOR, GENERAL VIEW FROM SOUTH WEST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT
Nucleic acid nanomaterials: Silver-wired DNA
NASA Astrophysics Data System (ADS)
Auffinger, Pascal; Ennifar, Eric
2017-10-01
DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.
3. VIEW OF WILLOW CREEK TRESTLE FROM CORNER BASELINE AVENUE ...
3. VIEW OF WILLOW CREEK TRESTLE FROM CORNER BASELINE AVENUE AND 185TH AVENUE, FACING NORTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR
MMPI Indices in the Discrimination of Brain-Damaged and Schizophrenic Groups
ERIC Educational Resources Information Center
Holland, Terrill R.; And Others
1975-01-01
The results of this investigation support Watson's (1971) hypothesis that his Schizophrenia-Organicity scales might be valid discriminators of braindamaged and schizophrenic patients equated for degree of intellectual deficit. (Author)
Finite-size scaling of survival probability in branching processes
NASA Astrophysics Data System (ADS)
Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Álvaro
2015-04-01
Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We derive analytically the existence of finite-size scaling for the survival probability as a function of the control parameter and the maximum number of generations, obtaining the critical exponents as well as the exact scaling function, which is G (y ) =2 y ey /(ey-1 ) , with y the rescaled distance to the critical point. Our findings are valid for any branching process of the Galton-Watson type, independently of the distribution of the number of offspring, provided its variance is finite. This proves the universal behavior of the finite-size effects in branching processes, including the universality of the metric factors. The direct relation to mean-field percolation is also discussed.
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
The web server of IBM's Bioinformatics and Pattern Discovery group.
Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo
2003-07-01
We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.
The web server of IBM's Bioinformatics and Pattern Discovery group
Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo
2003-01-01
We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/. PMID:12824385
Watson, Swellengrebel and species sanitation: environmental and ecological aspects.
Bradley, D J
1994-08-01
Following the discovery of mosquito transmission of malaria, the theory and practice of malaria control by general and selective removal of specific vector populations resulted particularly from Malcolm Watson's empirical work in peninsular Malaysia, first in the urban and peri-urban areas of Klang and Port Swettenham and subsequently in the rural rubber plantations, and from the work of N.H. Swellengrebel in nearby Indonesia on the taxonomy, ecology and control of anophelines. They developed the concept of species sanitation: the selective modification of the environment to render a particular anopheline of no importance as a vector in a particular situation. The lack of progress along these lines in India at that time is contrasted with that in south-east Asia. The extension of species sanitation and related concepts to other geographical areas and to other vector-borne disease situations is outlined.
Base modification strategies to modulate immune stimulation by an siRNA.
Valenzuela, Rachel Anne P; Suter, Scott R; Ball-Jones, Alexi A; Ibarra-Soza, José M; Zheng, Yuxuan; Beal, Peter A
2015-01-19
Immune stimulation triggered by siRNAs is one of the major challenges in the development of safe RNAi-based therapeutics. Within an immunostimulatory siRNA sequence, this hurdle is commonly addressed by using ribose modifications (e.g., 2'-OMe or 2'-F), which results in decreased cytokine production. However, as immune stimulation by siRNAs is a sequence-dependent phenomenon, recognition of the nucleobases by the trigger receptor(s) is also likely. Here, we use the recently published crystal structures of Toll-like receptor 8 (TLR8) bound to small-molecule agonists to generate computational models for ribonucleotide binding by this immune receptor. Our modeling suggested that modification of either the Watson-Crick or Hoogsteen face of adenosine would disrupt nucleotide/TLR8 interactions. We employed chemical synthesis to alter either the Watson-Crick or Hoogsteen face of adenosine and evaluated the effect of these modifications in an siRNA guide strand by measuring the immunostimulatory and RNA interference properties. For the siRNA guide strand tested, we found that modifying the Watson-Crick face is generally more effective at blocking TNFα production in human peripheral blood mononuclear cells (PBMCs) than modification at the Hoogsteen edge. We also observed that modifications near the 5'-end were more effective at blocking cytokine production than those placed at the 3'-end. This work advances our understanding of how chemical modifications can be used to optimize siRNA performance. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rare disease diagnosis: A review of web search, social media and large-scale data-mining approaches.
Svenstrup, Dan; Jørgensen, Henrik L; Winther, Ole
2015-01-01
Physicians and the general public are increasingly using web-based tools to find answers to medical questions. The field of rare diseases is especially challenging and important as shown by the long delay and many mistakes associated with diagnoses. In this paper we review recent initiatives on the use of web search, social media and data mining in data repositories for medical diagnosis. We compare the retrieval accuracy on 56 rare disease cases with known diagnosis for the web search tools google.com, pubmed.gov, omim.org and our own search tool findzebra.com. We give a detailed description of IBM's Watson system and make a rough comparison between findzebra.com and Watson on subsets of the Doctor's dilemma dataset. The recall@10 and recall@20 (fraction of cases where the correct result appears in top 10 and top 20) for the 56 cases are found to be be 29%, 16%, 27% and 59% and 32%, 18%, 34% and 64%, respectively. Thus, FindZebra has a significantly (p < 0.01) higher recall than the other 3 search engines. When tested under the same conditions, Watson and FindZebra showed similar recall@10 accuracy. However, the tests were performed on different subsets of Doctors dilemma questions. Advances in technology and access to high quality data have opened new possibilities for aiding the diagnostic process. Specialized search engines, data mining tools and social media are some of the areas that hold promise.