Clinical evaluation of a quantitative real time polymerase chain reaction assay for diagnosis of primary Epstein-Barr virus infection in children.

PubMed

Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M

2003-08-01

Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all

A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

PubMed

Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

2007-07-01

In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

Quantification of rice brown leaf spot through Taqman real-time PCR specific to the unigene encoding Cochliobolus miyabeanus SCYTALONE DEHYDRATASE1 involved in fungal melanin biosynthesis.

PubMed

Su'udi, Mukhamad; Park, Jong-Mi; Kang, Woo-Ri; Park, Sang-Ryeol; Hwang, Duk-Ju; Ahn, Il-Pyung

2012-12-01

Rice brown leaf spot is a major disease in the rice paddy field. The causal agent Cochliobolus miyabeanus is an ascomycete fungus and a representative necrotrophic pathogen in the investigation of rice-microbe interactions. The aims of this research were to identify a quantitative evaluation method to determine the amount of C. miyabeanus proliferation in planta and determine the method's sensitivity. Real-time polymerase chain reaction (PCR) was employed in combination with the primer pair and Taqman probe specific to CmSCD1, a C. miyabeanus unigene encoding SCYTALONE DEHYDRATASE, which is involved in fungal melanin biosynthesis. Comparative analysis of the nucleotide sequences of CmSCD1 from Korean strains with those from the Japanese and Taiwanese strains revealed some sequence differences. Based on the crossing point (CP) values from Taqman real-time PCR containing a series of increasing concentrations of cloned amplicon or fungal genomic DNA, linear regressions with a high level of reliability (R(2)>0.997) were constructed. This system was able to estimate fungal genomic DNA at the picogram level. The reliability of this equation was further confirmed using DNA samples from both resistant and susceptible cultivars infected with C. miyabeanus. In summary, our quantitative system is a powerful alternative in brown leaf spot forecasting and in the consistent evaluation of disease progression.

Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*

PubMed Central

Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

2011-01-01

The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID

Detection of Food Allergens by Taqman Real-Time PCR Methodology.

PubMed

García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel

2017-01-01

Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.

Comparative evaluation of new TaqMan real-time assays for the detection of hepatitis A virus.

PubMed

Houde, Alain; Guévremont, Evelyne; Poitras, Elyse; Leblanc, Danielle; Ward, Pierre; Simard, Carole; Trottier, Yvon-Louis

2007-03-01

Three novel real-time TaqMan RT-PCR assays targeting the 5'-UTR, the viral protease and the viral polymerase regions of the hepatitis A virus (HAV) were developed, evaluated and compared against a new published 5'-UTR TaqMan assay (JN) and a widely used conventional RT-PCR assay (HAVc). All conventional RT-PCR (HAV, SH-Prot and SH-Poly systems) and TaqMan (SH-Prot, SH-Poly, JN and SH-5U systems) assays evaluated were consistent for the detection of the three different HAV strains (HM-175, HAS-15 and LSH/S) used and reproducible for both RNA duplicates with the exception of two reproducibility discrepancies observed with both 5'-UTR real-time systems (JN and SH-5U). Limits of detection for conventional HAV, SH-Prot and SH-Poly RT-PCR systems were found to be equivalent when tested with serially diluted suspensions of the HM-175 strain. Although the four real-time RT-PCR TaqMan assays evaluated herein produced similar and consistent quantification data down to the level of one genomic equivalent copy with their respectively cloned amplicons, significant and important differences were observed for the detection of HAV genomic RNA. Results showed that the new real-time TaqMan SH-Poly and SH-Prot primer and probe systems were more consistent and sensitive by 5 logs as compared to both 5'-UTR designs (JN and SH-5U) used for the detection of HAV genomic RNA as well as for the detection in cell culture by cytopathic effect. Considering their higher analytical sensitivity, the proposed SH-Poly and SH-Prot amplification systems could therefore represent valuable tools for the detection of HAV in clinical, environmental and food samples.

Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

PubMed

Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

2013-07-01

Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Concordance of HIV-1 RNA Values by Amplicor and TaqMan 2.0 in Patients With Confirmed Suppression in Clinical Trials

PubMed Central

Garner, Will; White, Kirsten; Szwarcberg, Javier; McCallister, Scott; Zhong, Lijie; Wulfsohn, Mike

2016-01-01

Background. The COBAS AMPLICOR HIV-1 MONITOR Test, version 1.5 (Amplicor) has been replaced with the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, version 2.0 (TaqMan 2.0), a real-time polymerase chain reaction human immunodeficiency virus type 1 (HIV-1) assay with higher sensitivity and broader dynamic range. HIV-1 RNA values at the 50 copies/mL cutoff drive major patient management decisions and clinical study outcomes. Methods. A total of 2217 samples were collected from 1922 HIV-1–infected subjects taking antiretroviral therapy for at least 48 weeks and had at least 2 consecutive samples with HIV-1 RNA <50 copies/mL by Amplicor from 7 recent clinical trials. HIV-1 RNA results were obtained from the Amplicor and TaqMan 2.0 assays in parallel by a reference laboratory. Results. The overall concordance between assay results was 96% at the cutoff of 50 copies/mL. However, statistically significant discordance at the 50 copies/mL cutoff was found between the assays for 3.9% of samples (n = 87). By TaqMan 2.0, virologic failure defined as HIV-1 RNA ≥50 copies/mL was reported for 2.8% more samples than Amplicor. Of these 87 samples, 68 samples fell within the predicted range of assay variability. Retesting of HIV-1 RNA by TaqMan 2.0 confirmed the discordance in only 28 of the 87 samples. Conclusions. The TaqMan 2.0 assay reports fewer subjects below the clinical endpoint of HIV-1 RNA <50 copies/mL in HIV clinical trials than the Amplicor assay. This difference must be considered when assessing disease progression, designing clinical trials, and comparisons with historical trials that used the Amplicor assay. PMID:26689956

Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

PubMed

Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

2015-09-01

Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3  CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0  CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.

A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

PubMed

Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

2013-12-27

Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

PubMed

Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

2010-08-01

A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

USGS Publications Warehouse

Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

2013-01-01

The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

PubMed

Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

2015-04-15

Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

One step screening of retroviral producer clones by real time quantitative PCR.

PubMed

Towers, G J; Stockholm, D; Labrousse-Najburg, V; Carlier, F; Danos, O; Pagès, J C

1999-01-01

Recombinant retroviruses are obtained from either stably or transiently transfected retrovirus producer cells. In the case of stably producing lines, a large number of clones must be screened in order to select the one with the highest titre. The multi-step selection of high titre producing clones is time consuming and expensive. We have taken advantage of retroviral endogenous reverse transcription to develop a quantitative PCR assay on crude supernatant from producing clones. We used Taqman PCR technology, which, by using fluorescence measurement at each cycle of amplification, allows PCR product quantification. Fluorescence results from specific degradation of a probe oligonucleotide by the Taq polymerase 3'-5' exonuclease activity. Primers and probe sequences were chosen to anneal to the viral strong stop species, which is the first DNA molecule synthesised during reverse transcription. The protocol consists of a single real time PCR, using as template filtered viral supernatant without any other pre-treatment. We show that the primers and probe described allow quantitation of serially diluted plasmid to as few as 15 plasmid molecules. We then test 200 GFP-expressing retroviral-producing clones either by FACS analysis of infected cells or by using the quantitative PCR. We confirm that the Taqman protocol allows the detection of virus in supernatant and selection of high titre clones. Furthermore, we can determine infectious titre by quantitative PCR on genomic DNA from infected cells, using an additional set of primers and probe to albumin to normalise for the genomic copy number. We demonstrate that real time quantitative PCR can be used as a powerful and reliable single step, high throughput screen for high titre retroviral producer clones.

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

TaqMan RT-PCR and VERSANT HIV-1 RNA 3.0 (bDNA) assay Quantification of HIV-1 RNA viral load in breast milk.

PubMed

Israel-Ballard, Kiersten; Ziermann, Rainer; Leutenegger, Christian; Di Canzio, James; Leung, Kimmy; Strom, Lynn; Abrams, Barbara; Chantry, Caroline

2005-12-01

Transmission of HIV via breast milk is a primary cause of pediatric HIV infection in developing countries. Reliable methods to detect breast milk viral load are important. To correlate the ability of the VERSANT HIV 3.0 (bDNA) assay to real-time (RT) TaqMan PCR in quantifying breast milk HIV-1 RNA. Forty-six breast milk samples that had been spiked with cell-free HIV-1 and eight samples spiked with cell-associated HIV-1 were assayed for HIV-1 RNA by both VERSANT HIV 3.0 and TaqMan RNA assays. Only assays on the cell-free samples were statistically compared. Both a Deming regression slope and a Bland-Altman slope indicated a linear relationship between the two assays. TaqMan quantitations were on average 2.6 times higher than those of HIV 3.0. A linear relationship was observed between serial dilutions of spiked cell-free HIV-1 and both the VERSANT HIV 3.0 and the TaqMan RNA assays. The two methods correlated well although the VERSANT HIV 3.0 research protocol quantified HIV-1 RNA slightly lower than TaqMan.

New design, development, and optimization of an in-house quantitative TaqMan Real-time PCR assay for HIV-1 viral load measurement.

PubMed

Noorbazargan, Hassan; Nadji, Seyed Alireza; Samiee, Siamak Mirab; Paryan, Mahdi; Mohammadi-Yeganeh, Samira

2018-04-01

Background Viral load measurement is commonly applicable to monitor HIV infection in patients to determine the number of HIV-RNA in serum samples of individuals. The aim of the present study was to set up a highly specific, sensitive, and reproducible home-brewed Real-time PCR assay based on TaqMan chemistry to quantify HIV-1 RNA genome. Methods In this study, three sets of primer pairs and a TaqMan probe were designed for HIV subtypes conserved sequences. An internal control was included in this assay to evaluate the presence of inhibition. Standard curve and threshold cycle values were determined using in vitro transcribed RNA from int region of HIV-1. A serial dilution of RNA standards was generated by in vitro transcription, from 10 to 10 9 copies/ml to find the sensitivity and the limit of detection (LOD) of the assay and to evaluate its performance in a quantitative RT-PCR assay. Results The assay has a low LOD equivalent to 33.13 copies/ml of HIV-1 RNA and a linear range of detection from 10 to 10 9 copies/ml. The coefficient of variation (CV) for Inter and Intra-assay precision of this in-house HIV Real-time RT-PCR ranged from 0.28 to 2.49% and 0.72 to 4.47%, respectively. The analytical and clinical specificity was 100%. Conclusions The results indicate that the developed method has a suitable specificity and sensitivity and is highly reproducible and cost-benefit. Therefore, it will be useful to monitor HIV infection in plasma samples of individuals.

Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

Treesearch

Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

2013-01-01

The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

Development of a real-time quantitative PCR assay to enumerate Yersinia pestis in fleas.

PubMed

Gabitzsch, Elizabeth S; Vera-Tudela, Rommelle; Eisen, Rebecca J; Bearden, Scott W; Gage, Kenneth L; Zeidner, Nordin S

2008-07-01

A real-time quantitative polymerase chain reaction (qPCR) assay was developed for Yersina pestis. The qPCR assay was developed utilizing a conserved region of the Y. pestis ferric iron uptake regulator gene (fur) to design primers and a fluorescent (FAM-labeled) TaqMan probe. The assay was optimized using cultured Y. pestis (UG05-0454) and was confirmed to work with strains from 3 Y. pestis biovars. The optimized assay was capable of detecting a single organism of cultured Y. pestis and as little as 300 bacteria in infected flea triturates. This qPCR assay enables rapid enumeration of Y. pestis bacterium in laboratory-infected fleas when compared with conventional serial dilution plating.

Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.

PubMed

Peng, Xiujuan; Nguyen, Alex; Ghosh, Debadyuti

2018-02-01

TaqMan and SYBR Green quantitative PCR (qPCR) methods were developed as DNA-based approaches to reproducibly enumerate M13 and T7 phages from phage display selection experiments individually and simultaneously. The genome copies of M13 and T7 phages were quantified by TaqMan or SYBR Green qPCR referenced against M13 and T7 DNA standard curves of known concentrations. TaqMan qPCR was capable of quantifying M13 and T7 phage DNA simultaneously with a detection range of 2.75*10 1 -2.75*10 8 genome copies(gc)/μL and 2.66*10 1 -2.66*10 8 genome copies(gc)/μL respectively. TaqMan qPCR demonstrated an efficient amplification efficiency (E s ) of 0.97 and 0.90 for M13 and T7 phage DNA, respectively. SYBR Green qPCR was ten-fold more sensitive than TaqMan qPCR, able to quantify 2.75-2.75*10 7 gc/μL and 2.66*10 1 -2.66*10 7 gc/μL of M13 and T7 phage DNA, with an amplification efficiency E s of 1.06 and 0.78, respectively. Due to its superior sensitivity, SYBR Green qPCR was used to enumerate M13 and T7 phage display clones selected against a cell line, and quantified titers demonstrated accuracy comparable to titers from traditional double-layer plaque assay. Compared to enzyme linked immunosorbent assay, both qPCR methods exhibited increased detection sensitivity and reproducibility. These qPCR methods are reproducible, sensitive, and time-saving to determine their titers and to quantify a large number of phage samples individually or simultaneously, thus avoiding the need for time-intensive double-layer plaque assay. These findings highlight the attractiveness of qPCR for phage enumeration for applications ranging from selection to next-generation sequencing (NGS). Copyright © 2017 Elsevier B.V. All rights reserved.

Clinical evaluation of the COBAS Ampliprep/COBAS TaqMan for HCV RNA quantitation in comparison with the branched-DNA assay.

PubMed

Pittaluga, Fabrizia; Allice, Tiziano; Abate, Maria Lorena; Ciancio, Alessia; Cerutti, Francesco; Varetto, Silvia; Colucci, Giuseppe; Smedile, Antonina; Ghisetti, Valeria

2008-02-01

Diagnosis and monitoring of HCV infection relies on sensitive and accurate HCV RNA detection and quantitation. The performance of the COBAS AmpliPrep/COBAS TaqMan 48 (CAP/CTM) (Roche, Branchburg, NJ), a fully automated, real-time PCR HCV RNA quantitative test was assessed and compared with the branched-DNA (bDNA) assay. Clinical evaluation on 576 specimens obtained from patients with chronic hepatitis C showed a good correlation (r = 0.893) between the two test, but the CAP/CTM scored higher HCV RNA titers than the bDNA across all viral genotypes. The mean bDNA versus CAP/CTM log10 IU/ml differences were -0.49, -0.4, -0.54, -0.26 for genotype 1a, 1b, 2a/2c, 3a, and 4, respectively. These differences reached statistical significance for genotypes 1b, 2a/c, and 3a. The ability of the CAP/CTM to monitor patients undergoing antiviral therapy and correctly identify the weeks 4 and 12 rapid and early virological responses was confirmed. The broader dynamic range of the CAP/CTM compared with the bDNA allowed for a better definition of viral kinetics. In conclusion, the CAP/CTM appears as a reliable and user-friendly assay to monitor HCV viremia during treatment of patients with chronic hepatitis. Its high sensitivity and wide dynamic range may help a better definition of viral load changes during antiviral therapy. (Copyright) 2007 Wiley-Liss, Inc.

[Quantitative PCR in the diagnosis of Leishmania].

PubMed

Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C

2004-06-01

fluorescent dsDNA intercalator and it is applicable to all potential targets. TaqMan technology is more specific since performs the direct assessment of the amount of amplified DNA using a fluorescent probe specific for the target sequence flanked by the primer pair. This probe is an oligonucleotide labelled with a reporter dye (fluorescent) and a quencher (which absorbs the fluorescent signal generated by the reporter). The thermic protocol of amplification allows the binding of the fluorescent probe to the target sequence before the binding of the primers and the starting of the polymerization by Taq polymerase. During polymerization, 5'-3' exonuclease activity of Taq polymerase digests the probe and in this way the reporter dye is released from the probe and a fluorescent signal is detected. The intensity of the signal accumulates at the end of each cycle and is related to the amount of the amplification product. In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of Leishmania in mouse liver, mouse skin and human peripheral blood, targeting either single-copy chromosomal or multi-copy minicircle sequences with high sensitivity and reproducibility. In particular, real-time PCR seems to be a reliable, rapid and noninvasive method for the diagnosis and follow up of visceral leishmaniasis in humans. At present, the application of real-time PCR for research and clinical diagnosis of Leishmania infection in dogs is still foreseable. As for standard PCR, the high sensitivity of real-time PCR could allow the use of blood sampling that is less invasive and easily performed for monitoring the status of the dogs. The development of a real-time PCR assay for Leishmania infantum infection in dogs could support the standard and optimized serological and PCR methods currenly in use for the diagnosis and follow-up of canine leishmaniasis, and perhaps prediction of recurrences associated with tissue loads of

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Development of SYBR Green and TaqMan quantitative real-time PCR assays for hepatopancreatic parvovirus (HPV) infecting Penaeus monodon in India.

PubMed

Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V

2015-12-01

Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

PubMed

Ito, Takao; Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

PubMed Central

Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

The development of a real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay using TaqMan technology for the pan detection of bluetongue virus (BTV).

PubMed

Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John

2017-07-01

Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Real-time quantitative PCR for retrovirus-like particle quantification in CHO cell culture.

PubMed

de Wit, C; Fautz, C; Xu, Y

2000-09-01

Chinese hamster ovary (CHO) cells have been widely used to manufacture recombinant proteins intended for human therapeutic uses. Retrovirus-like particles, which are apparently defective and non-infectious, have been detected in all CHO cells by electron microscopy (EM). To assure viral safety of CHO cell-derived biologicals, quantification of retrovirus-like particles in production cell culture and demonstration of sufficient elimination of such retrovirus-like particles by the down-stream purification process are required for product market registration worldwide. EM, with a detection limit of 1x10(6) particles/ml, is the standard retrovirus-like particle quantification method. The whole process, which requires a large amount of sample (3-6 litres), is labour intensive, time consuming, expensive, and subject to significant assay variability. In this paper, a novel real-time quantitative PCR assay (TaqMan assay) has been developed for the quantification of retrovirus-like particles. Each retrovirus particle contains two copies of the viral genomic particle RNA (pRNA) molecule. Therefore, quantification of retrovirus particles can be achieved by quantifying the pRNA copy number, i.e. every two copies of retroviral pRNA is equivalent to one retrovirus-like particle. The TaqMan assay takes advantage of the 5'-->3' exonuclease activity of Taq DNA polymerase and utilizes the PRISM 7700 Sequence Detection System of PE Applied Biosystems (Foster City, CA, U.S.A.) for automated pRNA quantification through a dual-labelled fluorogenic probe. The TaqMan quantification technique is highly comparable to the EM analysis. In addition, it offers significant advantages over the EM analysis, such as a higher sensitivity of less than 600 particles/ml, greater accuracy and reliability, higher sample throughput, more flexibility and lower cost. Therefore, the TaqMan assay should be used as a substitute for EM analysis for retrovirus-like particle quantification in CHO cell

TaqMan DNA technology confirms likely overestimation of cod (Gadus morhua L.) egg abundance in the Irish Sea: implications for the assessment of the cod stock and mapping of spawning areas using egg-based methods.

PubMed

Fox, C J; Taylor, M I; Pereyra, R; Villasana, M I; Rico, C

2005-03-01

Recent substantial declines in northeastern Atlantic cod stocks necessitate improved biological knowledge and the development of techniques to complement standard stock assessment methods (which largely depend on accurate commercial catch data). In 2003, an ichthyoplankton survey was undertaken in the Irish Sea and subsamples of 'cod-like' eggs were analysed using a TaqMan multiplex, PCR (polymerase chain reaction) assay (with specific probes for cod, haddock and whiting). The TaqMan method was readily applied to the large number of samples (n = 2770) generated during the survey and when combined with a manual DNA extraction protocol had a low failure rate of 6%. Of the early stage 'cod-like' eggs (1.2-1.75 mm diameter) positively identified: 34% were cod, 8% haddock and 58% whiting. As previous stock estimates based on egg surveys for Irish Sea cod assumed that the majority of 'cod-like' eggs were from cod, the TaqMan results confirm that there was probably substantial contamination by eggs of whiting and haddock that would have inflated estimates of the stock biomass.

Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

PubMed

Pegels, N; González, I; Fernández, S; García, T; Martín, R

2012-01-01

A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

PubMed

Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

2017-01-01

In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

Rapid quantitative detection of chytridiomycosis (Batrachochytrium dendrobatidis) in amphibian samples using real-time Taqman PCR assay.

PubMed

Boyle, D G; Boyle, D B; Olsen, V; Morgan, J A T; Hyatt, A D

2004-08-09

Batrachochytrium dendrobatidis is a major pathogen of frogs worldwide, associated with declines in amphibian populations. Diagnosis of chytridiomycosis to date has largely relied upon histological and immunohistochemical examination of toe clips. This technique is invasive and insensitive particularly at early stages of infection when treatment may be possible. We have developed a real-time PCR Taqman assay that can accurately detect and quantify one zoospore in a diagnostic sample. This assay will assist the early detection of B. dendrobatidis in both captive and wild populations, with a high degree of sensitivity and specificity, thus facilitating treatment and protection of endangered populations, monitoring of pristine environments and preventing further global spread via amphibian trade.

Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

PubMed Central

Richards-Kortum, Rebecca

2015-01-01

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest. PMID:25867513

Development of a quantitative recombinase polymerase amplification assay with an internal positive control.

PubMed

Crannell, Zachary A; Rohrman, Brittany; Richards-Kortum, Rebecca

2015-03-30

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

PubMed

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

PubMed

Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

2018-05-01

Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.

PubMed

Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E

2009-06-01

To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.

Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman(®) real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay.

PubMed

Röder, Martin; Vieths, Stefan; Holzhauser, Thomas

2011-01-24

Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg(-1) almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg(-1). We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman(®) probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg(-1) almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg(-1). Further, between 100 and 100,000 mg kg(-1) spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman(®) real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n=5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and

Detection of minute virus of mice using real time quantitative PCR in assessment of virus clearance during the purification of Mammalian cell substrate derived biotherapeutics.

PubMed

Zhan, Dejin; Roy, Margaret R; Valera, Christine; Cardenas, Jesse; Vennari, Joann C; Chen, Janice W; Liu, Shengjiang

2002-12-01

A real time quantitative PCR assay has been developed for detecting minute virus of mice (MVM). This assay directly quantifies PCR product by monitoring the increase of fluorescence intensity emitted during enzymatic hydrolysis of an oligonucleotide probe labelled covalently with fluorescent reporting and quenching dyes via Taq polymerase 5'-->3' exonuclease activity. The quantity of MVM DNA molecules in the samples was determined using a known amount of MVM standard control DNA fragment cloned into a plasmid (pCR-MVM). We have demonstrated that MVM TaqMan PCR assay is approximately 1000-fold more sensitive than the microplate infectivity assay with the lowest detection limit of approximately one particle per reaction. The reliable detection range is within 100 to 10(9) molecules per reaction with high reproducibility. The intra assay variation is <2.5%, and the inter assays variation is <6.5% when samples contain >100 particles/assay. When we applied the TaqMan PCR to MVM clearance studies done by column chromatography or normal flow viral filtration, we found that the virus removal factors were similar to that of virus infectivity assay. It takes about a day to complete entire assay processes, thus, the TaqMan PCR assay is at least 10-fold faster than the infectivity assay. Therefore, we concluded that this fast, specific, sensitive, and robust assay could replace the infectivity assay for virus clearance evaluation. Copyright 2002 The International Association for Biologicals. Published by Elsevier Science Ltd. All rights reserved.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

TaqMan PCR for Detection of Vibrio cholerae O1, O139, Non-O1, and Non-O139 in Pure Cultures, Raw Oysters, and Synthetic Seawater†

PubMed Central

Lyon, W. J.

2001-01-01

Vibrio cholerae is recognized as a leading human waterborne pathogen. Traditional diagnostic testing for Vibrio is not always reliable, because this bacterium can enter a viable but nonculturable state. Therefore, nucleic acid-based tests have emerged as a useful alternative to traditional enrichment testing. In this article, a TaqMan PCR assay is presented for quantitative detection of V. cholerae in pure cultures, oysters, and synthetic seawater. Primers and probe were designed from the nonclassical hemolysin (hlyA) sequence of V. cholerae strains. This probe was applied to DNA from 60 bacterial strains comprising 21 genera. The TaqMan PCR assay was positive for all of the strains of V. cholerae tested and negative for all other species of Vibrio tested. In addition, none of the other genera tested was amplified with the TaqMan primers and probe used in this study. The results of the TaqMan PCR with raw oysters and spiked with V. cholerae serotypes O1 and O139 were comparable to those of pure cultures. The sensitivity of the assay was in the range of 6 to 8 CFU g−1 and 10 CFU ml−1 in spiked raw oyster and synthetic seawater samples, respectively. The total assay could be completed in 3 h. Quantification of the Vibrio cells was linear over at least 6 log units. The TaqMan probe and primer set developed in this study can be used as a rapid screening tool for the presence of V. cholerae in oysters and seawater without prior isolation and characterization of the bacteria by traditional microbiological methods. PMID:11571173

New approach to real-time nucleic acids detection: folding polymerase chain reaction amplicons into a secondary structure to improve cleavage of Förster resonance energy transfer probes in 5′-nuclease assays

PubMed Central

Kutyavin, Igor V.

2010-01-01

The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection

Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR.

PubMed

Liu, Ya-Mei; Qiu, Liang; Sheng, An-Zhi; Wan, Xiao-Yuan; Cheng, Dong-Yuan; Huang, Jie

2018-01-01

A TaqMan probe and a pair of specific primers were selected from the small subunit ribosomal DNA (SSU rDNA) sequence of Enterocytozoon hepatopenaei (EHP); this real-time PCR assay was developed and optimized. It showed a good linearity in detecting standards of EHP SSU rDNA fragments from 4 × 10 2 to 4 × 10 8 copies/reaction using the established method. The detection limit of the qPCR method was as low as 4 × 10 1 copies per reaction, which was higher than the conventional PCR and SYBR Green I-based EHP qPCR reported. Using the qPCR assay, EHP was detected in four batches of slow-growing Penaeus vannamei specimens collected from Tianjin and Zhejiang Province in China was detected using qPCR. The results showed that all the hepatopancreas from the slow-growing P. vannamei specimens were detected as EHP-positive. EHP copies of hepatopancreas in some batches had a negative correlation with the body mass index (BMI) of shrimps; however, not all batches of specimens had this negative correlation between EHP copies of hepatopancreas and BMI. This qPCR technique is sensitive, specific and easy to perform (96 tests in <3 h), which provides technical support for the detection and prevention of EHP. Copyright © 2017 Elsevier Inc. All rights reserved.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

Application of TaqMan fluorescent probe-based quantitative real-time PCR assay for the environmental survey of Legionella spp. and Legionella pneumophila in drinking water reservoirs in Taiwan.

PubMed

Kao, Po-Min; Hsu, Bing-Mu; Hsu, Tsui-Kang; Ji, Wen-Tsai; Huang, Po-Hsiang; Hsueh, Chih-Jen; Chiang, Chuen-Sheue; Huang, Shih-Wei; Huang, Yu-Li

2014-08-15

In this study, TaqMan fluorescent quantitative real-time PCR was performed to quantify Legionella species in reservoirs. Water samples were collected from 19 main reservoirs in Taiwan, and 12 (63.2%) were found to contain Legionella spp. The identified species included uncultured Legionella spp., L. pneumophila, L. jordanis, and L. drancourtii. The concentrations of Legionella spp. and L. pneumophila in the water samples were in the range of 1.8×10(2)-2.6×10(3) and 1.6×10(2)-2.4×10(2) cells/L, respectively. The presence and absence of Legionella spp. in the reservoir differed significantly in pH values. These results highlight the importance that L. pneumophila, L. jordanis, and L. drancourtii are potential pathogens in the reservoirs. The presence of L. pneumophila in reservoirs may be a potential public health concern that must be further examined. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation of sensitivity of TaqMan RT-PCR for rubella virus detection in clinical specimens.

PubMed

Okamoto, Kiyoko; Mori, Yoshio; Komagome, Rika; Nagano, Hideki; Miyoshi, Masahiro; Okano, Motohiko; Aoki, Yoko; Ogura, Atsushi; Hotta, Chiemi; Ogawa, Tomoko; Saikusa, Miwako; Kodama, Hiroe; Yasui, Yoshihiro; Minagawa, Hiroko; Kurata, Takako; Kanbayashi, Daiki; Kase, Tetsuo; Murata, Sachiko; Shirabe, Komei; Hamasaki, Mitsuhiro; Kato, Takashi; Otsuki, Noriyuki; Sakata, Masafumi; Komase, Katsuhiro; Takeda, Makoto

2016-07-01

An easy and reliable assay for detection of the rubella virus is required to strengthen rubella surveillance. Although a TaqMan RT-PCR assay for detection of the rubella virus has been established in Japan, its utility for diagnostic purposes has not been tested. To allow introduction of the TaqMan RT-PCR into the rubella surveillance system in Japan, the sensitivity of the assay was determined using representative strains for all genotypes and clinical specimens. The detection limits of the method for individual genotypes were examined using viral RNA extracted from 13 representative strains. The assay was also tested at 10 prefectural laboratories in Japan, designated as local reference laboratories for measles and rubella, to allow nationwide application of the assay. The detection limits and amplification efficiencies of the assay were similar among all the representative strains of the 13 genotypes. The TaqMan RT-PCR could detect approximately 90% of throat swab and urine samples taken up to 5days of illness. These samples were determined positive by a highly sensitive nested RT-PCR. The TaqMan RT-PCR could detect at least 10 pfu of rubella virus. Although the sensitivity was somewhat lower than that of the conventional nested RT-PCR, the TaqMan RT-PCR could be more practical to routine tests for rubella laboratory diagnosis and detection in view of the rapid response and reducing risks of contamination. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of TaqMan assays for the quantitative detection of Fusarium avenaceum/Fusarium tricinctum and Fusarium poae esyn1 genotypes from cereal grain.

PubMed

Kulik, Tomasz; Jestoi, Marika; Okorski, Adam

2011-01-01

Fungi of the genus Fusarium are important plant pathogens and contaminants of cereal grains producing different types of mycotoxins. Enniatins are a group of mycotoxins with ionophoric properties frequently detected in North European grains. Within the Fusarium complex responsible for grain infection, Fusarium avenaceum, Fusarium poae and Fusarium tricinctum are the most potential enniatins producers. This study presents the development of two quantitative TaqMan MGB (Minor Groove Binder) assays for the specific quantification of F. avenaceum/F. tricinctum and F. poae esyn1 genotypes, respectively. Two sets of genotype-specific primers/probes were designed on the basis of esyn1 gene homologues encoding multifunctional enzyme enniatin synthetase. The specificity of the assays developed has been tested successfully on 111 Fusarium isolates from different geographical origins. The detection limits for F. avenaceum/F. tricinctum esyn1 genotype and F. poae genotype were 19 and 0.3 pg, respectively. The application of the assays developed on asymptomatic wheat grain samples revealed significant positive correlations between the enniatins levels and the amount of F. avenaceum/F. tricinctum esyn1 genotype (R=0.61) and F. poae esyn1 genotype (R=0.42). © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

PubMed

Hamlet, Stephen M

2010-01-01

The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

PubMed

Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

2015-03-01

A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

PubMed

Glenney, Gavin W; Barbash, Patricia A; Coll, John A

2016-03-01

Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015.

Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

PubMed

Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

2017-03-01

The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

PubMed

Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

2009-11-25

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

High sensitivity detection and quantitation of DNA copy number and single nucleotide variants with single color droplet digital PCR.

PubMed

Miotke, Laura; Lau, Billy T; Rumma, Rowza T; Ji, Hanlee P

2014-03-04

In this study, we present a highly customizable method for quantifying copy number and point mutations utilizing a single-color, droplet digital PCR platform. Droplet digital polymerase chain reaction (ddPCR) is rapidly replacing real-time quantitative PCR (qRT-PCR) as an efficient method of independent DNA quantification. Compared to quantative PCR, ddPCR eliminates the needs for traditional standards; instead, it measures target and reference DNA within the same well. The applications for ddPCR are widespread including targeted quantitation of genetic aberrations, which is commonly achieved with a two-color fluorescent oligonucleotide probe (TaqMan) design. However, the overall cost and need for optimization can be greatly reduced with an alternative method of distinguishing between target and reference products using the nonspecific DNA binding properties of EvaGreen (EG) dye. By manipulating the length of the target and reference amplicons, we can distinguish between their fluorescent signals and quantify each independently. We demonstrate the effectiveness of this method by examining copy number in the proto-oncogene FLT3 and the common V600E point mutation in BRAF. Using a series of well-characterized control samples and cancer cell lines, we confirmed the accuracy of our method in quantifying mutation percentage and integer value copy number changes. As another novel feature, our assay was able to detect a mutation comprising less than 1% of an otherwise wild-type sample, as well as copy number changes from cancers even in the context of significant dilution with normal DNA. This flexible and cost-effective method of independent DNA quantification proves to be a robust alternative to the commercialized TaqMan assay.

Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

PubMed

Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

2002-01-01

Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

Application of quantitative real-time PCR compared to filtration methods for the enumeration of Escherichia coli in surface waters within Vietnam.

PubMed

Vital, Pierangeli G; Van Ha, Nguyen Thi; Tuyet, Le Thi Hong; Widmer, Kenneth W

2017-02-01

Surface water samples in Vietnam were collected from the Saigon River, rural and suburban canals, and urban runoff canals in Ho Chi Minh City, Vietnam, and were processed to enumerate Escherichia coli. Quantification was done through membrane filtration and quantitative real-time polymerase chain reaction (PCR). Mean log colony-forming unit (CFU)/100 ml E. coli counts in the dry season for river/suburban canals and urban canals were log 2.8 and 3.7, respectively, using a membrane filtration method, while using Taqman quantitative real-time PCR they were log 2.4 and 2.8 for river/suburban canals and urban canals, respectively. For the wet season, data determined by the membrane filtration method in river/suburban canals and urban canals samples had mean counts of log 3.7 and 4.1, respectively. While mean log CFU/100 ml counts in the wet season using quantitative PCR were log 3 and 2, respectively. Additionally, the urban canal samples were significantly lower than those determined by conventional culture methods for the wet season. These results show that while quantitative real-time PCR can be used to determine levels of fecal indicator bacteria in surface waters, there are some limitations to its application and it may be impacted by sources of runoff based on surveyed samples.

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

Development of a Real-Time, TaqMan Reverse Transcription-PCR Assay for Detection and Differentiation of Lyssavirus Genotypes 1, 5, and 6

PubMed Central

Wakeley, P. R.; Johnson, N.; McElhinney, L. M.; Marston, D.; Sawyer, J.; Fooks, A. R.

2005-01-01

Several reverse transcription-PCR (RT-PCR) methods have been reported for the detection of rabies and rabies-related viruses. These methods invariably involve multiple transfers of nucleic acids between different tubes, with the risk of contamination leading to the production of false-positive results. Here we describe a single, closed-tube, nonnested RT-PCR with TaqMan technology that distinguishes between classical rabies virus (genotype 1) and European bat lyssaviruses 1 and 2 (genotypes 5 and 6) in real time. The TaqMan assay is rapid, sensitive, and specific and allows for the genotyping of unknown isolates concomitant with the RT-PCR. The assay can be applied quantitatively and the use of an internal control enables the quality of the isolated template to be assessed. Despite sequence heterogeneity in the N gene between the different genotypes, a universal forward and reverse primer set has been designed, allowing for the simplification of previously described assays. We propose that within a geographically constrained area, this assay will be a useful tool for the detection and differentiation of members of the Lyssavirus genus. PMID:15956398

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

PubMed

Lo, Yat-Tung; Shaw, Pang-Chui

2017-10-25

Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

PubMed

Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

2015-11-01

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

Evaluation of TaqMan qPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay

PubMed Central

Nagy, Alexander; Vitásková, Eliška; Černíková, Lenka; Křivda, Vlastimil; Jiřincová, Helena; Sedlák, Kamil; Horníčková, Jitka; Havlíčková, Martina

2017-01-01

Ongoing evolution of viral pathogens is a significant issue in diagnostic virology employing TaqMan qPCR/RT-qPCR. Specific concerns are related to false negativity due to probe binding failure. One option for compensating for such deficiency is to integrate a second identically labelled probe in the assay. However, how this alteration influences the reaction parameters has not been comprehensively demonstrated. In the present study, we evaluate a TaqMan protocol using two identically labelled hydrolysis probes (simple, LNA (locked-nucleic-acid)) and MGB (minor-groove-binder) modified probes and combinations thereof in a single assay. Our results based on a synthetic amplicon suggest that the second probe does not compromise the TaqMan qPCR/RT-qPCR parameters, which repeatedly and reproducibly remained comparable to those of the corresponding single-probe assays, irrespective of the relative probe orientation, whether opposite or tandem, and probe modifications or combinations thereof. On the other hand, the second probe additively contributed to the overall fluorescence signal. The utility of the dual-probe approach was demonstrated on practical examples by using field specimens. We hope that the present study might serve as a theoretical basis for the development or improvement of TaqMan qPCR/RT-qPCR assays for the detection of highly variable nucleic acid templates. PMID:28120891

Quantification of Human Polyomaviruses JC Virus and BK Virus by TaqMan Quantitative PCR and Comparison to Other Water Quality Indicators in Water and Fecal Samples▿

PubMed Central

McQuaig, Shannon M.; Scott, Troy M.; Lukasik, Jerzy O.; Paul, John H.; Harwood, Valerie J.

2009-01-01

In the United States, total maximum daily load standards for bodies of water that do not meet bacterial water quality standards are set by each state. The presence of human polyomaviruses (HPyVs) can be used as an indicator of human-associated sewage pollution in these waters. We have developed and optimized a TaqMan quantitative PCR (QPCR) assay based on the conserved T antigen to both quantify and simultaneously detect two HPyVs; JC virus and BK virus. The QPCR assay was able to consistently quantify ≥10 gene copies per reaction and is linear over 5 orders of magnitude. HPyVs were consistently detected in human waste samples (57 of 64) and environmental waters with known human fecal contamination (5 of 5) and were not amplified in DNA extracted from 127 animal waste samples from 14 species. HPyV concentrations in sewage decreased 81.2 and 84.2% over 28 days incubation at 25 and 35°C, respectively. HPyVs results were compared to Escherichia coli, fecal coliform, and enterococci concentrations and the presence of three other human-associated microbes: Bacteroidetes, Methanobrevibacter smithii, and adenovirus. HPyVs were the most frequently detected of these in human and contaminated environmental samples and were more human specific than the Bacteroidetes (HF183) or M. smithii. HPyVs and M. smithii more closely mimicked the persistence of adenovirus in sewage than the other microbes. The use of this rapid and quantitative assay in water quality research could help regulatory agencies to identify sources of water pollution for improved remediation of contaminated waters and ultimately protect humans from exposure to pathogens. PMID:19346361

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

PubMed Central

2005-01-01

Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

PubMed

Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

2011-09-01

To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

PubMed

Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

2005-09-01

1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-30

Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

PubMed

Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

2016-01-01

Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

T.I.M.S: TaqMan Information Management System, tools to organize data flow in a genotyping laboratory

PubMed Central

Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico

2005-01-01

Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298

Quantitative detection method for Roundup Ready soybean in food using duplex real-time PCR MGB chemistry.

PubMed

Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson

2010-07-01

Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.

EVALUATION OF RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

EPA Science Inventory

Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan (trademark)) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glab...

Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations.

PubMed

Teh, L-K; Lee, T-Y; Tan, J A M A; Lai, M-I; George, E

2015-02-01

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations. Genotype identification of common β-thalassaemia mutations in Malays was carried out using Taqman genotyping assays. Results show that the Taqman assays allow mutation detection with DNA template concentrations as low as 2-100 ng. In addition, consistent reproducibility was observed in the Taqman assays when repeated eight times and at different time intervals. The developed sensitive Taqman assays allow molecular characterization of β-thalassaemia mutations in samples with low DNA concentrations. The Taqman genotyping assays have potential as a diagnostic tool for foetal blood, chorionic villi or pre-implantation genetic diagnosis where DNA is limited and precious. © 2014 John Wiley & Sons Ltd.

A new TaqMan method for the reliable diagnosis of Ehrlichia spp. in canine whole blood.

PubMed

Thomson, Kirsty; Yaaran, Tal; Belshaw, Alex; Curson, Lucia; Tisi, Laurence; Maurice, Sarah; Kiddle, Guy

2018-06-18

Ehrlichiosis is an important emerging infectious disease of the canid family and humans worldwide. To date, no extensive evaluation or validation of a molecular diagnostic test for ehrlichiosis has been published. Here, we present data for a newly designed TaqMan assay and compare its performance to a commercial technology (PCRun®). Both of these real-time methods of analysis were evaluated using a comprehensive number of prospective and retrospective samples collected from dogs exhibiting symptoms of ehrlichiosis. Whole blood samples collected from dogs, retrospectively in the United Kingdom and prospectively in Israel, were analysed for the presence of Ehrlichia canis and Ehrlichia minasensis DNA using the TaqMan PCR, developed specifically for this study. The results were compared to those of a real time commercial isothermal amplification method (PCRun® system developed by Biogal Galed Labs ACS, Galed, Israel). The sensitivity and specificity (CI: 95%) of the TaqMan PCR and PCRun® were both determined to be 100% and absolute, for all of the samples tested. Interestingly, both tests were demonstrated to be highly comparable, irrespective of differences in amplification chemistry or sequences targeted. Host differences, incidence of disease and geographical location of the isolates had little impact on the positivity recorded by each of the diagnostic methods. It was evident that both amplification methods were equally suited for diagnosing canine ehrlichiosis and while the PCRun® clearly amplified all clinically relevant Ehrlichia species known to infect dogs and humans, the TaqMan method was more specific for E. canis and E. minasensis. This work demonstrates that despite good analytical sensitivities and specificities for Ehrlichia spp. neither method could fully account for the clinical diagnosis of thrombocytopenia.

EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

EPA Science Inventory

Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Development and validation of quantitative PCR for detection of Terrapene herpesvirus 1 utilizing free-ranging eastern box turtles (Terrapene carolina carolina).

PubMed

Kane, Lauren P; Bunick, David; Abd-Eldaim, Mohamed; Dzhaman, Elena; Allender, Matthew C

2016-06-01

Diseases that affect the upper respiratory tract (URT) in chelonians have been well described as a significant contributor of morbidity and mortality. Specifically, herpesviruses are common pathogens in captive chelonians worldwide, but their importance on free-ranging populations is less well known. Historical methods for the diagnosis of herpesvirus infections include virus isolation and conventional PCR. Real-time PCR has become an essential tool for detection and quantitation of many pathogens, but has not yet been developed for herpesviruses in box turtles. Two quantitative real-time TaqMan PCR assays, TerHV58 and TerHV64, were developed targeting the DNA polymerase gene of Terrapene herpesvirus 1 (TerHV1). The assay detected a viral DNA segment cloned within a plasmid with 10-fold serial dilutions from 1.04 × 10(7) to 1.04 × 10(1) viral copies per reaction. Even though both primers had acceptable levels of efficiency and variation, TerHV58 was utilized to test clinical samples based on less variation and increased efficiency. This assay detected as few as 10 viral copies per reaction and should be utilized in free-ranging and captive box turtles to aid in the characterization of the epidemiology of this disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

PubMed

Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

2004-01-01

In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement

qSR: a quantitative super-resolution analysis tool reveals the cell-cycle dependent organization of RNA Polymerase I in live human cells.

PubMed

Andrews, J O; Conway, W; Cho, W -K; Narayanan, A; Spille, J -H; Jayanth, N; Inoue, T; Mullen, S; Thaler, J; Cissé, I I

2018-05-09

We present qSR, an analytical tool for the quantitative analysis of single molecule based super-resolution data. The software is created as an open-source platform integrating multiple algorithms for rigorous spatial and temporal characterizations of protein clusters in super-resolution data of living cells. First, we illustrate qSR using a sample live cell data of RNA Polymerase II (Pol II) as an example of highly dynamic sub-diffractive clusters. Then we utilize qSR to investigate the organization and dynamics of endogenous RNA Polymerase I (Pol I) in live human cells, throughout the cell cycle. Our analysis reveals a previously uncharacterized transient clustering of Pol I. Both stable and transient populations of Pol I clusters co-exist in individual living cells, and their relative fraction vary during cell cycle, in a manner correlating with global gene expression. Thus, qSR serves to facilitate the study of protein organization and dynamics with very high spatial and temporal resolutions directly in live cell.

Comparison of allelic discrimination by dHPLC, HRM, and TaqMan in the detection of BRAF mutation V600E.

PubMed

Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo

2011-09-01

The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

MeltMan: Optimization, Evaluation, and Universal Application of a qPCR System Integrating the TaqMan qPCR and Melting Analysis into a Single Assay

PubMed Central

Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina

2016-01-01

In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

PubMed

Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

2016-12-01

Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

PubMed

Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

2014-01-01

The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

PubMed Central

Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

2014-01-01

The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

PubMed

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Real-time quantitative polymerase chain reaction analysis of patients with refractory chronic periodontitis.

PubMed

Marconcini, Simone; Covani, Ugo; Barone, Antonio; Vittorio, Orazio; Curcio, Michele; Barbuti, Serena; Scatena, Fabrizio; Felli, Lamberto; Nicolini, Claudio

2011-07-01

Periodontitis is a complex multifactorial disease and is typically polygenic in origin. Genes play a fundamental part in each biologic process forming complex networks of interactions. However, only some genes have a high number of interactions with other genes in the network and may, therefore, be considered to play an important role. In a preliminary bioinformatic analysis, five genes that showed a higher number of interactions were identified and termed leader genes. In the present study, we use real-time quantitative polymerase chain reaction (PCR) technology to evaluate the expression levels of leader genes in the leukocytes of 10 patients with refractory chronic periodontitis and compare the expression levels with those of the same genes in 24 healthy patients. Blood was collected from 24 healthy human subjects and 10 patients with refractory chronic periodontitis and placed into heparinized blood collection tubes by personnel trained in phlebotomy using a sterile technique. Blood leukocyte cells were immediately lysed by using a kit for total RNA purification from human whole blood. Complementary DNA (cDNA) synthesis was obtained from total RNA and then real-time quantitative PCR was performed. PCR efficiencies were calculated with a relative standard curve derived from a five cDNA dilution series in triplicate that gave regression coefficients >0.98 and efficiencies >96%. The standard curves were obtained using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and growth factor receptor binding protein 2 (GRB2), casitas B-lineage lymphoma (CBL), nuclear factor-KB1 (NFKB1), and REL-A (gene for transcription factor p65) gene primers and amplified with 1.6, 8, 40, 200, and 1,000 ng/μL total cDNA. Curves obtained for each sample showed a linear relationship between RNA concentrations and the cycle threshold value of real-time quantitative PCR for all genes. Data were expressed as mean ± SE (SEM). The groups were compared to the analysis of variance. A

Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

NASA Astrophysics Data System (ADS)

Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

1992-04-01

Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

PubMed Central

Dinoop, K.P.; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R.P.; Narayanan, P.

2016-01-01

Background & objectives: Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Methods: Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. Results: In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated (P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the

Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

PubMed

Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

2016-01-01

Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

PubMed

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction.

PubMed

Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C

2000-09-01

The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.

Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

PubMed

Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

2002-10-15

Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

Sperm count and motility are quantitatively affected by functional polymorphisms of HTR2A, MAOA and SLC18A.

PubMed

Cortés-Rodriguez, Miriam; Royo, Jose-Luis; Reyes-Palomares, Arturo; Lendínez, Ana M; Ruiz-Galdón, Maximiliano; Reyes-Engel, Armando

2018-05-01

Spermatozoa and neurones share similar membrane characteristics and features. Associations of multiple polymorphisms traditionally related to neurotransmission were investigated. Infertile men were grouped into controls with normospermia (n = 182) and idiopathic infertile men with asthenozoospermia (n = 103), and analysed as a case-control study and as a quantitative association of each genotype. Ten neurotransmission-associated genetic variants were mapped by SNP analysis using quantitative polymerase chain reaction with TaqMan probes. Men with HTR2A rs6313 had a higher risk of asthenozoospermia (OR = 2.14; P = 0.04). MAOA rs3788862 G carriers displayed an increased risk of asthenozoospermia (OR = 2.29; P = 0.02). The SLC18A1 rs1390938 G allele was more frequent among such cases (0.75 versus 0.87; P < 0.01 and P < 0.01 for Armitage trend test); for SLC18A1 rs2270641 P = 0.02 (case-control frequency) and P = 0.01 (Armitage trend test). MAOA rs3788862 was correlated with sperm motility (Spearman ρ = 0.14; P = 0.02); SLC18A1 rs1390938 was correlated with sperm count and motility (Spearman ρ = 0.20; P < 0.01). Gene polymorphisms of HTR2A, MAOA and SLC18A1, related to neurotransmission, are individually associated with asthenozoospermia through variation in sperm count and motility, without detectable allelic or genotype interaction. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

A sensitive one-step TaqMan amplification approach for detection of rubella virus clade I and II genotypes in clinical samples.

PubMed

Claus, C; Bergs, S; Emmrich, N C; Hübschen, J M; Mankertz, A; Liebert, U G

2017-02-01

Although teratogenic rubella virus (RV) causes a vaccine-preventable disease, it is still endemic in several countries worldwide. Thus, there is a constant risk of RV importation into non-endemic areas. RV monitoring, especially during measles and Zika virus outbreaks, requires reliable diagnostic tools. For this study, a TaqMan-based one-step reverse transcription-quantitative PCR (RT-qPCR) assay, with the p90 gene as a novel and so far unexplored target for detection of clade I and II genotypes, was developed and evaluated. Automated nucleic acid extraction was carried out. Performance characteristics of the TaqMan RT-qPCR assay were determined for a RV plasmid standard and RNA extracted from virus-infected cell culture supernatants representing clade I and II genotypes. Diagnostic specificity and sensitivity were validated against other RNA and DNA viruses, relevant for RV diagnostic approaches and for RV-positive clinical samples, respectively. The assay is specific and highly sensitive with a limit of detection as low as five to one copies per reaction or 200 infectious virus particles per ml. The coefficients of variation (CV) were specified as intra- (within one run) and inter- (between different runs) assay variation, and calculated based on the standard deviations for the obtained Ct values of the respective samples. Intra- and inter-assay CV values were low, with a maximum of 3.4% and 2.4%, respectively. The assay was shown to be suitable and specific for the analysis of clinical samples. With p90 as a novel target, the highly sensitive and specific TaqMan assay outlined in this study is suitable for RV diagnosis worldwide.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

PubMed Central

Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

2011-01-01

Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Detection of Legionella by cultivation and quantitative real-time polymerase chain reaction in biological waste water treatment plants in Norway.

PubMed

Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase

2014-09-01

Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.

A novel duplex real time quantitative reverse transcription polymerase chain reaction for rubella virus with armored RNA as a noncompetitive internal positive control.

PubMed

Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping

2015-07-01

The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.

Role of disulfide bridges in archaeal family-B DNA polymerases.

PubMed

Killelea, Tom; Connolly, Bernard A

2011-06-14

The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of reference gene suitability for quantitative expression analysis by quantitative polymerase chain reaction in the mandibular condyle of sheep.

PubMed

Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin

2015-10-01

Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.

Design and Development of a Quantitative TaqMan Real-Time PCR Assay for Evaluation of HIV-1 (group M) Viral Load in Plasma Using Armored RNA Standard.

PubMed

Gholami, Mohammad; Baesi, Kazem; Rouzbahani, Negin H; Mohraz, Minoo

2018-06-01

Human immunodeficiency virus-1 (HIV-1) is a viral infectious agent that gradually extinguishes the immune system, resulting in the acquired immune deficiency syndrome (AIDS). The aim of this study was to develop a TaqMan based detection assay to evaluate HIV-1 plasma viral load and to construct a stable internal positive control (IPC) and external positive control (EPC) RNA based on Armored RNA (AR) technology. The MS2 maturase, coat protein gene and HIV-1 pol gene were cloned in pET-32a plasmid. The recently fabricated recombinant plasmid was transformed into Escherichia coli strain BL2 (DE3) and protein expression and Armored RNA was fabricated in presence of isopropyl-L-thio-D-galactopyranoside (IPTG). The Armored RNA was precipitated and purified by polyethylene glycol (PEG) and sephacryl S-200 chromatography. The stability of Armored RNA was evaluated by treatment with DNase I and RNase A and confirmed by transmission electron microscopy (TEM) and gel agarose electrophoresis. The specificity, sensitivity, inter- and intra-day precision, and the dynamic range of the assay were experimentally determined. The AR was stable in presence of ribonuclease, and the assay had a dynamic detection range from 101 to 105 copies of AR. The coefficient of variation (CV) was 4.8% for intra-assay and 5.8% for inter-assay precision. Clinical specificity and sensitivity of the assay were assessed at 100% and 96.66%, respectively. The linear regression analysis confirmed a high correlation between the in-house and the commercial assay, Real Star HIV-1-qRTPCR, respectively (R2 = 0.888). The AR standard is non-infectious and highly resistant in the presence of ribonuclease. The TaqMan assay developed is able to quantify HIV viral load based on a novel conserved region of HIV-1 pol gene which has minimal sequence inconsistency.

A New Diagnostic system for Ultra Sensitive and Specific Detection and Quantitation of “Candidatus Liberibacter asiaticus”, the Bacterium Associated with Citrus Huanglongbing

USDA-ARS?s Scientific Manuscript database

In this study, an ultra sensitive and quantitative diagnostic system for “Candidatus Liberibacter asiaticus” was developed. This system adapts a nested PCR and Taq-Man PCR in a single closed tube. The procedure involves two steps of PCR using the species specific outer and inner primer pairs. Differ...

Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

2009-08-01

A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection.

PubMed

Buh Gasparic, Meti; Tengs, Torstein; La Paz, Jose Luis; Holst-Jensen, Arne; Pla, Maria; Esteve, Teresa; Zel, Jana; Gruden, Kristina

2010-03-01

Several techniques have been developed for detection and quantification of genetically modified organisms, but quantitative real-time PCR is by far the most popular approach. Among the most commonly used real-time PCR chemistries are TaqMan probes and SYBR green, but many other detection chemistries have also been developed. Because their performance has never been compared systematically, here we present an extensive evaluation of some promising chemistries: sequence-unspecific DNA labeling dyes (SYBR green), primer-based technologies (AmpliFluor, Plexor, Lux primers), and techniques involving double-labeled probes, comprising hybridization (molecular beacon) and hydrolysis (TaqMan, CPT, LNA, and MGB) probes, based on recently published experimental data. For each of the detection chemistries assays were included targeting selected loci. Real-time PCR chemistries were subsequently compared for their efficiency in PCR amplification and limits of detection and quantification. The overall applicability of the chemistries was evaluated, adding practicability and cost issues to the performance characteristics. None of the chemistries seemed to be significantly better than any other, but certain features favor LNA and MGB technology as good alternatives to TaqMan in quantification assays. SYBR green and molecular beacon assays can perform equally well but may need more optimization prior to use.

Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

DOE PAGES

McInerney, Peter; Adams, Paul; Hadi, Masood Z.

2014-01-01

As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

PubMed

Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

2016-11-01

Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

Quantitative polymerase chain reaction for transforming growth factor-β applied to a field study of fish health in Chesapeake Bay tributaries

USGS Publications Warehouse

Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.

2000-01-01

Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.

Detection of nucleophosmin 1 mutations by quantitative real-time polymerase chain reaction versus capillary electrophoresis: a comparative study.

PubMed

Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang

2011-08-01

Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

PubMed

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

Factors affecting the relationship between quantitative polymerase chain reaction (qPCR) and culture-based enumeration of Enterococcus in environmental waters.

PubMed

Raith, M R; Ebentier, D L; Cao, Y; Griffith, J F; Weisberg, S B

2014-03-01

To determine the extent to which discrepancies between qPCR and culture-based results in beach water quality monitoring can be attributed to: (i) within-method variability, (ii) between-method difference within each method class (qPCR or culture) and (iii) between-class difference. We analysed 306 samples using two culture-based (EPA1600 and Enterolert) and two qPCR (Taqman and Scorpion) methods, each in duplicate. Both qPCR methods correlated with EPA1600, but regression analyses indicated approximately 0·8 log10 unit overestimation by qPCR compared to culture methods. Differences between methods within a class were less than half of this and were minimal for between-replicate within a method. Using the 104 Enterococcus per 100 ml management decision threshold, Taqman qPCR indicated the same decisions as EPA1600 for 87% of the samples, but indicated beach posting for unhealthful water when EPA1600 did not for 12% of the samples. After accounting for within-method and within-class variability, 8% of the samples exhibited true between-class discrepancy where both qPCR methods indicated beach posting while both culture methods did not. Measurement target difference (DNA vs growth) accounted for the majority of the qPCR-vs-culture discrepancy, but its influence on monitoring application is outweighed by frequent incorrect posting with culture methods due to incubation time delay. This is the first study to quantify the frequency with which culture-vs-qPCR discrepancies can be attributed to target difference - vs - method variability. © 2013 The Society for Applied Microbiology.

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

PubMed

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-10-04

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

PubMed Central

Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

2009-01-01

Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases

PubMed Central

Su, Yan; Guengerich, F. Peter

2016-01-01

Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

PubMed Central

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-01-01

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

PubMed

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

PubMed

Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-05-27

This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

PubMed

Wang, Li-Ping; Lei, Kun

2016-12-01

Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

Quantitative polymerase chain reaction detection of circulating DNA in serum for early diagnosis of mucormycosis in immunocompromised patients.

PubMed

Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic

2013-05-01

The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.

Real-time quantitative PCR detection of genetically modified Maximizer maize and Roundup Ready soybean in some representative foods.

PubMed

Vaïtilingom, M; Pijnenburg, H; Gendre, F; Brignon, P

1999-12-01

A fast and quantitative method was developed to detect transgenic "Maximizer" maize "event 176" (Novartis) and "Roundup Ready" soybean (Monsanto) in food by real-time quantitative PCR. The use of the ABI Prism 7700 sequence detection system allowed the determination of the amplified product accumulation through a fluorogenic probe (TaqMan). Fluorescent dyes were chosen in such a way as to coamplify total and transgenic DNA in the same tube. Using real-time quantitative PCR, 2 pg of transgenic or total DNA per gram of starting sample was detected in 3 h after DNA extraction and the relative amounts of "Maximizer" maize and "Roundup Ready" soybean in some representative food products were quantified.

Simultaneous detection and differentiation of three Potyviridae viruses by a multiplex TaqMan real time RT-PCR assay

USDA-ARS?s Scientific Manuscript database

A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay w...

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Evaluation of the Aptima HBV Quant assay vs. the COBAS TaqMan HBV test using the high pure system for the quantitation of HBV DNA in plasma and serum samples.

PubMed

Schalasta, Gunnar; Börner, Anna; Speicher, Andrea; Enders, Martin

2018-03-28

Proper management of patients with chronic hepatitis B virus (HBV) infection requires monitoring of plasma or serum HBV DNA levels using a highly sensitive nucleic acid amplification test. Because commercially available assays differ in performance, we compared herein the performance of the Hologic Aptima HBV Quant assay (Aptima) to that of the Roche Cobas TaqMan HBV test for use with the high pure system (HPS/CTM). Assay performance was assessed using HBV reference panels as well as plasma and serum samples from chronically HBV-infected patients. Method correlation, analytical sensitivity, precision/reproducibility, linearity, bias and influence of genotype were evaluated. Data analysis was performed using linear regression, Deming correlation analysis and Bland-Altman analysis. Agreement between the assays for the two reference panels was good, with a difference in assay values vs. target <0.5 log. Qualitative assay results for 159 clinical samples showed good concordance (88.1%; κ=0.75; 95% confidence interval: 0.651-0.845). For the 106 samples quantitated by both assays, viral load results were highly correlated (R=0.92) and differed on average by 0.09 log, with 95.3% of the samples being within the 95% limit of agreement of the assays. Linearity for viral loads 1-7 log was excellent for both assays (R2>0.98). The two assays had similar bias and precision across the different genotypes tested at low viral loads (25-1000 IU/mL). Aptima has a performance comparable with that of HPS/CTM, making it suitable for use for HBV infection monitoring. Aptima runs on a fully automated platform (the Panther system) and therefore offers a significantly improved workflow compared with HPS/CTM.

A comparative evaluation between real time Roche COBas TAQMAN 48 HCV and bDNA Bayer Versant HCV 3.0.

PubMed

Giraldi, Cristina; Noto, Alessandra; Tenuta, Robert; Greco, Francesca; Perugini, Daniela; Spadafora, Mario; Bianco, Anna Maria Lo; Savino, Olga; Natale, Alfonso

2006-10-01

The HCV virus is a common human pathogen made of a single stranded RNA genome with 9600nt. This work compared two different commercial methods used for HCV viral load, the bDNA Bayer Versant HCV 3.0 and the RealTime Roche COBAS TaqMan 48 HCV. We compared the reproducibility and linearity of the two methods. Seventy-five plasma samples with genotypes 1 to 4, which represent the population (45% genotype 1; 24% genotype 2; 13% genotype 3; 18% genotype 4) were directly processed with the Versanto method based upon signal amplification; the same samples were first extracted (COBAS Ampliprep - TNAI) and then amplified using RealTime PCR (COBAS TaqMan 48). The results obtained indicate the same performance for both methods if they have genotype 1, but in samples with genotypes 2, 3 and 4 the RealTime PCR Roche method gave an underestimation in respect to the Bayer bDNA assay.

Quantitative Analysis of the Mutagenic Potential of 1-Aminopyrene-DNA Adduct Bypass Catalyzed by Y-Family DNA Polymerases

PubMed Central

Sherrer, Shanen M.; Taggart, David J.; Pack, Lindsey R.; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

2012-01-01

N- (deoxyguanosin-8-yl)-1-aminopyrene (dGAP) is the predominant nitro polyaromatic hydrocarbon product generated from the air pollutant 1-nitropyrene reacting with DNA. Previous studies have shown that dGAP induces genetic mutations in bacterial and mammalian cells. One potential source of these mutations is the error-prone bypass of dGAP lesions catalyzed by the low-fidelity Y-family DNA polymerases. To provide a comparative analysis of the mutagenic potential of the translesion DNA synthesis (TLS) of dGAP, we employed short oligonucleotide sequencing assays (SOSAs) with the model Y-family DNA polymerase from Sulfolobus solfataricus, DNA Polymerase IV (Dpo4), and the human Y-family DNA polymerases eta (hPolη), kappa (hPolκ), and iota (hPolι). Relative to undamaged DNA, all four enzymes generated far more mutations (base deletions, insertions, and substitutions) with a DNA template containing a site-specifically placed dGAP. Opposite dGAP and at an immediate downstream template position, the most frequent mutations made by the three human enzymes were base deletions and the most frequent base substitutions were dAs for all enzymes. Based on the SOSA data, Dpo4 was the least error-prone Y-family DNA polymerase among the four enzymes during the TLS of dGAP. Among the three human Y-family enzymes, hPolκ made the fewest mutations at all template positions except opposite the lesion site. hPolκ was significantly less error-prone than hPolι and hPolη during the extension of dGAP bypass products. Interestingly, the most frequent mutations created by hPolι at all template positions were base deletions. Although hRev1, the fourth human Y-family enzyme, could not extend dGAP bypass products in our standing start assays, it preferentially incorporated dCTP opposite the bulky lesion. Collectively, these mutagenic profiles suggest that hPolkk and hRev1 are the most suitable human Y-family DNA polymerases to perform TLS of dGAP in humans. PMID:22917544

Usefulness of quantitative polymerase chain reaction in amniotic fluid as early prognostic marker of fetal infection with Toxoplasma gondii.

PubMed

Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane

2004-03-01

Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.

A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

PubMed

Kidd, I M; Clark, D A; Emery, V C

2000-06-01

Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

Defining the Status of RNA Polymerase at Promoters

PubMed Central

Core, Leighton J.; Waterfall, Joshua J.; Gilchrist, Daniel A.; Fargo, David C.; Kwak, Hojoong; Adelman, Karen; Lis, John T.

2012-01-01

Summary Recent genome-wide studies in metazoans have shown that RNA Polymerase II (Pol II) accumulates to high densities on many promoters at a rate-limited step in transcription. However, the status of this Pol II remains an area of debate. Here, we compare quantitative outputs of GRO-seq and ChIP-seq assays and demonstrate the majority of the Pol II on Drosophila promoters is transcriptionally-engaged - very little exists in a preinitiation or arrested complex. These promoter-proximal polymerases are inhibited from further elongation by detergent sensitive factors, and knockdown of negative elongation factor, NELF, reduces their levels. These results not only solidify that pausing occurs at most promoters, but demonstrate that it is the major rate-limiting step in early transcription at these promoters. Finally, the divergent elongation complexes seen at mammalian promoters are far less prevalent in Drosophila, and this specificity in orientation correlates with directional core promoter elements, which are abundant in Drosophila. PMID:23062713

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

TaqMan Real-Time PCR Assays To Assess Arbuscular Mycorrhizal Responses to Field Manipulation of Grassland Biodiversity: Effects of Soil Characteristics, Plant Species Richness, and Functional Traits▿ †

PubMed Central

König, Stephan; Wubet, Tesfaye; Dormann, Carsten F.; Hempel, Stefan; Renker, Carsten; Buscot, François

2010-01-01

Large-scale (temporal and/or spatial) molecular investigations of the diversity and distribution of arbuscular mycorrhizal fungi (AMF) require considerable sampling efforts and high-throughput analysis. To facilitate such efforts, we have developed a TaqMan real-time PCR assay to detect and identify AMF in environmental samples. First, we screened the diversity in clone libraries, generated by nested PCR, of the nuclear ribosomal DNA internal transcribed spacer (ITS) of AMF in environmental samples. We then generated probes and forward primers based on the detected sequences, enabling AMF sequence type-specific detection in TaqMan multiplex real-time PCR assays. In comparisons to conventional clone library screening and Sanger sequencing, the TaqMan assay approach provided similar accuracy but higher sensitivity with cost and time savings. The TaqMan assays were applied to analyze the AMF community composition within plots of a large-scale plant biodiversity manipulation experiment, the Jena Experiment, primarily designed to investigate the interactive effects of plant biodiversity on element cycling and trophic interactions. The results show that environmental variables hierarchically shape AMF communities and that the sequence type spectrum is strongly affected by previous land use and disturbance, which appears to favor disturbance-tolerant members of the genus Glomus. The AMF species richness of disturbance-associated communities can be largely explained by richness of plant species and plant functional groups, while plant productivity and soil parameters appear to have only weak effects on the AMF community. PMID:20418424

Transcriptional bursting is intrinsically caused by interplay between RNA polymerases on DNA

NASA Astrophysics Data System (ADS)

Fujita, Keisuke; Iwaki, Mitsuhiro; Yanagida, Toshio

2016-12-01

Cell-to-cell variability plays a critical role in cellular responses and decision-making in a population, and transcriptional bursting has been broadly studied by experimental and theoretical approaches as the potential source of cell-to-cell variability. Although molecular mechanisms of transcriptional bursting have been proposed, there is little consensus. An unsolved key question is whether transcriptional bursting is intertwined with many transcriptional regulatory factors or is an intrinsic characteristic of RNA polymerase on DNA. Here we design an in vitro single-molecule measurement system to analyse the kinetics of transcriptional bursting. The results indicate that transcriptional bursting is caused by interplay between RNA polymerases on DNA. The kinetics of in vitro transcriptional bursting is quantitatively consistent with the gene-nonspecific kinetics previously observed in noisy gene expression in vivo. Our kinetic analysis based on a cellular automaton model confirms that arrest and rescue by trailing RNA polymerase intrinsically causes transcriptional bursting.

T7-RNA Polymerase

NASA Technical Reports Server (NTRS)

1997-01-01

T7-RNA Polymerase grown on STS-81. Structure-Function Relationships of RNA Polymerase: DNA-dependent RNA polymerase is the key enzyme responsible for the biosynthesis of RNA, a process known as transcription. Principal Investigator's include Dr. Dan Carter, Dr. B.C. Wang, and Dr. John Rose of New Century Pharmaceuticals.

[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

PubMed

Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

2005-07-01

To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

Development of 20 TaqMan assays differentiating the endangered shortnose and Lost River suckers

USGS Publications Warehouse

Hoy, Marshal S.; Ostberg, Carl O.

2015-01-01

Accurate species identification is vital to conservation and management of species at risk. Species identification is challenging when taxa express similar phenotypic characters and form hybrids, for example the endangered shortnose sucker (Chasmistes brevirostris) and Lost River sucker (Deltistes luxatus). Here, we developed 20 Taqman assays that differentiate these species (19 nuclear DNA and one mitochondrial DNA). Assays were evaluated in 160 young-of-the-year identified to species using meristic counts. Alleles were not fixed between species, but species were highly differentiated (F ST = 0.753, P < 0.001). The assays developed herein will be a valuable tool for resource managers.

Fluorescence resonance energy transfer analysis of escherichia coli RNA polymerase and polymerase-DNA complexes.

PubMed

Heyduk, T; Niedziela-Majka, A

Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

PubMed

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Quantitative polymerase chain reaction (PCR) assays for a bacterial thiaminase I gene and the thiaminase-producing bacterium Paenibacillus thiaminolyticus.

USGS Publications Warehouse

Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.

2009-01-01

The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.

Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

PubMed

Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

2008-05-15

Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

High resolution TaqMan real-time PCR approach to detect hazelnut DNA encoding for ITS rDNA in foods.

PubMed

López-Calleja, Inés María; de la Cruz, Silvia; Pegels, Nicolette; González, Isabel; García, Teresa; Martín, Rosario

2013-12-01

A broad range of foods have been described as causing allergies, but the majority of allergic reactions can be ascribed to a limited number of food components. Recent extensive surveys showed how tree nuts, particularly hazelnut (Corylus avellana L.) seeds, rank amongst the most important sources of food allergy. In order to protect the allergic consumer, efficient and reliable methods are required for the detection of allergenic ingredients. For this purpose, we have developed a real-time polymerase chain reaction (PCR) for detection of hazelnut in commercial food products. In this way a specific hazelnut primer pair based on the ITS marker (70 bp) and a nuclease (TaqMan) probe labelled with FAM and BHQ were designed. Sensibility of real-time PCR was determined by analysis of raw and heat treated hazelnut-wheat flour mixtures with a range of detection of 0.1-100,000 ppm. Practical applicability of the real-time PCR assay developed for determining hazelnut in different food matrices was investigated by analyzing 179 commercial foodstuffs comprising snacks, biscuits, chocolates, bonbons, creams, nut bars, ice creams, precooked meals, breads, beverages, yogurts, cereals, meat products, rice cake and nougat. From the total of samples analyzed, 40 commercial food products that didn't declare hazelnut nor traces on the label were found to contain hazelnut. The real-time PCR method proposed herein due to its high sensitivity facilitates the detection of hazelnut traces in commercial food products and can also be useful for monitoring the effectiveness of cleaning processes and as consequence, can help to prevent the food allergic consumer from unintentional ingestion of hidden allergens. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genome shuffling of Saccharomyces cerevisiae for enhanced glutathione yield and relative gene expression analysis using fluorescent quantitation reverse transcription polymerase chain reaction.

PubMed

Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming

2016-08-01

Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation of the Abbott RealTime HCV assay for quantitative detection of hepatitis C virus RNA.

PubMed

Michelin, Birgit D A; Muller, Zsofia; Stelzl, Evelyn; Marth, Egon; Kessler, Harald H

2007-02-01

The Abbott RealTime HCV assay for quantitative detection of HCV RNA has recently been introduced. In this study, the performance of the Abbott RealTime HCV assay was evaluated and compared to the COBAS AmpliPrep/COBAS TaqMan HCV test. Accuracy, linearity, interassay and intra-assay variations were determined, and a total of 243 routine clinical samples were investigated. When accuracy of the new assay was tested, the majority of results were found to be within +/-0.5 log(10) unit of the results obtained by reference laboratories. Determination of linearity resulted in a quasilinear curve up to 1.0 x 10(6)IU/ml. The interassay variation ranged from 15% to 32%, and the intra-assay variation ranged from 5% to 8%. When clinical samples were tested by the Abbott RealTime HCV assay and the results were compared with those obtained by the COBAS AmpliPrep/COBAS TaqMan HCV test, the results for 93% of all samples with positive results by both tests were found to be within +/-1.0 log(10) unit. The viral loads for all patients measured by the Abbott and Roche assays showed a high correlation (R(2)=0.93); quantitative results obtained by the Abbott assay were found to be lower than those obtained by the Roche assay. The Abbott RealTime HCV assay proved to be suitable for use in the routine diagnostic laboratory. The time to results was similar for both of the assays.

mcrA-Targeted Real-Time Quantitative PCR Method To Examine Methanogen Communities▿

PubMed Central

Steinberg, Lisa M.; Regan, John M.

2009-01-01

Methanogens are of great importance in carbon cycling and alternative energy production, but quantitation with culture-based methods is time-consuming and biased against methanogen groups that are difficult to cultivate in a laboratory. For these reasons, methanogens are typically studied through culture-independent molecular techniques. We developed a SYBR green I quantitative PCR (qPCR) assay to quantify total numbers of methyl coenzyme M reductase α-subunit (mcrA) genes. TaqMan probes were also designed to target nine different phylogenetic groups of methanogens in qPCR assays. Total mcrA and mcrA levels of different methanogen phylogenetic groups were determined from six samples: four samples from anaerobic digesters used to treat either primarily cow or pig manure and two aliquots from an acidic peat sample stored at 4°C or 20°C. Only members of the Methanosaetaceae, Methanosarcina, Methanobacteriaceae, and Methanocorpusculaceae and Fen cluster were detected in the environmental samples. The three samples obtained from cow manure digesters were dominated by members of the genus Methanosarcina, whereas the sample from the pig manure digester contained detectable levels of only members of the Methanobacteriaceae. The acidic peat samples were dominated by both Methanosarcina spp. and members of the Fen cluster. In two of the manure digester samples only one methanogen group was detected, but in both of the acidic peat samples and two of the manure digester samples, multiple methanogen groups were detected. The TaqMan qPCR assays were successfully able to determine the environmental abundance of different phylogenetic groups of methanogens, including several groups with few or no cultivated members. PMID:19447957

Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

NASA Astrophysics Data System (ADS)

Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

2015-07-01

The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

Performance of three commercial viral load assays, Versant human immunodeficiency virus type 1 (HIV-1) RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2, testing HIV-1 non-B subtypes and recombinant variants.

PubMed

Holguín, Africa; López, Marisa; Molinero, Mar; Soriano, Vincent

2008-09-01

Monitoring antiretroviral therapy requires that human immunodeficiency virus type 1 (HIV-1) viremia assays are applicable to all distinct variants. This study evaluates the performance of three commercial viral load assays-Versant HIV-1 RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2-in testing 83 plasma specimens from patients carrying HIV-1 non-B subtypes and recombinants previously defined by phylogenetic analysis of the pol gene. All 28 specimens from patients under treatment presented viremia values below the detection limit with the three methods. In the remaining 55 specimens from naive individuals viremia could not be detected in 32.7, 20, and 14.6% using the NucliSens, Versant, or TaqMan tests, respectively, suggesting potential viral load underestimation of some samples by all techniques. Only 32 (58.2%) samples from naive subjects were quantified by the three methods; the NucliSens test provided the highest HIV RNA values (mean, 4.87 log copies/ml), and the Versant test provided the lowest (mean, 4.16 log copies/ml). Viremia differences of greater than 1 log were seen in 8 (14.5%) of 55 specimens, occurring in 10.9, 7.3, and 5.4%, respectively, of the specimens in comparisons of Versant versus NucliSens, Versant versus TaqMan, and TaqMan versus NucliSens. Differences greater than 0.5 log, considered significant for clinicians, occurred in 45.5, 27.3, and 29% when the same assays were compared. Some HIV-1 strains, such as subtype G and CRF02_AG, showed more discrepancies in distinct quantification methods than others. In summary, an adequate design of primers and probes is needed for optimal quantitation of plasma HIV-RNA in non-B subtypes. Our data emphasize the need to use the same method for monitoring patients on therapy and also the convenience of HIV-1 subtyping.

Evaluation of p16 hypermethylation in oral submucous fibrosis: A quantitative and comparative analysis in buccal cells and saliva using real-time methylation-specific polymerase chain reaction.

PubMed

Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian

2016-01-01

The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.

HSP90 and its R2TP/Prefoldin-like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II.

PubMed

Boulon, Séverine; Pradet-Balade, Bérengère; Verheggen, Céline; Molle, Dorothée; Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I; Bertrand, Edouard

2010-09-24

RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. Copyright © 2010 Elsevier Inc. All rights reserved.

HSP90 and Its R2TP/Prefoldin-like Cochaperone Are Involved in the Cytoplasmic Assembly of RNA Polymerase II

PubMed Central

Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I.; Bertrand, Edouard

2015-01-01

SUMMARY RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. PMID:20864038

Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

PubMed

Treff, Nathan R; Scott, Richard T

2013-03-15

Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Challenges in designing a Taqman-based multiplex assay for the simultaneous detection of Herpes simplex virus types 1 and 2 and Varicella-zoster virus.

PubMed

Weidmann, Manfred; Armbruster, Katrin; Hufert, Frank T

2008-08-01

To optimise molecular detection of herpesviruses an internally controlled multiplex Taqman-PCR for the detection of Herpes simplex virus 1 (HSV1), Herpes simplex virus 2 (HSV2) and Varicella-zoster virus (VZV) was developed. The selection of the dye combination working on the ABI 7700 cycler for this multiplex PCR revealed crosstalk phenomena between several combinations of reference dyes and reporter dyes. A final dye combination with CY5 as reference dye and FAM/JOE/TXR as reporter dyes was selected. The influence of the concentration of the internal positive control (IPC) concentration on the quantitative results of HSV1, HSV2 and VZV positive patient samples was analysed. The results indicate that high IPC concentrations are detrimental for the sensitivity of the multiplex assay and that the presence of the IPC molecule narrows the dynamic range of the duplex PCRs between any of the virus PCRs and the IPC-PCR. The optimised multiplex assay detecting HSV1, HSV2 and VZV using 10(3) IPC molecules showed a performance and sensitivity comparable to that of the individual assays.

Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

NASA Astrophysics Data System (ADS)

Miles, Jeff; Formosa, Tim

1992-02-01

We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

Characterization of vitellogenin gene expression in round goby (Neogobius melanostomus) using a quantitative polymerase chain reaction assay.

PubMed

Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y

2010-12-01

A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.

Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells

PubMed Central

Min, Irene M.; Waterfall, Joshua J.; Core, Leighton J.; Munroe, Robert J.; Schimenti, John; Lis, John T.

2011-01-01

Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, “bivalent” ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5′ proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation. PMID:21460038

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

PubMed

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

PubMed Central

Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-01-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

PubMed

Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

2006-08-18

DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

EPA Science Inventory

The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

Rapid identification of tomato Sw-5 resistance-breaking isolates of Tomato spotted wilt virus using high resolution melting and TaqMan SNP Genotyping assays as allelic discrimination techniques.

PubMed

di Rienzo, Valentina; Bubici, Giovanni; Montemurro, Cinzia; Cillo, Fabrizio

2018-01-01

In tomato, resistance to Tomato spotted wilt virus (TSWV) is conferred by the dominant gene, designated Sw-5. Virulent Sw-5 resistance breaking (SRB) mutants of TSWV have been reported on Sw-5 tomato cultivars. Two different PCR-based allelic discrimination techniques, namely Custom TaqMan™ SNP Genotyping and high-resolution melting (HRM) assays, were developed and compared for their ability to distinguish between avirulent (Sw-5 non-infecting, SNI) and SRB biotypes. TaqMan assays proved to be more sensitive (threshold of detection in a range of 50-70 TSWV RNA copies) and more reliable than HRM, assigning 25 TSWV isolates to their correct genotype with an accuracy of 100%. Moreover, the TaqMan SNP assays were further improved developing a rapid and simple protocol that included crude leaf extraction for RNA template preparations. On the other hand, HRM assays showed higher levels of sensitivity than TaqMan when used to co-detect both biotypes in different artificial mixtures. These diagnostic assays contributed to gain preliminary information on the epidemiology of TSWV isolates in open field conditions. In fact, the presented data suggest that SRB isolates are present as stable populations established year round, persisting on both winter (globe artichoke) and summer (tomato) crops, in the same cultivated areas of Southern Italy.

RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

DOEpatents

Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

1991-01-01

SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

A polymerase chain reaction strategy for the diagnosis of camelpox.

PubMed

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

Quantitative real-time polymerase chain reaction for monitoring minimal residual disease in patients with advanced indolent lymphomas treated with rituximab, fludarabine, mitoxantrone, and dexamethasone.

PubMed

Sarris, Andreas H; Jiang, Yunfang; Tsimberidou, Apostolia M; Thomaides, Athanasios; Rassidakis, George Z; Ford, Richard J; Medeiros, L Jeffrey; Cabanillas, Fernando; McLaughlin, Peter

2002-02-01

Fludarabine and rituximab (Rituxan; Genentech, Inc, South San Francisco, CA, and IDEC Pharmaceuticals, San Diego, CA) are active against indolent lymphomas. We have previously shown the safety and efficacy of the combination of FND (fludarabine/mitoxantrone/dexamethasone) in relapsed and subsequently untreated patients with stage IV indolent lymphomas. Currently, we treat patients with stage IV indolent lymphomas who are previously untreated, younger than 60 years, human immunodeficiency virus-negative, and have adequate organ and marrow function with FND and random assignment to concurrent or delayed administration of rituximab. We have developed a quantitative real-time polymerase chain reaction assay for t(14;18). With 1 μg of DNA, this assay detects 0.6 copies in 55% of reactions, as expected for the Poisson distribution. When 1μg of DNA was analyzed in duplicate, cells with the t(14;18) were detected in peripheral blood of 22% of 152 volunteer blood donors. Quantitation showed that numbers of t(14;18) cells were higher than the statistical upper normal limit (mean of all volunteer values plus standard deviations) in 2% of volunteer blood donors. By contrast, 36% of blood or marrow specimens from follicular lymphoma patients were positive, and the number of cells with t(14;18) was higher than the normal upper limit in 26%. The presence of cells with t(14;18) and their numbers are prospectively quantitated in blood and marrow of patients treated with FND plus rituximab to determine their clinical significance both at presentation and during therapy. Semin Oncol 29 (suppl 2):48-55. Copyright © 2002 by W.B. Saunders Company. Copyright © 2002 W.B. Saunders Company. All rights reserved.

Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.

PubMed

Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A

2008-04-01

To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.

Coupling Spore Traps and Quantitative PCR Assays for Detection of the Downy Mildew Pathogens of Spinach (Peronospora effusa) and Beet (P. schachtii)

PubMed Central

Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.

2016-01-01

Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150

The effect of main urine inhibitors on the activity of different DNA polymerases in loop-mediated isothermal amplification.

PubMed

Jevtuševskaja, Jekaterina; Krõlov, Katrin; Tulp, Indrek; Langel, Ülo

2017-04-01

The use of rapid amplification methods to detect pathogens in biological samples is mainly limited by the amount of pathogens present in the sample and the presence of inhibiting substances. Inhibitors can affect the amplification efficiency by either binding to the polymerase, interacting with the DNA, or interacting with the polymerase during primer extension. Amplification is performed using DNA polymerase enzymes and even small changes in their activity can influence the sensitivity and robustness of molecular assays Methods: The main purpose of this research was to examine which compounds present in urine inhibit polymerases with strand displacement activity. To quantify the inhibition, we employed quantitative loop-mediated isothermal amplification Results: The authors found that the presence of BSA, Mg 2+, and urea at physiologically relevant concentrations, as well as acidic or alkaline conditions did not affect the activity of any of the tested polymerases. However, addition of salt significantly affected the activity of the tested polymerases. These findings may aid in the development of more sensitive, robust, cost effective isothermal amplification based molecular assays suitable for both point-of-care testing and on-site screening of pathogens directly from unprocessed urine which avoid the need for long and tedious DNA purification steps prior to amplification.

Quantitative real-time polymerase chain reaction for Streptococcus mutans and Streptococcus sobrinus in dental plaque samples and its association with early childhood caries.

PubMed

Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae

2009-03-01

Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P < 0.05). The proportion of S. sobrinus to S. mutans showed strong correlation to the dmfs scores (r = 0.748, P < 0.05). The qRT-PCR results of this study showed that children with ECC had higher level of S. mutans and S. sobrinus in their dental plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.

Post-Outbreak Investigation of Pseudomonas aeruginosa Faucet Contamination by Quantitative Polymerase Chain Reaction and Environmental Factors Affecting Positivity.

PubMed

Bédard, Emilie; Laferrière, Céline; Charron, Dominique; Lalancette, Cindy; Renaud, Christian; Desmarais, Nadia; Déziel, Eric; Prévost, Michèle

2015-11-01

To perform a post-outbreak prospective study of the Pseudomonas aeruginosa contamination at the faucets (water, aerator and drain) by culture and quantitative polymerase chain reaction (qPCR) and to assess environmental factors influencing occurrence A 450-bed pediatric university hospital in Montreal, Canada Water, aerator swab, and drain swab samples were collected from faucets and analyzed by culture and qPCR for the post-outbreak investigation. Water microbial and physicochemical parameters were measured, and a detailed characterization of the sink environmental and design parameters was performed. The outbreak genotyping investigation identified drains and aerators as the source of infection. The implementation of corrective measures was effective, but post-outbreak sampling using qPCR revealed 50% positivity for P. aeruginosa remaining in the water compared with 7% by culture. P. aeruginosa was recovered in the water, the aerator, and the drain in 21% of sinks. Drain alignment vs the faucet and water microbial quality were significant factors associated with water positivity, whereas P. aeruginosa load in the water was an average of 2 log higher for faucets with a positive aerator. P. aeruginosa contamination in various components of sink environments was still detected several years after the resolution of an outbreak in a pediatric university hospital. Although contamination is often not detectable in water samples by culture, P. aeruginosa is present and can recover its culturability under favorable conditions. The importance of having clear maintenance protocols for water systems, including the drainage components, is highlighted.

Design principles of a microtubule polymerase

PubMed Central

Geyer, Elisabeth A; Miller, Matthew P; Brautigam, Chad A; Biggins, Sue

2018-01-01

Stu2/XMAP215 microtubule polymerases use multiple tubulin-binding TOG domains and a lattice-binding basic region to processively promote faster elongation. How the domain composition and organization of these proteins dictate polymerase activity, end localization, and processivity is unknown. We show that polymerase activity does not require different kinds of TOGs, nor are there strict requirements for how the TOGs are linked. We identify an unexpected antagonism between the tubulin-binding TOGs and the lattice-binding basic region: lattice binding by the basic region is weak when at least two TOGs engage tubulins, strong when TOGs are empty. End-localization of Stu2 requires unpolymerized tubulin, at least two TOGs, and polymerase competence. We propose a ‘ratcheting’ model for processivity: transfer of tubulin from TOGs to the lattice activates the basic region, retaining the polymerase at the end for subsequent rounds of tubulin binding and incorporation. These results clarify design principles of the polymerase. PMID:29897335

Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

PubMed

Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

2014-01-01

Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

PubMed

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Isothermal Method of a Recombinase Polymerase Amplification Assay for the Detection of Most Common High-Risk Human Papillomavirus Type 16 and Type 18 DNA.

PubMed

Ma, Biao; Fang, Jiehong; Wang, Ye; He, Haizhen; Dai, Mingyan; Lin, Wei; Su, Wei; Zhang, Mingzhou

2017-01-01

Cervical cancer is a common gynecologic malignant tumor and has a great impact on women's health. Human papillomavirus (HPV) is implicated in cervical cancer and precancerous lesions and the two are possibly two stages of disease progression. With the technological development of molecular biology and epidemiology, detection and treatment of HPV has become an important means to prevent cervical cancer. Here we present a novel, rapid, sensitive and specific isothermal method of recombinase polymerase amplification (RPA), which is established to detect the two most common high-risk human papillomavirus type 16 and type 18 DNA. In this study, we evaluate the efficacy of the RPA assay, incubating clinical specimens of HPV16 and HPV18 using plasmids standard. It operates at constant low temperature without the thermal instrumentation for incubation. The products can be detected via agarose gel electrophoresis assay, reverse dot blot assay, and quantitative real-time assay with SYBR Green I. We assess the diagnostic performance of the RPA assay for detecting of HPV16 and HPV18 in 335 clinical samples from patients suspected of cervical cancer. The results revealed no cross-reaction with other HPV genotypes and the RPA assay achieve a sensitivity of 100 copies. Compared with TaqMan qPCR, the RPA technique achieves exponential amplification with no need for pretreatment of sample DNA at 37°C for 20 minutes, which reveals more satisfactory performance. The agreement between the RPA and qPCR assays was 97.6% (κ = 0.89) for HPV16 positivity and 98.5% (κ = 0.81) for HPV18 positivity, indicating very good correlation between both tests. Importantly, the RPA assay was demonstrated to be a useful and powerful method for detection of HPV virus, which therefore may serve as a valuable tool for rapid diagnosis of HPV infection in both commercial and clinical applications.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment.

PubMed

Krøjgaard, Louise H; Krogfelt, Karen A; Albrechtsen, Hans-Jørgen; Uldum, Søren A

2011-11-21

Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L) to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila) was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay). Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.

Habitat associations of two entomopathogenic nematodes: a quantitative study using real-time quantitative polymerase chain reactions.

PubMed

Torr, Peter; Spiridonov, Sergei E; Heritage, Stuart; Wilson, Michael J

2007-03-01

1. Despite nematodes being the most abundant animals on earth, very few animal ecologists study them, probably because of the difficulties of identifying them to species by morphological methods. 2. A group of nematodes that are important both ecologically and economically is the entomopathogenic nematodes, which play a key role in regulating soil food webs and are sold throughout the world as biological insecticides, yet for which very little is known of their population ecology. 3. A novel detection and quantification method was developed for soil nematodes using real-time polymerase chain reaction (PCR), and the technique was used to estimate numbers of two closely related species of entomopathogenic nematodes, Steinernema kraussei and S. affine in 50 soil samples from 10 sites in Scotland representing two distinct habitats (woodland and grassland). 4. There was a high degree of correlation between our molecular and traditional morphological estimates of population size and our data clearly showed that Steinernema affine occurred only in grassland areas, whereas S. kraussei was found in grassland and woodland samples to a similar degree. 5. Real-time PCR offers a rapid and accurate method of detecting individual nematode species from soil samples without the need for a specialist taxonomist, and has much potential for use in studies of nematode population ecology.

Development and validation of a real-time TaqMan assay for the detection and enumeration of Pseudomonas fluorescens ATCC 13525 used as a challenge organism in testing of food equipments.

PubMed

Saha, Ratul; Bestervelt, Lorelle L; Donofrio, Robert S

2012-02-01

Pseudomonas fluorescens ATCC 13525 is used as the challenge organism to evaluate the efficacy of the clean-in-place (CIP) process of food equipment (automatic ice-maker) as per NSF/ANSI Standard 12. Traditional culturing methodology is presently used to determine the concentration of the challenge organism, which takes 48 h to confirm the cell density. Storage of the challenge preparation in the refrigerator might alter the cell density as P. fluorescens is capable of growing at 4 °C. Also, background organism can grow on the Pseudomonas F agar (PFA) used for the recovery of P. fluorescens thus affecting the results of the test. Real-time TaqMan assay targeting the cpn60 gene was developed for the enumeration and the identification of P. fluorescens because of its specificity, accuracy, and shorter turnaround time. The TaqMan primer-probe pair developed using the Allele ID® 7.0 probe design software was highly specific and sensitive for the target organism. The sensitivity of the assay was 10 colony forming units (CFU)/mL. The assay was also successful in determining the concentration of the challenge preparation within 2 h. Based on these observations, TaqMan assay targeting the cpn60 gene can be efficiently used for strain level identification and enumeration of bacteria. Pseudomonas fluorescens ATCC 13525 is used as a challenge organism in the efficacy testing of clean-in-place process of food equipments. Currently, culturing technique is used for its identification and estimation, which is not only time-consuming but also prone to error. Real-time TaqMan assay is more specific, sensitive, and accurate along with a shorter turnaround time compared to culturing techniques, thereby increasing the overall quality of the testing methodology to evaluate the clean-in-place process critical for the food industry to protect public health and safety. © 2012 Institute of Food Technologists®

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

PubMed

Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

2015-12-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

Quantitative analysis of pork and chicken products by droplet digital PCR.

PubMed

Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

2014-01-01

In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

Comparison of quantitative real-time polymerase chain reaction with NanoString® methodology using adipose and liver tissues from rats fed seaweed.

PubMed

Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman

2016-05-25

Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

PubMed

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-11

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

PubMed Central

Earl, P L; Jones, E V; Moss, B

1986-01-01

A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524

High-throughput detection and screening of plants modified by gene editing using quantitative real-time polymerase chain reaction.

PubMed

Peng, Cheng; Wang, Hua; Xu, Xiaoli; Wang, Xiaofu; Chen, Xiaoyun; Wei, Wei; Lai, Yongmin; Liu, Guoquan; Godwin, Ian Douglas; Li, Jieqin; Zhang, Ling; Xu, Junfeng

2018-05-15

Gene editing techniques are becoming powerful tools for modifying target genes in organisms. Although several methods have been developed to detect gene-edited organisms, these techniques are time and labour intensive. Meanwhile, few studies have investigated high-throughput detection and screening strategies for plants modified by gene editing. In this study, we developed a simple, sensitive and high-throughput quantitative real-time (qPCR)-based method. The qPCR-based method exploits two differently labelled probes that are placed within one amplicon at the gene editing target site to simultaneously detect the wild-type and a gene-edited mutant. We showed that the qPCR-based method can accurately distinguish CRISPR/Cas9-induced mutants from the wild-type in several different plant species, such as Oryza sativa, Arabidopsis thaliana, Sorghum bicolor, and Zea mays. Moreover, the method can subsequently determine the mutation type by direct sequencing of the qPCR products of mutations due to gene editing. The qPCR-based method is also sufficiently sensitive to distinguish between heterozygous and homozygous mutations in T 0 transgenic plants. In a 384-well plate format, the method enabled the simultaneous analysis of up to 128 samples in three replicates without handling the post-polymerase chain reaction (PCR) products. Thus, we propose that our method is an ideal choice for screening plants modified by gene editing from many candidates in T 0 transgenic plants, which will be widely used in the area of plant gene editing. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

Fusobacterium nucleatum in gastroenterological cancer: Evaluation of measurement methods using quantitative polymerase chain reaction and a literature review.

PubMed

Yamamura, Kensuke; Baba, Yoshifumi; Miyake, Keisuke; Nakamura, Kenichi; Shigaki, Hironobu; Mima, Kosuke; Kurashige, Junji; Ishimoto, Takatsugu; Iwatsuki, Masaaki; Sakamoto, Yasuo; Yamashita, Yoichi; Yoshida, Naoya; Watanabe, Masayuki; Baba, Hideo

2017-12-01

The human microbiome Fusobacterium nucleatum , which primarily inhabits the oral cavity, causes periodontal disease and has also been implicated in the development of colorectal cancer. However, whether F. nucleatum is present in other gastroenterological cancer tissues remains to be elucidated. The present study evaluated whether quantitative polymerase chain reaction (qPCR) assays were able to detect F. nucleatum DNA and measure the quantity of F. nucleatum DNA in esophageal, gastric, pancreatic and liver cancer tissues. The accuracy of the qPCR assay was determined from a calibration curve using DNA extracted from cells from the oral cavity. Formalin-fixed paraffin-embedded (FFPE) tumor tissues from 20 patients with gastroenterological [esophageal (squamous cell carcinoma), gastric, colorectal, pancreatic and liver] cancer and 20 matched normal tissues were evaluated for F. nucleatum DNA content. The cycle threshold values in the qPCR assay for F. nucleatum and solute carrier organic anion transporter family member 2A1 (reference sample) decreased linearly with the quantity of input DNA ( r 2 >0.99). The F. nucleatum detection rate in esophageal, gastric and colorectal cancer tissues were 20% (4/20), 10% (2/20) and 45% (9/20), respectively. F. nucleatum was not detected in liver and pancreatic cancer tissues. The qPCR results from the frozen and FFPE tissues were consistent. Notably, F. nucleatum was detected at a higher level in superficial areas compared with the invasive areas. F. nucleatum in esophageal, gastric and colorectal cancer tissues was evaluated by qPCR using FFPE tissues. F. nucleatum may be involved in the development of esophageal, gastric and colorectal cancer.

Using Reference Quantitative Polymerase Chain Reaction to Assess the Clinical Performance of the Paracheck-Pf® Rapid Diagnostic Test in a Field Setting in Uganda.

PubMed

Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K

2018-06-04

Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.

[A quantitative real time polymerase chain reaction for detection of HBV covalently closed circular DNA in livers of the HBV infected patients].

PubMed

Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui

2011-05-01

To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used

Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods

EPA Science Inventory

Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...

Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

PubMed

Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

2009-12-01

The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

RNA Polymerase in Mumps Virion

PubMed Central

Bernard, Jacqueline P.; Northrop, Robert L.

1974-01-01

Mumps virions of the Enders' strain were examined for polymerase activity in vitro. An RNA-dependent RNA polymerase was found to be associated with the virion. The general properties of the reaction appear to be similar to those described for other paramyxoviruses. PMID:4836602

Detection and quantitation of Kaposi's sarcoma-associated herpesvirus (KSHV) by a single competitive-quantitative polymerase chain reaction.

PubMed

Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella

2003-02-01

Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.

Application of TaqMan qPCR for the detection and monitoring of Naegleria species in reservoirs used as a source for drinking water.

PubMed

Kao, Po-Min; Hsu, Bing-Mu; Hsu, Tsui-Kang; Chiu, Yi-Chou; Chang, Chung-Liang; Ji, Wen-Tsai; Huang, Shih-Wei; Fan, Cheng-Wei

2014-10-01

Naegleria spp. can be found in the natural aquatic environments. Naegleria fowleri can cause fatal infections in the central nervous system in humans and animals, and the most important source of infection is through direct water contact. In this study, PCR of 5.8S ribosomal RNA (rRNA) gene and internal transcribed spacer (ITS) region was performed in order to identify Naegleria isolates and quantify the Naegleria spp. by TaqMan real-time quantitative PCR in reservoir water samples. The occurrence of Naegleria spp. was investigated in 57 water samples from reservoirs with culture and PCR positive in 2 of them (3.5%), respectively. The total detection rate was 7.0% (4/ 57) for Naegleria spp. The identified species included Naegleria spp., Naegleria canariensis, and Naegleria clarki. N. fowleri was not found in Taiwan's reservoirs used for drinking purposes. The concentrations of Naegleria spp. in detected positive reservoir water samples were in the range of 599 and 3.1 × 10(3) cells/L. The presence or absence of Naegleria spp. within the reservoir water samples showed significant difference with the levels of water temperature. The presence of Naegleria spp. in reservoirs considered a potential public health threat if pathogenic species exist in reservoirs.

DNA Polymerase Eta and Chemotherapeutic Agents

PubMed Central

2011-01-01

Abstract The discovery of human DNA polymerase eta (pol η) has a major impact on the fields of DNA replication/repair fields. Since the discovery of human pol η, a number of new DNA polymerases with the ability to bypass various DNA lesions have been discovered. Among these polymerases, pol η is the most extensively studied lesion bypass polymerase with a defined major biological function, that is, to replicate across the cyclobutane pyrimidine dimers introduced by UV irradiation. Cyclobutane pyrimidine dimer is a major DNA lesion that causes distortion of DNA structure and block the replicative DNA polymerases during DNA replication process. Genetic defects in the pol η gene, Rad30, results in a disease called xeroderma pigmentosum variant. This review focuses on the overall properties of pol η and the mechanism that involved in regulating its activity in cells. In addition, the role of pol η in the action of DNA-targeting anticancer compounds is also discussed. Antioxid. Redox Signal. 14, 2521–2529. PMID:21050139

Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

PubMed

Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

2018-05-31

Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

The expanding polymerase universe.

PubMed

Goodman, M F; Tippin, B

2000-11-01

Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

Evaluation of the Cobas TaqMan MTB Test for the Detection of Mycobacterium tuberculosis Complex According to Acid-Fast-Bacillus Smear Grades in Respiratory Specimens

PubMed Central

Huh, Hee Jae; Koh, Won-Jung; Song, Dong Joon

2014-01-01

We evaluated the performance of the Cobas TaqMan MTB test (Roche Diagnostics, Basel, Switzerland), stratified by acid-fast bacilli (AFB) smear grades. The sensitivity of this test in smear-positive specimens was >95% in all grades, while that in trace and negative specimens was 85.3% and 34.4%, respectively. PMID:25428157

Comparative Diagnosis of Human Bocavirus 1 Respiratory Infection With Messenger RNA Reverse-Transcription Polymerase Chain Reaction (PCR), DNA Quantitative PCR, and Serology.

PubMed

Xu, Man; Arku, Benedict; Jartti, Tuomas; Koskinen, Janne; Peltola, Ville; Hedman, Klaus; Söderlund-Venermo, Maria

2017-05-15

Human bocavirus (HBoV) 1 can cause life-threatening respiratory tract infection in children. Diagnosing acute HBoV1 infection is challenging owing to long-term airway persistence. We assessed whether messenger RNA (mRNA) detection would correlate better than DNA detection with acute HBoV1 infection. Paired serum samples from 121 children with acute wheezing were analyzed by means of serology. Quantitative polymerase chain reaction (PCR) and reverse-transcription (RT) PCR were applied to nasopharyngeal swab (NPS) samples from all acutely HBoV1-infected children and from controls with nonacute infection. By serology, 16 of 121 children (13.2%) had acute HBoV1 infection, all of whom had HBoV1 DNA in NPS samples, and 12 of 16 (75%) had HBoV1 mRNA. Among 25 children with nondiagnostic results, 6 had HBoV1 DNA in NPS samples, and 1 had mRNA. All 13 mRNA-positive samples exhibited high DNA loads (≥106 copies/mL). No mRNA persisted for 2 weeks, whereas HBoV1 DNA persisted for 2 months in 4 children; 1 year later all 15 samples were DNA negative. Compared with serology, DNA PCR had high clinical sensitivity (100%) but, because of viral persistence, low specificity (76%). In contrast, mRNA RT-PCR had low clinical sensitivity (75%) but high specificity (96%). A combination of HBoV1 serology and nasopharyngeal DNA quantitative PCR and mRNA RT-PCR should be used for accurate diagnosis of HBoV1 infection. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

[Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

PubMed

Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

2017-07-28

To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).
 Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.
 Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.
 Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

Development of a reverse transcription quantitative polymerase chain reaction-based assay for broad coverage detection of African and Asian Zika virus lineages.

PubMed

Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai

2017-06-01

The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.

Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

PubMed Central

Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

2011-01-01

Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

PubMed

Nishiura, T; Abe, K

1999-01-01

The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

EVALUATION OF QUANTITATIVE REAL TIME PCR FOR THE MEASUREMENT OF HELICOBATER PYLORI AT LOW CONCENTRATIONS IN DRINKING WATER

EPA Science Inventory

Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.

Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...

Prenatal diagnosis of fetuses with increased nuchal translucency using an approach based on quantitative fluorescent polymerase chain reaction and genomic microarray.

PubMed

Pan, Min; Han, Jin; Zhen, Li; Yang, Xin; Li, Ru; Liao, Can; Li, Dong-Zhi

2016-02-01

To assess the clinical value of prenatal diagnosis of fetuses with increased nuchal translucency (NT) using an approach based on quantitative fluorescent polymerase chain reaction (QF-PCR) and chromosomal microarray (CMA). From January 2013 to October 2014, we included 175 pregnancies with fetal NT ≥ 3.5mm at 11-13 weeks' gestation who received chorionic villus sampling. QF-PCR was first used to rapidly detect common aneuploidies. The cases with a normal QF-PCR result were analyzed by CMA. Of the 175 cases, common aneuploidies were detected by QF-PCR in 53 (30.2%) cases (30 cases of trisomy 21, 12 cases of monosomy X, 7 cases of trisomy 18, 3 cases of trisomy 13 and 1 case of 47, XXY). Among the 122 cases with a normal QF-PCR result, microarray detected additional pathogenic copy number variants (CNVs) in 5.7% (7/122) of cases. Four cases would have expected to be detectable by conventional karyotyping because of large deletions/duplications (>10 Mb), leaving three cases (2.5%; 3/118) with pathogenic CNVs only detectable by CMA. It is rational to use a diagnostic strategy in which CMA is preceded by the less expensive, rapid, QF-PCR to detect common aneuploidies. CMA allows detection of a number of pathogenic chromosomal aberrations in fetuses with a high NT. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Evaluation of quantitative polymerase chain reaction assays targeting Mycobacterium avium, M. intracellulare, and M. avium subspecies paratuberculosis in drinking water biofilms.

PubMed

Chern, Eunice C; King, Dawn; Haugland, Richard; Pfaller, Stacy

2015-03-01

Mycobacterium avium (MA), Mycobacterium intracellulare (MI), and Mycobacterium avium subsp. paratuberculosis (MAP) are difficult to culture due to their slow growing nature. A quantitative polymerase chain reaction (qPCR) method for the rapid detection of MA, MI, and MAP can be used to provide data supporting drinking water biofilms as potential sources of human exposure. The aim of this study was to characterize two qPCR assays targeting partial 16S rRNA gene sequences of MA and MI and use these assays, along with two previously reported MAP qPCR assays (IS900 and Target 251), to investigate Mycobacterium occurrence in kitchen faucet biofilms. MA and MI qPCR assays demonstrated 100% specificity and sensitivity when evaluated against 18 non-MA complex, 76 MA, and 17 MI isolates. Both assays detected approximately 1,000 cells from a diluted cell stock inoculated on a sampling swab 100% of the time. DNA analysis by qPCR indicated that 35.3, 56.9 and 11.8% of the 51 kitchen faucet biofilm samples collected contained MA, MI, and MAP, respectively. This study introduces novel qPCR assays designed to specifically detect MA and MI in biofilm. Results support the use of qPCR as an alternative to culture for detection and enumeration of MA, MI, and MAP in microbiologically complex samples.

Glycosyltransferases as marker genes for the quantitative polymerase chain reaction-based detection of circulating tumour cells from blood samples of patients with breast cancer undergoing adjuvant therapy.

PubMed

Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich

2015-08-01

Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

PubMed

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

PubMed

Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

2017-06-01

A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

Quantitative competitive (QC) PCR for quantification of porcine DNA.

PubMed

Wolf, C; Lüthy, J

2001-02-01

Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

Identification of human intestinal parasites affecting an asymptomatic peri-urban Argentinian population using multi-parallel quantitative real-time polymerase chain reaction.

PubMed

Cimino, Rubén O; Jeun, Rebecca; Juarez, Marisa; Cajal, Pamela S; Vargas, Paola; Echazú, Adriana; Bryan, Patricia E; Nasser, Julio; Krolewiecki, Alejandro; Mejia, Rojelio

2015-07-17

In resource-limited countries, stool microscopy is the diagnostic test of choice for intestinal parasites (soil-transmitted helminths and/or intestinal protozoa). However, sensitivity and specificity is low. Improved diagnosis of intestinal parasites is especially important for accurate measurements of prevalence and intensity of infections in endemic areas. The study was carried out in Orán, Argentina. A total of 99 stool samples from a local surveillance campaign were analyzed by concentration microscopy and McMaster egg counting technique compared to the analysis by multi-parallel quantitative real-time polymerase chain reaction (qPCR). This study compared the performance of qPCR assay and stool microscopy for 8 common intestinal parasites that infect humans including the helminths Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Strongyloides stercoralis, Trichuris trichiura, and the protozoa Giardia lamblia, Cryptosporidium parvum/hominis, and Entamoeba histolytica, and investigated the prevalence of polyparasitism in an endemic area. qPCR showed higher detection rates for all parasites as compared to stool microscopy except T. trichiura. Species-specific primers and probes were able to distinguish between A. duodenale (19.1%) and N. americanus (36.4%) infections. There were 48.6% of subjects co-infected with both hookworms, and a significant increase in hookworm DNA for A. duodenale versus N. americanus (119.6 fg/μL: 0.63 fg/μL, P < 0.001) respectively. qPCR outperformed microscopy by the largest margin in G. lamblia infections (63.6% versus 8.1%, P < 0.05). Polyparasitism was detected more often by qPCR compared to microscopy (64.7% versus 24.2%, P < 0.05). Multi-parallel qPCR is a quantitative molecular diagnostic method for common intestinal parasites in an endemic area that has improved diagnostic accuracy compared to stool microscopy. This first time use of multi-parallel qPCR in Argentina has demonstrated the high

Frequency-encoded laser-induced fluorescence for multiplexed detection in infrared-mediated quantitative PCR

PubMed Central

Schrell, Adrian M.; Roper, Michael G.

2014-01-01

A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431

DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients

PubMed Central

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-01-01

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618

DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients.

PubMed

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-07-14

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.

An outbreak of West Nile Virus infection in the region of Monastir, Tunisia, 2003

PubMed Central

Riabi, Samira; Gaaloul, Imed; Mastouri, Maha; Hassine, Mohsen; Aouni, Mahjoub

2014-01-01

Background A West Nile (WN) fever epidemic occurred in the region of Monastir, Tunisia, between August and October 2003. Aim of the study We attempt to describe the epidemiology, clinical presentation, and outcome of patients with confirmed West Nile virus (WNV) infection. Methods Three groups of specimens were prepared. One was made up of serum only (n  =  43), the other of cerebrospinal fluid (CSF) only (n  =  30), and the third group was made up of both (n  =  40). These specimens were obtained from 113 patients. A serological diagnosis and evidence of WNV genome by nested reverse-transcriptase polymerase chain reaction (nRT-PCR) and TaqMan reverse transcription-polymerase chain reaction (RT-PCR) were carried out. Results Thirty-eight cases (33.6%) were serologically positive. Results of nRT-PCR showed a total of 10 positive cases of WNV (8.8%) detected in group 1 (n  =  1/43), group 2 (n  =  5/30), and group 3 (n  =  4/40) whereas the PCR TaqMan showed 18 positive samples (15.9%) found in group 1 (n  =  3/43), group 2 (n  =  9/30), and group 3 (n  =  6/40). All TaqMan PCR positive cases were nRT-PCR positive. In addition, four serologically probable cases were confirmed by TaqMan PCR. The attempts to isolate WNV by cell culture were unsuccessful. Considering the results of TaqMan assay and the serological diagnosis, WNV infection was confirmed in a total of 42 patients. The main clinical presentations were meningoencephalitis (40%), febrile disease (95%), and meningitis (36%). Eight patients (19%) died. The highest case-fatality rates occurred among patients aged ≧55 years. The phylogenetic analysis revealed that isolates of WNV were closely related to the Tunisian strain 1997 (PAH001) and the Israeli one (Is-98). Conclusions West Nile virus is a reemerging global pathogen that remains an important public health challenge in the next decade. PMID:24766339

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

PubMed

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

Directed evolution of polymerase function by compartmentalized self-replication.

PubMed

Ghadessy, F J; Ong, J L; Holliger, P

2001-04-10

We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially polymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.

Evolving a polymerase for hydrophobic base analogues.

PubMed

Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

2009-10-21

Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

Evaluation of the Cobas TaqMan MTB test for the detection of Mycobacterium tuberculosis complex according to acid-fast-bacillus smear grades in respiratory specimens.

PubMed

Huh, Hee Jae; Koh, Won-Jung; Song, Dong Joon; Ki, Chang-Seok; Lee, Nam Yong

2015-02-01

We evaluated the performance of the Cobas TaqMan MTB test (Roche Diagnostics, Basel, Switzerland), stratified by acid-fast bacilli (AFB) smear grades. The sensitivity of this test in smear-positive specimens was >95% in all grades, while that in trace and negative specimens was 85.3% and 34.4%, respectively. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

RNA binding and replication by the poliovirus RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oberste, M.S.

1988-01-01

RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to {sup 32}P-labeled ribohomopolymeric RNAs wasmore » examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K{sub a} for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 {times} 10{sup 9} M{sup {minus}1}. The polymerase binds to a subgenomic RNAs which contain the 3{prime} end of the genome with a K{sub a} similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3{prime} noncoding region.« less

MicroRNA markers for forensic body fluid identification obtained from microarray screening and quantitative RT-PCR confirmation

PubMed Central

Zubakov, Dmitry; Boersma, Anton W. M.; Choi, Ying; van Kuijk, Patricia F.; Wiemer, Erik A. C.

2010-01-01

MicroRNAs (miRNAs) are non-protein coding molecules with important regulatory functions; many have tissue-specific expression patterns. Their very small size in principle makes them less prone to degradation processes, unlike messenger RNAs (mRNAs), which were previously proposed as molecular tools for forensic body fluid identification. To identify suitable miRNA markers for forensic body fluid identification, we first screened total RNA samples derived from saliva, semen, vaginal secretion, and venous and menstrual blood for the expression of 718 human miRNAs using a microarray platform. All body fluids could be easily distinguished from each other on the basis of complete array-based miRNA expression profiles. Results from quantitative reverse transcription PCR (RT-PCR; TaqMan) assays for microarray candidate markers confirmed strong over-expression in the targeting body fluid of several miRNAs for venous blood and several others for semen. However, no candidate markers from array experiments for other body fluids such as saliva, vaginal secretion, or menstrual blood could be confirmed by RT-PCR. Time-wise degradation of venous blood and semen stains for at least 1 year under lab conditions did not significantly affect the detection sensitivity of the identified miRNA markers. The detection limit of the TaqMan assays tested for selected venous blood and semen miRNA markers required only subpicogram amounts of total RNA per single RT-PCR test, which is considerably less than usually needed for reliable mRNA RT-PCR detection. We therefore propose the application of several stable miRNA markers for the forensic identification of blood stains and several others for semen stain identification, using commercially available TaqMan assays. Additional work remains necessary in search for suitable miRNA markers for other forensically relevant body fluids. Electronic supplementary material The online version of this article (doi:10.1007/s00414-009-0402-3) contains

Analytical characteristics and comparative evaluation of Aptima HCV quant Dx assay with the Abbott RealTime HCV assay and Roche COBAS AmpliPrep/COBAS TaqMan HCV quantitative test v2.0.

PubMed

Worlock, A; Blair, D; Hunsicker, M; Le-Nguyen, T; Motta, C; Nguyen, C; Papachristou, E; Pham, J; Williams, A; Vi, M; Vinluan, B; Hatzakis, A

2017-04-04

The Aptima HCV Quant Dx assay (Aptima assay) is a fully automated quantitative assay on the Panther® system. This assay is intended for confirmation of diagnosis and monitoring of HCV RNA in plasma and serum specimens. The purpose of the testing described in this paper was to evaluate the performance of the Aptima assay. The analytical sensitivity, analytical specificity, precision, and linearity of the Aptima assay were assessed. The performance of the Aptima assay was compared to two commercially available HCV assays; the Abbott RealTime HCV assay (Abbott assay, Abbott Labs Illinois, USA) and the Roche COBAS Ampliprep/COBAS Taqman HCV Quantitative Test v2.0 (Roche Assay, Roche Molecular Systems, Pleasanton CA, USA). The 95% Lower Limit of Detection (LoD) of the assay was determined from dilutions of the 2nd HCV WHO International Standard (NIBSC 96/798 genotype 1) and HCV positive clinical specimens in HCV negative human plasma and serum. Probit analysis was performed to generate the 95% predicted detection limits. The Lower Limit of Quantitation (LLoQ) was established for each genotype by diluting clinical specimens and the 2nd HCV WHO International Standard (NIBSC 96/798 genotype 1) in HCV negative human plasma and serum. Specificity was determined using 200 fresh and 536 frozen HCV RNA negative clinical specimens including 370 plasma specimens and 366 serum specimens. Linearity for genotypes 1 to 6 was established by diluting armored RNA or HCV positive clinical specimens in HCV negative serum or plasma from 8.08 log IU/mL to below 1 log IU/mL. Precision was tested using a 10 member panel made by diluting HCV positive clinical specimens or spiking armored RNA into HCV negative plasma and serum. A method comparison was conducted against the Abbott assay using 1058 clinical specimens and against the Roche assay using 608 clinical specimens from HCV infected patients. In addition, agreement between the Roche assay and the Aptima assay using specimens with low

Etiology of Severe Acute Watery Diarrhea in Children in the Global Rotavirus Surveillance Network Using Quantitative Polymerase Chain Reaction

PubMed Central

Operario, Darwin J; Platts-Mills, James A; Nadan, Sandrama; Page, Nicola; Seheri, Mapaseka; Mphahlele, Jeffrey; Praharaj, Ira; Kang, Gagandeep; Araujo, Irene T; Leite, Jose Paulo G; Cowley, Daniel; Thomas, Sarah; Kirkwood, Carl D; Dennis, Francis; Armah, George; Mwenda, Jason M; Wijesinghe, Pushpa Ranjan; Rey, Gloria; Grabovac, Varja; Berejena, Chipo; Simwaka, Chibumbya J; Uwimana, Jeannine; Sherchand, Jeevan B; Thu, Hlaing Myat; Galagoda, Geethani; Bonkoungou, Isidore J O; Jagne, Sheriffo; Tsolenyanu, Enyonam; Diop, Amadou; Enweronu-Laryea, Christabel; Borbor, Sam-Aliyah; Liu, Jie; McMurry, Timothy; Lopman, Benjamin; Parashar, Umesh; Gentsch, John; Steele, A Duncan; Cohen, Adam; Serhan, Fatima; Houpt, Eric R

2017-01-01

Abstract Background The etiology of acute watery diarrhea remains poorly characterized, particularly after rotavirus vaccine introduction. Methods We performed quantitative polymerase chain reaction for multiple enteropathogens on 878 acute watery diarrheal stools sampled from 14643 episodes captured by surveillance of children <5 years of age during 2013–2014 from 16 countries. We used previously developed models of the association between pathogen quantity and diarrhea to calculate pathogen-specific weighted attributable fractions (AFs). Results Rotavirus remained the leading etiology (overall weighted AF, 40.3% [95% confidence interval {CI}, 37.6%–44.3%]), though the AF was substantially lower in the Americas (AF, 12.2 [95% CI, 8.9–15.6]), based on samples from a country with universal rotavirus vaccination. Norovirus GII (AF, 6.2 [95% CI, 2.8–9.2]), Cryptosporidium (AF, 5.8 [95% CI, 4.0–7.6]), Shigella (AF, 4.7 [95% CI, 2.8–6.9]), heat-stable enterotoxin-producing Escherichia coli (ST-ETEC) (AF, 4.2 [95% CI, 2.0–6.1]), and adenovirus 40/41 (AF, 4.2 [95% CI, 2.9–5.5]) were also important. In the Africa Region, the rotavirus AF declined from 54.8% (95% CI, 48.3%–61.5%) in rotavirus vaccine age-ineligible children to 20.0% (95% CI, 12.4%–30.4%) in age-eligible children. Conclusions Rotavirus remained the leading etiology of acute watery diarrhea despite a clear impact of rotavirus vaccine introduction. Norovirus GII, Cryptosporidium, Shigella, ST-ETEC, and adenovirus 40/41 were also important. Prospective surveillance can help identify priorities for further reducing the burden of diarrhea. PMID:28838152

Quantitative assessment of Azumiobodo hoyamushi distribution in the tunic of soft tunic syndrome-affected ascidian Halocynthia roretzi using real-time polymerase chain reaction.

PubMed

Shin, Yun-Kyung; Nam, Ki-Woong; Park, Kwan Ha; Yoon, Jong-Man; Park, Kyung-Il

2014-11-26

The kinetoplastid parasite, Azumiobodo hoyamushi, is the causative agent of soft tunic syndrome (STS) in ascidians and leads to their mass mortality in Korean waters. This study was conducted to quantify A. hoyamushi density during the development of STS in the tunics of ascidians (Halocynthia roretzi) using real-time polymerase chain reaction (qPCR). The infection intensity of A. hoyamushi, as measured by qPCR, varied depending on the part of the tunic analyzed, as well as the stage of STS development. The highest infection intensity was recorded in the tunics of the siphons. The infection intensity of A. hoyamushi in the siphons was only 2.9 cell/tunic (area, 0.25 cm(2)) or 106.0 cell/gram tunic (GT) in the early phase of STS, but this value increased dramatically to 16,066 cells/tunic (0.25 cm(2)) or 617,004 cell/GT at the time of death. The number of A. hoyamushi parasites increased gradually and their distribution spread from the siphons to the other parts of the tunics. qPCR enabled the quantitation of A. hoyamushi and the results revealed that parasite density increased as STS progressed. In addition, our results suggested that the siphons might function as the portal of entry for A. hoyamushi during infection.

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

PubMed Central

2017-01-01

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

Quantitative Polymerase Chain Reaction to Assess Response to Treatment of Bacterial Vaginosis and Risk of Preterm Birth.

PubMed

Abramovici, Adi; Lobashevsky, Elena; Cliver, Suzanne P; Edwards, Rodney K; Hauth, John C; Biggio, Joseph R

2015-10-01

The aim of this study was to determine whether quantitative polymerase chain reaction (qPCR) bacterial load measurement is a valid method to assess response to treatment of bacterial vaginosis and risk of preterm birth in pregnant women. Secondary analysis by utilizing stored vaginal samples obtained during a previous randomized controlled trial studying the effect of antibiotics on preterm birth (PTB). All women had risk factors for PTB: (1) positive fetal fibronectin (n=146), (2) bacterial vaginosis (BV) and a prior PTB (n=43), or (3) BV and a prepregnancy weight<50 kg (n=54). Total and several individual BV-related bacteria loads were measured using qPCR for 16S rRNA. Loads were correlated with Nugent scores (Spearman correlation coefficients). Loads were compared pre- and posttreatment with Wilcoxon rank-sum test. Individual patient differences were examined with Wilcoxon signed-rank test. A total of 243 paired vaginal samples were available for analysis: 123 antibiotics and 120 placebo. Groups did not differ by risk factors for PTB. For all samples, bacterial loads were correlated with Nugent score and each of its specific bacterial components (all p<0.01). Baseline total bacterial load did not differ by treatment group (p=0.87). Posttreatment total bacterial load was significantly lower in the antibiotics group than the placebo group (p<0.01). Individual patient total bacterial load decreased significantly posttreatment in the antibiotics group (p<0.01), but not in the placebo group (p=0.12). The rate of PTB did not differ between groups (p=0.24). PTB relative risks calculated for BV positive versus BV negative women and women with the highest quartile total and individual bacterial loads were not statistically significant. qPCR correlates with Nugent score and demonstrates decreased bacterial load after antibiotic treatment. Therefore, it is a valid method of vaginal flora assessment in pregnant women who are at high risk for PTB. Thieme Medical Publishers

EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

EPA Science Inventory

Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

PubMed

Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

2016-08-01

Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa.

Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

PubMed Central

Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

2012-01-01

The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

Polymerase Gamma Disease through the Ages

ERIC Educational Resources Information Center

Saneto, Russell P.; Naviaux, Robert K.

2010-01-01

The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.

PubMed

Cobbs, Gary

2012-08-16

Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of

Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

PubMed

Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

2017-07-01

The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4  ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.

Picornaviral Polymerase Structure, Function, and Fidelity Modulation

PubMed Central

Peersen, Olve B.

2017-01-01

Like all positive strand RNA viruses, the picornaviruses replicate their genomes using a virally encoded RNA-dependent RNA polymerase enzyme known as 3Dpol. Over the past decade we have made tremendous advances in our understanding of 3Dpol structure and function, including the discovery of a novel mechanism for closing the active site that allows these viruses to easily fine tune replication fidelity and quasispecies distributions. This review summarizes current knowledge of picornaviral polymerase structure and how the enzyme interacts with RNA and other viral proteins to form stable and processive elongation complexes. The picornaviral RdRPs are among the smallest viral polymerases, but their fundamental molecular mechanism for catalysis appears to be generally applicable as a common feature of all positive strand RNA virus polymerases. PMID:28163093

Yeast Cells Expressing the Human Mitochondrial DNA Polymerase Reveal Correlations between Polymerase Fidelity and Human Disease Progression*

PubMed Central

Qian, Yufeng; Kachroo, Aashiq H.; Yellman, Christopher M.; Marcotte, Edward M.; Johnson, Kenneth A.

2014-01-01

Mutations in the human mitochondrial polymerase (polymerase-γ (Pol-γ)) are associated with various mitochondrial disorders, including mitochondrial DNA (mtDNA) depletion syndrome, Alpers syndrome, and progressive external opthamalplegia. To correlate biochemically quantifiable defects resulting from point mutations in Pol-γ with their physiological consequences, we created “humanized” yeast, replacing the yeast mtDNA polymerase (MIP1) with human Pol-γ. Despite differences in the replication and repair mechanism, we show that the human polymerase efficiently complements the yeast mip1 knockouts, suggesting common fundamental mechanisms of replication and conserved interactions between the human polymerase and other components of the replisome. We also examined the effects of four disease-related point mutations (S305R, H932Y, Y951N, and Y955C) and an exonuclease-deficient mutant (D198A/E200A). In haploid cells, each mutant results in rapid mtDNA depletion, increased mutation frequency, and mitochondrial dysfunction. Mutation frequencies measured in vivo equal those measured with purified enzyme in vitro. In heterozygous diploid cells, wild-type Pol-γ suppresses mutation-associated growth defects, but continuous growth eventually leads to aerobic respiration defects, reduced mtDNA content, and depolarized mitochondrial membranes. The severity of the Pol-γ mutant phenotype in heterozygous diploid humanized yeast correlates with the approximate age of disease onset and the severity of symptoms observed in humans. PMID:24398692

Visualizing polynucleotide polymerase machines at work

PubMed Central

Steitz, Thomas A

2006-01-01

The structures of T7 RNA polymerase (T7 RNAP) captured in the initiation and elongation phases of transcription, that of φ29 DNA polymerase bound to a primer protein and those of the multisubunit RNAPs bound to initiating factors provide insights into how these proteins can initiate RNA synthesis and synthesize 6–10 nucleotides while remaining bound to the site of initiation. Structural insight into the translocation of the product transcript and the separation of the downstream duplex DNA is provided by the structures of the four states of nucleotide incorporation. Single molecule and biochemical studies show a distribution of primer terminus positions that is altered by the binding of NTP and PPi ligands. This article reviews the insights that imaging the structure of polynucleotide polymerases at different steps of the polymerization reaction has provided on the mechanisms of the polymerization reaction. Movies are shown that allow the direct visualization of the conformational changes that the polymerases undergo during the different steps of polymerization. PMID:16900098

New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

EPA Science Inventory

Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

Results of the Abbott RealTime HIV-1 assay for specimens yielding "target not detected" results by the Cobas AmpliPrep/Cobas TaqMan HIV-1 Test.

PubMed

Babady, N Esther; Germer, Jeffrey J; Yao, Joseph D C

2010-03-01

No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding "target not detected" results by CTM.

Multiple two-polymerase mechanisms in mammalian translesion DNA synthesis.

PubMed

Livneh, Zvi; Ziv, Omer; Shachar, Sigal

2010-02-15

The encounter of replication forks with DNA lesions may lead to fork arrest and/or the formation of single-stranded gaps. A major strategy to cope with these replication irregularities is translesion DNA synthesis (TLS), in which specialized error-prone DNA polymerases bypass the blocking lesions. Recent studies suggest that TLS across a particular DNA lesion may involve as many as four different TLS polymerases, acting in two-polymerase reactions in which insertion by a particular polymerase is followed by extension by another polymerase. Insertion determines the accuracy and mutagenic specificity of the TLS reaction, and is carried out by one of several polymerases such as poleta, polkappa or poliota. In contrast, extension is carried out primarily by polzeta. In cells from XPV patients, which are deficient in TLS across cyclobutane pyrimidine dimers (CPD) due to a deficiency in poleta, TLS is carried out by at least two backup reactions each involving two polymerases: One reaction involves polkappa and polzeta, and the other poliota and polzeta. These mechanisms may also assist poleta in normal cells under an excessive amount of UV lesions.

Investigation of specific interactions between T7 promoter and T7 RNA polymerase by force spectroscopy using atomic force microscope.

PubMed

Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong

2018-01-11

The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

DNA polymerase gamma from Xenopus laevis. I. The identification of a high molecular weight catalytic subunit by a novel DNA polymerase photolabeling procedure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Insdorf, N.F.; Bogenhagen, D.F.

1989-12-25

DNA polymerase gamma has been purified over 10,000-fold from mitochondria of Xenopus laevis ovaries. We have developed a novel technique which specifically photolabels DNA polymerases. This procedure, the DNA polymerase trap, was used to identify a catalytic subunit of 140,000 Da from X. laevis DNA polymerase gamma. Additional catalytically active polypeptides of 100,000 and 55,000 Da were identified in the highly purified enzyme. These appear to be products of degradation of the 140,000-Da subunit. The DNA polymerase trap, which does not require large amounts of enzyme or renaturation from sodium dodecyl sulfate, is an alternative to the classic activity gel.

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

PubMed

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

Multicentre study of Y chromosome microdeletions in 1,808 Chinese infertile males using multiplex and real-time polymerase chain reaction.

PubMed

Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z

2017-06-01

Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.

A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species.

PubMed

Linck, Holger; Krüger, Erika; Reineke, Annette

2017-01-01

Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect). This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers.

A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species

PubMed Central

Krüger, Erika; Reineke, Annette

2017-01-01

Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect). This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers. PMID:28545043

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

PubMed

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

PubMed

Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

2014-12-01

A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

Next-generation sequencing facilitates quantitative analysis of wild-type and Nrl−/− retinal transcriptomes

PubMed Central

Brooks, Matthew J.; Rajasimha, Harsha K.; Roger, Jerome E.

2011-01-01

Purpose Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis. Methods Retinal mRNA profiles of 21-day-old wild-type (WT) and neural retina leucine zipper knockout (Nrl−/−) mice were generated by deep sequencing, in triplicate, using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner (BWA) followed by ANOVA (ANOVA) and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results Using an optimized data analysis workflow, we mapped about 30 million sequence reads per sample to the mouse genome (build mm9) and identified 16,014 transcripts in the retinas of WT and Nrl−/− mice with BWA workflow and 34,115 transcripts with TopHat workflow. RNA-seq data confirmed stable expression of 25 known housekeeping genes, and 12 of these were validated with qRT–PCR. RNA-seq data had a linear relationship with qRT–PCR for more than four orders of magnitude and a goodness of fit (R2) of 0.8798. Approximately 10% of the transcripts showed differential expression between the WT and Nrl−/− retina, with a fold change ≥1.5 and p value <0.05. Altered expression of 25 genes was confirmed with qRT–PCR, demonstrating the high degree of sensitivity of the RNA-seq method. Hierarchical clustering of differentially expressed genes uncovered several as yet uncharacterized genes that may contribute to retinal function. Data analysis with BWA and TopHat workflows revealed a significant overlap yet provided complementary insights in transcriptome profiling. Conclusions Our study represents the first detailed analysis of retinal

A TaqMan real-time PCR method based on alternative oxidase genes for detection of plant species in animal feed samples.

PubMed

Campos, Maria Doroteia; Valadas, Vera; Campos, Catarina; Morello, Laura; Braglia, Luca; Breviario, Diego; Cardoso, Hélia G

2018-01-01

Traceability of processed food and feed products has been gaining importance due to the impact that those products can have on human/animal health and to the associated economic and legal concerns, often related to adulterations and frauds as it can be the case for meat and milk. Despite mandatory traceability requirements for the analysis of feed composition, few reliable and accurate methods are presently available to enforce the legislative frame and allow the authentication of animal feeds. In this study, nine sensitive and species-specific real-time PCR TaqMan MGB assays are described for plant species detection in animal feed samples. The method is based on selective real-time qPCR (RT-qPCR) amplification of target genes belonging to the alternative oxidase (AOX) gene family. The plant species selected for detection in feed samples were wheat, maize, barley, soybean, rice and sunflower as common components of feeds, and cotton, flax and peanut as possible undesirable contaminants. The obtained results were compared with end-point PCR methodology. The applicability of the AOX TaqMan assays was evaluated through the screening of commercial feed samples, and by the analysis of plant mixtures with known composition. The RT-qPCR methodology allowed the detection of the most abundant species in feeds but also the identification of contaminant species present in lower amounts, down to 1% w/w. AOX-based methodology provides a suitable molecular marker approach to ascertain plant species composition of animal feed samples, thus supporting feed control and enforcement of the feed sector and animal production.

Integrated microfluidic card with TaqMan probes and high-resolution melt analysis to detect tuberculosis drug resistance mutations across 10 genes.

PubMed

Pholwat, Suporn; Liu, Jie; Stroup, Suzanne; Gratz, Jean; Banu, Sayera; Rahman, S M Mazidur; Ferdous, Sara Sabrina; Foongladda, Suporn; Boonlert, Duangjai; Ogarkov, Oleg; Zhdanova, Svetlana; Kibiki, Gibson; Heysell, Scott; Houpt, Eric

2015-02-24

Genotypic methods for drug susceptibility testing of Mycobacterium tuberculosis are desirable to speed the diagnosis and proper therapy of tuberculosis (TB). However, the numbers of genes and polymorphisms implicated in resistance have proliferated, challenging diagnostic design. We developed a microfluidic TaqMan array card (TAC) that utilizes both sequence-specific probes and high-resolution melt analysis (HRM), providing two layers of detection of mutations. Twenty-seven primer pairs and 40 probes were designed to interrogate 3,200 base pairs of critical regions of the inhA, katG, rpoB, embB, rpsL, rrs, eis, gyrA, gyrB, and pncA genes. The method was evaluated on 230 clinical M. tuberculosis isolates from around the world, and it yielded 96.1% accuracy (2,431/2,530) in comparison to that of Sanger sequencing and 87% accuracy in comparison to that of the slow culture-based susceptibility testing. This TAC-HRM method integrates assays for 10 genes to yield fast, comprehensive, and accurate drug susceptibility results for the 9 major antibiotics used to treat TB and could be deployed to improve treatment outcomes. Multidrug-resistant tuberculosis threatens global tuberculosis control efforts. Optimal therapy utilizes susceptibility test results to guide individualized treatment regimens; however, the susceptibility testing methods in use are technically difficult and slow. We developed an integrated TaqMan array card method with high-resolution melt analysis that interrogates 10 genes to yield a fast, comprehensive, and accurate drug susceptibility result for the 9 major antituberculosis antibiotics. Copyright © 2015 Pholwat et al.

Performance of the New Aptima HCV Quant Dx Assay in Comparison to the Cobas TaqMan HCV2 Test for Use with the High Pure System in Detection and Quantification of Hepatitis C Virus RNA in Plasma or Serum.

PubMed

Schalasta, Gunnar; Speicher, Andrea; Börner, Anna; Enders, Martin

2016-04-01

Quantitating the level of hepatitis C virus (HCV) RNA is the standard of care for monitoring HCV-infected patients during treatment. The performances of commercially available assays differ for precision, limit of detection, and limit of quantitation (LOQ). Here, we compare the performance of the Hologic Aptima HCV Quant Dx assay (Aptima) to that of the Roche Cobas TaqMan HCV test, version 2.0, using the High Pure system (HPS/CTM), considered a reference assay since it has been used in trials defining clinical decision points in patient care. The assays' performance characteristics were assessed using HCV RNA reference panels and plasma/serum from chronically HCV-infected patients. The agreement between the assays for the 3 reference panels was good, with a difference in quantitation values of <0.5 log. High concordance was demonstrated between the assays for 245 clinical samples (kappa = 0.80; 95% confidence interval [CI], 0.720 to 0.881); however, Aptima detected and/or quantitated 20 samples that HPS/CTM did not detect, while Aptima did not detect 1 sample that was quantitated by HPS/CTM. For the 165 samples quantitated by both assays, the values were highly correlated (R= 0.98;P< 0.0001). The linearity of quantitation from concentrations of 1.4 to 6 log was excellent for both assays for all HCV genotypes (GT) tested (GT 1a, 1b, 2b, and 3a) (R(2)> 0.99). The assays had similar levels of total and intra-assay variability across all genotypes at concentrations from 1,000 to 25 IU/ml. Aptima had a greater analytical sensitivity, quantitating more than 50% of replicates at 25-IU/ml target. Aptima showed performance characteristics comparable to those of HPS/CTM and increased sensitivity, making it suitable for use as a clinical diagnostic tool on the fully automated Panther platform. Copyright © 2016 Schalasta et al.

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

PubMed

Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

2013-07-10

The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process

Analytical characteristics and comparative evaluation of Aptima HIV-1 Quant Dx assay with Ampliprep/COBAS TaqMan HIV-1 test v2.0.

PubMed

Hatzakis, Angelos; Papachristou, Helen; Nair, Sangeetha J; Fortunko, Jacqueline; Foote, Tracy; Kim, HeeCheol; Peling, Tashi L; Worlock, Andrew J

2016-10-21

Quantitation of HIV-RNA is critically important for diagnosis, prognosis, treatment, monitoring and assessment of infectivity in HIV-1 infection. The objective of this study was to assess performance characteristics of the Aptima HIV-1 Quant Dx assay (Aptima), a new transcription mediated amplification (TMA), fully integrated and automated assay from Hologic Inc., San Diego, CA, USA. The analytical sensitivity, analytical specificity, precision and detection of HIV-1 subtypes were tested based on commercially available international standards or panels. A selected group of 244 anti-HIV-1 (+) plasma samples was used for comparison with Roche COBAS Ampliprep/COBAS TaqMan HIV- 1 test v2.0 (Roche CAP/CTM), (Roche Molecular Systems, Pleasanton, CA). The 50 and 95 % limit of detection were estimated at 4.9 (95 % CI 3.9-5.7) and 17.6 (15.2-21.2) IU/mL respectively. The specificity was found 99.83 (99.06-99.97) %. The standard deviations and coefficient of variations for panels with 50 and 100 copies/mL (1.7 and 2 log copies/mL) were 0.14 log copies/mL (8.67 %CV) and 0.18 log copies/mL (9.91 %CV) respectively. The detection rate for Aptima and Roche assays was 220/244 (90.2 %) and 217/244 (88.9 %) respectively. The Aptima assay is a sensitive, specific, precise and accurate test for measuring HIV-1 viral loads and for the detection of HIV-1 infections.

Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

USGS Publications Warehouse

Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

2012-01-01

During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

Quantitative fluorescent polymerase chain reaction for rapid prenatal diagnosis of fetal aneuploidies in chorionic villus sampling in a single institution

PubMed Central

Shin, You Jung; Kim, Do Jin; Ryu, Hyun Mee; Kim, Moon Young; Han, Jung Yeol; Choi, June Seek

2016-01-01

Objective To validate quantitative fluorescent polymerase chain reaction (QF-PCR) via chorionic villus sampling (CVS) for the diagnosis of fetal aneuploidies. Methods We retrospectively reviewed the medical records of consecutive pregnant women who had undergone CVS at Cheil General Hospital between December 2009 and June 2014. Only cases with reported QF-PCR before long-term culture (LTC) for conventional cytogenetic analysis were included, and the results of these two methods were compared. Results A total of 383 pregnant women underwent QF-PCR and LTC via CVS during the study period and 403 CVS specimens were collected. The indications of CVS were as follows: abnormal first-trimester ultrasonographic findings, including increased fetal nuchal translucency (85.1%), advanced maternal age (6.8%), previous history of fetal anomalies (4.2%), and positive dual test results for trisomy 21 (3.9%). The results of QF-PCR via CVS were as follows: 76 (18.9%) cases were identified as trisomy 21 (36 cases), 18 (33 cases), or 13 (seven cases), and 4 (1.0%) cases were suspected to be mosaicism. All results of common autosomal trisomies by QF-PCR were consistent with those of LTC and there were no false-positive findings. Four cases suspected as mosaicism in QF-PCR were confirmed as non-mosaic trisomies of trisomy 21 (one case) or trisomy 18 (three cases) in LTC. Conclusion QF-PCR via CVS has the advantage of rapid prenatal screening at an earlier stage of pregnancy for common chromosomal trisomies and thus can reduce the anxiety of parents. In particular, it can be helpful for pregnant women with increased fetal nuchal translucency or abnormal first-trimester ultrasonographic findings. PMID:27896246

DNA polymerase having modified nucleotide binding site for DNA sequencing

DOEpatents

Tabor, Stanley; Richardson, Charles

1997-01-01

Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

Selection and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Studies in Mossy Maze Polypore, Cerrena unicolor (Higher Basidiomycetes).

PubMed

Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun

2016-01-01

With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.

Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

PubMed

Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

2011-08-01

DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

Resistance of Legionella and Acanthamoeba mauritaniensis to heat treatment as determined by relative and quantitative polymerase chain reactions.

PubMed

Dobrowsky, Penelope H; Khan, Sehaam; Khan, Wesaal

2017-10-01

Legionella and Acanthamoeba spp. persist in harvested rainwater pasteurized at high temperatures (> 72°C) and the interaction mechanisms exhibited between these organisms need to be elucidated. The resistance of two Legionella reference strains (Legionella pneumophila ATCC 33152 and Legionella longbeachae ATCC 33462), three environmental strains [Legionella longbeachae (env.), Legionella norrlandica (env.) and Legionella rowbothamii (env.)] and Acanthamoeba mauritaniensis ATCC 50676 to heat treatment (50-90°C) was determined by monitoring culturability and viability [ethidium monoazide quantitative polymerase chain reaction (EMA-qPCR)]. The expression of metabolic and virulence genes of L. pneumophila ATCC 33152 (lolA, sidF, csrA) and L. longbeachae (env.) (lolA) in co-culture with A. mauritaniensis ATCC 50676 during heat treatment (50-90°C) was monitored using relative qPCR. While the culturability (CFU/mL) and viability (gene copies/mL) of the Legionella strains reduced significantly (p < 0.05) following heat treatment (60-90°C), L. longbeachae (env.) and L. pneumophila ATCC 33152 were culturable following heat treatment at 50-60°C. Metabolically active trophozoites and dormant cysts of A. mauritaniensis ATCC 50676 were detected at 50°C and 60-90°C, respectively. For L. pneumophila ATCC 33152, lolA expression remained constant, sidF expression increased and the expression of csrA decreased during co-culture with A. mauritaniensis ATCC 50676. For L. longbeachae (env.), while lolA was up-regulated at 50-70°C, expression was not detected at 80-90°C and in co-culture. In conclusion, while heat treatment may reduce the number of viable Legionella spp. in monoculture, results indicate that the presence of A. mauritaniensis increases the virulence of L. pneumophila during heat treatment. The virulence of Legionella spp. in co-culture with Acanthamoeba spp. should thus be monitored in water distribution systems where temperature (heat) is utilized for treatment

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

PubMed

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

MONITORING ASPERGILLUS SPECIES BY QUANTITATIVE PCR DURING CONSTRUCTION OF A MULTI-STORY HOSPITAL BUILDING

EPA Science Inventory

Noscomial fungal infections represent a persistent threat in hospitals. One of the major issues in fungal control has been monitoring these fungi in a timely manner. Quantitative polymerase chain reaction (QPCR) allows for the rapid (2 to 4 h), sensitive (often down to a single...

DNA polymerase having modified nucleotide binding site for DNA sequencing

DOEpatents

Tabor, S.; Richardson, C.

1997-03-25

A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

PubMed

Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

2000-04-01

Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

High-throughput real-time quantitative reverse transcription PCR.

PubMed

Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

2006-02-01

Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

Development a of multiplex TaqMan real-time RT-PCR assay for simultaneous detection of Asian prunus viruses, plum bark necrosis stem pitting associated virus, and peach latent mosaic virus

USDA-ARS?s Scientific Manuscript database

Asian prunus viruses (APV 1, APV 2 and APV 3) and Plum bark necrosis stem pitting associated virus (PBNSPaV) are two recently described viruses infecting Prunus spp., and Peach latent mosaic viroid (PLMVd) is a viroid that infects the same species. A single-tube multiplex, TaqMan real-time RT-PCR as...

Human DNA polymerase η accommodates RNA for strand extension.

PubMed

Su, Yan; Egli, Martin; Guengerich, F Peter

2017-11-03

Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase α, telomerase, and the mitochondrial human DNA polymerase (hpol) γ have been shown to tolerate an entire RNA strand. Y-family hpol η is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol η is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol η, as well as another Y-family DNA polymerase, hpol κ, accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions, such as 8-oxo-2'-deoxyguanosine or cyclobutane pyrimidine dimer, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA-accommodating ability of hpol η redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol η in vivo . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A multisite assessment of the quantitative capabilities of the Xpert MTB/RIF assay.

PubMed

Blakemore, Robert; Nabeta, Pamela; Davidow, Amy L; Vadwai, Viral; Tahirli, Rasim; Munsamy, Vanisha; Nicol, Mark; Jones, Martin; Persing, David H; Hillemann, Doris; Ruesch-Gerdes, Sabine; Leisegang, Felicity; Zamudio, Carlos; Rodrigues, Camilla; Boehme, Catharina C; Perkins, Mark D; Alland, David

2011-11-01

The Xpert MTB/RIF is an automated molecular test for Mycobacterium tuberculosis that estimates bacterial burden by measuring the threshold-cycle (Ct) of its M. tuberculosis-specific real-time polymerase chain reaction. Bacterial burden is an important biomarker for disease severity, infection control risk, and response to therapy. Evaluate bacterial load quantitation by Xpert MTB/RIF compared with conventional quantitative methods. Xpert MTB/RIF results were compared with smear-microscopy, semiquantiative solid culture, and time-to-detection in liquid culture for 741 patients and 2,008 samples tested in a multisite clinical trial. An internal control real-time polymerase chain reaction was evaluated for its ability to identify inaccurate quantitative Xpert MTB/RIF results. Assays with an internal control Ct greater than 34 were likely to be inaccurately quantitated; this represented 15% of M. tuberculosis-positive tests. Excluding these, decreasing M. tuberculosis Ct was associated with increasing smear microscopy grade for smears of concentrated sputum pellets (r(s) = -0.77) and directly from sputum (r(s) =-0.71). A Ct cutoff of approximately 27.7 best predicted smear-positive status. The association between M. tuberculosis Ct and time-to-detection in liquid culture (r(s) = 0.68) and semiquantitative colony counts (r(s) = -0.56) was weaker than smear. Tests of paired same-patient sputum showed that high viscosity sputum samples contained ×32 more M. tuberculosis than nonviscous samples. Comparisons between the grade of the acid-fast bacilli smear and Xpert MTB/RIF quantitative data across study sites enabled us to identify a site outlier in microscopy. Xpert MTB/RIF quantitation offers a new, standardized approach to measuring bacterial burden in the sputum of patients with tuberculosis.

Saccharomyces cerevisiae RNA Polymerase I Terminates Transcription at the Reb1 Terminator In Vivo

PubMed Central

Reeder, Ronald H.; Guevara, Palmira; Roan, Judith G.

1999-01-01

We have mapped transcription termination sites for RNA polymerase I in the yeast Saccharomyces cerevisiae. S1 nuclease mapping shows that the primary terminator is the Reb1p terminator located at +93 downstream of the 3′ end of 25S rRNA. Reverse transcription coupled with quantitative PCR shows that approximately 90% of all transcripts terminate at this site. Transcripts which read through the +93 site quantitatively terminate at a fail-safe terminator located further downstream at +250. Inactivation of Rnt1p (an RNase III involved in processing the 3′ end of 25S rRNA) greatly stabilizes transcripts extending to both sites and increases readthrough at the +93 site. In vivo assay of mutants of the Reb1p terminator shows that this site operates in vivo by the same mechanism as has previously been delineated through in vitro studies. PMID:10523625

Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico

PubMed Central

Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

2014-01-01

Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease. PMID:25512712

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

PubMed

Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2016-09-01

Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

Investigation of Influenza Virus Polymerase Activity in Pig Cells

PubMed Central

Moncorgé, Olivier; Long, Jason S.; Cauldwell, Anna V.; Zhou, Hongbo; Lycett, Samantha J.

2013-01-01

Reassortant influenza viruses with combinations of avian, human, and/or swine genomic segments have been detected frequently in pigs. As a consequence, pigs have been accused of being a “mixing vessel” for influenza viruses. This implies that pig cells support transcription and replication of avian influenza viruses, in contrast to human cells, in which most avian influenza virus polymerases display limited activity. Although influenza virus polymerase activity has been studied in human and avian cells for many years by use of a minigenome assay, similar investigations in pig cells have not been reported. We developed the first minigenome assay for pig cells and compared the activities of polymerases of avian or human influenza virus origin in pig, human, and avian cells. We also investigated in pig cells the consequences of some known mammalian host range determinants that enhance influenza virus polymerase activity in human cells, such as PB2 mutations E627K, D701N, G590S/Q591R, and T271A. The two typical avian influenza virus polymerases used in this study were poorly active in pig cells, similar to what is seen in human cells, and mutations that adapt the avian influenza virus polymerase for human cells also increased activity in pig cells. In contrast, a different pattern was observed in avian cells. Finally, highly pathogenic avian influenza virus H5N1 polymerase activity was tested because this subtype has been reported to replicate only poorly in pigs. H5N1 polymerase was active in swine cells, suggesting that other barriers restrict these viruses from becoming endemic in pigs. PMID:23077313

Selection of internal reference genes for normalization of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in the canine brain and other organs.

PubMed

Park, Sang-Je; Huh, Jae-Won; Kim, Young-Hyun; Lee, Sang-Rae; Kim, Sang-Hyun; Kim, Sun-Uk; Kim, Heui-Soo; Kim, Min Kyu; Chang, Kyu-Tae

2013-05-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a specific and sensitive technique for quantifying gene expression. To analyze qRT-PCR data accurately, suitable reference genes that show consistent expression patterns across different tissues and experimental conditions should be selected. The objective of this study was to obtain the most stable reference genes in dogs, using samples from 13 different brain tissues and 10 other organs. 16 well-known candidate reference genes were analyzed by the geNorm, NormFinder, and BestKeeper programs. Brain tissues were derived from several different anatomical regions, including the forebrain, cerebrum, diencephalon, hindbrain, and metencephalon, and grouped accordingly. Combination of the three different analyses clearly indicated that the ideal reference genes are ribosomal protien S5 (RPS5) in whole brain, RPL8 and RPS5 in whole body tissues, RPS5 and RPS19 in the forebrain and cerebrum, RPL32 and RPS19 in the diencephalon, GAPDH and RPS19 in the hindbrain, and MRPS7 and RPL13A in the metencephalon. These genes were identified as ideal for the normalization of qRT-PCR results in the respective tissues. These findings indicate more suitable and stable reference genes for future studies of canine gene expression.

Development of a TaqMan Array Card for Acute-Febrile-Illness Outbreak Investigation and Surveillance of Emerging Pathogens, Including Ebola Virus.

PubMed

Liu, Jie; Ochieng, Caroline; Wiersma, Steve; Ströher, Ute; Towner, Jonathan S; Whitmer, Shannon; Nichol, Stuart T; Moore, Christopher C; Kersh, Gilbert J; Kato, Cecilia; Sexton, Christopher; Petersen, Jeannine; Massung, Robert; Hercik, Christine; Crump, John A; Kibiki, Gibson; Maro, Athanasia; Mujaga, Buliga; Gratz, Jean; Jacob, Shevin T; Banura, Patrick; Scheld, W Michael; Juma, Bonventure; Onyango, Clayton O; Montgomery, Joel M; Houpt, Eric; Fields, Barry

2016-01-01

Acute febrile illness (AFI) is associated with substantial morbidity and mortality worldwide, yet an etiologic agent is often not identified. Convalescent-phase serology is impractical, blood culture is slow, and many pathogens are fastidious or impossible to cultivate. We developed a real-time PCR-based TaqMan array card (TAC) that can test six to eight samples within 2.5 h from sample to results and can simultaneously detect 26 AFI-associated organisms, including 15 viruses (chikungunya, Crimean-Congo hemorrhagic fever [CCHF] virus, dengue, Ebola virus, Bundibugyo virus, Sudan virus, hantaviruses [Hantaan and Seoul], hepatitis E, Marburg, Nipah virus, o'nyong-nyong virus, Rift Valley fever virus, West Nile virus, and yellow fever virus), 8 bacteria (Bartonella spp., Brucella spp., Coxiella burnetii, Leptospira spp., Rickettsia spp., Salmonella enterica and Salmonella enterica serovar Typhi, and Yersinia pestis), and 3 protozoa (Leishmania spp., Plasmodium spp., and Trypanosoma brucei). Two extrinsic controls (phocine herpesvirus 1 and bacteriophage MS2) were included to ensure extraction and amplification efficiency. Analytical validation was performed on spiked specimens for linearity, intra-assay precision, interassay precision, limit of detection, and specificity. The performance of the card on clinical specimens was evaluated with 1,050 blood samples by comparison to the individual real-time PCR assays, and the TAC exhibited an overall 88% (278/315; 95% confidence interval [CI], 84% to 92%) sensitivity and a 99% (5,261/5,326, 98% to 99%) specificity. This TaqMan array card can be used in field settings as a rapid screen for outbreak investigation or for the surveillance of pathogens, including Ebola virus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

New Deoxyribonucleic Acid Polymerase Induced by Bacillus subtilis Bacteriophage PBS2

PubMed Central

Price, Alan R.; Cook, Sandra J.

1972-01-01

The deoxyribonucleic acid (DNA) of Bacillus subtilis phage PBS2 has been confirmed to contain uracil instead of thymine. PBS2 phage infection of wild-type cells or DNA polymerase-deficient cells results in an increase in the specific activity of DNA polymerase. This induction of DNA polymerase activity is prevented by actinomycin D and chloramphenicol. In contrast to the major B. subtilis DNA polymerase, which prefers deoxythymidine triphosphate (dTTP) to deoxyuridine triphosphate (dUTP), the DNA polymerase in crude extracts of PBS2-infected cells is equally active whether dTTP or dUTP is employed. This phage-induced polymerase may be responsible for the synthesis of uracil-containing DNA during PBS2 phage infection. PMID:4623224

DNA polymerases eta and kappa exchange with the polymerase delta holoenzyme to complete common fragile site synthesis.

PubMed

Barnes, Ryan P; Hile, Suzanne E; Lee, Marietta Y; Eckert, Kristin A

2017-09-01

Common fragile sites (CFSs) are inherently unstable genomic loci that are recurrently altered in human tumor cells. Despite their instability, CFS are ubiquitous throughout the human genome and associated with large tumor suppressor genes or oncogenes. CFSs are enriched with repetitive DNA sequences, one feature postulated to explain why these loci are inherently difficult to replicate, and sensitive to replication stress. We have shown that specialized DNA polymerases (Pols) η and κ replicate CFS-derived sequences more efficiently than the replicative Pol δ. However, we lacked an understanding of how these enzymes cooperate to ensure efficient CFS replication. Here, we designed a model of lagging strand replication with RFC loaded PCNA that allows for maximal activity of the four-subunit human Pol δ holoenzyme, Pol η, and Pol κ in polymerase mixing assays. We discovered that Pol η and κ are both able to exchange with Pol δ stalled at repetitive CFS sequences, enhancing Normalized Replication Efficiency. We used this model to test the impact of PCNA mono-ubiquitination on polymerase exchange, and found no change in polymerase cooperativity in CFS replication compared with unmodified PCNA. Finally, we modeled replication stress in vitro using aphidicolin and found that Pol δ holoenzyme synthesis was significantly inhibited in a dose-dependent manner, preventing any replication past the CFS. Importantly, Pol η and κ were still proficient in rescuing this stalled Pol δ synthesis, which may explain, in part, the CFS instability phenotype of aphidicolin-treated Pol η and Pol κ-deficient cells. In total, our data support a model wherein Pol δ stalling at CFSs allows for free exchange with a specialized polymerase that is not driven by PCNA. Copyright © 2017 Elsevier B.V. All rights reserved.

NanoString nCounter® Approach in Breast Cancer: A Comparative Analysis with Quantitative Real-Time Polymerase Chain Reaction, In Situ Hybridization, and Immunohistochemistry.

PubMed

Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon

2017-09-01

Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srienc, Friedrich; Jackson, John K.; Somers, David A.

A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

The origin and early evolution of nucleic acid polymerases

NASA Technical Reports Server (NTRS)

Lazcano, A.; Cappello, R.; Valverde, V.; Llaca, V.; Oro, J.

1992-01-01

The hypothesis that vestiges of the ancestral RNA-dependent RNA polymerase involved in the replication of RNA genomes of Archean cells are present in the eubacterial RNA-polymerase beta-prime subunit and its homologues is discussed. It is shown that, in the DNA-dependent RNA polymerases from three cellular lineages, a very conserved sequence of eight amino acids, also found in a small RNA-binding site previously described for the E. coli polynucleotide phosphorylase and the S1 ribosomal protein, is present. The optimal conditions for the replicase activity of the avian-myeloblastosis-virus reverse transcriptase are presented. The evolutionary significance of the in vitro modifications of substrate and template specificities of RNA polymerases and reverse transcriptases is discussed.

Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

PubMed

Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E

2017-09-15

Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.

Repair of Clustered Damage and DNA Polymerase Iota.

PubMed

Belousova, E A; Lavrik, O I

2015-08-01

Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

PubMed

Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

2018-02-01

Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable

Mammalian proliferating cell nuclear antigen stimulates the processivity of two wheat embryo DNA polymerases.

PubMed Central

Laquel, P; Litvak, S; Castroviejo, M

1993-01-01

Multiple DNA polymerases have been described in all organisms studied to date. Their specific functions are not easy to determine, except when powerful genetic and/or biochemical tools are available. However, the processivity of a DNA polymerase could reflect the physiological role of the enzyme. In this study, analogies between plant and animal DNA polymerases have been investigated by analyzing the size of the products synthesized by wheat DNA polymerases A, B, CI, and CII as a measure of their processivity. Thus, incubations have been carried out with poly(dA)-oligo(dT) as a template-primer under varying assay conditions. In the presence of MgCl2, DNA polymerase A was highly processive, whereas DNA polymerases B, CI, and CII synthesized much shorter products. With MnCl2 instead of MgCl2, DNA polymerase A was highly processive, DNA polymerases B and CII were moderately processive, and DNA polymerase CI remained strictly distributive. The effect of calf thymus proliferating cell nuclear antigen (PCNA) on wheat polymerases was studied as described for animal DNA polymerases. The high processivity of DNA polymerase A was PCNA independent, whereas both enzyme activity and processivity of wheat DNA polymerases B and CII were significantly stimulated by PCNA. On the other hand, DNA polymerase CI was not stimulated by PCNA and, like animal DNA polymerase beta, was distributive in all cases. From these results, we propose that wheat DNA polymerase A could correspond to a DNA polymerase alpha, DNA polymerases B and CII could correspond to the delta-like enzyme, and DNA polymerase CI could correspond to DNA polymerase beta. PMID:7906418

Adhesion of mutans streptococci to self-ligating ceramic brackets: in vivo quantitative analysis with real-time polymerase chain reaction.

PubMed

Jung, Woo-Sun; Yang, Il-Hyung; Lim, Won Hee; Baek, Seung-Hak; Kim, Tae-Woo; Ahn, Sug-Joon

2015-12-01

To analyze in vivo mutans streptococci (MS) adhesion to self-ligating ceramic brackets [Clarity-SL (CSL) and Clippy-C (CC)] and the relationships between bacterial adhesion and oral hygiene indices. Four central incisor brackets from the maxilla and mandible were collected from 40 patients (20 patients per each bracket type) at debonding immediately after plaque and gingival indices were measured. Adhesions of Streptococcus mutans, S. sobrinus, and total bacteria were quantitatively determined using real-time polymerase chain reaction after genomic DNA was extracted. Factorial analysis of variance was used to analyze bacterial adhesion to the brackets with respect to the bracket type and jaw position. Correlation coefficients were calculated to determine the relationships of bacterial adhesion to oral hygiene indices. Adhesion of total bacteria and S. mutans to CSL was higher than that to CC (P < 0.001). Adhesion of total bacteria to the mandibular brackets was higher than that to the maxillary ones (P < 0.001), while adhesion of S. mutans to the maxillary brackets were higher than that in the mandibular ones (P < 0.001). In particular, the proportion of S. mutans to total bacteria in CSL was higher than CC (P < 0.05) in the maxillary anterior teeth (P < 0.001). There were no significant differences in adhesion of S. sobrinus between the brackets and jaw positions. Interestingly, no significant relationships were found between bacterial adhesions and oral hygiene indices. Complex bracket configurations may significantly influence bacterial adhesion to orthodontic brackets. Further in vivo study using bracket raw materials will help to define the relationships between bacteria adhesion and enamel demineralization. Because oral hygiene indices were not significantly correlated with adhesions of MS to self-ligating ceramic brackets, careful examinations around the brackets should be needed to prevent enamel demineralization, regardless of oral hygiene status. © The

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

DNA Polymerase in Virions of a Reptilian Type C Virus

PubMed Central

Twardzik, Daniel R.; Papas, Takis S.; Portugal, Frank H.

1974-01-01

A study was made of the DNA polymerase of reptilian type C virus isolated from Russell's viper spleen cells. Simultaneous detection experiments demonstrated the presence of 70S RNA and RNA-dependent DNA polymerase activity in reptilian type C virions. The endogenous activity was dependent on the addition of all four deoxynucleotide triphosphates and demonstrated an absolute requirement for a divalent cation. The reptilian viral DNA polymerase elutes from phosphocellulose at 0.22 M salt. In this respect, it is similar to the avian (avian myeloblastosis virus; AMV) viral enzyme but is different from the mammalian (Rauscher leukemia virus; RLV) viral enzyme which elutes at 0.4 M salt. The molecular weight of the viper DNA polymerase as estimated from glycerol gradient centrifugation is 109,000. It is a smaller enzyme than the AMV DNA polymerase (180,000 daltons) and somewhat larger than the RLV enzyme (70,000 daltons). A comparison of other properties of the type C reptilian DNA polymerase with the enzyme found in other type C oncogenic viruses is made. PMID:4129837

Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao Hongbin; Banh, Alice; Kwok, Shirley

Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

A meiotic DNA polymerase from a mushroom, Agaricus bisporus.

PubMed Central

Takami, K; Matsuda, S; Sono, A; Sakaguchi, K

1994-01-01

A meiotic DNA polymerase [DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7], which likely has a role in meiotic DNA repair, was isolated from a mushroom, Agaricus bisporus. The purified fraction displays three bands in SDS/PAGE, at molecular masses of 72 kDa, 65 kDa and 36 kDa. Optimal activity is at pH 7.0-8.0 in the presence of 5 mM Mg2+ and 50 mM KCl and at 28-30 degrees C, which is the temperature for meiosis. This enzyme is resistant to N-ethylmaleimide and sensitive to 2',3'-dideoxythymidine 5'-triphosphate, suggesting that it is a beta-like DNA polymerase. These characteristics are similar to those of Coprinus DNA polymerase beta [Sakaguchi and Lu (1982) Mol. Cell. Biol. 2, 752-757]. In Western-blot analysis, the antiserum against the Coprinus polymerase reacts only with the 65 kDa band, which coincides with the molecular mass of the Coprinus polymerase. Western-blot analysis also showed that the antiserum could react with crude extracts not only from the Agaricales family, to which Agaricus and Coprinus belong, but also from different mushroom families and Saccharomyces. The Agaricus polymerase activity can be found only in the meiotic-cell-rich fraction, but the enzyme is also present in the somatic cells in an inactive state. Images Figure 2 Figure 5 Figure 6 PMID:8172591

Functional Architecture of T7 RNA Polymerase Transcription Complexes

PubMed Central

Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

2007-01-01

Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription

PubMed Central

Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-01-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.

PubMed

Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-03-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Heat-mediated activation of affinity-immobilized Taq DNA polymerase.

PubMed

Nilsson, J; Bosnes, M; Larsen, F; Nygren, P A; Uhlén, M; Lundeberg, J

1997-04-01

A novel strategy for heat-mediated activation of recombinant Taq DNA polymerase is described. A serum albumin binding protein tag is used to affinity-immobilize an E. coli-expressed Taq DNA polymerase fusion protein onto a solid support coated with human serum albumin (HSA). Analysis of heat-mediated elution showed that elevated temperatures (> 70 degrees C) were required to significantly release the fusion protein from the solid support. A primer-extension assay showed that immobilization of the fusion protein resulted in little or no extension product. In contrast, fusion protein released from the HSA ligand by heat showed high polymerase activity. Thus, a heat-mediated release and reactivation of the Taq DNA polymerase fusion protein from the solid support can be obtained to allow for hot-start PCR with improved amplification performance.

Identification of suitable reference genes for hepatic microRNA quantitation.

PubMed

Lamba, Vishal; Ghodke-Puranik, Yogita; Guan, Weihua; Lamba, Jatinder K

2014-03-07

MicroRNAs (miRNAs) are short (~22 nt) endogenous RNAs that play important roles in regulating expression of a wide variety of genes involved in different cellular processes. Alterations in microRNA expression patterns have been associated with a number of human diseases. Accurate quantitation of microRNA levels is important for their use as biomarkers and in determining their functions. Real time PCR is the gold standard and the most frequently used technique for miRNA quantitation. Real time PCR data analysis includes normalizing the amplification data to suitable endogenous control/s to ensure that microRNA quantitation is not affected by the variability that is potentially introduced at different experimental steps. U6 (RNU6A) and RNU6B are two commonly used endogenous controls in microRNA quantitation. The present study was designed to investigate inter-individual variability and gender differences in hepatic microRNA expression as well as to identify the best endogenous control/s that could be used for normalization of real-time expression data in liver samples. We used Taqman based real time PCR to quantitate hepatic expression levels of 22 microRNAs along with U6 and RNU6B in 50 human livers samples (25 M, 25 F). To identify the best endogenous controls for use in data analysis, we evaluated the amplified candidates for their stability (least variability) in expression using two commonly used software programs: Normfinder and GeNormplus, Both Normfinder and GeNormplus identified U6 to be among the least stable of all the candidates analyzed, and RNU6B was also not among the top genes in stability. mir-152 and mir-23b were identified to be the two most stable candidates by both Normfinder and GeNormplus in our analysis, and were used as endogenous controls for normalization of hepatic miRNA levels. Measurements of microRNA stability indicate that U6 and RNU6B are not suitable for use as endogenous controls for normalizing microRNA relative quantitation

The translesion DNA polymerases Pol ζ and Rev1 are activated independently of PCNA ubiquitination upon UV radiation in mutants of DNA polymerase δ

PubMed Central

Ma, Emilie; Veaute, Xavier; Coïc, Eric

2017-01-01

Replicative DNA polymerases cannot insert efficiently nucleotides at sites of base lesions. This function is taken over by specialized translesion DNA synthesis (TLS) polymerases to allow DNA replication completion in the presence of DNA damage. In eukaryotes, Rad6- and Rad18-mediated PCNA ubiquitination at lysine 164 promotes recruitment of TLS polymerases, allowing cells to efficiently cope with DNA damage. However, several studies showed that TLS polymerases can be recruited also in the absence of PCNA ubiquitination. We hypothesized that the stability of the interactions between DNA polymerase δ (Pol δ) subunits and/or between Pol δ and PCNA at the primer/template junction is a crucial factor to determine the requirement of PCNA ubiquitination. To test this hypothesis, we used a structural mutant of Pol δ in which the interaction between Pol3 and Pol31 is inhibited. We found that in yeast, rad18Δ-associated UV hypersensitivity is suppressed by pol3-ct, a mutant allele of the POL3 gene that encodes the catalytic subunit of replicative Pol δ. pol3-ct suppressor effect was specifically dependent on the Rev1 and Pol ζ TLS polymerases. This result strongly suggests that TLS polymerases could rely much less on PCNA ubiquitination when Pol δ interaction with PCNA is partially compromised by mutations. In agreement with this model, we found that the pol3-FI allele suppressed rad18Δ-associated UV sensitivity as observed for pol3-ct. This POL3 allele carries mutations within a putative PCNA Interacting Peptide (PIP) motif. We then provided molecular and genetic evidence that this motif could contribute to Pol δ-PCNA interaction indirectly, although it is not a bona fide PIP. Overall, our results suggest that the primary role of PCNA ubiquitination is to allow TLS polymerases to outcompete Pol δ for PCNA access upon DNA damage. PMID:29281621

Independent Structural Domains in Paramyxovirus Polymerase Protein*

PubMed Central

Dochow, Melanie; Krumm, Stefanie A.; Crowe, James E.; Moore, Martin L.; Plemper, Richard K.

2012-01-01

All enzymatic activities required for genomic replication and transcription of nonsegmented negative strand RNA viruses (or Mononegavirales) are believed to be concentrated in the viral polymerase (L) protein. However, our insight into the organization of these different enzymatic activities into a bioactive tertiary structure remains rudimentary. Fragments of Mononegavirales polymerases analyzed to date cannot restore bioactivity through trans-complementation, unlike the related L proteins of segmented NSVs. We investigated the domain organization of phylogenetically diverse Paramyxovirus L proteins derived from measles virus (MeV), Nipah virus (NiV), and respiratory syncytial virus (RSV). Through a comprehensive in silico and experimental analysis of domain intersections, we defined MeV L position 615 as an interdomain candidate in addition to the previously reported residue 1708. Only position 1708 of MeV and the homologous positions in NiV and RSV L also tolerated the insertion of epitope tags. Splitting of MeV L at residue 1708 created fragments that were unable to physically interact and trans-complement, but strikingly, these activities were reconstituted by the addition of dimerization tags to the fragments. Equivalently split fragments of NiV, RSV, and MeV L oligomerized with comparable efficiency in all homo- and heterotypic combinations, but only the homotypic pairs were able to trans-complement. These results demonstrate that synthesis as a single polypeptide is not required for the Mononegavirales polymerases to adopt a proper tertiary conformation. Paramyxovirus polymerases are composed of at least two truly independent folding domains that lack a traditional interface but require molecular compatibility for bioactivity. The functional probing of the L domain architecture through trans-complementation is anticipated to be applicable to all Mononegavirales polymerases. PMID:22215662

Poly(A) polymerase contains multiple functional domains.

PubMed Central

Raabe, T; Murthy, K G; Manley, J L

1994-01-01

Poly(A) polymerase (PAP) contains regions of similarity with several known protein domains. Through site-directed mutagenesis, we provide evidence that PAP contains a functional ribonucleoprotein-type RNA binding domain (RBD) that is responsible for primer binding, making it the only known polymerase to contain such a domain. The RBD is adjacent to, and probably overlaps with, an apparent catalytic region responsible for polymerization. Despite the presence of sequence similarities, this catalytic domain appears to be distinct from the conserved polymerase module found in a large number of RNA-dependent polymerases. PAP contains two nuclear localization signals (NLSs) in its C terminus, each by itself similar to the consensus bipartite NLS found in many nuclear proteins. Mutagenesis experiments indicate that both signals, which are separated by nearly 140 residues, play important roles in directing PAP exclusively to the nucleus. Surprisingly, basic amino acids in the N-terminal-most NLS are also essential for AAUAAA-dependent polyadenylation but not for nonspecific poly(A) synthesis, suggesting that this region of PAP is involved in interactions both with nuclear targeting proteins and with nuclear polyadenylation factors. The serine/threonine-rich C terminus is multiply phosphorylated, including at sites affected by mutations in either NLS. Images PMID:8164653

Differences in AMY1 Gene Copy Numbers Derived from Blood, Buccal Cells and Saliva Using Quantitative and Droplet Digital PCR Methods: Flagging the Pitfall.

PubMed

Ooi, Delicia Shu Qin; Tan, Verena Ming Hui; Ong, Siong Gim; Chan, Yiong Huak; Heng, Chew Kiat; Lee, Yung Seng

2017-01-01

The human salivary (AMY1) gene, encoding salivary α-amylase, has variable copy number variants (CNVs) in the human genome. We aimed to determine if real-time quantitative polymerase chain reaction (qPCR) and the more recently available Droplet Digital PCR (ddPCR) can provide a precise quantification of the AMY1 gene copy number in blood, buccal cells and saliva samples derived from the same individual. Seven participants were recruited and DNA was extracted from the blood, buccal cells and saliva samples provided by each participant. Taqman assay real-time qPCR and ddPCR were conducted to quantify AMY1 gene copy numbers. Statistical analysis was carried out to determine the difference in AMY1 gene copy number between the different biological specimens and different assay methods. We found significant within-individual difference (p<0.01) in AMY1 gene copy number between different biological samples as determined by qPCR. However, there was no significant within-individual difference in AMY1 gene copy number between different biological samples as determined by ddPCR. We also found that AMY1 gene copy number of blood samples were comparable between qPCR and ddPCR, while there is a significant difference (p<0.01) between AMY1 gene copy numbers measured by qPCR and ddPCR for both buccal swab and saliva samples. Despite buccal cells and saliva samples being possible sources of DNA, it is pertinent that ddPCR or a single biological sample, preferably blood sample, be used for determining highly polymorphic gene copy numbers like AMY1, due to the large within-individual variability between different biological samples if real time qPCR is employed.

General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.

PubMed

Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun

2018-02-19

DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.

3D-QSAR and molecular docking studies on designing inhibitors of the hepatitis C virus NS5B polymerase

NASA Astrophysics Data System (ADS)

Li, Wenlian; Si, Hongzong; Li, Yang; Ge, Cuizhu; Song, Fucheng; Ma, Xiuting; Duan, Yunbo; Zhai, Honglin

2016-08-01

Viral hepatitis C infection is one of the main causes of the hepatitis after blood transfusion and hepatitis C virus (HCV) infection is a global health threat. The HCV NS5B polymerase, an RNA dependent RNA polymerase (RdRp) and an essential role in the replication of the virus, has no functional equivalent in mammalian cells. So the research and development of efficient NS5B polymerase inhibitors provides a great strategy for antiviral therapy against HCV. A combined three-dimensional quantitative structure-activity relationship (QSAR) modeling was accomplished to profoundly understand the structure-activity correlation of a train of indole-based inhibitors of the HCV NS5B polymerase to against HCV. A comparative molecular similarity indices analysis (COMSIA) model as the foundation of the maximum common substructure alignment was developed. The optimum model exhibited statistically significant results: the cross-validated correlation coefficient q2 was 0.627 and non-cross-validated r2 value was 0.943. In addition, the results of internal validations of bootstrapping and Y-randomization confirmed the rationality and good predictive ability of the model, as well as external validation (the external predictive correlation coefficient rext2 = 0.629). The information obtained from the COMSIA contour maps enables the interpretation of their structure-activity relationship. Furthermore, the molecular docking study of the compounds for 3TYV as the protein target revealed important interactions between active compounds and amino acids, and several new potential inhibitors with higher activity predicted were designed basis on our analyses and supported by the simulation of molecular docking. Meanwhile, the OSIRIS Property Explorer was introduced to help select more satisfactory compounds. The satisfactory results from this study may lay a reliable theoretical base for drug development of hepatitis C virus NS5B polymerase inhibitors.

Family A and B DNA Polymerases in Cancer: Opportunities for Therapeutic Interventions

PubMed Central

Shanbhag, Vinit; Sachdev, Shrikesh; Flores, Jacqueline A.; Modak, Mukund J.; Singh, Kamalendra

2018-01-01

DNA polymerases are essential for genome replication, DNA repair and translesion DNA synthesis (TLS). Broadly, these enzymes belong to two groups: replicative and non-replicative DNA polymerases. A considerable body of data suggests that both groups of DNA polymerases are associated with cancer. Many mutations in cancer cells are either the result of error-prone DNA synthesis by non-replicative polymerases, or the inability of replicative DNA polymerases to proofread mismatched nucleotides due to mutations in 3′-5′ exonuclease activity. Moreover, non-replicative, TLS-capable DNA polymerases can negatively impact cancer treatment by synthesizing DNA past lesions generated from treatments such as cisplatin, oxaliplatin, etoposide, bleomycin, and radiotherapy. Hence, the inhibition of DNA polymerases in tumor cells has the potential to enhance treatment outcomes. Here, we review the association of DNA polymerases in cancer from the A and B families, which participate in lesion bypass, and conduct gene replication. We also discuss possible therapeutic interventions that could be used to maneuver the role of these enzymes in tumorigenesis. PMID:29301327

Eukaryotic DNA polymerase ζ

PubMed Central

Makarova, Alena V.; Burgers, Peter M.

2015-01-01

This review focuses on eukaryotic DNA polymerase ζ (Pol ζ), the enzyme responsible for the bulk of mutagenesis in eukaryotic cells in response to DNA damage. Pol ζ is also responsible for a large portion of mutagenesis during normal cell growth, in response to spontaneous damage or to certain DNA structures and other blocks that stall DNA replication forks. Novel insights in mutagenesis have been derived from recent advances in the elucidation of the subunit structure of Pol ζ. The lagging strand DNA polymerase δ shares the small Pol31 and Pol32 subunits with the Rev3-Rev7 core assembly giving a four subunit Pol ζ complex that is the active form in mutagenesis. Furthermore, Pol ζ forms essential interactions with the mutasome assembly factor Rev1 and with proliferating cell nuclear antigen (PCNA). These interactions are modulated by posttranslational modifications such as ubiquitination and phosphorylation that enhance translesion synthesis (TLS) and mutagenesis. PMID:25737057

A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-dependent RNA polymerase.

PubMed

Niyomrattanakit, Pornwaratt; Abas, Siti Nurdiana; Lim, Chin Chin; Beer, David; Shi, Pei-Yong; Chen, Yen-Liang

2011-02-01

The flaviviral RNA-dependent RNA polymerase (RdRp) is an attractive drug target. To discover new inhibitors of dengue virus RdRp, the authors have developed a fluorescence-based alkaline phosphatase-coupled polymerase assay (FAPA) for high-throughput screening (HTS). A modified nucleotide analogue (2'-[2-benzothiazoyl]-6'-hydroxybenzothiazole) conjugated adenosine triphosphate (BBT-ATP) and 3'UTR-U(30) RNA were used as substrates. After the polymerase reaction, treatment with alkaline phosphatase liberates the BBT fluorophore from the polymerase reaction by-product, BBT(PPi), which can be detected at excitation and emission wavelengths of 422 and 566 nm, respectively. The assay was evaluated by examining the time dependency, assay reagent effects, reaction kinetics, and signal stability and was validated with 3'dATP and an adenosine-nucleotide triphosphate inhibitor, giving IC(50) values of 0.13 µM and 0.01 µM, respectively. A pilot screen of a diverse compound library of 40,572 compounds at 20 µM demonstrated good performance with an average Z factor of 0.81. The versatility and robustness of FAPA were evaluated with another substrate system, BBT-GTP paired with 3'UTR-C(30) RNA. The FAPA method presented here can be readily adapted for other nucleotide-dependent enzymes that generate PPi.

Stochastic resetting in backtrack recovery by RNA polymerases

NASA Astrophysics Data System (ADS)

Roldán, Édgar; Lisica, Ana; Sánchez-Taltavull, Daniel; Grill, Stephan W.

2016-06-01

Transcription is a key process in gene expression, in which RNA polymerases produce a complementary RNA copy from a DNA template. RNA polymerization is frequently interrupted by backtracking, a process in which polymerases perform a random walk along the DNA template. Recovery of polymerases from the transcriptionally inactive backtracked state is determined by a kinetic competition between one-dimensional diffusion and RNA cleavage. Here we describe backtrack recovery as a continuous-time random walk, where the time for a polymerase to recover from a backtrack of a given depth is described as a first-passage time of a random walker to reach an absorbing state. We represent RNA cleavage as a stochastic resetting process and derive exact expressions for the recovery time distributions and mean recovery times from a given initial backtrack depth for both continuous and discrete-lattice descriptions of the random walk. We show that recovery time statistics do not depend on the discreteness of the DNA lattice when the rate of one-dimensional diffusion is large compared to the rate of cleavage.

Expression levels of seven candidate genes in human peripheral blood mononuclear cells and their association with preeclampsia

PubMed Central

Garza-Veloz, I.; Carrillo-Sanchez, K.; Martinez-Gaytan, V.; Cortes-Flores, R.; Ochoa-Torres, M. A.; Guerrero, G. G.; Rodriguez-Sanchez, I. P.; Cancela-Murrieta, C. O.; Zamudio-Osuna, M.; Badillo-Almaraz, J. I.; Castruita-De la Rosa, C.

2014-01-01

Objective To evaluate the peripheral blood mononuclear cell (PBMC) expression levels of hemeoxygenase 1 (HMOX-1), superoxide dismutase 1 (SOD-1), vascular endothelial growth factor A (VEGF-A), transforming growth factor beta 1 (TGF-β1), interleukin (IL)-6, IL-15 and AdipoQ genes to study their association with preeclampsia (PE). Methods A total of 177 pregnant women were recruited: 108 cases and 69 controls. Quantification of gene expression was measured by quantitative real-time polymerase chain reaction (PCR) using TaqMan probes. Results Underexpression of VEGF-A and TGF-β1 was a constant in most of the cases (80.91% and 76.36%, respectively) and their expression was associated with onset and/or severity of disease (p values < 0.05). IL-6, IL-15 and AdipoQ, showed low or no expression in PBMC samples evaluated. Conclusion PBMC underexpression of VEGF-A and TGF-β1 is a hallmark of PE in the study population. PMID:24295154

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

PubMed Central

Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

2005-01-01

Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

New approaches for the standardization and validation of a real-time qPCR assay using TaqMan probes for quantification of yellow fever virus on clinical samples with high quality parameters.

PubMed

Fernandes-Monteiro, Alice G; Trindade, Gisela F; Yamamura, Anna M Y; Moreira, Otacilio C; de Paula, Vanessa S; Duarte, Ana Cláudia M; Britto, Constança; Lima, Sheila Maria B

2015-01-01

The development and production of viral vaccines, in general, involve several steps that need the monitoring of viral load throughout the entire process. Applying a 2-step quantitative reverse transcription real time PCR assay (RT-qPCR), viral load can be measured and monitored in a few hours. In this context, the development, standardization and validation of a RT-qPCR test to quickly and efficiently quantify yellow fever virus (YFV) in all stages of vaccine production are extremely important. To serve this purpose we used a plasmid construction containing the NS5 region from 17DD YFV to generate the standard curve and to evaluate parameters such as linearity, precision and specificity against other flavivirus. Furthermore, we defined the limits of detection as 25 copies/reaction, and quantification as 100 copies/reaction for the test. To ensure the quality of the method, reference controls were established in order to avoid false negative results. The qRT-PCR technique based on the use of TaqMan probes herein standardized proved to be effective for determining yellow fever viral load both in vivo and in vitro, thus becoming a very important tool to assure the quality control for vaccine production and evaluation of viremia after vaccination or YF disease.

New approaches for the standardization and validation of a real-time qPCR assay using TaqMan probes for quantification of yellow fever virus on clinical samples with high quality parameters

PubMed Central

Fernandes-Monteiro, Alice G; Trindade, Gisela F; Yamamura, Anna MY; Moreira, Otacilio C; de Paula, Vanessa S; Duarte, Ana Cláudia M; Britto, Constança; Lima, Sheila Maria B

2015-01-01

The development and production of viral vaccines, in general, involve several steps that need the monitoring of viral load throughout the entire process. Applying a 2-step quantitative reverse transcription real time PCR assay (RT-qPCR), viral load can be measured and monitored in a few hours. In this context, the development, standardization and validation of a RT-qPCR test to quickly and efficiently quantify yellow fever virus (YFV) in all stages of vaccine production are extremely important. To serve this purpose we used a plasmid construction containing the NS5 region from 17DD YFV to generate the standard curve and to evaluate parameters such as linearity, precision and specificity against other flavivirus. Furthermore, we defined the limits of detection as 25 copies/reaction, and quantification as 100 copies/reaction for the test. To ensure the quality of the method, reference controls were established in order to avoid false negative results. The qRT-PCR technique based on the use of TaqMan probes herein standardized proved to be effective for determining yellow fever viral load both in vivo and in vitro, thus becoming a very important tool to assure the quality control for vaccine production and evaluation of viremia after vaccination or YF disease. PMID:26011746

Polymerase III transcription factor B activity is reduced in extracts of growth-restricted cells.

PubMed Central

Tower, J; Sollner-Webb, B

1988-01-01

Extracts of cells that are down-regulated for transcription by RNA polymerase I and RNA polymerase III exhibit a reduced in vitro transcriptional capacity. We have recently demonstrated that the down-regulation of polymerase I transcription in extracts of cycloheximide-treated and stationary-phase cells results from a lack of an activated subform of RNA polymerase I which is essential for rDNA transcription. To examine whether polymerase III transcriptional down-regulation occurs by a similar mechanism, the polymerase III transcription factors were isolated and added singly and in pairs to control cell extracts and to extracts of cells that had reduced polymerase III transcriptional activity due to cycloheximide treatment or growth into stationary phase. These down-regulations result from a specific reduction in TFIIIB; TFIIIC and polymerase III activities remain relatively constant. Thus, although transcription by both polymerase III and polymerase I is substantially decreased in extracts of growth-arrested cells, this regulation is brought about by reduction of different kinds of activities: a component of the polymerase III stable transcription complex in the former case and the activated subform of RNA polymerase I in the latter. Images PMID:3352599

Real-time PCR to determine transgene copy number and to quantitate the biolocalization of adoptively transferred cells from EGFP-transgenic mice.

PubMed

Joshi, Molishree; Keith Pittman, H; Haisch, Carl; Verbanac, Kathryn

2008-09-01

Quantitative real-time PCR (qPCR) is a sensitive technique for the detection and quantitation of specific DNA sequences. Here we describe a Taqman qPCR assay for quantification of tissue-localized, adoptively transferred enhanced green fluorescent protein (EGFP)-transgenic cells. A standard curve constructed from serial dilutions of a plasmid containing the EGFP transgene was (i) highly reproducible, (ii) detected as few as two copies, and (iii) was included in each qPCR assay. qPCR analysis of genomic DNA was used to determine transgene copy number in several mouse strains. Fluorescent microscopy of tissue sections showed that adoptively transferred vascular endothelial cells (VEC) from EGFP-transgenic mice specifically localized to tissue with metastatic tumors in syngeneic recipients. VEC microscopic enumeration of liver metastases strongly correlated with qPCR analysis of identical sections (Pearson correlation 0.81). EGFP was undetectable in tissue from control mice by qPCR. In another study using intra-tumor EGFP-VEC delivery to subcutaneous tumors, manual cell count and qPCR analysis of alternating sections also strongly correlated (Pearson correlation 0.82). Confocal microscopy of the subcutaneous tumor sections determined that visual fluorescent signals were frequently tissue artifacts. This qPCR methodology offers specific, objective, and rapid quantitation, uncomplicated by tissue autofluorescence, and should be readily transferable to other in vivo models to quantitate the biolocalization of transplanted cells.

Development of TaqMan probes targeting the four major celiac disease epitopes found in α-gliadin sequences of spelt (Triticum aestivum ssp. spelta) and bread wheat (Triticum aestivum ssp. aestivum).

PubMed

Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique

2017-01-01

Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the

RNA Polymerase II Elongation Control

PubMed Central

Zhou, Qiang; Li, Tiandao; Price, David H.

2014-01-01

Regulation of the elongation phase of transcription by RNA Polymerase II (Pol II) is utilized extensively to generate the pattern of mRNAs needed to specify cell types and to respond to environmental changes. After Pol II initiates, negative elongation factors cause it to pause in a promoter proximal position. These polymerases are poised to respond to the positive transcription elongation factor, P-TEFb, and then enter productive elongation only under the appropriate set of signals to generate full length properly processed mRNAs. Recent global analyses of Pol II and elongation factors, mechanisms that regulate P-TEFb involving the 7SK snRNP, factors that control both the negative and positive elongation properties of Pol II and the mRNA processing events that are coupled with elongation are discussed. PMID:22404626

Quantitative real-time PCR method with internal amplification control to quantify cyclopiazonic acid producing molds in foods.

PubMed

Rodríguez, Alicia; Werning, María L; Rodríguez, Mar; Bermúdez, Elena; Córdoba, Juan J

2012-12-01

A quantitative TaqMan real-time PCR (qPCR) method that includes an internal amplification control (IAC) to quantify cyclopiazonic acid (CPA)-producing molds in foods has been developed. A specific primer pair (dmaTF/dmaTR) and a TaqMan probe (dmaTp) were designed on the basis of dmaT gene which encodes the enzyme dimethylallyl tryptophan synthase involved in the biosynthesis of CPA. The IAC consisted of a 105 bp chimeric DNA fragment containing a region of the hly gene of Listeria monocytogenes. Thirty-two mold reference strains representing CPA producers and non-producers of different mold species were used in this study. All strains were tested for CPA production by high-performance liquid chromatography-mass spectrometry (HPLC-MS). The functionality of the designed qPCR method was demonstrated by the high linear relationship of the standard curves relating to the dmaT gene copy numbers and the Ct values obtained from the different CPA producers tested. The ability of the qPCR protocol to quantify CPA-producing molds was evaluated in different artificially inoculated foods. A good linear correlation was obtained over the range 1-4 log cfu/g in the different food matrices. The detection limit in all inoculated foods ranged from 1 to 2 log cfu/g. This qPCR protocol including an IAC showed good efficiency to quantify CPA-producing molds in naturally contaminated foods avoiding false negative results. This method could be used to monitor the CPA producers in the HACCP programs to prevent the risk of CPA formation throughout the food chain. Copyright © 2012 Elsevier Ltd. All rights reserved.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

PubMed Central

2010-01-01

Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-10-20

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-11-03

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Analytical Performance of a Multiplex Real-Time PCR Assay Using TaqMan Probes for Quantification of Trypanosoma cruzi Satellite DNA in Blood Samples

PubMed Central

Abate, Teresa; Cayo, Nelly M.; Parrado, Rudy; Bello, Zoraida Diaz; Velazquez, Elsa; Muñoz-Calderon, Arturo; Juiz, Natalia A.; Basile, Joaquín; Garcia, Lineth; Riarte, Adelina; Nasser, Julio R.; Ocampo, Susana B.; Yadon, Zaida E.; Torrico, Faustino; de Noya, Belkisyole Alarcón; Ribeiro, Isabela; Schijman, Alejandro G.

2013-01-01

Background The analytical validation of sensitive, accurate and standardized Real-Time PCR methods for Trypanosoma cruzi quantification is crucial to provide a reliable laboratory tool for diagnosis of recent infections as well as for monitoring treatment efficacy. Methods/Principal Findings We have standardized and validated a multiplex Real-Time quantitative PCR assay (qPCR) based on TaqMan technology, aiming to quantify T. cruzi satellite DNA as well as an internal amplification control (IAC) in a single-tube reaction. IAC amplification allows rule out false negative PCR results due to inhibitory substances or loss of DNA during sample processing. The assay has a limit of detection (LOD) of 0.70 parasite equivalents/mL and a limit of quantification (LOQ) of 1.53 parasite equivalents/mL starting from non-boiled Guanidine EDTA blood spiked with T. cruzi CL-Brener stock. The method was evaluated with blood samples collected from Chagas disease patients experiencing different clinical stages and epidemiological scenarios: 1- Sixteen Venezuelan patients from an outbreak of oral transmission, 2- Sixty three Bolivian patients suffering chronic Chagas disease, 3- Thirty four Argentinean cases with chronic Chagas disease, 4- Twenty seven newborns to seropositive mothers, 5- A seronegative receptor who got infected after transplantation with a cadaveric kidney explanted from an infected subject. Conclusions/Significance The performing parameters of this assay encourage its application to early assessment of T. cruzi infection in cases in which serological methods are not informative, such as recent infections by oral contamination or congenital transmission or after transplantation with organs from seropositive donors, as well as for monitoring Chagas disease patients under etiological treatment. PMID:23350002

Effect of pH on the Misincorporation Rate of DNA Polymerase η.

PubMed

Nishimoto, Naomi; Suzuki, Motoshi; Izuta, Shunji

2016-01-01

The many known eukaryotic DNA polymerases are classified into four families; A, B, X, and Y. Among them, DNA polymerase η, a Y family polymerase, is a low fidelity enzyme that contributes to translesional synthesis and somatic hypermutation. Although a high mutation frequency is observed in immunoglobulin genes, translesional synthesis occurs with a high accuracy. We determined whether the misincorporation rate of DNA polymerase η varies with ambient conditions. It has been reported that DNA polymerase η is unable to exclude water molecules from the active site. This finding suggests that some ions affect hydrogen bond formation at the active site. We focused on the effect of pH and evaluated the misincorporation rate of deoxyguanosine triphosphate (dGTP) opposite template T by DNA polymerase η at various pH levels with a synthetic template-primer. The misincorporation rate of dGTP by DNA polymerase η drastically increased at pH 8.0-9.0 compared with that at pH 6.5-7.5. Kinetic analysis revealed that the Km value for dGTP on the misincorporation opposite template T was markedly affected by pH. However, this drastic change was not seen with the low fidelity DNA polymerase α.

Structure of T7 RNA polymerase complexed to the transcriptional inhibitor T7 lysozyme.

PubMed Central

Jeruzalmi, D; Steitz, T A

1998-01-01

The T7 RNA polymerase-T7 lysozyme complex regulates phage gene expression during infection of Escherichia coli. The 2.8 A crystal structure of the complex reveals that lysozyme binds at a site remote from the polymerase active site, suggesting an indirect mechanism of inhibition. Comparison of the T7 RNA polymerase structure with that of the homologous pol I family of DNA polymerases reveals identities in the catalytic site but also differences specific to RNA polymerase function. The structure of T7 RNA polymerase presented here differs significantly from a previously published structure. Sequence similarities between phage RNA polymerases and those from mitochondria and chloroplasts, when interpreted in the context of our revised model of T7 RNA polymerase, suggest a conserved fold. PMID:9670025

Purine inhibitors of protein kinases, G proteins and polymerases

DOEpatents

Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

2001-07-03

The present invention relates to purine analogs that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such purine analogs to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

PubMed

Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L

2018-04-20

Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes

[Method validation according to ISO 15189 and SH GTA 04: application for the detection of KRAS mutations using PCR TaqMan assay].

PubMed

Harlé, Alexandre; Dubois, Cindy; Rouyer, Marie; Merlin, Jean-Louis

2013-01-01

Since January 16(th) 2010, the French legislation requires that the medical laboratories must be accredited according to ISO 15189 standards. Thus, all medical laboratories in France must be accredited for at least part of their biological tests before the end of October 2013. Molecular biology tests are also concerned by the accreditation. Validation of molecular biology methods is made difficult, for reasons related to the methods, but also by the type of analytes that are basically rare. This article describes the validation of the qualitative detection of KRAS mutations in metastatic colorectal cancer using TaqMan PCR according to ISO 15189 and to the technical guide for accreditation in Human Health, SH-GTA-04, edited by the COFRAC.

Modeling RNA polymerase interaction in mitochondria of chordates

PubMed Central

2012-01-01

Background In previous work, we introduced a concept, a mathematical model and its computer realization that describe the interaction between bacterial and phage type RNA polymerases, protein factors, DNA and RNA secondary structures during transcription, including transcription initiation and termination. The model accurately reproduces changes of gene transcription level observed in polymerase sigma-subunit knockout and heat shock experiments in plant plastids. The corresponding computer program and a user guide are available at http://lab6.iitp.ru/en/rivals. Here we apply the model to the analysis of transcription and (partially) translation processes in the mitochondria of frog, rat and human. Notably, mitochondria possess only phage-type polymerases. We consider the entire mitochondrial genome so that our model allows RNA polymerases to complete more than one circle on the DNA strand. Results Our model of RNA polymerase interaction during transcription initiation and elongation accurately reproduces experimental data obtained for plastids. Moreover, it also reproduces evidence on bulk RNA concentrations and RNA half-lives in the mitochondria of frog, human with or without the MELAS mutation, and rat with normal (euthyroid) or hyposecretion of thyroid hormone (hypothyroid). The transcription characteristics predicted by the model include: (i) the fraction of polymerases terminating at a protein-dependent terminator in both directions (the terminator polarization), (ii) the binding intensities of the regulatory protein factor (mTERF) with the termination site and, (iii) the transcription initiation intensities (initiation frequencies) of all promoters in all five conditions (frog, healthy human, human with MELAS syndrome, healthy rat, and hypothyroid rat with aberrant mtDNA methylation). Using the model, absolute levels of all gene transcription can be inferred from an arbitrary array of the three transcription characteristics, whereas, for selected genes only

Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

EPA Science Inventory

Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...

Quantitative Detection of Low-Abundance Transcripts at Single-Cell Level in Human Epidermal Keratinocytes by Digital Droplet Reverse Transcription-Polymerase Chain Reaction.

PubMed

Auvré, Frédéric; Coutier, Julien; Martin, Michèle T; Fortunel, Nicolas O

2018-05-08

Genetic and epigenetic characterization of the large cellular diversity observed within tissues is essential to understanding the molecular networks that ensure the regulation of homeostasis, repair, and regeneration, but also pathophysiological processes. Skin is composed of multiple cell lineages and is therefore fully concerned by this complexity. Even within one particular lineage, such as epidermal keratinocytes, different immaturity statuses or differentiation stages are represented, which are still incompletely characterized. Accordingly, there is presently great demand for methods and technologies enabling molecular investigation at single-cell level. Also, most current methods used to analyze gene expression at RNA level, such as RT-qPCR, do not directly provide quantitative data, but rather comparative ratios between two conditions. A second important need in skin biology is thus to determine the number of RNA molecules in a given cell sample. Here, we describe a workflow that we have set up to meet these specific needs, by means of transcript quantification in cellular micro-samples using flow cytometry sorting and reverse transcription-digital droplet polymerase chain reaction. As a proof-of-principle, the workflow was tested for the detection of transcription factor transcripts expressed at low levels in keratinocyte precursor cells. A linear correlation was found between quantification values and keratinocyte input numbers in a low quantity range from 40 cells to 1 cell. Interpretable signals were repeatedly obtained from single-cell samples corresponding to estimated expression levels as low as 10-20 transcript copies per keratinocyte or less. The present workflow may have broad applications for the detection and quantification of low-abundance nucleic acid species in single cells, opening up perspectives for the study of cell-to-cell genetic and molecular heterogeneity. Interestingly, the process described here does not require internal references

Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies

PubMed Central

Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran

2015-01-01

Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.

1997-12-02

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

1999-02-09

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

1997-12-02

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

1990-01-01

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.

1999-02-09

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.

Human DNA polymerase θ grasps the primer terminus to mediate DNA repair

DOE PAGES

Zahn, Karl E.; Averill, April M.; Aller, Pierre; ...

2015-03-16

DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less

Quantitative Real-Time Polymerase Chain Reaction for the Diagnosis of Mycoplasma genitalium Infection in South African Men With and Without Symptoms of Urethritis.

PubMed

le Roux, Marie Cecilia; Hoosen, Anwar Ahmed

2017-01-01

This study was done to diagnose Mycoplasma genitalium infection based on bacterial load in urine specimens from symptomatic and asymptomatic men. Urine specimens from 94 men with visible urethral discharge, 206 with burning on micturition and 75 without symptoms presenting to a family practitioner were tested for M. genitalium as well as Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis by transcription-mediated amplification assays. A quantitative polymerase chain reaction assay was used to determine the bacterial load for all specimens in which M. genitalium was the only organism detected. Among the 375 specimens collected, M. genitalium was detected in 59 (15.7%) men (both symptomatic and asymptomatic) using the transcription-mediated amplification assay, and in 45 (12.0%) of the total population, it was the only pathogen detected. One or more pathogens were detected in 129 (43%) of the symptomatic men, with N. gonorrhoeae in 50 (16.7%); C. trachomatis in 37 (12.3%) and T. vaginalis present in 24 (8.0%) patients. Among the 17 patients where mixed infections were detected, M. genitalium with N. gonorrhoeae was the most common (11/17; 64.7%). Patients with visible urethral discharge had significantly higher M. genitalium concentrations than those with burning on micturition. The median M. genitalium load in symptomatic men was significantly higher than that in asymptomatic men. This study confirms the high prevalence of M. genitalium among men with urethritis in South Africa and demonstrates that there is a strong association with M. genitalium bacterial load and clinical urethritis. As the number of organisms increased, the severity of the symptoms increased, an indication of the role that the organism plays in disease progression.

Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

USGS Publications Warehouse

Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

2011-01-01

Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

COMPARISON OF POPULATIONS OF MOULD SPECIES IN HOMES IN THE UK AND US USING MOLD-SPECIFIC QUANTITATIVE PCR (MSQPCR)

EPA Science Inventory

The goal of this research was to compare the populations of 81 mold species in homes in USA and UK using mould specific quantitative polymerase chain reaction (MSQPCR) technology. Dust samples were obtained from randomly selected homes in Great Britain (n=11). The mould populat...

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

PubMed

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Isolation and characterization of high affinity aptamers against DNA polymerase iota.

PubMed

Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V

2012-02-01

Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases

PubMed Central

Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

2002-01-01

Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475

Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases

PubMed Central

2015-01-01

The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and allow for efficient lesion bypass. Their promiscuous active sites, however, also lead to fidelities that are much lower than those observed for other DNA polymerases and give rise to interesting mechanistic properties. Additionally, the Y-family DNA polymerases have several other unique structural features and undergo a set of conformational changes during substrate binding and catalysis different from those observed for replicative DNA polymerases. In recent years, pre-steady-state kinetic methods have been extensively employed to reveal a wealth of information about the catalytic properties of these fascinating noncanonical DNA polymerases. Here, we review many of the recent findings on the kinetic mechanisms of DNA polymerization with undamaged and damaged DNA substrates by the Y-family DNA polymerases, and the conformational dynamics employed by these error-prone enzymes during catalysis. PMID:24716482

Purine inhibitors of protein kinases, G proteins and polymerases

DOEpatents

Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

2004-10-12

The present invention relates to 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

PubMed

Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

2017-04-15

Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

High-throughput Screening Identification of Poliovirus RNA-dependent RNA Polymerase Inhibitors

PubMed Central

Campagnola, Grace; Gong, Peng; Peersen, Olve B.

2011-01-01

Viral RNA-dependent RNA polymerase (RdRP) enzymes are essential for the replication of positive-strand RNA viruses and established targets for the development of selective antiviral therapeutics. In this work we have carried out a high-throughput screen of 154,267 compounds to identify poliovirus polymerase inhibitors using a fluorescence based RNA elongation assay. Screening and subsequent validation experiments using kinetic methods and RNA product analysis resulted in the identification of seven inhibitors that affect the RNA binding, initiation, or elongation activity of the polymerase. X-ray crystallography data show clear density for five of the compounds in the active site of the poliovirus polymerase elongation complex. The inhibitors occupy the NTP binding site by stacking on the priming nucleotide and interacting with the templating base, yet competition studies show fairly weak IC50 values in the low μM range. A comparison with nucleotide bound structures suggests that weak binding is likely due to the lack of a triphosphate group on the inhibitors. Consequently, the inhibitors are primarily effective at blocking polymerase initiation and do not effectively compete with NTP binding during processive elongation. These findings are discussed in the context of the polymerase elongation complex structure and allosteric control of the viral RdRP catalytic cycle. PMID:21722674

DNA Carrier Testing and Newborn Screening for Maple Syrup Urine Disease in Old Order Mennonite Communities

PubMed Central

Carleton, Stephanie M.; Peck, Dawn S.; Grasela, Julie; Dietiker, Kristin L.

2010-01-01

Maple syrup urine disease (MSUD) is an inherited metabolic disorder caused by mutations in the branched chain α-keto acid dehydrogenase complex. Worldwide incidence of MSUD is 1:225,000 live births. However, within Old Order Mennonite communities, the incidence is 1:150 live births and results from a common tyrosine to asparagine substitution (Y438N) in the E1α subunit of branched chain α-keto acid dehydrogenase. We developed a new DNA diagnostic assay utilizing TaqMan® technology and compared its efficacy, sensitivity, and duration with an existing polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) assay. Carrier testing was performed by both TaqMan technology and PCR-RFLP on DNA isolated from buccal swabs of 160 individuals as well as from buccal swabs and blood spots of nine at-risk newborns; assay time, sensitivity, and reliability were also evaluated. The TaqMan assay, like the PCR-RFLP assay, accurately determined Y438N E1α allele status. However, the TaqMan assay appeared (1) more sensitive than the PCR-RFLP assay, requiring 10-fold less DNA (10 ng) to reliably determine genotype status and (2) faster, reducing the assay time required for diagnosis from ∼12 to 5 h. TaqMan technology allowed more rapid DNA diagnoses of MSUD in the neonate, thereby reducing the likelihood of neurological impairment while enhancing health and prognosis for affected infants. PMID:20136525

Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

PubMed Central

2011-01-01

Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

EPA Science Inventory

Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

PCR performance of a thermostable heterodimeric archaeal DNA polymerase

PubMed Central

Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

2014-01-01

DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

Cloning and expression of the gene for bacteriophage T7 RNA polymerase

DOEpatents

Studier, F.W.; Davanloo, P.; Rosenberg, A.H.

1984-03-30

This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties.

Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR

PubMed Central

2010-01-01

Background Human papillomaviruses (HPVs) remain a serious world health problem due to their association with anogenital/oral cancers and warts. While over 100 HPV types have been identified, a subset is associated with malignancy. HPV16 and 18 are the most prevalent oncogenic types, while HPV6 and 11 are most commonly responsible for anogenital warts. While other quantitative PCR (qPCR) assays detect oncogenic HPV, there is no single tube assay distinguishing the most frequent oncogenic types and the most common types found in warts. Results A Sybr Green-based qPCR assay was developed utilizing degenerate primers to the highly conserved HPV E1 theoretically detecting any HPV type. A single tube multiplex qPCR assay was also developed using type-specific primer pairs and TaqMan probes that allowed for detection and quantitation of HPV6,11,16,18. Each HPV type was detected over a range from 2 × 101 to 2 × 106copies/reaction providing a reliable method of quantitating type-specific HPV in 140 anogenital/cutaneous/oral benign and malignant specimens. 35 oncogenic and low risk alpha genus HPV types were detected. Concordance was detected in previously typed specimens. Comparisons to the gold standard detected an overall sensitivity of 89% (95% CI: 77% - 96%) and specificity of 90% (95%CI: 52% - 98%). Conclusion There was good agreement between the ability of the qPCR assays described here to identify HPV types in malignancies previously typed using standard methods. These novel qPCR assays will allow rapid detection and quantitation of HPVs to assess their role in viral pathogenesis. PMID:20723234

Monitoring the dynamics of syntrophic β-oxidizing bacteria during anaerobic degradation of oleic acid by quantitative PCR.

PubMed

Ziels, Ryan M; Beck, David A C; Martí, Magalí; Gough, Heidi L; Stensel, H David; Svensson, Bo H

2015-04-01

The ecophysiology of long-chain fatty acid-degrading syntrophic β-oxidizing bacteria has been poorly understood due to a lack of quantitative abundance data. Here, TaqMan quantitative PCR (qPCR) assays targeting the 16S rRNA gene of the known mesophilic syntrophic β-oxidizing bacterial genera Syntrophomonas and Syntrophus were developed and validated. Microbial community dynamics were followed using qPCR and Illumina-based high-throughput amplicon sequencing in triplicate methanogenic bioreactors subjected to five consecutive batch feedings of oleic acid. With repeated oleic acid feeding, the initial specific methane production rate significantly increased along with the relative abundances of Syntrophomonas and methanogenic archaea in the bioreactor communities. The novel qPCR assays showed that Syntrophomonas increased from 7 to 31% of the bacterial community 16S rRNA gene concentration, whereas that of Syntrophus decreased from 0.02 to less than 0.005%. High-throughput amplicon sequencing also revealed that Syntrophomonas became the dominant genus within the bioreactor microbiomes. These results suggest that increased specific mineralization rates of oleic acid were attributed to quantitative shifts within the microbial communities toward higher abundances of syntrophic β-oxidizing bacteria and methanogenic archaea. The novel qPCR assays targeting syntrophic β-oxidizing bacteria may thus serve as monitoring tools to indicate the fatty acid β-oxidization potential of anaerobic digester communities. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Rapid and Reliable Genotyping of HLA-B*57:01 in Four Chinese Populations Using a Single-Tube Duplex Real-Time Polymerase Chain Reaction Assay.

PubMed

Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan

2017-07-01

HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.

Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

PubMed

Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

2017-01-01

Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

Large-scale screening and molecular characterization of EML4-ALK fusion variants in archival non-small-cell lung cancer tumor specimens using quantitative reverse transcription polymerase chain reaction assays.

PubMed

Li, Tianhong; Maus, Martin K H; Desai, Sonal J; Beckett, Laurel A; Stephens, Craig; Huang, Eric; Hsiang, Jack; Zeger, Gary; Danenberg, Kathleen D; Astrow, Stephanie H; Gandara, David R

2014-01-01

The objective of this study was to identify and characterize echinoderm microtubule-associated protein-like 4 anaplastic lymphoma kinase fusion (EML4-ALK+) cancers by variant-specific, quantitative reverse transcription polymerase chain reaction (RT-PCR) assays in a large cohort of North American non-small-cell lung cancer (NSCLC) patients. We developed a panel of single and multiplex RT-PCR assays suitable for rapid and accurate detection of the eight most common EML4-ALK+ variants and ALK gene expression in archival formalin-fixed, paraffin-embedded NSCLC specimens. EGFR and KRAS genotyping and thymidylate synthase RNA level by RT-PCR assays were available in a subset of patients. Between December 2009 and September 2012, 7344 NSCLC specimens were tested. An EML4-ALK+ transcript was detected in 200 cases (2.7%), including 109 V1 (54.5%), 20 V2 (10.0%), 68 V3 (34.0%), and three V5a (1.5%) variants. Median age was 54.5 years (range, 23-89), and 104 patients (52.0%) were women. The great majority (n=188, 94.0%) of EML4-ALK+ NSCLC tumors had adenocarcinoma histology. ALK expression level varied significantly among different EML4-ALK+ variants and individual tumors. Only one case each of concurrent EGFR or KRAS mutation was detected. The median thymidylate synthase RNA level from 85 EML4-ALK+ cancers was significantly lower compared with that of EML4-ALK-negative lung adenocarcinomas (2.02 versus 3.29, respectively, p<0.001). This panel of variant-specific, quantitative RT-PCR assays detects common EML4-ALK+ variants as well as ALK gene expression level in archival formalin-fixed paraffin-embedded NSCLC specimens. These RT-PCR assays may be useful as an adjunct to the standard fluorescence in situ hybridization assay to better understand biologic variability and response patterns to anaplastic lymphoma kinase inhibitors.

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nasarabadi, Shanavaz

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

Refolding Active Human DNA Polymerase ν from Inclusion Bodies

PubMed Central

Arana, Mercedes E.; Powell, Gary K.; Edwards, Lori L.; Kunkel, Thomas A.; Petrovich, Robert M.

2017-01-01

Human DNA polymerase ν (Pol ν) is a conserved family A DNA polymerase of uncertain biological function. Physical and biochemical characterization aimed at understanding Pol ν function is hindered by the fact that, when over-expressed in E. coli, Pol ν is largely insoluble, and the small amount of soluble protein is difficult to purify. Here we describe the use of high hydrostatic pressure to refold Pol ν from inclusion bodies, in soluble and active form. The refolded Pol ν has properties comparable to those of the small amount of Pol ν that was purified from the soluble fraction. The approach described here may be applicable to other DNA polymerases that are expressed as insoluble inclusion bodies in E. coli. PMID:19853037

Regional specialization in human nuclei: visualization of discrete sites of transcription by RNA polymerase III.

PubMed Central

Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R

1999-01-01

Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177

A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases

PubMed Central

2011-01-01

Y-family DNA polymerases are characterized by low-fidelity synthesis on undamaged DNA and ability to catalyze translesion synthesis over the damaged DNA. Their translocation along the DNA template is an important event during processive DNA synthesis. In this work we present a Brownian ratchet model for this translocation, where the directed translocation is rectified by the nucleotide binding to the polymerase. Using the model, different features of the available structures for Dpo4, Dbh and polymerase ι in binary and ternary forms can be easily explained. Other dynamic properties of the Y-family polymerases such as the fast translocation event upon dNTP binding for Dpo4 and the considerable variations of the processivity among the polymerases can also be well explained by using the model. In addition, some predicted results of the DNA synthesis rate versus the external force acting on Dpo4 and Dbh polymerases are presented. Moreover, we compare the effect of the external force on the DNA synthesis rate of the Y-family polymerase with that of the replicative DNA polymerase. PMID:21699732

NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

EPA Science Inventory

Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

DNA polymerases in the rat pituitary gland. Effect of oestrogens and sulpiride.

PubMed

Jahn, G A; Kalbermann, L E; Machiavelli, G; Szijan, I; Burdman, J A

1980-06-01

Changes in the activity of DNA polymerase and [3H]thymidine incorporation into the DNA of the anterior pituitary gland were studied in oestrogenized male and pregnant rats. The activities of DNA polymerases alpha and beta, extracted in Tris--HCl or in sodium phosphate buffer were characterized according to their optimum pH and sensitivity to N-ethyl-maleimide. In the Tris-soluble fraction DNA polymerase activity is almost exclusively alpha, while in the phosphate soluble fraction it is a mixture of alpha and beta. The administration of oestrogens to male rats increases [3H]thymidine incorporation and enhances the activity of DNA polymerases in the Tris-soluble fraction, while the activity of the phosphate-soluble enzyme does not change. Sulpiride administration results in a further increment of [3H]thymidine incorporation and of DNA polymerase activity in the Tris-soluble fraction. In pregnant rats sulpiride also produces an increment of DNA polymerase activity only in the Tris-soluble fraction. Thus, the activity of the Tris-soluble fraction from APG behaves as DNA polymerase alpha. This activity changes in parallel with [3H]thymidine incorporation into DNA which is an indication of cell proliferation in the gland. This is discussed with respect to a negative feedback mechanism between intracellular prolactin concentration and DNA synthesis in the APG.

Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

USDA-ARS?s Scientific Manuscript database

Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

Base modifications affecting RNA polymerase and reverse transcriptase fidelity.

PubMed

Potapov, Vladimir; Fu, Xiaoqing; Dai, Nan; Corrêa, Ivan R; Tanner, Nathan A; Ong, Jennifer L

2018-06-20

Ribonucleic acid (RNA) is capable of hosting a variety of chemically diverse modifications, in both naturally-occurring post-transcriptional modifications and artificial chemical modifications used to expand the functionality of RNA. However, few studies have addressed how base modifications affect RNA polymerase and reverse transcriptase activity and fidelity. Here, we describe the fidelity of RNA synthesis and reverse transcription of modified ribonucleotides using an assay based on Pacific Biosciences Single Molecule Real-Time sequencing. Several modified bases, including methylated (m6A, m5C and m5U), hydroxymethylated (hm5U) and isomeric bases (pseudouridine), were examined. By comparing each modified base to the equivalent unmodified RNA base, we can determine how the modification affected cumulative RNA polymerase and reverse transcriptase fidelity. 5-hydroxymethyluridine and N6-methyladenosine both increased the combined error rate of T7 RNA polymerase and reverse transcriptases, while pseudouridine specifically increased the error rate of RNA synthesis by T7 RNA polymerase. In addition, we examined the frequency, mutational spectrum and sequence context of reverse transcription errors on DNA templates from an analysis of second strand DNA synthesis.

Palm Mutants in DNA Polymerases α and η Alter DNA Replication Fidelity and Translesion Activity

PubMed Central

Niimi, Atsuko; Limsirichaikul, Siripan; Yoshida, Shonen; Iwai, Shigenori; Masutani, Chikahide; Hanaoka, Fumio; Kool, Eric T.; Nishiyama, Yukihiro; Suzuki, Motoshi

2004-01-01

We isolated active mutants in Saccharomyces cerevisiae DNA polymerase α that were associated with a defect in error discrimination. Among them, L868F DNA polymerase α has a spontaneous error frequency of 3 in 100 nucleotides and 570-fold lower replication fidelity than wild-type (WT) polymerase α. In vivo, mutant DNA polymerases confer a mutator phenotype and are synergistic with msh2 or msh6, suggesting that DNA polymerase α-dependent replication errors are recognized and repaired by mismatch repair. In vitro, L868F DNA polymerase α catalyzes efficient bypass of a cis-syn cyclobutane pyrimidine dimer, extending the 3′ T 26,000-fold more efficiently than the WT. Phe34 is equivalent to residue Leu868 in translesion DNA polymerase η, and the F34L mutant of S. cerevisiae DNA polymerase η has reduced translesion DNA synthesis activity in vitro. These data suggest that high-fidelity DNA synthesis by DNA polymerase α is required for genomic stability in yeast. The data also suggest that the phenylalanine and leucine residues in translesion and replicative DNA polymerases, respectively, might have played a role in the functional evolution of these enzyme classes. PMID:15024063

Quantification of HIV-1 DNA using real-time recombinase polymerase amplification.

PubMed

Crannell, Zachary Austin; Rohrman, Brittany; Richards-Kortum, Rebecca

2014-06-17

Although recombinase polymerase amplification (RPA) has many advantages for the detection of pathogenic nucleic acids in point-of-care applications, RPA has not yet been implemented to quantify sample concentration using a standard curve. Here, we describe a real-time RPA assay with an internal positive control and an algorithm that analyzes real-time fluorescence data to quantify HIV-1 DNA. We show that DNA concentration and the onset of detectable amplification are correlated by an exponential standard curve. In a set of experiments in which the standard curve and algorithm were used to analyze and quantify additional DNA samples, the algorithm predicted an average concentration within 1 order of magnitude of the correct concentration for all HIV-1 DNA concentrations tested. These results suggest that quantitative RPA (qRPA) may serve as a powerful tool for quantifying nucleic acids and may be adapted for use in single-sample point-of-care diagnostic systems.

Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Faye, Oumar; Thaloengsok, Sasikanya; Heidenreich, Doris; Matangkasombut, Ponpan; Manopwisedjaroen, Khajohnpong; Sakuntabhai, Anavaj; Sall, Amadou A.; Hufert, Frank T.; Weidmann, Manfred

2015-01-01

Background Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF). Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR) are the standard method for molecular detection of the dengue virus (DENV). Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA) assays were developed to detect DENV1-4. Methodology/Principal Findings Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4) to 241 (DENV1-3) RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal) and in Bangkok (Thailand). In Kedougou, the RT-RPA was operated at an ambient temperature of 38°C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31) and 100% (n=23), respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90) and 100%(n=41), respectively. Conclusions/Significance During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations. PMID:26075598

Comparison of Simplexa HSV 1 & 2 PCR with culture, immunofluorescence, and laboratory-developed TaqMan PCR for detection of herpes simplex virus in swab specimens.

PubMed

Gitman, Melissa R; Ferguson, David; Landry, Marie L

2013-11-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type.

The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ

PubMed Central

Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G.; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E.; Takeda, Shunichi

2015-01-01

The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

Selective affinity chromatography of DNA polymerases with associated 3' to 5' exonuclease activities.

PubMed

Lee, M Y; Whyte, W A

1984-05-01

The use of 5'-AMP as a ligand for the affinity chromatography of DNA polymerases with intrinsic 3' to 5' exonuclease activities was investigated. The basis for this is that 5'-AMP would be expected to act as a ligand for the associated 3' to 5' exonuclease. The requirements for binding of Escherichia coli DNA polymerase I, T4 DNA polymerase, and calf thymus DNA polymerase delta, all of which have associated 3' to 5' exonuclease activities, to several commercially available 5'-AMP supports with different linkages of 5'-AMP to either agarose or cellulose were examined. The DNA polymerases which possessed 3' to 5' exonuclease activities were bound to agarose types in which the 5'-phosphoryl group and the 3'-hydroxyl group of the AMP were unsubstituted. Bound enzyme could be eluted by either an increase in ionic strength or competitive binding of nucleoside 5'-monophosphates. Magnesium was found to reinforce the binding of the enzyme to these affinity supports. DNA polymerase alpha, which does not have an associated 3' to 5' exonuclease activity, did not bind to any of these columns. These differences can be used to advantage for the purification of DNA polymerases that have associated 3' to 5' exonuclease activities, as well as a means for establishing the association of 3' to 5' exonuclease activities with DNA polymerases.

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

A Polymerase With Potential: The Fe-S Cluster in Human DNA Primase.

PubMed

Holt, Marilyn E; Salay, Lauren E; Chazin, Walter J

2017-01-01

Replication of DNA in eukaryotes is primarily executed by the combined action of processive DNA polymerases δ and ɛ. These enzymes cannot initiate synthesis of new DNA without the presence of a primer on the template ssDNA. The primers on both the leading and lagging strands are generated by DNA polymerase α-primase (pol-prim). DNA primase is a DNA-dependent RNA polymerase that synthesizes the first ~10 nucleotides and then transfers the substrate to polymerase α to complete primer synthesis. The mechanisms governing the coordination and handoff between primase and polymerase α are largely unknown. Isolated DNA primase contains a [4Fe-4S] 2+ cluster that has been shown to serve as a redox switch modulating DNA binding affinity. This discovery suggests a mechanism for modulating the priming activity of primase and handoff to polymerase α. In this chapter, we briefly discuss the current state of knowledge of primase structure and function, including the role of its iron-sulfur cluster. This is followed by providing the methods for expressing, purifying, and biophysically/structurally characterizing primase and its iron-sulfur cluster-containing domain, p58C. © 2017 Elsevier Inc. All rights reserved.

Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

PubMed

Makarova, A V; Kulbachinskiy, A V

2012-06-01

Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

Compartmentalized self-replication: a novel method for the directed evolution of polymerases and other enzymes.

PubMed

Ghadessy, Farid J; Holliger, Philipp

2007-01-01

Compartmentalized self-replication (CSR) is a novel method for the directed evolution of enzymes and, in particular, polymerases. In its simplest form, CSR consists of a simple feedback loop involving a polymerase that replicates only its own encoding gene (self-replication). Self-replication occurs in discrete, spatially separate, noncommunicating compartments formed by a heat-stable water-in-oil emulsion. Compartmentalization ensures the linkage of phenotype and genotype (i.e., it ensures that each polymerase replicates only its own encoding gene to the exclusion of those in the other compartments). As a result, adaptive gains by the polymerase directly (and proportionally) translate into genetic amplification of the encoding polymerase gene. CSR has proven to be a useful strategy for the directed evolution of polymerases directly from diverse repertoires of polymerase genes. In this chapter, we describe some of the CSR protocols used successfully to evolve variants of T. aquaticus Pol I (Taq) polymerase with novel and useful properties, such as increased thermostability or resistance to the potent inhibitor, heparin, from a repertoire of randomly mutated Taq polymerase genes.

The Cobas AmpliPrep/Cobas TaqMan HCV test, version 2.0, real-time PCR assay accurately quantifies hepatitis C virus genotype 4 RNA.

PubMed

Chevaliez, Stéphane; Bouvier-Alias, Magali; Rodriguez, Christophe; Soulier, Alexandre; Poveda, Jean-Dominique; Pawlotsky, Jean-Michel

2013-04-01

Accurate hepatitis C virus (HCV) RNA quantification is mandatory for the management of chronic hepatitis C therapy. The first-generation Cobas AmpliPrep/Cobas TaqMan HCV test (CAP/CTM HCV) underestimated HCV RNA levels by >1-log10 international units/ml in a number of patients infected with HCV genotype 4 and occasionally failed to detect it. The aim of this study was to evaluate the ability of the Cobas AmpliPrep/Cobas TaqMan HCV test, version 2.0 (CAP/CTM HCV v2.0), to accurately quantify HCV RNA in a large series of patients infected with different subtypes of HCV genotype 4. Group A comprised 122 patients with chronic HCV genotype 4 infection, and group B comprised 4 patients with HCV genotype 4 in whom HCV RNA was undetectable using the CAP/CTM HCV. Each specimen was tested with the third-generation branched DNA (bDNA) assay, CAP/CTM HCV, and CAP/CTM HCV v2.0. The HCV RNA level was lower in CAP/CTM HCV than in bDNA in 76.2% of cases, regardless of the HCV genotype 4 subtype. In contrast, the correlation between bDNA and CAP/CTM HCV v2.0 values was excellent. CAP/CTM HCV v2.0 accurately quantified HCV RNA levels in the presence of an A-to-T substitution at position 165 alone or combined with a G-to-A substitution at position 145 of the 5' untranslated region of HCV genome. In conclusion, CAP/CTM HCV v2.0 accurately quantifies HCV RNA in genotype 4 clinical specimens, regardless of the subtype, and can be confidently used in clinical trials and clinical practice with this genotype.

Inhibition of RNA-Dependent DNA Polymerase of Avian Myeloblastosis Virus by Pyran Copolymer

PubMed Central

Papas, Takis S.; Pry, Thomas W.; Chirigos, Michael A.

1974-01-01

Pyran copolymer, a known immunostimulator, was found to be a potent inhibitor of purified DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase; EC 2.7.7.7) isolated from avian myeloblastosis virus. Unlike other inhibitors, pyran showed unique features of inhibition. It interacts with the polymerase at a region other than the template site. The inhibitory effect was overcome only by excess enzyme and not affected by excess template. The degree of inhibition was not template specific for the templates tested: 70S RNA from avian myeloblastosis virus, synthetic hybrid poly(rA)·oligo(dT)10, synthetic copolymer poly(dA-dT), and activated calf-thymus DNA. The observed rate of inhibition by pyran was shown to vary with the different polymerases tested. Inhibition was shown with all oncornaviral polymerases and, to a lesser extent, with mammalian polymerases. However, two of the three bacterial polymerases, by contrast, showed a marked activation. PMID:4131275

Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

PubMed

Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

2016-01-01

Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Comparison of culture and qPCR methods in detection of mycobacteria from drinking waters.

PubMed

Räsänen, Noora H J; Rintala, Helena; Miettinen, Ilkka T; Torvinen, Eila

2013-04-01

Environmental mycobacteria are common bacteria in man-made water systems and may cause infections and hypersensitivity pneumonitis via exposure to water. We compared a generally used cultivation method and a quantitative polymerase chain reaction (qPCR) method to detect mycobacteria in 3 types of drinking waters: surface water, ozone-treated surface water, and groundwater. There was a correlation between the numbers of mycobacteria obtained by cultivation and qPCR methods, but the ratio of the counts obtained by the 2 methods varied among the types of water. The qPCR counts in the drinking waters produced from surface or groundwater were 5 to 34 times higher than culturable counts. In ozone-treated surface waters, both methods gave similar counts. The ozone-treated drinking waters had the highest concentration of assimilable organic carbon, which may explain the good culturability. In warm tap waters, qPCR gave 43 times higher counts than cultivation, but both qPCR counts and culturable counts were lower than those in the drinking waters collected from the same sites. The TaqMan qPCR method is a rapid and sensitive tool for total quantitation of mycobacteria in different types of clean waters. The raw water source and treatments affect both culturability and total numbers of mycobacteria in drinking waters.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

PubMed Central

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

Inhibiting poly(ADP-ribose) polymerase: a potential therapy against oligodendrocyte death

PubMed Central

Veto, Sara; Acs, Peter; Bauer, Jan; Lassmann, Hans; Berente, Zoltan; Setalo, Gyorgy; Borgulya, Gabor; Sumegi, Balazs; Komoly, Samuel; Gallyas, Ferenc; Illes, Zsolt

2010-01-01

Oligodendrocyte loss and demyelination are major pathological hallmarks of multiple sclerosis. In pattern III lesions, inflammation is minor in the early stages, and oligodendrocyte apoptosis prevails, which appears to be mediated at least in part through mitochondrial injury. Here, we demonstrate poly(ADP-ribose) polymerase activation and apoptosis inducing factor nuclear translocation within apoptotic oligodendrocytes in such multiple sclerosis lesions. The same morphological and molecular pathology was observed in an experimental model of primary demyelination, induced by the mitochondrial toxin cuprizone. Inhibition of poly(ADP-ribose) polymerase in this model attenuated oligodendrocyte depletion and decreased demyelination. Poly(ADP-ribose) polymerase inhibition suppressed c-Jun N-terminal kinase and p38 mitogen-activated protein kinase phosphorylation, increased the activation of the cytoprotective phosphatidylinositol-3 kinase-Akt pathway and prevented caspase-independent apoptosis inducing factor-mediated apoptosis. Our data indicate that poly(ADP-ribose) polymerase activation plays a crucial role in the pathogenesis of pattern III multiple sclerosis lesions. Since poly(ADP-ribose) polymerase inhibition was also effective in the inflammatory model of multiple sclerosis, it may target all subtypes of multiple sclerosis, either by preventing oligodendrocyte death or attenuating inflammation. PMID:20157013

Continuous in vitro evolution of bacteriophage RNA polymerase promoters

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Banerji, A.; Joyce, G. F.

1994-01-01

Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

Comparison of Polymerase Subunits from Double-Stranded RNA Bacteriophages

PubMed Central

Yang, Hongyan; Makeyev, Eugene V.; Bamford, Dennis H.

2001-01-01

The family Cystoviridae comprises several bacteriophages with double-stranded RNA (dsRNA) genomes. We have previously purified the catalytic polymerase subunit (Pol) of one of the Cystoviridae members, bacteriophage φ6, and shown that the protein can catalyze RNA synthesis in vitro. In this reaction, both bacteriophage-specific and heterologous RNAs can serve as templates, but those containing 3′ termini from the φ6 minus strands are favored. This provides a molecular basis for the observation that only plus strands, not minus strands, are transcribed from φ6 dsRNA segments in vivo. To test whether such a regulatory mechanism is also found in other dsRNA viruses, we purified recombinant Pol subunits from the φ6-related bacteriophages φ8 and φ13 and assayed their polymerase activities in vitro. The enzymes catalyze template-dependent RNA synthesis using both single-stranded-RNA (ssRNA) and dsRNA templates. However, they differ from each other as well as from φ6 Pol in certain biochemical properties. Notably, each polymerase demonstrates a distinct preference for ssRNAs bearing short 3′-terminal sequences from the virus-specific minus strands. This suggests that, in addition to other factors, RNA transcription in Cystoviridae is controlled by the template specificity of the polymerase subunit. PMID:11602748

Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

PubMed

Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

2012-04-27

To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

QUANTITATIVE MEASUREMENT OF HELICOBACTER PYLORI BY THE TAQMAN FLUOROGENIC PROBE SYSTEM

EPA Science Inventory

Culturing of H. pylori from environmental sources continues to be an obstacle in detecting and enumerating this organism. Successful methods of isolation and growth from water samples have not yet been developed. In this study a method involving real tme PCR product detection wit...

Taqman Real-Time PCR Detects Avipoxvirus DNA in Blood of Hawaìi `Amakihi (Hemignathus virens)

PubMed Central

Farias, Margaret E. M.; LaPointe, Dennis A.; Atkinson, Carter T.; Czerwonka, Christopher; Shrestha, Rajesh; Jarvi, Susan I.

2010-01-01

Background Avipoxvirus sp. is a significant threat to endemic bird populations on several groups of islands worldwide, including Hawaìi, the Galapagos Islands, and the Canary Islands. Accurate identification and genotyping of Avipoxvirus is critical to the study of this disease and how it interacts with other pathogens, but currently available methods rely on invasive sampling of pox-like lesions and may be especially harmful in smaller birds. Methodology/Principal Findings Here, we present a nested TaqMan Real-Time PCR for the detection of the Avipoxvirus 4b core protein gene in archived blood samples from Hawaiian birds. The method was successful in amplifying Avipoxvirus DNA from packed blood cells of one of seven Hawaiian honeycreepers with confirmed Avipoxvirus infections and 13 of 28 Hawaìi `amakihi (Hemignathus virens) with suspected Avipoxvirus infections based on the presence of pox-like lesions. Mixed genotype infections have not previously been documented in Hawaìi but were observed in two individuals in this study. Conclusions/Significance We anticipate that this method will be applicable to other closely related strains of Avipoxvirus and will become an important and useful tool in global studies of the epidemiology of Avipoxvirus. PMID:20523726

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

PubMed Central

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].

PubMed

D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V

1980-11-01

A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.

Analysis of cytomegalovirus (CMV) viremia using the pp65 antigenemia assay, the amplicor CMV test, and a semi-quantitative polymerase chain reaction test after allogeneic marrow transplantation.

PubMed

Ksouri, H; Eljed, H; Greco, A; Lakhal, A; Torjman, L; Abdelkefi, A; Ben Othmen, T; Ladeb, S; Slim, A; Zouari, B; Abdeladhim, A; Ben Hassen, A

2007-03-01

A pp65 antigenemia assay for polymorphonuclear leukocytes (PMNLs) (CINAkit Rapid Antigenemia), and a qualitative polymerase chain reaction (PCR) test for plasma 'PCR-P qual' (Amplicor cytomegalovirus [CMV] test) were performed for 126 samples (blood and plasma) obtained from 18 bone marrow transplant patients, over a 9-month surveillance period. Among those samples, 92 were assayed with a semi-quantitative PCR test for PMNLs 'PCR-L quant.' The number of samples with a positive CMV test for antigenemia and PCR-P qual assays was 20.63% and 12.7%, respectively, whereas the PCR-L quant assay was positive in 48 of the 92 samples assayed (52.17%). The rates of concordance of the results of PCR-P qual and antigenemia, PCR-P qual and PCR-L quant, antigenemia and PCR-L quant were 92%, 65.2% and 66.8%, respectively. The analysis of the results for the 92 specimens tested by all 3 methods showed a rate of concordance of 63% among all methods. Good agreement (kappa=0.72) was found only between pp65 Ag and PCR-P qual assays. Clinical disease correlates with an antigenemia high viral load. Three patients had CMV disease despite preemptive therapy, and all of them had graft-versus-host-disease (GVHD). PMNLs-based assays are more efficient in monitoring CMV reactivation, but for high-risk patients with GVHD, more sensitive assays (real-time PCR) must be done.

Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

PubMed

Pinkney, M; Hoggett, J G

1988-03-15

Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase.

Use of the MagNA Pure LC Automated Nucleic Acid Extraction System followed by Real-Time Reverse Transcription-PCR for Ultrasensitive Quantitation of Hepatitis C Virus RNA

PubMed Central

Cook, Linda; Ng, Ka-Wing; Bagabag, Arthur; Corey, Lawrence; Jerome, Keith R.

2004-01-01

Hepatitis C virus (HCV) infection is an increasing health problem worldwide. Quantitative assays for HCV viral load are valuable in predicting response to therapy and for following treatment efficacy. Unfortunately, most quantitative tests for HCV RNA are limited by poor sensitivity. We have developed a convenient, highly sensitive real-time reverse transcription-PCR assay for HCV RNA. The assay amplifies a portion of the 5′ untranslated region of HCV, which is then quantitated using the TaqMan 7700 detection system. Extraction of viral RNA for our assay is fully automated with the MagNA Pure LC extraction system (Roche). Our assay has a 100% detection rate for samples containing 50 IU of HCV RNA/ml and is linear up to viral loads of at least 109 IU/ml. The assay detects genotypes 1a, 2a, and 3a with equal efficiency. Quantitative results by our assay correlate well with HCV viral load as determined by the Bayer VERSANT HCV RNA 3.0 bDNA assay. In clinical use, our assay is highly reproducible, with high and low control specimens showing a coefficient of variation for the logarithmic result of 2.8 and 7.0%, respectively. The combination of reproducibility, extreme sensitivity, and ease of performance makes this assay an attractive option for routine HCV viral load testing. PMID:15365000

A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods.

PubMed

Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A

2014-12-01

Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

Techniques used to study the DNA polymerase reaction pathway

PubMed Central

Joyce, Catherine M.

2009-01-01

Summary A minimal reaction pathway for DNA polymerases was established over 20 years ago using chemical quench methods. Since that time there has been considerable interest in noncovalent steps in the reaction pathway, conformational changes involving the polymerase or its DNA substrate that may play a role in substrate specificity. Fluorescence-based assays have been devised in order to study these conformational transitions and the results obtained have added new detail to the reaction pathway. PMID:19665596

Comparison of Simplexa HSV 1 & 2 PCR with Culture, Immunofluorescence, and Laboratory-Developed TaqMan PCR for Detection of Herpes Simplex Virus in Swab Specimens

PubMed Central

Gitman, Melissa R.; Ferguson, David

2013-01-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type. PMID:24006008

Trigger loop folding determines transcription rate of Escherichia coli’s RNA polymerase

DOE PAGES

Mejia, Yara X.; Nudler, Evgeny; Bustamante, Carlos

2014-12-31

Two components of the RNA polymerase (RNAP) catalytic center, the bridge helix and the trigger loop (TL), have been linked with changes in elongation rate and pausing. Here, single molecule experiments with the WT and two TL-tip mutants of the Escherichia coli enzyme reveal that tip mutations modulate RNAP’s pause-free velocity, identifying TL conformational changes as one of two rate-determining steps in elongation. Consistent with this observation, we find a direct correlation between helix propensity of the modified amino acid and pause-free velocity. Moreover, nucleotide analogs affect transcription rate, suggesting that their binding energy also influences TL folding. A kineticmore » model in which elongation occurs in two steps, TL folding on nucleoside triphosphate (NTP) binding followed by NTP incorporation/pyrophosphate release, quantitatively accounts for these results. The TL plays no role in pause recovery remaining unfolded during a pause. The model suggests a finely tuned mechanism that balances transcription speed and fidelity.« less

A Structural Overview of RNA-Dependent RNA Polymerases from the Flaviviridae Family

PubMed Central

Wu, Jiqin; Liu, Weichi; Gong, Peng

2015-01-01

RNA-dependent RNA polymerases (RdRPs) from the Flaviviridae family are representatives of viral polymerases that carry out RNA synthesis through a de novo initiation mechanism. They share a ≈ 600-residue polymerase core that displays a canonical viral RdRP architecture resembling an encircled right hand with palm, fingers, and thumb domains surrounding the active site. Polymerase catalytic motifs A–E in the palm and motifs F/G in the fingers are shared by all viral RdRPs with sequence and/or structural conservations regardless of the mechanism of initiation. Different from RdRPs carrying out primer-dependent initiation, Flaviviridae and other de novo RdRPs utilize a priming element often integrated in the thumb domain to facilitate primer-independent initiation. Upon the transition to the elongation phase, this priming element needs to undergo currently unresolved conformational rearrangements to accommodate the growth of the template-product RNA duplex. In the genera of Flavivirus and Pestivirus, the polymerase module in the C-terminal part of the RdRP protein may be regulated in cis by the N-terminal region of the same polypeptide. Either being a methyltransferase in Flavivirus or a functionally unclarified module in Pestivirus, this region could play auxiliary roles for the canonical folding and/or the catalysis of the polymerase, through defined intra-molecular interactions. PMID:26062131

Human cytomegalovirus DNA polymerase catalytic subunit pUL54 possesses independently acting nuclear localization and ppUL44 binding motifs.

PubMed

Alvisi, Gualtiero; Ripalti, Alessandro; Ngankeu, Apollinaire; Giannandrea, Maila; Caraffi, Stefano G; Dias, Manisha M; Jans, David A

2006-10-01

The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reported to be sufficient for ppUL44 binding in vitro. Although believed to be important for functioning in the nuclei of infected cells, no data are available on either the interaction of pUL54 with ppUL44 in living mammalian cells or the mechanism of pUL54 nuclear transport and its relationship with that of ppUL44. The present study examines for the first time the nuclear import pathway of pUL54 and its interaction with ppUL44 using dual color, quantitative confocal laser scanning microscopy on live transfected cells and quantitative gel mobility shift assays. We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. We also showed that pUL54 residues 1213-1242 are sufficient to confer ppUL44 binding abilities on GFP and that pUL54 and ppUL44 can be transported to the nucleus as a complex. Our work thus identified distinct sites within the HCMV DNA polymerase, which represent potential therapeutic targets and establishes the molecular basis of UL54 nuclear import.

Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.

PubMed

Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J

2011-01-21

In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

PubMed

Frank, K B; Cheng, Y C

1986-02-05

Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication

PubMed Central

Lapenta, Fabio; Montón Silva, Alejandro; Brandimarti, Renato; Lanzi, Massimiliano; Gratani, Fabio Lino; Vellosillo Gonzalez, Perceval; Perticarari, Sofia; Hochkoeppler, Alejandro

2016-01-01

DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP) domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics. PMID:27050298

Activation mechanism of a noncanonical RNA-dependent RNA polymerase.

PubMed

Garriga, Damià; Navarro, Aitor; Querol-Audí, Jordi; Abaitua, Fernando; Rodríguez, José F; Verdaguer, Núria

2007-12-18

Two lineages of viral RNA-dependent RNA polymerases (RDRPs) differing in the organization (canonical vs. noncanonical) of the palm subdomain have been identified. Phylogenetic analyses indicate that both lineages diverged at a very early stage of the evolution of the enzyme [Gorbalenya AE, Pringle FM, Zeddam JL, Luke BT, Cameron CE, Kalmakoff J, Hanzlik TN, Gordon KH, Ward VK (2002) J Mol Biol 324:47-62]. Here, we report the x-ray structure of a noncanonical birnaviral RDRP, named VP1, in its free form, bound to Mg(2+) ions, and bound to a peptide representing the polymerase-binding motif of the regulatory viral protein VP3. The structure of VP1 reveals that the noncanonical connectivity of the palm subdomain maintains the geometry of the catalytic residues found in canonical polymerases but results in a partial blocking of the active site cavity. The VP1-VP3 peptide complex shows a mode of polymerase activation in which VP3 binding promotes a conformational change that removes the steric blockade of the VP1 active site, facilitating the accommodation of the template and incoming nucleotides for catalysis. The striking structural similarities between birnavirus (dsRNA) and the positive-stranded RNA picornavirus and calicivirus RDRPs provide evidence supporting the existence of functional and evolutionary relationships between these two virus groups.

A quantitative strategy to detect changes in accessibility of protein regions to chemical modification on heterodimerization

PubMed Central

Dreger, Mathias; Leung, Bo Wah; Brownlee, George G; Deng, Tao

2009-01-01

We describe a method for studying quantitative changes in accessibility of surface lysine residues of the PB1 subunit of the influenza RNA polymerase as a result of association with the PA subunit to form a PB1-PA heterodimer. Our method combines two established methods: (i) the chemical modification of surface lysine residues of native proteins by N-hydroxysuccinimidobiotin (NHS-biotin) and (ii) the stable isotope labeling of amino acids in cell culture (SILAC) followed by tryptic digestion and mass spectrometry. By linking the chemical modification with the SILAC methodology for the first time, we obtain quantitative data on chemical modification allowing subtle changes in accessibility to be described. Five regions in the PB1 monomer showed altered reactivity to NHS-biotin when compared with the [PB1-PA] heterodimer. Mutational analysis of residues in two such regions—at K265 and K481 of PB1, which were about three- and twofold, respectively, less accessible to biotinylation in the PB1-PA heterodimer compared with the PB1 monomer, demonstrated that both K265 and K481 were crucial for polymerase function. This novel assay of quantitative profiling of biotinylation patterns (Q-POP assay) highlights likely conformational changes at important functional sites, as observed here for PB1, and may provide information on protein–protein interaction interfaces. The Q-POP assay should be a generally applicable approach and may detect novel functional sites suitable for targeting by drugs. PMID:19517532

The replisome uses mRNA as a primer after colliding with RNA polymerase.

PubMed

Pomerantz, Richard T; O'Donnell, Mike

2008-12-11

Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

PubMed Central

Pinkney, M; Hoggett, J G

1988-01-01

Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

Kinetics and thermodynamics of DNA polymerases with exonuclease proofreading

NASA Astrophysics Data System (ADS)

Gaspard, Pierre

2016-04-01

Kinetic theory and thermodynamics are applied to DNA polymerases with exonuclease activity, taking into account the dependence of the rates on the previously incorporated nucleotide. The replication fidelity is shown to increase significantly thanks to this dependence at the basis of the mechanism of exonuclease proofreading. In particular, this dependence can provide up to a 100-fold lowering of the error probability under physiological conditions. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

Fixing the model for transcription: the DNA moves, not the polymerase.

PubMed

Papantonis, Argyris; Cook, Peter R

2011-01-01

The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Molecular Dynamics Study of the Opening Mechanism for DNA Polymerase I

PubMed Central

Miller, Bill R.; Parish, Carol A.; Wu, Eugene Y.

2014-01-01

During DNA replication, DNA polymerases follow an induced fit mechanism in order to rapidly distinguish between correct and incorrect dNTP substrates. The dynamics of this process are crucial to the overall effectiveness of catalysis. Although X-ray crystal structures of DNA polymerase I with substrate dNTPs have revealed key structural states along the catalytic pathway, solution fluorescence studies indicate that those key states are populated in the absence of substrate. Herein, we report the first atomistic simulations showing the conformational changes between the closed, open, and ajar conformations of DNA polymerase I in the binary (enzyme∶DNA) state to better understand its dynamics. We have applied long time-scale, unbiased molecular dynamics to investigate the opening process of the fingers domain in the absence of substrate for B. stearothermophilis DNA polymerase in silico. These simulations are biologically and/or physiologically relevant as they shed light on the transitions between states in this important enzyme. All closed and ajar simulations successfully transitioned into the fully open conformation, which is known to be the dominant binary enzyme-DNA conformation from solution and crystallographic studies. Furthermore, we have detailed the key stages in the opening process starting from the open and ajar crystal structures, including the observation of a previously unknown key intermediate structure. Four backbone dihedrals were identified as important during the opening process, and their movements provide insight into the recognition of dNTP substrate molecules by the polymerase binary state. In addition to revealing the opening mechanism, this study also demonstrates our ability to study biological events of DNA polymerase using current computational methods without biasing the dynamics. PMID:25474643

U6 small nuclear RNA is transcribed by RNA polymerase III.

PubMed Central

Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

1986-01-01

A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

A novel specific duplex real-time RT-PCR method for absolute quantitation of Grapevine Pinot gris virus in plant material and single mites.

PubMed

Morán, Félix; Olmos, Antonio; Lotos, Leonidas; Predajňa, Lukáš; Katis, Nikolaos; Glasa, Miroslav; Maliogka, Varvara; Ruiz-García, Ana B

2018-01-01

Grapevine Pinot gris virus (GPGV) is a widely distributed grapevine pathogen that has been associated to the grapevine leaf mottling and deformation disease. With the aim of better understanding the disease epidemiology and providing efficient control strategies a specific and quantitative duplex TaqMan real-time RT-PCR assay has been developed. This method has allowed reliable quantitation of the GPGV titer ranging from 30 up to 3 x 108 transcript copies, with a detection limit of 70 viral copies in plant material. The assay targets a grapevine internal control that reduces the occurrence of false negative results, thus increasing the diagnostic sensitivity of the technique. Viral isolates both associated and non-associated to symptoms from Greece, Slovakia and Spain have been successfully detected. The method has also been applied to the absolute quantitation of GPGV in its putative transmission vector Colomerus vitis. Moreover, the viral titer present in single mites has been determined. In addition, in the current study a new polymorphism in the GPGV genome responsible for a shorter movement protein has been found. A phylogenetic study based on this genomic region has shown a high variability among Spanish isolates and points to a different evolutionary origin of this new polymorphism. The methodology here developed opens new possibilities for basic and epidemiological studies as well as for the establishment of efficient control strategies.

Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

PubMed Central

Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

2012-01-01

Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

Backtracking dynamics of RNA polymerase: pausing and error correction.

PubMed

Sahoo, Mamata; Klumpp, Stefan

2013-09-18

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

Backtracking dynamics of RNA polymerase: pausing and error correction

NASA Astrophysics Data System (ADS)

Sahoo, Mamata; Klumpp, Stefan

2013-09-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

Species difference in ANP32A underlies influenza A virus polymerase host restriction

PubMed Central

Long, Jason S.; Giotis, Efstathios S.; Moncorgé, Olivier; Frise, Rebecca; Mistry, Bhakti; James, Joe; Morisson, Mireille; Iqbal, Munir; Vignal, Alain; Skinner, Michael A.; Barclay, Wendy S.

2015-01-01

Influenza pandemics occur unpredictably when zoonotic influenza viruses with novel antigenicity acquire the ability to transmit amongst humans 1. Incompatibilities between avian virus components and the human host limit host range breaches. Barriers include receptor preference, virion stability and poor activity of the avian virus RNA-dependent RNA polymerase in human cells 2. Mutants of the heterotrimeric viral polymerase components, particularly PB2 protein, are selected during mammalian adaptation, but their mode of action is unknown 3–6. We show that a species-specific difference in host protein ANP32A accounts for the suboptimal function of avian virus polymerase in mammalian cells. Avian ANP32A possesses an additional 33 amino acids between the LRR and LCAR domains. In mammalian cells, avian ANP32A rescued the suboptimal function of avian virus polymerase to levels similar to mammalian adapted polymerase. Deletion of the avian-specific sequence from chicken ANP32A abrogated this activity whereas its insertion into human ANP32A, or closely related ANP32B, supported avian virus polymerase function. Substitutions, such as PB2 E627K, rapidly selected upon infection of humans with avian H5N1 or H7N9 influenza viruses, adapt the viral polymerase for the shorter mammalian ANP32A. Thus ANP32A represents an essential host partner co-opted to support influenza virus replication and is a candidate host target for novel antivirals. PMID:26738596

Quantitative phylogenetic assessment of microbial communities in diverse environments.

PubMed

von Mering, C; Hugenholtz, P; Raes, J; Tringe, S G; Doerks, T; Jensen, L J; Ward, N; Bork, P

2007-02-23

The taxonomic composition of environmental communities is an important indicator of their ecology and function. We used a set of protein-coding marker genes, extracted from large-scale environmental shotgun sequencing data, to provide a more direct, quantitative, and accurate picture of community composition than that provided by traditional ribosomal RNA-based approaches depending on the polymerase chain reaction. Mapping marker genes from four diverse environmental data sets onto a reference species phylogeny shows that certain communities evolve faster than others. The method also enables determination of preferred habitats for entire microbial clades and provides evidence that such habitat preferences are often remarkably stable over time.

Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes

PubMed Central

Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas

2014-01-01

The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

Replicative DNA polymerase mutations in cancer☆

PubMed Central

Heitzer, Ellen; Tomlinson, Ian

2014-01-01

Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393

Quantitative real-time RT-PCR assay for research studies on enterovirus infections in the central nervous system.

PubMed

Volle, Romain; Nourrisson, Céline; Mirand, Audrey; Regagnon, Christel; Chambon, Martine; Henquell, Cécile; Bailly, Jean-Luc; Peigue-Lafeuille, Hélène; Archimbaud, Christine

2012-10-01

Human enteroviruses are the most frequent cause of aseptic meningitis and are involved in other neurological infections. Qualitative detection of enterovirus genomes in cerebrospinal fluid is a prerequisite in diagnosing neurological diseases. The pathogenesis of these infections is not well understood and research in this domain would benefit from the availability of a quantitative technique to determine viral load in clinical specimens. This study describes the development of a real-time RT-qPCR assay using hydrolysis TaqMan probe and a competitive RNA internal control. The assay has high specificity and can be used for a large sample of distinct enterovirus strains and serotypes. The reproducible limit of detection was estimated at 1875 copies/ml of quantitative standards composed of RNA transcripts obtained from a cloned echovirus 30 genome. Technical performance was unaffected by the introduction of a competitive RNA internal control before RNA extraction. The mean enterovirus RNA concentration in an evaluation series of 15 archived cerebrospinal fluid specimens was determined at 4.78 log(10)copies/ml for the overall sample. The sensitivity and reproducibility of the real time RT-qPCR assay used in combination with the internal control to monitor the overall specimen process make it a valuable tool with applied research into enterovirus infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

PubMed Central

Shu, Bo; Gong, Peng

2017-01-01

ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

PubMed Central

Yu, Chuanhe; Gan, Haiyun

2017-01-01

ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

Conformational transitions in DNA polymerase I revealed by single-molecule FRET

PubMed Central

Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

2010-01-01

The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740

Discordances with HIV-1 RNA quantitative determinations by three commercial assays in Pointe Noire, Republic of Congo.

PubMed

Bruzzone, Bianca; Bisio, Francesca; Caligiuri, Patrizia; Mboungou, Franc A Mayinda; Nigro, Nicola; Sticchi, Laura; Ventura, Agostina; Saladini, Francesco; Zazzi, Maurizio; Icardi, Giancarlo; Viscoli, Claudio

2014-07-01

Accurate HIV-1 RNA quantitation is required to support the scale up of antiretroviral therapy in African countries. Extreme HIV-1 genetic variability in Africa may affect the ability of commercially available assays to detect and quantify HIV-1 RNA accurately. The aim of this study was to compare three real-time PCR assays for quantitation of plasma HIV-1 RNA levels in patients from the Republic of Congo, an area with highly diversified HIV-1 subtypes and recombinants. The Abbott RealTime HIV-1, BioMérieux HIV-1 EasyQ test 1.2 and Cobas AmpliPrep/Cobas TaqMan HIV-1 1.0 were compared for quantitation of HIV-1 RNA in 37 HIV-1 seropositive pregnant women enrolled in the Kento-Mwana project for prevention of mother-to-child transmission in Pointe-Noire, Republic of Congo. The sample panel included a variety of HIV-1 subtypes with as many as 21 (56.8%) putative unique recombinant forms. Qualitative detection of HIV-1 RNA was concordant by all three assays in 33/37 (89.2%) samples. Of the remaining 4 (10.8%) samples, all were positive by Roche, three by Abbott and none by BioMérieux. Differences exceeding 1Log in positive samples were found in 4/31 (12.9%), 10/31 (32.3%) and 5/31 (16.1%) cases between Abbott and BioMérieux, Roche and BioMérieux, and Abbott and Roche, respectively. In this sample panel representative of highly polymorphic HIV-1 in Congo, the agreement among the three assays was moderate in terms of HIV-1 RNA detectability and rather inconsistent in terms of quantitation. Copyright © 2014. Published by Elsevier B.V.

Role of the C-terminal residue of the DNA polymerase of bacteriophage T7.

PubMed

Kumar, J K; Tabor, S; Richardson, C C

2001-09-14

The crystal structure of the DNA polymerase encoded by gene 5 of bacteriophage T7, in a complex with its processivity factor, Escherichia coli thioredoxin, a primer-template, and an incoming deoxynucleoside triphosphate reveals a putative hydrogen bond between the C-terminal residue, histidine 704 of gene 5 protein, and an oxygen atom on the penultimate phosphate diester of the primer strand. Elimination of this electrostatic interaction by replacing His(704) with alanine renders the phage nonviable, and no DNA synthesis is observed in vivo. Polymerase activity of the genetically altered enzyme on primed M13 DNA is only 12% of the wild-type enzyme, and its processivity is drastically reduced. Kinetic parameters for binding a primer-template (K(D)(app)), nucleotide binding (K(m)), and k(off) for dissociation of the altered polymerase from a primer-template are not significantly different from that of wild-type T7 DNA polymerase. However, the decrease in polymerase activity is concomitant with increased hydrolytic activity, judging from the turnover of nucleoside triphosphate into the corresponding nucleoside monophosphate (percentage of turnover, 65%) during DNA synthesis. Biochemical data along with structural observations imply that the terminal amino acid residue of T7 DNA polymerase plays a critical role in partitioning DNA between the polymerase and exonuclease sites.

Unlocking the sugar "steric gate" of DNA polymerases.

PubMed

Brown, Jessica A; Suo, Zucai

2011-02-22

To maintain genomic stability, ribonucleotide incorporation during DNA synthesis is controlled predominantly at the DNA polymerase level. A steric clash between the 2'-hydroxyl of an incoming ribonucleotide and a bulky active site residue, known as the "steric gate", establishes an effective mechanism for most DNA polymerases to selectively insert deoxyribonucleotides. Recent kinetic, structural, and in vivo studies have illuminated novel features about ribonucleotide exclusion and the mechanistic consequences of ribonucleotide misincorporation on downstream events, such as the bypass of a ribonucleotide in a DNA template and the subsequent extension of the DNA lesion bypass product. These important findings are summarized in this review.

Kinetics and thermodynamics of exonuclease-deficient DNA polymerases

NASA Astrophysics Data System (ADS)

Gaspard, Pierre

2016-04-01

A kinetic theory is developed for exonuclease-deficient DNA polymerases, based on the experimental observation that the rates depend not only on the newly incorporated nucleotide, but also on the previous one, leading to the growth of Markovian DNA sequences from a Bernoullian template. The dependencies on nucleotide concentrations and template sequence are explicitly taken into account. In this framework, the kinetic and thermodynamic properties of DNA replication, in particular, the mean growth velocity, the error probability, and the entropy production are calculated analytically in terms of the rate constants and the concentrations. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

Correlation of Clinical Outcomes with Quantitative Polymerase Chain Reaction DNA Copy Number in Patients with Acute Retinal Necrosis.

PubMed

Calvo, Charles M; Khan, Mohammed Ali; Mehta, Sonia; Garg, Sunir J; Dunn, James P

2017-04-01

To correlate visual acuity outcomes and clinical features with quantitative PCR DNA copy number in patients with acute retinal necrosis (ARN). Retrospective, consecutive case series. In total, 14 eyes of 13 patients were diagnosed with ARN, based on the American Uveitis Society criteria, and were followed for a mean of 324.5 days (median 250.5 days, SD ± 214 days). Anterior chamber fluid analyzed by quantitative PCR identified viral DNA in 11 of 14 eyes (78.5%). Varicella zoster virus (VZV) was identified in seven eyes (50%) and herpes simplex virus (HSV) in four eyes (28.5%). Mean DNA copy number was 7.9 × 10 6 /mL (median 2.10 × 10 6 /mL, range: 0-5.60 × 10 7 /mL). Eyes with quantitative PCR DNA copy number of ≥5.0 × 10 6 /mL (n = 6 eyes) had worse baseline visual acuity (logMAR 1.48 ± 0.71 vs 0.94 ± 0.76, p = 0.196) and final visual acuity (logMAR 2.10 ± 0.60 vs 0.82 ± 0.81, p = 0.007) compared with patients with a DNA copy number <5.0 × 10 6 /mL (n = 8 eyes). Patients with a DNA copy number of ≥5.0 × 10 6 /mL were more likely to have at least 5 clock hours of retinitis on funduscopic exam (p = 0.03) and developed retinal detachment more frequently (p = 0.08). Quantitative DNA copy number of ≥5.0 × 10 6 /mL is associated with more extensive retinitis, worse visual acuity, and development of retinal detachment in patients with acute retinal necrosis.

ε, a new subunit of RNA polymerase found in gram-positive bacteria.

PubMed

Keller, Andrew N; Yang, Xiao; Wiedermannová, Jana; Delumeau, Olivier; Krásný, Libor; Lewis, Peter J

2014-10-01

RNA polymerase in bacteria is a multisubunit protein complex that is essential for gene expression. We have identified a new subunit of RNA polymerase present in the high-A+T Firmicutes phylum of Gram-positive bacteria and have named it ε. Previously ε had been identified as a small protein (ω1) that copurified with RNA polymerase. We have solved the structure of ε by X-ray crystallography and show that it is not an ω subunit. Rather, ε bears remarkable similarity to the Gp2 family of phage proteins involved in the inhibition of host cell transcription following infection. Deletion of ε shows no phenotype and has no effect on the transcriptional profile of the cell. Determination of the location of ε within the assembly of RNA polymerase core by single-particle analysis suggests that it binds toward the downstream side of the DNA binding cleft. Due to the structural similarity of ε with Gp2 and the fact they bind similar regions of RNA polymerase, we hypothesize that ε may serve a role in protection from phage infection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

PubMed

de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

2010-09-20

Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression

Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill

PubMed Central

2010-01-01

Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based

Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

PubMed

Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

2010-10-01

The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

Replication of N[superscript 2],3-Ethenoguanine by DNA Polymerases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Linlin; Christov, Plamen P.; Kozekov, Ivan D.

2014-10-02

The unstable DNA adduct N2,3-ethenoguanine, a product of both exposure to the carcinogen vinyl chloride and of oxidative stress, was built into an oligonucleotide, using an isostere strategy to stabilize the glycosidic bond. This modification was then used to examine the cause of mutations by DNA polymerases, in terms of both the biochemistry of the lesion and a structure of the lesion within a polymerase.

Localized cerebral energy failure in DNA polymerase gamma-associated encephalopathy syndromes.

PubMed

Tzoulis, Charalampos; Neckelmann, Gesche; Mørk, Sverre J; Engelsen, Bernt E; Viscomi, Carlo; Moen, Gunnar; Ersland, Lars; Zeviani, Massimo; Bindoff, Laurence A

2010-05-01

Mutations in the catalytic subunit of the mitochondrial DNA-polymerase gamma cause a wide spectrum of clinical disease ranging from infantile hepato-encephalopathy to juvenile/adult-onset spinocerebellar ataxia and late onset progressive external ophthalmoplegia. Several of these syndromes are associated with an encephalopathy that characteristically shows episodes of rapid neurological deterioration and the development of acute cerebral lesions. The purpose of this study was to investigate the nature, distribution and natural evolution of central nervous system lesions in polymerase gamma associated encephalopathy focusing particularly on lesions identified by magnetic resonance imaging. We compared radiological, electrophysiological and pathological findings where available to study potential mechanisms underlying the episodes of exacerbation and acute cerebral lesions. We studied a total of 112 magnetic resonance tomographies and 11 computed tomographies in 32 patients with polymerase gamma-encephalopathy, including multiple serial examinations performed during both the chronic and acute phases of the disease and, in several cases, magnetic resonance spectroscopy and serial diffusion weighted studies. Data from imaging, electroencephalography and post-mortem examination were compared in order to study the underlying disease process. Our findings show that magnetic resonance imaging in polymerase gamma-related encephalopathies has high sensitivity and can identify patterns that are specific for individual syndromes. One form of chronic polymerase gamma-encephalopathy, that is associated with the c.1399G > A and c.2243G > C mutations, is characterized by progressive cerebral and cerebellar atrophy and focal lesions of the thalamus, deep cerebellar structures and medulla oblongata. Acute encephalopathies, both infantile and later onset, show similar pictures with cortical stroke-like lesions occurring during episodes of exacerbation. These lesions can occur both

High frequency of the PNPLA3 rs738409 [G] single-nucleotide polymorphism in Hmong individuals as a potential basis for a predisposition to chronic liver disease.

PubMed

Tepper, Clifford G; Dang, Julie H T; Stewart, Susan L; Fang, Dao M; Wong, Kimberly A; Liu, Stephenie Y; Davis, Ryan R; Dao, Doan Y; Gregg, Jeffrey P; Török, Natalie J; Chen, Moon S

2018-04-01

An exploratory study was performed to determine the prevalence of the patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs78409 [G] allele among the Hmong as a risk factor for nonalcoholic fatty liver disease (NAFLD). NAFLD/nonalcoholic steatohepatitis is the world's most common chronic liver disease and is expected to replace viral hepatitis as the leading cause of cirrhosis and potential precursor to hepatocellular carcinoma (HCC). Of all populations in California, the Hmong experience the highest risk of death from HCC and the highest prevalence of metabolic syndrome risk factors among Asians that predispose them to NAFLD. Here a genetic explanation was sought for the high rates of chronic liver disease among the Hmong. The literature pointed to the PNPLA3 rs738409 [G] allele as a potential genetic culprit. Cell-free DNA was isolated from 26 serum samples previously collected in community settings. Quantitative polymerase chain reaction-based single-nucleotide polymorphism (SNP) genotyping was performed with a validated TaqMan SNP genotyping assay, and results were analyzed with TaqMan Genotyper software. The PNPLA3 rs738409 [C>G] variant occurred at a frequency of 0.46 (12 of 26; 95% confidence interval, 0.27-0.67). This carrier rate would rank the Hmong as the third highest population in the 1000 Genomes Project. Although this small sample size limits the generalizability, the high frequency rates of this allele along with the presence of metabolic syndrome risk factors warrant further studies into the etiology of NAFLD among the Hmong. Cancer 2018;124:1583-9. © 2018 American Cancer Society. © 2018 American Cancer Society.

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

PubMed

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Direct measurement of the poliovirus RNA polymerase error frequency in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ward, C.D.; Stokes, M.A.M.; Flanegan, J.B.

1988-02-01

The fidelity of RNA replication by the poliovirus-RNA-dependent RNA polymerase was examined by copying homopolymeric RNA templates in vitro. The poliovirus RNA polymerase was extensively purified and used to copy poly(A), poly(C), or poly(I) templates with equimolar concentrations of noncomplementary and complementary ribonucleotides. The error frequency was expressed as the amount of a noncomplementary nucleotide incorporated divided by the total amount of complementary and noncomplementary nucleotide incorporated. The polymerase error frequencies were very high, depending on the specific reaction conditions. The activity of the polymerase on poly(U) and poly(G) was too low to measure error frequencies on these templates. Amore » fivefold increase in the error frequency was observed when the reaction conditions were changed from 3.0 mM Mg{sup 2+} (pH 7.0) to 7.0 mM Mg{sup 2+} (pH 8.0). This increase in the error frequency correlates with an eightfold increase in the elongation rate that was observed under the same conditions in a previous study.« less

Heat Shock Protein 70 Modulates Influenza A Virus Polymerase Activity*

PubMed Central

Manzoor, Rashid; Kuroda, Kazumichi; Yoshida, Reiko; Tsuda, Yoshimi; Fujikura, Daisuke; Miyamoto, Hiroko; Kajihara, Masahiro; Kida, Hiroshi; Takada, Ayato

2014-01-01

The role of heat shock protein 70 (Hsp70) in virus replication has been discussed for many viruses. The known suppressive role of Hsp70 in influenza virus replication is based on studies conducted in cells with various Hsp70 expression levels. In this study, we determined the role of Hsp70 in influenza virus replication in HeLa and HEK293T cells, which express Hsp70 constitutively. Co-immunoprecipitation and immunofluorescence studies revealed that Hsp70 interacted with PB2 or PB1 monomers and PB2/PB1 heterodimer but not with the PB1/PA heterodimer or PB2/PB1/PA heterotrimer and translocated into the nucleus with PB2 monomers or PB2/PB1 heterodimers. Knocking down Hsp70 resulted in reduced virus transcription and replication activities. Reporter gene assay, immunofluorescence assay, and Western blot analysis of nuclear and cytoplasmic fractions from infected cells demonstrated that the increase in viral polymerase activity during the heat shock phase was accompanied with an increase in Hsp70 and viral polymerases levels in the nuclei, where influenza virus replication takes place, whereas a reduction in viral polymerase activity was accompanied with an increase in cytoplasmic relocation of Hsp70 along with viral polymerases. Moreover, significantly higher levels of viral genomic RNA (vRNA) were observed during the heat shock phase than during the recovery phase. Overall, for the first time, these findings suggest that Hsp70 may act as a chaperone for influenza virus polymerase, and the modulatory effect of Hsp70 appears to be a sequel of shuttling of Hsp70 between nuclear and cytoplasmic compartments. PMID:24474693

Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

PubMed Central

Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

2016-01-01

Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

Detection of Bordetella avium by TaqMan real-time PCR in tracheal swabs from wildlife birds.

PubMed

Stenzel, T; Pestka, D; Tykałowski, B; Śmiałek, M; Koncicki, A; Bancerz-Kisiel, A

2017-03-28

Bordetella avium, the causing agent of bordetellosis, a highly contagious infection of the respiratory tract in young poultry, causes significant losses in poultry farming throughout the world. Wildlife birds can be a reservoir of various pathogens that infect farm animals. For this reason the studies were conducted to estimate the prevalence of Bordetella avium in wildlife birds in Poland. Tracheal swab samples were collected from 650 birds representing 27 species. The bacterial DNA was isolated directly from the swabs and screened for Bordetella avium by TaqMan real-time PCR. The assay specificity was evaluated by testing DNA isolated from 8 other bacteria that can be present in avian respiratory tract, and there was no amplification from non-Bordetella avium agents. Test sensitivity was determined by preparing standard tenfold serial dilutions of DNA isolated from positive control. The assay revealed to be sensitive, with detection limit of approximately 4.07x10^2 copies of Bordetella avium DNA. The genetic material of Bordetella avium was found in 54.54% of common pheasants, in 9.09% of Eurasian coots, in 3.22% of black-headed gulls and in 2.77% of mallard ducks. The results of this study point to low prevalence of Bordetella avium infections in wildlife birds. The results also show that described molecular assay proved to be suitable for the rapid diagnosis of bordetellosis in the routine diagnostic laboratory.

3D structure of the influenza virus polymerase complex: Localization of subunit domains

PubMed Central

Area, Estela; Martín-Benito, Jaime; Gastaminza, Pablo; Torreira, Eva; Valpuesta, José M.; Carrascosa, José L.; Ortín, Juan

2004-01-01

The 3D structure of the influenza virus polymerase complex was determined by electron microscopy and image processing of recombinant ribonucleoproteins (RNPs). The RNPs were generated by in vivo amplification using cDNAs of the three polymerase subunits, the nucleoprotein, and a model virus-associated RNA containing 248 nt. The polymerase structure obtained is very compact, with no apparent boundaries among subunits. The position of specific regions of the PB1, PB2, and PA subunits was determined by 3D reconstruction of either RNP–mAb complexes or tagged RNPs. This structural model is available for the polymerase of a negative-stranded RNA virus and provides a general delineation of the complex and its interaction with the template-associated nucleoprotein monomers in the RNP. PMID:14691253

Improving clinical laboratory efficiency: a time-motion evaluation of the Abbott m2000 RealTime and Roche COBAS AmpliPrep/COBAS TaqMan PCR systems for the simultaneous quantitation of HIV-1 RNA and HCV RNA.

PubMed

Amendola, Alessandra; Coen, Sabrina; Belladonna, Stefano; Pulvirenti, F Renato; Clemens, John M; Capobianchi, M Rosaria

2011-08-01

Diagnostic laboratories need automation that facilitates efficient processing and workflow management to meet today's challenges for expanding services and reducing cost, yet maintaining the highest levels of quality. Processing efficiency of two commercially available automated systems for quantifying HIV-1 and HCV RNA, Abbott m2000 system and Roche COBAS Ampliprep/COBAS TaqMan 96 (docked) systems (CAP/CTM), was evaluated in a mid/high throughput workflow laboratory using a representative daily workload of 24 HCV and 72 HIV samples. Three test scenarios were evaluated: A) one run with four batches on the CAP/CTM system, B) two runs on the Abbott m2000 and C) one run using the Abbott m2000 maxCycle feature (maxCycle) for co-processing these assays. Cycle times for processing, throughput and hands-on time were evaluated. Overall processing cycle time was 10.3, 9.1 and 7.6 h for Scenarios A), B) and C), respectively. Total hands-on time for each scenario was, in order, 100.0 (A), 90.3 (B) and 61.4 min (C). The interface of an automated analyzer to the laboratory workflow, notably system set up for samples and reagents and clean up functions, are as important as the automation capability of the analyzer for the overall impact to processing efficiency and operator hands-on time.

Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

USGS Publications Warehouse

Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

2002-01-01

A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

Human parvovirus B19, varicella zoster virus, and human herpesvirus-6 in mesenchymal stem cells of patients with osteoarthritis: analysis with quantitative real-time polymerase chain reaction.

PubMed

Rollín, R; Alvarez-Lafuente, R; Marco, F; Jover, J A; Hernández-García, C; Rodríguez-Navas, C; López-Durán, L; Fernández-Gutiérrez, B

2007-04-01

To investigate whether there is a possible viral transmission using mesenchymal stem cells (MSCs) in autologous or allogeneic transplantation in the context of osteoarthritis (OA) patients. The presence of parvovirus B19 (B19), varicella zoster virus (VZV), and human herpesvirus-6 (HHV-6) was studied in MSCs from bone marrow of patients with OA and healthy controls. MSCs were prepared from bone marrow aspirates obtained from 18 patients undergoing joint replacement as a result of OA and from 10 healthy controls. DNA was extracted from primary MSCs' culture established from these cells and quantitative real-time polymerase chain reaction was performed to analyse the prevalence and viral load of B19, VZV and HHV-6. The prevalence of total viral DNA among patients with OA was 16.7% (3/18), with a mean viral load of 29.7 copies/microg of DNA. One out of 18 was positive for B19 (viral load, 61.2 copies/microg of DNA), two for VZV (mean viral load, 14.4 copies/microg of DNA), and none for HHV-6. The prevalence of total viral DNA in the control group was 20% (2/10), with a mean viral load of 13.4 copies/microg of DNA. Both positive results were of B19 parvoviruses. There were no statistically significant differences among patients and controls. This first approach to the viral prevalence in MSCs of bone marrow in OA patients and healthy controls seems to show a very low risk of viral transmission or reactivation in a possible MSCs' transplantation.

Comparison of culture versus quantitative real-time polymerase chain reaction for the detection of Taylorella equigenitalis in field samples from naturally infected horses in Canada and Germany.

PubMed

Nadin-Davis, Susan; Knowles, Margaret K; Burke, Teresa; Böse, Reinhard; Devenish, John

2015-07-01

A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment.

Both High-Fidelity Replicative and Low-Fidelity Y-Family Polymerases Are Involved in DNA Rereplication

PubMed Central

Sekimoto, Takayuki; Oda, Tsukasa; Kurashima, Kiminori; Hanaoka, Fumio

2014-01-01

DNA rereplication is a major form of aberrant replication that causes genomic instabilities, such as gene amplification. However, little is known about which DNA polymerases are involved in the process. Here, we report that low-fidelity Y-family polymerases (Y-Pols), Pol η, Pol ι, Pol κ, and REV1, significantly contribute to DNA synthesis during rereplication, while the replicative polymerases, Pol δ and Pol ε, play an important role in rereplication, as expected. When rereplication was induced by depletion of geminin, these polymerases were recruited to rereplication sites in human cell lines. This finding was supported by RNA interference (RNAi)-mediated knockdown of the polymerases, which suppressed rereplication induced by geminin depletion. Interestingly, epistatic analysis indicated that Y-Pols collaborate in a common pathway, independently of replicative polymerases. We also provide evidence for a catalytic role for Pol η and the involvement of Pol η and Pol κ in cyclin E-induced rereplication. Collectively, our findings indicate that, unlike normal S-phase replication, rereplication induced by geminin depletion and oncogene activation requires significant contributions of both Y-Pols and replicative polymerases. These findings offer important mechanistic insights into cancer genomic instability. PMID:25487575

Influenza Polymerase Can Adopt an Alternative Configuration Involving a Radical Repacking of PB2 Domains.

PubMed

Thierry, Eric; Guilligay, Delphine; Kosinski, Jan; Bock, Thomas; Gaudon, Stephanie; Round, Adam; Pflug, Alexander; Hengrung, Narin; El Omari, Kamel; Baudin, Florence; Hart, Darren J; Beck, Martin; Cusack, Stephen

2016-01-07

Influenza virus polymerase transcribes or replicates the segmented RNA genome (vRNA) into respectively viral mRNA or full-length copies and initiates RNA synthesis by binding the conserved 3' and 5' vRNA ends (the promoter). In recent structures of promoter-bound polymerase, the cap-binding and endonuclease domains are configured for cap snatching, which generates capped transcription primers. Here, we present a FluB polymerase structure with a bound complementary cRNA 5' end that exhibits a major rearrangement of the subdomains within the C-terminal two-thirds of PB2 (PB2-C). Notably, the PB2 nuclear localization signal (NLS)-containing domain translocates ∼90 Å to bind to the endonuclease domain. FluA PB2-C alone and RNA-free FluC polymerase are similarly arranged. Biophysical and cap-dependent endonuclease assays show that in solution the polymerase explores different conformational distributions depending on which RNA is bound. The inherent flexibility of the polymerase allows it to adopt alternative conformations that are likely important during polymerase maturation into active progeny RNPs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Evaluation of viral removal by nanofiltration using real-time quantitative polymerase chain reaction.

PubMed

Zhao, Xiaowen; Bailey, Mark R; Emery, Warren R; Lambooy, Peter K; Chen, Dayue

2007-06-01

Nanofiltration is commonly introduced into purification processes of biologics produced in mammalian cells to serve as a designated step for removal of potential exogenous viral contaminants and endogenous retrovirus-like particles. The LRV (log reduction value) achieved by nanofiltration is often determined by cell-based infectivity assay, which is time-consuming and labour-intensive. We have explored the possibility of employing QPCR (quantitative PCR) to evaluate LRV achieved by nanofiltration in scaled-down studies using two model viruses, namely xenotropic murine leukemia virus and murine minute virus. We report here the successful development of a QPCR-based method suitable for quantification of virus removal by nanofiltration. The method includes a nuclease treatment step to remove free viral nucleic acids, while viral genome associated with intact virus particles is shielded from the nuclease. In addition, HIV Armored RNA was included as an internal control to ensure the accuracy and reliability of the method. The QPCRbased method described here provides several advantages such as better sensitivity, faster turnaround time, reduced cost and higher throughput over the traditional cell-based infectivity assays.

A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.

PubMed Central

Tabor, S; Richardson, C C

1985-01-01

The RNA polymerase gene of bacteriophage T7 has been cloned into the plasmid pBR322 under the inducible control of the lambda PL promoter. After induction, T7 RNA polymerase constitutes 20% of the soluble protein of Escherichia coli, a 200-fold increase over levels found in T7-infected cells. The overproduced enzyme has been purified to homogeneity. During extraction the enzyme is sensitive to a specific proteolysis, a reaction that can be prevented by a modification of lysis conditions. The specificity of T7 RNA polymerase for its own promoters, combined with the ability to inhibit selectively the host RNA polymerase with rifampicin, permits the exclusive expression of genes under the control of a T7 RNA polymerase promoter. We describe such a coupled system and its use to express high levels of phage T7 gene 5 protein, a subunit of T7 DNA polymerase. Images PMID:3156376

A sensitive and high throughput TaqMan-based reverse transcription quantitative polymerase chain reaction assay efficiently discriminates ALK rearrangement from overexpression for lung cancer FFPE specimens.

PubMed

Lung, Jrhau; Lin, Yu-Ching; Hung, Ming-Szu; Jiang, Yuan Yuan; Lee, Kuan-Der; Lin, Paul Yann; Tsai, Ying Huang

2016-04-01

ALK fusion gene is an oncogenic driver in lung cancer with low prevalence, which can be ameliorated by crizotinib. Currently, ALK fusion gene can be diagnosed by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC), but inconstistnt results between the two methods are encountered regularly. To make the ALK fusion gene screening more efficient and to provide a simple solution to clarify the discrepancy between FISH and IHC results, a sensitive TaqMan-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay was established. The 3-plex TaqMan-based RT-qPCR assay was established and performed on 102 archived formalin-fixed, paraffin-embedded (FFPE) NSCLC samples to detect ALK rearrangement and overexpression. Break-apart FISH and automatic immunohistochemistry based ALK assays were performed side by side using tissue microarray. The RT-qPCR was performed successfully for 80 samples and 10 of them showed positive signals. Three out of the 10 qPCR positive cases were further confirmed by FISH and IHC test. Two others were IHC positive and FISH negative, and expressed full-length ALK transcript. The rest were neither FISH nor IHC positive and their ALK expression level was significantly lower than those FISH or IHC positive cases. Our RT-qPCR assay demonstrates that the capability and reliability of ALK detection is comparable to FISH and IHC, but it is more effective at discriminating ALK rearrangement from overexpression. The RT-qPCR assay easily clarifies the discrepancy between FISH and IHC, and can be incorporated into routine ALK screening for lung cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Detection of rearrangements and transcriptional up-regulation of ALK in FFPE lung cancer specimens using a novel, sensitive, quantitative reverse transcription polymerase chain reaction assay.

PubMed

Gruber, Kim; Horn, Heike; Kalla, Jörg; Fritz, Peter; Rosenwald, Andreas; Kohlhäufl, Martin; Friedel, Godehard; Schwab, Matthias; Ott, German; Kalla, Claudia

2014-03-01

The approved dual-color fluorescence in situ hybridization (FISH) test for the detection of anaplastic lymphoma receptor tyrosine kinase (ALK) gene rearrangements in non-small-cell lung cancer (NSCLC) is complex and represents a low-throughput assay difficult to use in daily diagnostic practice. We devised a sensitive and robust routine diagnostic test for the detection of rearrangements and transcriptional up-regulation of ALK. We developed a quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay adapted to RNA isolated from routine formalin-fixed, paraffin-embedded material and applied it to 652 NSCLC specimens. The reliability of this technique to detect ALK dysregulation was shown by comparison with FISH and immunohistochemistry. qRT-PCR analysis detected unbalanced ALK expression indicative of a gene rearrangement in 24 (4.6%) and full-length ALK transcript expression in six (1.1%) of 523 interpretable tumors. Among 182 tumors simultaneously analyzed by FISH and qRT-PCR, the latter accurately typed 97% of 19 rearranged and 158 nonrearranged tumors and identified ALK deregulation in two cases with insufficient FISH. Six tumors expressing full-length ALK transcripts did not show rearrangements of the gene. Immunohistochemistry detected ALK protein overexpression in tumors with gene fusions and transcriptional up-regulation, but did not distinguish between the two. One case with full-length ALK expression carried a heterozygous point mutation (S1220Y) within the kinase domain potentially interfering with kinase activity and/or inhibitor binding. Our qRT-PCR assay reliably identifies and distinguishes ALK rearrangements and full-length transcript expression in formalin-fixed, paraffin-embedded material. It is an easy-to-perform, cost-effective, and high-throughput tool for the diagnosis of ALK activation. The expression of full-length ALK transcripts may be relevant for ALK inhibitor therapy in NSCLC.

A structural role for the PHP domain in E. coli DNA polymerase III

PubMed Central

2013-01-01

Background In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Results Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. Conclusions While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase. PMID:23672456

A structural role for the PHP domain in E. coli DNA polymerase III.

PubMed

Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H

2013-05-14

In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.

Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

PubMed Central

Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

2017-01-01

DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement

PubMed Central

Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.

2013-01-01

A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700

Archaeal RNA polymerase and transcription regulation

PubMed Central

Jun, Sung-Hoon; Reichlen, Matthew J.; Tajiri, Momoko; Murakami, Katsuhiko S.

2010-01-01

To elucidate the mechanism of transcription by cellular RNA polymerases (RNAPs), high resolution X-ray crystal structures together with structure-guided biochemical, biophysical and genetics studies are essential. The recently-solved X-ray crystal structures of archaeal RNA polymerase (RNAP) allow a structural comparison of the transcription machinery among all three domains of life. The archaea were once thought of closely related to bacteria, but they are now considered to be more closely related to the eukaryote at the molecular level than bacteria. According to these structures, the archaeal transcription apparatus, which includes RNAP and general transcription factors, is similar to the eukaryotic transcription machinery. Yet, the transcription regulators, activators and repressors, encoded by archaeal genomes are closely related to bacterial factors. Therefore, archaeal transcription appears to possess an intriguing hybrid of eukaryotic-type transcription apparatus and bacterial-like regulatory mechanisms. Elucidating the transcription mechanism in archaea, which possesses a combination of bacterial and eukaryotic transcription mechanisms that are commonly regarded as separate and mutually exclusive, can provide data that will bring basic transcription mechanisms across all three domains of life. PMID:21250781

Rapid Detection of Ceratocystis platani Inoculum by Quantitative Real-Time PCR Assay

PubMed Central

Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

2013-01-01

Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10−2 to 1.4 × 10−2 pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management. PMID:23811499

Structural insight into recruitment of translesion DNA polymerase Dpo4 to sliding clamp PCNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xing, G.; Kirouac, K.; Shin, Y.J.

2009-09-16

DNA polymerases are co-ordinated by sliding clamps (PCNA/{beta}-clamp) in translesion synthesis. It is unclear how these enzymes assemble on PCNA with geometric and functional compatibility. We report the crystal structure of a full-length Y-family polymerase, Dpo4, in complex with heterodimeric PCNA1-PCNA2 at 2.05 {angstrom} resolution. Dpo4 exhibits an extended conformation that differs from the Dpo4 structures in apo- or DNA-bound form. Two hinges have been identified in Dpo4, which render the multidomain polymerase flexible conformations and orientations relative to PCNA. Dpo4 binds specifically to PCNA1 on the conserved ligand binding site. The C-terminal peptide of Dpo4 becomes structured with amore » 3{sub 10} helix and dominates the specific binding. The Y-family polymerase also contacts PCNA1 with its finger, thumb and little finger domains, which are conformation-dependent protein-protein interactions that diversify the binding mode of Dpo4 on PCNA. The structure reveals a molecular model in which substrate/partner binding-coupled multiple conformations of a Y-family polymerase facilitate its recruitment and co-ordination on the sliding clamp. The conformational flexibility would turn the error-prone Y-family polymerase off when more efficient high-fidelity DNA polymerases work on undamaged DNA and turn it onto DNA templates to perform translesion synthesis when replication forks are stalled by DNA lesions.« less

T7 RNA Polymerase Functions In Vitro without Clustering

PubMed Central

Finan, Kieran; Torella, Joseph P.; Kapanidis, Achillefs N.; Cook, Peter R.

2012-01-01

Many nucleic acid polymerases function in clusters known as factories. We investigate whether the RNA polymerase (RNAP) of phage T7 also clusters when active. Using ‘pulldowns’ and fluorescence correlation spectroscopy we find that elongation complexes do not interact in vitro with a Kd<1 µM. Chromosome conformation capture also reveals that genes located 100 kb apart on the E. coli chromosome do not associate more frequently when transcribed by T7 RNAP. We conclude that if clustering does occur in vivo, it must be driven by weak interactions, or mediated by a phage-encoded protein. PMID:22768341

Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

PubMed Central

Suo, Zucai

2014-01-01

Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

Digital quantitative analysis of microRNA in single cell based on ligation-depended polymerase colony (Polony).

PubMed

Wang, Hui; Wang, Honghong; Duan, Xinrui; Liu, Chenghui; Li, Zhengping

2017-09-15

The ability to dissect cell-to-cell variations of microRNA (miRNA) expression with single-cell resolution has become a powerful tool to investigate the regulatory function of miRNAs in biological processes and the pathogenesis of miRNA-related diseases. Herein, we have developed a novel scheme for digital detection of miRNA in single cell by using the ligation-depended DNA polymerase colony (polony). Firstly, two simply designed target-specific DNA probes were ligated by using individual miRNA as the template. Then the ligated DNA probe acted as polony template that was amplified by PCR process in the thin polyacrylamide hydrogel. Due to the covalent attachment of a PCR primer on polyacrylamide matrix and the retarding effect of the polyacrylamide hydrogel matrix itself, as the polony reaction proceeds, the PCR products diffused radially near individual template molecule to form a bacteria colony-like spots of DNA molecules. The spots can be counted after staining the polyacrylamide gel with SYBR Green I and imaging with a microarray scanner. Our polony-based method is sensitive enough to detect 60 copies of miRNA molecules. Meanwhile, the new strategy has the capability of distinguishing singe-base difference. Due to its high sensitivity and specificity, the proposed method has been successfully applied to analysis of the expression profiling of miRNA in single cell. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of a TaqMan Array Card for Detection of Central Nervous System Infections.

PubMed

Onyango, Clayton O; Loparev, Vladimir; Lidechi, Shirley; Bhullar, Vinod; Schmid, D Scott; Radford, Kay; Lo, Michael K; Rota, Paul; Johnson, Barbara W; Munoz, Jorge; Oneko, Martina; Burton, Deron; Black, Carolyn M; Neatherlin, John; Montgomery, Joel M; Fields, Barry

2017-07-01

Infections of the central nervous system (CNS) are often acute, with significant morbidity and mortality. Routine diagnosis of such infections is limited in developing countries and requires modern equipment in advanced laboratories that may be unavailable to a number of patients in sub-Saharan Africa. We developed a TaqMan array card (TAC) that detects multiple pathogens simultaneously from cerebrospinal fluid. The 21-pathogen CNS multiple-pathogen TAC (CNS-TAC) assay includes two parasites ( Balamuthia mandrillaris and Acanthamoeba ), six bacterial pathogens ( Streptococcus pneumonia e, Haemophilus influenzae , Neisseria meningitidis , Mycoplasma pneumoniae , Mycobacterium tuberculosis , and Bartonella ), and 13 viruses (parechovirus, dengue virus, Nipah virus, varicella-zoster virus, mumps virus, measles virus, lyssavirus, herpes simplex viruses 1 and 2, Epstein-Barr virus, enterovirus, cytomegalovirus, and chikungunya virus). The card also includes human RNase P as a nucleic acid extraction control and an internal manufacturer control, GAPDH (glyceraldehyde-3-phosphate dehydrogenase). This CNS-TAC assay can test up to eight samples for all 21 agents within 2.5 h following nucleic acid extraction. The assay was validated for linearity, limit of detection, sensitivity, and specificity by using either live viruses (dengue, mumps, and measles viruses) or nucleic acid material (Nipah and chikungunya viruses). Of 120 samples tested by individual real-time PCR, 35 were positive for eight different targets, whereas the CNS-TAC assay detected 37 positive samples across nine different targets. The CNS-TAC assays showed 85.6% sensitivity and 96.7% specificity. Therefore, the CNS-TAC assay may be useful for outbreak investigation and surveillance of suspected neurological disease. Copyright © 2017 American Society for Microbiology.

Quantitative assessment of hematopoietic chimerism by quantitative real-time polymerase chain reaction of sequence polymorphism systems after hematopoietic stem cell transplantation.

PubMed

Qin, Xiao-ying; Li, Guo-xuan; Qin, Ya-zhen; Wang, Yu; Wang, Feng-rong; Liu, Dai-hong; Xu, Lan-ping; Chen, Huan; Han, Wei; Wang, Jing-zhi; Zhang, Xiao-hui; Li, Jin-lan; Li, Ling-di; Liu, Kai-yan; Huang, Xiao-jun

2011-08-01

Analysis of changes in recipient and donor hematopoietic cell origin is extremely useful to monitor the effect of hematopoietic stem cell transplantation (HSCT) and sequential adoptive immunotherapy by donor lymphocyte infusions. We developed a sensitive, reliable and rapid real-time PCR method based on sequence polymorphism systems to quantitatively assess the hematopoietic chimerism after HSCT. A panel of 29 selected sequence polymorphism (SP) markers was screened by real-time PCR in 101 HSCT patients with leukemia and other hematological diseases. The chimerism kinetics of bone marrow samples of 8 HSCT patients in remission and relapse situations were followed longitudinally. Recipient genotype discrimination was possible in 97.0% (98 of 101) with a mean number of 2.5 (1-7) informative markers per recipient/donor pair. Using serial dilutions of plasmids containing specific SP markers, the linear correlation (r) of 0.99, the slope between -3.2 and -3.7 and the sensitivity of 0.1% were proved reproducible. By this method, it was possible to very accurately detect autologous signals in the range from 0.1% to 30%. The accuracy of the method in the very important range of autologous signals below 5% was extraordinarily high (standard deviation <1.85%), which might significantly improve detection accuracy of changes in autologous signals early in the post-transplantation course of follow-up. The main advantage of the real-time PCR method over short tandem repeat PCR chimerism assays is the absence of PCR competition and plateau biases, with demonstrated greater sensitivity and linearity. Finally, we prospectively analyzed bone marrow samples of 8 patients who received allografts and presented the chimerism kinetics of remission and relapse situations that illustrated the sensitivity level and the promising clinical application of this method. This SP-based real-time PCR assay provides a rapid, sensitive, and accurate quantitative assessment of mixed chimerism that can

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

PubMed

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

[Development of a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse tanscription polymerase chain reaction (qRT-PCR)].

PubMed

Pavlov, K A; Shkoporov, A N; Khokhlova, E V; Korchagina, A A; Sidorenkov, A V; Grigor'ev, M É; Pushkar', D Iu; Chekhonin, V P

2013-01-01

The wide introduction of prostatic specific antigen (PSA) determination into clinical practice has resulted in a larger number of prostate biopsies, while the lower age threshold for PSA has led to a larger number of unnecessary prostate biopsies. Hence, there is a need for new biomarkers that can detect prostate cancer. PCA3 is a noncoding messenger ribonucleic acid (mRNA) that is expressed exclusively in prostate cells. The aim of the study has been to develop a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse transcription polymerase chain reaction (qRT-PCR). As part of the study, a laboratory diagnostic test system prototype has been designed, an application methodology has been developed and specificity and sensitivity data of the method has been assessed. The diagnostic system has demonstrated its ability to detect significantly elevated levels of PCA 3/KLK 3 in samples from prostate cancer (PCa) patients compared with those from healthy men. The findings have shown relatively high diagnostic sensitivity, specificity and negative-predictive values for an early non-invasive screening of prostate cancer

Occupancy of RNA Polymerase II Phosphorylated on Serine 5 (RNAP S5P) and RNAP S2P on Varicella-Zoster Virus Genes 9, 51, and 66 Is Independent of Transcript Abundance and Polymerase Location within the Gene.

PubMed

Henderson, Heather H; Timberlake, Kensey B; Austin, Zoe A; Badani, Hussain; Sanford, Bridget; Tremblay, Keriann; Baird, Nicholas L; Jones, Kenneth; Rovnak, Joel; Frietze, Seth; Gilden, Don; Cohrs, Randall J

2016-02-01

Regulation of gene transcription in varicella-zoster virus (VZV), a ubiquitous human neurotropic alphaherpesvirus, requires coordinated binding of multiple host and virus proteins onto specific regions of the virus genome. Chromatin immunoprecipitation (ChIP) is widely used to determine the location of specific proteins along a genomic region. Since the size range of sheared virus DNA fragments governs the limit of accurate protein localization, particularly for compact herpesvirus genomes, we used a quantitative PCR (qPCR)-based assay to determine the efficiency of VZV DNA shearing before ChIP, after which the assay was used to determine the relationship between transcript abundance and the occupancy of phosphorylated RNA polymerase II (RNAP) on the gene promoter, body, and terminus of VZV genes 9, 51, and 66. The abundance of VZV gene 9, 51, and 66 transcripts in VZV-infected human fetal lung fibroblasts was determined by reverse transcription-linked quantitative PCR. Our results showed that the C-terminal domain of RNAP is hyperphosphorylated at serine 5 (S5(P)) on VZV genes 9, 51, and 66 independently of transcript abundance and the location within the virus gene at both 1 and 3 days postinfection (dpi). In contrast, phosphorylated serine 2 (S2(P))-modified RNAP was not detected at any virus gene location at 3 dpi and was detected at levels only slightly above background levels at 1 dpi. Regulation of herpesvirus gene transcription is an elaborate choreography between proteins and DNA that is revealed by chromatin immunoprecipitation (ChIP). We used a quantitative PCR-based assay to determine fragment size after DNA shearing, a critical parameter in ChIP assays, and exposed a basic difference in the mechanism of transcription between mammalian cells and VZV. We found that hyperphosphorylation at serine 5 of the C-terminal domain of RNAP along the lengths of VZV genes (the promoter, body, and transcription termination site) was independent of mRNA abundance. In

Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

PubMed

Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

2005-01-01

Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

Transcription in Yeast: Separation and Properties of Multiple RNA Polymerases

PubMed Central

Adman, Ray; Schultz, Loren D.; Hall, Benjamin D.

1972-01-01

Four peaks of DNA-directed RNA polymerase activity are resolved by salt gradient elution of a sonicated yeast cell extract on DEAE-Sephadex. The enzymes, which are named IA, IB, II, and III in order of elution, all appear to come from cell nuclei. Only enzyme II is sensitive to α-amanitin. All enzymes are more active with Mn++ than with Mg++ as divalent ion. Enzymes IB and II have salt optima in the range 0.05-0.10 M (NH4)2SO4, whereas enzyme III is maximally active at 0.20-0.25 M (NH4)2SO4. With optimal salt concentration and saturating DNA, the template preference ratio, activity on native calfthymus DNA divided by activity on denatured calf-thymus DNA, is 2.2 for IB, 0.4 for II, and 3.5 for III. None of the yeast polymerases was inhibited by rifamycin SV. Rifamycin AF/013 effectively inhibited polymerases IB, II, and III. PMID:4558656

Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

PubMed

Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

2018-02-01

Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

A real-time, quantitative PCR protocol for assessing the relative parasitemia of Leucocytozoon in waterfowl