Sample records for taqman polymerase chain

  1. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  2. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    PubMed

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  3. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  4. Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

    PubMed

    Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

    2002-03-01

    Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

  5. A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

    PubMed

    Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

    2007-07-01

    In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

  6. Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

    2005-08-10

    As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM

  7. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

    PubMed

    Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

    2015-09-01

    Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3  CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0  CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.

  8. TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

    PubMed

    Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

    2015-04-15

    Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

  9. Detection and quantification of genetically modified organisms using very short, locked nucleic acid TaqMan probes.

    PubMed

    Salvi, Sergio; D'Orso, Fabio; Morelli, Giorgio

    2008-06-25

    Many countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (PCR) based upon the TaqMan probe chemistry has become the method mostly used to support these regulations; moreover, event-specific PCR is the preferred method in GMO detection because of its high specificity based on the flanking sequence of the exogenous integrant. The aim of this study was to evaluate the use of very short (eight-nucleotide long), locked nucleic acid (LNA) TaqMan probes in 5'-nuclease PCR assays for the detection and quantification of GMOs. Classic TaqMan and LNA TaqMan probes were compared for the analysis of the maize MON810 transgene. The performance of the two types of probes was tested on the maize endogenous reference gene hmga, the CaMV 35S promoter, and the hsp70/cryIA(b) construct as well as for the event-specific 5'-integration junction of MON810, using plasmids as standard reference molecules. The results of our study demonstrate that the LNA 5'-nuclease PCR assays represent a valid and reliable analytical system for the detection and quantification of transgenes. Application of very short LNA TaqMan probes to GMO quantification can simplify the design of 5'-nuclease assays.

  10. The development of a real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay using TaqMan technology for the pan detection of bluetongue virus (BTV).

    PubMed

    Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John

    2017-07-01

    Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  11. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  12. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  13. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  14. Detection of Food Allergens by Taqman Real-Time PCR Methodology.

    PubMed

    García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel

    2017-01-01

    Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.

  15. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    PubMed

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

  16. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  17. Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.

    PubMed

    Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui

    2018-05-01

    The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.

  18. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    USGS Publications Warehouse

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  19. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  20. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  1. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    PubMed

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  2. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

  3. New approach to real-time nucleic acids detection: folding polymerase chain reaction amplicons into a secondary structure to improve cleavage of Förster resonance energy transfer probes in 5′-nuclease assays

    PubMed Central

    Kutyavin, Igor V.

    2010-01-01

    The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection

  4. Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

    Treesearch

    Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

  5. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    PubMed

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  6. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  7. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  8. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  10. Concordance of HIV-1 RNA Values by Amplicor and TaqMan 2.0 in Patients With Confirmed Suppression in Clinical Trials

    PubMed Central

    Garner, Will; White, Kirsten; Szwarcberg, Javier; McCallister, Scott; Zhong, Lijie; Wulfsohn, Mike

    2016-01-01

    Background. The COBAS AMPLICOR HIV-1 MONITOR Test, version 1.5 (Amplicor) has been replaced with the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, version 2.0 (TaqMan 2.0), a real-time polymerase chain reaction human immunodeficiency virus type 1 (HIV-1) assay with higher sensitivity and broader dynamic range. HIV-1 RNA values at the 50 copies/mL cutoff drive major patient management decisions and clinical study outcomes. Methods. A total of 2217 samples were collected from 1922 HIV-1–infected subjects taking antiretroviral therapy for at least 48 weeks and had at least 2 consecutive samples with HIV-1 RNA <50 copies/mL by Amplicor from 7 recent clinical trials. HIV-1 RNA results were obtained from the Amplicor and TaqMan 2.0 assays in parallel by a reference laboratory. Results. The overall concordance between assay results was 96% at the cutoff of 50 copies/mL. However, statistically significant discordance at the 50 copies/mL cutoff was found between the assays for 3.9% of samples (n = 87). By TaqMan 2.0, virologic failure defined as HIV-1 RNA ≥50 copies/mL was reported for 2.8% more samples than Amplicor. Of these 87 samples, 68 samples fell within the predicted range of assay variability. Retesting of HIV-1 RNA by TaqMan 2.0 confirmed the discordance in only 28 of the 87 samples. Conclusions. The TaqMan 2.0 assay reports fewer subjects below the clinical endpoint of HIV-1 RNA <50 copies/mL in HIV clinical trials than the Amplicor assay. This difference must be considered when assessing disease progression, designing clinical trials, and comparisons with historical trials that used the Amplicor assay. PMID:26689956

  11. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  12. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  13. Assessment of Legionella pneumophila in recreational spring water with quantitative PCR (Taqman) assay.

    PubMed

    Shen, Shu-Min; Chou, Ming-Yuan; Hsu, Bing-Mu; Ji, Wen-Tsai; Hsu, Tsui-Kang; Tsai, Hsiu-Feng; Huang, Yu-Li; Chiu, Yi-Chou; Kao, Erl-Shyh; Kao, Po-Min; Fan, Cheng-Wei

    2015-07-01

    Legionella spp. are common in various natural and man-made aquatic environments. Recreational hot spring is frequently reported as an infection hotspot because of various factors such as temperature and humidity. Although polymerase chain reaction (PCR) had been used for detecting Legionella, several inhibitors such as humic substances, calcium, and melanin in the recreational spring water may interfere with the reaction thus resulting in risk underestimation. The purpose of this study was to compare the efficiencies of conventional and Taqman quantitative PCR (qPCR) on detecting Legionella pneumophila in spring facilities and in receiving water. In the results, Taqman PCR had much better efficiency on specifying the pathogen in both river and spring samples. L. pneumophila was detected in all of the 27 river water samples and 45 of the 48 hot spring water samples. The estimated L. pneumophela concentrations ranged between 1.0 × 10(2) and 3.3 × 10(5) cells/l in river water and 72.1-5.7 × 10(6) cells/l in hot spring water. Total coliforms and turbidity were significantly correlated with concentrations of L. pneumophila in positive water samples. Significant difference was also found in water temperature between the presence/absence of L. pneumophila. Our results suggest that conventional PCR may be not enough for detecting L. pneumophila particularly in the aquatic environments full of reaction inhibitors.

  14. Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.

    PubMed

    Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A

    2008-04-01

    To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.

  15. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

    PubMed

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

    2015-03-01

    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

  16. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

  17. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  18. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  19. Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

    PubMed

    Makeyev, E V; Bamford, D H

    2001-05-01

    Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

  20. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  1. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  2. TaqMan DNA technology confirms likely overestimation of cod (Gadus morhua L.) egg abundance in the Irish Sea: implications for the assessment of the cod stock and mapping of spawning areas using egg-based methods.

    PubMed

    Fox, C J; Taylor, M I; Pereyra, R; Villasana, M I; Rico, C

    2005-03-01

    Recent substantial declines in northeastern Atlantic cod stocks necessitate improved biological knowledge and the development of techniques to complement standard stock assessment methods (which largely depend on accurate commercial catch data). In 2003, an ichthyoplankton survey was undertaken in the Irish Sea and subsamples of 'cod-like' eggs were analysed using a TaqMan multiplex, PCR (polymerase chain reaction) assay (with specific probes for cod, haddock and whiting). The TaqMan method was readily applied to the large number of samples (n = 2770) generated during the survey and when combined with a manual DNA extraction protocol had a low failure rate of 6%. Of the early stage 'cod-like' eggs (1.2-1.75 mm diameter) positively identified: 34% were cod, 8% haddock and 58% whiting. As previous stock estimates based on egg surveys for Irish Sea cod assumed that the majority of 'cod-like' eggs were from cod, the TaqMan results confirm that there was probably substantial contamination by eggs of whiting and haddock that would have inflated estimates of the stock biomass.

  3. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  4. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  5. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  6. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier

  7. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  11. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  12. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  13. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  14. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  15. Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

    PubMed

    Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

    2018-05-31

    Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

  16. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  17. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGES

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  18. Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

    PubMed Central

    2005-01-01

    Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

  19. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  20. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  1. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    PubMed

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement

  2. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  3. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  4. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  5. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions

  6. [Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

    PubMed

    Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

    2017-07-28

    To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).
 Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.
 Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.
 Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.

  7. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  8. Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

    PubMed

    Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

    2017-07-01

    The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4  ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.

  9. Multicentre study of Y chromosome microdeletions in 1,808 Chinese infertile males using multiplex and real-time polymerase chain reaction.

    PubMed

    Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z

    2017-06-01

    Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.

  10. Building block synthesis using the polymerase chain assembly method.

    PubMed

    Marchand, Julie A; Peccoud, Jean

    2012-01-01

    De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

  11. Comparative evaluation of new TaqMan real-time assays for the detection of hepatitis A virus.

    PubMed

    Houde, Alain; Guévremont, Evelyne; Poitras, Elyse; Leblanc, Danielle; Ward, Pierre; Simard, Carole; Trottier, Yvon-Louis

    2007-03-01

    Three novel real-time TaqMan RT-PCR assays targeting the 5'-UTR, the viral protease and the viral polymerase regions of the hepatitis A virus (HAV) were developed, evaluated and compared against a new published 5'-UTR TaqMan assay (JN) and a widely used conventional RT-PCR assay (HAVc). All conventional RT-PCR (HAV, SH-Prot and SH-Poly systems) and TaqMan (SH-Prot, SH-Poly, JN and SH-5U systems) assays evaluated were consistent for the detection of the three different HAV strains (HM-175, HAS-15 and LSH/S) used and reproducible for both RNA duplicates with the exception of two reproducibility discrepancies observed with both 5'-UTR real-time systems (JN and SH-5U). Limits of detection for conventional HAV, SH-Prot and SH-Poly RT-PCR systems were found to be equivalent when tested with serially diluted suspensions of the HM-175 strain. Although the four real-time RT-PCR TaqMan assays evaluated herein produced similar and consistent quantification data down to the level of one genomic equivalent copy with their respectively cloned amplicons, significant and important differences were observed for the detection of HAV genomic RNA. Results showed that the new real-time TaqMan SH-Poly and SH-Prot primer and probe systems were more consistent and sensitive by 5 logs as compared to both 5'-UTR designs (JN and SH-5U) used for the detection of HAV genomic RNA as well as for the detection in cell culture by cytopathic effect. Considering their higher analytical sensitivity, the proposed SH-Poly and SH-Prot amplification systems could therefore represent valuable tools for the detection of HAV in clinical, environmental and food samples.

  12. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  13. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  14. Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

    PubMed

    Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

    2010-06-01

    Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

  15. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  16. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  17. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  18. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  19. Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

    PubMed

    Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

    2010-08-01

    A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

  20. Quantification of rice brown leaf spot through Taqman real-time PCR specific to the unigene encoding Cochliobolus miyabeanus SCYTALONE DEHYDRATASE1 involved in fungal melanin biosynthesis.

    PubMed

    Su'udi, Mukhamad; Park, Jong-Mi; Kang, Woo-Ri; Park, Sang-Ryeol; Hwang, Duk-Ju; Ahn, Il-Pyung

    2012-12-01

    Rice brown leaf spot is a major disease in the rice paddy field. The causal agent Cochliobolus miyabeanus is an ascomycete fungus and a representative necrotrophic pathogen in the investigation of rice-microbe interactions. The aims of this research were to identify a quantitative evaluation method to determine the amount of C. miyabeanus proliferation in planta and determine the method's sensitivity. Real-time polymerase chain reaction (PCR) was employed in combination with the primer pair and Taqman probe specific to CmSCD1, a C. miyabeanus unigene encoding SCYTALONE DEHYDRATASE, which is involved in fungal melanin biosynthesis. Comparative analysis of the nucleotide sequences of CmSCD1 from Korean strains with those from the Japanese and Taiwanese strains revealed some sequence differences. Based on the crossing point (CP) values from Taqman real-time PCR containing a series of increasing concentrations of cloned amplicon or fungal genomic DNA, linear regressions with a high level of reliability (R(2)>0.997) were constructed. This system was able to estimate fungal genomic DNA at the picogram level. The reliability of this equation was further confirmed using DNA samples from both resistant and susceptible cultivars infected with C. miyabeanus. In summary, our quantitative system is a powerful alternative in brown leaf spot forecasting and in the consistent evaluation of disease progression.

  1. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  2. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  3. Thermally multiplexed polymerase chain reaction.

    PubMed

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  4. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  5. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  6. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  7. [Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

    PubMed

    Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

    2010-06-01

    To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

  8. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  9. Theory and applications of the polymerase chain reaction.

    PubMed

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  10. Integrated polymerase chain reaction/electrophoresis instrument

    DOEpatents

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  11. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    PubMed Central

    2010-01-01

    Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

  12. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  13. Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

    PubMed Central

    2011-01-01

    Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

  14. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  15. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  17. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  18. Rapid and Reliable Genotyping of HLA-B*57:01 in Four Chinese Populations Using a Single-Tube Duplex Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan

    2017-07-01

    HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.

  19. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  20. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  1. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    PubMed

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  2. USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

    EPA Science Inventory

    The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

  3. Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

    PubMed

    Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

    1998-11-23

    Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

  4. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

  5. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  6. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  7. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  8. Accuracy of polimerase chain reaction for the diagnosis of pleural tuberculosis.

    PubMed

    Trajman, Anete; da Silva Santos Kleiz de Oliveira, Elen Fabricia; Bastos, Mayara Lisboa; Belo Neto, Epaminondas; Silva, Edgar Manoel; da Silva Lourenço, Maria Cristina; Kritski, Afrânio; Oliveira, Martha Maria

    2014-06-01

    Polymerase chain reaction (PCR)-based techniques to detect Mycobacterium tuberculosis DNA in respiratory specimens have been increasingly used to diagnose pulmonary tuberculosis. Their use in non-respiratory specimens to diagnose extrapulmonary tuberculosis is, however, controversial. In this study, we estimated the accuracy of three in-country commercialized PCR-based diagnostic techniques in pleural fluid samples for the diagnosis of pleural tuberculosis. Patients underwent thoracenthesis for diagnosis purposes; pleural fluid aliquots were frozen and subsequently submitted to two real time PCR tests (COBAS(®)TAQMAN(®)MTB and Xpert(®)MTB/Rif) and one conventional PCR test (Detect-TB(®)). Two different reference standards were considered: probable tuberculosis (based on clinical grounds) and confirmed tuberculosis (bacteriologically or histologically). Ninety-three patients were included, of whom 65 with pleural tuberculosis, 35 of them confirmed. Sensitivities were 29% for COBAS(®)TAQMAN(®)MTB, 3% for Xpert(®)MTB/Rif and 3% for Detect-TB(®); specificities were 86%, 100% and 97% respectively, considering confirmed tuberculosis. Considering all cases, sensitivities were 16%, 3% and 2%, and specificities, 86%, 100%, and 97%. Compared to the 95% sensitivity of adenosine deaminase, the most sensitive test for pleural tuberculosis, the sensitivities of the three PCR-based tests were very low. We conclude that at present, there is no major place for such tests in routine clinical use. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Clinical evaluation of a quantitative real time polymerase chain reaction assay for diagnosis of primary Epstein-Barr virus infection in children.

    PubMed

    Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M

    2003-08-01

    Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all

  10. Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

    PubMed Central

    Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

    2016-01-01

    Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

  11. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  12. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  13. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  14. Detection of human Pneumocystis carinii by the polymerase chain reaction.

    PubMed

    Becker-Hapak, M; Liberator, P; Graves, D

    1991-01-01

    Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

  15. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  16. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  17. Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

    PubMed

    Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

    2018-06-01

    Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

  18. A polymerase chain reaction strategy for the diagnosis of camelpox.

    PubMed

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  19. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    PubMed

    Ito, Takao; Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  20. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

    PubMed Central

    Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

  1. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

    PubMed Central

    Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

    2017-01-01

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

  2. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  3. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  4. Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

    PubMed

    Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

    2005-01-01

    The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  5. Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

    PubMed

    Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

    2005-01-01

    Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

  6. Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

    PubMed

    Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

    2017-01-01

    In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

  7. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  8. Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

    PubMed

    Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

    2014-09-19

    Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

  9. Anti-Caries Effects of Dental Adhesives Containing Quaternary Ammonium Methacrylates with Different Chain Lengths

    PubMed Central

    Han, Qi; Li, Bolei; Zhou, Xuedong; Ge, Yang; Wang, Suping; Li, Mingyun; Ren, Biao; Wang, Haohao; Zhang, Keke; Xu, Hockin H. K.; Peng, Xian; Feng, Mingye; Weir, Michael D.; Chen, Yu; Cheng, Lei

    2017-01-01

    The objectives of this study were to investigate the effects of dental adhesives containing quaternary ammonium methacrylates (QAMs) with different alkyl chain lengths (CL) on ecological caries prevention in vitro. Five QAMs were synthesized with a CL = 3, 6, 9, 12, and 16 and incorporated into adhesives. Micro-tensile bond strength and surface charge density were used to measure the physical properties of the adhesives. The proportion change in three-species biofilms consisting of Streptococcus mutans, Streptococcus sanguinis, and Streptococcus gordonii was tested using the TaqMan real-time polymerase chain reaction. Lactic acid assay, MTT [3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, exopolysaccharide staining, live/dead staining, scanning electron microscopy (SEM), and transverse microradiography (TMR) were performed to study the anti-biofilm and anti-demineralization effects of the dental adhesives. The results showed that incorporating QAMs with different alkyl chain lengths into the adhesives had no obvious effect on the dentin bond strength. The adhesives containing QAMs with a longer alkyl chain developed healthier biofilms. The surface charge density, anti-biofilm, and anti-demineralization effects of the adhesives increased with a CL of the QAMs from 3 to 12, but decreased slightly with a CL from 12 to 16. In conclusion, adhesives containing QAMs with a tailored chain length are promising for preventing secondary caries in an “ecological way”. PMID:28773004

  10. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  11. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  13. Evidence of simian retrovirus type D by polymerase chain reaction.

    PubMed

    Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

    2017-06-01

    Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    PubMed

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  15. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  16. Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

    PubMed

    Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

    2018-05-25

    The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  18. Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus.

    PubMed

    Lakshmi, I Karthika; Putty, Kalyani; Raut, Satya Samparna; Patil, Sunil R; Rao, P P; Bhagyalakshmi, B; Jyothi, Y Krishna; Susmitha, B; Reddy, Y Vishnuvardhan; Kasulanati, Sowmya; Jyothi, J Shiva; Reddy, Y N

    2018-04-01

    The present study was designed to standardize real-time polymerase chain reaction (PCR) for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV) NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 10 5 ml and RNA was isolated by the Trizol method. Both reverse transcription-PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD). The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect) and molecular confirmation (by BTV-NS1 group-specific PCR). The standardized technique was then applied to field samples (blood) for detecting BTV. The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269E×10 3 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 10 3 TCID 50/ml and 10 4 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 10 2 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Real-time PCR was found to be a very sensitive as well as reliable method to detect BTV present in different types of samples

  19. Identification of four squid species by quantitative real-time polymerase chain reaction.

    PubMed

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    USDA-ARS?s Scientific Manuscript database

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  1. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srienc, Friedrich; Jackson, John K.; Somers, David A.

    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  2. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  3. Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

    PubMed

    Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

    2018-04-01

    Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

  4. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  5. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

  6. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  7. A primer on on-demand polymerase chain reaction technology.

    PubMed

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  8. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  9. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  10. [Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

    PubMed

    Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

    2004-11-01

    To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

  11. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  12. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Electrochemical product detection of an asymmetric convective polymerase chain reaction.

    PubMed

    Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

    2009-10-15

    For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

  14. Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

    PubMed

    Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

    2018-05-15

    A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

  15. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  16. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less

  17. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    NASA Astrophysics Data System (ADS)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  18. Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

    PubMed Central

    Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

    1992-01-01

    A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983

  19. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  20. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

    PubMed

    Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

    2000-01-01

    Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

  1. [Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].

    PubMed

    Liu, C; Ouyang, K; Tan, D

    1998-01-01

    In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).

  2. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    PubMed

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  3. Identifying of meat species using polymerase chain reaction (PCR)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

  4. One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

    PubMed

    Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

    2016-06-01

    Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

  5. Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

    PubMed

    Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

    2018-02-26

    Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

  6. Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

    PubMed Central

    Bjourson, A J; Stone, C E; Cooper, J E

    1992-01-01

    A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

  7. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  8. Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

    PubMed

    Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

    2017-03-01

    The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

  9. On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

    NASA Astrophysics Data System (ADS)

    Persat, Alexandre; Santiago, Juan

    2008-11-01

    We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

  10. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  11. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  12. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    PubMed Central

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

  13. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  14. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  16. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  17. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  18. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    PubMed

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  19. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

    PubMed

    van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

    2012-05-01

    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

  20. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  1. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  2. Electrically controlled microvalves to integrate microchip polymerase chain reaction and capillary electrophoresis.

    PubMed

    Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J

    2008-07-01

    Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.

  3. The actin multigene family and livestock speciation using the polymerase chain reaction.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-01-01

    Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

  4. Identification of 29 Rat Genetic Markers by Arbitrarily Primed Polymerase Chain Reaction

    PubMed Central

    Canzian, Federico; Toyota, Minoru; Hosoya, Yoko; Sugimura, Takashi; Nagao, Minako

    1996-01-01

    The number of genetic markers for the rat is still limited, in spite of its wide use in cancer research. To facilitate accurate mapping of both established and novel rat genetic markers, we constructed a linkage map by genotyping 105 F2 rats from ACI/N (ACI) and BUF/Nac (BUF) crosses. This map consists of 120 genetic markers that had been previously reported, mainly by two research groups, but had not been integrated. To find new genetic markers, the arbitrarily primed polymerase chain reaction (AP‐PCR) was applied to detect polymorphic bands between ACI and BUF rats. After testing 56 single primers and 12 combinations of primers, we found 36 bands produced by 16 single primers and two combinations to be reliably polymorphic between ACI and BUF rats. The 36 bands were typed in the 105 F2 rats, and 29 of them could be linkage‐mapped. AP‐PCR is thus useful to detect new genetic markers in laboratory strains of rats. PMID:8698613

  5. Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers

    PubMed Central

    Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric

    2012-01-01

    Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402

  6. Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.

    PubMed

    Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi

    2018-04-17

    We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.

  7. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  8. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  9. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  10. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  11. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  12. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman(®) real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay.

    PubMed

    Röder, Martin; Vieths, Stefan; Holzhauser, Thomas

    2011-01-24

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg(-1) almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg(-1). We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman(®) probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg(-1) almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg(-1). Further, between 100 and 100,000 mg kg(-1) spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman(®) real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n=5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and

  13. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  14. Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.

    PubMed

    Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S

    1996-01-01

    The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.

  15. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  16. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  17. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    PubMed

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  18. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  19. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    PubMed

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis.

  20. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    PubMed

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  1. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis.

    PubMed

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive.

  3. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis

    PubMed Central

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268

  4. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  5. Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

    PubMed Central

    Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

    2010-01-01

    Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

  6. Evaluation of sensitivity of TaqMan RT-PCR for rubella virus detection in clinical specimens.

    PubMed

    Okamoto, Kiyoko; Mori, Yoshio; Komagome, Rika; Nagano, Hideki; Miyoshi, Masahiro; Okano, Motohiko; Aoki, Yoko; Ogura, Atsushi; Hotta, Chiemi; Ogawa, Tomoko; Saikusa, Miwako; Kodama, Hiroe; Yasui, Yoshihiro; Minagawa, Hiroko; Kurata, Takako; Kanbayashi, Daiki; Kase, Tetsuo; Murata, Sachiko; Shirabe, Komei; Hamasaki, Mitsuhiro; Kato, Takashi; Otsuki, Noriyuki; Sakata, Masafumi; Komase, Katsuhiro; Takeda, Makoto

    2016-07-01

    An easy and reliable assay for detection of the rubella virus is required to strengthen rubella surveillance. Although a TaqMan RT-PCR assay for detection of the rubella virus has been established in Japan, its utility for diagnostic purposes has not been tested. To allow introduction of the TaqMan RT-PCR into the rubella surveillance system in Japan, the sensitivity of the assay was determined using representative strains for all genotypes and clinical specimens. The detection limits of the method for individual genotypes were examined using viral RNA extracted from 13 representative strains. The assay was also tested at 10 prefectural laboratories in Japan, designated as local reference laboratories for measles and rubella, to allow nationwide application of the assay. The detection limits and amplification efficiencies of the assay were similar among all the representative strains of the 13 genotypes. The TaqMan RT-PCR could detect approximately 90% of throat swab and urine samples taken up to 5days of illness. These samples were determined positive by a highly sensitive nested RT-PCR. The TaqMan RT-PCR could detect at least 10 pfu of rubella virus. Although the sensitivity was somewhat lower than that of the conventional nested RT-PCR, the TaqMan RT-PCR could be more practical to routine tests for rubella laboratory diagnosis and detection in view of the rapid response and reducing risks of contamination. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

    PubMed

    Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

    2018-02-01

    Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

  8. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    PubMed

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  9. DNA Carrier Testing and Newborn Screening for Maple Syrup Urine Disease in Old Order Mennonite Communities

    PubMed Central

    Carleton, Stephanie M.; Peck, Dawn S.; Grasela, Julie; Dietiker, Kristin L.

    2010-01-01

    Maple syrup urine disease (MSUD) is an inherited metabolic disorder caused by mutations in the branched chain α-keto acid dehydrogenase complex. Worldwide incidence of MSUD is 1:225,000 live births. However, within Old Order Mennonite communities, the incidence is 1:150 live births and results from a common tyrosine to asparagine substitution (Y438N) in the E1α subunit of branched chain α-keto acid dehydrogenase. We developed a new DNA diagnostic assay utilizing TaqMan® technology and compared its efficacy, sensitivity, and duration with an existing polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) assay. Carrier testing was performed by both TaqMan technology and PCR-RFLP on DNA isolated from buccal swabs of 160 individuals as well as from buccal swabs and blood spots of nine at-risk newborns; assay time, sensitivity, and reliability were also evaluated. The TaqMan assay, like the PCR-RFLP assay, accurately determined Y438N E1α allele status. However, the TaqMan assay appeared (1) more sensitive than the PCR-RFLP assay, requiring 10-fold less DNA (10 ng) to reliably determine genotype status and (2) faster, reducing the assay time required for diagnosis from ∼12 to 5 h. TaqMan technology allowed more rapid DNA diagnoses of MSUD in the neonate, thereby reducing the likelihood of neurological impairment while enhancing health and prognosis for affected infants. PMID:20136525

  10. HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.

    PubMed

    Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E

    2009-06-01

    To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.

  11. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

    PubMed

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

  12. [The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

    PubMed

    D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

    1993-01-01

    The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

  13. High-throughput microfluidic single-cell digital polymerase chain reaction.

    PubMed

    White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

    2013-08-06

    Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

  14. Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

    PubMed

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

    2015-08-25

    Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

    PubMed

    Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

    2007-12-01

    Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

  16. High resolution TaqMan real-time PCR approach to detect hazelnut DNA encoding for ITS rDNA in foods.

    PubMed

    López-Calleja, Inés María; de la Cruz, Silvia; Pegels, Nicolette; González, Isabel; García, Teresa; Martín, Rosario

    2013-12-01

    A broad range of foods have been described as causing allergies, but the majority of allergic reactions can be ascribed to a limited number of food components. Recent extensive surveys showed how tree nuts, particularly hazelnut (Corylus avellana L.) seeds, rank amongst the most important sources of food allergy. In order to protect the allergic consumer, efficient and reliable methods are required for the detection of allergenic ingredients. For this purpose, we have developed a real-time polymerase chain reaction (PCR) for detection of hazelnut in commercial food products. In this way a specific hazelnut primer pair based on the ITS marker (70 bp) and a nuclease (TaqMan) probe labelled with FAM and BHQ were designed. Sensibility of real-time PCR was determined by analysis of raw and heat treated hazelnut-wheat flour mixtures with a range of detection of 0.1-100,000 ppm. Practical applicability of the real-time PCR assay developed for determining hazelnut in different food matrices was investigated by analyzing 179 commercial foodstuffs comprising snacks, biscuits, chocolates, bonbons, creams, nut bars, ice creams, precooked meals, breads, beverages, yogurts, cereals, meat products, rice cake and nougat. From the total of samples analyzed, 40 commercial food products that didn't declare hazelnut nor traces on the label were found to contain hazelnut. The real-time PCR method proposed herein due to its high sensitivity facilitates the detection of hazelnut traces in commercial food products and can also be useful for monitoring the effectiveness of cleaning processes and as consequence, can help to prevent the food allergic consumer from unintentional ingestion of hidden allergens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. An outbreak of West Nile Virus infection in the region of Monastir, Tunisia, 2003

    PubMed Central

    Riabi, Samira; Gaaloul, Imed; Mastouri, Maha; Hassine, Mohsen; Aouni, Mahjoub

    2014-01-01

    Background A West Nile (WN) fever epidemic occurred in the region of Monastir, Tunisia, between August and October 2003. Aim of the study We attempt to describe the epidemiology, clinical presentation, and outcome of patients with confirmed West Nile virus (WNV) infection. Methods Three groups of specimens were prepared. One was made up of serum only (n  =  43), the other of cerebrospinal fluid (CSF) only (n  =  30), and the third group was made up of both (n  =  40). These specimens were obtained from 113 patients. A serological diagnosis and evidence of WNV genome by nested reverse-transcriptase polymerase chain reaction (nRT-PCR) and TaqMan reverse transcription-polymerase chain reaction (RT-PCR) were carried out. Results Thirty-eight cases (33.6%) were serologically positive. Results of nRT-PCR showed a total of 10 positive cases of WNV (8.8%) detected in group 1 (n  =  1/43), group 2 (n  =  5/30), and group 3 (n  =  4/40) whereas the PCR TaqMan showed 18 positive samples (15.9%) found in group 1 (n  =  3/43), group 2 (n  =  9/30), and group 3 (n  =  6/40). All TaqMan PCR positive cases were nRT-PCR positive. In addition, four serologically probable cases were confirmed by TaqMan PCR. The attempts to isolate WNV by cell culture were unsuccessful. Considering the results of TaqMan assay and the serological diagnosis, WNV infection was confirmed in a total of 42 patients. The main clinical presentations were meningoencephalitis (40%), febrile disease (95%), and meningitis (36%). Eight patients (19%) died. The highest case-fatality rates occurred among patients aged ≧55 years. The phylogenetic analysis revealed that isolates of WNV were closely related to the Tunisian strain 1997 (PAH001) and the Israeli one (Is-98). Conclusions West Nile virus is a reemerging global pathogen that remains an important public health challenge in the next decade. PMID:24766339

  18. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest

    Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less

  19. Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

    PubMed

    Teixeira, M M; Campaner, M; Camargo, E P

    1994-01-01

    To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

  20. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

  1. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    PubMed Central

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770

  2. Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.

    PubMed

    Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L

    1990-08-01

    To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.

  3. A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

    PubMed Central

    Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

    2009-01-01

    This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

  4. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    PubMed

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-06-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  5. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    PubMed

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  6. Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

    PubMed

    Bullard, K M; Hietpas, P B; Ewing, A G

    1998-01-01

    Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

  7. Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

    PubMed

    Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

    2007-03-01

    A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

  8. Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

    PubMed

    Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

    2007-06-01

    Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

  9. Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

    PubMed

    Ares, Manuel

    2014-10-01

    This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

  10. DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

    PubMed Central

    Wickner, William; Kornberg, Arthur

    1973-01-01

    DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657

  11. Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

    PubMed

    Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

    2002-01-01

    Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

  12. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

    PubMed Central

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

  13. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    PubMed

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  14. Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

    PubMed

    Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

    2014-12-01

    We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

    PubMed

    Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

    2017-12-01

    A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

  16. Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

    PubMed

    Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

    2017-04-01

    There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

  17. Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

    PubMed

    Frank, K B; Cheng, Y C

    1986-02-05

    Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

  18. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  19. Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

    PubMed

    Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

    2015-03-07

    We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

  20. Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

    PubMed

    Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

    2005-01-01

    A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

  1. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

  2. Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

    PubMed

    Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

    1996-05-01

    Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

  3. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  4. Comparison of Versant HBV DNA 3.0 and COBAS AmpliPrep-COBAS TaqMan assays for hepatitis B DNA quantitation: Possible clinical implications.

    PubMed

    Garbuglia, A R; Angeletti, C; Lauria, F N; Zaccaro, P; Cocca, A M; Pisciotta, M; Solmone, M; Capobianchi, M R

    2007-12-01

    We compared two commercial assays for HBV DNA quantitation, Versant HBV 3.0, System 340 (bDNA; Bayer Diagnostics) and COBAS AmpliPrep-COBAS TaqMan HBV Test (TaqMan; Roche Diagnostics). Analytical sensitivity, calculated on WHO International Standard, predicted 95% detection rate at 11.4 and 520.2IU/ml for TaqMan and bDNA, respectively. Specificity, established on 50 blood donor samples, was 100% and 84% for TaqMan and bDNA, respectively. When using clinical samples, HBV DNA was detected by TaqMan in 21/55 samples negative to bDNA. Mean values of HBV DNA obtained with bDNA were higher than those obtained with TaqMan (4.09log(10)+/-1.90 versus 3.39log(10)+/-2.41, p<0.001), and 24.4% of samples showed differences in viral load values >0.5log(10), without association with HBV genotype. There was a good correlation for HBV DNA concentrations measured by the two assays (r=0.94; p<0.001) within the overlapping range, and the distribution of results with respect to relevant clinical threshold recently confirmed (20,000 and 2000IU/ml) was similar. Approximately 50% of samples with low HBV DNA, appreciated by TaqMan but not by bDNA, were successfully sequenced in pol region, where drug resistance mutations are located.

  5. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

    PubMed

    Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

    2017-01-01

    Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

  7. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  8. Evaluation of TaqMan qPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay

    PubMed Central

    Nagy, Alexander; Vitásková, Eliška; Černíková, Lenka; Křivda, Vlastimil; Jiřincová, Helena; Sedlák, Kamil; Horníčková, Jitka; Havlíčková, Martina

    2017-01-01

    Ongoing evolution of viral pathogens is a significant issue in diagnostic virology employing TaqMan qPCR/RT-qPCR. Specific concerns are related to false negativity due to probe binding failure. One option for compensating for such deficiency is to integrate a second identically labelled probe in the assay. However, how this alteration influences the reaction parameters has not been comprehensively demonstrated. In the present study, we evaluate a TaqMan protocol using two identically labelled hydrolysis probes (simple, LNA (locked-nucleic-acid)) and MGB (minor-groove-binder) modified probes and combinations thereof in a single assay. Our results based on a synthetic amplicon suggest that the second probe does not compromise the TaqMan qPCR/RT-qPCR parameters, which repeatedly and reproducibly remained comparable to those of the corresponding single-probe assays, irrespective of the relative probe orientation, whether opposite or tandem, and probe modifications or combinations thereof. On the other hand, the second probe additively contributed to the overall fluorescence signal. The utility of the dual-probe approach was demonstrated on practical examples by using field specimens. We hope that the present study might serve as a theoretical basis for the development or improvement of TaqMan qPCR/RT-qPCR assays for the detection of highly variable nucleic acid templates. PMID:28120891

  9. Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.

    PubMed Central

    Pollard, D R; Johnson, W M; Lior, H; Tyler, S D; Rozee, K R

    1990-01-01

    Synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) technique to detect the gene for aerolysin in strains of Aeromonas hydrophila and to screen for identical genes in A. caviae, A. sobria, and A. veronii isolated from patients with diarrheal disease. Primers targeted a 209-bp fragment of the aer gene coding for the beta-hemolysin and detected template DNA only in the PCR using nucleic acid (NA) from hemolytic strains of A. hydrophila which were also cytotoxic to Vero and CHO cells and enterotoxic in suckling-mouse assays. PCR amplification of NA from hemolytic A. sobria or nonhemolytic A. hydrophila and A. caviae strains was consistently negative. Primer specificity was determined in the PCR by using NA extracted from 56 strains of bacteria, including hemolytic Escherichia coli and Listeria monocytogenes as well as several recognized enteric pathogens defined in terms of their toxigenicity. The detection limit for the aerolysin gene by PCR amplification was 1 ng of total NA. The PCR clearly identified aerolysin-producing strains of A. hydrophila and may have application as a species-specific virulence test because other hemolytic Aeromonas species tested were negative. Images PMID:2254423

  10. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  11. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    PubMed Central

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831

  12. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    PubMed

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  13. Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

    PubMed

    An, S F; Fleming, K A

    1991-11-01

    A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

  14. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    PubMed

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  15. An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

    PubMed

    Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

    2014-01-01

    Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

  16. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    PubMed Central

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

  17. Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

    PubMed

    Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

    2000-01-01

    Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

  18. Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

    PubMed

    Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

    2018-05-01

    Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  20. Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

    PubMed

    Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

    2018-05-15

    A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

  1. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  2. Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

    PubMed

    Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

    2006-02-01

    The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

  3. Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

    PubMed Central

    Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

    2001-01-01

    Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

  4. Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

    PubMed

    Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

    2018-01-18

    Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  5. Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

    PubMed Central

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-01-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

  6. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  7. A polymerase chain reaction-based methodology to detect gene doping.

    PubMed

    Carter, Adam; Flueck, Martin

    2012-04-01

    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  8. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    PubMed

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    PubMed

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  10. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  11. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  12. Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

    2005-01-01

    To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

  13. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    PubMed Central

    Xu, Qing; Zhu, Yazhen; Bai, Yali; Wei, Xiumin; Zheng, Xirun; Mao, Mao; Zheng, Guangjuan

    2015-01-01

    Background Two types of epidermal growth factor receptor (EGFR) mutations in exon 19 and exon 21 (ex19del and L858R) are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M) has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR)-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR) method in detecting the three EGFR mutations in patients with lung cancer. Methods Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR. Results The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect patient samples that the qPCR method failed to detect. About 49% of this patient cohort had EGFR mutations (L858R, 15.4%; ex19del, 29.5%; T790M, 6.4%). Two patients with the ex19del mutation also had a naïve T790M mutation. Conclusion These data suggest that the ddPCR method could be useful in the personalized treatment of patients with lung cancer. PMID:26124670

  14. Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

    PubMed

    Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

    2010-09-01

    This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights

  15. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum.

    PubMed

    Tan, Ching Giap; Ideris, Aini; Omar, Abdul R; Yii, Chen Pei; Kleven, Stanley H

    2014-09-02

    The present study was based on the reverse transcription polymerase chain reaction (RT-PCR) of the 16S ribosomal nucleic acid (rRNA) of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20-25 h at 37 °C, 22-25 h at 16 °C, and 23-27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h). The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  16. Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction.

    PubMed

    Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M

    2011-04-01

    Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

  17. Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

    PubMed

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-03-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

  18. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  19. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  20. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.

    PubMed

    Peng, Xiujuan; Nguyen, Alex; Ghosh, Debadyuti

    2018-02-01

    TaqMan and SYBR Green quantitative PCR (qPCR) methods were developed as DNA-based approaches to reproducibly enumerate M13 and T7 phages from phage display selection experiments individually and simultaneously. The genome copies of M13 and T7 phages were quantified by TaqMan or SYBR Green qPCR referenced against M13 and T7 DNA standard curves of known concentrations. TaqMan qPCR was capable of quantifying M13 and T7 phage DNA simultaneously with a detection range of 2.75*10 1 -2.75*10 8 genome copies(gc)/μL and 2.66*10 1 -2.66*10 8 genome copies(gc)/μL respectively. TaqMan qPCR demonstrated an efficient amplification efficiency (E s ) of 0.97 and 0.90 for M13 and T7 phage DNA, respectively. SYBR Green qPCR was ten-fold more sensitive than TaqMan qPCR, able to quantify 2.75-2.75*10 7 gc/μL and 2.66*10 1 -2.66*10 7 gc/μL of M13 and T7 phage DNA, with an amplification efficiency E s of 1.06 and 0.78, respectively. Due to its superior sensitivity, SYBR Green qPCR was used to enumerate M13 and T7 phage display clones selected against a cell line, and quantified titers demonstrated accuracy comparable to titers from traditional double-layer plaque assay. Compared to enzyme linked immunosorbent assay, both qPCR methods exhibited increased detection sensitivity and reproducibility. These qPCR methods are reproducible, sensitive, and time-saving to determine their titers and to quantify a large number of phage samples individually or simultaneously, thus avoiding the need for time-intensive double-layer plaque assay. These findings highlight the attractiveness of qPCR for phage enumeration for applications ranging from selection to next-generation sequencing (NGS). Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  2. Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

    PubMed

    Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

    2014-02-01

    Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

  3. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

  4. T.I.M.S: TaqMan Information Management System, tools to organize data flow in a genotyping laboratory

    PubMed Central

    Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico

    2005-01-01

    Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298

  5. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  6. A polymerase chain reaction enzyme immunoassay for diagnosing infection caused by Aspergillus fumigatus.

    PubMed Central

    Golbang, N; Burnie, J P; Matthews, R C

    1999-01-01

    AIM: To develop a polymerase chain reaction enzyme immunoassay (PCR-EIA) to measure levels of circulating aspergillus DNA in invasive aspergillosis caused by Aspergillus fumigatus. METHODS: The PCR reaction was based on primers from the 18s rRNA gene. Binding of the product to a streptavidin coated microtitration plate was mediated by a biotinylated capture probe. The product was digoxigenylated during PCR and this was the tag to which antibody was bound in the subsequent EIA. RESULTS: The optical density (OD) endpoint was < 0.1 in 10 sera from neutropenic patients with no evidence of invasive aspergillosis, and in 10 sera from nonneutropenic patients with bacterial pneumonia (group 1). The OD from five of 12 patients with allergic bronchopulmonary aspergillosis (ABPA) (group 2), three with an aspergilloma (group 3), and five with possible invasive aspergillosis (group 4) was > or = 0.1. In 63 sera from 33 cases of proven invasive aspergillosis (group 5) an OD > or = 0.1 was achieved in 48 sera from 30 patients. The maximum OD was 0.510. The level fell in survivors and gradually rose in fatal cases. CONCLUSIONS: This assay validated the concept of diagnosing invasive aspergillosis by measuring levels of circulating fungal DNA in serum. PMID:10562808

  7. Multiplex polymerase chain reaction assay developed to diagnose adult bacterial meningitis in Taiwan.

    PubMed

    Lee, Chi-Tsung; Hsiao, Kuang-Ming; Chen, Jin-Cherng; Su, Cheng-Chuan

    2015-11-01

    Acute bacterial meningitis causes high morbidity and mortality; the associated clinical symptoms often are insensitive or non-specific; and the pathogenic bacteria are geographically diverse. Clinical diagnosis requires a rapid and accurate methodology. This study aimed to develop a new multiplex polymerase chain reaction (mPCR) assay to detect simultaneously six major bacteria that cause adult bacterial meningitis in Taiwan: Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, and Acinetobacter baumannii. Species-specific primers for the six bacteria were developed using reference strains. The specificities of the mPCRs for these bacteria were validated, and the sensitivities were evaluated via serial dilutions. The mPCR assay specifically detected all of the six pathogens, particularly with sensitivities of 12 colony forming units (CFU)/mL, 90 CFU/mL, and 390 CFU/mL for E. coli, S. pneumoniae, and K. pneumoniae, respectively. This mPCR assay is a rapid and specific tool to detect the six major bacterial pathogens that cause acute adult meningitis in Taiwan, particularly sensitive for detecting E. coli, S. pneumoniae, and K. pneumoniae. The assay may facilitate early diagnosis and guidance for antimicrobial therapy for adult patients with this deadly disease in Taiwan. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  8. Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

    PubMed

    Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

    2007-01-01

    Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

  9. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

    PubMed

    Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

    2003-02-01

    A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

  10. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  11. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    PubMed

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

    PubMed

    Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

    2016-11-01

    Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

  13. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis

    PubMed Central

    Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh

    2016-01-01

    Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real

  14. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction

    PubMed Central

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-01-01

    Abstract Background Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. Methods We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Results Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Conclusion Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. PMID:28973672

  15. Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

    PubMed

    Po, F; Le Dimna, M; Le Potier, M F

    2011-12-01

    Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

  16. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    PubMed

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  17. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  18. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  19. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Polymerase chain reaction for screening clinical isolates of corynebacteria for the production of diphtheria toxin.

    PubMed

    Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A

    1994-04-01

    To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease.

  1. Polymerase chain reaction for screening clinical isolates of corynebacteria for the production of diphtheria toxin.

    PubMed Central

    Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A

    1994-01-01

    AIMS--To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. METHODS--Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. RESULTS--There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. CONCLUSIONS--These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease. Images PMID:8027375

  2. Detection of hepatitis "C" virus in formalin-fixed liver tissue by nested polymerase chain reaction.

    PubMed

    Sallie, R; Rayner, A; Portmann, B; Eddleston, A L; Williams, R

    1992-08-01

    Interpretation of antibody to hepatitis C virus (HCV) in patients with liver disease is difficult due to false-positive reactivity in some conditions. To evaluate the feasibility of HCV in archival material, HCV was sought in formalin-fixed, paraffin-embedded liver biopsy specimens. Nested polymerase chain reaction was used to detect hepatitis C virus in formalin-fixed, paraffin-embedded liver biopsy specimens after total RNA was extracted from tissue by proteinase K digestion and phenol/chloroform purification. The relative efficiency of amplification of HCV RNA from formalin-fixed material was estimated semiquantitatively by serial dilution of cDNA synthesised from RNA extracted from fresh and formalin-fixed sections from the same liver. Although HCV RNA could be detected in formalin-fixed liver tissue by nested PCR in 5/5 cases in which HCV was detected in serum, amplification was approximately 5-fold less efficient than when HCV was amplified from fresh tissue. Nevertheless, nested PCR of HCV from formalin-fixed liver tissue represents a useful technique in addressing some important questions related to the pathogenesis of liver disease.

  3. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

    2013-01-01

    The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

  4. The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations.

    PubMed

    Teh, L-K; Lee, T-Y; Tan, J A M A; Lai, M-I; George, E

    2015-02-01

    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations. Genotype identification of common β-thalassaemia mutations in Malays was carried out using Taqman genotyping assays. Results show that the Taqman assays allow mutation detection with DNA template concentrations as low as 2-100 ng. In addition, consistent reproducibility was observed in the Taqman assays when repeated eight times and at different time intervals. The developed sensitive Taqman assays allow molecular characterization of β-thalassaemia mutations in samples with low DNA concentrations. The Taqman genotyping assays have potential as a diagnostic tool for foetal blood, chorionic villi or pre-implantation genetic diagnosis where DNA is limited and precious. © 2014 John Wiley & Sons Ltd.

  5. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  6. Prenatal diagnosis using polymerase chain reaction on amniotic fluid for congenital toxoplasmosis.

    PubMed

    Romand, S; Wallon, M; Franck, J; Thulliez, P; Peyron, F; Dumon, H

    2001-02-01

    To evaluate sensitivity, specificity, and predictive values of a prenatal amniotic fluid (AF) polymerase chain reaction (PCR) test for diagnosis of congenital toxoplasmosis. A multicenter prospective study was done on 271 women with proved primary Toxoplasma infection during pregnancy and who had amniocentesis for prenatal diagnosis by PCR. Live-born infants were eligible for analysis only if a serologic follow-up could assess a definitive infection status. Of the 270 evaluable cases, 75 were congenitally infected, 48 of whom had a positive PCR at prenatal diagnosis. Overall sensitivity of PCR on AF was estimated at 64% (95% confidence interval [CI] 53.1%, 74.9%), negative predictive value of 87.8% (95% CI 83.5%, 92.1%), whereas specificity and positive predictive value were 100% (95% CIs 98%, 100% and 92.3%, 100%, respectively). Among cases with congenital toxoplasmosis, there were no significant differences between those with positive or negative PCR with regard to median gestational age at maternal infection, interval between maternal infection and amniocentesis, or duration of treatment before amniocentesis. However, sensitivity of PCR was found to be significantly higher for maternal infections that occurred between 17 and 21 weeks' gestation (P <.02). A negative PCR of AF cannot rule out congenital infection. In this case, continuation of treatment with spiramycin combined with ultrasonographic follow-up and postnatal follow-up are warranted. Our results also suggest presumptive treatment combining pyrimethamine and sulfonamides in case of maternal infection occurring late in pregnancy.

  7. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  8. Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

    PubMed

    Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

    2007-09-01

    Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

  9. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  10. Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

    PubMed

    Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

    2011-01-03

    In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

  11. The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

    PubMed

    Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

    2018-03-15

    To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

  12. A new TaqMan method for the reliable diagnosis of Ehrlichia spp. in canine whole blood.

    PubMed

    Thomson, Kirsty; Yaaran, Tal; Belshaw, Alex; Curson, Lucia; Tisi, Laurence; Maurice, Sarah; Kiddle, Guy

    2018-06-18

    Ehrlichiosis is an important emerging infectious disease of the canid family and humans worldwide. To date, no extensive evaluation or validation of a molecular diagnostic test for ehrlichiosis has been published. Here, we present data for a newly designed TaqMan assay and compare its performance to a commercial technology (PCRun®). Both of these real-time methods of analysis were evaluated using a comprehensive number of prospective and retrospective samples collected from dogs exhibiting symptoms of ehrlichiosis. Whole blood samples collected from dogs, retrospectively in the United Kingdom and prospectively in Israel, were analysed for the presence of Ehrlichia canis and Ehrlichia minasensis DNA using the TaqMan PCR, developed specifically for this study. The results were compared to those of a real time commercial isothermal amplification method (PCRun® system developed by Biogal Galed Labs ACS, Galed, Israel). The sensitivity and specificity (CI: 95%) of the TaqMan PCR and PCRun® were both determined to be 100% and absolute, for all of the samples tested. Interestingly, both tests were demonstrated to be highly comparable, irrespective of differences in amplification chemistry or sequences targeted. Host differences, incidence of disease and geographical location of the isolates had little impact on the positivity recorded by each of the diagnostic methods. It was evident that both amplification methods were equally suited for diagnosing canine ehrlichiosis and while the PCRun® clearly amplified all clinically relevant Ehrlichia species known to infect dogs and humans, the TaqMan method was more specific for E. canis and E. minasensis. This work demonstrates that despite good analytical sensitivities and specificities for Ehrlichia spp. neither method could fully account for the clinical diagnosis of thrombocytopenia.

  13. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  14. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  15. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

    PubMed

    Hamlet, Stephen M

    2010-01-01

    The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

  17. Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

    NASA Astrophysics Data System (ADS)

    Madadelahi, M.; Kalan, K.; Shamloo, A.

    2018-05-01

    Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

  18. Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

    PubMed

    Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

    1999-01-01

    A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

  19. Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

    PubMed

    Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

    2017-02-01

    Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

  20. TaqMan RT-PCR and VERSANT HIV-1 RNA 3.0 (bDNA) assay Quantification of HIV-1 RNA viral load in breast milk.

    PubMed

    Israel-Ballard, Kiersten; Ziermann, Rainer; Leutenegger, Christian; Di Canzio, James; Leung, Kimmy; Strom, Lynn; Abrams, Barbara; Chantry, Caroline

    2005-12-01

    Transmission of HIV via breast milk is a primary cause of pediatric HIV infection in developing countries. Reliable methods to detect breast milk viral load are important. To correlate the ability of the VERSANT HIV 3.0 (bDNA) assay to real-time (RT) TaqMan PCR in quantifying breast milk HIV-1 RNA. Forty-six breast milk samples that had been spiked with cell-free HIV-1 and eight samples spiked with cell-associated HIV-1 were assayed for HIV-1 RNA by both VERSANT HIV 3.0 and TaqMan RNA assays. Only assays on the cell-free samples were statistically compared. Both a Deming regression slope and a Bland-Altman slope indicated a linear relationship between the two assays. TaqMan quantitations were on average 2.6 times higher than those of HIV 3.0. A linear relationship was observed between serial dilutions of spiked cell-free HIV-1 and both the VERSANT HIV 3.0 and the TaqMan RNA assays. The two methods correlated well although the VERSANT HIV 3.0 research protocol quantified HIV-1 RNA slightly lower than TaqMan.

  1. Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

    PubMed

    Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

    1991-10-01

    Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

  2. Following DNA chain extension and protein conformational changes in crystals of a Y-family DNA polymerase via Raman crystallography.

    PubMed

    Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R

    2013-07-23

    Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.

  3. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia

    PubMed Central

    2012-01-01

    Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E

  4. Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

    PubMed

    Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

    2018-02-01

    Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.

  5. Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

    PubMed Central

    Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

    1997-01-01

    To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131

  6. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    PubMed

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  7. Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A

    2002-10-01

    ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.

  8. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  9. A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

    PubMed

    Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

    2017-01-01

    To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

  10. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    PubMed

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

  11. relA-dependent RNA polymerase activity in Escherichia coli.

    PubMed Central

    Ryals, J; Bremer, H

    1982-01-01

    Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

  12. Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

    PubMed Central

    Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

    2006-01-01

    Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

  13. Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction.

    PubMed

    Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C

    2000-09-01

    The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.

  14. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    PubMed Central

    Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

    2015-01-01

    The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

  15. Rapid polymerase chain reaction screening of Helicobacter pylori chromosomal point mutations.

    PubMed

    Ge, Z; Taylor, D E

    1997-09-01

    Microdiversity (within individual genes) in the genomes of different Helicobacter pylori strains has been demonstrated to be more frequent than that seen in other prokaryotes. Point mutations in some genes, such as the vacA and 23S ribosomal RNA genes could result in the alteration of pathogenicity or antibiotic susceptibility of individual H. pylori strains. Development of a simple, rapid, and reliable screening method would be useful in the molecular characterization of genetic variation among different H. pylori strains. The copP gene from H. pylori UA802 was used as a model for developing a mutation screening method. Four point mutations were introduced into the copP gene by in vitro site-directed mutagenesis and were verified by DNA sequencing. The mutated copP gene replaced the wild-type locus by natural transformation and homologous recombination. The site-specific mutants were screened by polymerase chain reaction (PCR) using 3'-end mismatched primers. The origins of the PCR fragments were demonstrated by Southern hybridization with the copP-derived DNA probe. Three of these four mutations were characterized by PCR with the specific primers that contained the 3'-terminal nucleotide complementary only to the mutated nucleotide on both plasmid and chromosomal DNA templates. One mutation was able to be identified with the foregoing primer containing an additional wild-type nucleotide at its 3'-end. Point mutant screening with these specific primers offers 100% sensitivity in the aforementioned conditions. To achieve optimal screening, the concentration of magnesium and the annealing temperature have to be adjusted. The procedure reported in this study is a simple, economical, rapid, and efficient approach in the identification of site-specific mutations on both plasmids and chromosomal DNA. Although the method was developed by using a specified H. pylori gene, it can be extended easily to other genes of interest in H. pylori or other organisms.

  16. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  17. In-house polymerase chain reaction for affordable and sustainable Chlamydia trachomatis detection in Trinidad and Tobago.

    PubMed

    Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David

    2007-11-01

    To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.

  18. Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

    PubMed

    Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-10-01

    Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

  19. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  20. Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

    PubMed

    Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

    2003-01-01

    Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.

  1. Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

    PubMed Central

    Bej, A K; McCarty, S C; Atlas, R M

    1991-01-01

    Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

  2. Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

    PubMed

    Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

    2016-12-20

    Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

  3. Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

    PubMed

    Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

    This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

  4. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    PubMed

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  6. Comparison of allelic discrimination by dHPLC, HRM, and TaqMan in the detection of BRAF mutation V600E.

    PubMed

    Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo

    2011-09-01

    The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  7. Allele and genotype frequencies of polymorphisms in cytokine genes in ethnic Russian individuals from Moscow, Russia.

    PubMed

    Shadrina, Alexandra; Voronina, Elena; Zolotukhin, Igor; Filipenko, Maxim

    2017-02-01

    Two hundred and twenty eight ethnic Russian individuals from Moscow, Russia, were genotyped at 14 single nucleotide polymorphisms CCL2 A-2578G; VEGFA C-2578A, G-634C, and C+936T; TNF G+419A and G-308A; IL1A G-889A; IL1RN T+1018C; IL6G-174C and G-572C; IFNG T+874A; IL1B C-511T; IL10 A+1082G; TGFB1 C-509T. Genotypes were determined using real-time polymerase chain reaction with TaqMan probes and polymerase chain reaction followed by melting analysis of dual-labeled probe. Genotype distribution was in accordance with Hardy-Weinberg equilibrium for all studied polymorphisms. Genotype data are available in the Allele Frequencies Net Database under identifier AFND 3367 and the population name "Russia Moscow Cytokine". Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  8. A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

    PubMed

    Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

    2010-01-15

    During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

  9. Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

    PubMed Central

    Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

    2014-01-01

    Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

  10. Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

    PubMed

    Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

    2011-06-07

    Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

  11. Genome-wide and digital polymerase chain reaction epigenetic assessments of alcohol consumption.

    PubMed

    Philibert, Robert; Dogan, Meesha; Noel, Amanda; Miller, Shelly; Krukow, Brianna; Papworth, Emma; Cowley, Joseph; Knudsen, April; Beach, Steven R H; Black, Donald

    2018-04-28

    The lack of readily employable biomarkers of alcohol consumption is a problem for clinicians and researchers. In 2014, we published a preliminary DNA methylation signature of heavy alcohol consumption that remits as a function of abstinence. Herein, we present new genome-wide methylation findings from a cohort of additional subjects and a meta-analysis of the data. Using DNA from 47 consecutive heavy drinkers admitted for alcohol detoxification in the context of alcohol treatment and 47 abstinent controls, we replicate the 2014 results and show that 21,221 CpG residues are differentially methylated in active heavy drinkers. Meta-analysis of all data from the 448,058 probes common to the two methylation platforms shows a similarly profound signature with confirmation of findings from other groups. Principal components analyses show that genome-wide methylation changes in response to alcohol consumption load on two major factors with one component accounting at least 50% of the total variance in both smokers and nonsmoking alcoholics. Using data from the arrays, we derive a panel of five methylation probes that classifies use status with a receiver operator characteristic area under the curve (AUC) of 0.97. Finally, using droplet digital polymerase chain reaction (PCR), we convert these array-based findings to two marker assays with an AUC of 0.95 and a four marker set AUC of 0.98. We conclude that DNA methylation assessments are capable of quantifying alcohol use status and suggest that readily employable digital PCR approaches for substance consumption may find widespread use in alcohol-related research and patient care. © 2018 Wiley Periodicals, Inc.

  12. MeltMan: Optimization, Evaluation, and Universal Application of a qPCR System Integrating the TaqMan qPCR and Melting Analysis into a Single Assay

    PubMed Central

    Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina

    2016-01-01

    In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831

  13. Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

    PubMed

    Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

    2013-09-01

    Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.

  14. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    PubMed

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  15. [The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

    PubMed

    Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

    2013-03-01

    The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

  16. Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

    PubMed

    Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

    2011-12-01

    Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

  17. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

    PubMed

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-03-05

    The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

  18. Detection of Porphyromonas endodontalis in infected root canals by 16S rRNA gene-directed polymerase chain reaction.

    PubMed

    Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F

    2000-12-01

    Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.

  19. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.

  20. Enhanced detection of intracellular organism of swine proliferative enteritis, ileal symbiont intracellularis, in feces by polymerase chain reaction.

    PubMed Central

    Jones, G F; Ward, G E; Murtaugh, M P; Lin, G; Gebhart, C J

    1993-01-01

    A sensitive assay based on amplification of a 319-bp DNA fragment of the intracellular bacterium of swine proliferative enteritis was developed for the detection of the organism in the feces of swine. A vernacular name, ileal symbiont intracellularis (IS-intracellularis), has recently been published for the intracellular bacterium, which was formerly known as a Campylobacter-like organism (C.J. Gebhart, S.M. Barnes, S. McOrist, G.F. Lin, and G.H.K. Larson, Int. J. Syst. Bacteriol. 43:533-538, 1993). As few as 10(1) IS-intracellularis organisms purified from intestinal mucosa, or 10(3) IS-intracellularis per g of feces, were detected. No amplification product was produced from a polymerase chain reaction performed on DNA extracted from the feces of healthy pigs. A 319-bp DNA fragment specific for IS-intracellularis was produced on amplification of DNA from the feces of pigs with experimental and naturally occurring proliferative enteritis. Images PMID:8253956

  1. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis

    PubMed Central

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  2. On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

    PubMed

    Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

    2017-09-01

    Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

    PubMed

    Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

    1999-10-01

    Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.

  4. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

    PubMed

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

    1999-07-01

    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  5. Development of a dry-reagent mix-based polymerase chain reaction as a novel tool for the identification of Acinetobacter species and its comparison with conventional polymerase chain reaction

    PubMed Central

    Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama

    2018-01-01

    BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209

  6. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

    PubMed

    James, Ameh; Macdonald, Joanne

    2015-01-01

    Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

  7. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    PubMed

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  8. Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

    PubMed

    Xia, Minghui; Qi, Qingguo

    2013-01-01

    We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

  9. Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*

    PubMed Central

    Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio

    1971-01-01

    In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548

  10. Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

    PubMed

    Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

    1998-01-01

    To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

  11. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  13. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    PubMed

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  14. A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

    PubMed

    Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

    2017-11-01

    Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

  15. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  16. Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

    PubMed

    Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

    1998-04-01

    Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

  17. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.

    PubMed

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum

    2012-12-01

    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

  18. Monochrome Multiplexing in Polymerase Chain Reaction by Photobleaching of Fluorogenic Hydrolysis Probes.

    PubMed

    Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix

    2016-03-01

    Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays.

  19. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    PubMed Central

    Eustaquio, Trisha; Leary, James F

    2012-01-01

    Background Determination of the fate of nanoparticles (NPs) in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR), coined “nanobarcoding,” is demonstrated. Methods Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs) were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs) was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV). Results Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs), while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas. Conclusion Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further development before its widespread use as a standardized assay. PMID:23144562

  20. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Souza, M T; Carvalho-Zilse, G A

    2014-07-25

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

  1. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    PubMed

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray ® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. © The American Society of Tropical Medicine and Hygiene.

  2. A movie of the RNA polymerase nucleotide addition cycle.

    PubMed

    Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

    2009-06-01

    During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

  3. Role of disulfide bridges in archaeal family-B DNA polymerases.

    PubMed

    Killelea, Tom; Connolly, Bernard A

    2011-06-14

    The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay.

    PubMed

    Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

    2006-02-01

    Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR.

  5. High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

    PubMed

    Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

    2014-10-01

    This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    NASA Astrophysics Data System (ADS)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

    2013-07-01

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

  7. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  8. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    PubMed

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  9. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

    PubMed Central

    Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

    2009-01-01

    Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

  10. The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

    PubMed Central

    Shu, Bo; Gong, Peng

    2017-01-01

    ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

  11. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    PubMed Central

    Dinoop, K.P.; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R.P.; Narayanan, P.

    2016-01-01

    Background & objectives: Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Methods: Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. Results: In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated (P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the

  12. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    PubMed

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  13. Posttranslational Regulation of Human DNA Polymerase ι.

    PubMed

    McIntyre, Justyna; McLenigan, Mary P; Frank, Ekaterina G; Dai, Xiaoxia; Yang, Wei; Wang, Yinsheng; Woodgate, Roger

    2015-11-06

    Human DNA polymerases (pols) η and ι are Y-family DNA polymerase paralogs that facilitate translesion synthesis past damaged DNA. Both polη and polι can be monoubiquitinated in vivo. Polη has been shown to be ubiquitinated at one primary site. When this site is unavailable, three nearby lysines may become ubiquitinated. In contrast, mass spectrometry analysis of monoubiquitinated polι revealed that it is ubiquitinated at over 27 unique sites. Many of these sites are localized in different functional domains of the protein, including the catalytic polymerase domain, the proliferating cell nuclear antigen-interacting region, the Rev1-interacting region, and its ubiquitin binding motifs UBM1 and UBM2. Polι monoubiquitination remains unchanged after cells are exposed to DNA-damaging agents such as UV light (generating UV photoproducts), ethyl methanesulfonate (generating alkylation damage), mitomycin C (generating interstrand cross-links), or potassium bromate (generating direct oxidative DNA damage). However, when exposed to naphthoquinones, such as menadione and plumbagin, which cause indirect oxidative damage through mitochondrial dysfunction, polι becomes transiently polyubiquitinated via Lys(11)- and Lys(48)-linked chains of ubiquitin and subsequently targeted for degradation. Polyubiquitination does not occur as a direct result of the perturbation of the redox cycle as no polyubiquitination was observed after treatment with rotenone or antimycin A, which both inhibit mitochondrial electron transport. Interestingly, polyubiquitination was observed after the inhibition of the lysine acetyltransferase KATB3/p300. We hypothesize that the formation of polyubiquitination chains attached to polι occurs via the interplay between lysine acetylation and ubiquitination of ubiquitin itself at Lys(11) and Lys(48) rather than oxidative damage per se. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  15. Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

    PubMed

    Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

    2018-02-01

    Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable

  16. Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

    PubMed

    Cowan, Ashley F; Elkins, Kelly M

    2017-12-01

    Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

  17. Development of an immunomagnetic separation-polymerase chain reaction (IMS-PCR) assay specific for Enterocytozoon bieneusi in water samples.

    PubMed

    Sorel, N; Guillot, E; Thellier, M; Accoceberry, I; Datry, A; Mesnard-Rouiller, L; Miégeville, M

    2003-01-01

    Microsporidia have become widely recognized as important human pathogens. Among Microsporidia, Enterocytozoon bieneusi is responsible for severe gastrointestinal disease. To date, no current therapy has been proven effective. Their mode of transmission and environmental occurrence are poorly documented because of the lack of detection methods that are both species-specific and sensitive. In this study, we developed a sensitive and specific molecular method to detect E. bieneusi spores in water samples. The molecular assay combined immunomagnetic separation (IMS) and polymerase chain reaction (PCR) amplification to detect E. bieneusi spores. A comparison was made of IMS magnetic beads coated with two different monoclonal antibodies, one specific for the Encephalitozoon genus that cross-reacts with E. bieneusi and the other specific only for the E. bieneusi species itself. Immunotech beads coated with the antibody specific for E. bieneusi were found to be the most effective combination. The highly specific IMS-PCR assay developed in this study provides a rapid and sensitive means of screening water samples for the presence of E. bieneusi spores.

  18. Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

    PubMed

    Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2016-09-01

    Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

    PubMed Central

    Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

    2015-01-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  20. Diagnosis of Whooping Cough in Switzerland: Differentiating Bordetella pertussis from Bordetella holmesii by Polymerase Chain Reaction

    PubMed Central

    Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  1. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    PubMed

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  2. A new multiplex real-time polymerase chain reaction assay for the diagnosis of periprosthetic joint infection.

    PubMed

    Kawamura, Masaki; Kobayashi, Naomi; Inaba, Yutaka; Choe, Hyonmin; Tezuka, Taro; Kubota, So; Saito, Tomoyuki

    2017-11-01

    A new multiplex real-time polymerase chain reaction (PCR) assay was developed to detect methicillin-resistant Staphylococcus (MRS) and to distinguish between gram-positive and gram-negative bacteria. In this study, we validated the sensitivity and specificity of this assay with periprosthetic joint infections (PJIs) and evaluated the utility of PCR for culture-negative PJI. Forty-five samples from 23 infectious PJI cases and 106 samples from 64 non-infectious control cases were analyzed by real-time PCR using a LightCycler Nano ® system. Twenty-eight clinical samples, comprising bacteria of known species isolated consecutively in the microbiological laboratory of our hospital, were used to determine the spectrum of bacterial species that could be detected using the new multiplex primers and probes. The sensitivity and specificity of the MRS- and universal-PCR assays were 92% and 99%, and 91% and 88%, respectively. Twenty-eight species of clinically isolated bacteria were detected using this method and the concordance rate for the identification of gram-positive or gram-negative organisms was 96%. Eight samples were identified as PCR-positive despite a culture-negative result. This novel multiplex real-time PCR system has acceptable sensitivity and specificity and several advantages; therefore, it has potential use for the diagnosis of PJIs, particularly in culture-negative cases.

  3. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  4. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

    PubMed Central

    White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

    2015-01-01

    Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

  5. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing.

    PubMed

    White, P Lewis; Wingard, John R; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F; Slavin, Monica A; Barnes, Rosemary A; Pappas, Peter G; Donnelly, J Peter

    2015-10-15

    Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%-88.0% and 75.0%-94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  6. Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

    PubMed Central

    Kutyavin, Igor V.

    2013-01-01

    Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

  7. Habitat associations of two entomopathogenic nematodes: a quantitative study using real-time quantitative polymerase chain reactions.

    PubMed

    Torr, Peter; Spiridonov, Sergei E; Heritage, Stuart; Wilson, Michael J

    2007-03-01

    1. Despite nematodes being the most abundant animals on earth, very few animal ecologists study them, probably because of the difficulties of identifying them to species by morphological methods. 2. A group of nematodes that are important both ecologically and economically is the entomopathogenic nematodes, which play a key role in regulating soil food webs and are sold throughout the world as biological insecticides, yet for which very little is known of their population ecology. 3. A novel detection and quantification method was developed for soil nematodes using real-time polymerase chain reaction (PCR), and the technique was used to estimate numbers of two closely related species of entomopathogenic nematodes, Steinernema kraussei and S. affine in 50 soil samples from 10 sites in Scotland representing two distinct habitats (woodland and grassland). 4. There was a high degree of correlation between our molecular and traditional morphological estimates of population size and our data clearly showed that Steinernema affine occurred only in grassland areas, whereas S. kraussei was found in grassland and woodland samples to a similar degree. 5. Real-time PCR offers a rapid and accurate method of detecting individual nematode species from soil samples without the need for a specialist taxonomist, and has much potential for use in studies of nematode population ecology.

  8. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    PubMed

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  9. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  10. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  11. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less

  12. [Identification of Panax ginseng, P. notoginseng and P. quinquefolius admixture by multiplex allele-specific polymerase chain reaction].

    PubMed

    Jiang, Chao; Luo, Yu-Qing; Yuan, Yuan; Huang, Lu-Qi; Jin, Yan; Zhao, Yu-Yang

    2017-04-01

    To achieve a molecular method to identify Panax ginseng, P. notoginseng,P. quinquefolius and their admixture. The ITS,18S and matK sequences of Panax genus were analyzed to develop species-specific SNP marker. Three pairs of species-specific primers were designed to establish a multiplex allele-specific polymerase chain reaction (MAS-PCR) and the samples from different region were tested. The results showed that when the annealing temperature was 60 ℃ and the cycle number was 35, approximately 250, 500,1 000 bp specific band were obtained from P. ginseng, P. notoginseng and P. quinquefolius obtain, respectively. This method could also be used to authentificate admixture samples and could detect 0.5% percent of P. notoginseng or P. quinquefolius adulterated in P. ginseng, or 0.5% percent of P. ginseng or P. quinquefolius adulterated in P. notoginseng. The detect limit of P. ginseng in P. quinquefolius was 0.5% and P. notoginseng in P. quinquefolius was 1%. This results showed that the present method could be used as a promise method to identify Panax ginseng, P. notoginseng, P. quinquefolius and their admixture. Copyright© by the Chinese Pharmaceutical Association.

  13. Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

    PubMed

    Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

    2015-08-01

    HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

    PubMed

    Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

    2014-12-01

    Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

  15. The cellular level of O-antigen polymerase Wzy determines chain length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a.

    PubMed

    Carter, Javier A; Jiménez, Juan C; Zaldívar, Mercedes; Alvarez, Sergio A; Marolda, Cristina L; Valvano, Miguel A; Contreras, Inés

    2009-10-01

    The lipopolysaccharide O antigen of Shigella flexneri 2a has two preferred chain lengths, a short (S-OAg) composed of an average of 17 repeated units and a very long (VL-OAg) of about 90 repeated units. These chain length distributions are controlled by the chromosomally encoded WzzB and the plasmid-encoded Wzz(pHS-2) proteins, respectively. In this study, genes wzzB, wzz(pHS-2) and wzy (encoding the O-antigen polymerase) were cloned under the control of arabinose- and rhamnose-inducible promoters to investigate the effect of varying their relative expression levels on O antigen polysaccharide chain length distribution. Controlled expression of the chain length regulators wzzB and wzz(pHS-2) revealed a dose-dependent production of each modal length. Increase in one mode resulted in a parallel decrease in the other, indicating that chain length regulators compete to control the degree of O antigen polymerization. Also, when expression of the wzy gene is low, S-OAg but not VL-OAg is produced. Production of VL-OAg requires high induction levels of wzy. Thus, the level of expression of wzy is critical in determining O antigen modal distribution. Western blot analyses of membrane proteins showed comparable high levels of the WzzB and Wzz(pHS-2) proteins, but very low levels of Wzy. In vivo cross-linking experiments and immunoprecipitation of membrane proteins did not detect any direct interaction between Wzy and WzzB, suggesting the possibility that these two proteins may not interact physically but rather by other means such as via translocated O antigen precursors.

  16. Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges.

    PubMed

    Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

    Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR.

  17. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

    PubMed Central

    Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  18. Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

    PubMed Central

    Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

    2017-01-01

    DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

  19. Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

    PubMed

    Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

    2012-08-01

    Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and

  20. Large Pathogenic Expansions in the SCA2 and SCA7 Genes Can Be Detected by Fluorescent Repeat-Primed Polymerase Chain Reaction Assay

    PubMed Central

    Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

    2006-01-01

    Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR. PMID:16436644

  1. Use of polymerase chain reaction in human African trypanosomiasis stage determination and follow-up.

    PubMed Central

    Truc, P.; Jamonneau, V.; Cuny, G.; Frézil, J. L.

    1999-01-01

    Stage determination of human African trypanosomiasis is based on the detection of parasites and measurements of biological changes in the cerebrospinal fluid (CSF) (concentration of white blood cells > 5 cells per mm3 and increased total protein levels). The patient is treated accordingly. Demonstration of the absence or presence of trypanosomes by the double centrifugation technique is still the only test available to clinicians for assessing treatment success. In this study, however, we evaluate the polymerase chain reaction (PCR) as a tool for assessing the disease stage of trypanosomiasis and for determining whether treatment has been successful. All 15 study patients considered to be in the advanced stage of the disease were PCR positive; however, trypanosomes were demonstrated by double centrifugation in only 11 patients. Of the five remaining patients, who were considered to be in the early stage, PCR and double centrifugation were negative. Following treatment, 13 of the 15 second-stage patients were found to be negative for the disease in at least two samples by PCR and double centrifugation. Two others were still positive by PCR immediately and one month after the treatment. Trypanosome DNA detection using PCR suggested that the two positive patients were not cured but that their possible relapse could not be identified by a search for parasites using the double centrifugation technique. Further evaluation of the PCR method is required, in particular to determine whether PCR assays could be used in studies on patients who fail to respond to melarsoprol, as observed in several foci. PMID:10534898

  2. Detection of common diarrhea-causing pathogens in Northern Taiwan by multiplex polymerase chain reaction.

    PubMed

    Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng

    2018-06-01

    Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians' orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs.

  3. Detection of common diarrhea-causing pathogens in Northern Taiwan by multiplex polymerase chain reaction

    PubMed Central

    Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng

    2018-01-01

    Abstract Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians’ orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs. PMID:29879060

  4. [DIAGNOSTIC VALUE OF COMBINED USE OF COMBINED METHOD OF ENZYME IMMUNOASSAY AND POLYMERASE CHAIN REACTION TO DETECT OF INTRAUTERINE FETAL INFECTION BY PARVOVIRUS B19].

    PubMed

    Bondarenko, N P; Lakatosh, V P; Lakatosh, P V; Malanchuk, O B; Poladich, I V

    2015-01-01

    The combined method of diagnosis parvovirus infection during pregnancy by maternal serum enzyme immunoassay and deoxyribonucleic acid isolation parvovirus B19 polymerase chain reaction in amnniotic fluid and fetal cord blood newborns, can diagnose vertical transmission and anticipate a negative effect on the fetus parvovirus. Lack of maternal IgM antibodies in serum due to parvovirus seroconversion during pregnancy does not exclude the persistence of the virus in the fetus. To analyze the diagnostic value of the method for determining the LHP parvovirus B19 DNA in the amniotic fluid, umbilical cord blood of newborns to determine vertical transmission of parvovirus infection when infected mothers B19 during pregnancy.

  5. Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics.

    PubMed

    Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio

    2017-05-01

    Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

  6. Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics

    PubMed Central

    Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio

    2017-01-01

    BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses. PMID:28403327

  7. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    PubMed Central

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  8. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  9. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    PubMed Central

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  10. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

    PubMed

    Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

    2015-09-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. © The American Society of Tropical Medicine and Hygiene.

  11. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  12. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, T.E.; Smith, S.R.; Miyamoto, A.; Shadduck, D.J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  13. Early polymerase chain reaction detection of Chagas disease reactivation in heart transplant patients.

    PubMed

    da Costa, Priscilla Almeida; Segatto, Marcela; Durso, Danielle Fernandes; de Carvalho Moreira, Wagson José; Junqueira, Lucas Lodi; de Castilho, Fábio Morato; de Andrade, Silvio Amadeu; Gelape, Cláudio Léo; Chiari, Egler; Teixeira-Carvalho, Andréa; Junho Pena, Sergio Danilo; Machado, Carlos Renato; Franco, Gloria Regina; Filho, Geraldo Brasileiro; Vieira Moreira, Maria da Consolação; Mara Macedo, Andréa

    2017-07-01

    Heart transplantation is a valuable therapeutic option for Chagas disease patients with severe cardiomyopathy. During patient follow-up, the differential diagnosis between cardiac transplant rejection and Chagas disease infection reactivation remains a challenging task, which hinders rapid implementation of the appropriate treatment. Herein we investigate whether polymerase chain reaction (PCR) strategies could facilitate early detection of Trypanosoma cruzi (T cruzi) in transplanted endomyocardial biopsies (EMBs). In this study we analyzed 500 EMB specimens obtained from 58 chagasic cardiac transplant patients, using PCR approaches targeted to nuclear (rDNA 24Sα) and kinetoplastid (kDNA) markers, and compared the efficiency of these approaches with that of other tests routinely used. T cruzi DNA was detected in 112 EMB specimens derived from 39 patients (67.2%). The first positive result occurred at a median 1.0 month post-transplant. Conventional histopathologic, blood smear and hemoculture analyses showed lower sensitivity and higher median time to the first positive result. Patient follow-up revealed that 31 of 39 PCR-positive cases presented clinical reactivation of Chagas disease at different time-points after transplantation. PCR techniques showed considerable sensitivity (0.82) and specificity (0.60), with area under the receiver operating characteristic (ROC) curves of 0.708 (p = 0.001). Moreover, PCR techniques anticipated the clinical signs of Chagas disease reactivation by up to 36 months, with a median time of 6 months and an average of 9.1 months. We found a good association between the PCR diagnosis and the clinical signs of the disease, indicating that the PCR approaches used herein are suitable for early diagnosis of Chagas disease reactivation, with high potential to assist physicians in treatment decisions. For this purpose, an algorithm is proposed for surveillance based on the molecular tests. Copyright © 2017 International Society for the

  14. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    PubMed

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Polymerase Chain Reaction Pool Screening Used To Compare Prevalence of Infective Black Flies in Two Onchocerciasis Foci in Northern Sudan

    PubMed Central

    Higazi, Tarig B.; Zarroug, Isam M. A.; Mohamed, Hanan A.; Mohamed, Wigdan A.; Deran, Tong Chor M.; Aziz, Nabil; Katabarwa, Moses; Hassan, Hassan K.; Unnasch, Thomas R.; Mackenzie, Charles D.; Richards, Frank

    2011-01-01

    Onchocerciasis remains an important debilitating disease in many areas of Africa, including Sudan. The status of infection transmission in 2007 was assessed in the vectors of two disease foci in Sudan: Abu Hamed in northern Sudan, which has received at least 10 years of annual treatment and Galabat focus in eastern Sudan, where only minor, largely undocumented treatment activity has occurred. Assessment of more than 30,000 black flies for Onchocerca volvulus infectious stage L3 larvae by using an O-150 polymerase chain reaction protocol showed that black fly infectivity rates were 0.84 (95% confidence interval = 0.0497–1.88) per 10,000 flies for Abu Hamed and 6.9 (95% confidence interval = 1.1–16.4) infective flies per 10,000 for Galabat. These results provide entomologic evidence for suppressed Onchocerca volvulus transmission in the Abu Hamed focus and a moderate transmission rate of the parasite in the Galabat focus. PMID:21540385

  16. Molecular identification and quantification of bacteria from endodontic infections using real-time polymerase chain reaction.

    PubMed

    Blome, B; Braun, A; Sobarzo, V; Jepsen, S

    2008-10-01

    It was the aim of the present study to evaluate root canal samples for the presence and numbers of specific species as well as for total bacterial load in teeth with chronic apical periodontitis using quantitative real-time polymerase chain reaction (PCR). Forty adult patients with one radiographically documented periapical lesion were included. Twenty teeth presented with primary infections and 20 with secondary infections, requiring retreatment. After removal of necrotic pulp tissue or root canal filling, a first bacterial sample was obtained. Following chemo-mechanical root canal preparation a second sample was taken and a third sample was obtained after 14 days of intracanal dressing with calcium hydroxide. Analysis by real-time PCR enabled the quantification of total bacterial counts and of nine selected species. Root canals with primary infections harbored significantly more bacteria (by total bacterial count) than teeth with secondary infections (P < 0.05). Mean total bacterial count in the retreatment group was 2.1 x 10(6) and was significantly reduced following root canal preparation (3.6 x 10(4)) and intracanal dressing (1.4 x 10(5)). Corresponding values for primary infections were: 4.6 x 10(7), 3.6 x 10(4), and 6.9 x 10(4). The numbers of the selected bacteria and their detection frequency were also significantly reduced. Root canals with primary infections contained a higher bacterial load. Chemo-mechanical root canal preparation reduced bacterial counts by at least 95%.

  17. Piglet colibacillosis diagnosis based on multiplex polymerase chain reaction and immunohistochemistry of paraffin-embedded tissues

    PubMed Central

    de Andrade, Caroline P.; Machado, Verônica S. L.; Bianchi, Matheus V.; Rolim, Veronica M.; Cruz, Raquel A. S.; Driemeier, David

    2018-01-01

    Enterotoxigenic Escherichia coli (ETEC) causes diarrhea in pigs, referred to as colibacillosis. The aim of this study was to optimize multiplex polymerase chain reaction (PCR) and immunohistochemistry (IHC) analyses of paraffin-embedded material to detect pathogenic E. coli strains causing colibacillosis in pigs. Multiplex PCR was optimized for fimbriae (F18, F4, F6, F5, and F41) and toxins (types A and B heat-stable toxins [STaP and STb], heat-labile toxin [LT], and type 2 Shiga toxin [STx2e]), and IHC was optimized for an anti-E. coli polyclonal antibody. Samples (132) from pigs received between 2006 and 2014 with clinical and histopathological diagnoses of colibacillosis were analyzed. E. coli was detected by IHC in 78.7%, and at least one virulence factor gene was detected in 71.2%. Pathogenic strains of ETEC with at least one fimbria and one toxin were detected in 40% of the samples in multiplex PCR. The most frequent virulence types were F18-STaP (7.5%), F18-STaP-STb (5.7%), and F4-STaP (3.8%). A statistically significant association was noted between virulence factors F4, F18, STaP, and STb and positive immunostaining results. Colibacillosis diagnosis through multiplex PCR and IHC of paraffin-embedded tissues is a practical approach, as samples can be fixed and stored for long periods before analysis. PMID:28693311

  18. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

    PubMed

    Alexander, C L; Shankland, G S; Carman, W; Williams, C

    2011-05-01

    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  19. Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay.

    PubMed

    Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel

    2002-09-01

    Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.

  20. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    PubMed Central

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  1. Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

    PubMed

    Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

    2011-09-01

    Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

  2. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    NASA Astrophysics Data System (ADS)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  3. A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

    PubMed

    Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

    2016-12-01

    Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

  4. Usefulness of quantitative polymerase chain reaction in amniotic fluid as early prognostic marker of fetal infection with Toxoplasma gondii.

    PubMed

    Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane

    2004-03-01

    Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.

  5. Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

    PubMed

    Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

    2015-03-01

    Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes. © 2015 The Author(s).

  6. Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

    PubMed

    Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

    1998-02-01

    A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

  7. A real-time polymerase chain reaction-based protocol for low/medium-throughput Y-chromosome microdeletions analysis.

    PubMed

    Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe

    2012-12-01

    We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.

  8. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  9. Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed Central

    Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

    1991-01-01

    A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

  10. Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

    PubMed

    Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

    1994-02-01

    We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

  11. Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed

    Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

    2001-01-01

    A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of <5% (w/w) guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

  12. Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

    NASA Astrophysics Data System (ADS)

    Lily; Siregar, Y.; Ilyas, S.

    2018-03-01

    This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

  13. Impact of polymerase chain reaction results on patient management during a viral meningitis outbreak in Tropical North Queensland.

    PubMed

    Stonehouse, Vicki; Furyk, Jeremy; Norton, Robert

    2012-02-01

    Enterovirus is the most commonly isolated pathogen in viral meningitis. We report on the first outbreak of viral meningitis in Tropical Queensland and the effect of polymerase chain reaction (PCR) results on antibiotic use and hospital length of stay. Retrospective case series of consecutive patients presenting to the Townsville ED with viral meningitis were evaluated by examining hospital medical records. The study period was November 2008 to February 2009. Forty-three patients were available for full analysis of which 17 (40%) were female and 17 (40%) had a positive enteroviral PCR. Antibiotics were commenced on 37 (86%) of patients. There was no difference in hospital length of stay in patients with a negative versus positive PCR (2.52 vs 2.72 days, P = 0.68) or duration of antibiotic therapy (2.20 vs 1.94 days, P = 0.61). In our study a positive result on PCR was not associated with a shorter hospital length of stay or a shorter duration of antibiotic therapy. This contrasts with previous reports on this topic and requires further evaluation. © 2011 The Authors. EMA © 2011 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

  14. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

    PubMed

    Kidd, I M; Clark, D A; Emery, V C

    2000-06-01

    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

  15. Duplex real-time polymerase chain reaction reveals competition between Erwinia amylovora and E. pyrifoliae on pear blossoms.

    PubMed

    Lehman, Susan M; Kim, Won-Sik; Castle, Alan J; Svircev, Antonet M

    2008-06-01

    Erwinia amylovora and E. pyrifoliae are the causative agents of fire blight and Asian pear blight, respectively. The pathogens are closely related, with overlapping host ranges. Data are unavailable on the current distribution of E. pyrifoliae and on the interaction between the two species when they are present together on the same host. In this study, a duplex real-time polymerase chain reaction (PCR) protocol was developed to monitor the population dynamics of E. amylovora and E. pyrifoliae on the surface of Bartlett pear blossoms. Bacterial cells washed from blossoms were used directly as the PCR template without DNA extraction. Primers and a probe based on the E. amylovora levansucrase gene detected all E. amylovora strains. All E. pyrifoliae strains, including the Japanese Erwinia strains previously described as E. amylovora, were detected with a primer and probe combination based on the E. pyrifoliae hrpW gene. Disease development and severity were not significantly different in blossoms inoculated with individual Erwinia species or with a mixture of the two species. However, E. amylovora grew to greater population sizes than did E. pyrifoliae in both single species inoculations and in mixtures, suggesting that E. amylovora has a greater competitive fitness on Bartlett pear blossoms than E. pyrifoliae.

  16. A simple nucleic acid hybridization/latex agglutination assay for the rapid detection of polymerase chain reaction amplicons.

    PubMed

    Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred

    2007-03-01

    We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.

  17. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    PubMed

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  18. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  19. Factors affecting the relationship between quantitative polymerase chain reaction (qPCR) and culture-based enumeration of Enterococcus in environmental waters.

    PubMed

    Raith, M R; Ebentier, D L; Cao, Y; Griffith, J F; Weisberg, S B

    2014-03-01

    To determine the extent to which discrepancies between qPCR and culture-based results in beach water quality monitoring can be attributed to: (i) within-method variability, (ii) between-method difference within each method class (qPCR or culture) and (iii) between-class difference. We analysed 306 samples using two culture-based (EPA1600 and Enterolert) and two qPCR (Taqman and Scorpion) methods, each in duplicate. Both qPCR methods correlated with EPA1600, but regression analyses indicated approximately 0·8 log10 unit overestimation by qPCR compared to culture methods. Differences between methods within a class were less than half of this and were minimal for between-replicate within a method. Using the 104 Enterococcus per 100 ml management decision threshold, Taqman qPCR indicated the same decisions as EPA1600 for 87% of the samples, but indicated beach posting for unhealthful water when EPA1600 did not for 12% of the samples. After accounting for within-method and within-class variability, 8% of the samples exhibited true between-class discrepancy where both qPCR methods indicated beach posting while both culture methods did not. Measurement target difference (DNA vs growth) accounted for the majority of the qPCR-vs-culture discrepancy, but its influence on monitoring application is outweighed by frequent incorrect posting with culture methods due to incubation time delay. This is the first study to quantify the frequency with which culture-vs-qPCR discrepancies can be attributed to target difference - vs - method variability. © 2013 The Society for Applied Microbiology.

  20. Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota.

    PubMed

    Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T

    2006-10-01

    Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.

  1. DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

    PubMed

    Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

    2013-06-13

    Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

  2. Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

    PubMed Central

    Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

    2011-01-01

    The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

  3. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  4. Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

    PubMed

    Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

    2017-09-01

    To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

  5. Postinduction minimal residual disease monitoring by polymerase chain reaction in children with acute lymphoblastic leukemia.

    PubMed

    Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe

    2014-11-01

    Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.

  6. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

    1990-01-01

    The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

  7. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  8. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    PubMed

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015.

  9. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-10-04

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

  10. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  11. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    PubMed

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  12. Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease.

    PubMed

    Olsvik, B; Olsen, I; Tenover, F C

    1995-04-01

    The polymerase chain reaction was used to examine 114 tetracycline-resistant anaerobic and facultative anaerobic bacterial isolates from patients with periodontal disease for the tet(M) and tet(O) genes. A 740-base-pair fragment of the tet(M) gene was amplified from 84 of 114 isolates, and a 519-base-pair fragment of the tet(O) gene was amplified from 13 streptococcal isolates. Six of 7 tetracycline-resistant isolates of Veillonella spp. and tetracycline-resistant isolates of Eubacterium spp. (n = 3), Eubacterium saburreum (n = 1), Streptococcus intermedius (n = 5) and Gemella morbillorum (n = 2) all harbored the tet(M) gene. The tet(M) and tet(O) negative as well as selected positive isolates were tested for the tet(K) and tet(L) genes using DNA probes. All isolates of Staphylococcus spp. (n = 11) hybridized with the tet(K) probe. None of the isolates tested hybridized with the probe for tet(L). This is the first report of the tet(M) gene in the facultative bacterium G. morbillorum and in E. saburreum.

  13. Allelic Dropout During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA Methylation Is Widespread at Imprinted Human Loci.

    PubMed

    Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A

    2017-03-10

    Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.

  14. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  15. Detection of periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction.

    PubMed

    Ohki, Takahiro; Itabashi, Yuji; Kohno, Takashi; Yoshizawa, Akihiro; Nishikubo, Shuichi; Watanabe, Shinya; Yamane, Genyuki; Ishihara, Kazuyuki

    2012-02-01

    Numerous reports have demonstrated that periodontal bacteria are present in plaques from atherosclerotic arteries. Although periodontitis has recently been recognized as a risk factor for coronary artery disease, the direct relationship between periodontal bacteria and coronary artery disease has not yet been clarified. It has been suggested that these bacteria might contribute to inflammation and plaque instability. We assumed that if periodontal bacteria induce inflammation of plaque, the bacteria would be released into the bloodstream when vulnerable plaque ruptures. To determine whether periodontal bacteria are present in thrombi at the site of acute myocardial infarction, we tried to detect periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction (PCR). We studied 81 consecutive adults with ST-segment elevation acute myocardial infarction who underwent primary percutaneous coronary intervention (PCI). All patients underwent removal of thrombus with aspiration catheters at the beginning of percutaneous coronary intervention, and a small sample of thrombus was obtained for PCR. The detection rates of periodontal bacteria by PCR were 19.7% for Aggregatibacter actinomycetemcomitans, 3.4% for Porphyromonas gingivalis, and 2.3% for Treponema denticola. Three species of periodontal bacteria were detected in the thrombi of patients with acute myocardial infarction. This raises the possibility that such bacteria are latently present in plaque and also suggests that these bacteria might have a role in plaque inflammation and instability. Copyright © 2012 Mosby, Inc. All rights reserved.

  16. TaqMan PCR for Detection of Vibrio cholerae O1, O139, Non-O1, and Non-O139 in Pure Cultures, Raw Oysters, and Synthetic Seawater†

    PubMed Central

    Lyon, W. J.

    2001-01-01

    Vibrio cholerae is recognized as a leading human waterborne pathogen. Traditional diagnostic testing for Vibrio is not always reliable, because this bacterium can enter a viable but nonculturable state. Therefore, nucleic acid-based tests have emerged as a useful alternative to traditional enrichment testing. In this article, a TaqMan PCR assay is presented for quantitative detection of V. cholerae in pure cultures, oysters, and synthetic seawater. Primers and probe were designed from the nonclassical hemolysin (hlyA) sequence of V. cholerae strains. This probe was applied to DNA from 60 bacterial strains comprising 21 genera. The TaqMan PCR assay was positive for all of the strains of V. cholerae tested and negative for all other species of Vibrio tested. In addition, none of the other genera tested was amplified with the TaqMan primers and probe used in this study. The results of the TaqMan PCR with raw oysters and spiked with V. cholerae serotypes O1 and O139 were comparable to those of pure cultures. The sensitivity of the assay was in the range of 6 to 8 CFU g−1 and 10 CFU ml−1 in spiked raw oyster and synthetic seawater samples, respectively. The total assay could be completed in 3 h. Quantification of the Vibrio cells was linear over at least 6 log units. The TaqMan probe and primer set developed in this study can be used as a rapid screening tool for the presence of V. cholerae in oysters and seawater without prior isolation and characterization of the bacteria by traditional microbiological methods. PMID:11571173

  17. The detection of melanoma cells in peripheral blood by reverse transcription-polymerase chain reaction.

    PubMed Central

    Foss, A. J.; Guille, M. J.; Occleston, N. L.; Hykin, P. G.; Hungerford, J. L.; Lightman, S.

    1995-01-01

    Both cutaneous and uveal melanoma undergo haematogenous dissemination. Detection of tyrosinase mRNA by reverse transcription-polymerase chain reaction (RT-PCR) has been described as an extremely sensitive way of detecting circulating viable melanoma cells in the peripheral venous blood, and this technique may be of value in the early detection of dissemination. Also, it has been suggested that surgical manipulation of the eye, such as occurs during enucleation, can provoke uveal melanoma dissemination. The purpose of this study was to evaluate whether tyrosinase mRNA is detectable in the peripheral blood of patients with uveal and cutaneous melanoma and in patients with uveal melanoma undergoing surgical procedures on the eye harbouring the tumour. Venous blood samples from 36 patients diagnosed as having active uveal melanoma and from six patients with advanced metastatic cutaneous melanoma were analysed. In addition, blood samples were spiked with known numbers of cells from three cell lines and four primary uveal melanoma cultures. The reported sensitivity of the technique was confirmed, with an ability to detect down to one cell per ml of blood. All 51 blood samples from the 36 patients with uveal melanoma were negative, and this included 20 perioperative blood samples. The test was also negative for the six patients with advanced cutaneous melanoma. There were two positives among 31 control samples analysed. This study demonstrates that there are far fewer circulating viable melanocytes than has been previously supposed in patients with melanoma and that the RT-PCR is of no clinical value in detecting metastatic melanoma disease. There was no evidence for surgery causing a bolus of melanoma cells to enter the peripheral circulation. Images Figure 1 Figure 2 PMID:7599046

  18. Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

    PubMed

    Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

    2013-12-01

    A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    PubMed

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; P<0.001). Viremia was detected when the serum was sampled within 30 h after the beginning of symptoms. These results confirm previous reports of early and transient viremia in young children. This preliminary study shows the limits and added value of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Polymerase Chain Reaction Detection of Leishmania kDNA from the Urine of Peruvian Patients with Cutaneous and Mucocutaneous Leishmaniasis

    PubMed Central

    Veland, Nicolas; Espinosa, Diego; Valencia, Braulio Mark; Ramos, Ana Pilar; Calderon, Flor; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

    2011-01-01

    We hypothesized that Leishmania kDNA may be present in urine of patients with cutaneous leishmaniasis (CL). Urine samples and standard diagnostic specimens were collected from patients with skin lesions. kDNA polymerase chain reaction (PCR) was performed on samples from patients and 10 healthy volunteers from non-endemic areas. Eighty-six of 108 patients were diagnosed with CL and 18 (21%) had detectable Leishmania Viannia kDNA in the urine. Sensitivity and specificity were 20.9% (95% confidence interval [CI] 12.3–29.5%) and 100%. Six of 8 patients with mucocutaneous involvement had detectable kDNA in urine versus 12 of 78 patients with isolated cutaneous disease (P < 0.001). L. (V.) braziliensis (N = 3), L. (V.) guyanensis (N = 6), and L. (V.) peruviana (N = 3) were identified from urine. No healthy volunteer or patient with an alternate diagnosis had detectable kDNA in urine. Sensitivity of urine PCR is sub-optimal for diagnosis. On the basis of these preliminary data in a small number of patients, detectable kDNA in urine may identify less localized forms of infection and inform treatment decisions. PMID:21460009

  1. The value of routine polymerase chain reaction analysis of intraocular fluid specimens in the diagnosis of infectious posterior uveitis.

    PubMed

    Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel

    2013-01-01

    To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

  2. A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

    PubMed

    Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

    2009-11-01

    To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

  3. Massively parallel single-molecule and single-cell emulsion reverse transcription polymerase chain reaction using agarose droplet microfluidics.

    PubMed

    Zhang, Huifa; Jenkins, Gareth; Zou, Yuan; Zhu, Zhi; Yang, Chaoyong James

    2012-04-17

    A microfluidic device for performing single copy, emulsion Reverse Transcription Polymerase Chain Reaction (RT-PCR) within agarose droplets is presented. A two-aqueous-inlet emulsion droplet generator was designed and fabricated to produce highly uniform monodisperse picoliter agarose emulsion droplets with RT-PCR reagents in carrier oil. Template RNA or cells were delivered from one inlet with RT-PCR reagents/cell lysis buffer delivered separately from the other. Efficient RNA/cell encapsulation and RT-PCR at the single copy level was achieved in agarose-in-oil droplets, which, after amplification, can be solidified into agarose beads for further analysis. A simple and efficient method to graft primer to the polymer matrix using 5'-acrydite primer was developed to ensure highly efficient trapping of RT-PCR products in agarose. High-throughput single RNA molecule/cell RT-PCR was demonstrated in stochastically diluted solutions. Our results indicate that single-molecule RT-PCR can be efficiently carried out in agarose matrix. Single-cell RT-PCR was successfully performed which showed a clear difference in gene expression level of EpCAM, a cancer biomarker gene, at the single-cell level between different types of cancer cells. This work clearly demonstrates for the first time, single-copy RT-PCR in agarose droplets. We believe this will open up new possibilities for viral RNA detection and single-cell transcription analysis.

  4. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    PubMed

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Value of the polymerase chain reaction method for detecting tuberculosis in the bronchial tissue involved by anthracosis.

    PubMed

    Mirsadraee, Majid; Shafahie, Ahmad; Reza Khakzad, Mohammad; Sankian, Mojtaba

    2014-04-01

    Anthracofibrosis is the black discoloration of the bronchial mucosa with deformity and obstruction. Association of this disease with tuberculosis (TB) was approved. The objective of this study was to find the additional benefit of assessment of TB by the polymerase chain reaction (PCR) method. Bronchoscopy was performed on 103 subjects (54 anthracofibrosis and 49 control subjects) who required bronchoscopy for their pulmonary problems. According to bronchoscopic findings, participants were classified to anthracofibrosis and nonanthracotic groups. They were examined for TB with traditional methods such as direct smear (Ziehl-Neelsen staining), Löwenstein-Jensen culture, and histopathology and the new method "PCR" for Mycobacterium tuberculosis genome (IS6110). Age, sex, smoking, and clinical findings were not significantly different in the TB and the non-TB groups. Acid-fast bacilli could be detected by a direct smear in 12 (25%) of the anthracofibrosis subjects, and adding the results of culture and histopathology traditional tests indicated TB in 27 (31%) of the cases. Mycobacterium tuberculosis was diagnosed by PCR in 18 (33%) patients, but the difference was not significant. Detection of acid-fast bacilli in control nonanthracosis subjects was significantly lower (3, 6%), but PCR (20, 40%) and accumulation of results from all traditional methods (22, 44%) showed a nonsignificant difference. The PCR method showed a result equal to traditional methods including accumulation of smear, culture, and histopathology.

  6. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction

    PubMed Central

    Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura

    2016-01-01

    The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii. The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0–86.4%) and the prevalence across the three areas was not significantly different (P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant (P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly (P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area. PMID:27981052

  7. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  8. Cykotine mRNA expression in mouse retina after laser injury by reverse transcriptase-polymerase chain reaction (RT-PCR)

    NASA Astrophysics Data System (ADS)

    Schuschereba, Steven T.; Bowman, Phillip D.; Ujimore, Veronica; Hoxie, Stephen W.; Pizarro, Jose M.; Cross, Michael E.; Lund, David J.

    1996-04-01

    The purpose of this study was to identify cytokines produced by the retina after laser injury. With the aid of a scanning laser ophthalmoscope (SLO), right eyes of mice received lesions from a continuous wave argon laser. Left eyes served as unirradiated controls. At 2, 4, 6, 12, 24, and 48 hr after laser irradiation groups of 3 mice were euthanized and retinas fixed for histology or isolated for RNA. Messenger RNA (mRNA) was reverse-transcribed into complementary DNA (cDNA) and subjected to polymerase chain reaction for the following cytokines: tumor necrosis factor-(alpha) (TNF-(alpha) ), interleukin-1(alpha) /(Beta) (IL- 1(alpha) /(Beta) ), interleukin-6 (IL-6), transforming growth factor-(Beta) 1 (TGF- (Beta) 1), macrophage colony stimulating factor (M-CSF), inducible nitric oxide synthase (iNOS), and glyceraldehyde 3-phosphate dehydrogenase (G3PDH). Histologically, lesions were confined to the photoreceptors, retinal pigment epithelium, and choroid. In laser-injured retinas, mRNA levels were elevated for IL-1(alpha) , TGF-(Beta) 1, iNOS, and G3PDH, but not TNF-(alpha) , IL-1(Beta) , or IL-6. It appears that the retina, in response to laser injury, upregulates a select number of cytokines in a time-course dependent fashion.

  9. Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction.

    PubMed

    Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun

    2012-10-01

    Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction.

    PubMed

    Mose, John Mokua; Kagira, John Maina; Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura; Maina, Naomi Wangari

    2016-01-01

    The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii . The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0-86.4%) and the prevalence across the three areas was not significantly different ( P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant ( P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly ( P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area.

  11. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

  12. [Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

    PubMed

    Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

    2016-02-01

    Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

  13. The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

    PubMed

    Nadin-Davis, S A; Huang, W; Wandeler, A I

    1996-03-01

    Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

  14. Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

    PubMed

    Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

    2013-06-01

    Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

  15. The Collaborative Ocular Tuberculosis Study (COTS)-1 Report 3: Polymerase Chain Reaction in the Diagnosis and Management of Tubercular Uveitis: Global Trends.

    PubMed

    Agarwal, Aniruddha; Agrawal, Rupesh; Gunasekaran, Dinesh Visva; Raje, Dhananjay; Gupta, Bhaskar; Aggarwal, Kanika; Murthy, Somasheila L; Westcott, Mark; Chee, Soon Phaik; Mccluskey, Peter; Su Ling, Ho; Teoh, Stephen; Cimino, Luca; Biswas, Jyotirmay; Narain, Shishir; Agarwal, Manisha; Mahendradas, Padmamalini; Khairallah, Moncef; Jones, Nicholas; Tugal-Tutkun, Ilknur; Babu, Kalpana; Basu, Soumayava; Carreño, Ester; Lee, Richard; Al-Dhibi, Hassan; Bodaghi, Bahram; Invernizzi, Alessandro; Goldstein, Debra A; Herbort, Carl P; Barisani-Asenbauer, Talin; González-López, Julio J; Androudi, Sofia; Bansal, Reema; Moharana, Bruttendu; Mahajan, Sarakshi; Esposti, Simona; Tasiopoulou, Anastasia; Nadarajah, Sengal; Agarwal, Mamta; Abraham, Sharanya; Vala, Ruchi; Singh, Ramandeep; Sharma, Aman; Sharma, Kusum; Zierhut, Manfred; Kon, Onn Min; Cunningham, Emmett; Nguyen, Quan Dong; Pavesio, Carlos; Gupta, Vishali

    2017-12-20

    To analyze the role of polymerase chain reaction (PCR) of ocular fluids in management of tubercular (TB) anterior, intermediate, posterior, and panuveitis. In Collaborative Ocular Tuberculosis Study (COTS)-1 (25 centers, n = 962), patients with TB-related uveitis were included. 59 patients undergoing PCR of intraocular fluids (18 females; 53 Asian Indians) were included. 59 (6.13%) of COTS-1 underwent PCR analysis. PCR was positive for Mycobacterium TB in 33 patients (23 males; all Asian Indians). 26 patients were PCR negative (18 males). Eight patients with negative PCR had systemic TB. Anti-TB therapy was given in 18 negative and 31 PCR cases. At 1-year follow-up, five patients with positive PCR (15.15%) and three with negative PCR (11.54%) had persistence/worsening of inflammation. Data from COTS-1 suggest that PCR is not commonly done for diagnosing intraocular TB and positive/negative results may not influence management or treatment outcomes in the real world scenario.

  16. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  17. Detection of hepatitis C virus RNA using ligation-dependent polymerase chain reaction in formalin-fixed, paraffin-embedded liver tissues.

    PubMed Central

    Park, Y. N.; Abe, K.; Li, H.; Hsuih, T.; Thung, S. N.; Zhang, D. Y.

    1996-01-01

    Reverse transcription polymerase chain reaction (RT-PCR) has been used to detect hepatitis C virus (HCV) sequences in liver tissue. However, RT-PCR has a variable detection sensitivity, especially on routinely processed formalin-fixed, paraffin-embedded (FFPE) specimens. RNA-RNA and RNA-protein cross-links formed during formalin fixation is the major limiting factor preventing reverse trans criptase from extending the primers. To overcome this problem, we applied the ligation-dependent PCR (LD-PCR) for the detection of HCV RNA in FFPE liver tissue. This method uses two capture probes for RNA isolation and two hemiprobes for the subsequent PCR. Despite cross-links, the capture probes and the hemiprobes are able to form hybrids with HCV RNAs released from the FFPE tissue. The hybrids are isolated through binding of the capture probes to paramagnetic beads. The hemiprobes are then ligated by a T4 DNA ligase to form a full probe that serves as a template for the Taq DNA polymerase. A total of 22 FFPE liver specimens, 21 with hepatocellular carcinoma (HCC) and 1 with biliary cirrhosis secondary to bile duct atresia were selected for this study, of which 13 patients were HCV seropositive and 9 seronegative. HCV RNA was detectable by ID-PCR from all 13 HCV-seropositive HCCs and from 5 of 8 HCV-seronegative HCCs but not from the HCV-seronegative liver with biliary atresia. By contrast, RT-PCR detected HCV sequences in only 5 of the HCV-sero-positive and in 1 of the HCV-seronegative HCCs. To resolve the discordance between the LD-PCR and RT-PCR results, RT-PCR was performed on frozen liver tissue of the discrepant specimens, which confirmed the LD-PCR positive results. In conclusion, LD-PCR is a more sensitive method than RT-PCR for the detection of HCV sequences in routinely processed liver tissues. A high rate of HCV infection (86%) is found in HCC specimens, indicating a previously underestimated role of HCV in HCC pathogenesis. Images Figure 2 PMID:8909238

  18. Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

    PubMed

    Treff, Nathan R; Scott, Richard T

    2013-03-15

    Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  19. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    PubMed

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  20. Simultaneous detection and differentiation of three Potyviridae viruses by a multiplex TaqMan real time RT-PCR assay

    USDA-ARS?s Scientific Manuscript database

    A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay w...