Sample records for taqman quantitative polymerase

  1. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  2. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    USDA-ARS?s Scientific Manuscript database

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  3. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  4. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  5. Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

    2005-08-10

    As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM insect resistant cottons quantification. All of these results indicated that our established conventional and TaqMan real-time PCR assays were applicable to detect the three insect resistant cottons qualitatively and quantitatively.

  6. Detection and quantification of genetically modified organisms using very short, locked nucleic acid TaqMan probes.

    PubMed

    Salvi, Sergio; D'Orso, Fabio; Morelli, Giorgio

    2008-06-25

    Many countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (PCR) based upon the TaqMan probe chemistry has become the method mostly used to support these regulations; moreover, event-specific PCR is the preferred method in GMO detection because of its high specificity based on the flanking sequence of the exogenous integrant. The aim of this study was to evaluate the use of very short (eight-nucleotide long), locked nucleic acid (LNA) TaqMan probes in 5'-nuclease PCR assays for the detection and quantification of GMOs. Classic TaqMan and LNA TaqMan probes were compared for the analysis of the maize MON810 transgene. The performance of the two types of probes was tested on the maize endogenous reference gene hmga, the CaMV 35S promoter, and the hsp70/cryIA(b) construct as well as for the event-specific 5'-integration junction of MON810, using plasmids as standard reference molecules. The results of our study demonstrate that the LNA 5'-nuclease PCR assays represent a valid and reliable analytical system for the detection and quantification of transgenes. Application of very short LNA TaqMan probes to GMO quantification can simplify the design of 5'-nuclease assays.

  7. Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

    PubMed

    Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

    2002-03-01

    Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

  8. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    PubMed

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

  9. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  10. Quantification of rice brown leaf spot through Taqman real-time PCR specific to the unigene encoding Cochliobolus miyabeanus SCYTALONE DEHYDRATASE1 involved in fungal melanin biosynthesis.

    PubMed

    Su'udi, Mukhamad; Park, Jong-Mi; Kang, Woo-Ri; Park, Sang-Ryeol; Hwang, Duk-Ju; Ahn, Il-Pyung

    2012-12-01

    Rice brown leaf spot is a major disease in the rice paddy field. The causal agent Cochliobolus miyabeanus is an ascomycete fungus and a representative necrotrophic pathogen in the investigation of rice-microbe interactions. The aims of this research were to identify a quantitative evaluation method to determine the amount of C. miyabeanus proliferation in planta and determine the method's sensitivity. Real-time polymerase chain reaction (PCR) was employed in combination with the primer pair and Taqman probe specific to CmSCD1, a C. miyabeanus unigene encoding SCYTALONE DEHYDRATASE, which is involved in fungal melanin biosynthesis. Comparative analysis of the nucleotide sequences of CmSCD1 from Korean strains with those from the Japanese and Taiwanese strains revealed some sequence differences. Based on the crossing point (CP) values from Taqman real-time PCR containing a series of increasing concentrations of cloned amplicon or fungal genomic DNA, linear regressions with a high level of reliability (R(2)>0.997) were constructed. This system was able to estimate fungal genomic DNA at the picogram level. The reliability of this equation was further confirmed using DNA samples from both resistant and susceptible cultivars infected with C. miyabeanus. In summary, our quantitative system is a powerful alternative in brown leaf spot forecasting and in the consistent evaluation of disease progression.

  11. Assessment of Legionella pneumophila in recreational spring water with quantitative PCR (Taqman) assay.

    PubMed

    Shen, Shu-Min; Chou, Ming-Yuan; Hsu, Bing-Mu; Ji, Wen-Tsai; Hsu, Tsui-Kang; Tsai, Hsiu-Feng; Huang, Yu-Li; Chiu, Yi-Chou; Kao, Erl-Shyh; Kao, Po-Min; Fan, Cheng-Wei

    2015-07-01

    Legionella spp. are common in various natural and man-made aquatic environments. Recreational hot spring is frequently reported as an infection hotspot because of various factors such as temperature and humidity. Although polymerase chain reaction (PCR) had been used for detecting Legionella, several inhibitors such as humic substances, calcium, and melanin in the recreational spring water may interfere with the reaction thus resulting in risk underestimation. The purpose of this study was to compare the efficiencies of conventional and Taqman quantitative PCR (qPCR) on detecting Legionella pneumophila in spring facilities and in receiving water. In the results, Taqman PCR had much better efficiency on specifying the pathogen in both river and spring samples. L. pneumophila was detected in all of the 27 river water samples and 45 of the 48 hot spring water samples. The estimated L. pneumophela concentrations ranged between 1.0 × 10(2) and 3.3 × 10(5) cells/l in river water and 72.1-5.7 × 10(6) cells/l in hot spring water. Total coliforms and turbidity were significantly correlated with concentrations of L. pneumophila in positive water samples. Significant difference was also found in water temperature between the presence/absence of L. pneumophila. Our results suggest that conventional PCR may be not enough for detecting L. pneumophila particularly in the aquatic environments full of reaction inhibitors.

  12. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    PubMed

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  13. Evaluation of the clinical sensitivity for the quantification of human immunodeficiency virus type 1 RNA in plasma: Comparison of the new COBAS TaqMan HIV-1 with three current HIV-RNA assays--LCx HIV RNA quantitative, VERSANT HIV-1 RNA 3.0 (bDNA) and COBAS AMPLICOR HIV-1 Monitor v1.5.

    PubMed

    Katsoulidou, Antigoni; Petrodaskalaki, Maria; Sypsa, Vana; Papachristou, Eleni; Anastassopoulou, Cleo G; Gargalianos, Panagiotis; Karafoulidou, Anastasia; Lazanas, Marios; Kordossis, Theodoros; Andoniadou, Anastasia; Hatzakis, Angelos

    2006-02-01

    The COBAS TaqMan HIV-1 test (Roche Diagnostics) was compared with the LCx HIV RNA quantitative assay (Abbott Laboratories), the Versant HIV-1 RNA 3.0 (bDNA) assay (Bayer) and the COBAS Amplicor HIV-1 Monitor v1.5 test (Roche Diagnostics), using plasma samples of various viral load levels from HIV-1-infected individuals. In the comparison of TaqMan with LCx, TaqMan identified as positive 77.5% of the 240 samples versus 72.1% identified by LCx assay, while their overall agreement was 94.6% and the quantitative results of samples that were positive by both methods were strongly correlated (r=0.91). Similarly, in the comparison of TaqMan with bDNA 3.0, both methods identified 76.3% of the 177 samples as positive, while their overall agreement was 95.5% and the quantitative results of samples that were positive by both methods were strongly correlated (r=0.95). Finally, in the comparison of TaqMan with Monitor v1.5, TaqMan identified 79.5% of the 156 samples as positive versus 80.1% identified by Monitor v1.5, while their overall agreement was 95.5% and the quantitative results of samples that were positive by both methods were strongly correlated (r=0.96). In conclusion, the new COBAS TaqMan HIV-1 test showed excellent agreement with other widely used commercially available tests for the quantitation of HIV-1 viral load.

  14. Development of a real-time quantitative PCR assay to enumerate Yersinia pestis in fleas.

    PubMed

    Gabitzsch, Elizabeth S; Vera-Tudela, Rommelle; Eisen, Rebecca J; Bearden, Scott W; Gage, Kenneth L; Zeidner, Nordin S

    2008-07-01

    A real-time quantitative polymerase chain reaction (qPCR) assay was developed for Yersina pestis. The qPCR assay was developed utilizing a conserved region of the Y. pestis ferric iron uptake regulator gene (fur) to design primers and a fluorescent (FAM-labeled) TaqMan probe. The assay was optimized using cultured Y. pestis (UG05-0454) and was confirmed to work with strains from 3 Y. pestis biovars. The optimized assay was capable of detecting a single organism of cultured Y. pestis and as little as 300 bacteria in infected flea triturates. This qPCR assay enables rapid enumeration of Y. pestis bacterium in laboratory-infected fleas when compared with conventional serial dilution plating.

  15. Detection of minute virus of mice using real time quantitative PCR in assessment of virus clearance during the purification of Mammalian cell substrate derived biotherapeutics.

    PubMed

    Zhan, Dejin; Roy, Margaret R; Valera, Christine; Cardenas, Jesse; Vennari, Joann C; Chen, Janice W; Liu, Shengjiang

    2002-12-01

    A real time quantitative PCR assay has been developed for detecting minute virus of mice (MVM). This assay directly quantifies PCR product by monitoring the increase of fluorescence intensity emitted during enzymatic hydrolysis of an oligonucleotide probe labelled covalently with fluorescent reporting and quenching dyes via Taq polymerase 5'-->3' exonuclease activity. The quantity of MVM DNA molecules in the samples was determined using a known amount of MVM standard control DNA fragment cloned into a plasmid (pCR-MVM). We have demonstrated that MVM TaqMan PCR assay is approximately 1000-fold more sensitive than the microplate infectivity assay with the lowest detection limit of approximately one particle per reaction. The reliable detection range is within 100 to 10(9) molecules per reaction with high reproducibility. The intra assay variation is <2.5%, and the inter assays variation is <6.5% when samples contain >100 particles/assay. When we applied the TaqMan PCR to MVM clearance studies done by column chromatography or normal flow viral filtration, we found that the virus removal factors were similar to that of virus infectivity assay. It takes about a day to complete entire assay processes, thus, the TaqMan PCR assay is at least 10-fold faster than the infectivity assay. Therefore, we concluded that this fast, specific, sensitive, and robust assay could replace the infectivity assay for virus clearance evaluation. Copyright 2002 The International Association for Biologicals. Published by Elsevier Science Ltd. All rights reserved.

  16. Real-time quantitative PCR for retrovirus-like particle quantification in CHO cell culture.

    PubMed

    de Wit, C; Fautz, C; Xu, Y

    2000-09-01

    Chinese hamster ovary (CHO) cells have been widely used to manufacture recombinant proteins intended for human therapeutic uses. Retrovirus-like particles, which are apparently defective and non-infectious, have been detected in all CHO cells by electron microscopy (EM). To assure viral safety of CHO cell-derived biologicals, quantification of retrovirus-like particles in production cell culture and demonstration of sufficient elimination of such retrovirus-like particles by the down-stream purification process are required for product market registration worldwide. EM, with a detection limit of 1x10(6) particles/ml, is the standard retrovirus-like particle quantification method. The whole process, which requires a large amount of sample (3-6 litres), is labour intensive, time consuming, expensive, and subject to significant assay variability. In this paper, a novel real-time quantitative PCR assay (TaqMan assay) has been developed for the quantification of retrovirus-like particles. Each retrovirus particle contains two copies of the viral genomic particle RNA (pRNA) molecule. Therefore, quantification of retrovirus particles can be achieved by quantifying the pRNA copy number, i.e. every two copies of retroviral pRNA is equivalent to one retrovirus-like particle. The TaqMan assay takes advantage of the 5'-->3' exonuclease activity of Taq DNA polymerase and utilizes the PRISM 7700 Sequence Detection System of PE Applied Biosystems (Foster City, CA, U.S.A.) for automated pRNA quantification through a dual-labelled fluorogenic probe. The TaqMan quantification technique is highly comparable to the EM analysis. In addition, it offers significant advantages over the EM analysis, such as a higher sensitivity of less than 600 particles/ml, greater accuracy and reliability, higher sample throughput, more flexibility and lower cost. Therefore, the TaqMan assay should be used as a substitute for EM analysis for retrovirus-like particle quantification in CHO cell-based production system. Copyright 2000 The International Association for Biologicals.

  17. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

    PubMed

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

    2015-03-01

    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

  18. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  19. Identification of four squid species by quantitative real-time polymerase chain reaction.

    PubMed

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. One step screening of retroviral producer clones by real time quantitative PCR.

    PubMed

    Towers, G J; Stockholm, D; Labrousse-Najburg, V; Carlier, F; Danos, O; Pagès, J C

    1999-01-01

    Recombinant retroviruses are obtained from either stably or transiently transfected retrovirus producer cells. In the case of stably producing lines, a large number of clones must be screened in order to select the one with the highest titre. The multi-step selection of high titre producing clones is time consuming and expensive. We have taken advantage of retroviral endogenous reverse transcription to develop a quantitative PCR assay on crude supernatant from producing clones. We used Taqman PCR technology, which, by using fluorescence measurement at each cycle of amplification, allows PCR product quantification. Fluorescence results from specific degradation of a probe oligonucleotide by the Taq polymerase 3'-5' exonuclease activity. Primers and probe sequences were chosen to anneal to the viral strong stop species, which is the first DNA molecule synthesised during reverse transcription. The protocol consists of a single real time PCR, using as template filtered viral supernatant without any other pre-treatment. We show that the primers and probe described allow quantitation of serially diluted plasmid to as few as 15 plasmid molecules. We then test 200 GFP-expressing retroviral-producing clones either by FACS analysis of infected cells or by using the quantitative PCR. We confirm that the Taqman protocol allows the detection of virus in supernatant and selection of high titre clones. Furthermore, we can determine infectious titre by quantitative PCR on genomic DNA from infected cells, using an additional set of primers and probe to albumin to normalise for the genomic copy number. We demonstrate that real time quantitative PCR can be used as a powerful and reliable single step, high throughput screen for high titre retroviral producer clones.

  1. Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.

    PubMed

    Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui

    2018-05-01

    The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.

  2. Clinical evaluation of a quantitative real time polymerase chain reaction assay for diagnosis of primary Epstein-Barr virus infection in children.

    PubMed

    Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M

    2003-08-01

    Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all had positive PCR results. No sample contained PCR inhibitors. A real time TaqMan PCR assay allows rapid identification of patients with primary EBV infection and those with EBV infectious mononucleosis.

  3. Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

    Treesearch

    Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

  4. One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

    PubMed

    Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

    2015-03-01

    A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. New approach to real-time nucleic acids detection: folding polymerase chain reaction amplicons into a secondary structure to improve cleavage of Förster resonance energy transfer probes in 5′-nuclease assays

    PubMed Central

    Kutyavin, Igor V.

    2010-01-01

    The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection. PMID:19969535

  6. Comparison of Versant HBV DNA 3.0 and COBAS AmpliPrep-COBAS TaqMan assays for hepatitis B DNA quantitation: Possible clinical implications.

    PubMed

    Garbuglia, A R; Angeletti, C; Lauria, F N; Zaccaro, P; Cocca, A M; Pisciotta, M; Solmone, M; Capobianchi, M R

    2007-12-01

    We compared two commercial assays for HBV DNA quantitation, Versant HBV 3.0, System 340 (bDNA; Bayer Diagnostics) and COBAS AmpliPrep-COBAS TaqMan HBV Test (TaqMan; Roche Diagnostics). Analytical sensitivity, calculated on WHO International Standard, predicted 95% detection rate at 11.4 and 520.2IU/ml for TaqMan and bDNA, respectively. Specificity, established on 50 blood donor samples, was 100% and 84% for TaqMan and bDNA, respectively. When using clinical samples, HBV DNA was detected by TaqMan in 21/55 samples negative to bDNA. Mean values of HBV DNA obtained with bDNA were higher than those obtained with TaqMan (4.09log(10)+/-1.90 versus 3.39log(10)+/-2.41, p<0.001), and 24.4% of samples showed differences in viral load values >0.5log(10), without association with HBV genotype. There was a good correlation for HBV DNA concentrations measured by the two assays (r=0.94; p<0.001) within the overlapping range, and the distribution of results with respect to relevant clinical threshold recently confirmed (20,000 and 2000IU/ml) was similar. Approximately 50% of samples with low HBV DNA, appreciated by TaqMan but not by bDNA, were successfully sequenced in pol region, where drug resistance mutations are located.

  7. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  8. High sensitivity detection and quantitation of DNA copy number and single nucleotide variants with single color droplet digital PCR.

    PubMed

    Miotke, Laura; Lau, Billy T; Rumma, Rowza T; Ji, Hanlee P

    2014-03-04

    In this study, we present a highly customizable method for quantifying copy number and point mutations utilizing a single-color, droplet digital PCR platform. Droplet digital polymerase chain reaction (ddPCR) is rapidly replacing real-time quantitative PCR (qRT-PCR) as an efficient method of independent DNA quantification. Compared to quantative PCR, ddPCR eliminates the needs for traditional standards; instead, it measures target and reference DNA within the same well. The applications for ddPCR are widespread including targeted quantitation of genetic aberrations, which is commonly achieved with a two-color fluorescent oligonucleotide probe (TaqMan) design. However, the overall cost and need for optimization can be greatly reduced with an alternative method of distinguishing between target and reference products using the nonspecific DNA binding properties of EvaGreen (EG) dye. By manipulating the length of the target and reference amplicons, we can distinguish between their fluorescent signals and quantify each independently. We demonstrate the effectiveness of this method by examining copy number in the proto-oncogene FLT3 and the common V600E point mutation in BRAF. Using a series of well-characterized control samples and cancer cell lines, we confirmed the accuracy of our method in quantifying mutation percentage and integer value copy number changes. As another novel feature, our assay was able to detect a mutation comprising less than 1% of an otherwise wild-type sample, as well as copy number changes from cancers even in the context of significant dilution with normal DNA. This flexible and cost-effective method of independent DNA quantification proves to be a robust alternative to the commercialized TaqMan assay.

  9. Comparison of the COBAS TAQMAN HIV-1 HPS with VERSANT HIV-1 RNA 3.0 assay (bDNA) for plasma RNA quantitation in different HIV-1 subtypes.

    PubMed

    Gomes, Perpétua; Palma, Ana Carolina; Cabanas, Joaquim; Abecasis, Ana; Carvalho, Ana Patrícia; Ziermann, Rainer; Diogo, Isabel; Gonçalves, Fátima; Lobo, Céu Sousa; Camacho, Ricardo

    2006-08-01

    Quantitation of HIV-1 RNA levels in plasma has an undisputed prognostic value and is extremely important for evaluating response to antiretroviral therapy. The purpose of this study was to evaluate the performance of the real-time PCR COBAS TaqMan 48 analyser, comparing it to the existing VERSANT 3.0 (bDNA) for HIV-1 RNA quantitation in plasma of individuals infected with different HIV-1 subtypes (104 blood samples). A positive linear correlation between the two tests (r2 = 0.88) was found. Quantitation by the COBAS TaqMan assay was approximately 0.32log10 higher than by bDNA. The relationship between the two assays was similar within all subtypes with a Deming regression of <1 and <0 for the Bland-Altman plots. Overall, no significant differences were found in plasma viral load quantitation in different HIV-1 subtypes between both assays; therefore these assays are suitable for viral load quantitation of highly genetically diverse HIV-1 plasma samples.

  10. [Quantitative PCR in the diagnosis of Leishmania].

    PubMed

    Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C

    2004-06-01

    Polymerase chain reaction (PCR) is a sensitive and rapid method for the diagnosis of canine Leishmania infection and can be performed on a variety of biological samples, including peripheral blood, lymph node, bone marrow and skin. Standard PCR requires electrophoretic analysis of the amplification products and is usually not suitable for quantification of the template DNA (unless competitor-based or other methods are developed), being of reduced usefulness when accurate monitoring of target DNA is required. Quantitative real-time PCR allows the continuous monitoring of the accumulation of PCR products during the amplification reaction. This allows the identification of the cycle of near-logarithmic PCR product generation (threshold cycle) and, by inference, the relative quantification of the template DNA present at the start of the reaction. Since the amplification product are monitored in "real-time" as they form cycle-by-cycle, no post-amplification handling is required. The absolute quantification is performed according either to an internal standard co-amplified with the sample DNA, or to an external standard curve obtained by parallel amplification of serial known concentrations of a reference DNA sequence. From the quantification of the template DNA, an estimation of the relative load of parasites in the different samples can be obtained. The advantages compared to standard and semi-quantitative PCR techniques are reduction of the assay's time and contamination risks, and improved sensitivity. As for standard PCR, the minimal components of the quantitative PCR reaction mixture are the DNA target of the amplification, an oligonucleotide primer pair flanking the target sequence, a suitable DNA polymerase, deoxynucleotides, buffer and salts. Different technologies have been set up for the monitoring of amplification products, generally based on the use of fluorescent probes. For instance, SYBR Green technology is a non-specific detection system based on a fluorescent dsDNA intercalator and it is applicable to all potential targets. TaqMan technology is more specific since performs the direct assessment of the amount of amplified DNA using a fluorescent probe specific for the target sequence flanked by the primer pair. This probe is an oligonucleotide labelled with a reporter dye (fluorescent) and a quencher (which absorbs the fluorescent signal generated by the reporter). The thermic protocol of amplification allows the binding of the fluorescent probe to the target sequence before the binding of the primers and the starting of the polymerization by Taq polymerase. During polymerization, 5'-3' exonuclease activity of Taq polymerase digests the probe and in this way the reporter dye is released from the probe and a fluorescent signal is detected. The intensity of the signal accumulates at the end of each cycle and is related to the amount of the amplification product. In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of Leishmania in mouse liver, mouse skin and human peripheral blood, targeting either single-copy chromosomal or multi-copy minicircle sequences with high sensitivity and reproducibility. In particular, real-time PCR seems to be a reliable, rapid and noninvasive method for the diagnosis and follow up of visceral leishmaniasis in humans. At present, the application of real-time PCR for research and clinical diagnosis of Leishmania infection in dogs is still foreseable. As for standard PCR, the high sensitivity of real-time PCR could allow the use of blood sampling that is less invasive and easily performed for monitoring the status of the dogs. The development of a real-time PCR assay for Leishmania infantum infection in dogs could support the standard and optimized serological and PCR methods currenly in use for the diagnosis and follow-up of canine leishmaniasis, and perhaps prediction of recurrences associated with tissue loads of residual pathogens after treatment. At this regard, a TaqMan Real Time PCR method developed for the quantification of Leishmania infantum minicircle DNA in peripheral blood of naturally infected dogs sampled before and at different time points after the beginning of a standard antileishmanial therapy will be illustrated.

  11. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    PubMed

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  12. USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

    EPA Science Inventory

    The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

  13. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    PubMed

    Ito, Takao; Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  14. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

    PubMed Central

    Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

  15. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    PubMed

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  16. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  17. A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

    PubMed

    Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

    2007-07-01

    In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

  18. Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

    PubMed

    Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

    2010-08-01

    A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

  19. Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

    PubMed

    Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

    2010-02-01

    To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

  20. An outbreak of West Nile Virus infection in the region of Monastir, Tunisia, 2003

    PubMed Central

    Riabi, Samira; Gaaloul, Imed; Mastouri, Maha; Hassine, Mohsen; Aouni, Mahjoub

    2014-01-01

    Background A West Nile (WN) fever epidemic occurred in the region of Monastir, Tunisia, between August and October 2003. Aim of the study We attempt to describe the epidemiology, clinical presentation, and outcome of patients with confirmed West Nile virus (WNV) infection. Methods Three groups of specimens were prepared. One was made up of serum only (n  =  43), the other of cerebrospinal fluid (CSF) only (n  =  30), and the third group was made up of both (n  =  40). These specimens were obtained from 113 patients. A serological diagnosis and evidence of WNV genome by nested reverse-transcriptase polymerase chain reaction (nRT-PCR) and TaqMan reverse transcription-polymerase chain reaction (RT-PCR) were carried out. Results Thirty-eight cases (33.6%) were serologically positive. Results of nRT-PCR showed a total of 10 positive cases of WNV (8.8%) detected in group 1 (n  =  1/43), group 2 (n  =  5/30), and group 3 (n  =  4/40) whereas the PCR TaqMan showed 18 positive samples (15.9%) found in group 1 (n  =  3/43), group 2 (n  =  9/30), and group 3 (n  =  6/40). All TaqMan PCR positive cases were nRT-PCR positive. In addition, four serologically probable cases were confirmed by TaqMan PCR. The attempts to isolate WNV by cell culture were unsuccessful. Considering the results of TaqMan assay and the serological diagnosis, WNV infection was confirmed in a total of 42 patients. The main clinical presentations were meningoencephalitis (40%), febrile disease (95%), and meningitis (36%). Eight patients (19%) died. The highest case-fatality rates occurred among patients aged ≧55 years. The phylogenetic analysis revealed that isolates of WNV were closely related to the Tunisian strain 1997 (PAH001) and the Israeli one (Is-98). Conclusions West Nile virus is a reemerging global pathogen that remains an important public health challenge in the next decade. PMID:24766339

  1. TaqMan DNA technology confirms likely overestimation of cod (Gadus morhua L.) egg abundance in the Irish Sea: implications for the assessment of the cod stock and mapping of spawning areas using egg-based methods.

    PubMed

    Fox, C J; Taylor, M I; Pereyra, R; Villasana, M I; Rico, C

    2005-03-01

    Recent substantial declines in northeastern Atlantic cod stocks necessitate improved biological knowledge and the development of techniques to complement standard stock assessment methods (which largely depend on accurate commercial catch data). In 2003, an ichthyoplankton survey was undertaken in the Irish Sea and subsamples of 'cod-like' eggs were analysed using a TaqMan multiplex, PCR (polymerase chain reaction) assay (with specific probes for cod, haddock and whiting). The TaqMan method was readily applied to the large number of samples (n = 2770) generated during the survey and when combined with a manual DNA extraction protocol had a low failure rate of 6%. Of the early stage 'cod-like' eggs (1.2-1.75 mm diameter) positively identified: 34% were cod, 8% haddock and 58% whiting. As previous stock estimates based on egg surveys for Irish Sea cod assumed that the majority of 'cod-like' eggs were from cod, the TaqMan results confirm that there was probably substantial contamination by eggs of whiting and haddock that would have inflated estimates of the stock biomass.

  2. Detection of Food Allergens by Taqman Real-Time PCR Methodology.

    PubMed

    García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel

    2017-01-01

    Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.

  3. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    PubMed

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015.

  4. Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

    PubMed Central

    2005-01-01

    Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

  5. Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

    USGS Publications Warehouse

    Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

  6. Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

    PubMed

    Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

    2016-01-01

    Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

  7. Application of quantitative real-time PCR compared to filtration methods for the enumeration of Escherichia coli in surface waters within Vietnam.

    PubMed

    Vital, Pierangeli G; Van Ha, Nguyen Thi; Tuyet, Le Thi Hong; Widmer, Kenneth W

    2017-02-01

    Surface water samples in Vietnam were collected from the Saigon River, rural and suburban canals, and urban runoff canals in Ho Chi Minh City, Vietnam, and were processed to enumerate Escherichia coli. Quantification was done through membrane filtration and quantitative real-time polymerase chain reaction (PCR). Mean log colony-forming unit (CFU)/100 ml E. coli counts in the dry season for river/suburban canals and urban canals were log 2.8 and 3.7, respectively, using a membrane filtration method, while using Taqman quantitative real-time PCR they were log 2.4 and 2.8 for river/suburban canals and urban canals, respectively. For the wet season, data determined by the membrane filtration method in river/suburban canals and urban canals samples had mean counts of log 3.7 and 4.1, respectively. While mean log CFU/100 ml counts in the wet season using quantitative PCR were log 3 and 2, respectively. Additionally, the urban canal samples were significantly lower than those determined by conventional culture methods for the wet season. These results show that while quantitative real-time PCR can be used to determine levels of fecal indicator bacteria in surface waters, there are some limitations to its application and it may be impacted by sources of runoff based on surveyed samples.

  8. Comparative evaluation of new TaqMan real-time assays for the detection of hepatitis A virus.

    PubMed

    Houde, Alain; Guévremont, Evelyne; Poitras, Elyse; Leblanc, Danielle; Ward, Pierre; Simard, Carole; Trottier, Yvon-Louis

    2007-03-01

    Three novel real-time TaqMan RT-PCR assays targeting the 5'-UTR, the viral protease and the viral polymerase regions of the hepatitis A virus (HAV) were developed, evaluated and compared against a new published 5'-UTR TaqMan assay (JN) and a widely used conventional RT-PCR assay (HAVc). All conventional RT-PCR (HAV, SH-Prot and SH-Poly systems) and TaqMan (SH-Prot, SH-Poly, JN and SH-5U systems) assays evaluated were consistent for the detection of the three different HAV strains (HM-175, HAS-15 and LSH/S) used and reproducible for both RNA duplicates with the exception of two reproducibility discrepancies observed with both 5'-UTR real-time systems (JN and SH-5U). Limits of detection for conventional HAV, SH-Prot and SH-Poly RT-PCR systems were found to be equivalent when tested with serially diluted suspensions of the HM-175 strain. Although the four real-time RT-PCR TaqMan assays evaluated herein produced similar and consistent quantification data down to the level of one genomic equivalent copy with their respectively cloned amplicons, significant and important differences were observed for the detection of HAV genomic RNA. Results showed that the new real-time TaqMan SH-Poly and SH-Prot primer and probe systems were more consistent and sensitive by 5 logs as compared to both 5'-UTR designs (JN and SH-5U) used for the detection of HAV genomic RNA as well as for the detection in cell culture by cytopathic effect. Considering their higher analytical sensitivity, the proposed SH-Poly and SH-Prot amplification systems could therefore represent valuable tools for the detection of HAV in clinical, environmental and food samples.

  9. Taqman real-time quantitative PCR for identification of western flower thrip (Frankliniella occidentalis) for plant quarantine

    PubMed Central

    Huang, K. S.; Lee, S. E.; Yeh, Y.; Shen, G. S.; Mei, E.; Chang, C. M.

    2010-01-01

    Western flower thrip (Frankliniella occidentalis) is a major global pest of agricultural products. It directly damages crops through feeding, oviposition activity or transmission of several plant viruses. We describe a Taqman real-time quantitative PCR detection system, which can rapidly identify F. occidentalis from thrips larvae to complement the traditional morphological identification. The data showed that our detection system targeted on the ribosomal RNA gene regions of F. occidentalis has high sensitivity and specificity. The rapid method can be used for on-site testing of samples at ports-of-entry in the future. PMID:20129946

  10. Taqman real-time quantitative PCR for identification of western flower thrip (Frankliniella occidentalis) for plant quarantine.

    PubMed

    Huang, K S; Lee, S E; Yeh, Y; Shen, G S; Mei, E; Chang, C M

    2010-08-23

    Western flower thrip (Frankliniella occidentalis) is a major global pest of agricultural products. It directly damages crops through feeding, oviposition activity or transmission of several plant viruses. We describe a Taqman real-time quantitative PCR detection system, which can rapidly identify F. occidentalis from thrips larvae to complement the traditional morphological identification. The data showed that our detection system targeted on the ribosomal RNA gene regions of F. occidentalis has high sensitivity and specificity. The rapid method can be used for on-site testing of samples at ports-of-entry in the future.

  11. Concordance of HIV-1 RNA Values by Amplicor and TaqMan 2.0 in Patients With Confirmed Suppression in Clinical Trials

    PubMed Central

    Garner, Will; White, Kirsten; Szwarcberg, Javier; McCallister, Scott; Zhong, Lijie; Wulfsohn, Mike

    2016-01-01

    Background. The COBAS AMPLICOR HIV-1 MONITOR Test, version 1.5 (Amplicor) has been replaced with the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, version 2.0 (TaqMan 2.0), a real-time polymerase chain reaction human immunodeficiency virus type 1 (HIV-1) assay with higher sensitivity and broader dynamic range. HIV-1 RNA values at the 50 copies/mL cutoff drive major patient management decisions and clinical study outcomes. Methods. A total of 2217 samples were collected from 1922 HIV-1–infected subjects taking antiretroviral therapy for at least 48 weeks and had at least 2 consecutive samples with HIV-1 RNA <50 copies/mL by Amplicor from 7 recent clinical trials. HIV-1 RNA results were obtained from the Amplicor and TaqMan 2.0 assays in parallel by a reference laboratory. Results. The overall concordance between assay results was 96% at the cutoff of 50 copies/mL. However, statistically significant discordance at the 50 copies/mL cutoff was found between the assays for 3.9% of samples (n = 87). By TaqMan 2.0, virologic failure defined as HIV-1 RNA ≥50 copies/mL was reported for 2.8% more samples than Amplicor. Of these 87 samples, 68 samples fell within the predicted range of assay variability. Retesting of HIV-1 RNA by TaqMan 2.0 confirmed the discordance in only 28 of the 87 samples. Conclusions. The TaqMan 2.0 assay reports fewer subjects below the clinical endpoint of HIV-1 RNA <50 copies/mL in HIV clinical trials than the Amplicor assay. This difference must be considered when assessing disease progression, designing clinical trials, and comparisons with historical trials that used the Amplicor assay. PMID:26689956

  12. TaqMan RT-PCR and VERSANT HIV-1 RNA 3.0 (bDNA) assay Quantification of HIV-1 RNA viral load in breast milk.

    PubMed

    Israel-Ballard, Kiersten; Ziermann, Rainer; Leutenegger, Christian; Di Canzio, James; Leung, Kimmy; Strom, Lynn; Abrams, Barbara; Chantry, Caroline

    2005-12-01

    Transmission of HIV via breast milk is a primary cause of pediatric HIV infection in developing countries. Reliable methods to detect breast milk viral load are important. To correlate the ability of the VERSANT HIV 3.0 (bDNA) assay to real-time (RT) TaqMan PCR in quantifying breast milk HIV-1 RNA. Forty-six breast milk samples that had been spiked with cell-free HIV-1 and eight samples spiked with cell-associated HIV-1 were assayed for HIV-1 RNA by both VERSANT HIV 3.0 and TaqMan RNA assays. Only assays on the cell-free samples were statistically compared. Both a Deming regression slope and a Bland-Altman slope indicated a linear relationship between the two assays. TaqMan quantitations were on average 2.6 times higher than those of HIV 3.0. A linear relationship was observed between serial dilutions of spiked cell-free HIV-1 and both the VERSANT HIV 3.0 and the TaqMan RNA assays. The two methods correlated well although the VERSANT HIV 3.0 research protocol quantified HIV-1 RNA slightly lower than TaqMan.

  13. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman(®) real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay.

    PubMed

    Röder, Martin; Vieths, Stefan; Holzhauser, Thomas

    2011-01-24

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg(-1) almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg(-1). We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman(®) probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg(-1) almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg(-1). Further, between 100 and 100,000 mg kg(-1) spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman(®) real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n=5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially quantitative almond detection. This PCR method detects almond at a level where severe allergic reactions should not be expected for the majority of the almond allergic individuals. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. [Comparative analysis of real-time quantitative PCR-Sanger sequencing method and TaqMan probe method for detection of KRAS/BRAF mutation in colorectal carcinomas].

    PubMed

    Zhang, Xun; Wang, Yuehua; Gao, Ning; Wang, Jinfen

    2014-02-01

    To compare the application values of real-time quantitative PCR-Sanger sequencing and TaqMan probe method in the detection of KRAS and BRAF mutations, and to correlate KRAS/BRAF mutations with the clinicopathological characteristics in colorectal carcinomas. Genomic DNA of the tumor cells was extracted from formalin fixed paraffin embedded (FFPE) tissue samples of 344 colorectal carcinomas by microdissection. Real-time quantitative PCR-Sanger sequencing and TaqMan probe method were performed to detect the KRAS/BRAF mutations. The frequency and types of KRAS/BRAF mutations, clinicopathological characteristics and survival time were analyzed. KRAS mutations were detected in 39.8% (137/344) and 38.7% (133/344) of 344 colorectal carcinomas by using real-time quantitative PCR-Sanger sequencing and TaqMan probe method, respectively. BRAF mutation was detected in 4.7% (16/344) and 4.1% (14/344), respectively. There was no significant correlation between the two methods. The frequency of the KRAS mutation in female was higher than that in male (P < 0.05). The frequency of the BRAF mutation in colon was higher than that in rectum. The frequency of the BRAF mutation in stage III-IV cases was higher than that in stageI-II cases. The frequency of the BRAF mutation in signet ring cell carcinoma was higher than that in mucinous carcinoma and nonspecific adenocarcinoma had the lowest mutation rate. The frequency of the BRAF mutation in grade III cases was higher than that in grade II cases (P < 0.05). The overall concordance for the two methods of KRAS/BRAF mutation detection was 98.8% (kappa = 0.976). There was statistic significance between BRAF and KRAS mutations for the survival time of colorectal carcinomas (P = 0.039). There were no statistic significance between BRAF mutation type and BRAF/KRAS wild type (P = 0.058). (1) Compared with real-time quantitative PCR-Sanger sequencing, TaqMan probe method is better with regard to handling time, efficiency, repeatability, cost and equipment. (2) The frequency of the KRAS mutation is correlated with gender. BRAF mutation is correlated with primary tumor site, TNM stage, histological types and histological grades.(3) BRAF gene mutation is an independent prognostic marker for colorectal carcinomas.

  15. Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

    PubMed

    Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

    2017-01-01

    In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

  16. Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

    USGS Publications Warehouse

    Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

    2007-01-01

    The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

  17. Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico

    PubMed Central

    Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

    2014-01-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease. PMID:25512712

  18. Expression levels of seven candidate genes in human peripheral blood mononuclear cells and their association with preeclampsia

    PubMed Central

    Garza-Veloz, I.; Carrillo-Sanchez, K.; Martinez-Gaytan, V.; Cortes-Flores, R.; Ochoa-Torres, M. A.; Guerrero, G. G.; Rodriguez-Sanchez, I. P.; Cancela-Murrieta, C. O.; Zamudio-Osuna, M.; Badillo-Almaraz, J. I.; Castruita-De la Rosa, C.

    2014-01-01

    Objective To evaluate the peripheral blood mononuclear cell (PBMC) expression levels of hemeoxygenase 1 (HMOX-1), superoxide dismutase 1 (SOD-1), vascular endothelial growth factor A (VEGF-A), transforming growth factor beta 1 (TGF-β1), interleukin (IL)-6, IL-15 and AdipoQ genes to study their association with preeclampsia (PE). Methods A total of 177 pregnant women were recruited: 108 cases and 69 controls. Quantification of gene expression was measured by quantitative real-time polymerase chain reaction (PCR) using TaqMan probes. Results Underexpression of VEGF-A and TGF-β1 was a constant in most of the cases (80.91% and 76.36%, respectively) and their expression was associated with onset and/or severity of disease (p values < 0.05). IL-6, IL-15 and AdipoQ, showed low or no expression in PBMC samples evaluated. Conclusion PBMC underexpression of VEGF-A and TGF-β1 is a hallmark of PE in the study population. PMID:24295154

  19. Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

    PubMed Central

    Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

    2005-01-01

    Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

  20. Smallpox and pan-Orthodox Virus Detection by Real-Time 3’-Minor Groove Binder TaqMan Assays Oil the Roche LightCycler and the Cepheid Smart Cycler Platforms

    DTIC Science & Technology

    2003-11-08

    Bacillus anthracis BA0068 Ames Sterne SPS 97.13.213 Bacillus cereus Bacillus coagulans Bacillus licheniformis Bacillus macerans Bacillus ...megaterium Bacillus polymyxa Bacillus sphaericus Bacillus stearothermophilus Bacillus subtilis subsp. niger Bacillus thuringiensis Bacillus popilliae...varicella- zoster virus, and Bacillus anthracis DNA by LightCycler polymerase chain reaction after autoclaving:

  1. DNA Carrier Testing and Newborn Screening for Maple Syrup Urine Disease in Old Order Mennonite Communities

    PubMed Central

    Carleton, Stephanie M.; Peck, Dawn S.; Grasela, Julie; Dietiker, Kristin L.

    2010-01-01

    Maple syrup urine disease (MSUD) is an inherited metabolic disorder caused by mutations in the branched chain α-keto acid dehydrogenase complex. Worldwide incidence of MSUD is 1:225,000 live births. However, within Old Order Mennonite communities, the incidence is 1:150 live births and results from a common tyrosine to asparagine substitution (Y438N) in the E1α subunit of branched chain α-keto acid dehydrogenase. We developed a new DNA diagnostic assay utilizing TaqMan® technology and compared its efficacy, sensitivity, and duration with an existing polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) assay. Carrier testing was performed by both TaqMan technology and PCR-RFLP on DNA isolated from buccal swabs of 160 individuals as well as from buccal swabs and blood spots of nine at-risk newborns; assay time, sensitivity, and reliability were also evaluated. The TaqMan assay, like the PCR-RFLP assay, accurately determined Y438N E1α allele status. However, the TaqMan assay appeared (1) more sensitive than the PCR-RFLP assay, requiring 10-fold less DNA (10 ng) to reliably determine genotype status and (2) faster, reducing the assay time required for diagnosis from ∼12 to 5 h. TaqMan technology allowed more rapid DNA diagnoses of MSUD in the neonate, thereby reducing the likelihood of neurological impairment while enhancing health and prognosis for affected infants. PMID:20136525

  2. Quantitative detection method for Roundup Ready soybean in food using duplex real-time PCR MGB chemistry.

    PubMed

    Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson

    2010-07-01

    Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.

  3. Development and validation of quantitative PCR for detection of Terrapene herpesvirus 1 utilizing free-ranging eastern box turtles (Terrapene carolina carolina).

    PubMed

    Kane, Lauren P; Bunick, David; Abd-Eldaim, Mohamed; Dzhaman, Elena; Allender, Matthew C

    2016-06-01

    Diseases that affect the upper respiratory tract (URT) in chelonians have been well described as a significant contributor of morbidity and mortality. Specifically, herpesviruses are common pathogens in captive chelonians worldwide, but their importance on free-ranging populations is less well known. Historical methods for the diagnosis of herpesvirus infections include virus isolation and conventional PCR. Real-time PCR has become an essential tool for detection and quantitation of many pathogens, but has not yet been developed for herpesviruses in box turtles. Two quantitative real-time TaqMan PCR assays, TerHV58 and TerHV64, were developed targeting the DNA polymerase gene of Terrapene herpesvirus 1 (TerHV1). The assay detected a viral DNA segment cloned within a plasmid with 10-fold serial dilutions from 1.04 × 10(7) to 1.04 × 10(1) viral copies per reaction. Even though both primers had acceptable levels of efficiency and variation, TerHV58 was utilized to test clinical samples based on less variation and increased efficiency. This assay detected as few as 10 viral copies per reaction and should be utilized in free-ranging and captive box turtles to aid in the characterization of the epidemiology of this disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. EVALUATION OF RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    EPA Science Inventory

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan (trademark)) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glab...

  5. Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

    PubMed

    Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

    1998-11-23

    Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

  6. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    EPA Science Inventory

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  7. Comparison of culture and qPCR methods in detection of mycobacteria from drinking waters.

    PubMed

    Räsänen, Noora H J; Rintala, Helena; Miettinen, Ilkka T; Torvinen, Eila

    2013-04-01

    Environmental mycobacteria are common bacteria in man-made water systems and may cause infections and hypersensitivity pneumonitis via exposure to water. We compared a generally used cultivation method and a quantitative polymerase chain reaction (qPCR) method to detect mycobacteria in 3 types of drinking waters: surface water, ozone-treated surface water, and groundwater. There was a correlation between the numbers of mycobacteria obtained by cultivation and qPCR methods, but the ratio of the counts obtained by the 2 methods varied among the types of water. The qPCR counts in the drinking waters produced from surface or groundwater were 5 to 34 times higher than culturable counts. In ozone-treated surface waters, both methods gave similar counts. The ozone-treated drinking waters had the highest concentration of assimilable organic carbon, which may explain the good culturability. In warm tap waters, qPCR gave 43 times higher counts than cultivation, but both qPCR counts and culturable counts were lower than those in the drinking waters collected from the same sites. The TaqMan qPCR method is a rapid and sensitive tool for total quantitation of mycobacteria in different types of clean waters. The raw water source and treatments affect both culturability and total numbers of mycobacteria in drinking waters.

  8. High frequency of the PNPLA3 rs738409 [G] single-nucleotide polymorphism in Hmong individuals as a potential basis for a predisposition to chronic liver disease.

    PubMed

    Tepper, Clifford G; Dang, Julie H T; Stewart, Susan L; Fang, Dao M; Wong, Kimberly A; Liu, Stephenie Y; Davis, Ryan R; Dao, Doan Y; Gregg, Jeffrey P; Török, Natalie J; Chen, Moon S

    2018-04-01

    An exploratory study was performed to determine the prevalence of the patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs78409 [G] allele among the Hmong as a risk factor for nonalcoholic fatty liver disease (NAFLD). NAFLD/nonalcoholic steatohepatitis is the world's most common chronic liver disease and is expected to replace viral hepatitis as the leading cause of cirrhosis and potential precursor to hepatocellular carcinoma (HCC). Of all populations in California, the Hmong experience the highest risk of death from HCC and the highest prevalence of metabolic syndrome risk factors among Asians that predispose them to NAFLD. Here a genetic explanation was sought for the high rates of chronic liver disease among the Hmong. The literature pointed to the PNPLA3 rs738409 [G] allele as a potential genetic culprit. Cell-free DNA was isolated from 26 serum samples previously collected in community settings. Quantitative polymerase chain reaction-based single-nucleotide polymorphism (SNP) genotyping was performed with a validated TaqMan SNP genotyping assay, and results were analyzed with TaqMan Genotyper software. The PNPLA3 rs738409 [C>G] variant occurred at a frequency of 0.46 (12 of 26; 95% confidence interval, 0.27-0.67). This carrier rate would rank the Hmong as the third highest population in the 1000 Genomes Project. Although this small sample size limits the generalizability, the high frequency rates of this allele along with the presence of metabolic syndrome risk factors warrant further studies into the etiology of NAFLD among the Hmong. Cancer 2018;124:1583-9. © 2018 American Cancer Society. © 2018 American Cancer Society.

  9. Factors affecting the relationship between quantitative polymerase chain reaction (qPCR) and culture-based enumeration of Enterococcus in environmental waters.

    PubMed

    Raith, M R; Ebentier, D L; Cao, Y; Griffith, J F; Weisberg, S B

    2014-03-01

    To determine the extent to which discrepancies between qPCR and culture-based results in beach water quality monitoring can be attributed to: (i) within-method variability, (ii) between-method difference within each method class (qPCR or culture) and (iii) between-class difference. We analysed 306 samples using two culture-based (EPA1600 and Enterolert) and two qPCR (Taqman and Scorpion) methods, each in duplicate. Both qPCR methods correlated with EPA1600, but regression analyses indicated approximately 0·8 log10 unit overestimation by qPCR compared to culture methods. Differences between methods within a class were less than half of this and were minimal for between-replicate within a method. Using the 104 Enterococcus per 100 ml management decision threshold, Taqman qPCR indicated the same decisions as EPA1600 for 87% of the samples, but indicated beach posting for unhealthful water when EPA1600 did not for 12% of the samples. After accounting for within-method and within-class variability, 8% of the samples exhibited true between-class discrepancy where both qPCR methods indicated beach posting while both culture methods did not. Measurement target difference (DNA vs growth) accounted for the majority of the qPCR-vs-culture discrepancy, but its influence on monitoring application is outweighed by frequent incorrect posting with culture methods due to incubation time delay. This is the first study to quantify the frequency with which culture-vs-qPCR discrepancies can be attributed to target difference - vs - method variability. © 2013 The Society for Applied Microbiology.

  10. Sperm count and motility are quantitatively affected by functional polymorphisms of HTR2A, MAOA and SLC18A.

    PubMed

    Cortés-Rodriguez, Miriam; Royo, Jose-Luis; Reyes-Palomares, Arturo; Lendínez, Ana M; Ruiz-Galdón, Maximiliano; Reyes-Engel, Armando

    2018-05-01

    Spermatozoa and neurones share similar membrane characteristics and features. Associations of multiple polymorphisms traditionally related to neurotransmission were investigated. Infertile men were grouped into controls with normospermia (n = 182) and idiopathic infertile men with asthenozoospermia (n = 103), and analysed as a case-control study and as a quantitative association of each genotype. Ten neurotransmission-associated genetic variants were mapped by SNP analysis using quantitative polymerase chain reaction with TaqMan probes. Men with HTR2A rs6313 had a higher risk of asthenozoospermia (OR = 2.14; P = 0.04). MAOA rs3788862 G carriers displayed an increased risk of asthenozoospermia (OR = 2.29; P = 0.02). The SLC18A1 rs1390938 G allele was more frequent among such cases (0.75 versus 0.87; P < 0.01 and P < 0.01 for Armitage trend test); for SLC18A1 rs2270641 P = 0.02 (case-control frequency) and P = 0.01 (Armitage trend test). MAOA rs3788862 was correlated with sperm motility (Spearman ρ = 0.14; P = 0.02); SLC18A1 rs1390938 was correlated with sperm count and motility (Spearman ρ = 0.20; P < 0.01). Gene polymorphisms of HTR2A, MAOA and SLC18A1, related to neurotransmission, are individually associated with asthenozoospermia through variation in sperm count and motility, without detectable allelic or genotype interaction. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  11. Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection.

    PubMed

    Buh Gasparic, Meti; Tengs, Torstein; La Paz, Jose Luis; Holst-Jensen, Arne; Pla, Maria; Esteve, Teresa; Zel, Jana; Gruden, Kristina

    2010-03-01

    Several techniques have been developed for detection and quantification of genetically modified organisms, but quantitative real-time PCR is by far the most popular approach. Among the most commonly used real-time PCR chemistries are TaqMan probes and SYBR green, but many other detection chemistries have also been developed. Because their performance has never been compared systematically, here we present an extensive evaluation of some promising chemistries: sequence-unspecific DNA labeling dyes (SYBR green), primer-based technologies (AmpliFluor, Plexor, Lux primers), and techniques involving double-labeled probes, comprising hybridization (molecular beacon) and hydrolysis (TaqMan, CPT, LNA, and MGB) probes, based on recently published experimental data. For each of the detection chemistries assays were included targeting selected loci. Real-time PCR chemistries were subsequently compared for their efficiency in PCR amplification and limits of detection and quantification. The overall applicability of the chemistries was evaluated, adding practicability and cost issues to the performance characteristics. None of the chemistries seemed to be significantly better than any other, but certain features favor LNA and MGB technology as good alternatives to TaqMan in quantification assays. SYBR green and molecular beacon assays can perform equally well but may need more optimization prior to use.

  12. Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

    PubMed

    Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

    2006-07-01

    To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

  13. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  14. [Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].

    PubMed

    Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing

    2012-08-01

    Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.

  15. TaqMan PCR for Detection of Vibrio cholerae O1, O139, Non-O1, and Non-O139 in Pure Cultures, Raw Oysters, and Synthetic Seawater†

    PubMed Central

    Lyon, W. J.

    2001-01-01

    Vibrio cholerae is recognized as a leading human waterborne pathogen. Traditional diagnostic testing for Vibrio is not always reliable, because this bacterium can enter a viable but nonculturable state. Therefore, nucleic acid-based tests have emerged as a useful alternative to traditional enrichment testing. In this article, a TaqMan PCR assay is presented for quantitative detection of V. cholerae in pure cultures, oysters, and synthetic seawater. Primers and probe were designed from the nonclassical hemolysin (hlyA) sequence of V. cholerae strains. This probe was applied to DNA from 60 bacterial strains comprising 21 genera. The TaqMan PCR assay was positive for all of the strains of V. cholerae tested and negative for all other species of Vibrio tested. In addition, none of the other genera tested was amplified with the TaqMan primers and probe used in this study. The results of the TaqMan PCR with raw oysters and spiked with V. cholerae serotypes O1 and O139 were comparable to those of pure cultures. The sensitivity of the assay was in the range of 6 to 8 CFU g−1 and 10 CFU ml−1 in spiked raw oyster and synthetic seawater samples, respectively. The total assay could be completed in 3 h. Quantification of the Vibrio cells was linear over at least 6 log units. The TaqMan probe and primer set developed in this study can be used as a rapid screening tool for the presence of V. cholerae in oysters and seawater without prior isolation and characterization of the bacteria by traditional microbiological methods. PMID:11571173

  16. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    PubMed

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement must be performed. Moreover, for some reference genes no sufficient information on copy number in and among genomes of different lines is available, making adequate quantification difficult. Once developed, the method was subsequently validated according to IUPAC and ISO 5725 guidelines. Thirteen laboratories from 8 EU countries participated in the trial. Eleven laboratories provided results complying with the predefined study requirements. Repeatability (RSDr) values ranged from 8.7 to 15.9%, with a mean value of 12%. Reproducibility (RSDR) values ranged from 16.3 to 25.5%, with a mean value of 21%. Following Codex Alimentarius Committee guidelines, both the limits of detection and quantitation were determined to be <0.1%.

  17. Comparative evaluation of the performance of the Abbott RealTime HIV-1 assay for measurement of HIV-1 plasma viral load on genetically diverse samples from Greece

    PubMed Central

    2011-01-01

    Background HIV-1 is characterized by increased genetic heterogeneity which tends to hinder the reliability of detection and accuracy of HIV-1 RNA quantitation assays. Methods In this study, the Abbott RealTime HIV-1 (Abbott RealTime) assay was compared to the Roche Cobas TaqMan HIV-1 (Cobas TaqMan) and the Siemens Versant HIV-1 RNA 3.0 (bDNA 3.0) assays, using clinical samples of various viral load levels and subtypes from Greece, where the recent epidemiology of HIV-1 infection has been characterized by increasing genetic diversity and a marked increase in subtype A genetic strains among newly diagnosed infections. Results A high correlation was observed between the quantitative results obtained by the Abbott RealTime and the Cobas TaqMan assays. Viral load values quantified by the Abbott RealTime were on average lower than those obtained by the Cobas TaqMan, with a mean (SD) difference of -0.206 (0.298) log10 copies/ml. The mean differences according to HIV-1 subtypes between the two techniques for samples of subtype A, B, and non-A/non-B were 0.089, -0.262, and -0.298 log10 copies/ml, respectively. Overall, differences were less than 0.5 log10 for 85% of the samples, and >1 log10 in only one subtype B sample. Similarly, Abbott RealTime and bDNA 3.0 assays yielded a very good correlation of quantitative results, whereas viral load values assessed by the Abbott RealTime were on average higher (mean (SD) difference: 0.160 (0.287) log10 copies/ml). The mean differences according to HIV-1 subtypes between the two techniques for subtype A, B and non-A/non-B samples were 0.438, 0.105 and 0.191 log10 copies/ml, respectively. Overall, the majority of samples (86%) differed by less than 0.5 log10, while none of the samples showed a deviation of more than 1.0 log10. Conclusions In an area of changing HIV-1 subtype pattern, the Abbott RealTime assay showed a high correlation and good agreement of results when compared both to the Cobas TaqMan and bDNA 3.0 assays, for all HIV-1 subtypes tested. All three assays could determine viral load from samples of different HIV-1 subtypes adequately. However, assay variation should be taken into account when viral load monitoring of the same individual is assessed by different systems. PMID:21219667

  18. A New Diagnostic system for Ultra Sensitive and Specific Detection and Quantitation of “Candidatus Liberibacter asiaticus”, the Bacterium Associated with Citrus Huanglongbing

    USDA-ARS?s Scientific Manuscript database

    In this study, an ultra sensitive and quantitative diagnostic system for “Candidatus Liberibacter asiaticus” was developed. This system adapts a nested PCR and Taq-Man PCR in a single closed tube. The procedure involves two steps of PCR using the species specific outer and inner primer pairs. Differ...

  19. Use of real-time qPCR to quantify members of the unculturable heterotrophic bacterial community in a deep sea marine sponge, Vetulina sp.

    PubMed

    Cassler, M; Peterson, C L; Ledger, A; Pomponi, S A; Wright, A E; Winegar, R; McCarthy, P J; Lopez, J V

    2008-04-01

    In this report, real-time quantitative PCR (TaqMan qPCR) of the small subunit (SSU) 16S-like rRNA molecule, a universal phylogenetic marker, was used to quantify the relative abundance of individual bacterial members of a diverse, yet mostly unculturable, microbial community from a marine sponge. Molecular phylogenetic analyses of bacterial communities derived from Caribbean Lithistid sponges have shown a wide diversity of microbes that included at least six major subdivisions; however, very little overlap was observed between the culturable and unculturable microbial communities. Based on sequence data of three culture-independent Lithistid-derived representative bacteria, we designed probe/primer sets for TaqMan qPCR to quantitatively characterize selected microbial residents in a Lithistid sponge, Vetulina, metagenome. TaqMan assays included specificity testing, DNA limit of detection analysis, and quantification of specific microbial rRNA sequences such as Nitrospira-like microbes and Actinobacteria up to 172 million copies per microgram per Lithistid sponge metagenome. By contrast, qPCR amplification with probes designed for common previously cultured sponge-associated bacteria in the genera Rheinheimera and Marinomonas and a representative of the CFB group resulted in only minimal detection of the Rheiheimera in total DNA extracted from the sponge. These data verify that a large portion of the microbial community within Lithistid sponges may consist of currently unculturable microorganisms.

  20. Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

    PubMed

    Pegels, N; González, I; Fernández, S; García, T; Martín, R

    2012-01-01

    A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

  1. COMPARISON OF GENETIC METHODS TO OPTICAL METHODS IN THE IDENTIFICATION AND ASSESSMENT OF MOLD IN THE BUILT ENVIRONMENT -- COMPARISON OF TAQMAN AND MICROSCOPIC ANALYSIS OF CLADOSPORIUM SPORES RETRIEVED FROM ZEFON AIR-O-CELL TRACES

    EPA Science Inventory

    Recent advances in the sequencing of relevant water intrusion fungi by the EPA, combined with the development of probes and primers have allowed for the unequivocal quantitative and qualitative identification of fungi in selected matrices.

    In this pilot study, quantitative...

  2. Frequency-encoded laser-induced fluorescence for multiplexed detection in infrared-mediated quantitative PCR

    PubMed Central

    Schrell, Adrian M.; Roper, Michael G.

    2014-01-01

    A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431

  3. Development of Molecular Methods to Detect Macrophomina phaseolina from Strawberry Plants and Soil.

    PubMed

    Burkhardt, Alyssa; Ramon, Marina L; Smith, Brett; Koike, Steven T; Martin, Frank N

    2018-06-05

    Macrophomina phaseolina is a broad-host range fungus that shows some degree of host preference on strawberry, and causes symptoms including crown rot and root rot. Recently, this pathogen has impacted strawberry production as fumigation practices have changed, leaving many growers in California and around the world in need of accurate, rapid diagnostic tools for M. phaseolina in soil and infected plants. This study uses next-generation sequencing and comparative genomics to identify a locus that is unique to isolates within a main genotype shared by a majority of isolates that infect strawberry. This locus was used to develop a quantitative single-tube nested TaqMan qPCR assay which is able to quantify as little as 2-3 microsclerotia/g of soil with 100% genotype specificity. An isothermal assay using recombinase polymerase amplification (RPA) was developed from the same locus and has been validated on over 200 infected strawberry plants with a diagnostic sensitivity of 93% and a diagnostic specificity of 99%, respectively. Together, this work demonstrates the value of using new approaches to identify loci for detection and provides valuable diagnostic tools that can be used to monitor soil and strawberry plant samples for M. phaseolina.

  4. The development of a real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay using TaqMan technology for the pan detection of bluetongue virus (BTV).

    PubMed

    Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John

    2017-07-01

    Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  5. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

  6. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.

    PubMed

    Peng, Xiujuan; Nguyen, Alex; Ghosh, Debadyuti

    2018-02-01

    TaqMan and SYBR Green quantitative PCR (qPCR) methods were developed as DNA-based approaches to reproducibly enumerate M13 and T7 phages from phage display selection experiments individually and simultaneously. The genome copies of M13 and T7 phages were quantified by TaqMan or SYBR Green qPCR referenced against M13 and T7 DNA standard curves of known concentrations. TaqMan qPCR was capable of quantifying M13 and T7 phage DNA simultaneously with a detection range of 2.75*10 1 -2.75*10 8 genome copies(gc)/μL and 2.66*10 1 -2.66*10 8 genome copies(gc)/μL respectively. TaqMan qPCR demonstrated an efficient amplification efficiency (E s ) of 0.97 and 0.90 for M13 and T7 phage DNA, respectively. SYBR Green qPCR was ten-fold more sensitive than TaqMan qPCR, able to quantify 2.75-2.75*10 7 gc/μL and 2.66*10 1 -2.66*10 7 gc/μL of M13 and T7 phage DNA, with an amplification efficiency E s of 1.06 and 0.78, respectively. Due to its superior sensitivity, SYBR Green qPCR was used to enumerate M13 and T7 phage display clones selected against a cell line, and quantified titers demonstrated accuracy comparable to titers from traditional double-layer plaque assay. Compared to enzyme linked immunosorbent assay, both qPCR methods exhibited increased detection sensitivity and reproducibility. These qPCR methods are reproducible, sensitive, and time-saving to determine their titers and to quantify a large number of phage samples individually or simultaneously, thus avoiding the need for time-intensive double-layer plaque assay. These findings highlight the attractiveness of qPCR for phage enumeration for applications ranging from selection to next-generation sequencing (NGS). Copyright © 2017 Elsevier B.V. All rights reserved.

  7. QUANTITATIVE MEASUREMENT OF HELICOBACTER PYLORI BY THE TAQMAN FLUOROGENIC PROBE SYSTEM

    EPA Science Inventory

    Culturing of H. pylori from environmental sources continues to be an obstacle in detecting and enumerating this organism. Successful methods of isolation and growth from water samples have not yet been developed. In this study a method involving real tme PCR product detection wit...

  8. QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

    EPA Science Inventory

    The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

  9. Rapid quantitative detection of chytridiomycosis (Batrachochytrium dendrobatidis) in amphibian samples using real-time Taqman PCR assay.

    PubMed

    Boyle, D G; Boyle, D B; Olsen, V; Morgan, J A T; Hyatt, A D

    2004-08-09

    Batrachochytrium dendrobatidis is a major pathogen of frogs worldwide, associated with declines in amphibian populations. Diagnosis of chytridiomycosis to date has largely relied upon histological and immunohistochemical examination of toe clips. This technique is invasive and insensitive particularly at early stages of infection when treatment may be possible. We have developed a real-time PCR Taqman assay that can accurately detect and quantify one zoospore in a diagnostic sample. This assay will assist the early detection of B. dendrobatidis in both captive and wild populations, with a high degree of sensitivity and specificity, thus facilitating treatment and protection of endangered populations, monitoring of pristine environments and preventing further global spread via amphibian trade.

  10. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

    PubMed

    Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

    2015-09-01

    Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3  CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0  CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.

  11. Application of TaqMan fluorescent probe-based quantitative real-time PCR assay for the environmental survey of Legionella spp. and Legionella pneumophila in drinking water reservoirs in Taiwan.

    PubMed

    Kao, Po-Min; Hsu, Bing-Mu; Hsu, Tsui-Kang; Ji, Wen-Tsai; Huang, Po-Hsiang; Hsueh, Chih-Jen; Chiang, Chuen-Sheue; Huang, Shih-Wei; Huang, Yu-Li

    2014-08-15

    In this study, TaqMan fluorescent quantitative real-time PCR was performed to quantify Legionella species in reservoirs. Water samples were collected from 19 main reservoirs in Taiwan, and 12 (63.2%) were found to contain Legionella spp. The identified species included uncultured Legionella spp., L. pneumophila, L. jordanis, and L. drancourtii. The concentrations of Legionella spp. and L. pneumophila in the water samples were in the range of 1.8×10(2)-2.6×10(3) and 1.6×10(2)-2.4×10(2) cells/L, respectively. The presence and absence of Legionella spp. in the reservoir differed significantly in pH values. These results highlight the importance that L. pneumophila, L. jordanis, and L. drancourtii are potential pathogens in the reservoirs. The presence of L. pneumophila in reservoirs may be a potential public health concern that must be further examined. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Distinct actions of ancestral vinclozolin and juvenile stress on neural gene expression in the male rat.

    PubMed

    Gillette, Ross; Miller-Crews, Isaac; Skinner, Michael K; Crews, David

    2015-01-01

    Exposure to the endocrine disrupting chemical vinclozolin during gestation of an F0 generation and/or chronic restraint stress during adolescence of the F3 descendants affects behavior, physiology, and gene expression in the brain. Genes related to the networks of growth factors, signaling peptides, and receptors, steroid hormone receptors and enzymes, and epigenetic related factors were measured using quantitative polymerase chain reaction via Taqman low density arrays targeting 48 genes in the central amygdaloid nucleus, medial amygdaloid nucleus, medial preoptic area (mPOA), lateral hypothalamus (LH), and the ventromedial nucleus of the hypothalamus. We found that growth factors are particularly vulnerable to ancestral exposure in the central and medial amygdala; restraint stress during adolescence affected neural growth factors in the medial amygdala. Signaling peptides were affected by both ancestral exposure and stress during adolescence primarily in hypothalamic nuclei. Steroid hormone receptors and enzymes were strongly affected by restraint stress in the mPOA. Epigenetic related genes were affected by stress in the ventromedial nucleus and by both ancestral exposure and stress during adolescence independently in the central amygdala. It is noteworthy that the LH showed no effects of either manipulation. Gene expression is discussed in the context of behavioral and physiological measures previously published.

  13. Valacyclovir Pharmacokinetics and Exploratory Pharmacodynamics in Young Adults With Epstein-Barr Virus Infectious Mononucleosis

    PubMed Central

    Vezina, Heather E.; Balfour, Henry H.; Weller, Dennis R.; Anderson, Bruce J.; Brundage, Richard C.

    2017-01-01

    Primary Epstein-Barr virus (EBV) infection often results in infectious mononucleosis and is associated with serious sequelae. No treatment is approved for EBV infection, and an antiviral intervention would be significant. The objectives of this study are to characterize the pharmacokinetics and explore the pharmacodynamics of acyclovir in plasma and oral washings of 8 subjects receiving 7 days of valacyclovir 1500 mg twice daily for EBV infectious mononucleosis. Virologic and clinical responses are assessed over 12 days. Acyclovir is measured by liquid chromatography/ultraviolet detection. EBV DNA is quantitated by TaqMan polymerase chain reaction. NONMEM VI and linear regression are used for data analysis. Acyclovir profiles in plasma and oral washings are consistent with a 1-compartment model. Final model estimates of clearance, volume of distribution, and fraction of acyclovir in oral wash supernatant are 49.9 L/h, 74.1 L, and 1.14%, respectively. The quantity of EBV DNA in oral washings and blood, and the severity of illness, measured by a graded scale, decrease during treatment. After treatment, viral rebound occurs in oral washings but not in blood, and the severity of illness continues to decline. Acyclovir pharmacokinetic parameters do not correlate with response metrics. These results support further studies of valacyclovir for EBV infectious mononucleosis. PMID:19897764

  14. Development and application of a rapid, user-friendly, and inexpensive method to detect Dehalococcoides sp. reductive dehalogenase genes from groundwater.

    PubMed

    Kanitkar, Yogendra H; Stedtfeld, Robert D; Hatzinger, Paul B; Hashsham, Syed A; Cupples, Alison M

    2017-06-01

    TaqMan probe-based quantitative polymerase chain reaction (qPCR) specific to the biomarker reductive dehalogenase (RDase) genes is a widely accepted molecular biological tool (MBT) for determining the abundance of Dehalococcoides sp. in groundwater samples from chlorinated solvent-contaminated sites. However, there are significant costs associated with this MBT. In this study, we describe an approach that requires only low-cost laboratory equipment (a bench top centrifuge and a water bath) and requires less time and resources compared to qPCR. The method involves the concentration of biomass from groundwater, without DNA extraction, and loop-mediated isothermal amplification (LAMP) of the cell templates. The amplification products are detected by a simple visual color change (orange/green). The detection limits of the assay were determined using groundwater from a contaminated site. In addition, the assay was tested with groundwater from three additional contaminated sites. The final approach to detect RDase genes, without DNA extraction or a thermal cycler, was successful to 1.8 × 10 5  gene copies per L for vcrA and 1.3 × 10 5  gene copies per L for tceA. Both values are below the threshold recommended for effective in situ dechlorination.

  15. Role of serum miRNAs in the prediction of ovarian hyperstimulation syndrome in polycystic ovarian syndrome patients.

    PubMed

    Zhao, Chun; Liu, Xiaoguang; Shi, Zhonghua; Zhang, Jing; Zhang, Junqiang; Jia, Xuemei; Ling, Xiufeng

    2015-01-01

    Polycystic ovarian syndrome (PCOS) causes a significantly increased risk of ovarian hyperstimulation syndrome (OHSS). Here, we focused on the altered expression of serum miRNAs and their predictive value for OHSS in PCOS patients. We used the TaqMan low density array followed by individual quantitative reverse transcription-polymerase chain reaction to identify and validate the expression of serum miRNAs in PCOS patients likely to develop severe OHSS. The miR-16 and miR-223 expression levels were significantly reduced in the patients who were likely to develop severe OHSS than in the control subjects who were likely to develop mild or no OHSS. The sensitivity and specificity of the basal LH, basal LH/FSH, and body mass index (BMI) as OHSS predictors were also evaluated. miR-16 was the most efficient for OHSS prediction as it yielded the highest AUC. Logistic binary regression analyses revealed a positive association of miR-223 and BMI. Serum miRNAs are differentially expressed in PCOS patients likely to suffer from severe OHSS. We identified and validated two serum miRNAs that have potential for use as novel noninvasive biomarkers to accurately predict OHSS before controlled ovarian hyperstimulation (COH) for PCOS patients. © 2015 S. Karger AG, Basel.

  16. Synthesis of O-serogroup specific positive controls and real-time PCR standards for nine clinically relevant non-O157 STECs.

    PubMed

    Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim

    2012-10-01

    Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Ciculating miRNA-21 as a Biomarker Predicts Polycystic Ovary Syndrome (PCOS) in Patients.

    PubMed

    Jiang, Liyan; Li, Wei; Wu, Minmin; Cao, Sifan

    2015-01-01

    Polycystic ovary syndrome (PCOS) is characterized by hyperandrogenism, hyperinsulinemia, and infertility. In PCOS, abnormal regulation of relevant genes is required for follicular development. By binding to the 3' untranslated region (3'URT), microRNAs (miRNAs) are widely involved in posttranscriptional gene regulation. However, few studies have been conducted on circulating miRNA expression in PCOS. This study aims to describe altered expression of circulating miR-21 in PCOS. The expression of serum miRNAs of PCOS patients were explored using the TaqMan Low Density Array followed by individual quantitative reverse transcription polymerase chain reaction assays. The protein level of LATS1 was determined using Western blot. To validate whether miR-21 targeted LATS1, the luciferase assay was applied. In comparison with normal subjects, the circulating level of miRNA-21 was significantly enhanced in PCOS patients. In PCOS patients, the expression levels of MST1/2, LATS1/2, TAZ were much lower than the control subjects. Luciferase reporter assay revealed that LATS1 was a downstream target of miR-21. In comparison with normal subjects, serum miR-21 is obviously increased in PCOS patients. Through targeting LATS1, miR-21 could prompt PCOS progression and could act as a novel non-invasive biomarker for diagnosis of PCOS.

  18. Valacyclovir pharmacokinetics and exploratory pharmacodynamics in young adults with Epstein-Barr virus infectious mononucleosis.

    PubMed

    Vezina, Heather E; Balfour, Henry H; Weller, Dennis R; Anderson, Bruce J; Brundage, Richard C

    2010-07-01

    Primary Epstein-Barr virus (EBV) infection often results in infectious mononucleosis and is associated with serious sequelae. No treatment is approved for EBV infection, and an antiviral intervention would be significant. The objectives of this study are to characterize the pharmacokinetics and explore the pharmacodynamics of acyclovir in plasma and oral washings of 8 subjects receiving 7 days of valacyclovir 1500 mg twice daily for EBV infectious mononucleosis. Virologic and clinical responses are assessed over 12 days. Acyclovir is measured by liquid chromatography/ultraviolet detection. EBV DNA is quantitated by TaqMan polymerase chain reaction. NONMEM VI and linear regression are used for data analysis. Acyclovir profiles in plasma and oral washings are consistent with a 1-compartment model. Final model estimates of clearance, volume of distribution, and fraction of acyclovir in oral wash supernatant are 49.9 L/h, 74.1 L, and 1.14%, respectively. The quantity of EBV DNA in oral washings and blood, and the severity of illness, measured by a graded scale, decrease during treatment. After treatment, viral rebound occurs in oral washings but not in blood, and the severity of illness continues to decline. Acyclovir pharmacokinetic parameters do not correlate with response metrics. These results support further studies of valacyclovir for EBV infectious mononucleosis.

  19. Development of a Real-Time, TaqMan Reverse Transcription-PCR Assay for Detection and Differentiation of Lyssavirus Genotypes 1, 5, and 6

    PubMed Central

    Wakeley, P. R.; Johnson, N.; McElhinney, L. M.; Marston, D.; Sawyer, J.; Fooks, A. R.

    2005-01-01

    Several reverse transcription-PCR (RT-PCR) methods have been reported for the detection of rabies and rabies-related viruses. These methods invariably involve multiple transfers of nucleic acids between different tubes, with the risk of contamination leading to the production of false-positive results. Here we describe a single, closed-tube, nonnested RT-PCR with TaqMan technology that distinguishes between classical rabies virus (genotype 1) and European bat lyssaviruses 1 and 2 (genotypes 5 and 6) in real time. The TaqMan assay is rapid, sensitive, and specific and allows for the genotyping of unknown isolates concomitant with the RT-PCR. The assay can be applied quantitatively and the use of an internal control enables the quality of the isolated template to be assessed. Despite sequence heterogeneity in the N gene between the different genotypes, a universal forward and reverse primer set has been designed, allowing for the simplification of previously described assays. We propose that within a geographically constrained area, this assay will be a useful tool for the detection and differentiation of members of the Lyssavirus genus. PMID:15956398

  20. Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

    PubMed

    Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

    2016-12-20

    Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

  1. Allele and genotype frequencies of polymorphisms in cytokine genes in ethnic Russian individuals from Moscow, Russia.

    PubMed

    Shadrina, Alexandra; Voronina, Elena; Zolotukhin, Igor; Filipenko, Maxim

    2017-02-01

    Two hundred and twenty eight ethnic Russian individuals from Moscow, Russia, were genotyped at 14 single nucleotide polymorphisms CCL2 A-2578G; VEGFA C-2578A, G-634C, and C+936T; TNF G+419A and G-308A; IL1A G-889A; IL1RN T+1018C; IL6G-174C and G-572C; IFNG T+874A; IL1B C-511T; IL10 A+1082G; TGFB1 C-509T. Genotypes were determined using real-time polymerase chain reaction with TaqMan probes and polymerase chain reaction followed by melting analysis of dual-labeled probe. Genotype distribution was in accordance with Hardy-Weinberg equilibrium for all studied polymorphisms. Genotype data are available in the Allele Frequencies Net Database under identifier AFND 3367 and the population name "Russia Moscow Cytokine". Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  2. Coupling Spore Traps and Quantitative PCR Assays for Detection of the Downy Mildew Pathogens of Spinach (Peronospora effusa) and Beet (P. schachtii)

    PubMed Central

    Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.

    2016-01-01

    Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150

  3. Optimization of routine KRAS mutation PCR-based testing procedure for rational individualized first-line-targeted therapy selection in metastatic colorectal cancer.

    PubMed

    Chretien, Anne-Sophie; Harlé, Alexandre; Meyer-Lefebvre, Magali; Rouyer, Marie; Husson, Marie; Ramacci, Carole; Harter, Valentin; Genin, Pascal; Leroux, Agnès; Merlin, Jean-Louis

    2013-02-01

    KRAS mutation detection represents a crucial issue in metastatic colorectal cancer (mCRC). The optimization of KRAS mutation detection delay enabling rational prescription of first-line treatment in mCRC including anti-EGFR-targeted therapy requires robust and rapid molecular biology techniques. Routine analysis of mutations in codons 12 and 13 on 674 paraffin-embedded tissue specimens of mCRC has been performed for KRAS mutations detection using three molecular biology techniques, that is, high-resolution melting (HRM), polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP), and allelic discrimination PCR (TaqMan PCR). Discordant cases were assessed with COBAS 4800 KRAS CE-IVD assay. Among the 674 tumor specimens, 1.5% (10/674) had excessive DNA degradation and could not be analyzed. KRAS mutations were detected in 38.0% (256/674) of the analysable specimens (82.4% in codon 12 and 17.6% in codon 13). Among 613 specimens in whom all three techniques were used, 12 (2.0%) cases of discordance between the three techniques were observed. 83.3% (10/12) of the discordances were due to PCR-RFLP as confirmed by COBAS 4800 retrospective analysis. The three techniques were statistically comparable (κ > 0.9; P < 0.001). From these results, optimization of the routine procedure consisted of proceeding to systematic KRAS detection using HRM and TaqMan and PCR-RFLP in case of discordance and allowed significant decrease in delays. The results showed an excellent correlation between the three techniques. Using HRM and TaqMan warrants high-quality and rapid-routine KRAS mutation detection in paraffin-embedded tumor specimens. The new procedure allowed a significant decrease in delays for reporting results, enabling rational prescription of first-line-targeted therapy in mCRC.

  4. New design, development, and optimization of an in-house quantitative TaqMan Real-time PCR assay for HIV-1 viral load measurement.

    PubMed

    Noorbazargan, Hassan; Nadji, Seyed Alireza; Samiee, Siamak Mirab; Paryan, Mahdi; Mohammadi-Yeganeh, Samira

    2018-04-01

    Background Viral load measurement is commonly applicable to monitor HIV infection in patients to determine the number of HIV-RNA in serum samples of individuals. The aim of the present study was to set up a highly specific, sensitive, and reproducible home-brewed Real-time PCR assay based on TaqMan chemistry to quantify HIV-1 RNA genome. Methods In this study, three sets of primer pairs and a TaqMan probe were designed for HIV subtypes conserved sequences. An internal control was included in this assay to evaluate the presence of inhibition. Standard curve and threshold cycle values were determined using in vitro transcribed RNA from int region of HIV-1. A serial dilution of RNA standards was generated by in vitro transcription, from 10 to 10 9 copies/ml to find the sensitivity and the limit of detection (LOD) of the assay and to evaluate its performance in a quantitative RT-PCR assay. Results The assay has a low LOD equivalent to 33.13 copies/ml of HIV-1 RNA and a linear range of detection from 10 to 10 9 copies/ml. The coefficient of variation (CV) for Inter and Intra-assay precision of this in-house HIV Real-time RT-PCR ranged from 0.28 to 2.49% and 0.72 to 4.47%, respectively. The analytical and clinical specificity was 100%. Conclusions The results indicate that the developed method has a suitable specificity and sensitivity and is highly reproducible and cost-benefit. Therefore, it will be useful to monitor HIV infection in plasma samples of individuals.

  5. Real-time quantitative PCR detection of genetically modified Maximizer maize and Roundup Ready soybean in some representative foods.

    PubMed

    Vaïtilingom, M; Pijnenburg, H; Gendre, F; Brignon, P

    1999-12-01

    A fast and quantitative method was developed to detect transgenic "Maximizer" maize "event 176" (Novartis) and "Roundup Ready" soybean (Monsanto) in food by real-time quantitative PCR. The use of the ABI Prism 7700 sequence detection system allowed the determination of the amplified product accumulation through a fluorogenic probe (TaqMan). Fluorescent dyes were chosen in such a way as to coamplify total and transgenic DNA in the same tube. Using real-time quantitative PCR, 2 pg of transgenic or total DNA per gram of starting sample was detected in 3 h after DNA extraction and the relative amounts of "Maximizer" maize and "Roundup Ready" soybean in some representative food products were quantified.

  6. Multiplexed target detection using DNA-binding dye chemistry in droplet digital PCR.

    PubMed

    McDermott, Geoffrey P; Do, Duc; Litterst, Claudia M; Maar, Dianna; Hindson, Christopher M; Steenblock, Erin R; Legler, Tina C; Jouvenot, Yann; Marrs, Samuel H; Bemis, Adam; Shah, Pallavi; Wong, Josephine; Wang, Shenglong; Sally, David; Javier, Leanne; Dinio, Theresa; Han, Chunxiao; Brackbill, Timothy P; Hodges, Shawn P; Ling, Yunfeng; Klitgord, Niels; Carman, George J; Berman, Jennifer R; Koehler, Ryan T; Hiddessen, Amy L; Walse, Pramod; Bousse, Luc; Tzonev, Svilen; Hefner, Eli; Hindson, Benjamin J; Cauly, Thomas H; Hamby, Keith; Patel, Viresh P; Regan, John F; Wyatt, Paul W; Karlin-Neumann, George A; Stumbo, David P; Lowe, Adam J

    2013-12-03

    Two years ago, we described the first droplet digital PCR (ddPCR) system aimed at empowering all researchers with a tool that removes the substantial uncertainties associated with using the analogue standard, quantitative real-time PCR (qPCR). This system enabled TaqMan hydrolysis probe-based assays for the absolute quantification of nucleic acids. Due to significant advancements in droplet chemistry and buoyed by the multiple benefits associated with dye-based target detection, we have created a "second generation" ddPCR system compatible with both TaqMan-probe and DNA-binding dye detection chemistries. Herein, we describe the operating characteristics of DNA-binding dye based ddPCR and offer a side-by-side comparison to TaqMan probe detection. By partitioning each sample prior to thermal cycling, we demonstrate that it is now possible to use a DNA-binding dye for the quantification of multiple target species from a single reaction. The increased resolution associated with partitioning also made it possible to visualize and account for signals arising from nonspecific amplification products. We expect that the ability to combine the precision of ddPCR with both DNA-binding dye and TaqMan probe detection chemistries will further enable the research community to answer complex and diverse genetic questions.

  7. TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

    PubMed

    Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

    2015-04-15

    Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

  8. Differences in AMY1 Gene Copy Numbers Derived from Blood, Buccal Cells and Saliva Using Quantitative and Droplet Digital PCR Methods: Flagging the Pitfall.

    PubMed

    Ooi, Delicia Shu Qin; Tan, Verena Ming Hui; Ong, Siong Gim; Chan, Yiong Huak; Heng, Chew Kiat; Lee, Yung Seng

    2017-01-01

    The human salivary (AMY1) gene, encoding salivary α-amylase, has variable copy number variants (CNVs) in the human genome. We aimed to determine if real-time quantitative polymerase chain reaction (qPCR) and the more recently available Droplet Digital PCR (ddPCR) can provide a precise quantification of the AMY1 gene copy number in blood, buccal cells and saliva samples derived from the same individual. Seven participants were recruited and DNA was extracted from the blood, buccal cells and saliva samples provided by each participant. Taqman assay real-time qPCR and ddPCR were conducted to quantify AMY1 gene copy numbers. Statistical analysis was carried out to determine the difference in AMY1 gene copy number between the different biological specimens and different assay methods. We found significant within-individual difference (p<0.01) in AMY1 gene copy number between different biological samples as determined by qPCR. However, there was no significant within-individual difference in AMY1 gene copy number between different biological samples as determined by ddPCR. We also found that AMY1 gene copy number of blood samples were comparable between qPCR and ddPCR, while there is a significant difference (p<0.01) between AMY1 gene copy numbers measured by qPCR and ddPCR for both buccal swab and saliva samples. Despite buccal cells and saliva samples being possible sources of DNA, it is pertinent that ddPCR or a single biological sample, preferably blood sample, be used for determining highly polymorphic gene copy numbers like AMY1, due to the large within-individual variability between different biological samples if real time qPCR is employed.

  9. The peripheral messenger RNA expression of glycogen synthase kinase-3β genes in Alzheimer's disease patients: a preliminary study.

    PubMed

    Sheng, Jian-Hua; Ng, Tze-Pin; Li, Chun-Bo; Lu, Guang-Hua; He, Wei; Qian, Yi-Ping; Wang, Jing-Hua; Yu, Shun-Ying

    2012-12-01

    To explore the peripheral leucocytic messenger RNA (mRNA) expression of glycogen synthase kinase-3β (GSK-3β) gene in Alzheimer's disease (AD) patients. Using TaqMan relative quantitative real-time polymerase chain reaction, we analyzed leucocytic gene expression of GSK-3β in 48 AD patients and 49 healthy controls. Clinical data of AD patients were also collected. The mRNA expression level of the GSK-3β gene was significantly higher in the AD group (3.13±0.62) than in the normal group (2.77±0.77). Correlational analyses showed that the mRNA expression level of GSK-3β gene in AD patients was associated with the age of onset (P=0.047), age (P=0.055), and Behavioral Pathology in Alzheimer's Disease Rating Scale total score (P=0.062) and subscores: aggressiveness score (P=0.073) and anxieties and phobias score (P=0.067). Through multivariate regression model, older age, higher anxieties and phobias score and aggressiveness score were associated with higher mRNA expression level of GSK-3β gene. In AD patients, the mRNA expression level of the GSK-3β gene is increased and may be related to age and behavioural pathology in AD. © 2012 The Authors. Psychogeriatrics © 2012 Japanese Psychogeriatric Society.

  10. Development of FQ-PCR method to determine the level of ADD1 expression in fatty and lean pigs.

    PubMed

    Cui, J X; Chen, W; Zeng, Y Q

    2015-10-30

    To determine how adipocyte determination and differentiation factor 1 (ADD1), a gene involved in the determination of pork quality, is regulated in Laiwu and Large pigs, we used TaqMan fluorescence quantitative real-time polymerase chain reaction (FQ-PCR) to detect differential expression in the longissimus muscle of Laiwu (fatty) and Large White (lean) pigs. In this study, the ADD1 and GAPDH cDNA sequences were cloned using a T-A cloning assay, and the clone sequences were consistent with those deposited in GenBank. Thus, the target fragment was successfully recombined into the vector, and its integrity was maintained. The standard curve and regression equation were established through the optimized FQ-PCR protocol. The standard curve of porcine ADD1 and GAPDH cDNA was determined, and its linear range extension could reach seven orders of magnitudes. The results showed that this method was used to quantify ADD1 expression in the longissimus muscle of two breeds of pig, and was found to be accurate, sensitive, and convenient. These results provide information regarding porcine ADD1 mRNA expression and the mechanism of adipocyte differentiation, and this study could help in the effort to meet the demands of consumers interested in the maintenance of health and prevention of obesity. Furthermore, it could lead to new approaches in the prevention and clinical treatment of this disease.

  11. Clinical evaluation of the COBAS Ampliprep/COBAS TaqMan for HCV RNA quantitation in comparison with the branched-DNA assay.

    PubMed

    Pittaluga, Fabrizia; Allice, Tiziano; Abate, Maria Lorena; Ciancio, Alessia; Cerutti, Francesco; Varetto, Silvia; Colucci, Giuseppe; Smedile, Antonina; Ghisetti, Valeria

    2008-02-01

    Diagnosis and monitoring of HCV infection relies on sensitive and accurate HCV RNA detection and quantitation. The performance of the COBAS AmpliPrep/COBAS TaqMan 48 (CAP/CTM) (Roche, Branchburg, NJ), a fully automated, real-time PCR HCV RNA quantitative test was assessed and compared with the branched-DNA (bDNA) assay. Clinical evaluation on 576 specimens obtained from patients with chronic hepatitis C showed a good correlation (r = 0.893) between the two test, but the CAP/CTM scored higher HCV RNA titers than the bDNA across all viral genotypes. The mean bDNA versus CAP/CTM log10 IU/ml differences were -0.49, -0.4, -0.54, -0.26 for genotype 1a, 1b, 2a/2c, 3a, and 4, respectively. These differences reached statistical significance for genotypes 1b, 2a/c, and 3a. The ability of the CAP/CTM to monitor patients undergoing antiviral therapy and correctly identify the weeks 4 and 12 rapid and early virological responses was confirmed. The broader dynamic range of the CAP/CTM compared with the bDNA allowed for a better definition of viral kinetics. In conclusion, the CAP/CTM appears as a reliable and user-friendly assay to monitor HCV viremia during treatment of patients with chronic hepatitis. Its high sensitivity and wide dynamic range may help a better definition of viral load changes during antiviral therapy. (Copyright) 2007 Wiley-Liss, Inc.

  12. Evaluation of the Abbott RealTime HCV assay for quantitative detection of hepatitis C virus RNA.

    PubMed

    Michelin, Birgit D A; Muller, Zsofia; Stelzl, Evelyn; Marth, Egon; Kessler, Harald H

    2007-02-01

    The Abbott RealTime HCV assay for quantitative detection of HCV RNA has recently been introduced. In this study, the performance of the Abbott RealTime HCV assay was evaluated and compared to the COBAS AmpliPrep/COBAS TaqMan HCV test. Accuracy, linearity, interassay and intra-assay variations were determined, and a total of 243 routine clinical samples were investigated. When accuracy of the new assay was tested, the majority of results were found to be within +/-0.5 log(10) unit of the results obtained by reference laboratories. Determination of linearity resulted in a quasilinear curve up to 1.0 x 10(6)IU/ml. The interassay variation ranged from 15% to 32%, and the intra-assay variation ranged from 5% to 8%. When clinical samples were tested by the Abbott RealTime HCV assay and the results were compared with those obtained by the COBAS AmpliPrep/COBAS TaqMan HCV test, the results for 93% of all samples with positive results by both tests were found to be within +/-1.0 log(10) unit. The viral loads for all patients measured by the Abbott and Roche assays showed a high correlation (R(2)=0.93); quantitative results obtained by the Abbott assay were found to be lower than those obtained by the Roche assay. The Abbott RealTime HCV assay proved to be suitable for use in the routine diagnostic laboratory. The time to results was similar for both of the assays.

  13. Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study

    USGS Publications Warehouse

    Layton, Blythe A.; Cao, Yiping; Ebentier, Darcy L.; Hanley, Kaitlyn; Ballesté, Elisenda; Brandão, João; Byappanahalli, Muruleedhara N.; Converse, Reagan; Farnleitner, Andreas H.; Gentry-Shields, Jennifer; Gourmelon, Michèle; Lee, Chang Soo; Lee, Jiyoung; Lozach, Solen; Madi, Tania; Meijer, Wim G.; Noble, Rachel; Peed, Lindsay; Reischer, Georg H.; Rodrigues, Raquel; Rose, Joan B.; Schriewer, Alexander; Sinigalliano, Chris; Srinivasan, Sangeetha; Stewart, Jill; ,; Laurie, C.; Wang, Dan; Whitman, Richard; Wuertz, Stefan; Jay, Jenny; Holden, Patricia A.; Boehm, Alexandria B.; Shanks, Orin; Griffith, John F.

    2013-01-01

    A number of PCR-based methods for detecting human fecal material in environmental waters have been developed over the past decade, but these methods have rarely received independent comparative testing in large multi-laboratory studies. Here, we evaluated ten of these methods (BacH, BacHum-UCD, Bacteroides thetaiotaomicron (BtH), BsteriF1, gyrB, HF183 endpoint, HF183 SYBR, HF183 Taqman®, HumM2, and Methanobrevibacter smithii nifH (Mnif)) using 64 blind samples prepared in one laboratory. The blind samples contained either one or two fecal sources from human, wastewater or non-human sources. The assay results were assessed for presence/absence of the human markers and also quantitatively while varying the following: 1) classification of samples that were detected but not quantifiable (DNQ) as positive or negative; 2) reference fecal sample concentration unit of measure (such as culturable indicator bacteria, wet mass, total DNA, etc); and 3) human fecal source type (stool, sewage or septage). Assay performance using presence/absence metrics was found to depend on the classification of DNQ samples. The assays that performed best quantitatively varied based on the fecal concentration unit of measure and laboratory protocol. All methods were consistently more sensitive to human stools compared to sewage or septage in both the presence/absence and quantitative analysis. Overall, HF183 Taqman® was found to be the most effective marker of human fecal contamination in this California-based study.

  14. Performance of three commercial viral load assays, Versant human immunodeficiency virus type 1 (HIV-1) RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2, testing HIV-1 non-B subtypes and recombinant variants.

    PubMed

    Holguín, Africa; López, Marisa; Molinero, Mar; Soriano, Vincent

    2008-09-01

    Monitoring antiretroviral therapy requires that human immunodeficiency virus type 1 (HIV-1) viremia assays are applicable to all distinct variants. This study evaluates the performance of three commercial viral load assays-Versant HIV-1 RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2-in testing 83 plasma specimens from patients carrying HIV-1 non-B subtypes and recombinants previously defined by phylogenetic analysis of the pol gene. All 28 specimens from patients under treatment presented viremia values below the detection limit with the three methods. In the remaining 55 specimens from naive individuals viremia could not be detected in 32.7, 20, and 14.6% using the NucliSens, Versant, or TaqMan tests, respectively, suggesting potential viral load underestimation of some samples by all techniques. Only 32 (58.2%) samples from naive subjects were quantified by the three methods; the NucliSens test provided the highest HIV RNA values (mean, 4.87 log copies/ml), and the Versant test provided the lowest (mean, 4.16 log copies/ml). Viremia differences of greater than 1 log were seen in 8 (14.5%) of 55 specimens, occurring in 10.9, 7.3, and 5.4%, respectively, of the specimens in comparisons of Versant versus NucliSens, Versant versus TaqMan, and TaqMan versus NucliSens. Differences greater than 0.5 log, considered significant for clinicians, occurred in 45.5, 27.3, and 29% when the same assays were compared. Some HIV-1 strains, such as subtype G and CRF02_AG, showed more discrepancies in distinct quantification methods than others. In summary, an adequate design of primers and probes is needed for optimal quantitation of plasma HIV-RNA in non-B subtypes. Our data emphasize the need to use the same method for monitoring patients on therapy and also the convenience of HIV-1 subtyping.

  15. Development of SYBR Green and TaqMan quantitative real-time PCR assays for hepatopancreatic parvovirus (HPV) infecting Penaeus monodon in India.

    PubMed

    Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V

    2015-12-01

    Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a comparison of two new high-throughput assays with existing methods

    PubMed Central

    Bass, Chris; Nikou, Dimitra; Donnelly, Martin J; Williamson, Martin S; Ranson, Hilary; Ball, Amanda; Vontas, John; Field, Linda M

    2007-01-01

    Background Knockdown resistance (kdr) is a well-characterized mechanism of resistance to pyrethroid insecticides in many insect species and is caused by point mutations of the pyrethroid target site the para-type sodium channel. The presence of kdr mutations in Anopheles gambiae, the most important malaria vector in Africa, has been monitored using a variety of molecular techniques. However, there are few reports comparing the performance of these different assays. In this study, two new high-throughput assays were developed and compared with four established techniques. Methods Fluorescence-based assays based on 1) TaqMan probes and 2) high resolution melt (HRM) analysis were developed to detect kdr alleles in An. gambiae. Four previously reported techniques for kdr detection, Allele Specific Polymerase Chain Reaction (AS-PCR), Heated Oligonucleotide Ligation Assay (HOLA), Sequence Specific Oligonucleotide Probe – Enzyme-Linked ImmunoSorbent Assay (SSOP-ELISA) and PCR-Dot Blot were also optimized. The sensitivity and specificity of all six assays was then compared in a blind genotyping trial of 96 single insect samples that included a variety of kdr genotypes and African Anopheline species. The relative merits of each assay was assessed based on the performance in the genotyping trial, the length/difficulty of each protocol, cost (both capital outlay and consumable cost), and safety (requirement for hazardous chemicals). Results The real-time TaqMan assay was both the most sensitive (with the lowest number of failed reactions) and the most specific (with the lowest number of incorrect scores). Adapting the TaqMan assay to use a PCR machine and endpoint measurement with a fluorimeter showed a slight reduction in sensitivity and specificity. HRM initially gave promising results but was more sensitive to both DNA quality and quantity and consequently showed a higher rate of failure and incorrect scores. The sensitivity and specificity of AS-PCR, SSOP-ELISA, PCR Dot Blot and HOLA was fairly similar with a small number of failures and incorrect scores. Conclusion The results of blind genotyping trials of each assay indicate that where maximum sensitivity and specificity are required the TaqMan real-time assay is the preferred method. However, the cost of this assay, particularly in terms of initial capital outlay, is higher than that of some of the other methods. TaqMan assays using a PCR machine and fluorimeter are nearly as sensitive as real-time assays and provide a cost saving in capital expenditure. If price is a primary factor in assay choice then the AS-PCR, SSOP-ELISA, and HOLA are all reasonable alternatives with the SSOP-ELISA approach having the highest throughput. PMID:17697325

  17. Development of TaqMan assays for the quantitative detection of Fusarium avenaceum/Fusarium tricinctum and Fusarium poae esyn1 genotypes from cereal grain.

    PubMed

    Kulik, Tomasz; Jestoi, Marika; Okorski, Adam

    2011-01-01

    Fungi of the genus Fusarium are important plant pathogens and contaminants of cereal grains producing different types of mycotoxins. Enniatins are a group of mycotoxins with ionophoric properties frequently detected in North European grains. Within the Fusarium complex responsible for grain infection, Fusarium avenaceum, Fusarium poae and Fusarium tricinctum are the most potential enniatins producers. This study presents the development of two quantitative TaqMan MGB (Minor Groove Binder) assays for the specific quantification of F. avenaceum/F. tricinctum and F. poae esyn1 genotypes, respectively. Two sets of genotype-specific primers/probes were designed on the basis of esyn1 gene homologues encoding multifunctional enzyme enniatin synthetase. The specificity of the assays developed has been tested successfully on 111 Fusarium isolates from different geographical origins. The detection limits for F. avenaceum/F. tricinctum esyn1 genotype and F. poae genotype were 19 and 0.3 pg, respectively. The application of the assays developed on asymptomatic wheat grain samples revealed significant positive correlations between the enniatins levels and the amount of F. avenaceum/F. tricinctum esyn1 genotype (R=0.61) and F. poae esyn1 genotype (R=0.42). © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  18. Isothermal Method of a Recombinase Polymerase Amplification Assay for the Detection of Most Common High-Risk Human Papillomavirus Type 16 and Type 18 DNA.

    PubMed

    Ma, Biao; Fang, Jiehong; Wang, Ye; He, Haizhen; Dai, Mingyan; Lin, Wei; Su, Wei; Zhang, Mingzhou

    2017-01-01

    Cervical cancer is a common gynecologic malignant tumor and has a great impact on women's health. Human papillomavirus (HPV) is implicated in cervical cancer and precancerous lesions and the two are possibly two stages of disease progression. With the technological development of molecular biology and epidemiology, detection and treatment of HPV has become an important means to prevent cervical cancer. Here we present a novel, rapid, sensitive and specific isothermal method of recombinase polymerase amplification (RPA), which is established to detect the two most common high-risk human papillomavirus type 16 and type 18 DNA. In this study, we evaluate the efficacy of the RPA assay, incubating clinical specimens of HPV16 and HPV18 using plasmids standard. It operates at constant low temperature without the thermal instrumentation for incubation. The products can be detected via agarose gel electrophoresis assay, reverse dot blot assay, and quantitative real-time assay with SYBR Green I. We assess the diagnostic performance of the RPA assay for detecting of HPV16 and HPV18 in 335 clinical samples from patients suspected of cervical cancer. The results revealed no cross-reaction with other HPV genotypes and the RPA assay achieve a sensitivity of 100 copies. Compared with TaqMan qPCR, the RPA technique achieves exponential amplification with no need for pretreatment of sample DNA at 37°C for 20 minutes, which reveals more satisfactory performance. The agreement between the RPA and qPCR assays was 97.6% (κ = 0.89) for HPV16 positivity and 98.5% (κ = 0.81) for HPV18 positivity, indicating very good correlation between both tests. Importantly, the RPA assay was demonstrated to be a useful and powerful method for detection of HPV virus, which therefore may serve as a valuable tool for rapid diagnosis of HPV infection in both commercial and clinical applications.

  19. Performance of the New Aptima HCV Quant Dx Assay in Comparison to the Cobas TaqMan HCV2 Test for Use with the High Pure System in Detection and Quantification of Hepatitis C Virus RNA in Plasma or Serum.

    PubMed

    Schalasta, Gunnar; Speicher, Andrea; Börner, Anna; Enders, Martin

    2016-04-01

    Quantitating the level of hepatitis C virus (HCV) RNA is the standard of care for monitoring HCV-infected patients during treatment. The performances of commercially available assays differ for precision, limit of detection, and limit of quantitation (LOQ). Here, we compare the performance of the Hologic Aptima HCV Quant Dx assay (Aptima) to that of the Roche Cobas TaqMan HCV test, version 2.0, using the High Pure system (HPS/CTM), considered a reference assay since it has been used in trials defining clinical decision points in patient care. The assays' performance characteristics were assessed using HCV RNA reference panels and plasma/serum from chronically HCV-infected patients. The agreement between the assays for the 3 reference panels was good, with a difference in quantitation values of <0.5 log. High concordance was demonstrated between the assays for 245 clinical samples (kappa = 0.80; 95% confidence interval [CI], 0.720 to 0.881); however, Aptima detected and/or quantitated 20 samples that HPS/CTM did not detect, while Aptima did not detect 1 sample that was quantitated by HPS/CTM. For the 165 samples quantitated by both assays, the values were highly correlated (R= 0.98;P< 0.0001). The linearity of quantitation from concentrations of 1.4 to 6 log was excellent for both assays for all HCV genotypes (GT) tested (GT 1a, 1b, 2b, and 3a) (R(2)> 0.99). The assays had similar levels of total and intra-assay variability across all genotypes at concentrations from 1,000 to 25 IU/ml. Aptima had a greater analytical sensitivity, quantitating more than 50% of replicates at 25-IU/ml target. Aptima showed performance characteristics comparable to those of HPS/CTM and increased sensitivity, making it suitable for use as a clinical diagnostic tool on the fully automated Panther platform. Copyright © 2016 Schalasta et al.

  20. Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

    PubMed

    Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

    2014-12-01

    Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

  1. MicroRNA markers for forensic body fluid identification obtained from microarray screening and quantitative RT-PCR confirmation

    PubMed Central

    Zubakov, Dmitry; Boersma, Anton W. M.; Choi, Ying; van Kuijk, Patricia F.; Wiemer, Erik A. C.

    2010-01-01

    MicroRNAs (miRNAs) are non-protein coding molecules with important regulatory functions; many have tissue-specific expression patterns. Their very small size in principle makes them less prone to degradation processes, unlike messenger RNAs (mRNAs), which were previously proposed as molecular tools for forensic body fluid identification. To identify suitable miRNA markers for forensic body fluid identification, we first screened total RNA samples derived from saliva, semen, vaginal secretion, and venous and menstrual blood for the expression of 718 human miRNAs using a microarray platform. All body fluids could be easily distinguished from each other on the basis of complete array-based miRNA expression profiles. Results from quantitative reverse transcription PCR (RT-PCR; TaqMan) assays for microarray candidate markers confirmed strong over-expression in the targeting body fluid of several miRNAs for venous blood and several others for semen. However, no candidate markers from array experiments for other body fluids such as saliva, vaginal secretion, or menstrual blood could be confirmed by RT-PCR. Time-wise degradation of venous blood and semen stains for at least 1 year under lab conditions did not significantly affect the detection sensitivity of the identified miRNA markers. The detection limit of the TaqMan assays tested for selected venous blood and semen miRNA markers required only subpicogram amounts of total RNA per single RT-PCR test, which is considerably less than usually needed for reliable mRNA RT-PCR detection. We therefore propose the application of several stable miRNA markers for the forensic identification of blood stains and several others for semen stain identification, using commercially available TaqMan assays. Additional work remains necessary in search for suitable miRNA markers for other forensically relevant body fluids. Electronic supplementary material The online version of this article (doi:10.1007/s00414-009-0402-3) contains supplementary material, which is available to authorized users. PMID:20145944

  2. Accuracy of polimerase chain reaction for the diagnosis of pleural tuberculosis.

    PubMed

    Trajman, Anete; da Silva Santos Kleiz de Oliveira, Elen Fabricia; Bastos, Mayara Lisboa; Belo Neto, Epaminondas; Silva, Edgar Manoel; da Silva Lourenço, Maria Cristina; Kritski, Afrânio; Oliveira, Martha Maria

    2014-06-01

    Polymerase chain reaction (PCR)-based techniques to detect Mycobacterium tuberculosis DNA in respiratory specimens have been increasingly used to diagnose pulmonary tuberculosis. Their use in non-respiratory specimens to diagnose extrapulmonary tuberculosis is, however, controversial. In this study, we estimated the accuracy of three in-country commercialized PCR-based diagnostic techniques in pleural fluid samples for the diagnosis of pleural tuberculosis. Patients underwent thoracenthesis for diagnosis purposes; pleural fluid aliquots were frozen and subsequently submitted to two real time PCR tests (COBAS(®)TAQMAN(®)MTB and Xpert(®)MTB/Rif) and one conventional PCR test (Detect-TB(®)). Two different reference standards were considered: probable tuberculosis (based on clinical grounds) and confirmed tuberculosis (bacteriologically or histologically). Ninety-three patients were included, of whom 65 with pleural tuberculosis, 35 of them confirmed. Sensitivities were 29% for COBAS(®)TAQMAN(®)MTB, 3% for Xpert(®)MTB/Rif and 3% for Detect-TB(®); specificities were 86%, 100% and 97% respectively, considering confirmed tuberculosis. Considering all cases, sensitivities were 16%, 3% and 2%, and specificities, 86%, 100%, and 97%. Compared to the 95% sensitivity of adenosine deaminase, the most sensitive test for pleural tuberculosis, the sensitivities of the three PCR-based tests were very low. We conclude that at present, there is no major place for such tests in routine clinical use. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-30

    Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  5. Canine parvovirus 2c infection in central Portugal.

    PubMed

    João Vieira, Maria; Silva, Eliane; Oliveira, João; Luísa Vieira, Ana; Decaro, Nicola; Desario, Costantina; Muller, Alexandra; Carvalheira, Júlio; Buonavoglia, Canio; Thompson, Gertrude

    2008-07-01

    Canine parvovirus (CPV) has been evolving, generating new genetic and antigenic variants throughout the world. This study was conducted to determine the types of CPV circulating in dogs in Figueira da Foz, Portugal. Thirty fecal samples, collected between 2006 and 2007 from dogs with clinical signs of CPV infection, were tested for CPV by a rapid, in-clinic, enzyme-linked immunosorbent assay (ELISA)/immunomigration test, by conventional real-time polymerase chain reaction (PCR), and by minor-groove binding TaqMan PCR. Of the 29 PCR-positive samples, 15 were identified as CPV-2b and 14 as CPV-2c. No CPV-2a was detected. The sensitivity of the ELISA test was 82.76% compared with the PCR assays. No significant associations were found between CPV type, clinical outcome, breed, vaccination status, or age.

  6. A small noncoding RNA signature found in exosomes of GBM patient serum as a diagnostic tool.

    PubMed

    Manterola, Lorea; Guruceaga, Elizabeth; Gállego Pérez-Larraya, Jaime; González-Huarriz, Marisol; Jauregui, Patricia; Tejada, Sonia; Diez-Valle, Ricardo; Segura, Victor; Samprón, Nicolás; Barrena, Cristina; Ruiz, Irune; Agirre, Amaia; Ayuso, Angel; Rodríguez, Javier; González, Alvaro; Xipell, Enric; Matheu, Ander; López de Munain, Adolfo; Tuñón, Teresa; Zazpe, Idoya; García-Foncillas, Jesús; Paris, Sophie; Delattre, Jean Yves; Alonso, Marta M

    2014-04-01

    Glioblastoma multiforme (GBM) is the most frequent malignant brain tumor in adults, and its prognosis remains dismal despite intensive research and therapeutic advances. Diagnostic biomarkers would be clinically meaningful to allow for early detection of the tumor and for those cases in which surgery is contraindicated or biopsy results are inconclusive. Recent findings show that GBM cells release microvesicles that contain a select subset of cellular proteins and RNA. The aim of this hypothesis-generating study was to assess the diagnostic potential of miRNAs found in microvesicles isolated from the serum of GBM patients. To control disease heterogeneity, we used patients with newly diagnosed GBM. In the discovery stage, PCR-based TaqMan Low Density Arrays followed by individual quantitative reverse transcriptase polymerase chain reaction were used to test the differences in the miRNA expression levels of serum microvesicles among 25 GBM patients and healthy controls paired by age and sex. The detected noncoding RNAs were then validated in another 50 GBM patients. We found that the expression levels of 1 small noncoding RNA (RNU6-1) and 2 microRNAs (miR-320 and miR-574-3p) were significantly associated with a GBM diagnosis. In addition, RNU6-1 was consistently an independent predictor of a GBM diagnosis. Altogether our results uncovered a small noncoding RNA signature in microvesicles isolated from GBM patient serum that could be used as a fast and reliable differential diagnostic biomarker.

  7. Altered serum microRNAs as biomarkers for the early diagnosis of pulmonary tuberculosis infection

    PubMed Central

    2012-01-01

    Background Pulmonary tuberculosis (TB) is a highly lethal infectious disease and early diagnosis of TB is critical for the control of disease progression. The objective of this study was to profile a panel of serum microRNAs (miRNAs) as potential biomarkers for the early diagnosis of pulmonary TB infection. Methods Using TaqMan Low-Density Array (TLDA) analysis followed by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) validation, expression levels of miRNAs in serum samples from 30 patients with active tuberculosis and 60 patients with Bordetella pertussis (BP), varicella-zoster virus (VZV) and enterovirus (EV) were analyzed. Results The Low-Density Array data showed that 97 miRNAs were differentially expressed in pulmonary TB patient sera compared with healthy controls (90 up-regulated and 7 down-regulated). Following qRT-PCR confirmation and receiver operational curve (ROC) analysis, three miRNAs (miR-361-5p, miR-889 and miR-576-3p) were shown to distinguish TB infected patients from healthy controls and other microbial infections with moderate sensitivity and specificity (area under curve (AUC) value range, 0.711-0.848). Multiple logistic regression analysis of a combination of these three miRNAs showed an enhanced ability to discriminate between these two groups with an AUC value of 0.863. Conclusions Our study suggests that altered levels of serum miRNAs have great potential to serve as non-invasive biomarkers for early detection of pulmonary TB infection. PMID:23272999

  8. Geographic and habitat partitioning of genetically distinct zooxanthellae (Symbiodinium) in Acropora corals on the Great Barrier Reef.

    PubMed

    Ulstrup, K E; Van Oppen, M J H

    2003-12-01

    Intra- and intercolony diversity and distribution of zooxanthellae in acroporid corals is largely uncharted. In this study, two molecular methods were applied to determine the distribution of zooxanthellae in the branching corals Acropora tenuis and A. valida at several reef locations in the central section of the Great Barrier Reef. Sun-exposed and shaded parts of all colonies were examined. Single-stranded conformational polymorphism analysis showed that individual colonies of A. tenuis at two locations harbour two strains of Symbiodinium belonging to clade C (C1 and C2), whereas conspecific colonies at two other reefs harboured a single zooxanthella strain. A. valida was found to simultaneously harbour strains belonging to two distinct phylogenetic clades (C and D) at all locations sampled. A novel method with improved sensitivity (quantitative polymerase chain reaction using Taqman fluorogenic probes) was used to map the relative abundance distribution of the two zooxanthella clades. At two of the five sampling locations both coral species were collected. At these two locations, composition of the zooxanthella communities showed the same pattern in both coral species, i.e. correlation with ambient light in Pioneer Bay and an absence thereof in Nelly Bay. The results show that the distribution of genetically distinct zooxanthellae is correlated with light regime and possibly temperature in some (but not all) colonies of A. tenuis and A. valida and at some reef locations, which we interpret as acclimation to local environmental conditions.

  9. Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

    PubMed

    Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

    2018-05-31

    Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

  10. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  11. Expectoration of Flaviviruses during sugar feeding by mosquitoes (Diptera: Culicidae).

    PubMed

    van den Hurk, Andrew F; Johnson, Petrina H; Hall-Mendelin, Sonja; Northill, Judy A; Simmons, Russell J; Jansen, Cassie C; Frances, Stephen P; Smith, Greg A; Ritchie, Scott A

    2007-09-01

    Biological transmission of arboviruses to a vertebrate host occurs when virions are expelled along with saliva during blood feeding by a hematophagous arthropod. We undertook experiments to determine whether mosquitoes expectorate flaviviruses in their saliva while sugar feeding. Batches of Culex annulirostris Skuse and Culex gelidus Theobald (Diptera: Culicidae) were orally infected with Japanese encephalitis (family Flaviviridae, genus Flavivirus, JEV), Kunjin (family Flaviviridae, genus Flavivirus, KUNV; a subtype of West Nile virus), and Murray Valley encephalitis (family Flaviviridae, genus Flavivirus, MVEV) viruses. After a 7-d extrinsic incubation, these mosquitoes were offered sucrose meals via cotton pledgets, which were removed daily and processed for viral RNA by using real-time TaqMan reverse transcriptase-polymerase chain reaction (RT-PCR) assays. JEV, MVEV, and KUNV RNA was detected in all pledgets removed from batches of Cx. gelidus on days 7-14 postexposure. In contrast, detection rates were variable for Cx. annulirostris, with KUNV detected in 0.3 M sucrose pledgets on all days postexposure, and JEV and MVEV detected on 57 and 50% of days postexposure, respectively. Higher concentrations of sucrose in the pledget did not increase virus detection rates. When individual JEV-infected Cx. gelidus were exposed to the sucrose pledget, 73% of mosquitoes expectorated virus with titers that were detectable by TaqMan RT-PCR. These results clearly show that flaviviruses are expectorated by infected mosquitoes during the process of sugar feeding on artificial pledgets. Potential applications of the method for arboviral bioassays and field surveillance are discussed.

  12. Evaluation and utilization of preassembled frozen commercial fast real-time qPCR master mixes for detection of cytomegalovirus and BK virus.

    PubMed

    Glover, William A; Atienza, Ederlyn E; Nesbitt, Shannon; Kim, Woo J; Castor, Jared; Cook, Linda; Jerome, Keith R

    2016-01-01

    Quantitative DNA detection of cytomegalovirus (CMV) and BK virus (BKV) is critical in the management of transplant patients. Quantitative laboratory-developed procedures for CMV and BKV have been described in which much of the processing is automated, resulting in rapid, reproducible, and high-throughput testing of transplant patients. To increase the efficiency of such assays, the performance and stability of four commercial preassembled frozen fast qPCR master mixes (Roche FastStart Universal Probe Master Mix with Rox, Bio-Rad SsoFast Probes Supermix with Rox, Life Technologies TaqMan FastAdvanced Master Mix, and Life Technologies Fast Universal PCR Master Mix), in combination with in-house designed primers and probes, was evaluated using controls and standards from standard CMV and BK assays. A subsequent parallel evaluation using patient samples was performed comparing the performance of freshly prepared assay mixes versus aliquoted frozen master mixes made with two of the fast qPCR mixes (Life Technologies TaqMan FastAdvanced Master Mix, and Bio-Rad SsoFast Probes Supermix with Rox), chosen based on their performance and compatibility with existing PCR cycling conditions. The data demonstrate that the frozen master mixes retain excellent performance over a period of at least 10 weeks. During the parallel testing using clinical specimens, no difference in quantitative results was observed between the preassembled frozen master mixes and freshly prepared master mixes. Preassembled fast real-time qPCR frozen master mixes perform well and represent an additional strategy laboratories can implement to reduce assay preparation times, and to minimize technical errors and effort necessary to perform clinical PCR. © 2015 Wiley Periodicals, Inc.

  13. mcrA-Targeted Real-Time Quantitative PCR Method To Examine Methanogen Communities▿

    PubMed Central

    Steinberg, Lisa M.; Regan, John M.

    2009-01-01

    Methanogens are of great importance in carbon cycling and alternative energy production, but quantitation with culture-based methods is time-consuming and biased against methanogen groups that are difficult to cultivate in a laboratory. For these reasons, methanogens are typically studied through culture-independent molecular techniques. We developed a SYBR green I quantitative PCR (qPCR) assay to quantify total numbers of methyl coenzyme M reductase α-subunit (mcrA) genes. TaqMan probes were also designed to target nine different phylogenetic groups of methanogens in qPCR assays. Total mcrA and mcrA levels of different methanogen phylogenetic groups were determined from six samples: four samples from anaerobic digesters used to treat either primarily cow or pig manure and two aliquots from an acidic peat sample stored at 4°C or 20°C. Only members of the Methanosaetaceae, Methanosarcina, Methanobacteriaceae, and Methanocorpusculaceae and Fen cluster were detected in the environmental samples. The three samples obtained from cow manure digesters were dominated by members of the genus Methanosarcina, whereas the sample from the pig manure digester contained detectable levels of only members of the Methanobacteriaceae. The acidic peat samples were dominated by both Methanosarcina spp. and members of the Fen cluster. In two of the manure digester samples only one methanogen group was detected, but in both of the acidic peat samples and two of the manure digester samples, multiple methanogen groups were detected. The TaqMan qPCR assays were successfully able to determine the environmental abundance of different phylogenetic groups of methanogens, including several groups with few or no cultivated members. PMID:19447957

  14. Quantification of Human Polyomaviruses JC Virus and BK Virus by TaqMan Quantitative PCR and Comparison to Other Water Quality Indicators in Water and Fecal Samples▿

    PubMed Central

    McQuaig, Shannon M.; Scott, Troy M.; Lukasik, Jerzy O.; Paul, John H.; Harwood, Valerie J.

    2009-01-01

    In the United States, total maximum daily load standards for bodies of water that do not meet bacterial water quality standards are set by each state. The presence of human polyomaviruses (HPyVs) can be used as an indicator of human-associated sewage pollution in these waters. We have developed and optimized a TaqMan quantitative PCR (QPCR) assay based on the conserved T antigen to both quantify and simultaneously detect two HPyVs; JC virus and BK virus. The QPCR assay was able to consistently quantify ≥10 gene copies per reaction and is linear over 5 orders of magnitude. HPyVs were consistently detected in human waste samples (57 of 64) and environmental waters with known human fecal contamination (5 of 5) and were not amplified in DNA extracted from 127 animal waste samples from 14 species. HPyV concentrations in sewage decreased 81.2 and 84.2% over 28 days incubation at 25 and 35°C, respectively. HPyVs results were compared to Escherichia coli, fecal coliform, and enterococci concentrations and the presence of three other human-associated microbes: Bacteroidetes, Methanobrevibacter smithii, and adenovirus. HPyVs were the most frequently detected of these in human and contaminated environmental samples and were more human specific than the Bacteroidetes (HF183) or M. smithii. HPyVs and M. smithii more closely mimicked the persistence of adenovirus in sewage than the other microbes. The use of this rapid and quantitative assay in water quality research could help regulatory agencies to identify sources of water pollution for improved remediation of contaminated waters and ultimately protect humans from exposure to pathogens. PMID:19346361

  15. [Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

    PubMed

    Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

    2005-07-01

    To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

  16. Comparison of the performance of three PCR assays for the detection and differentiation of Theileria orientalis genotypes.

    PubMed

    Perera, Piyumali K; Gasser, Robin B; Pulford, David J; Stevenson, Mark A; Firestone, Simon M; McFadden, Andrew M J; Jabbar, Abdul

    2015-03-31

    Oriental theileriosis is a tick-borne disease of bovines caused by the members of the Theileria orientalis complex. Recently, we developed a multiplexed tandem (MT) PCR to detect, differentiate and quantitate four genotypes (i.e., buffeli, chitose, ikeda and type 5) of T. orientalis. In this study, we used MT PCR to assess the prevalence and infection intensity of four T. orientalis genotypes in selected cattle herds that experienced oriental theileriosis outbreaks in New Zealand, and compared the sensitivities and specificities of MT PCR, PCR-high resolution melting (PCR-HRM) and a TaqMan qPCR. MT PCR, PCR-HRM analysis for T. orientalis and a TaqMan qPCR assay for ikeda genotype were employed to test 154 and 88 cattle blood samples from North (where oriental theileriosis outbreaks had occurred; designated as Group 1) and South (where no outbreaks had been reported; Group 2) Islands of New Zealand, respectively. Quantitative data from MT PCR assay were analyzed using generalized linear model and paired-sample t-test. The diagnostic specificity and sensitivity of the assays were estimated using a Bayesian latent class modeling approach. In Group 1, 99.4% (153/154) of cattle were test-positive for T. orientalis in both the MT PCR and PCR-HRM assays. The apparent prevalences of genotype ikeda in Group 1 were 87.6% (134/153) and 87.7% (135/154) using the MT PCR and Ikeda TaqMan qPCR assays, respectively. Using the MT PCR test, all four genotypes of T. orientalis were detected. The infection intensity estimated for genotype ikeda was significantly higher (P = 0.009) in severely anaemic cattle than in those without anaemia, and this intensity was significantly higher than that of buffeli (P < 0.001) in the former cattle. Bayesian latent class analysis showed that the diagnostic sensitivities (97.1-98.9%) and specificities (96.5-98.9%) of the three PCR assays were very comparable. The present findings show the advantages of using the MT PCR assay as a useful tool for in-depth epidemiological and transmission studies of T. orientalis worldwide.

  17. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    PubMed

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  18. Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

    PubMed

    Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

    2011-12-01

    High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  20. A Gene Expression Signature Associated with Overall Survival in Patients with Hepatocellular Carcinoma Suggests a New Treatment Strategy.

    PubMed

    Gillet, Jean-Pierre; Andersen, Jesper B; Madigan, James P; Varma, Sudhir; Bagni, Rachel K; Powell, Katie; Burgan, William E; Wu, Chung-Pu; Calcagno, Anna Maria; Ambudkar, Suresh V; Thorgeirsson, Snorri S; Gottesman, Michael M

    2016-02-01

    Despite improvements in the management of liver cancer, the survival rate for patients with hepatocellular carcinoma (HCC) remains dismal. The survival benefit of systemic chemotherapy for the treatment of liver cancer is only marginal. Although the reasons for treatment failure are multifactorial, intrinsic resistance to chemotherapy plays a primary role. Here, we analyzed the expression of 377 multidrug resistance (MDR)-associated genes in two independent cohorts of patients with advanced HCC, with the aim of finding ways to improve survival in this poor-prognosis cancer. Taqman-based quantitative polymerase chain reaction revealed a 45-gene signature that predicts overall survival (OS) in patients with HCC. Using the Connectivity Map Tool, we were able to identify drugs that converted the gene expression profiles of HCC cell lines from ones matching patients with poor OS to profiles associated with good OS. We found three compounds that convert the gene expression profiles of three HCC cell lines to gene expression profiles associated with good OS. These compounds increase histone acetylation, which correlates with the synergistic sensitization of those MDR tumor cells to conventional chemotherapeutic agents, including cisplatin, sorafenib, and 5-fluorouracil. Our results indicate that it is possible to modulate gene expression profiles in HCC cell lines to those associated with better outcome. This approach also increases sensitization of HCC cells toward conventional chemotherapeutic agents. This work suggests new treatment strategies for a disease for which few therapeutic options exist. U.S. Government work not protected by U.S. copyright.

  1. MYC-induced nuclear antigen (MINA) and preeclampsia.

    PubMed

    Martinez-Fierro, Margarita L; Reyes-Oliva, Edwin A; Cabral-Pacheco, Griselda A; Garza-Veloz, Idalia; Aceves-Medina, Maria C; Luevano, Martha; Barbosa-Cisneros, Olga Y; Galvan-Valencia, Marisol; Yahuaca-Mendoza, Patricia; Delgado-Enciso, Ivan; Zamudio-Osuna, Michelle; Rodriguez-Sanchez, Iram P; Vazquez-Castro, Rosbel; Guerrero-Saucedo, Marycruz

    2016-05-01

    Inadequate trophoblast invasion and the subsequent inflammatory response have been implicated in preeclampsia (PE) pathogenesis. Because MYC-induced nuclear antigen (MINA) gene expression is involved in cell proliferation and differentiation, inflammatory response modulation, and the unpaired regulation of which is associated with human diseases, we sought to investigate the connection between MINA and PE. The aim of this study was to evaluate the possible relationship between the MINA rs4857304 variant and susceptibility to PE development as well as to estimate placental MINA gene expression and its association with PE. About 242 pregnant women (126 PE cases and 116 controls) were included. MINA genotyping and gene expression were evaluated by quantitative real-time polymerase chain reaction using TaqMan probes. The G/G genotype of the MINA rs4857304 variant was associated with severe PE (p = 0.027, OR = 1.8, 95% CI = 1.8-3.2). Carriers of one G allele of the MINA rs4857304 variant exhibited a 1.7-fold increased risk of severe PE (p = 0.029, 95% CI = 1.1-3.0). MINA was underexpressed in preeclamptic placentas and MINA expression differed between the mild and severe PE groups. Differences in the expression levels of MINA were found among women with the T/T genotype of the rs4857304 polymorphism and carriers of at least one G allele (p = 0.024). PE and its severity are associated with the underexpression of placental MINA, and the G/G genotype of the MINA rs4857304 variant may modify the risk of severe PE among the PE cases evaluated.

  2. Development and Validation of Monoclonal Antibody-Based Antigen Capture ELISA for Detection of Group A Porcine Rotavirus.

    PubMed

    Memon, Atta Muhammad; Bhuyan, Anjuman Ara; Chen, Fangzhou; Guo, Xiaozhen; Menghwar, Harish; Zhu, Yinxing; Ku, Xugang; Chen, Shuhua; Li, Zhonghua; He, Qigai

    2017-05-01

    Porcine rotavirus-A (PoRVA) is one of the common causes of mild to severe dehydrating diarrhea, leading to losses in weaning and postweaning piglets. A rapid, highly specific, and sensitive antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) was developed for detection of PoRVA, by using VP6 (a highly conserved and antigenic protein of group-A rotavirus)-directed rabbit polyclonal antibodies (capture antibody) and murine monoclonal antibodies (detector antibody). The detection limit of AC-ELISA was found to be equal to that of conventional reverse transcription-polymerase chain reaction (RT-PCR; about 10 2.5 TCID 50 /mL). For validation of the in-house AC-ELISA, 295 porcine fecal/diarrhea samples, collected from different provinces of China, were evaluated and compared with conventional RT-PCR and TaqMan RT-quantitative PCR (qPCR). The sensitivity and specificity of this in-house AC-ELISA relative to RT-qPCR were found to be 91.67% and 100%, respectively, with the strong agreement (kappa = 0.972) between these two techniques. Total detection rate with AC-ELISA, conventional RT-PCR, and RT-qPCR were found to be 11.2%, 11.5%, and 12.2%, respectively, without any statistical significant difference. Moreover, AC-ELISA failed to detect any cross-reactivity with porcine epidemic diarrhea virus, transmissible gastroenteritis virus, pseudorabies virus, and porcine circovirus-2. These results suggested that our developed method was rapid, highly specific, and sensitive, which may help in large-scale surveillance, timely detection, and preventive control of rotavirus infection in porcine farms.

  3. Impact of novel histone deacetylase inhibitors, CHAP31 and FR901228 (FK228), on adenovirus-mediated transgene expression.

    PubMed

    Taura, Kojiro; Yamamoto, Yuzo; Nakajima, Akio; Hata, Koichiro; Uchinami, Hiroshi; Yonezawa, Kei; Hatano, Etsuro; Nishino, Norikazu; Yamaoka, Yoshio

    2004-05-01

    Histone deacetylase inhibitors (HDIs) are known to enhance adenovirus (Ad)-mediated transgene expression. Recently, novel HDIs, including cyclic hydroxamic-acid-containing peptide 31 (CHAP31) and FR901228 (FK228), have been developed. The effects of these two novel HDIs on Ad-transduced or endogenous gene expression were investigated. Acetylation of core histones and the expression of the coxsackie and adenovirus receptor (CAR) in HDI-treated cells were examined using Western blot and a quantitative reverse transcription polymerase chain reaction (TaqMan RT-PCR), respectively. Their in vivo effect on adenoviral gene expression was investigated in BALB/c mice. Both compounds enhanced and prolonged Ad-mediated beta-galactosidase expression more effectively than did trichostatin A, a classic HDI. The same effect was observed in Ad-transduced heat shock protein 72 (HSP72), but not in hyperthermia-induced endogenous expression of HSP72, suggesting that the effect is specific for transduced gene expression. Hyperacetylation of core histones induced by HDIs was considered responsible for the augmentative effects of gene expression. Intravenous administration of either CHAP31 or FR901228 enhanced beta-galactosidase expression in mice infected with AdLacZ. CHAP31 and FR901228 amplified Ad-mediated transgene expression. The enhancement of transgene expression by HDIs may result in fewer vector doses for necessary gene expression, helping to alleviate disadvantages caused by Ad vectors. This could be a useful tool in overcoming current limitations of gene therapy using adenovirus vectors. Copyright 2004 John Wiley & Sons, Ltd.

  4. Association study of Toll-like receptor 5 (TLR5) and Toll-like receptor 9 (TLR9) polymorphisms in systemic lupus erythematosus.

    PubMed

    Demirci, F Yesim K; Manzi, Susan; Ramsey-Goldman, Rosalind; Kenney, Margaret; Shaw, Penny S; Dunlop-Thomas, Charmayne M; Kao, Amy H; Rhew, Elisa Y; Bontempo, Franklin; Kammerer, Candace; Kamboh, M Ilyas

    2007-08-01

    Toll-like receptors (TLR) play an important role in both adaptive and innate immunity. Variations in TLR genes have been shown to be associated with various infectious and inflammatory diseases. We investigated the association of TLR5 (Arg392Stop, rs5744168) and TLR9 (-1237T-->C, rs5743836) single nucleotide polymorphisms (SNP) with systemic lupus erythematosus (SLE) in Caucasian American subjects. We performed a case-control association study and genotyped 409 Caucasian women with SLE and 509 Caucasian healthy female controls using TaqMan allelic discrimination (rs5744168) or polymerase chain reaction-restriction fragment length polymorphism analysis (rs5743836). None of the 2 TLR SNP showed a statistically significant association with SLE risk in our cohort. Our results do not indicate a major influence of these putative functional TLR SNP on the susceptibility to (or protection from) SLE.

  5. Direct detection of Leishmania from clinical samples.

    PubMed

    Waitumbi, John N; Bast, Joshua; Nyakoe, Nancy; Magiri, Charles; Quintana, Miguel; Takhampunya, Ratree; Schuster, Anthony L; Van de Wyngaerde, Marshall T; McAvin, James C; Coleman, Russell E

    2017-01-01

    The ability to rapidly and accurately diagnose leishmaniasis is a military priority. Testing was conducted to evaluate diagnostic sensitivity and specificity of field-expedient Leishmania genus and visceral Leishmania specific dual-fluorogenic, hydrolysis probe (TaqMan), polymerase chain reaction assays previously established for use in vector surveillance. Blood samples of patients with confirmed visceral leishmaniasis and controls without the disease from Baringo District, Kenya, were tested. Leishmania genus assay sensitivity was 100% (14/14) and specificity was 84% (16/19). Visceral Leishmania assay sensitivity was 93% (13/14) and specificity 80% (4/5). Cutaneous leishmaniasis (CL) skin scrapes of patients from Honduras were also evaluated. Leishmania genus assay sensitivity was 100% (10/10). Visceral Leishmania assay specificity was 100% (10/10) from cutaneous leishmaniasis samples; no fluorescence above background was reported. These results show promise in a rapid, sensitive, and specific method for Leishmania direct detection from clinical samples.

  6. The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations.

    PubMed

    Teh, L-K; Lee, T-Y; Tan, J A M A; Lai, M-I; George, E

    2015-02-01

    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations. Genotype identification of common β-thalassaemia mutations in Malays was carried out using Taqman genotyping assays. Results show that the Taqman assays allow mutation detection with DNA template concentrations as low as 2-100 ng. In addition, consistent reproducibility was observed in the Taqman assays when repeated eight times and at different time intervals. The developed sensitive Taqman assays allow molecular characterization of β-thalassaemia mutations in samples with low DNA concentrations. The Taqman genotyping assays have potential as a diagnostic tool for foetal blood, chorionic villi or pre-implantation genetic diagnosis where DNA is limited and precious. © 2014 John Wiley & Sons Ltd.

  7. MeltMan: Optimization, Evaluation, and Universal Application of a qPCR System Integrating the TaqMan qPCR and Melting Analysis into a Single Assay

    PubMed Central

    Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina

    2016-01-01

    In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831

  8. A sensitive one-step TaqMan amplification approach for detection of rubella virus clade I and II genotypes in clinical samples.

    PubMed

    Claus, C; Bergs, S; Emmrich, N C; Hübschen, J M; Mankertz, A; Liebert, U G

    2017-02-01

    Although teratogenic rubella virus (RV) causes a vaccine-preventable disease, it is still endemic in several countries worldwide. Thus, there is a constant risk of RV importation into non-endemic areas. RV monitoring, especially during measles and Zika virus outbreaks, requires reliable diagnostic tools. For this study, a TaqMan-based one-step reverse transcription-quantitative PCR (RT-qPCR) assay, with the p90 gene as a novel and so far unexplored target for detection of clade I and II genotypes, was developed and evaluated. Automated nucleic acid extraction was carried out. Performance characteristics of the TaqMan RT-qPCR assay were determined for a RV plasmid standard and RNA extracted from virus-infected cell culture supernatants representing clade I and II genotypes. Diagnostic specificity and sensitivity were validated against other RNA and DNA viruses, relevant for RV diagnostic approaches and for RV-positive clinical samples, respectively. The assay is specific and highly sensitive with a limit of detection as low as five to one copies per reaction or 200 infectious virus particles per ml. The coefficients of variation (CV) were specified as intra- (within one run) and inter- (between different runs) assay variation, and calculated based on the standard deviations for the obtained Ct values of the respective samples. Intra- and inter-assay CV values were low, with a maximum of 3.4% and 2.4%, respectively. The assay was shown to be suitable and specific for the analysis of clinical samples. With p90 as a novel target, the highly sensitive and specific TaqMan assay outlined in this study is suitable for RV diagnosis worldwide.

  9. Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*

    PubMed Central

    Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

    2011-01-01

    The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID:21048197

  10. Event-specific plasmid standards and real-time PCR methods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola.

    PubMed

    Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc

    2005-04-20

    Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.

  11. Challenges in designing a Taqman-based multiplex assay for the simultaneous detection of Herpes simplex virus types 1 and 2 and Varicella-zoster virus.

    PubMed

    Weidmann, Manfred; Armbruster, Katrin; Hufert, Frank T

    2008-08-01

    To optimise molecular detection of herpesviruses an internally controlled multiplex Taqman-PCR for the detection of Herpes simplex virus 1 (HSV1), Herpes simplex virus 2 (HSV2) and Varicella-zoster virus (VZV) was developed. The selection of the dye combination working on the ABI 7700 cycler for this multiplex PCR revealed crosstalk phenomena between several combinations of reference dyes and reporter dyes. A final dye combination with CY5 as reference dye and FAM/JOE/TXR as reporter dyes was selected. The influence of the concentration of the internal positive control (IPC) concentration on the quantitative results of HSV1, HSV2 and VZV positive patient samples was analysed. The results indicate that high IPC concentrations are detrimental for the sensitivity of the multiplex assay and that the presence of the IPC molecule narrows the dynamic range of the duplex PCRs between any of the virus PCRs and the IPC-PCR. The optimised multiplex assay detecting HSV1, HSV2 and VZV using 10(3) IPC molecules showed a performance and sensitivity comparable to that of the individual assays.

  12. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  13. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    PubMed Central

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  14. Development and evaluation of a Quadruplex Taq Man real-time PCR assay for simultaneous detection of clinical isolates of Enterococcus faecalis, Enterococcus faecium and their vanA and vanB genotypes.

    PubMed

    Naserpour Farivar, Taghi; Najafipour, Reza; Johari, Pouran; Aslanimehr, Masoumeh; Peymani, Amir; Jahani Hashemi, Hoasan; Mirzaui, Baman

    2014-10-01

    We developed and evaluated the utility of a quadruplex Taqman real-time PCR assay that allows simultaneous identification of vancomycin-resistant genotypes and clinically relevant enterococci. The specificity of the assay was tested using reference strains of vancomycin-resistant and susceptible enterococci. In total, 193 clinical isolates were identified and subsequently genotyped using a Quadruplex Taqman real-time PCR assay and melting curve analysis. Representative Quadruplex Taqman real-time PCR amplification curve were obtained for Enterococcus faecium, Enterococcus faecalis, vanA-containing E. faecium, vanB-containing E. faecalis. Phenotypic and genotypic analysis of the isolates gave same results for 82 enterococcal isolates, while in 5 isolates, they were inconsistent. We had three mixed strains, which were detected by the TaqMan real-time PCR assay and could not be identified correctly using phenotypic methods. Vancomycin resistant enterococci (VRE) genotyping and identification of clinically relevant enterococci were rapidly and correctly performed using TaqMan real-time multiplex real-time PCR assay.

  15. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  16. Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

    PubMed

    Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

    2010-06-01

    Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

  17. Multicentre study of Y chromosome microdeletions in 1,808 Chinese infertile males using multiplex and real-time polymerase chain reaction.

    PubMed

    Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z

    2017-06-01

    Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.

  18. Development of hydrolysis probe-based real-time PCR for identification of virulent gene targets of Burkholderia pseudomallei and B. mallei--a retrospective study on archival cases of service members with melioidosis and glanders.

    PubMed

    Zhang, Binxue; Wear, Douglas J; Kim, H S; Weina, Peter; Stojadinovic, Alexander; Izadjoo, Mina

    2012-02-01

    Burkholderia pseudomallei and B. mallei are two highly pathogenic bacteria responsible for melioidosis and glanders, respectively. Our laboratory developed hydrolysis probe-based real-time polymerase chain reaction assays targeting type three secretion system (TTS) and transposase family protein (TFP) of B. pseudomallei and B. malli, respectively. The assays were validated for target specificity, amplification sensitivity, and reproducibility. A bacterial DNA panel, composed of B. pseudomallei (13 strains), B. mallei (11 strains), Burkholderia species close neighbors (5 strains), and other bacterial species (17 strains), was prepared for specificity testing. Reference DNAs from B. pseudomallei and B. mallei bacterial cultures were used as controls for amplification, limit of detection, and reproducibility testing. The two TaqMan assays, Bp-TTS 1 and Bm-TFP, were optimized and applied in a retrospective study of archived cases from the Armed Forces Institute of Pathology. We tested 10 formalin-fixed paraffin-embedded blocks originally from autopsy specimens of patients who died of melioidosis or glanders during or after overseas tours in 1960s. Polymerase chain reaction results confirmed that DNA samples from formalin-fixed paraffin-embedded blocks of eight patients with melioidosis were positive for Bp-TTS 1 target and two patients with glanders were positive for Bm-TFP target.

  19. Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

    PubMed

    Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

    2017-07-01

    The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4  ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.

  20. Evaluation of sensitivity of TaqMan RT-PCR for rubella virus detection in clinical specimens.

    PubMed

    Okamoto, Kiyoko; Mori, Yoshio; Komagome, Rika; Nagano, Hideki; Miyoshi, Masahiro; Okano, Motohiko; Aoki, Yoko; Ogura, Atsushi; Hotta, Chiemi; Ogawa, Tomoko; Saikusa, Miwako; Kodama, Hiroe; Yasui, Yoshihiro; Minagawa, Hiroko; Kurata, Takako; Kanbayashi, Daiki; Kase, Tetsuo; Murata, Sachiko; Shirabe, Komei; Hamasaki, Mitsuhiro; Kato, Takashi; Otsuki, Noriyuki; Sakata, Masafumi; Komase, Katsuhiro; Takeda, Makoto

    2016-07-01

    An easy and reliable assay for detection of the rubella virus is required to strengthen rubella surveillance. Although a TaqMan RT-PCR assay for detection of the rubella virus has been established in Japan, its utility for diagnostic purposes has not been tested. To allow introduction of the TaqMan RT-PCR into the rubella surveillance system in Japan, the sensitivity of the assay was determined using representative strains for all genotypes and clinical specimens. The detection limits of the method for individual genotypes were examined using viral RNA extracted from 13 representative strains. The assay was also tested at 10 prefectural laboratories in Japan, designated as local reference laboratories for measles and rubella, to allow nationwide application of the assay. The detection limits and amplification efficiencies of the assay were similar among all the representative strains of the 13 genotypes. The TaqMan RT-PCR could detect approximately 90% of throat swab and urine samples taken up to 5days of illness. These samples were determined positive by a highly sensitive nested RT-PCR. The TaqMan RT-PCR could detect at least 10 pfu of rubella virus. Although the sensitivity was somewhat lower than that of the conventional nested RT-PCR, the TaqMan RT-PCR could be more practical to routine tests for rubella laboratory diagnosis and detection in view of the rapid response and reducing risks of contamination. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    PubMed

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  2. Real-time PCR and its application to mumps rapid diagnosis.

    PubMed

    Jin, L; Feng, Y; Parry, R; Cui, A; Lu, Y

    2007-11-01

    A real-time polymerase chain reaction assay was initially developed in China to detect mumps genome. The primers and TaqMan-MGB probe were selected from regions of the hemagglutinin gene of mumps virus. The primers and probe for the real-time PCR were evaluated by both laboratories in China and in the UK using three different pieces of equipment, LightCycler (Roche), MJ DNA Engine Option 2 (BIO-RAD) and TaqMan (ABI Prism) on different samples. The reaction was performed with either a one-step (China) or two-step (UK) process. The sensitivity (10 copies) was estimated using a serial dilution of constructed mumps-plasmid DNA and a linear standard curve was obtained between 10 and 10(7) DNA copies/reaction, which can be used to quantify viral loads. The detection limit on cell culture-grown virus was approximately 2 pfu/ml with a two-step assay on TaqMan, which was equivalent to the sensitivity of the nested PCR routinely used in the UK. The specificity was proved by testing a range of respiratory viruses and several genotypes of mumps strains. The concentration of primers and probe is 22 pmol and 6.25 or 7 pmol respectively for a 25 microl reaction. The assay took 3 hr from viral RNA extraction to complete the detection using any of the three pieces of equipment. Three hundred forty-one (35 in China and 306 in the UK) clinical specimens were tested, the results showing that this real-time PCR assay is suitable for rapid and accurate detection of mumps virus RNA in various types of clinical specimens. (c) 2007 Wiley-Liss, Inc.

  3. High resolution TaqMan real-time PCR approach to detect hazelnut DNA encoding for ITS rDNA in foods.

    PubMed

    López-Calleja, Inés María; de la Cruz, Silvia; Pegels, Nicolette; González, Isabel; García, Teresa; Martín, Rosario

    2013-12-01

    A broad range of foods have been described as causing allergies, but the majority of allergic reactions can be ascribed to a limited number of food components. Recent extensive surveys showed how tree nuts, particularly hazelnut (Corylus avellana L.) seeds, rank amongst the most important sources of food allergy. In order to protect the allergic consumer, efficient and reliable methods are required for the detection of allergenic ingredients. For this purpose, we have developed a real-time polymerase chain reaction (PCR) for detection of hazelnut in commercial food products. In this way a specific hazelnut primer pair based on the ITS marker (70 bp) and a nuclease (TaqMan) probe labelled with FAM and BHQ were designed. Sensibility of real-time PCR was determined by analysis of raw and heat treated hazelnut-wheat flour mixtures with a range of detection of 0.1-100,000 ppm. Practical applicability of the real-time PCR assay developed for determining hazelnut in different food matrices was investigated by analyzing 179 commercial foodstuffs comprising snacks, biscuits, chocolates, bonbons, creams, nut bars, ice creams, precooked meals, breads, beverages, yogurts, cereals, meat products, rice cake and nougat. From the total of samples analyzed, 40 commercial food products that didn't declare hazelnut nor traces on the label were found to contain hazelnut. The real-time PCR method proposed herein due to its high sensitivity facilitates the detection of hazelnut traces in commercial food products and can also be useful for monitoring the effectiveness of cleaning processes and as consequence, can help to prevent the food allergic consumer from unintentional ingestion of hidden allergens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Next-generation sequencing facilitates quantitative analysis of wild-type and Nrl−/− retinal transcriptomes

    PubMed Central

    Brooks, Matthew J.; Rajasimha, Harsha K.; Roger, Jerome E.

    2011-01-01

    Purpose Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis. Methods Retinal mRNA profiles of 21-day-old wild-type (WT) and neural retina leucine zipper knockout (Nrl−/−) mice were generated by deep sequencing, in triplicate, using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner (BWA) followed by ANOVA (ANOVA) and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results Using an optimized data analysis workflow, we mapped about 30 million sequence reads per sample to the mouse genome (build mm9) and identified 16,014 transcripts in the retinas of WT and Nrl−/− mice with BWA workflow and 34,115 transcripts with TopHat workflow. RNA-seq data confirmed stable expression of 25 known housekeeping genes, and 12 of these were validated with qRT–PCR. RNA-seq data had a linear relationship with qRT–PCR for more than four orders of magnitude and a goodness of fit (R2) of 0.8798. Approximately 10% of the transcripts showed differential expression between the WT and Nrl−/− retina, with a fold change ≥1.5 and p value <0.05. Altered expression of 25 genes was confirmed with qRT–PCR, demonstrating the high degree of sensitivity of the RNA-seq method. Hierarchical clustering of differentially expressed genes uncovered several as yet uncharacterized genes that may contribute to retinal function. Data analysis with BWA and TopHat workflows revealed a significant overlap yet provided complementary insights in transcriptome profiling. Conclusions Our study represents the first detailed analysis of retinal transcriptomes, with biologic replicates, generated by RNA-seq technology. The optimized data analysis workflows reported here should provide a framework for comparative investigations of expression profiles. Our results show that NGS offers a comprehensive and more accurate quantitative and qualitative evaluation of mRNA content within a cell or tissue. We conclude that RNA-seq based transcriptome characterization would expedite genetic network analyses and permit the dissection of complex biologic functions. PMID:22162623

  5. Global microRNA profiling of peripheral blood mononuclear cells in patients with Behçet's disease.

    PubMed

    Erre, Gian Luca; Piga, Matteo; Carru, Ciriaco; Angius, Andrea; Carcangiu, Laura; Piras, Marco; Sotgia, Salvatore; Zinellu, Angelo; Mathieu, Alessandro; Passiu, Giuseppe; Pescatori, Mario

    2015-01-01

    To explore the post-transcriptional regulation of the peripheral blood mononuclear cells (PBMCs) transcriptome by microRNAs in Behçet's disease (BD). Using TaqMan Low Density Array-based microRNAs expression profiling, the expression of 750 mature human microRNAs in PBMCs from 5 BD patients and 3 healthy controls (HC) was compared. The expression of deregulated microRNAs was then validated by quantitative real time-polymerase chain reaction (qRT-PCR), in 42 BD patients and 8 HC. In the initial screening, 13 microRNAs appeared deregulated in BD vs HC. Among them, the differential expression of miR-720 and miR-139-3p was confirmed by qRT-PCR, (p<0.05 and FDR<5%). Areas under the receiver operating characteristic curve for miR-139-3p, miR-720 and miR-139-3p+miR-720 in the validation cohort were 0.84, 0.87 and 0.92 respectively, indicating good discrimination between BD patients and HC. Post-hoc analysis showed that 9 out of 13 microRNAs from the discovery phase were significantly upregulated in active vs. quiescent BD, suggesting inflammation as a key regulator of microRNAs machinery in BD. In silico analysis revealed that several BD candidate susceptibility genes are predicted target of significantly deregulated microRNAs in active BD. A significant enrichment in microRNAs targeting elements of the Toll-like receptor (TLR) and T-cell receptor signalling pathways was also assumed. miR199-3p and miR720 deserve further confirmation as biomarkers of BD in larger studies. PBMCs from active BD displayed a unique signature of microRNAs which may be implicated in regulation of innate immunity activation and T-cell function.

  6. ESR1 and PGR polymorphisms are associated with estrogen and progesterone receptor expression in breast tumors.

    PubMed

    Hertz, Daniel L; Henry, N Lynn; Kidwell, Kelley M; Thomas, Dafydd; Goddard, Audrey; Azzouz, Faouzi; Speth, Kelly; Li, Lang; Banerjee, Mousumi; Thibert, Jacklyn N; Kleer, Celina G; Stearns, Vered; Hayes, Daniel F; Skaar, Todd C; Rae, James M

    2016-09-01

    Hormone receptor-positive (HR+) breast cancers express the estrogen (ERα) and/or progesterone (PgR) receptors. Inherited single nucleotide polymorphisms (SNPs) in ESR1, the gene encoding ERα, have been reported to predict tamoxifen effectiveness. We hypothesized that these associations could be attributed to altered tumor gene/protein expression of ESR1/ERα and that SNPs in the PGR gene predict tumor PGR/PgR expression. Formalin-fixed paraffin-embedded breast cancer tumor specimens were analyzed for ESR1 and PGR gene transcript expression by the reverse transcription polymerase chain reaction based Oncotype DX assay and for ERα and PgR protein expression by immunohistochemistry (IHC) and an automated quantitative immunofluorescence assay (AQUA). Germline genotypes for SNPs in ESR1 (n = 41) and PGR (n = 8) were determined by allele-specific TaqMan assays. One SNP in ESR1 (rs9322336) was significantly associated with ESR1 gene transcript expression (P = 0.006) but not ERα protein expression (P > 0.05). A PGR SNP (rs518162) was associated with decreased PGR gene transcript expression (P = 0.003) and PgR protein expression measured by IHC (P = 0.016), but not AQUA (P = 0.054). There were modest, but statistically significant correlations between gene and protein expression for ESR1/ERα and PGR/PgR and for protein expression measured by IHC and AQUA (Pearson correlation = 0.32-0.64, all P < 0.001). Inherited ESR1 and PGR genotypes may affect tumor ESR1/ERα and PGR/PgR expression, respectively, which are moderately correlated. This work supports further research into germline predictors of tumor characteristics and treatment effectiveness, which may someday inform selection of hormonal treatments for patients with HR+ breast cancer. Copyright © 2016 the American Physiological Society.

  7. Characterization of serum microRNAs profile of PCOS and identification of novel non-invasive biomarkers.

    PubMed

    Long, Wei; Zhao, Chun; Ji, Chenbo; Ding, Hongjuan; Cui, Yugui; Guo, Xirong; Shen, Rong; Liu, Jiayin

    2014-01-01

    Polycystic ovary syndrome (PCOS), the most common endocrinopathy in women of reproductive age, is characterized by polycystic ovaries, chronic anovulation, hyperandrogenism and insulin resistance. Despite the high prevalence of hyperandrogenemia, a definitive endocrine marker for PCOS has so far not been identified. Circulating miRNAs have recently been shown to serve as diagnostic/prognostic biomarkers in patients with cancers. Our current study focused on the altered expression of serum miRNAs and their correlation with PCOS. We systematically used the TaqMan Low Density Array followed by individual quantitative reverse transcription polymerase chain reaction assays to identify and validate the expression of serum miRNAs of PCOS patients. The expression levels of three miRNAs (miR-222, miR-146a and miR-30c) were significantly increased in PCOS patients with respect to the controls in our discovery evaluation and followed validation. The area under the receiver operating characteristic (ROC) curve (AUC) is 0.799, 0.706, and 0.688, respectively. The combination of the three miRNAs using multiple logistic regression analysis showed a larger AUC (0.852) that was more efficient for the diagnosis of PCOS. In addition, logistic binary regression analyses show miR-222 is positively associated with serum insulin, while miR-146a is negatively associated with serum testosterone. Furthermore, bioinformatics analysis indicated that the predicted targets function of the three miRNAs mainly involved in the metastasis, cell cycle, apoptosis and endocrine. Serum miRNAs are differentially expressed between PCOS patients and controls. We identified and validated a class of three serum miRNAs that could act as novel non-invasive biomarkers for diagnosis of PCOS. These miRNAs may be involved in the pathogenesis of PCOS. © 2014 S. Karger AG, Basel.

  8. Pepper mild mottle virus as a process indicator at drinking water treatment plants employing coagulation-sedimentation, rapid sand filtration, ozonation, and biological activated carbon treatments in Japan.

    PubMed

    Kato, Ryuichi; Asami, Tatsuya; Utagawa, Etsuko; Furumai, Hiroaki; Katayama, Hiroyuki

    2018-04-01

    To assess the potential of pepper mild mottle virus (PMMoV) as a viral process indicator, its reduction through coagulation-sedimentation (CS) and rapid sand filtration (RSF) were compared with those of Escherichia coli, previously used viral indicators, and norovirus genotype II (NoV GII; enteric virus reference pathogen) in a bench-scale experiment. PMMoV log 10 reductions in CS (1.96 ± 0.30) and RSF (0.26 ± 0.38) were similar to those of NoV GII (1.86 ± 0.61 and 0.28 ± 0.46). PMMoV, the most abundant viruses in the raw water, was also determined during CS, RSF, and advanced treatment processes at two full-scale drinking water treatment plants under strict turbidity management over a 13-month period. PMMoV was concentrated from large-volume water samples (10-614 L) and quantified by Taqman-based quantitative polymerase chain reaction. The PMMoV log 10 reduction in CS (2.38 ± 0.74, n = 13 and 2.63 ± 0.76, n = 10 each for Plant A and B) and in ozonation (1.91 ± 1.18, n = 5, Plant A) greatly contributed to the overall log 10 reduction. Our results suggest that PMMoV can act as a useful treatment process indicator of enteric viruses and can be used to monitor the log 10 reduction of individual treatment processes at drinking water treatment plants due to its high and consistent copy numbers in source water. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The kinetics of feline leukaemia virus shedding in experimentally infected cats are associated with infection outcome.

    PubMed

    Cattori, Valentino; Tandon, Ravi; Riond, Barbara; Pepin, Andrea C; Lutz, Hans; Hofmann-Lehmann, Regina

    2009-01-13

    Feline leukaemia virus (FeLV) infection in felids results mainly from oronasal exposure to infectious saliva and nasal secretions, but the potential for viral transmission through faeces and urine has not been completely characterized. In order to assess and compare potential FeLV transmission routes, we determined the viral kinetics in plasma, saliva, faeces and urine during early experimental FeLV infection (up to week 15 post-exposure) in specific pathogen-free cats. In addition to monitoring p27 antigen levels measured by ELISA, we evaluated the presence of infectious particles by cell culture assays and quantified viral RNA loads by a quantitative real-time TaqMan polymerase chain reaction. RNA load was associated with infection outcome (high load-progressive infection; low load-regressive infection) not only in plasma, but also in saliva, faeces and urine. Infectious virus was isolated from the saliva, faeces and urine of infected cats with progressive infection as early as 3-6 weeks post-infection, but usually not in cats with regressive infection. In cats with progressive infection, therefore, not only saliva but also faeces and to some extent urine might represent potential FeLV transmission routes. These results should be taken into account when modelling FeLV-host interactions and assessing FeLV transmission risk. Moreover, during early FeLV infection, detection of viral RNA in saliva may be used as an indicator of recent virus exposure, even in cats without detectable antigenaemia/viraemia. To determine the clinically relevant outcome of FeLV infection in exposed cats, however, p27 antigen levels in the peripheral blood should be measured.

  10. Expression differences of circulating microRNAs in metastatic castration resistant prostate cancer and low-risk, localized prostate cancer.

    PubMed

    Nguyen, Han Christine Ngoc; Xie, Wanling; Yang, Ming; Hsieh, Chen-Lin; Drouin, Sarah; Lee, Gwo-Shu Mary; Kantoff, Philip W

    2013-03-01

    Recent studies show that microRNAs (miRNAs), small non-coding RNAs that negatively regulate gene expression, may have potential for monitoring cancer status. We investigated circulating miRNAs in prostate cancer that may be associated with the progression of hormone-sensitive primary tumors to metastatic castration resistant prostate cancer (CRPC) after androgen deprivation therapy. Using genome-wide expression profiling by TaqMan Human MicroRNA Arrays (Applied Biosystems) and/or quantitative real-time polymerase chain reaction, we compared the expression levels of miRNAs in serum samples from 28 patients of low-risk localized disease, 30 of high-risk localized disease and 26 of metastatic CRPC. We demonstrated that serum samples from patients of low risk, localized prostate cancer and metastatic CRPC patients exhibit distinct circulating miRNA signatures. MiR-375, miR-378*, and miR-141 were significantly over-expressed in serum from CRPC patients compared with serum from low-risk localized patients, while miR-409-3p was significantly under-expressed. In prostate primary tumor samples, miR-375 and miR-141 also had significantly higher expression levels compared with those in normal prostate tissue. Circulating miRNAs, particularly miR-375, miR-141, miR-378*, and miR-409-3p, are differentially expressed in serum samples from prostate cancer patients. In the search for improved minimally invasive methods to follow cancer pathogenesis, the correlation of disease status with the expression patterns of circulating miRNAs may indicate the potential importance of circulating miRNAs as prognostic markers for prostate cancer progression. Copyright © 2012 Wiley Periodicals, Inc.

  11. Effect of cilostazol on platelet reactivity among patients with peripheral artery disease on clopidogrel therapy.

    PubMed

    Hernandez-Suarez, Dagmar F; Núñez-Medina, Hector; Scott, Stuart A; Lopez-Candales, Angel; Wiley, Jose M; Garcia, Mario J; Melin, Kyle; Nieves-Borrero, Karid; Rodriguez-Ruiz, Christina; Marshall, Lorraine; Duconge, Jorge

    2018-03-28

    Antiplatelet therapy with clopidogrel is recommended to reduce cardiovascular events in patients with peripheral artery disease (PAD); however, clopidogrel efficacy has not been adequately studied in this patient population. Therefore, we aimed to determine the effects of cilostazol therapy on platelet reactivity among PAD patients on clopidogrel. We performed a cross-sectional pilot study of 46 Puerto Rican patients diagnosed with PAD. The cohort was divided based on use of clopidogrel and cilostazol (n=24) or clopidogrel alone (n=22). Platelet function was measured ex vivo using the VerifyNow P2Y12 assay. Genomic DNA was extracted from peripheral blood samples using the QIAamp DNA Blood Midi Kit, which was subjected to candidate variant genotyping (CYP2C19, ABCB1, PON1 and P2RY12) using TaqMan quantitative polymerase chain reaction assays. All analyses were performed using SAS version 9.4 (SAS Institute). Among all enrolled patients, 18 (39%) had high on-treatment platelet reactivity (HTPR). The mean platelet reactivity was 207±53 (range, 78-325) with higher P2Y12 reaction units in the non-cilostazol group, 224±45 vs. 191±55 on the cilostazol group (p=0.03). No significant differences were observed in the clinical or genetic variables between the two groups. A multiple regression analysis determined that history of diabetes mellitus (p=0.03), use of cilostazol (p=0.03) and hematocrit (p=0.02) were independent predictors of platelet reactivity. In Puerto Rican PAD patients on clopidogrel therapy, history of diabetes mellitus, use of cilostazol and hematocrit are independent predictors of platelet reactivity. Adjunctive cilostazol therapy may enhance clopidogrel efficacy among PAD patients with HTPR.

  12. The use of agricultural substrates to improve methane yield in anaerobic co-digestion with pig slurry: effect of substrate type and inclusion level.

    PubMed

    Ferrer, Pablo; Cambra-López, María; Cerisuelo, Alba; Peñaranda, David S; Moset, Verónica

    2014-01-01

    Anaerobic co-digestion of pig slurry with four agricultural substrates (tomato, pepper, persimmon and peach) was investigated. Each agricultural substrate was tested in co-digestion with pig slurry at four inclusion levels: 0%, 15%, 30% and 50%. Inclusion levels consisted in the replacement of the volatile solids (VS) from the pig slurry with the VS from the agricultural substrate. The effect of substrate type and inclusion level on the biochemical methane potential (BMP) was evaluated in a batch assay performed at 35 °C for 100 days. Agricultural substrate's chemical composition was also analyzed and related with BMP. Additionally, Bacteria and Archaea domains together with the four main methanogenic archaeal orders were quantified using quantitative real-time TaqMan polymerase chain reaction (qPCR) at the end of the experiment to determine the influence of agricultural substrate on sludge's microbial composition. Results showed that vegetable substrates (pepper and tomato) had higher lipid and protein content and lower carbohydrates than fruit substrates (persimmon and peach). Among substrates, vegetable substrates showed higher BMP than fruit substrates. Higher BMP values were obtained with increasing addition of agricultural substrate. The replacement of 50% of VS from pig slurry by tomato and pepper increased BMP in 41% and 44%, respectively compared with pig slurry only. Lower increments in BMP were achieved with lower inclusion levels. Results from qPCR showed that total bacteria and total archaea gene concentrations were similar in all combinations tested. Methanomicrobiales gene concentrations dominated over the rest of individual archaeal orders. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Interlaboratory and between-specimen comparisons of diagnostic tests for leptospirosis in sheep and cattle.

    PubMed

    Fang, Fang; Collins-Emerson, Julie M; Heuer, Cord; Hill, Fraser I; Tisdall, David J; Wilson, Peter R; Benschop, Jackie

    2014-11-01

    A study was performed to investigate interlaboratory test agreement between a research and a commercial veterinary diagnostic laboratory on blood and urine samples, and to investigate test agreement between blood, urine, and kidney samples (research laboratory) for leptospirosis diagnosis. Samples were sourced from 399 sheep and 146 beef cattle from a local abattoir. Interlaboratory agreement for real-time quantitative polymerase chain reaction (qPCR) results on urine samples was almost perfect (kappa = 0.90), despite the use of different amplification targets (DNA gyrase subunit B gene vs. 16s ribosomal RNA gene), chemistries (SYTO9 vs. TaqMan probe), and pre-PCR processing. Interlaboratory agreement for microscopic agglutination test (MAT) positivity was almost perfect (kappa = 0.93) for Leptospira borgpetersenii serovar Hardjo subtype Hardjobovis (Hardjobovis) but moderate (kappa = 0.53) for Leptospira interrogans serovar Pomona (Pomona). Among animals that had different titers recorded, higher Hardjobovis and lower Pomona titers were reported by the commercial laboratory than by the research laboratory (P < 0.005). These interlaboratory comparisons can assist researchers and diagnosticians in interpreting the sometimes discrepant test results. Within the research laboratory, the comparison of qPCR results on urine and kidney showed almost perfect agreement (kappa = 0.84), suggesting that the qPCR on these 2 specimens can be used interchangeably. The agreement between MAT positivity and urine and kidney qPCR results was fair (kappa = 0.32 and kappa = 0.33, respectively). However, the prevalence ratio of urine and kidney qPCR positivity in Hardjobovis-seropositive versus Hardjobovis-seronegative sheep indicated that Hardjobovis seropositivity found in sheep may be able to predict shedding or renal carriage. © 2014 The Author(s).

  14. Evaluation of the Aptima HBV Quant assay vs. the COBAS TaqMan HBV test using the high pure system for the quantitation of HBV DNA in plasma and serum samples.

    PubMed

    Schalasta, Gunnar; Börner, Anna; Speicher, Andrea; Enders, Martin

    2018-03-28

    Proper management of patients with chronic hepatitis B virus (HBV) infection requires monitoring of plasma or serum HBV DNA levels using a highly sensitive nucleic acid amplification test. Because commercially available assays differ in performance, we compared herein the performance of the Hologic Aptima HBV Quant assay (Aptima) to that of the Roche Cobas TaqMan HBV test for use with the high pure system (HPS/CTM). Assay performance was assessed using HBV reference panels as well as plasma and serum samples from chronically HBV-infected patients. Method correlation, analytical sensitivity, precision/reproducibility, linearity, bias and influence of genotype were evaluated. Data analysis was performed using linear regression, Deming correlation analysis and Bland-Altman analysis. Agreement between the assays for the two reference panels was good, with a difference in assay values vs. target <0.5 log. Qualitative assay results for 159 clinical samples showed good concordance (88.1%; κ=0.75; 95% confidence interval: 0.651-0.845). For the 106 samples quantitated by both assays, viral load results were highly correlated (R=0.92) and differed on average by 0.09 log, with 95.3% of the samples being within the 95% limit of agreement of the assays. Linearity for viral loads 1-7 log was excellent for both assays (R2>0.98). The two assays had similar bias and precision across the different genotypes tested at low viral loads (25-1000 IU/mL). Aptima has a performance comparable with that of HPS/CTM, making it suitable for use for HBV infection monitoring. Aptima runs on a fully automated platform (the Panther system) and therefore offers a significantly improved workflow compared with HPS/CTM.

  15. Quantitative real-time PCR method with internal amplification control to quantify cyclopiazonic acid producing molds in foods.

    PubMed

    Rodríguez, Alicia; Werning, María L; Rodríguez, Mar; Bermúdez, Elena; Córdoba, Juan J

    2012-12-01

    A quantitative TaqMan real-time PCR (qPCR) method that includes an internal amplification control (IAC) to quantify cyclopiazonic acid (CPA)-producing molds in foods has been developed. A specific primer pair (dmaTF/dmaTR) and a TaqMan probe (dmaTp) were designed on the basis of dmaT gene which encodes the enzyme dimethylallyl tryptophan synthase involved in the biosynthesis of CPA. The IAC consisted of a 105 bp chimeric DNA fragment containing a region of the hly gene of Listeria monocytogenes. Thirty-two mold reference strains representing CPA producers and non-producers of different mold species were used in this study. All strains were tested for CPA production by high-performance liquid chromatography-mass spectrometry (HPLC-MS). The functionality of the designed qPCR method was demonstrated by the high linear relationship of the standard curves relating to the dmaT gene copy numbers and the Ct values obtained from the different CPA producers tested. The ability of the qPCR protocol to quantify CPA-producing molds was evaluated in different artificially inoculated foods. A good linear correlation was obtained over the range 1-4 log cfu/g in the different food matrices. The detection limit in all inoculated foods ranged from 1 to 2 log cfu/g. This qPCR protocol including an IAC showed good efficiency to quantify CPA-producing molds in naturally contaminated foods avoiding false negative results. This method could be used to monitor the CPA producers in the HACCP programs to prevent the risk of CPA formation throughout the food chain. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

    PubMed

    Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

    2013-12-27

    Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

  17. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    PubMed

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  18. T.I.M.S: TaqMan Information Management System, tools to organize data flow in a genotyping laboratory

    PubMed Central

    Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico

    2005-01-01

    Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298

  19. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    PubMed

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

  20. Simplex and duplex event-specific analytical methods for functional biotech maize.

    PubMed

    Lee, Seong-Hun; Kim, Su-Jeong; Yi, Bu-Young

    2009-08-26

    Analytical methods are very important in the control of genetically modified organism (GMO) labeling systems or living modified organism (LMO) management for biotech crops. Event-specific primers and probes were developed for qualitative and quantitative analysis for biotech maize event 3272 and LY 038 on the basis of the 3' flanking regions, respectively. The qualitative primers confirmed the specificity by a single PCR product and sensitivity to 0.05% as a limit of detection (LOD). Simplex and duplex quantitative methods were also developed using TaqMan real-time PCR. One synthetic plasmid was constructed from two taxon-specific DNA sequences of maize and two event-specific 3' flanking DNA sequences of event 3272 and LY 038 as reference molecules. In-house validation of the quantitative methods was performed using six levels of mixing samples, from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-30%. Limits of quantitation (LOQs) of the quantitative methods were all 0.1% for simplex real-time PCRs of event 3272 and LY 038 and 0.5% for duplex real-time PCR of LY 038. This study reports that event-specific analytical methods were applicable for qualitative and quantitative analysis for biotech maize event 3272 and LY 038.

  1. Application of TaqMan qPCR for the detection and monitoring of Naegleria species in reservoirs used as a source for drinking water.

    PubMed

    Kao, Po-Min; Hsu, Bing-Mu; Hsu, Tsui-Kang; Chiu, Yi-Chou; Chang, Chung-Liang; Ji, Wen-Tsai; Huang, Shih-Wei; Fan, Cheng-Wei

    2014-10-01

    Naegleria spp. can be found in the natural aquatic environments. Naegleria fowleri can cause fatal infections in the central nervous system in humans and animals, and the most important source of infection is through direct water contact. In this study, PCR of 5.8S ribosomal RNA (rRNA) gene and internal transcribed spacer (ITS) region was performed in order to identify Naegleria isolates and quantify the Naegleria spp. by TaqMan real-time quantitative PCR in reservoir water samples. The occurrence of Naegleria spp. was investigated in 57 water samples from reservoirs with culture and PCR positive in 2 of them (3.5%), respectively. The total detection rate was 7.0% (4/ 57) for Naegleria spp. The identified species included Naegleria spp., Naegleria canariensis, and Naegleria clarki. N. fowleri was not found in Taiwan's reservoirs used for drinking purposes. The concentrations of Naegleria spp. in detected positive reservoir water samples were in the range of 599 and 3.1 × 10(3) cells/L. The presence or absence of Naegleria spp. within the reservoir water samples showed significant difference with the levels of water temperature. The presence of Naegleria spp. in reservoirs considered a potential public health threat if pathogenic species exist in reservoirs.

  2. Development of fluorogenic probe-based PCR assays for the detection and quantification of bovine piroplasmids.

    PubMed

    Criado-Fornelio, A; Buling, A; Asenzo, G; Benitez, D; Florin-Christensen, M; Gonzalez-Oliva, A; Henriques, G; Silva, M; Alongi, A; Agnone, A; Torina, A; Madruga, C R

    2009-06-10

    This paper reports two new quantitative PCR (qPCR) assays, developed in an attempt to improve the detection of bovine piroplasmids. The first of these techniques is a duplex TaqMan assay for the simultaneous diagnosis of Babesia bovis and B. bigemina. This technique is ideal for use in South America where bovids harbour no theilerids. The second technique, which is suitable for the diagnosis of both babesiosis and theileriosis worldwide, involves fluorescence resonance energy transfer (FRET) probes. In FRET assays, Babesia bovis, B. divergens, Babesia sp. (B. major or B. bigemina), Theileria annae and Theileria sp. were all identifiable based on the melting temperatures of their amplified fragments. Both techniques provided linear calibration curves over the 0.1fg/microl to 0.01ng/microl DNA range. The assays showed good sensitivity and specificity. To assess their performance, both procedures were compared in two separate studies: the first was intended to monitor the experimental infection of calves with B. bovis and the second was a survey where 200 bovid/equine DNA samples from different countries were screened for piroplasmids. Comparative studies showed that duplex TaqMan qPCR was more sensitive than FRET qPCR in the detection of babesids.

  3. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  4. Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods

    EPA Science Inventory

    Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...

  5. Polymorphisms of interleukin 6 in Down syndrome individuals: a case-control study.

    PubMed

    Mattos, M F; Uback, L; Biselli-Chicote, P M; Biselli, J M; Goloni-Bertollo, E M; Pavarino, E C

    2017-08-17

    Down syndrome (DS) individuals present impaired adaptive immune system. However, the etiology of the immunological deficiency in these individuals is not completely understood. This study investigated the frequency of interleukin 6 polymorphisms (rs1800795, rs1800796, and rs1800797) in individuals with DS and individuals without the syndrome. The study included 282 individuals, 94 with DS attended at the General Genetics Outpatient Service of Hospital de Base, São José do Rio Preto, SP, Brazil, and 188 individuals without DS attended at the Pediatric Service of Hospital de Base de São José do Rio Preto, SP, Brazil. Genotyping was performed by allelic discrimination technique by real-time polymerase chain reaction using TaqMan SNP Genotyping Assays (Applied Biosystems). There was no difference in the genotype frequency between individuals with and without DS for the evaluated polymorphisms (P > 0.05). The frequency of interleukin 6 polymorphisms did not differ significantly between individuals with and without DS in the casuistic analyzed.

  6. Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae)

    PubMed Central

    Brault, Aaron C.; Fang, Ying; Reisen, William K.

    2015-01-01

    Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer–probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. PMID:26334826

  7. Market analysis of food products for detection of allergenic walnut (Juglans regia) and pecan (Carya illinoinensis) by real-time PCR.

    PubMed

    López-Calleja, Inés María; de la Cruz, Silvia; González, Isabel; García, Teresa; Martín, Rosario

    2015-06-15

    Two real-time polymerase chain reaction (PCR)-based assays for detection of walnut (Juglans regia) and pecan (Carya illinoinensis) traces in a wide range of processed foods are described here. The method consists on a real-time PCR assay targeting the ITS1 region, using a nuclease (TaqMan) probe labeled with FAM and BBQ. The method was positive for walnut and pecan respectively, and negative for all other heterologous plants and animals tested. Using a series of model samples with defined raw walnut in wheat flour and heat-treated walnut in wheat flour with a range of concentrations of 0.1-100,000 mg kg(-1), a practical detection limit of 0.1 mg kg(-1) of walnut content was estimated. Identical binary mixtures were done for pecan, reaching the same limit of detection of 0.1 mg kg(-1). The assay was successfully trialed on a total of 232 commercial foodstuffs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Design and Development of a Quantitative TaqMan Real-Time PCR Assay for Evaluation of HIV-1 (group M) Viral Load in Plasma Using Armored RNA Standard.

    PubMed

    Gholami, Mohammad; Baesi, Kazem; Rouzbahani, Negin H; Mohraz, Minoo

    2018-06-01

    Human immunodeficiency virus-1 (HIV-1) is a viral infectious agent that gradually extinguishes the immune system, resulting in the acquired immune deficiency syndrome (AIDS). The aim of this study was to develop a TaqMan based detection assay to evaluate HIV-1 plasma viral load and to construct a stable internal positive control (IPC) and external positive control (EPC) RNA based on Armored RNA (AR) technology. The MS2 maturase, coat protein gene and HIV-1 pol gene were cloned in pET-32a plasmid. The recently fabricated recombinant plasmid was transformed into Escherichia coli strain BL2 (DE3) and protein expression and Armored RNA was fabricated in presence of isopropyl-L-thio-D-galactopyranoside (IPTG). The Armored RNA was precipitated and purified by polyethylene glycol (PEG) and sephacryl S-200 chromatography. The stability of Armored RNA was evaluated by treatment with DNase I and RNase A and confirmed by transmission electron microscopy (TEM) and gel agarose electrophoresis. The specificity, sensitivity, inter- and intra-day precision, and the dynamic range of the assay were experimentally determined. The AR was stable in presence of ribonuclease, and the assay had a dynamic detection range from 101 to 105 copies of AR. The coefficient of variation (CV) was 4.8% for intra-assay and 5.8% for inter-assay precision. Clinical specificity and sensitivity of the assay were assessed at 100% and 96.66%, respectively. The linear regression analysis confirmed a high correlation between the in-house and the commercial assay, Real Star HIV-1-qRTPCR, respectively (R2 = 0.888). The AR standard is non-infectious and highly resistant in the presence of ribonuclease. The TaqMan assay developed is able to quantify HIV viral load based on a novel conserved region of HIV-1 pol gene which has minimal sequence inconsistency.

  9. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  10. A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

    PubMed

    Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

    2018-01-01

    One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

  11. EVALUATION OF QUANTITATIVE REAL TIME PCR FOR THE MEASUREMENT OF HELICOBATER PYLORI AT LOW CONCENTRATIONS IN DRINKING WATER

    EPA Science Inventory

    Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.

    Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...

  12. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  13. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    PubMed Central

    Dinoop, K.P.; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R.P.; Narayanan, P.

    2016-01-01

    Background & objectives: Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Methods: Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. Results: In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated (P<0.0001). The nested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods. PMID:26997014

  14. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

  15. Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases

    PubMed Central

    Su, Yan; Guengerich, F. Peter

    2016-01-01

    Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785

  16. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  17. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    PubMed Central

    2010-01-01

    Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

  18. Evaluation of TaqMan qPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay

    PubMed Central

    Nagy, Alexander; Vitásková, Eliška; Černíková, Lenka; Křivda, Vlastimil; Jiřincová, Helena; Sedlák, Kamil; Horníčková, Jitka; Havlíčková, Martina

    2017-01-01

    Ongoing evolution of viral pathogens is a significant issue in diagnostic virology employing TaqMan qPCR/RT-qPCR. Specific concerns are related to false negativity due to probe binding failure. One option for compensating for such deficiency is to integrate a second identically labelled probe in the assay. However, how this alteration influences the reaction parameters has not been comprehensively demonstrated. In the present study, we evaluate a TaqMan protocol using two identically labelled hydrolysis probes (simple, LNA (locked-nucleic-acid)) and MGB (minor-groove-binder) modified probes and combinations thereof in a single assay. Our results based on a synthetic amplicon suggest that the second probe does not compromise the TaqMan qPCR/RT-qPCR parameters, which repeatedly and reproducibly remained comparable to those of the corresponding single-probe assays, irrespective of the relative probe orientation, whether opposite or tandem, and probe modifications or combinations thereof. On the other hand, the second probe additively contributed to the overall fluorescence signal. The utility of the dual-probe approach was demonstrated on practical examples by using field specimens. We hope that the present study might serve as a theoretical basis for the development or improvement of TaqMan qPCR/RT-qPCR assays for the detection of highly variable nucleic acid templates. PMID:28120891

  19. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  20. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  1. HSP90 and its R2TP/Prefoldin-like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II.

    PubMed

    Boulon, Séverine; Pradet-Balade, Bérengère; Verheggen, Céline; Molle, Dorothée; Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I; Bertrand, Edouard

    2010-09-24

    RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. HSP90 and Its R2TP/Prefoldin-like Cochaperone Are Involved in the Cytoplasmic Assembly of RNA Polymerase II

    PubMed Central

    Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I.; Bertrand, Edouard

    2015-01-01

    SUMMARY RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. PMID:20864038

  3. Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

    PubMed

    Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

    2016-11-01

    Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  4. EQUAL-quant: an international external quality assessment scheme for real-time PCR.

    PubMed

    Ramsden, Simon C; Daly, Sarah; Geilenkeuser, Wolf-Jochen; Duncan, Graeme; Hermitte, Fabienne; Marubini, Ettore; Neumaier, Michael; Orlando, Claudio; Palicka, Vladimir; Paradiso, Angelo; Pazzagli, Mario; Pizzamiglio, Sara; Verderio, Paolo

    2006-08-01

    Quantitative gene expression analysis by real-time PCR is important in several diagnostic areas, such as the detection of minimum residual disease in leukemia and the prognostic assessment of cancer patients. To address quality assurance in this technically challenging area, the European Union (EU) has funded the EQUAL project to develop methodologic external quality assessment (EQA) relevant to diagnostic and research laboratories among the EU member states. We report here the results of the EQUAL-quant program, which assesses standards in the use of TaqMan probes, one of the most widely used assays in the implementation of real-time PCR. The EQUAL-quant reagent set was developed to assess the technical execution of a standard TaqMan assay, including RNA extraction, reverse transcription, and real-time PCR quantification of target DNA copy number. The multidisciplinary EQA scheme included 137 participating laboratories from 29 countries. We demonstrated significant differences in performance among laboratories, with 20% of laboratories reporting at least one result lacking in precision and/or accuracy according to the statistical procedures described. No differences in performance were observed for the >10 different testing platforms used by the study participants. This EQA scheme demonstrated both the requirement and demand for external assessment of technical standards in real-time PCR. The reagent design and the statistical tools developed within this project will provide a benchmark for defining acceptable working standards in this emerging technology.

  5. New approaches for the standardization and validation of a real-time qPCR assay using TaqMan probes for quantification of yellow fever virus on clinical samples with high quality parameters

    PubMed Central

    Fernandes-Monteiro, Alice G; Trindade, Gisela F; Yamamura, Anna MY; Moreira, Otacilio C; de Paula, Vanessa S; Duarte, Ana Cláudia M; Britto, Constança; Lima, Sheila Maria B

    2015-01-01

    The development and production of viral vaccines, in general, involve several steps that need the monitoring of viral load throughout the entire process. Applying a 2-step quantitative reverse transcription real time PCR assay (RT-qPCR), viral load can be measured and monitored in a few hours. In this context, the development, standardization and validation of a RT-qPCR test to quickly and efficiently quantify yellow fever virus (YFV) in all stages of vaccine production are extremely important. To serve this purpose we used a plasmid construction containing the NS5 region from 17DD YFV to generate the standard curve and to evaluate parameters such as linearity, precision and specificity against other flavivirus. Furthermore, we defined the limits of detection as 25 copies/reaction, and quantification as 100 copies/reaction for the test. To ensure the quality of the method, reference controls were established in order to avoid false negative results. The qRT-PCR technique based on the use of TaqMan probes herein standardized proved to be effective for determining yellow fever viral load both in vivo and in vitro, thus becoming a very important tool to assure the quality control for vaccine production and evaluation of viremia after vaccination or YF disease. PMID:26011746

  6. New approaches for the standardization and validation of a real-time qPCR assay using TaqMan probes for quantification of yellow fever virus on clinical samples with high quality parameters.

    PubMed

    Fernandes-Monteiro, Alice G; Trindade, Gisela F; Yamamura, Anna M Y; Moreira, Otacilio C; de Paula, Vanessa S; Duarte, Ana Cláudia M; Britto, Constança; Lima, Sheila Maria B

    2015-01-01

    The development and production of viral vaccines, in general, involve several steps that need the monitoring of viral load throughout the entire process. Applying a 2-step quantitative reverse transcription real time PCR assay (RT-qPCR), viral load can be measured and monitored in a few hours. In this context, the development, standardization and validation of a RT-qPCR test to quickly and efficiently quantify yellow fever virus (YFV) in all stages of vaccine production are extremely important. To serve this purpose we used a plasmid construction containing the NS5 region from 17DD YFV to generate the standard curve and to evaluate parameters such as linearity, precision and specificity against other flavivirus. Furthermore, we defined the limits of detection as 25 copies/reaction, and quantification as 100 copies/reaction for the test. To ensure the quality of the method, reference controls were established in order to avoid false negative results. The qRT-PCR technique based on the use of TaqMan probes herein standardized proved to be effective for determining yellow fever viral load both in vivo and in vitro, thus becoming a very important tool to assure the quality control for vaccine production and evaluation of viremia after vaccination or YF disease.

  7. Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR.

    PubMed

    Liu, Ya-Mei; Qiu, Liang; Sheng, An-Zhi; Wan, Xiao-Yuan; Cheng, Dong-Yuan; Huang, Jie

    2018-01-01

    A TaqMan probe and a pair of specific primers were selected from the small subunit ribosomal DNA (SSU rDNA) sequence of Enterocytozoon hepatopenaei (EHP); this real-time PCR assay was developed and optimized. It showed a good linearity in detecting standards of EHP SSU rDNA fragments from 4 × 10 2 to 4 × 10 8 copies/reaction using the established method. The detection limit of the qPCR method was as low as 4 × 10 1 copies per reaction, which was higher than the conventional PCR and SYBR Green I-based EHP qPCR reported. Using the qPCR assay, EHP was detected in four batches of slow-growing Penaeus vannamei specimens collected from Tianjin and Zhejiang Province in China was detected using qPCR. The results showed that all the hepatopancreas from the slow-growing P. vannamei specimens were detected as EHP-positive. EHP copies of hepatopancreas in some batches had a negative correlation with the body mass index (BMI) of shrimps; however, not all batches of specimens had this negative correlation between EHP copies of hepatopancreas and BMI. This qPCR technique is sensitive, specific and easy to perform (96 tests in <3 h), which provides technical support for the detection and prevention of EHP. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Q-PCR based bioburden assessment of drinking water throughout treatment and delivery to the International Space Station

    NASA Technical Reports Server (NTRS)

    Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri

    2005-01-01

    Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.

  9. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    PubMed

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance.

  10. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance. PMID:27380028

  11. [Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

    PubMed

    Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

    2017-07-28

    To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).
 Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.
 Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.
 Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.

  12. A pilot evaluation of whole blood finger-prick sampling for point-of-care HIV viral load measurement: the UNICORN study.

    PubMed

    Fidler, Sarah; Lewis, Heather; Meyerowitz, Jodi; Kuldanek, Kristin; Thornhill, John; Muir, David; Bonnissent, Alice; Timson, Georgina; Frater, John

    2017-10-20

    There is a global need for HIV viral load point-of-care (PoC) assays to monitor patients receiving antiretroviral therapy. UNICORN was the first study of an off-label protocol using whole blood finger-prick samples tested with and without a simple three minute spin using a clinic-room microcentrifuge. Two PoC assays were evaluated in 40 HIV-positive participants, 20 with detectable and 20 with undetectable plasma viral load (pVL) (<20 copies/ml). Using 100 µl finger-prick blood samples, the Cepheid Xpert HIV-1 Viral Load and HIV-1 Qual cartridges were compared with laboratory pVL assessment (TaqMan, Roche). For participants with undetectable viraemia by TaqMan, there was poor concordance without centrifugation with the TaqMan platform with only 40% 'undetectable' using Xpert VL and 25% 'not detected' using the Qual assay. After a 3 minute spin, 100% of samples were undetectable using either assay, showing full concordance with the TaqMan assay. Defining a lower limit of detection of 1000 copies/ml when including a spin, there was 100% concordance with the TaqMan platform with strong correlation (rho 0.95 and 0.94; p < 0.0001 for both assays). When including a simple microcentrifugation step, finger-prick PoC testing was a quick and accurate approach for assessing HIV viraemia, with excellent concordance with validated laboratory approaches.

  13. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    PubMed

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  14. Comparison of allelic discrimination by dHPLC, HRM, and TaqMan in the detection of BRAF mutation V600E.

    PubMed

    Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo

    2011-09-01

    The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  15. New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

    EPA Science Inventory

    Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

  16. Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

    PubMed

    Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2016-09-01

    Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  18. Recurrent high level parvovirus B19/genotype 2 viremia in a renal transplant recipient analyzed by real-time PCR for simultaneous detection of genotypes 1 to 3.

    PubMed

    Liefeldt, Lutz; Plentz, Annelie; Klempa, Boris; Kershaw, Olivia; Endres, Anne-Sophie; Raab, Ulla; Neumayer, Hans-H; Meisel, Helga; Modrow, Susanne

    2005-01-01

    Organ transplant recipients infected with parvovirus B19 frequently develop persistent viremia associated with chronic anemia and pure red cell aplasia. In this study, a male renal transplant recipient who had been infected with parvovirus B19/genotype 2 after renal transplantation at the age of 34 years is described. The patient was repeatedly treated with high dose intravenous immunoglobulin (IVIG) that resulted in the resolvement of symptoms but not in virus eradication. During an observation period of 33 months after transplantation three phases associated with high parvovirus B19 viremia were observed. Both the first and the second viremic phases were combined with severe anemia. Parvovirus B19 specific IgM-antibodies were initially detected at the beginning of the second phase in continually rising concentrations. Initially eradication of the virus by immunoglobulin therapy was reported after the first viremic phase [Liefeldt et al. (2002): Nephrol Dial Transplant 17:1840-1842]. Retrospectively this statement has to be corrected. It was based on the use of a qualitative PCR assay specific for parvovirus B19 genotype 1 associated with reduced sensitivity for detection of genotype 2. After sequence analysis of the viral DNA and adjustment of a real-time PCR assay (TaqMan) for quantitative detection of all three B19 virus genotypes analysis of consecutive serum samples allowed the demonstration of long lasting phases with reduced viral loads following IVIG-treatment. These results demonstrate that IVIG treatment of parvovirus B19-triggered anemia in transplant recipients offers an opportunity to resolve symptoms, but does not guarantee eradication of the virus. Since reactivation of parvovirus B19 infection can result in high virus load associated with the recurrence of symptoms repeated screening for viral DNA is recommended using the TaqMan system established for quantitative detection of all three genotypes of parvovirus B19. Copyright 2005 Wiley-Liss, Inc.

  19. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  20. Real-time PCR to determine transgene copy number and to quantitate the biolocalization of adoptively transferred cells from EGFP-transgenic mice.

    PubMed

    Joshi, Molishree; Keith Pittman, H; Haisch, Carl; Verbanac, Kathryn

    2008-09-01

    Quantitative real-time PCR (qPCR) is a sensitive technique for the detection and quantitation of specific DNA sequences. Here we describe a Taqman qPCR assay for quantification of tissue-localized, adoptively transferred enhanced green fluorescent protein (EGFP)-transgenic cells. A standard curve constructed from serial dilutions of a plasmid containing the EGFP transgene was (i) highly reproducible, (ii) detected as few as two copies, and (iii) was included in each qPCR assay. qPCR analysis of genomic DNA was used to determine transgene copy number in several mouse strains. Fluorescent microscopy of tissue sections showed that adoptively transferred vascular endothelial cells (VEC) from EGFP-transgenic mice specifically localized to tissue with metastatic tumors in syngeneic recipients. VEC microscopic enumeration of liver metastases strongly correlated with qPCR analysis of identical sections (Pearson correlation 0.81). EGFP was undetectable in tissue from control mice by qPCR. In another study using intra-tumor EGFP-VEC delivery to subcutaneous tumors, manual cell count and qPCR analysis of alternating sections also strongly correlated (Pearson correlation 0.82). Confocal microscopy of the subcutaneous tumor sections determined that visual fluorescent signals were frequently tissue artifacts. This qPCR methodology offers specific, objective, and rapid quantitation, uncomplicated by tissue autofluorescence, and should be readily transferable to other in vivo models to quantitate the biolocalization of transplanted cells.

  1. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  2. NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

    EPA Science Inventory

    Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

  3. MONITORING ASPERGILLUS SPECIES BY QUANTITATIVE PCR DURING CONSTRUCTION OF A MULTI-STORY HOSPITAL BUILDING

    EPA Science Inventory

    Noscomial fungal infections represent a persistent threat in hospitals. One of the major issues in fungal control has been monitoring these fungi in a timely manner. Quantitative polymerase chain reaction (QPCR) allows for the rapid (2 to 4 h), sensitive (often down to a single...

  4. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  5. Association of adiponectin gene polymorphism (+T45G) with acute coronary syndrome and circulating adiponectin levels.

    PubMed

    Rizk, Nasser M; El-Menyar, Ayman; Marei, Isra; Sameer, Maha; Musad, Tasneem; Younis, Dima; Farag, Fathi; Basem, Nora; Al-Ali, Khalid; Al Suwaidi, Jassim

    2013-05-01

    We investigated the association of adiponectin gene polymorphisms (+T45G and +G276T) and adiponectin levels with acute coronary syndrome (ACS) among Arabs in Qatar. A case-control study was performed in 142 Arab patients with ACS and 122 controls. Genotypes were determined using TaqMan real-time polymerase chain reaction assay. The TT, TG, and GG genotype frequencies of the T45G variant were significantly different among cases and controls (P = .023) but not significant for G276T genotypic frequencies. It was found that only the +45G allele was significantly associated with 3-fold increased risk of ACS (odds ratio = 2.77; 1.03-6.96; P = .043) among patients, using the genetic recessive model. Carriers of GG alleles had significantly lower adiponectin levels compared to TT/TG carriers of T45G in patients with ACS. The present study suggests that only T45G single-nucleotide polymorphism in the adiponectin gene is associated with higher odds for ACS events and has an effect on serum adiponectin levels among Arab populations.

  6. Real-time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan.

    PubMed

    Mano, Junichi; Shigemitsu, Natsuki; Futo, Satoshi; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Furui, Satoshi; Kitta, Kazumi

    2009-01-14

    We developed a novel type of real-time polymerase chain reaction (PCR) array with TaqMan chemistry as a platform for the comprehensive and semiquantitative detection of genetically modified (GM) crops. Thirty primer-probe sets for the specific detection of GM lines, recombinant DNA (r-DNA) segments, endogenous reference genes, and donor organisms were synthesized, and a 96-well PCR plate was prepared with a different primer-probe in each well as the real-time PCR array. The specificity and sensitivity of the array were evaluated. A comparative analysis with the data and publicly available information on GM crops approved in Japan allowed us to assume the possibility of unapproved GM crop contamination. Furthermore, we designed a Microsoft Excel spreadsheet application, Unapproved GMO Checker version 2.01, which helps process all the data of real-time PCR arrays for the easy assumption of unapproved GM crop contamination. The spreadsheet is available free of charge at http://cse.naro.affrc.go.jp/jmano/index.html .

  7. Rapid Laboratory Identification of Neisseria meningitidis Serogroup C as the Cause of an Outbreak - Liberia, 2017.

    PubMed

    Patel, Jaymin C; George, Josiah; Vuong, Jeni; Potts, Caelin C; Bozio, Catherine; Clark, Thomas A; Thomas, Jerry; Schier, Joshua; Chang, Arthur; Waller, Jessica L; Diaz, Maureen H; Whaley, Melissa; Jenkins, Laurel T; Fuller, Serena; Williams, Desmond E; Redd, John T; Arthur, Ray R; Taweh, Fahn; Vera Walker, Yatta; Hardy, Patrick; Freeman, Maxwell; Katawera, Victoria; Gwesa, Gulu; Gbanya, Miatta Z; Clement, Peter; Kohar, Henry; Stone, Mardia; Fallah, Mosoka; Nyenswah, Tolbert; Winchell, Jonas M; Wang, Xin; McNamara, Lucy A; Dokubo, E Kainne; Fox, LeAnne M

    2017-10-27

    On April 25, 2017, a cluster of unexplained illness and deaths among persons who had attended a funeral during April 21-22 was reported in Sinoe County, Liberia (1). Using a broad initial case definition, 31 cases were identified, including 13 (42%) deaths. Twenty-seven cases were from Sinoe County (1), and two cases each were from Grand Bassa and Monsterrado counties, respectively. On May 5, 2017, initial multipathogen testing of specimens from four fatal cases using the Taqman Array Card (TAC) assay identified Neisseria meningitidis in all specimens. Subsequent testing using direct real-time polymerase chain reaction (PCR) confirmed N. meningitidis in 14 (58%) of 24 patients with available specimens and identified N. meningitidis serogroup C (NmC) in 13 (54%) patients. N. meningitidis was detected in specimens from 11 of the 13 patients who died; no specimens were available from the other two fatal cases. On May 16, 2017, the National Public Health Institute of Liberia and the Ministry of Health of Liberia issued a press release confirming serogroup C meningococcal disease as the cause of this outbreak in Liberia.

  8. TaqMan Real-Time PCR Assays To Assess Arbuscular Mycorrhizal Responses to Field Manipulation of Grassland Biodiversity: Effects of Soil Characteristics, Plant Species Richness, and Functional Traits▿ †

    PubMed Central

    König, Stephan; Wubet, Tesfaye; Dormann, Carsten F.; Hempel, Stefan; Renker, Carsten; Buscot, François

    2010-01-01

    Large-scale (temporal and/or spatial) molecular investigations of the diversity and distribution of arbuscular mycorrhizal fungi (AMF) require considerable sampling efforts and high-throughput analysis. To facilitate such efforts, we have developed a TaqMan real-time PCR assay to detect and identify AMF in environmental samples. First, we screened the diversity in clone libraries, generated by nested PCR, of the nuclear ribosomal DNA internal transcribed spacer (ITS) of AMF in environmental samples. We then generated probes and forward primers based on the detected sequences, enabling AMF sequence type-specific detection in TaqMan multiplex real-time PCR assays. In comparisons to conventional clone library screening and Sanger sequencing, the TaqMan assay approach provided similar accuracy but higher sensitivity with cost and time savings. The TaqMan assays were applied to analyze the AMF community composition within plots of a large-scale plant biodiversity manipulation experiment, the Jena Experiment, primarily designed to investigate the interactive effects of plant biodiversity on element cycling and trophic interactions. The results show that environmental variables hierarchically shape AMF communities and that the sequence type spectrum is strongly affected by previous land use and disturbance, which appears to favor disturbance-tolerant members of the genus Glomus. The AMF species richness of disturbance-associated communities can be largely explained by richness of plant species and plant functional groups, while plant productivity and soil parameters appear to have only weak effects on the AMF community. PMID:20418424

  9. The cobas p 630 instrument: a dedicated pre-analytic solution to optimize COBAS® AmpliPrep/COBAS® TaqMan® system workflow and turn-around-time.

    PubMed

    Vallefuoco, L; Sorrentino, R; Spalletti Cernia, D; Colucci, G; Portella, G

    2012-12-01

    The cobas p 630, a fully automated pre-analytical instrument for primary tube handling recently introduced to complete the Cobas(®) TaqMan systems portfolio, was evaluated in conjunction with: the COBAS(®) AmpliPrep/COBAS(®) TaqMan HBV Test, v2.0, COBAS(®) AmpliPrep/COBAS(®) TaqMan HCV Test, v1.0 and COBAS(®) AmpliPrep/COBAS(®) TaqMan HIV Test, v2.0. The instrument performance in transferring samples from primary to secondary tubes, its impact in improving COBAS(®) AmpliPrep/COBAS(®) TaqMan workflow and hands-on reduction and the risk of possible cross-contamination were assessed. Samples from 42 HBsAg positive, 42 HCV and 42 HIV antibody (Ab) positive patients as well as 21 healthy blood donors were processed with or without automated primary tubes. HIV, HCV and HBsAg positive samples showed a correlation index of 0.999, 0.987 and of 0.994, respectively. To assess for cross-contamination, high titer HBV DNA positive samples, HCV RNA and HIV RNA positive samples were distributed in the cobas p 630 in alternate tube positions, adjacent to negative control samples within the same rack. None of the healthy donor samples showed any reactivity. Based on these results, the cobas p 630 can improve workflow and sample tracing in laboratories performing molecular tests, and reduce turnaround time, errors, and risks. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Rapid and Reliable Genotyping of HLA-B*57:01 in Four Chinese Populations Using a Single-Tube Duplex Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan

    2017-07-01

    HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.

  11. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  12. The Influence of Genetic and Environmental Factors among MDMA Users in Cognitive Performance

    PubMed Central

    Cuyàs, Elisabet; Verdejo-García, Antonio; Fagundo, Ana Beatriz; Khymenets, Olha; Rodríguez, Joan; Cuenca, Aida; de Sola Llopis, Susana; Langohr, Klaus; Peña-Casanova, Jordi; Torrens, Marta; Martín-Santos, Rocío; Farré, Magí; de la Torre, Rafael

    2011-01-01

    This study is aimed to clarify the association between MDMA cumulative use and cognitive dysfunction, and the potential role of candidate genetic polymorphisms in explaining individual differences in the cognitive effects of MDMA. Gene polymorphisms related to reduced serotonin function, poor competency of executive control and memory consolidation systems, and high enzymatic activity linked to bioactivation of MDMA to neurotoxic metabolites may contribute to explain variations in the cognitive impact of MDMA across regular users of this drug. Sixty ecstasy polydrug users, 110 cannabis users and 93 non-drug users were assessed using cognitive measures of Verbal Memory (California Verbal Learning Test, CVLT), Visual Memory (Rey-Osterrieth Complex Figure Test, ROCFT), Semantic Fluency, and Perceptual Attention (Symbol Digit Modalities Test, SDMT). Participants were also genotyped for polymorphisms within the 5HTT, 5HTR2A, COMT, CYP2D6, BDNF, and GRIN2B genes using polymerase chain reaction and TaqMan polymerase assays. Lifetime cumulative MDMA use was significantly associated with poorer performance on visuospatial memory and perceptual attention. Heavy MDMA users (>100 tablets lifetime use) interacted with candidate gene polymorphisms in explaining individual differences in cognitive performance between MDMA users and controls. MDMA users carrying COMT val/val and SERT s/s had poorer performance than paired controls on visuospatial attention and memory, and MDMA users with CYP2D6 ultra-rapid metabolizers performed worse than controls on semantic fluency. Both MDMA lifetime use and gene-related individual differences influence cognitive dysfunction in ecstasy users. PMID:22110616

  13. Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.

    PubMed

    Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A

    2008-04-01

    To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.

  14. Simultaneous detection and differentiation of three Potyviridae viruses by a multiplex TaqMan real time RT-PCR assay

    USDA-ARS?s Scientific Manuscript database

    A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay w...

  15. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    PubMed

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  16. Quantitative analysis of pork and chicken products by droplet digital PCR.

    PubMed

    Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

    2014-01-01

    In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

  17. Human-Associated Bacteroides spp. and Human Polyomaviruses as Microbial Source Tracking Markers in Hawaii

    PubMed Central

    Caffaro-Filho, Roberto A.; Wong, Mayee; Harwood, Valerie J.; Moravcik, Philip; Fujioka, Roger S.

    2016-01-01

    ABSTRACT Identification of sources of fecal contaminants is needed to (i) determine the health risk associated with recreational water use and (ii) implement appropriate management practices to mitigate this risk and protect the environment. This study evaluated human-associated Bacteroides spp. (HF183TaqMan) and human polyomavirus (HPyV) markers for host sensitivity and specificity using human and animal fecal samples collected in Hawaii. The decay rates of those markers and indicator bacteria were identified in marine and freshwater microcosms exposed and not exposed to sunlight, followed by field testing of the usability of the molecular markers. Both markers were strongly associated with sewage, although the cross-reactivity of the HF183TaqMan (also present in 82% of canine [n = 11], 30% of mongoose [n = 10], and 10% of feline [n = 10] samples) needs to be considered. Concentrations of HF183TaqMan in human fecal samples exceeded those in cross-reactive animals at least 1,000-fold. In the absence of sunlight, the decay rates of both markers were comparable to the die-off rates of enterococci in experimental freshwater and marine water microcosms. However, in sunlight, the decay rates of both markers were significantly lower than the decay rate of enterococci. While both markers have their individual limitations in terms of sensitivity and specificity, these limitations can be mitigated by using both markers simultaneously; ergo, this study supports the concurrent use of HF183TaqMan and HPyV markers for the detection of sewage contamination in coastal and inland waters in Hawaii. IMPORTANCE This study represents an in-depth characterization of microbial source tracking (MST) markers in Hawaii. The distribution and concentrations of HF183TaqMan and HPyV markers in human and animal fecal samples and in wastewater, coupled with decay data obtained from sunlight-exposed and unexposed microcosms, support the concurrent application of HF183TaqMan and HPyV markers for sewage contamination detection in Hawaii waters. Both markers are more conservative and more specific markers of sewage than fecal indicator bacteria (enterococci and Escherichia coli). Analysis of HF183TaqMan (or newer derivatives) is recommended for inclusion in future epidemiological studies concerned with beach water quality, while better concentration techniques are needed for HPyV. Such epidemiological studies can be used to develop new recreational water quality criteria, which will provide direct information on the absence or presence of sewage contamination in water samples as well as reliable measurements of the risk of waterborne disease transmission to swimmers. PMID:27613686

  18. Comprehensive Multiplex One-Step Real-Time TaqMan qRT-PCR Assays for Detection and Quantification of Hemorrhagic Fever Viruses

    PubMed Central

    Li, Jiandong; Qu, Jing; He, Chengcheng; Zhang, Shuo; Li, Chuan; Zhang, Quanfu; Liang, Mifang; Li, Dexin

    2014-01-01

    Background Viral hemorrhagic fevers (VHFs) are a group of animal and human illnesses that are mostly caused by several distinct families of viruses including bunyaviruses, flaviviruses, filoviruses and arenaviruses. Although specific signs and symptoms vary by the type of VHF, initial signs and symptoms are very similar. Therefore rapid immunologic and molecular tools for differential diagnosis of hemorrhagic fever viruses (HFVs) are important for effective case management and control of the spread of VHFs. Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assay is one of the reliable and desirable methods for specific detection and quantification of virus load. Multiplex PCR assay has the potential to produce considerable savings in time and resources in the laboratory detection. Results Primers/probe sets were designed based on appropriate specific genes for each of 28 HFVs which nearly covered all the HFVs, and identified with good specificity and sensitivity using monoplex assays. Seven groups of multiplex one-step real-time qRT-PCR assays in a universal experimental system were then developed by combining all primers/probe sets into 4-plex reactions and evaluated with serial dilutions of synthesized viral RNAs. For all the multiplex assays, no cross-reactivity with other HFVs was observed, and the limits of detection were mainly between 45 and 150 copies/PCR. The reproducibility was satisfactory, since the coefficient of variation of Ct values were all less than 5% in each dilution of synthesized viral RNAs for both intra-assays and inter-assays. Evaluation of the method with available clinical serum samples collected from HFRS patients, SFTS patients and Dengue fever patients showed high sensitivity and specificity of the related multiplex assays on the clinical specimens. Conclusions Overall, the comprehensive multiplex one-step real-time qRT-PCR assays were established in this study, and proved to be specific, sensitive, stable and easy to serve as a useful tool for rapid detection of HFVs. PMID:24752452

  19. Temporal Occurrence and Niche Preferences of Phytophthora spp. Causing Brown Rot of Citrus in the Central Valley of California.

    PubMed

    Hao, Wei; Miles, Timothy D; Martin, Frank N; Browne, Gregory T; Förster, Helga; Adaskaveg, James E

    2018-03-01

    Brown rot of citrus fruit is caused by several species of Phytophthora and is currently of serious concern for the California citrus industry. Two species, Phytophthora syringae and P. hibernalis, are quarantine pathogens in China, a major export market for California citrus. To maintain trade and estimate the risk of exporting a quarantine pathogen, the distribution and frequency of Phytophthora spp. causing brown rot of orange in major growing areas of California was investigated. Symptomatic fruit were collected from navel (winter to late spring) and Valencia (late spring to summer) orange orchards from 2013 to 2015. Species identification of isolates was based on morphological characteristics, random amplified polymorphic DNA banding patterns, and sequencing of the internal transcribed spacer and the partial cox2/spacer/cox1 regions from axenic cultures, or directly on DNA from fruit tissue using a multiplex TaqMan quantitative polymerase chain reaction assay. In winter samplings, the incidence of P. syringae based on the number of fruit with Phytophthora spp. detection ranged from 73.6 to 96.1% for the two counties surveyed. The remaining isolates were identified as P. citrophthora. In late spring or summer, only P. citrophthora was recovered. P. hibernalis and P. nicotianae were not detected in any fruit with brown rot symptoms. These results indicate that P. syringae is currently an important brown rot pathogen of citrus fruit in California during the cooler seasons of the year. In winter 2016 and 2017, P. syringae was recovered by pear baiting at a high incidence from leaf litter and from a small number of rhizosphere soil or root samples but not from living leaves on the tree. In contrast, P. citrophthora was rarely found in leaf litter but was commonly detected in the rhizosphere. Thus, leaf litter is a major inoculum source for P. syringae and this species occupies a distinct ecological niche.

  20. Polymorphisms in arsenic(+III oxidation state) methyltransferase (AS3MT) predict gene expression of AS3MT as well as arsenic metabolism.

    PubMed

    Engström, Karin; Vahter, Marie; Mlakar, Simona Jurkovic; Concha, Gabriela; Nermell, Barbro; Raqib, Rubhana; Cardozo, Alejandro; Broberg, Karin

    2011-02-01

    Arsenic (As) occurs as monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA) in humans, and the methylation pattern demonstrates large interindividual differences. The fraction of urinary MMA is a marker for susceptibility to As-related diseases. We evaluated the impact of polymorphisms in five methyltransferase genes on As metabolism in two populations, one in South America and one in Southeast Asia. The methyltransferase genes were arsenic(+III oxidation state) methyltransferase (AS3MT), DNA-methyltransferase 1a and 3b (DNMT1a and DNMT3b, respectively), phosphatidylethanolamine N-methyltransferase (PEMT), and betaine-homocysteine methyltransferase (BHMT). AS3MT expression was analyzed in peripheral blood. Subjects were women exposed to As in drinking water in the Argentinean Andes [n = 172; median total urinary As (U-As), 200 µg/L] and in rural Bangladesh (n = 361; U-As, 100 µg/L; all in early pregnancy). Urinary As metabolites were measured by high-pressure liquid chromatography/inductively coupled plasma mass spectrometry. Polymorphisms (n = 22) were genotyped with Sequenom, and AS3MT expression was measured by quantitative real-time polymerase chain reaction using TaqMan expression assays. Six AS3MT polymorphisms were significantly associated with As metabolite patterns in both populations (p ≤ 0.01). The most frequent AS3MT haplotype in Bangladesh was associated with a higher percentage of MMA (%MMA), and the most frequent haplotype in Argentina was associated with a lower %MMA and a higher percentage of DMA. Four polymorphisms in the DNMT genes were associated with metabolite patterns in Bangladesh. Noncoding AS3MT polymorphisms affected gene expression of AS3MT in peripheral blood, demonstrating that one functional impact of AS3MT polymorphisms may be altered levels of gene expression. Polymorphisms in AS3MT significantly predicted As metabolism across these two very different populations, suggesting that AS3MT may have an impact on As metabolite patterns in populations worldwide.

  1. Spermatozoa from patients with seminal alterations exhibit a differential micro-ribonucleic acid profile.

    PubMed

    Salas-Huetos, Albert; Blanco, Joan; Vidal, Francesca; Godo, Anna; Grossmann, Mark; Pons, Maria Carme; F-Fernández, Silvia; Garrido, Nicolás; Anton, Ester

    2015-09-01

    To compare the microRNA (miRNA) expression profile in spermatozoa from three infertile populations vs. a group of fertile men. Evaluation of the expression level of 736 miRNAs in human spermatozoa using TaqMan quantitative reverse transcription-polymerase chain reaction. University research facility. Semen samples with a single seminal alteration were collected from infertile individuals: asthenozoospermic (n = 10), teratozoospermic (n = 10), and oligozoospermic (n = 10). None. Correlation of the expression level of each miRNA with seminal parameters, age, and chromosome instability; clustering of the individuals according to their miRNA expression profiles and influence of the seminogram, age, chromosome instability, and assisted reproductive technology outcome in the clustering; analysis of the differentially expressed miRNAs (DE-miRNAs) in each infertile population; genome annotation of these DE-miRNAs; and ontological analysis of their predicted targets. The hsa-miR-34b-3p correlated with age, the hsa-miR-629-3p with sperm motility, and the hsa-miR-335-5p, hsa-miR-885-5p, and hsa-miR-152-3p with sperm concentration. The individuals clustered into two groups, and only the seminogram was differentially distributed. We identified 32 DE-miRNAs in the asthenozoospermic group, 19 in the teratozoospermic group, and 18 in the oligozoospermic group. The up-regulated miRNAs presented an enriched localization in introns, affecting relevant genes for spermatogenesis. The predicted targets of the DE-miRNAs contained critical genes associated to infertility, and their ontological analysis revealed significantly associated functions related to the seminal alterations of each group. Spermatozoa from patients with seminal alterations exhibit a differential miRNA profile. This provides new evidence that miRNAs have an essential role in spermatogenesis, contributing to the mechanisms involved in human fertility. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  2. Uncovering Small RNA-Mediated Responses to Cold Stress in a Wheat Thermosensitive Genic Male-Sterile Line by Deep Sequencing1[W][OA

    PubMed Central

    Tang, Zhonghui; Zhang, Liping; Xu, Chenguang; Yuan, Shaohua; Zhang, Fengting; Zheng, Yonglian; Zhao, Changping

    2012-01-01

    The male sterility of thermosensitive genic male sterile (TGMS) lines of wheat (Triticum aestivum) is strictly controlled by temperature. The early phase of anther development is especially susceptible to cold stress. MicroRNAs (miRNAs) play an important role in plant development and in responses to environmental stress. In this study, deep sequencing of small RNA (smRNA) libraries obtained from spike tissues of the TGMS line under cold and control conditions identified a total of 78 unique miRNA sequences from 30 families and trans-acting small interfering RNAs (tasiRNAs) derived from two TAS3 genes. To identify smRNA targets in the wheat TGMS line, we applied the degradome sequencing method, which globally and directly identifies the remnants of smRNA-directed target cleavage. We identified 26 targets of 16 miRNA families and three targets of tasiRNAs. Comparing smRNA sequencing data sets and TaqMan quantitative polymerase chain reaction results, we identified six miRNAs and one tasiRNA (tasiRNA-ARF [for Auxin-Responsive Factor]) as cold stress-responsive smRNAs in spike tissues of the TGMS line. We also determined the expression profiles of target genes that encode transcription factors in response to cold stress. Interestingly, the expression of cold stress-responsive smRNAs integrated in the auxin-signaling pathway and their target genes was largely noncorrelated. We investigated the tissue-specific expression of smRNAs using a tissue microarray approach. Our data indicated that miR167 and tasiRNA-ARF play roles in regulating the auxin-signaling pathway and possibly in the developmental response to cold stress. These data provide evidence that smRNA regulatory pathways are linked with male sterility in the TGMS line during cold stress. PMID:22508932

  3. Clinical relevance of molecular identification of microorganisms and detection of antimicrobial resistance genes in bloodstream infections of paediatric cancer patients.

    PubMed

    Carlesse, Fabianne; Cappellano, Paola; Quiles, Milene Gonçalves; Menezes, Liana Carballo; Petrilli, Antonio Sérgio; Pignatari, Antonio Carlos

    2016-09-01

    Bloodstream infections (BSIs) are the major cause of mortality in cancer patients. Molecular techniques are used for rapid diagnosis of BSI, allowing early therapy and improving survival. We aimed to establish whether real-time quantitative polymerase chain reaction (qPCR) could improve early diagnosis and therapy in paediatric cancer patients, and describe the predominant pathogens of BSI and their antimicrobial susceptibility. Blood samples were processed by the BACTEC system and microbial identification and susceptibility tests were performed by the Phoenix system. All samples were screened by multiplex 16 s rDNA qPCR. Seventeen species were evaluated using sex-specific TaqMan probes and resistance genes blaSHV, blaTEM, blaCTX, blaKPC, blaIMP, blaSPM, blaVIM, vanA, vanB and mecA were screened by SYBR Green reactions. Therapeutic efficacy was evaluated at the time of positive blood culture and at final phenotypic identification and antimicrobial susceptibility results. We analyzed 69 episodes of BSI from 64 patients. Gram-positive bacteria were identified in 61 % of the samples, Gram-negative bacteria in 32 % and fungi in 7 %. There was 78.2 % of agreement between the phenotypic and molecular methods in final species identification. The mecA gene was detected in 81.4 % of Staphylococcus spp., and 91.6 % were concordant with the phenotypic method. Detection of vanA gene was 100 % concordant. The concordance for Gram-negative susceptibilities was 71.4 % for Enterobacteriaceae and 50 % for Pseudomonas aeruginosa. Therapy was more frequently inadequate in patients who died, and the molecular test was concordant with the phenotypic susceptibility test in 50 %. qPCR has potential indication for early identification of pathogens and antimicrobial resistance genes from BSI in paediatric cancer patients and may improve antimicrobial therapy.

  4. Real-time PCR in detection and quantitation of Leishmania donovani for the diagnosis of Visceral Leishmaniasis patients and the monitoring of their response to treatment

    PubMed Central

    Ghosh, Prakash; Khan, Md. Anik Ashfaq; Duthie, Malcolm S.; Vallur, Aarthy C.; Picone, Alessandro; Howard, Randall F.; Reed, Steven G.

    2017-01-01

    Sustained elimination of Visceral Leishmaniasis (VL) requires the reduction and control of parasite reservoirs to minimize the transmission of Leishmania donovani infection. A simple, reproducible and definitive diagnostic procedure is therefore indispensable for the early and accurate detection of parasites in VL, Relapsed VL (RVL) and Post Kala-azar Dermal Leishmaniasis (PKDL) patients, all of whom are potential reservoirs of Leishmania parasites. To overcome the limitations of current diagnostic approaches, a novel quantitative real-time polymerase chain reaction (qPCR) method based on Taqman chemistry was devised for the detection and quantification of L. donovani in blood and skin. The diagnostic efficacy was evaluated using archived peripheral blood buffy coat DNA from 40 VL, 40 PKDL, 10 RVL, 20 cured VL, and 40 cured PKDL along with 10 tuberculosis (TB) cases and 80 healthy endemic controls. Results were compared to those obtained using a Leishmania-specific nested PCR (Ln-PCR). The real time PCR assay was 100% (95% CI, 91.19–100%) sensitive in detecting parasite genomes in VL and RVL samples and 85.0% (95% CI, 70.16–94.29%) sensitive for PKDL samples. In contrast, the sensitivity of Ln-PCR was 77.5% (95% CI, 61.55–89.16%) for VL samples, 100% (95%CI, 69.15–100%) for RVL samples, and 52.5% (95% CI, 36.13–68.49%) for PKDL samples. There was significant discordance between the two methods with the overall sensitivity of the qPCR assay being considerably higher than Ln-PCR. None of the assay detected L. donovani DNA in buffy coats from cured VL cases, and reduced infectious burdens were demonstrated in cured PKDL cases who remained positive in 7.5% (3/40) and 2.5% (1/40) cases by real-time PCR and Ln-PCR, respectively. Both assays were 100% (95% CI, 95.98–100) specific with no positive signals in either endemic healthy control or TB samples. The real time PCR assay we developed offers a molecular tool for accurate detection of circulating L. donovani parasites in VL, PKDL and RVL patients, as well as being capable of assessing response to treatment. As such, this real time PCR assay represents an important contribution in efforts to eliminate VL. PMID:28957391

  5. Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

    EPA Science Inventory

    Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...

  6. Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

    EPA Science Inventory

    Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

  7. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    USDA-ARS?s Scientific Manuscript database

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  8. Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

    PubMed

    Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

    2017-03-01

    The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

  9. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  10. A case of Pitt-Hopkins syndrome with absence of hyperventilation.

    PubMed

    Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

    2013-12-01

    Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

  11. Circulating miR-132-3p as a Candidate Diagnostic Biomarker for Malignant Mesothelioma

    PubMed Central

    Gawrych, Katarzyna; Casjens, Swaantje; Brik, Alexander; Lehnert, Martin; Taeger, Dirk; Pesch, Beate; Kollmeier, Jens; Bauer, Torsten T.; Johnen, Georg; Brüning, Thomas

    2017-01-01

    The use of circulating microRNAs as biomarkers has opened new opportunities for diagnosis of cancer because microRNAs exhibit tumor-specific expression profiles. The aim of this study was the identification of circulating microRNAs in human plasma as potential biomarkers for the diagnosis of malignant mesothelioma. For discovery, TaqMan Low Density Array Human MicroRNA Cards were used to analyze 377 microRNAs in plasma samples from 21 mesothelioma patients and 21 asbestos-exposed controls. For verification, individual TaqMan microRNA assays were used for quantitative real-time PCR in plasma samples from 22 mesothelioma patients and 44 asbestos-exposed controls. The circulating miR-132-3p showed different expression levels between mesothelioma patients and asbestos-exposed controls. For discrimination, sensitivity of 86% and specificity of 61% were calculated. Circulating miR-132-3p in plasma was not affected by hemolysis and no impact of age or smoking status on miR-132-3p levels could be observed. For the combination of miR-132-3p with the previously described miR-126, sensitivity of 77% and specificity of 86% were calculated. The results of this study indicate that miR-132-3p might be a new promising diagnostic biomarker for malignant mesothelioma. It is indicated that the combination of miR-132-3p with other individual biomarkers improves the biomarker performance. PMID:28321148

  12. Improving clinical laboratory efficiency: a time-motion evaluation of the Abbott m2000 RealTime and Roche COBAS AmpliPrep/COBAS TaqMan PCR systems for the simultaneous quantitation of HIV-1 RNA and HCV RNA.

    PubMed

    Amendola, Alessandra; Coen, Sabrina; Belladonna, Stefano; Pulvirenti, F Renato; Clemens, John M; Capobianchi, M Rosaria

    2011-08-01

    Diagnostic laboratories need automation that facilitates efficient processing and workflow management to meet today's challenges for expanding services and reducing cost, yet maintaining the highest levels of quality. Processing efficiency of two commercially available automated systems for quantifying HIV-1 and HCV RNA, Abbott m2000 system and Roche COBAS Ampliprep/COBAS TaqMan 96 (docked) systems (CAP/CTM), was evaluated in a mid/high throughput workflow laboratory using a representative daily workload of 24 HCV and 72 HIV samples. Three test scenarios were evaluated: A) one run with four batches on the CAP/CTM system, B) two runs on the Abbott m2000 and C) one run using the Abbott m2000 maxCycle feature (maxCycle) for co-processing these assays. Cycle times for processing, throughput and hands-on time were evaluated. Overall processing cycle time was 10.3, 9.1 and 7.6 h for Scenarios A), B) and C), respectively. Total hands-on time for each scenario was, in order, 100.0 (A), 90.3 (B) and 61.4 min (C). The interface of an automated analyzer to the laboratory workflow, notably system set up for samples and reagents and clean up functions, are as important as the automation capability of the analyzer for the overall impact to processing efficiency and operator hands-on time.

  13. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus.

    PubMed

    Jothikumar, Narayanan; Cromeans, Theresa L; Robertson, Betty H; Meng, X J; Hill, Vincent R

    2006-01-01

    Hepatitis E virus (HEV) is transmitted by the fecal-oral route and causes sporadic and epidemic forms of acute hepatitis. Large waterborne HEV epidemics have been documented exclusively in developing countries. At least four major genotypes of HEV have been reported worldwide: genotype 1 (found primarily in Asian countries), genotype 2 (isolated from a single outbreak in Mexico), genotype 3 (identified in swine and humans in the United States and many other countries), and genotype 4 (identified in humans, swine and other animals in Asia). To better detect and quantitate different HEV strains that may be present in clinical and environmental samples, we developed a rapid and sensitive real-time RT-PCR assay for the detection of HEV RNA. Primers and probes for the real-time RT-PCR were selected based on the multiple sequence alignments of 27 sequences of the ORF3 region. Thirteen HEV isolates representing genotypes 1-4 were used to standardize the real-time RT-PCR assay. The TaqMan assay detected as few as four genome equivalent (GE) copies of HEV plasmid DNA and detected as low as 0.12 50% pig infectious dose (PID50) of swine HEV. Different concentrations of swine HEV (120-1.2PID50) spiked into a surface water concentrate were detected in the real-time RT-PCR assay. This is the first reporting of a broadly reactive TaqMan RT-PCR assay for the detection of HEV in clinical and environmental samples.

  14. An Evaluation of Quantitative PCR Assays (TaqMan® and SYBR Green) for the Detection of Babesia bigemina and Babesia bovis, and a Novel Fluorescent-ITS1-PCR Capillary Electrophoresis Method for Genotyping B. bovis Isolates

    PubMed Central

    Zhang, Bing; Sambono, Jacqueline L.; Morgan, Jess A. T.; Venus, Bronwyn; Rolls, Peter; Lew-Tabor, Ala E.

    2016-01-01

    Babesia spp. are tick-transmitted haemoparasites causing tick fever in cattle. In Australia, economic losses to the cattle industry from tick fever are estimated at AUD$26 Million per annum. If animals recover from these infections, they become immune carriers. Here we describe a novel multiplex TaqMan qPCR targeting cytochrome b genes for the identification of Babesia spp. The assay shows high sensitivity, specificity and reproducibility, and allows quantification of parasite DNA from Babesia bovis and B. bigemina compared to standard PCR assays. A previously published cytochrome b SYBR Green qPCR was also tested in this study, showing slightly higher sensitivity than the Taqman qPCRs but requires melting curve analysis post-PCR to confirm specificity. The SYBR Green assays were further evaluated using both diagnostic submissions and vaccinated cattle (at 7, 9, 11 and 14 days post-inoculation) showed that B. bigemina can be detected more frequently than B. bovis. Due to fewer circulating parasites, B. bovis detection in carrier animals requires higher DNA input. Preliminary data for a novel fluorescent PCR genotyping based on the Internal Transcribed Spacer 1 region to detect vaccine and field alleles of B. bovis are described. This assay is capable of detecting vaccine and novel field isolate alleles in a single sample. PMID:29056732

  15. A new TaqMan method for the reliable diagnosis of Ehrlichia spp. in canine whole blood.

    PubMed

    Thomson, Kirsty; Yaaran, Tal; Belshaw, Alex; Curson, Lucia; Tisi, Laurence; Maurice, Sarah; Kiddle, Guy

    2018-06-18

    Ehrlichiosis is an important emerging infectious disease of the canid family and humans worldwide. To date, no extensive evaluation or validation of a molecular diagnostic test for ehrlichiosis has been published. Here, we present data for a newly designed TaqMan assay and compare its performance to a commercial technology (PCRun®). Both of these real-time methods of analysis were evaluated using a comprehensive number of prospective and retrospective samples collected from dogs exhibiting symptoms of ehrlichiosis. Whole blood samples collected from dogs, retrospectively in the United Kingdom and prospectively in Israel, were analysed for the presence of Ehrlichia canis and Ehrlichia minasensis DNA using the TaqMan PCR, developed specifically for this study. The results were compared to those of a real time commercial isothermal amplification method (PCRun® system developed by Biogal Galed Labs ACS, Galed, Israel). The sensitivity and specificity (CI: 95%) of the TaqMan PCR and PCRun® were both determined to be 100% and absolute, for all of the samples tested. Interestingly, both tests were demonstrated to be highly comparable, irrespective of differences in amplification chemistry or sequences targeted. Host differences, incidence of disease and geographical location of the isolates had little impact on the positivity recorded by each of the diagnostic methods. It was evident that both amplification methods were equally suited for diagnosing canine ehrlichiosis and while the PCRun® clearly amplified all clinically relevant Ehrlichia species known to infect dogs and humans, the TaqMan method was more specific for E. canis and E. minasensis. This work demonstrates that despite good analytical sensitivities and specificities for Ehrlichia spp. neither method could fully account for the clinical diagnosis of thrombocytopenia.

  16. Evaluation of the Cobas TaqMan MTB Test for the Detection of Mycobacterium tuberculosis Complex According to Acid-Fast-Bacillus Smear Grades in Respiratory Specimens

    PubMed Central

    Huh, Hee Jae; Koh, Won-Jung; Song, Dong Joon

    2014-01-01

    We evaluated the performance of the Cobas TaqMan MTB test (Roche Diagnostics, Basel, Switzerland), stratified by acid-fast bacilli (AFB) smear grades. The sensitivity of this test in smear-positive specimens was >95% in all grades, while that in trace and negative specimens was 85.3% and 34.4%, respectively. PMID:25428157

  17. qSR: a quantitative super-resolution analysis tool reveals the cell-cycle dependent organization of RNA Polymerase I in live human cells.

    PubMed

    Andrews, J O; Conway, W; Cho, W -K; Narayanan, A; Spille, J -H; Jayanth, N; Inoue, T; Mullen, S; Thaler, J; Cissé, I I

    2018-05-09

    We present qSR, an analytical tool for the quantitative analysis of single molecule based super-resolution data. The software is created as an open-source platform integrating multiple algorithms for rigorous spatial and temporal characterizations of protein clusters in super-resolution data of living cells. First, we illustrate qSR using a sample live cell data of RNA Polymerase II (Pol II) as an example of highly dynamic sub-diffractive clusters. Then we utilize qSR to investigate the organization and dynamics of endogenous RNA Polymerase I (Pol I) in live human cells, throughout the cell cycle. Our analysis reveals a previously uncharacterized transient clustering of Pol I. Both stable and transient populations of Pol I clusters co-exist in individual living cells, and their relative fraction vary during cell cycle, in a manner correlating with global gene expression. Thus, qSR serves to facilitate the study of protein organization and dynamics with very high spatial and temporal resolutions directly in live cell.

  18. Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

    PubMed

    Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

    1993-11-01

    To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

  19. Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

    PubMed Central

    Richards-Kortum, Rebecca

    2015-01-01

    It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest. PMID:25867513

  20. Development of a quantitative recombinase polymerase amplification assay with an internal positive control.

    PubMed

    Crannell, Zachary A; Rohrman, Brittany; Richards-Kortum, Rebecca

    2015-03-30

    It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.

  1. Human-Associated Fecal Quantitative Polymerase Chain ReactionMeasurements and Simulated Risk of Gastrointestinal Illness in Recreational Waters Contaminated with Raw Sewage

    EPA Science Inventory

    We used quantitative microbial risk assessment (QMRA) to estimate the risk of gastrointestinal (GI) illness associated with swimming in recreational waters containing different concentrations of human-associated fecal qPCR markers from raw sewage– HF183 and HumM2. The volume/volu...

  2. Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

  3. COMPARISON OF POPULATIONS OF MOULD SPECIES IN HOMES IN THE UK AND US USING MOLD-SPECIFIC QUANTITATIVE PCR (MSQPCR)

    EPA Science Inventory

    The goal of this research was to compare the populations of 81 mold species in homes in USA and UK using mould specific quantitative polymerase chain reaction (MSQPCR) technology. Dust samples were obtained from randomly selected homes in Great Britain (n=11). The mould populat...

  4. COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

    EPA Science Inventory

    Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

  5. HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.

    PubMed

    Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E

    2009-06-01

    To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.

  6. Use of the MagNA Pure LC Automated Nucleic Acid Extraction System followed by Real-Time Reverse Transcription-PCR for Ultrasensitive Quantitation of Hepatitis C Virus RNA

    PubMed Central

    Cook, Linda; Ng, Ka-Wing; Bagabag, Arthur; Corey, Lawrence; Jerome, Keith R.

    2004-01-01

    Hepatitis C virus (HCV) infection is an increasing health problem worldwide. Quantitative assays for HCV viral load are valuable in predicting response to therapy and for following treatment efficacy. Unfortunately, most quantitative tests for HCV RNA are limited by poor sensitivity. We have developed a convenient, highly sensitive real-time reverse transcription-PCR assay for HCV RNA. The assay amplifies a portion of the 5′ untranslated region of HCV, which is then quantitated using the TaqMan 7700 detection system. Extraction of viral RNA for our assay is fully automated with the MagNA Pure LC extraction system (Roche). Our assay has a 100% detection rate for samples containing 50 IU of HCV RNA/ml and is linear up to viral loads of at least 109 IU/ml. The assay detects genotypes 1a, 2a, and 3a with equal efficiency. Quantitative results by our assay correlate well with HCV viral load as determined by the Bayer VERSANT HCV RNA 3.0 bDNA assay. In clinical use, our assay is highly reproducible, with high and low control specimens showing a coefficient of variation for the logarithmic result of 2.8 and 7.0%, respectively. The combination of reproducibility, extreme sensitivity, and ease of performance makes this assay an attractive option for routine HCV viral load testing. PMID:15365000

  7. Detection methods for biotech cotton MON 15985 and MON 88913 by PCR.

    PubMed

    Lee, Seong-Hun; Kim, Jin-Kug; Yi, Bu-Young

    2007-05-02

    Plants derived through agricultural biotechnology, or genetically modified organisms (GMOs), may affect human health and ecological environment. A living GMO is also called a living modified organism (LMO). Biotech cotton is a GMO in food or feed and also an LMO in the environment. Recently, two varieties of biotech cotton, MON 15985 and MON 88913, were developed by Monsanto Co. The detection method is an essential element for the GMO labeling system or LMO management of biotech plants. In this paper, two primer pairs and probes were designed for specific amplification of 116 and 120 bp PCR products from MON 15985 and MON 88913, respectively, with no amplification from any other biotech cotton. Limits of detection of the qualitative method were all 0.05% for MON 15985 and MON 88913. The quantitative method was developed using a TaqMan real-time PCR. A synthetic plasmid, as a reference molecule, was constructed from a taxon-specific DNA sequence of cotton and two construct-specific DNA sequences of MON 15985 and MON 88913. The quantitative method was validated using six samples that contained levels of biotech cotton mixed with conventional cotton ranging from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-20%. Limits of quantitation of the quantitative method were all 0.1%. Consequently, it is reported that the proposed detection methods were applicable for qualitative and quantitative analyses for biotech cotton MON 15985 and MON 88913.

  8. Development a of multiplex TaqMan real-time RT-PCR assay for simultaneous detection of Asian prunus viruses, plum bark necrosis stem pitting associated virus, and peach latent mosaic virus

    USDA-ARS?s Scientific Manuscript database

    Asian prunus viruses (APV 1, APV 2 and APV 3) and Plum bark necrosis stem pitting associated virus (PBNSPaV) are two recently described viruses infecting Prunus spp., and Peach latent mosaic viroid (PLMVd) is a viroid that infects the same species. A single-tube multiplex, TaqMan real-time RT-PCR as...

  9. Results of the Abbott RealTime HIV-1 assay for specimens yielding "target not detected" results by the Cobas AmpliPrep/Cobas TaqMan HIV-1 Test.

    PubMed

    Babady, N Esther; Germer, Jeffrey J; Yao, Joseph D C

    2010-03-01

    No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding "target not detected" results by CTM.

  10. Human-Associated Bacteroides spp. and Human Polyomaviruses as Microbial Source Tracking Markers in Hawaii.

    PubMed

    Kirs, Marek; Caffaro-Filho, Roberto A; Wong, Mayee; Harwood, Valerie J; Moravcik, Philip; Fujioka, Roger S

    2016-11-15

    Identification of sources of fecal contaminants is needed to (i) determine the health risk associated with recreational water use and (ii) implement appropriate management practices to mitigate this risk and protect the environment. This study evaluated human-associated Bacteroides spp. (HF183TaqMan) and human polyomavirus (HPyV) markers for host sensitivity and specificity using human and animal fecal samples collected in Hawaii. The decay rates of those markers and indicator bacteria were identified in marine and freshwater microcosms exposed and not exposed to sunlight, followed by field testing of the usability of the molecular markers. Both markers were strongly associated with sewage, although the cross-reactivity of the HF183TaqMan (also present in 82% of canine [n = 11], 30% of mongoose [n = 10], and 10% of feline [n = 10] samples) needs to be considered. Concentrations of HF183TaqMan in human fecal samples exceeded those in cross-reactive animals at least 1,000-fold. In the absence of sunlight, the decay rates of both markers were comparable to the die-off rates of enterococci in experimental freshwater and marine water microcosms. However, in sunlight, the decay rates of both markers were significantly lower than the decay rate of enterococci. While both markers have their individual limitations in terms of sensitivity and specificity, these limitations can be mitigated by using both markers simultaneously; ergo, this study supports the concurrent use of HF183TaqMan and HPyV markers for the detection of sewage contamination in coastal and inland waters in Hawaii. This study represents an in-depth characterization of microbial source tracking (MST) markers in Hawaii. The distribution and concentrations of HF183TaqMan and HPyV markers in human and animal fecal samples and in wastewater, coupled with decay data obtained from sunlight-exposed and unexposed microcosms, support the concurrent application of HF183TaqMan and HPyV markers for sewage contamination detection in Hawaii waters. Both markers are more conservative and more specific markers of sewage than fecal indicator bacteria (enterococci and Escherichia coli). Analysis of HF183TaqMan (or newer derivatives) is recommended for inclusion in future epidemiological studies concerned with beach water quality, while better concentration techniques are needed for HPyV. Such epidemiological studies can be used to develop new recreational water quality criteria, which will provide direct information on the absence or presence of sewage contamination in water samples as well as reliable measurements of the risk of waterborne disease transmission to swimmers. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. A Pilot Study of Circulating MicroRNA-125b as a Diagnostic and Prognostic Biomarker for Epithelial Ovarian Cancer.

    PubMed

    Zhu, Tao; Gao, Wen; Chen, Xi; Zhang, Ying; Wu, Meijuan; Zhang, Ping; Wang, Shihua

    2017-01-01

    Early diagnosis of epithelial ovarian cancer is critical for patient survival. The objective of this pilot study is to identify a circulating micro (mi)RNA as a potential biomarker for epithelial ovarian cancer. A total of 135 epithelial ovarian cancer patients and 54 benign ovarian tumor patients were recruited for this study. Using customized TaqMan low density miRNA arrays, we first screened expression levels of 48 miRNAs in sera from 18 epithelial ovarian cancer patients and 16 benign ovarian tumor patients. The most significantly and differentially expressed miRNA was then further examined in all serum samples using real-time polymerase chain reaction. Its expression was further analyzed in relationship with clinicopathological factors and patient survival. Array screening data showed that expression levels of serum miRNA-20a, miRNA-125b, miRNA-126, miRNA-355, and let-7c were significantly different between malignant and benign ovarian tumor patients. Subsequent real-time polymerase chain reaction results showed that serum miRNA-125b levels were significantly higher in epithelial ovarian cancer patients compared to benign controls. Moreover, serum miRNA-125b levels were significantly higher in ovarian cancer patients in early stages I and II, and in patients having no residual tumor following surgery, but were not associated with differentiation and histological types of ovarian cancer. Notably, the higher level of miR-125b was significantly positively correlated with progression-free survival (P = 0.035) and marginally, with overall survival (P = 0.069). miRNA-125b plays an important role in the pathogenesis and progression of epithelial ovarian cancer. Circulating miRNA-125b has the potential to become a novel biomarker for early diagnosis and prognosis prediction of epithelial ovarian cancer.

  12. Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

    PubMed Central

    Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

    2016-01-01

    Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

  13. Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

    PubMed Central

    2011-01-01

    Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

  14. Comparative Evaluation of the Diagnostic Performance of the Prototype Cepheid GeneXpert Ebola Assay

    PubMed Central

    Jansen van Vuren, Petrus; Grobbelaar, Antoinette; Storm, Nadia; Conteh, Ousman; Konneh, Kelfala; Kamara, Abdul; Sanne, Ian

    2015-01-01

    The Ebola virus disease (EVD) outbreak in West Africa has highlighted an urgent need for point-of-care (POC) assays for the diagnosis of this devastating disease in resource-limited African countries. The diagnostic performance characteristics of a prototype Cepheid GeneXpert Ebola POC used to detect Ebola virus (EBOV) in stored serum and plasma samples collected from suspected EVD cases in Sierra Leone in 2014 and 2015 was evaluated. The GeneXpert Ebola POC is a self-contained single-cartridge automated system that targets the glycoprotein (GP) and nucleoprotein (NP) genes of EBOV and yields results within 90 min. Results from 281 patient samples were compared to the results of a TaqMan real-time reverse transcription-PCR (RT-PCR) targeting the polymerase gene and performed on two real-time PCR machines. Agreement between the three platforms was 100% at cycle threshold (CT) values of ≤34.99, but discordant results were noted between CT values of 35 and 45.The diagnostic sensitivity of the three platforms was 100% in 91 patient samples that were confirmed to be infectious by virus isolation. All three molecular platforms detected viral EBOV RNA in additional samples that did not contain viable EBOV. The analytical sensitivity of the GeneXpert Ebola POC for the detection of NP was higher, and comparable to that of polymerase gene detection, than that for the detection of GP when using a titrated laboratory stock of EBOV. There was no detectable cross-reactivity with other hemorrhagic fever viruses or arboviruses. The GeneXpert Ebola POC offers an easy to operate and sensitive diagnostic tool that can be used for the rapid screening of suspected EVD cases in treatment or in holding centers during EVD outbreaks. PMID:26637383

  15. Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

    PubMed

    Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

    2005-01-01

    Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

  16. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

    PubMed

    Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

    2002-10-15

    Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

  17. The effect of main urine inhibitors on the activity of different DNA polymerases in loop-mediated isothermal amplification.

    PubMed

    Jevtuševskaja, Jekaterina; Krõlov, Katrin; Tulp, Indrek; Langel, Ülo

    2017-04-01

    The use of rapid amplification methods to detect pathogens in biological samples is mainly limited by the amount of pathogens present in the sample and the presence of inhibiting substances. Inhibitors can affect the amplification efficiency by either binding to the polymerase, interacting with the DNA, or interacting with the polymerase during primer extension. Amplification is performed using DNA polymerase enzymes and even small changes in their activity can influence the sensitivity and robustness of molecular assays Methods: The main purpose of this research was to examine which compounds present in urine inhibit polymerases with strand displacement activity. To quantify the inhibition, we employed quantitative loop-mediated isothermal amplification Results: The authors found that the presence of BSA, Mg 2+, and urea at physiologically relevant concentrations, as well as acidic or alkaline conditions did not affect the activity of any of the tested polymerases. However, addition of salt significantly affected the activity of the tested polymerases. These findings may aid in the development of more sensitive, robust, cost effective isothermal amplification based molecular assays suitable for both point-of-care testing and on-site screening of pathogens directly from unprocessed urine which avoid the need for long and tedious DNA purification steps prior to amplification.

  18. Role of disulfide bridges in archaeal family-B DNA polymerases.

    PubMed

    Killelea, Tom; Connolly, Bernard A

    2011-06-14

    The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Transcriptional bursting is intrinsically caused by interplay between RNA polymerases on DNA

    NASA Astrophysics Data System (ADS)

    Fujita, Keisuke; Iwaki, Mitsuhiro; Yanagida, Toshio

    2016-12-01

    Cell-to-cell variability plays a critical role in cellular responses and decision-making in a population, and transcriptional bursting has been broadly studied by experimental and theoretical approaches as the potential source of cell-to-cell variability. Although molecular mechanisms of transcriptional bursting have been proposed, there is little consensus. An unsolved key question is whether transcriptional bursting is intertwined with many transcriptional regulatory factors or is an intrinsic characteristic of RNA polymerase on DNA. Here we design an in vitro single-molecule measurement system to analyse the kinetics of transcriptional bursting. The results indicate that transcriptional bursting is caused by interplay between RNA polymerases on DNA. The kinetics of in vitro transcriptional bursting is quantitatively consistent with the gene-nonspecific kinetics previously observed in noisy gene expression in vivo. Our kinetic analysis based on a cellular automaton model confirms that arrest and rescue by trailing RNA polymerase intrinsically causes transcriptional bursting.

  20. Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

    PubMed Central

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-01-01

    Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

  1. Evaluation of the Cobas TaqMan MTB test for the detection of Mycobacterium tuberculosis complex according to acid-fast-bacillus smear grades in respiratory specimens.

    PubMed

    Huh, Hee Jae; Koh, Won-Jung; Song, Dong Joon; Ki, Chang-Seok; Lee, Nam Yong

    2015-02-01

    We evaluated the performance of the Cobas TaqMan MTB test (Roche Diagnostics, Basel, Switzerland), stratified by acid-fast bacilli (AFB) smear grades. The sensitivity of this test in smear-positive specimens was >95% in all grades, while that in trace and negative specimens was 85.3% and 34.4%, respectively. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Pharmacogenetics of clopidogrel: comparison between a standard and a rapid genetic testing.

    PubMed

    Saracini, Claudia; Vestrini, Anna; Galora, Silvia; Armillis, Alessandra; Abbate, Rosanna; Giusti, Betti

    2012-06-01

    CYP2C19 variant alleles are independent predictors of clopidogrel response variability and occurrence of major adverse cardiovascular events in high-risk vascular patients on clopidogrel therapy. Increasing evidence suggests a combination of platelet function testing with CYP2C19 genetic testing may be more effective in identifying high-risk individuals for alternative antiplatelet therapeutic strategies. A crucial point in evaluating the use of these polymorphisms in clinical practice, besides test accuracy, is the cost of the genetic test and rapid availability of the results. One hundred acute coronary syndrome patients were genotyped for CYP2C19*2,*3,*4,*5, and *17 polymorphisms with two platforms: Verigene(®) and the TaqMan(®) system. Genotyping results obtained by the classical TaqMan approach and the rapid Verigene approach showed a 100% concordance for all the five polymorphisms investigated. The Verigene system had shorter turnaround time with respect to TaqMan. The cost of reagents for TaqMan genotyping was lower than that for the Verigene system, but the effective manual staff involvement and the relative cost resulted in higher cost for TaqMan than for Verigene. The Verigene system demonstrated good performance in terms of turnaround time and cost for the evaluation of the clopidogrel poor metabolizer status, giving genetic information in suitable time (206 min) for a therapeutic strategy decision.

  3. Rapid identification of tomato Sw-5 resistance-breaking isolates of Tomato spotted wilt virus using high resolution melting and TaqMan SNP Genotyping assays as allelic discrimination techniques.

    PubMed

    di Rienzo, Valentina; Bubici, Giovanni; Montemurro, Cinzia; Cillo, Fabrizio

    2018-01-01

    In tomato, resistance to Tomato spotted wilt virus (TSWV) is conferred by the dominant gene, designated Sw-5. Virulent Sw-5 resistance breaking (SRB) mutants of TSWV have been reported on Sw-5 tomato cultivars. Two different PCR-based allelic discrimination techniques, namely Custom TaqMan™ SNP Genotyping and high-resolution melting (HRM) assays, were developed and compared for their ability to distinguish between avirulent (Sw-5 non-infecting, SNI) and SRB biotypes. TaqMan assays proved to be more sensitive (threshold of detection in a range of 50-70 TSWV RNA copies) and more reliable than HRM, assigning 25 TSWV isolates to their correct genotype with an accuracy of 100%. Moreover, the TaqMan SNP assays were further improved developing a rapid and simple protocol that included crude leaf extraction for RNA template preparations. On the other hand, HRM assays showed higher levels of sensitivity than TaqMan when used to co-detect both biotypes in different artificial mixtures. These diagnostic assays contributed to gain preliminary information on the epidemiology of TSWV isolates in open field conditions. In fact, the presented data suggest that SRB isolates are present as stable populations established year round, persisting on both winter (globe artichoke) and summer (tomato) crops, in the same cultivated areas of Southern Italy.

  4. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  5. Analytical characteristics and comparative evaluation of Aptima HIV-1 Quant Dx assay with Ampliprep/COBAS TaqMan HIV-1 test v2.0.

    PubMed

    Hatzakis, Angelos; Papachristou, Helen; Nair, Sangeetha J; Fortunko, Jacqueline; Foote, Tracy; Kim, HeeCheol; Peling, Tashi L; Worlock, Andrew J

    2016-10-21

    Quantitation of HIV-RNA is critically important for diagnosis, prognosis, treatment, monitoring and assessment of infectivity in HIV-1 infection. The objective of this study was to assess performance characteristics of the Aptima HIV-1 Quant Dx assay (Aptima), a new transcription mediated amplification (TMA), fully integrated and automated assay from Hologic Inc., San Diego, CA, USA. The analytical sensitivity, analytical specificity, precision and detection of HIV-1 subtypes were tested based on commercially available international standards or panels. A selected group of 244 anti-HIV-1 (+) plasma samples was used for comparison with Roche COBAS Ampliprep/COBAS TaqMan HIV- 1 test v2.0 (Roche CAP/CTM), (Roche Molecular Systems, Pleasanton, CA). The 50 and 95 % limit of detection were estimated at 4.9 (95 % CI 3.9-5.7) and 17.6 (15.2-21.2) IU/mL respectively. The specificity was found 99.83 (99.06-99.97) %. The standard deviations and coefficient of variations for panels with 50 and 100 copies/mL (1.7 and 2 log copies/mL) were 0.14 log copies/mL (8.67 %CV) and 0.18 log copies/mL (9.91 %CV) respectively. The detection rate for Aptima and Roche assays was 220/244 (90.2 %) and 217/244 (88.9 %) respectively. The Aptima assay is a sensitive, specific, precise and accurate test for measuring HIV-1 viral loads and for the detection of HIV-1 infections.

  6. Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

    PubMed Central

    Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

  7. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    PubMed

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

    2015-10-01

    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Robust detection of rare species using environmental DNA: the importance of primer specificity.

    PubMed

    Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

  9. Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae).

    PubMed

    Brault, Aaron C; Fang, Ying; Reisen, William K

    2015-05-01

    Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer-probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV).

    PubMed

    Morozov, Vladimir A; Morozov, Alexey V; Denner, Joachim

    2016-05-01

    Pigs are frequently infected with porcine cytomegalovirus (PCMV). Infected adult animals may not present with symptoms of disease, and the virus remains latent. However, the virus may be transmitted to human recipients receiving pig transplants. Recently, it was shown that pig-to-non-human-primate xenotransplantations showed 2 to 3 times lower transplant survival when the donor pig was infected with PCMV. Therefore, highly sensitive methods are required to select virus-free pigs and to examine xenotransplants. Seven previously established PCR detection systems targeting the DNA polymerase gene of PCMV were examined by comparison of thermodynamic parameters of oligonucleotides, and new diagnostic nested PCR and real-time PCR systems with improved parameters and high sensitivity were established. The detection limit of conventional PCR was estimated to be 15 copies, and that of the nested PCR was 5 copies. The sensitivity of the real-time PCR with a TaqMan probe was two copies. An equal efficiency of the newly established detection systems was shown by parallel testing of DNA from sera and blood of six pigs, identifying the same animals as PCMV infected. These new diagnostic PCR systems will improve the detection of PCMV and therefore increase the safety of porcine xenotransplants.

  11. Impacts of ICAM-1 gene polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic characteristics in Taiwan.

    PubMed

    Wang, Shian-Shiang; Hsieh, Ming-Ju; Ou, Yen-Chuan; Chen, Chuan-Shu; Li, Jian-Ri; Hsiao, Pei-Ching; Yang, Shun-Fa

    2014-08-01

    Intercellular adhesion molecule (ICAM)-1, a cell adhesion molecule, is reportedly overexpressed in several cancers and may contribute to tumorgenesis and metastasis. The current study explored the effect of ICAM-1 gene polymorphisms on the susceptibility of developing urothelial cell carcinoma (UCC) and the clinicopathological status. A total of 558 participants, including 279 healthy people and 279 patients with UCC, were recruited for this study. Four single-nucleotide polymorphisms of the ICAM-1 gene were assessed by a real-time polymerase chain reaction with the TaqMan assay. After adjusting for other covariants, the individuals carrying at least one G allele at ICAM-1 rs5498 had a 1.603-fold risk of developing UCC than did wild-type (AA) carriers. Furthermore, UCC patients who carried at least one G allele at rs5498 had a higher invasive stage risk (p < 0.05) than did patients carrying the wild-type allele. In conclusion, the rs5498 polymorphic genotypes of ICAM-1 might contribute to the prediction of susceptibility to and pathological development of UCC. This is the first study to provide insight into risk factors associated with ICAM-1 variants in carcinogenesis of UCC in Taiwan.

  12. Genetic variations in the vitamin-D receptor (VDR) gene in preeclampsia patients in the Chinese Han population.

    PubMed

    Zhan, Ying; Liu, Mengchun; You, Yuelan; Zhang, Yan; Wang, Jingli; Wang, Xunfeng; Liu, Shiguo; Liu, Xuemei

    2015-07-01

    Previous studies have indicated that vitamin D deficiency is linked to a risk of preeclampsia (PE). The aim of our study was to investigate the association between genetic variations in the vitamin-D receptor (VDR) gene and the susceptibility to PE in the Chinese Han population. We examined the genotypes VDR rs2228570, rs11568820 and rs1544410 in 402 PE patients and 554 normal pregnant women in the third trimester by TaqMan allelic discrimination real-time polymerase chain reaction. The clinical data of the individuals were collected to enable genotype-phenotype analysis. A significant statistical difference in the genotypic frequencies of rs2228570 between cases and controls was found (χ(2)=13.750, P=0.001). The G allele was the risk factor for the risk of PE (χ(2)=9.456, P=0.002, OR=1.137, 95% CI 1.111-1.610). There was no difference in the genotypic and allelic distributions of rs11568820 and rs1544410 between the two groups (P> 0.05). Our results provide evidence for a possible link between VDR and the development of PE in the Chinese Han population.

  13. Genetic variants in 3′-UTRs of methylenetetrahydrofolate reductase (MTHFR) predict colorectal cancer susceptibility in Koreans

    PubMed Central

    Joo Jeon, Young; Woo Kim, Jong; Mi Park, Hye; Kim, Jung O; Geun Jang, Hyo; Oh, Jisu; Gyu Hwang, Seong; Won Kwon, Sung; Oh, Doyeun; Keun Kim, Nam

    2015-01-01

    Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) play important roles in tumor development, progression, and metastasis. Moreover, recent studies have reported that a number of 3′-UTR polymorphisms potentially bind to specific microRNAs in a variety of cancers. The aim of this study was to investigate the association of four MTHFR polymorphisms, 2572C>A [rs4846049], 4869C>G [rs1537514], 5488C>T [rs3737967], and 6685T>C [rs4846048] with colorectal cancer (CRC) in Koreans. A total of 850 participants (450 CRC patients and 400 controls) were enrolled in the study. The genotyping of MTHFR 3′-UTR polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism analysis or TaqMan allelic discrimination assay. We found that MTHFR 2572C>A, 4869C>G, and 5488C>T genotypes were substantially associated with CRC susceptibility. Of the potentially susceptible polymorphisms, MTHFR 2572C>A was associated with increased homocysteine and decreased folate levels in the plasma based on MTHFR 677CC. Our study provides the evidences for 3′-UTR variants in MTHFR gene as potential biomarkers for use in CRC prevention. PMID:26046315

  14. Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

    PubMed

    Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

    2010-01-01

    Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

  15. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is associated with asymptomatic malaria in a rural community in Burkina Faso.

    PubMed

    Ouattara, Abdoul Karim; Bisseye, Cyrille; Bazie, Bapio Valery Jean Télesphore Elvira; Diarra, Birama; Compaore, Tegwindé Rebeca; Djigma, Florencia; Pietra, Virginio; Moret, Remy; Simpore, Jacques

    2014-08-01

    To investigate 4 combinations of mutations responsible for glucose-6-phosphate dehydrogenase (G6PD) deficiency in a rural community of Burkina Faso, a malaria endemic country. Two hundred individuals in a rural community were genotyped for the mutations A376G, G202A, A542T, G680T and T968C using TaqMan single nucleotide polymorphism assays and polymerase chain reaction followed by restriction fragment length polymorphism. The prevalence of the G6PD deficiency was 9.5% in the study population. It was significantly higher in men compared to women (14.3% vs 6.0%, P=0.049). The 202A/376G G6PD A- was the only deficient variant detected. Plasmodium falciparum asymptomatic parasitaemia was significantly higher among the G6PD-non-deficient persons compared to the G6PD-deficient (P<0.001). The asymptomatic parasitaemia was also significantly higher among G6PD non-deficient compared to G6PD-heterozygous females (P<0.001). This study showed that the G6PD A- variant associated with protection against asymptomatic malaria in Burkina Faso is probably the most common deficient variant.

  16. Rapid method for controlling the correct labeling of products containing common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas) by fast real-time PCR.

    PubMed

    Espiñeira, Montserrat; Vieites, Juan M

    2012-12-15

    The TaqMan real-time PCR has the highest potential for automation, therefore representing the currently most suitable method for screening, allowing the detection of fraudulent or unintentional mislabeling of species. This work describes the development of a real-time polymerase chain reaction (RT-PCR) system for the detection and identification of common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas). This technique is notable for the combination of simplicity, speed, sensitivity and specificity in an homogeneous assay. The method can be applied to all kinds of products; fresh, frozen and processed, including those undergoing intensive processes of transformation. This methodology was validated to check how the degree of food processing affects the method and the detection of each species. Moreover, it was applied to 34 commercial samples to evaluate the labeling of products made from them. The methodology herein developed is useful to check the fulfillment of labeling regulations for seafood products and to verify traceability in commercial trade and for fisheries control. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Development and validation of a real-time TaqMan assay for the detection and enumeration of Pseudomonas fluorescens ATCC 13525 used as a challenge organism in testing of food equipments.

    PubMed

    Saha, Ratul; Bestervelt, Lorelle L; Donofrio, Robert S

    2012-02-01

    Pseudomonas fluorescens ATCC 13525 is used as the challenge organism to evaluate the efficacy of the clean-in-place (CIP) process of food equipment (automatic ice-maker) as per NSF/ANSI Standard 12. Traditional culturing methodology is presently used to determine the concentration of the challenge organism, which takes 48 h to confirm the cell density. Storage of the challenge preparation in the refrigerator might alter the cell density as P. fluorescens is capable of growing at 4 °C. Also, background organism can grow on the Pseudomonas F agar (PFA) used for the recovery of P. fluorescens thus affecting the results of the test. Real-time TaqMan assay targeting the cpn60 gene was developed for the enumeration and the identification of P. fluorescens because of its specificity, accuracy, and shorter turnaround time. The TaqMan primer-probe pair developed using the Allele ID® 7.0 probe design software was highly specific and sensitive for the target organism. The sensitivity of the assay was 10 colony forming units (CFU)/mL. The assay was also successful in determining the concentration of the challenge preparation within 2 h. Based on these observations, TaqMan assay targeting the cpn60 gene can be efficiently used for strain level identification and enumeration of bacteria. Pseudomonas fluorescens ATCC 13525 is used as a challenge organism in the efficacy testing of clean-in-place process of food equipments. Currently, culturing technique is used for its identification and estimation, which is not only time-consuming but also prone to error. Real-time TaqMan assay is more specific, sensitive, and accurate along with a shorter turnaround time compared to culturing techniques, thereby increasing the overall quality of the testing methodology to evaluate the clean-in-place process critical for the food industry to protect public health and safety. © 2012 Institute of Food Technologists®

  18. Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions.

    PubMed

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia; Gerlier, Denis

    2014-09-01

    The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, P(XD) and N(TAIL) is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the P(XD) F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in P(XD)-to-N(TAIL) binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the P(XD)-N(TAIL) interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼ 6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

    EPA Pesticide Factsheets

    In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

  20. Clinical characteristics of children with viral single- and co-infections and a petechial rash.

    PubMed

    Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

    2013-05-01

    Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

  1. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  2. Geographic variation in marine turtle fibropapillomatosis

    USGS Publications Warehouse

    Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

    2005-01-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  3. Geographic variation in marine turtle fibropapillomatosis.

    PubMed

    Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

    2005-09-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  4. Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao Hongbin; Banh, Alice; Kwok, Shirley

    Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

  5. A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

    PubMed

    Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

    2016-12-01

    Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

  6. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  7. Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

    PubMed

    Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

    2017-10-01

    Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  9. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Self-powered integrated microfluidic point-of-care low-cost enabling (SIMPLE) chip

    PubMed Central

    Yeh, Erh-Chia; Fu, Chi-Cheng; Hu, Lucy; Thakur, Rohan; Feng, Jeffrey; Lee, Luke P.

    2017-01-01

    Portable, low-cost, and quantitative nucleic acid detection is desirable for point-of-care diagnostics; however, current polymerase chain reaction testing often requires time-consuming multiple steps and costly equipment. We report an integrated microfluidic diagnostic device capable of on-site quantitative nucleic acid detection directly from the blood without separate sample preparation steps. First, we prepatterned the amplification initiator [magnesium acetate (MgOAc)] on the chip to enable digital nucleic acid amplification. Second, a simplified sample preparation step is demonstrated, where the plasma is separated autonomously into 224 microwells (100 nl per well) without any hemolysis. Furthermore, self-powered microfluidic pumping without any external pumps, controllers, or power sources is accomplished by an integrated vacuum battery on the chip. This simple chip allows rapid quantitative digital nucleic acid detection directly from human blood samples (10 to 105 copies of methicillin-resistant Staphylococcus aureus DNA per microliter, ~30 min, via isothermal recombinase polymerase amplification). These autonomous, portable, lab-on-chip technologies provide promising foundations for future low-cost molecular diagnostic assays. PMID:28345028

  11. Quantitative competitive (QC) PCR for quantification of porcine DNA.

    PubMed

    Wolf, C; Lüthy, J

    2001-02-01

    Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

  12. A comparative evaluation between real time Roche COBas TAQMAN 48 HCV and bDNA Bayer Versant HCV 3.0.

    PubMed

    Giraldi, Cristina; Noto, Alessandra; Tenuta, Robert; Greco, Francesca; Perugini, Daniela; Spadafora, Mario; Bianco, Anna Maria Lo; Savino, Olga; Natale, Alfonso

    2006-10-01

    The HCV virus is a common human pathogen made of a single stranded RNA genome with 9600nt. This work compared two different commercial methods used for HCV viral load, the bDNA Bayer Versant HCV 3.0 and the RealTime Roche COBAS TaqMan 48 HCV. We compared the reproducibility and linearity of the two methods. Seventy-five plasma samples with genotypes 1 to 4, which represent the population (45% genotype 1; 24% genotype 2; 13% genotype 3; 18% genotype 4) were directly processed with the Versanto method based upon signal amplification; the same samples were first extracted (COBAS Ampliprep - TNAI) and then amplified using RealTime PCR (COBAS TaqMan 48). The results obtained indicate the same performance for both methods if they have genotype 1, but in samples with genotypes 2, 3 and 4 the RealTime PCR Roche method gave an underestimation in respect to the Bayer bDNA assay.

  13. Monitoring the dynamics of syntrophic β-oxidizing bacteria during anaerobic degradation of oleic acid by quantitative PCR.

    PubMed

    Ziels, Ryan M; Beck, David A C; Martí, Magalí; Gough, Heidi L; Stensel, H David; Svensson, Bo H

    2015-04-01

    The ecophysiology of long-chain fatty acid-degrading syntrophic β-oxidizing bacteria has been poorly understood due to a lack of quantitative abundance data. Here, TaqMan quantitative PCR (qPCR) assays targeting the 16S rRNA gene of the known mesophilic syntrophic β-oxidizing bacterial genera Syntrophomonas and Syntrophus were developed and validated. Microbial community dynamics were followed using qPCR and Illumina-based high-throughput amplicon sequencing in triplicate methanogenic bioreactors subjected to five consecutive batch feedings of oleic acid. With repeated oleic acid feeding, the initial specific methane production rate significantly increased along with the relative abundances of Syntrophomonas and methanogenic archaea in the bioreactor communities. The novel qPCR assays showed that Syntrophomonas increased from 7 to 31% of the bacterial community 16S rRNA gene concentration, whereas that of Syntrophus decreased from 0.02 to less than 0.005%. High-throughput amplicon sequencing also revealed that Syntrophomonas became the dominant genus within the bioreactor microbiomes. These results suggest that increased specific mineralization rates of oleic acid were attributed to quantitative shifts within the microbial communities toward higher abundances of syntrophic β-oxidizing bacteria and methanogenic archaea. The novel qPCR assays targeting syntrophic β-oxidizing bacteria may thus serve as monitoring tools to indicate the fatty acid β-oxidization potential of anaerobic digester communities. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. A novel specific duplex real-time RT-PCR method for absolute quantitation of Grapevine Pinot gris virus in plant material and single mites.

    PubMed

    Morán, Félix; Olmos, Antonio; Lotos, Leonidas; Predajňa, Lukáš; Katis, Nikolaos; Glasa, Miroslav; Maliogka, Varvara; Ruiz-García, Ana B

    2018-01-01

    Grapevine Pinot gris virus (GPGV) is a widely distributed grapevine pathogen that has been associated to the grapevine leaf mottling and deformation disease. With the aim of better understanding the disease epidemiology and providing efficient control strategies a specific and quantitative duplex TaqMan real-time RT-PCR assay has been developed. This method has allowed reliable quantitation of the GPGV titer ranging from 30 up to 3 x 108 transcript copies, with a detection limit of 70 viral copies in plant material. The assay targets a grapevine internal control that reduces the occurrence of false negative results, thus increasing the diagnostic sensitivity of the technique. Viral isolates both associated and non-associated to symptoms from Greece, Slovakia and Spain have been successfully detected. The method has also been applied to the absolute quantitation of GPGV in its putative transmission vector Colomerus vitis. Moreover, the viral titer present in single mites has been determined. In addition, in the current study a new polymorphism in the GPGV genome responsible for a shorter movement protein has been found. A phylogenetic study based on this genomic region has shown a high variability among Spanish isolates and points to a different evolutionary origin of this new polymorphism. The methodology here developed opens new possibilities for basic and epidemiological studies as well as for the establishment of efficient control strategies.

  15. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    PubMed

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  16. A novel duplex real time quantitative reverse transcription polymerase chain reaction for rubella virus with armored RNA as a noncompetitive internal positive control.

    PubMed

    Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping

    2015-07-01

    The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  18. Saccharomyces cerevisiae RNA Polymerase I Terminates Transcription at the Reb1 Terminator In Vivo

    PubMed Central

    Reeder, Ronald H.; Guevara, Palmira; Roan, Judith G.

    1999-01-01

    We have mapped transcription termination sites for RNA polymerase I in the yeast Saccharomyces cerevisiae. S1 nuclease mapping shows that the primary terminator is the Reb1p terminator located at +93 downstream of the 3′ end of 25S rRNA. Reverse transcription coupled with quantitative PCR shows that approximately 90% of all transcripts terminate at this site. Transcripts which read through the +93 site quantitatively terminate at a fail-safe terminator located further downstream at +250. Inactivation of Rnt1p (an RNase III involved in processing the 3′ end of 25S rRNA) greatly stabilizes transcripts extending to both sites and increases readthrough at the +93 site. In vivo assay of mutants of the Reb1p terminator shows that this site operates in vivo by the same mechanism as has previously been delineated through in vitro studies. PMID:10523625

  19. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  20. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    PubMed

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  1. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    PubMed

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  2. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  3. Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    NASA Astrophysics Data System (ADS)

    Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

    2015-07-01

    The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

  4. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    PubMed

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  6. A multisite assessment of the quantitative capabilities of the Xpert MTB/RIF assay.

    PubMed

    Blakemore, Robert; Nabeta, Pamela; Davidow, Amy L; Vadwai, Viral; Tahirli, Rasim; Munsamy, Vanisha; Nicol, Mark; Jones, Martin; Persing, David H; Hillemann, Doris; Ruesch-Gerdes, Sabine; Leisegang, Felicity; Zamudio, Carlos; Rodrigues, Camilla; Boehme, Catharina C; Perkins, Mark D; Alland, David

    2011-11-01

    The Xpert MTB/RIF is an automated molecular test for Mycobacterium tuberculosis that estimates bacterial burden by measuring the threshold-cycle (Ct) of its M. tuberculosis-specific real-time polymerase chain reaction. Bacterial burden is an important biomarker for disease severity, infection control risk, and response to therapy. Evaluate bacterial load quantitation by Xpert MTB/RIF compared with conventional quantitative methods. Xpert MTB/RIF results were compared with smear-microscopy, semiquantiative solid culture, and time-to-detection in liquid culture for 741 patients and 2,008 samples tested in a multisite clinical trial. An internal control real-time polymerase chain reaction was evaluated for its ability to identify inaccurate quantitative Xpert MTB/RIF results. Assays with an internal control Ct greater than 34 were likely to be inaccurately quantitated; this represented 15% of M. tuberculosis-positive tests. Excluding these, decreasing M. tuberculosis Ct was associated with increasing smear microscopy grade for smears of concentrated sputum pellets (r(s) = -0.77) and directly from sputum (r(s) =-0.71). A Ct cutoff of approximately 27.7 best predicted smear-positive status. The association between M. tuberculosis Ct and time-to-detection in liquid culture (r(s) = 0.68) and semiquantitative colony counts (r(s) = -0.56) was weaker than smear. Tests of paired same-patient sputum showed that high viscosity sputum samples contained ×32 more M. tuberculosis than nonviscous samples. Comparisons between the grade of the acid-fast bacilli smear and Xpert MTB/RIF quantitative data across study sites enabled us to identify a site outlier in microscopy. Xpert MTB/RIF quantitation offers a new, standardized approach to measuring bacterial burden in the sputum of patients with tuberculosis.

  7. Prospective technical validation and assessment of intra-tumour heterogeneity of a low density array hypoxia gene profile in head and neck squamous cell carcinoma.

    PubMed

    Betts, Guy N J; Eustace, Amanda; Patiar, Shalini; Valentine, Helen R; Irlam, Joely; Ramachandran, Anassuya; Merve, Ashirwad; Homer, Jarrod J; Möller-Levet, Carla; Buffa, Francesca M; Hall, Gillian; Miller, Crispin J; Harris, Adrian L; West, Catharine M L

    2013-01-01

    Tumour hypoxia is associated with a poor prognosis in head and neck squamous cell carcinoma (HNSCC), however there is no accepted method for assessing hypoxia clinically. We aimed to conduct a technical validation of a hypoxia gene expression signature using the TaqMan Low Density Array (TLDA) platform to investigate if this approach reliably identified hypoxic tumours. Tumour samples (n=201) from 80 HNSCC patients were collected prospectively from two centres. Fifty-three patients received pimonidazole prior to surgery. TaqMan Low Density Array-Hypoxia Scores (TLDA-HS) were obtained by quantitative real-time PCR (qPCR) using a 25-gene signature and customised TLDA cards. Assay performance was assessed as coefficient of variation (CoV). The assay was sensitive with linear reaction efficiencies across a 4 log(10) range of inputted cDNA (0.001-10 ng/μl). Intra- (CoV=6.9%) and inter- (CoV=2.0%) assay reproducibility were excellent. Intra-tumour heterogeneity was lower for TLDA-HS (23.2%) than for pimonidazole (67.2%) or single gene measurements of CA9 (62.2%), VEGFA (45.0%) or HIG2 (39.4%). TLDA-HS in HNSCC cell lines increased with decreasing pO(2). TLDA-HS correlated with Affymetrix U133 Plus 2.0 microarray HS (p<0.01) and positive pimonidazole scores (p=0.005). Gene expression measurements of hypoxia using a 25-gene signature and TLDA cards are sensitive, reproducible and associated with lower intra-tumour heterogeneity than assaying individual genes or pimonidazole binding. The approach is suitable for further assessment of prognostic and predictive capability in clinical trial material. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Analytical Performance of a Multiplex Real-Time PCR Assay Using TaqMan Probes for Quantification of Trypanosoma cruzi Satellite DNA in Blood Samples

    PubMed Central

    Abate, Teresa; Cayo, Nelly M.; Parrado, Rudy; Bello, Zoraida Diaz; Velazquez, Elsa; Muñoz-Calderon, Arturo; Juiz, Natalia A.; Basile, Joaquín; Garcia, Lineth; Riarte, Adelina; Nasser, Julio R.; Ocampo, Susana B.; Yadon, Zaida E.; Torrico, Faustino; de Noya, Belkisyole Alarcón; Ribeiro, Isabela; Schijman, Alejandro G.

    2013-01-01

    Background The analytical validation of sensitive, accurate and standardized Real-Time PCR methods for Trypanosoma cruzi quantification is crucial to provide a reliable laboratory tool for diagnosis of recent infections as well as for monitoring treatment efficacy. Methods/Principal Findings We have standardized and validated a multiplex Real-Time quantitative PCR assay (qPCR) based on TaqMan technology, aiming to quantify T. cruzi satellite DNA as well as an internal amplification control (IAC) in a single-tube reaction. IAC amplification allows rule out false negative PCR results due to inhibitory substances or loss of DNA during sample processing. The assay has a limit of detection (LOD) of 0.70 parasite equivalents/mL and a limit of quantification (LOQ) of 1.53 parasite equivalents/mL starting from non-boiled Guanidine EDTA blood spiked with T. cruzi CL-Brener stock. The method was evaluated with blood samples collected from Chagas disease patients experiencing different clinical stages and epidemiological scenarios: 1- Sixteen Venezuelan patients from an outbreak of oral transmission, 2- Sixty three Bolivian patients suffering chronic Chagas disease, 3- Thirty four Argentinean cases with chronic Chagas disease, 4- Twenty seven newborns to seropositive mothers, 5- A seronegative receptor who got infected after transplantation with a cadaveric kidney explanted from an infected subject. Conclusions/Significance The performing parameters of this assay encourage its application to early assessment of T. cruzi infection in cases in which serological methods are not informative, such as recent infections by oral contamination or congenital transmission or after transplantation with organs from seropositive donors, as well as for monitoring Chagas disease patients under etiological treatment. PMID:23350002

  9. Quantitative real-time RT-PCR assay for research studies on enterovirus infections in the central nervous system.

    PubMed

    Volle, Romain; Nourrisson, Céline; Mirand, Audrey; Regagnon, Christel; Chambon, Martine; Henquell, Cécile; Bailly, Jean-Luc; Peigue-Lafeuille, Hélène; Archimbaud, Christine

    2012-10-01

    Human enteroviruses are the most frequent cause of aseptic meningitis and are involved in other neurological infections. Qualitative detection of enterovirus genomes in cerebrospinal fluid is a prerequisite in diagnosing neurological diseases. The pathogenesis of these infections is not well understood and research in this domain would benefit from the availability of a quantitative technique to determine viral load in clinical specimens. This study describes the development of a real-time RT-qPCR assay using hydrolysis TaqMan probe and a competitive RNA internal control. The assay has high specificity and can be used for a large sample of distinct enterovirus strains and serotypes. The reproducible limit of detection was estimated at 1875 copies/ml of quantitative standards composed of RNA transcripts obtained from a cloned echovirus 30 genome. Technical performance was unaffected by the introduction of a competitive RNA internal control before RNA extraction. The mean enterovirus RNA concentration in an evaluation series of 15 archived cerebrospinal fluid specimens was determined at 4.78 log(10)copies/ml for the overall sample. The sensitivity and reproducibility of the real time RT-qPCR assay used in combination with the internal control to monitor the overall specimen process make it a valuable tool with applied research into enterovirus infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    USGS Publications Warehouse

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  11. A real-time, quantitative PCR protocol for assessing the relative parasitemia of Leucocytozoon in waterfowl

    USGS Publications Warehouse

    Smith, Matthew M.; Schmutz, Joel A.; Apelgren, Chloe; Ramey, Andy M.

    2015-01-01

    Microscopic examination of blood smears can be effective at diagnosing and quantifying hematozoa infections. However, this method requires highly trained observers, is time consuming, and may be inaccurate for detection of infections at low levels of parasitemia. To develop a molecular methodology for identifying and quantifying Leucocytozoon parasite infection in wild waterfowl (Anseriformes), we designed a real-time, quantitative PCR protocol to amplify Leucocytozoon mitochondrial DNA using TaqMan fluorogenic probes and validated our methodology using blood samples collected from waterfowl in interior Alaska during late summer and autumn (n = 105). By comparing our qPCR results to those derived from a widely used nested PCR protocol, we determined that our assay showed high levels of sensitivity (91%) and specificity (100%) in detecting Leucocytozoon DNA from host blood samples. Additionally, results of a linear regression revealed significant correlation between the raw measure of parasitemia produced by our qPCR assay (Ct values) and numbers of parasites observed on blood smears (R2 = 0.694, P = 0.003), indicating that our assay can reliably determine the relative parasitemia levels among samples. This methodology provides a powerful new tool for studies assessing effects of haemosporidian infection in wild avian species.

  12. Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

    EPA Science Inventory

    Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

  13. Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

    PubMed

    Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

    2010-01-01

    Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

  14. Microfluidic droplet enrichment for targeted sequencing

    PubMed Central

    Eastburn, Dennis J.; Huang, Yong; Pellegrino, Maurizio; Sciambi, Adam; Ptáček, Louis J.; Abate, Adam R.

    2015-01-01

    Targeted sequence enrichment enables better identification of genetic variation by providing increased sequencing coverage for genomic regions of interest. Here, we report the development of a new target enrichment technology that is highly differentiated from other approaches currently in use. Our method, MESA (Microfluidic droplet Enrichment for Sequence Analysis), isolates genomic DNA fragments in microfluidic droplets and performs TaqMan PCR reactions to identify droplets containing a desired target sequence. The TaqMan positive droplets are subsequently recovered via dielectrophoretic sorting, and the TaqMan amplicons are removed enzymatically prior to sequencing. We demonstrated the utility of this approach by generating an average 31.6-fold sequence enrichment across 250 kb of targeted genomic DNA from five unique genomic loci. Significantly, this enrichment enabled a more comprehensive identification of genetic polymorphisms within the targeted loci. MESA requires low amounts of input DNA, minimal prior locus sequence information and enriches the target region without PCR bias or artifacts. These features make it well suited for the study of genetic variation in a number of research and diagnostic applications. PMID:25873629

  15. Association between enteropathogens and malnutrition in children aged 6-23 mo in Bangladesh: a case-control study.

    PubMed

    Platts-Mills, James A; Taniuchi, Mami; Uddin, Md Jashim; Sobuz, Shihab Uddin; Mahfuz, Mustafa; Gaffar, Sm Abdul; Mondal, Dinesh; Hossain, Md Iqbal; Islam, M Munirul; Ahmed, Am Shamsir; Petri, William A; Haque, Rashidul; Houpt, Eric R; Ahmed, Tahmeed

    2017-05-01

    Background: Early exposure to enteropathogens has been associated with malnutrition in children in low-resource settings. However, the contribution of individual enteropathogens remains poorly defined. Molecular diagnostics offer an increase in sensitivity for detecting enteropathogens but have not been comprehensively applied to studies of malnutrition. Objective: We sought to identify enteropathogens associated with malnutrition in Bangladesh. Design: Malnourished children [weight-for-age z score (WAZ) <-2] aged 6-23 mo in Dhaka, Bangladesh, and identified by active community surveillance were enrolled as cases, and normal-weight children (WAZ >-1) of the same age and from the same community were enrolled as controls. Stools were collected at enrollment and, for cases, after a 5-mo nutritional intervention. Enrollment and follow-up stools were tested by quantitative polymerase chain reaction for 32 enteropathogens with the use of a custom-developed TaqMan Array Card. Results: Enteropathogen testing was performed on 486 cases and 442 controls upon enrollment and 365 cases at follow-up. At enrollment, the detection of enteroaggregative Escherichia coli (OR: 1.39; 95% CI: 1.05, 1.83), Campylobacter spp. (OR: 1.46; 95% CI: 1.11, 1.91), heat-labile enterotoxin-producing E. coli (OR: 1.55; 95% CI: 1.04, 2.33), Shigella /enteroinvasive E. coli (OR: 1.65; 95% CI: 1.10, 2.46), norovirus genogroup I (OR: 1.66; 95% CI: 1.23, 2.25), and Giardia (OR: 1.73; 95% CI: 1.20, 2.49) were associated with malnourished cases, and the total burden of these pathogens remained associated with malnutrition after adjusting for sociodemographic factors. The number of these pathogens at follow-up was negatively associated with the change in WAZ during the intervention (-0.10 change in WAZ per pathogen detected; 95% CI: -0.14, -0.06), whereas the number at enrollment was positively associated with the change in WAZ (0.05 change in WAZ per pathogen detected; 95% CI: 0.00, 0.10). Conclusions: A subset of enteropathogens was associated with malnutrition in this setting. Broad interventions designed to reduce the burden of infection with these pathogens are needed. This trial was registered at clinicaltrials.gov as NCT02441426.

  16. Polymorphisms in Arsenic(+III Oxidation State) Methyltransferase (AS3MT) Predict Gene Expression of AS3MT as Well as Arsenic Metabolism

    PubMed Central

    Engström, Karin; Vahter, Marie; Mlakar, Simona Jurkovic; Concha, Gabriela; Nermell, Barbro; Raqib, Rubhana; Cardozo, Alejandro; Broberg, Karin

    2011-01-01

    Background Arsenic (As) occurs as monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA) in humans, and the methylation pattern demonstrates large interindividual differences. The fraction of urinary MMA is a marker for susceptibility to As-related diseases. Objectives We evaluated the impact of polymorphisms in five methyltransferase genes on As metabolism in two populations, one in South America and one in Southeast Asia. The methyltransferase genes were arsenic(+III oxidation state) methyltransferase (AS3MT), DNA-methyltransferase 1a and 3b (DNMT1a and DNMT3b, respectively), phosphatidylethanolamine N-methyltransferase (PEMT), and betaine-homocysteine methyltransferase (BHMT). AS3MT expression was analyzed in peripheral blood. Methods Subjects were women exposed to As in drinking water in the Argentinean Andes [n = 172; median total urinary As (U-As), 200 μg/L] and in rural Bangladesh (n = 361; U-As, 100 μg/L; all in early pregnancy). Urinary As metabolites were measured by high-pressure liquid chromatography/inductively coupled plasma mass spectrometry. Polymorphisms (n = 22) were genotyped with Sequenom, and AS3MT expression was measured by quantitative real-time polymerase chain reaction using TaqMan expression assays. Results Six AS3MT polymorphisms were significantly associated with As metabolite patterns in both populations (p ≤ 0.01). The most frequent AS3MT haplotype in Bangladesh was associated with a higher percentage of MMA (%MMA), and the most frequent haplotype in Argentina was associated with a lower %MMA and a higher percentage of DMA. Four polymorphisms in the DNMT genes were associated with metabolite patterns in Bangladesh. Noncoding AS3MT polymorphisms affected gene expression of AS3MT in peripheral blood, demonstrating that one functional impact of AS3MT polymorphisms may be altered levels of gene expression. Conclusions Polymorphisms in AS3MT significantly predicted As metabolism across these two very different populations, suggesting that AS3MT may have an impact on As metabolite patterns in populations worldwide. PMID:21247820

  17. Sex differences in metabolic aging of the brain: insights into female susceptibility to Alzheimer's disease.

    PubMed

    Zhao, Liqin; Mao, Zisu; Woody, Sarah K; Brinton, Roberta D

    2016-06-01

    Despite recent advances in the understanding of clinical aspects of sex differences in Alzheimer's disease (AD), the underlying mechanisms, for instance, how sex modifies AD risk and why the female brain is more susceptible to AD, are not clear. The purpose of this study is to elucidate sex disparities in brain aging profiles focusing on 2 major areas-energy and amyloid metabolism-that are most significantly affected in preclinical development of AD. Total RNA isolated from hippocampal tissues of both female and male 129/C57BL/6 mice at ages of 6, 9, 12, or 15 months were comparatively analyzed by custom-designed Taqman low-density arrays for quantitative real-time polymerase chain reaction detection of a total of 182 genes involved in a broad spectrum of biological processes modulating energy production and amyloid homeostasis. Gene expression profiles revealed substantial differences in the trajectory of aging changes between female and male brains. In female brains, 44.2% of genes were significantly changed from 6 months to 9 months and two-thirds showed downregulation. In contrast, in male brains, only 5.4% of genes were significantly altered at this age transition. Subsequent changes in female brains were at a much smaller magnitude, including 10.9% from 9 months to 12 months and 6.1% from 12 months to 15 months. In male brains, most changes occurred from 12 months to 15 months and the majority were upregulated. Furthermore, gene network analysis revealed that clusterin appeared to serve as a link between the overall decreased bioenergetic metabolism and increased amyloid dyshomeostasis associated with the earliest transition in female brains. Together, results from this study indicate that: (1) female and male brains follow profoundly dissimilar trajectories as they age; (2) female brains undergo age-related changes much earlier than male brains; (3) early changes in female brains signal the onset of a hypometabolic phenotype at risk for AD. These findings provide a mechanistic rationale for female susceptibility to AD and suggest a potential window of opportunity for AD prevention and risk reduction in women. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Quantitative polymerase chain reaction for transforming growth factor-β applied to a field study of fish health in Chesapeake Bay tributaries

    USGS Publications Warehouse

    Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.

    2000-01-01

    Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.

  19. Detection of Legionella by cultivation and quantitative real-time polymerase chain reaction in biological waste water treatment plants in Norway.

    PubMed

    Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase

    2014-09-01

    Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.

  20. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    PubMed

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  1. Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

    PubMed

    Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

    2016-01-01

    Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  2. Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR

    PubMed Central

    2010-01-01

    Background Human papillomaviruses (HPVs) remain a serious world health problem due to their association with anogenital/oral cancers and warts. While over 100 HPV types have been identified, a subset is associated with malignancy. HPV16 and 18 are the most prevalent oncogenic types, while HPV6 and 11 are most commonly responsible for anogenital warts. While other quantitative PCR (qPCR) assays detect oncogenic HPV, there is no single tube assay distinguishing the most frequent oncogenic types and the most common types found in warts. Results A Sybr Green-based qPCR assay was developed utilizing degenerate primers to the highly conserved HPV E1 theoretically detecting any HPV type. A single tube multiplex qPCR assay was also developed using type-specific primer pairs and TaqMan probes that allowed for detection and quantitation of HPV6,11,16,18. Each HPV type was detected over a range from 2 × 101 to 2 × 106copies/reaction providing a reliable method of quantitating type-specific HPV in 140 anogenital/cutaneous/oral benign and malignant specimens. 35 oncogenic and low risk alpha genus HPV types were detected. Concordance was detected in previously typed specimens. Comparisons to the gold standard detected an overall sensitivity of 89% (95% CI: 77% - 96%) and specificity of 90% (95%CI: 52% - 98%). Conclusion There was good agreement between the ability of the qPCR assays described here to identify HPV types in malignancies previously typed using standard methods. These novel qPCR assays will allow rapid detection and quantitation of HPVs to assess their role in viral pathogenesis. PMID:20723234

  3. Discordances with HIV-1 RNA quantitative determinations by three commercial assays in Pointe Noire, Republic of Congo.

    PubMed

    Bruzzone, Bianca; Bisio, Francesca; Caligiuri, Patrizia; Mboungou, Franc A Mayinda; Nigro, Nicola; Sticchi, Laura; Ventura, Agostina; Saladini, Francesco; Zazzi, Maurizio; Icardi, Giancarlo; Viscoli, Claudio

    2014-07-01

    Accurate HIV-1 RNA quantitation is required to support the scale up of antiretroviral therapy in African countries. Extreme HIV-1 genetic variability in Africa may affect the ability of commercially available assays to detect and quantify HIV-1 RNA accurately. The aim of this study was to compare three real-time PCR assays for quantitation of plasma HIV-1 RNA levels in patients from the Republic of Congo, an area with highly diversified HIV-1 subtypes and recombinants. The Abbott RealTime HIV-1, BioMérieux HIV-1 EasyQ test 1.2 and Cobas AmpliPrep/Cobas TaqMan HIV-1 1.0 were compared for quantitation of HIV-1 RNA in 37 HIV-1 seropositive pregnant women enrolled in the Kento-Mwana project for prevention of mother-to-child transmission in Pointe-Noire, Republic of Congo. The sample panel included a variety of HIV-1 subtypes with as many as 21 (56.8%) putative unique recombinant forms. Qualitative detection of HIV-1 RNA was concordant by all three assays in 33/37 (89.2%) samples. Of the remaining 4 (10.8%) samples, all were positive by Roche, three by Abbott and none by BioMérieux. Differences exceeding 1Log in positive samples were found in 4/31 (12.9%), 10/31 (32.3%) and 5/31 (16.1%) cases between Abbott and BioMérieux, Roche and BioMérieux, and Abbott and Roche, respectively. In this sample panel representative of highly polymorphic HIV-1 in Congo, the agreement among the three assays was moderate in terms of HIV-1 RNA detectability and rather inconsistent in terms of quantitation. Copyright © 2014. Published by Elsevier B.V.

  4. Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark

    PubMed Central

    Jensen, Anders; Hansen, Thomas M.; Søby, Karen M.; Prag, Jørgen

    2010-01-01

    Actinobaculum schaalii can cause urinary tract infections and septicemia but is difficult to identify by cultivation. To obtain a fast diagnosis and identify A. schaalii, we developed a TaqMan real-time quantitative PCR. Routine urine samples were obtained from 177 hospitalized patients and 75 outpatients in Viborg County, Denmark, in 2008–2009. The PCR detected A. schaalii in 22% of samples from patients >60 years of age. This assay showed that A. schaalii is more common than implied by routine cultivation. In 90% of PCR-positive urine samples, other common uropathogens were identified. This finding suggests that A. schaalii is a common, undetected, bacterial pathogen. Our results suggest that A. schaalii may be a more common pathogen than previously thought, especially in patients with unexplained chronic urinary tract infections, who are often treated with trimethoprim or ciprofloxacin, to which A. schaalii is resistant. PMID:20031046

  5. PCR Based Microbial Monitor for Analysis of Recycled Water Aboard the ISSA: Issues and Prospects

    NASA Technical Reports Server (NTRS)

    Cassell, Gail H.; Lefkowitz, Elliot J.; Glass, John I.

    1995-01-01

    The monitoring of spacecraft life support systems for the presence of health threatening microorganisms is paramount for crew well being and successful completion of missions. Development of technology to monitor spacecraft recycled water based on detection and identification of the genetic material of contaminating microorganisms and viruses would be a substantial improvement over current NASA plans to monitor recycled water samples that call for the use of conventional microbiology techniques which are slow, insensitive, and labor intensive. The union of the molecular biology techniques of DNA probe hybridization and polymerase chain reaction (PCR) offers a powerful method for the detection, identification, and quantification of microorganisms and viruses. This technology is theoretically capable of assaying samples in as little as two hours with specificity and sensitivity unmatched by any other method. A major advance in probe-hybridization/PCR has come about in a technology called TaqMan(TM), which was invented by Perkin Elmer. Instrumentation using TaqMan concepts is evolving towards devices that could meet NASA's needs of size, low power use, and simplicity of operation. The chemistry and molecular biology needed to utilize these probe-hybridization/PCR instruments must evolve in parallel with the hardware. The following issues of chemistry and biology must be addressed in developing a monitor: Early in the development of a PCR-based microbial monitor it will be necessary to decide how many and which organisms does the system need the capacity to detect. We propose a set of 17 different tests that would detect groups of bacteria and fungus, as well as specific eukaryotic parasites and viruses; In order to use the great sensitivity of PCR it will be necessary to concentrate water samples using filtration. If a lower limit of detection of 1 microorganism per 100 ml is required then the microbes in a 100 ml sample must be concentrated into a volume that can be added to a PCR assay; There are not likely to be contaminants in ISSA recycled water that would inhibit PCR resulting in false-negative results; The TaqMan PCR product detection system is the most promising method for developing a rapid, highly automated gene-based microbial monitoring system. The method is inherently quantitative. NASA and other government agencies have invested in other technologies that, although potentially could lead to revolutionary advances, are not likely to mature in the next 5 years into working systems; PCR-based methods cannot distinguish between DNA or RNA of a viable microorganism and that of a non-viable organism. This may or may not be an important issue with reclaimed water on the ISSA. The recycling system probably damages the capacity of the genetic material of any bacteria or viruses killed during processing to serve as a template in a PCR desinged to amplify a large segment of DNA (less than 650 base pairs). If necessary, vital dye staining could be used in addition to PCR, to enumerate the viable cells in a water sample; The quality control methods have been developed to insure that PCR's are working properly, and that reactions are not contaminated with PCR carryover products which could lead to the generation of false-positive results; and The sequences of the small rRNA subunit gene for a large number of microorganisms are known, and they consititue the best database for rational development of the oligonucleotide reagents that give PCR its great specificity. From those gene sequences, sets of oligonucleotide primers for PCR and Taqman detection that could be used in a NASA microbial monitor were constructed using computer based methods. In addition to space utilization, a microbial monitior will have tremendous terrestrial applications. Analysis of patient samples for microbial pathogens, testing industrial effluent for biofouling bacteria, and detection biological warfare agents on the battlefield are but a few of the diverse potential uses for this technology. Once fully developed, gene-based microbial monitors will become the fundamental tool in every lab that tests for microbial contaminants, and serve as a powerful weapon in mankind's war with the germ world.

  6. Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

    EPA Science Inventory

    EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

  7. MATERIALS SUPPORTING THE NEW RECREATIONAL WATER QUALITY CRITERIA FOR PATHOGENS

    EPA Science Inventory

    EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures...

  8. 77 FR 71191 - 2012 Recreational Water Quality Criteria

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-29

    ... Criteria AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of availability of the 2012... for beach monitoring, quantitative polymerase chain reaction (qPCR), for the detection of enterococci... managing recreational waters, such as predictive modeling; the EPA is providing a beach action value for...

  9. Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

    PubMed

    Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

    2018-05-01

    Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Evaluation of p16 hypermethylation in oral submucous fibrosis: A quantitative and comparative analysis in buccal cells and saliva using real-time methylation-specific polymerase chain reaction.

    PubMed

    Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian

    2016-01-01

    The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.

  11. Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

    PubMed

    Hamlet, Stephen M

    2010-01-01

    The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

  12. No Association Between Variant N-acetyltransferase Genes, Cigarette Smoking and Prostate Cancer Susceptibility Among Men of African Descent

    PubMed Central

    Kidd, La Creis Renee; VanCleave, Tiva T.; Doll, Mark A.; Srivastava, Daya S.; Thacker, Brandon; Komolafe, Oyeyemi; Pihur, Vasyl; Brock, Guy N.; Hein, David W.

    2011-01-01

    Objective We evaluated the individual and combination effects of NAT1, NAT2 and tobacco smoking in a case-control study of 219 incident prostate cancer (PCa) cases and 555 disease-free men. Methods Allelic discriminations for 15 NAT1 and NAT2 loci were detected in germ-line DNA samples using Taqman polymerase chain reaction (PCR) assays. Single gene, gene-gene and gene-smoking interactions were analyzed using logistic regression models and multi-factor dimensionality reduction (MDR) adjusted for age and subpopulation stratification. MDR involves a rigorous algorithm that has ample statistical power to assess and visualize gene-gene and gene-environment interactions using relatively small samples sizes (i.e., 200 cases and 200 controls). Results Despite the relatively high prevalence of NAT1*10/*10 (40.1%), NAT2 slow (30.6%), and NAT2 very slow acetylator genotypes (10.1%) among our study participants, these putative risk factors did not individually or jointly increase PCa risk among all subjects or a subset analysis restricted to tobacco smokers. Conclusion Our data do not support the use of N-acetyltransferase genetic susceptibilities as PCa risk factors among men of African descent; however, subsequent studies in larger sample populations are needed to confirm this finding. PMID:21709725

  13. Genome-wide copy number variation (CNV) in patients with autoimmune Addison's disease

    PubMed Central

    2011-01-01

    Background Addison's disease (AD) is caused by an autoimmune destruction of the adrenal cortex. The pathogenesis is multi-factorial, involving genetic components and hitherto unknown environmental factors. The aim of the present study was to investigate if gene dosage in the form of copy number variation (CNV) could add to the repertoire of genetic susceptibility to autoimmune AD. Methods A genome-wide study using the Affymetrix GeneChip® Genome-Wide Human SNP Array 6.0 was conducted in 26 patients with AD. CNVs in selected genes were further investigated in a larger material of patients with autoimmune AD (n = 352) and healthy controls (n = 353) by duplex Taqman real-time polymerase chain reaction assays. Results We found that low copy number of UGT2B28 was significantly more frequent in AD patients compared to controls; conversely high copy number of ADAM3A was associated with AD. Conclusions We have identified two novel CNV associations to ADAM3A and UGT2B28 in AD. The mechanism by which this susceptibility is conferred is at present unclear, but may involve steroid inactivation (UGT2B28) and T cell maturation (ADAM3A). Characterization of these proteins may unravel novel information on the pathogenesis of autoimmunity. PMID:21851588

  14. A real-time PCR approach to detect predation on anchovy and sardine early life stages

    NASA Astrophysics Data System (ADS)

    Cuende, Elsa; Mendibil, Iñaki; Bachiller, Eneko; Álvarez, Paula; Cotano, Unai; Rodriguez-Ezpeleta, Naiara

    2017-12-01

    Recruitment of sardine (Sardina pilchardus Walbaum, 1792) and anchovy (Engraulis encrasicolus Linnaeus, 1758) is thought to be regulated by predation of their eggs and larvae. Predators of sardine and anchovy can be identified by visual taxonomic identification of stomach contents, but this method is time consuming, tedious and may underestimate predation, especially in small predators such as fish larvae. Alternatively, genetic tools may offer a more cost-effective and accurate alternative. Here, we have developed a multiplex real-time polymerase chain reaction (RT-PCR) assay based on TaqMan probes to simultaneously detect sardine and anchovy remains in gut contents of potential predators. The assay combines previously described and newly generated species-specific primers and probes for anchovy and sardine detection respectively, and allows the detection of 0,001 ng of target DNA (which corresponds to about one hundredth of the total DNA present in a single egg). We applied the method to candidate anchovy and sardine egg predators in the Bay of Biscay, Atlantic Mackerel (Scomber scombrus) larvae. Egg predation observed was limited primarily to those stations where sardine and/or anchovy eggs were present. Our developed assay offers a suitable tool to understand the effects of predation on the survival of anchovy and sardine early life stages.

  15. Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

    PubMed Central

    MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

    2016-01-01

    Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

  16. Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

    PubMed

    Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

    2012-08-01

    Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

  17. Prevalence of Bartonella infection in wild African lions (Panthera leo) and cheetahs (Acinonyx jubatus).

    PubMed

    Molia, S; Chomel, B B; Kasten, R W; Leutenegger, C M; Steele, B R; Marker, L; Martenson, J S; Keet, D F; Bengis, R G; Peterson, R P; Munson, L; O'Brien, S J

    2004-05-20

    Bartonella species are emerging pathogens that have been isolated worldwide from humans and other mammals. Our objective was to estimate the prevalence of Bartonella infection in free-ranging African lions (Panthera leo) and cheetahs (Acinonyx jubatus). Blood and/or serum samples were collected from a convenience sample of 113 lions and 74 cheetahs captured in Africa between 1982 and 2002. Whole blood samples available from 58 of the lions and 17 of the cheetahs were cultured for evidence of Bartonella spp., and whole blood from 54 of the 58 lions and 73 of the 74 cheetahs tested for the presence of Bartonella DNA by TaqMan PCR. Serum samples from the 113 lions and 74 cheetahs were tested for the presence of antibodies against Bartonella henselae using an immunofluorescence assay. Three (5.2%) of the 58 lions and one (5.9%) of the 17 cheetahs were bacteremic. Two lions were infected with B. henselae, based on PCR/RFLP of the citrate synthase gene. The third lion and the cheetah were infected with previously unidentified Bartonella strains. Twenty-three percent of the 73 cheetahs and 3.7% of the 54 lions tested by TaqMan PCR were positive for Bartonella spp. B. henselae antibody prevalence was 17% (19/113) for the lions and 31% (23/74) for the cheetahs. The prevalence of seropositivity, bacteremia, and positive TaqMan PCR was not significantly different between sexes and age categories (juvenile versus adult) for both lions and cheetahs. Domestic cats are thus no longer the only known carriers of Bartonella spp. in Africa. Translocation of B. henselae seronegative and TaqMan PCR negative wild felids might be effective in limiting the spread of Bartonella infection.

  18. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    PubMed

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  19. A Pilot Study of the Noninvasive Assessment of the Lung Microbiota as a Potential Tool for the Early Diagnosis of Ventilator-Associated Pneumonia

    PubMed Central

    Brady, Jacob S.; Romano-Keeler, Joann; Drake, Wonder P.; Norris, Patrick R.; Jenkins, Judith M.; Isaacs, Richard J.; Boczko, Erik M.

    2015-01-01

    BACKGROUND: Ventilator-associated pneumonia (VAP) remains a common complication in critically ill surgical patients, and its diagnosis remains problematic. Exhaled breath contains aerosolized droplets that reflect the lung microbiota. We hypothesized that exhaled breath condensate fluid (EBCF) in hygroscopic condenser humidifier/heat and moisture exchanger (HCH/HME) filters would contain bacterial DNA that qualitatively and quantitatively correlate with pathogens isolated from quantitative BAL samples obtained for clinical suspicion of pneumonia. METHODS: Forty-eight adult patients who were mechanically ventilated and undergoing quantitative BAL (n = 51) for suspected pneumonia in the surgical ICU were enrolled. Per protocol, patients fulfilling VAP clinical criteria undergo quantitative BAL bacterial culture. Immediately prior to BAL, time-matched HCH/HME filters were collected for study of EBCF by real-time polymerase chain reaction. Additionally, convenience samples of serially collected filters in patients with BAL-diagnosed VAP were analyzed. RESULTS: Forty-nine of 51 time-matched EBCF/BAL fluid samples were fully concordant (concordance > 95% by κ statistic) relative to identified pathogens and strongly correlated with clinical cultures. Regression analysis of quantitative bacterial DNA in paired samples revealed a statistically significant positive correlation (r = 0.85). In a convenience sample, qualitative and quantitative polymerase chain reaction analysis of serial HCH/HME samples for bacterial DNA demonstrated an increase in load that preceded the suspicion of pneumonia. CONCLUSIONS: Bacterial DNA within EBCF demonstrates a high correlation with BAL fluid and clinical cultures. Bacterial DNA within EBCF increases prior to the suspicion of pneumonia. Further study of this novel approach may allow development of a noninvasive tool for the early diagnosis of VAP. PMID:25474571

  20. Investigation of specific interactions between T7 promoter and T7 RNA polymerase by force spectroscopy using atomic force microscope.

    PubMed

    Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong

    2018-01-11

    The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  1. *A FASTER METHOD OF MEASURING RECREATIONAL WATER QUALITY FOR BETTER PROTECTION OF SWIMMER'S HEALTH

    EPA Science Inventory

    We previously reported that a faster method (< 2 hours) of measuring fecal indicator bacteria (FIB), based on Quantitative Polymerase Chain Reaction (QPCR), was predictive of swimming associated gastrointestinal illness. Using data from two additional beaches, we examined the re...

  2. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  3. Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

    PubMed

    Treff, Nathan R; Scott, Richard T

    2013-03-15

    Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

    PubMed Central

    Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

    2009-01-01

    Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

  5. Detection of eastern equine encephalomyelitis virus RNA in North American snakes.

    PubMed

    Bingham, Andrea M; Graham, Sean P; Burkett-Cadena, Nathan D; White, Gregory S; Hassan, Hassan K; Unnasch, Thomas R

    2012-12-01

    The role of non-avian vertebrates in the ecology of eastern equine encephalomyelitis virus (EEEV) is unresolved, but mounting evidence supports a potential role for snakes in the EEEV transmission cycle, especially as over-wintering hosts. To determine rates of exposure and infection, we examined serum samples from wild snakes at a focus of EEEV in Alabama for viral RNA using quantitative reverse transcription polymerase chain reaction. Two species of vipers, the copperhead (Agkistrodon contortrix) and the cottonmouth (Agkistrodon piscivorus), were found to be positive for EEEV RNA using this assay. Prevalence of EEEV RNA was more frequent in seropositive snakes than seronegative snakes. Positivity for the quantitative reverse transcription polymerase chain reaction in cottonmouths peaked in April and September. Body size and sex ratios were not significantly different between infected and uninfected snakes. These results support the hypothesis that snakes are involved in the ecology of EEEV in North America, possibly as over-wintering hosts for the virus.

  6. A polymerase chain reaction strategy for the diagnosis of camelpox.

    PubMed

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  7. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  8. Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue.

    PubMed

    Miles, Timothy D; Martin, Frank N; Coffey, Michael D

    2015-02-01

    Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing, thereby reducing the time necessary for accurate diagnostics and making management decisions.

  9. Development of 20 TaqMan assays differentiating the endangered shortnose and Lost River suckers

    USGS Publications Warehouse

    Hoy, Marshal S.; Ostberg, Carl O.

    2015-01-01

    Accurate species identification is vital to conservation and management of species at risk. Species identification is challenging when taxa express similar phenotypic characters and form hybrids, for example the endangered shortnose sucker (Chasmistes brevirostris) and Lost River sucker (Deltistes luxatus). Here, we developed 20 Taqman assays that differentiate these species (19 nuclear DNA and one mitochondrial DNA). Assays were evaluated in 160 young-of-the-year identified to species using meristic counts. Alleles were not fixed between species, but species were highly differentiated (F ST = 0.753, P < 0.001). The assays developed herein will be a valuable tool for resource managers.

  10. Real-time PCR for type-specific identification of herpes simplex in clinical samples: evaluation of type-specific results in the context of CNS diseases.

    PubMed

    Meylan, Sylvain; Robert, Daniel; Estrade, Christine; Grimbuehler, Valérie; Péter, Olivier; Meylan, Pascal R; Sahli, Roland

    2008-02-01

    HSV-1 and HSV-2 cause CNS infections of dissimilar clinico-pathological characteristics with prognostic and therapeutic implications. To validate a type-specific real-time PCR that uses MGB/LNA Taqman probes and to review the virologico-clinical data of 25 eligible patients with non-neonatal CNS infections. This real-time PCR was evaluated against conventional PCR (26 CSF and 20 quality controls), and LightCycler assay (51 mucocutaneous, 8 CSF and 32 quality controls) and culture/immunofluorescence (75 mucocutaneous) to assess typing with independent methods. Taqman real-time PCR detected 240 HSV genomes per ml CSF, a level appropriate for the management of patients, and provided unambiguous typing for the 104 positive (62 HSV-1 and 42 HSV-2) out the 160 independent clinical samples tested. HSV type diagnosed by Taqman real-time PCR predicted final diagnosis (meningitis versus encephalitis/meningoencephalitis, p<0.001) in 24/25 patients at time of presentation, in contrast to clinical evaluation. Our real-time PCR, as a sensitive and specific means for type-specific HSV diagnosis, provided rapid prognostic information for patient management.

  11. Identification and genetic analysis of cancer cells with PCR-activated cell sorting

    PubMed Central

    Eastburn, Dennis J.; Sciambi, Adam; Abate, Adam R.

    2014-01-01

    Cell sorting is a central tool in life science research for analyzing cellular heterogeneity or enriching rare cells out of large populations. Although methods like FACS and FISH-FC can characterize and isolate cells from heterogeneous populations, they are limited by their reliance on antibodies, or the requirement to chemically fix cells. We introduce a new cell sorting technology that robustly sorts based on sequence-specific analysis of cellular nucleic acids. Our approach, PCR-activated cell sorting (PACS), uses TaqMan PCR to detect nucleic acids within single cells and trigger their sorting. With this method, we identified and sorted prostate cancer cells from a heterogeneous population by performing >132 000 simultaneous single-cell TaqMan RT-PCR reactions targeting vimentin mRNA. Following vimentin-positive droplet sorting and downstream analysis of recovered nucleic acids, we found that cancer-specific genomes and transcripts were significantly enriched. Additionally, we demonstrate that PACS can be used to sort and enrich cells via TaqMan PCR reactions targeting single-copy genomic DNA. PACS provides a general new technical capability that expands the application space of cell sorting by enabling sorting based on cellular information not amenable to existing approaches. PMID:25030902

  12. SWIMMING ASSOCIATED ILLNESS AND RAPID MEASURES OF WATER QUALITY AT A GULF BEACH

    EPA Science Inventory

    Studies at Great Lakes beaches have provided evidence that faster ways of measuring the fecal indicator bacteria (FIB) Enterococcus using quantitative polymerase chain reaction (qPCR) are predictive of swimming associated illness. In 2005 we conducted an epidemiology study to eva...

  13. RAPID MONITORING BY QPCR FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polymerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventi...

  14. Clusters of antibiotic resistance genes enriched together stay together in swine agriculture

    USDA-ARS?s Scientific Manuscript database

    Antibiotic resistance has developed into a worldwide health risk. The nature and extent of the contribution of animal agriculture to the evolution of antibiotic resistance in bacterial communities remains unclear. Using quantitative polymerase chain reaction (PCR) in tandem with next-generation sequ...

  15. RECREATIONAL BEACH WATER QUALITY MONITORING WITH QUANTITATIVE POLYMERASE CHAIN

    EPA Science Inventory

    Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in monitoring the water at these beaches for fecal indicator bacteria as a means of determining if it is safe for pu...

  16. Detection and quantification limits of the EPA Enterococcus qPCR method

    EPA Science Inventory

    The U.S. EPA will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality in 2013 and has published preliminary proposed water quality criteria guidelines for the method. An im...

  17. Development of a quantitative real-time PCR assay for sapovirus in children under 5-years-old in Regina Margherita Hospital of Turin, Italy.

    PubMed

    Bergallo, Massimiliano; Galliano, Ilaria; Montanari, Paola; Brusin, Martina Rosa; Finotti, Serena; Paderi, Giulia; Gabiano, Clara

    2017-04-01

    Gastroenteritis is a common disease in children. It is characterized by diarrhea, vomiting, abdominal pain, and fever. Sapovirus (SaV) is a causative agent of acute gastroenteritis, but it causes milder illness than do rotavirus and norovirus. There is high variability in the analytical performance of quantitative PCR-based assays among clinical laboratories. This study developed a reverse transcription real-time PCR method to detect SaV in fecal specimens collected from children under 5-years-old with acute gastroenteritis. Of 137 episodes of acute gastroenteritis, 15 (10.9%) were associated with SaV genomic detection, with a median viral load of 6.6(log 10 ) ± 7.1(log 10 ) genomes/mg fecal specimens. There was a significant difference in detection rate between males and females (9.48% (13/15) vs. 1.46% (2/15), p = 0.0232). Among the 15 SaV-positive cases, 6 were also positive for rotavirus. Viral RNA recovery rate ranged from 46% to 77% in the manual RNAzol protocol and from 31% to 90% in the automated Maxwell protocol. We also studied whether human genomic DNA influences the sensitivity of the assay: its presence caused a decrease in PCR sensitivity. The development of a laboratory-designed real-time PCR TaqMan assay for quantitative detection of SaV and the optimization and standardization of this assay, using stools of children with acute gastroenteritis, are described.

  18. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    USGS Publications Warehouse

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  19. Detection of growth hormone doping by gene expression profiling of peripheral blood.

    PubMed

    Mitchell, Christopher J; Nelson, Anne E; Cowley, Mark J; Kaplan, Warren; Stone, Glenn; Sutton, Selina K; Lau, Amie; Lee, Carol M Y; Ho, Ken K Y

    2009-12-01

    GH abuse is a significant problem in many sports, and there is currently no robust test that allows detection of doping beyond a short window after administration. Our objective was to evaluate gene expression profiling in peripheral blood leukocytes in-vivo as a test for GH doping in humans. Seven men and thirteen women were administered GH, 2 mg/d sc for 8 wk. Blood was collected at baseline and at 8 wk. RNA was extracted from the white cell fraction. Microarray analysis was undertaken using Agilent 44K G4112F arrays using a two-color design. Quantitative RT-PCR using TaqMan gene expression assays was performed for validation of selected differentially expressed genes. GH induced an approximately 2-fold increase in circulating IGF-I that was maintained throughout the 8 wk of the study. GH induced significant changes in gene expression with 353 in women and 41 in men detected with a false discovery rate of less than 5%. None of the differentially expressed genes were common between men and women. The maximal changes were a doubling for up-regulated or halving for down-regulated genes, similar in magnitude to the variation between individuals. Quantitative RT-PCR for seven target genes showed good concordance between microarray and quantitative PCR data in women but not in men. Gene expression analysis of peripheral blood leukocytes is unlikely to be a viable approach for the detection of GH doping.

  20. Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

    PubMed

    Nishiura, T; Abe, K

    1999-01-01

    The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

  1. Relationship and Variation of qPCR and Culturable Enterococci Estimates in Ambient Surface Waters Are Predictable

    EPA Science Inventory

    The quantitative polymerase chain reaction (qPCR) method provides rapid estimates of fecal indicator bacteria densities that have been indicated to be useful in the assessment of water quality. Primarily because this method provides faster results than standard culture-based meth...

  2. I See Your Smart Phone and Raise You Smart Bacteria

    Science.gov Websites

    understanding how bacteria sense their nearest neighbors (including pathogens), a DTRA CB/JSTO-funded research ;wild type" E. coli was tested via reverse transcription quantitative polymerase chain reactions Director of Research, Dale Ormond, kicks off #MATHCOUNTS #NationalCompetition2018 Countdown Round

  3. USING TODAY'S DATA TO CLOSE THE BEACH TODAY. QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) RAPID BEACH CLOSING TOOL

    EPA Science Inventory

    Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in the measurement of fecal indicator bacteria concentrations in the water at these beaches to determine whether thes...

  4. USING TODAY'S DATA TO CLOSE THE BEACH TODAY. QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) RAPID BEACH CLOSINGS TOOL

    EPA Science Inventory

    Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in the measurement of fecal indicator bacteria concentrations in the water at these beaches to determine whether thes...

  5. Modeling enterococcus densities measured by quantitative polymerase chain reaction and membrane filtration using environmental conditions at four Great Lakes beaches

    EPA Science Inventory

    Data collected by the US Environmental Protection Agency (EPA) during the summer months of 2003 and 2004 at four US Great Lakes beaches were analyzed using regression analysis to identify relationships between meteorological, physical water characteristics, and beach characterist...

  6. QUANTIFICATION AND ASSOCIATED VARIABILITY OF INDUCED VITELLOGENIN GENE TRANSCRIPTS IN FATHEAD MINNOW (PIMEPHALES PROMELAS) BY QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION ASSAY

    EPA Science Inventory

    Ecological risk assessors have a growing need for sensitive and rapid indicators of environmental exposure in aquatic ecosystems resulting from natural and synthetic estrogen-like compounds. Investigators developing subcellular exposure markers in traditional sentinel organisms m...

  7. Rapidly measured indicators of recreational water quality andswimming-associated illness at marine beaches: a prospective cohort study

    EPA Science Inventory

    Background: In the United States and elsewhere, recreational water is monitored for fecal indicator bacteria to prevent illness. Standard methods to measure fecal indicator bacteria take at least 24 hours to obtain results. Molecular approaches such as quantitative polymerase cha...

  8. Effect of Environmental Parameters on the qPCR Signal of Enterococci in Tropical Waters

    EPA Science Inventory

    Fecal contamination is the major source of pathogens in recreational waters. The need for quick public notifications has expanded the interest in the use of a rapid, quantitative polymerase chain reaction method (qPCR) to determine enterococci density. However, very little info...

  9. RAPID MEASUREMENT OF BACTERIAL FECAL INDICATORS IN SURFACE WATERS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS

    EPA Science Inventory

    Current methods for determining fecal contamination of recreational waters rely on the culture of bacterial indicators and require at least 24 hours to determine whether the water is unsafe for use. By the time monitoring results are available, exposures have already occurred. N...

  10. Comparison of Enterococcus qPCR analysis results from fresh and marine water samples on two real-time instruments - poster

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality. A practical consideration for widespread implementation of this or ...

  11. A quantitative strategy to detect changes in accessibility of protein regions to chemical modification on heterodimerization

    PubMed Central

    Dreger, Mathias; Leung, Bo Wah; Brownlee, George G; Deng, Tao

    2009-01-01

    We describe a method for studying quantitative changes in accessibility of surface lysine residues of the PB1 subunit of the influenza RNA polymerase as a result of association with the PA subunit to form a PB1-PA heterodimer. Our method combines two established methods: (i) the chemical modification of surface lysine residues of native proteins by N-hydroxysuccinimidobiotin (NHS-biotin) and (ii) the stable isotope labeling of amino acids in cell culture (SILAC) followed by tryptic digestion and mass spectrometry. By linking the chemical modification with the SILAC methodology for the first time, we obtain quantitative data on chemical modification allowing subtle changes in accessibility to be described. Five regions in the PB1 monomer showed altered reactivity to NHS-biotin when compared with the [PB1-PA] heterodimer. Mutational analysis of residues in two such regions—at K265 and K481 of PB1, which were about three- and twofold, respectively, less accessible to biotinylation in the PB1-PA heterodimer compared with the PB1 monomer, demonstrated that both K265 and K481 were crucial for polymerase function. This novel assay of quantitative profiling of biotinylation patterns (Q-POP assay) highlights likely conformational changes at important functional sites, as observed here for PB1, and may provide information on protein–protein interaction interfaces. The Q-POP assay should be a generally applicable approach and may detect novel functional sites suitable for targeting by drugs. PMID:19517532

  12. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    PubMed

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  13. A real-time, quantitative PCR protocol for assessing the relative parasitemia of Leucocytozoon in waterfowl.

    PubMed

    Smith, Matthew M; Schmutz, Joel; Apelgren, Chloe; Ramey, Andrew M

    2015-04-01

    Microscopic examination of blood smears can be effective at diagnosing and quantifying hematozoa infections. However, this method requires highly trained observers, is time consuming, and may be inaccurate for detection of infections at low levels of parasitemia. To develop a molecular methodology for identifying and quantifying Leucocytozoon parasite infection in wild waterfowl (Anseriformes), we designed a real-time, quantitative PCR protocol to amplify Leucocytozoon mitochondrial DNA using TaqMan fluorogenic probes and validated our methodology using blood samples collected from waterfowl in interior Alaska during late summer and autumn (n=105). By comparing our qPCR results to those derived from a widely used nested PCR protocol, we determined that our assay showed high levels of sensitivity (91%) and specificity (100%) in detecting Leucocytozoon DNA from host blood samples. Additionally, results of a linear regression revealed significant correlation between the raw measure of parasitemia produced by our qPCR assay (Ct values) and numbers of parasites observed on blood smears (R(2)=0.694, P=0.003), indicating that our assay can reliably determine the relative parasitemia levels among samples. This methodology provides a powerful new tool for studies assessing effects of haemosporidian infection in wild avian species. Published by Elsevier B.V.

  14. Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters.

    PubMed

    Riedel, Timothy E; Zimmer-Faust, Amity G; Thulsiraj, Vanessa; Madi, Tania; Hanley, Kaitlyn T; Ebentier, Darcy L; Byappanahalli, Muruleedhara; Layton, Blythe; Raith, Meredith; Boehm, Alexandria B; Griffith, John F; Holden, Patricia A; Shanks, Orin C; Weisberg, Stephen B; Jay, Jennifer A

    2014-04-01

    Some molecular methods for tracking fecal pollution in environmental waters have both PCR and quantitative PCR (qPCR) assays available for use. To assist managers in deciding whether to implement newer qPCR techniques in routine monitoring programs, we compared detection limits (LODs) and costs of PCR and qPCR assays with identical targets that are relevant to beach water quality assessment. For human-associated assays targeting Bacteroidales HF183 genetic marker, qPCR LODs were 70 times lower and there was no effect of target matrix (artificial freshwater, environmental creek water, and environmental marine water) on PCR or qPCR LODs. The PCR startup and annual costs were the lowest, while the per reaction cost was 62% lower than the Taqman based qPCR and 180% higher than the SYBR based qPCR. For gull-associated assays, there was no significant difference between PCR and qPCR LODs, target matrix did not effect PCR or qPCR LODs, and PCR startup, annual, and per reaction costs were lower. Upgrading to qPCR involves greater startup and annual costs, but this increase may be justified in the case of the human-associated assays with lower detection limits and reduced cost per sample. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

    USGS Publications Warehouse

    Riedel, Timothy E.; Zimmer-Faust, Amity G.; Thulsiraj, Vanessa; Madi, Tania; Hanley, Kaitlyn T.; Ebentier, Darcy L.; Byappanahalli, Muruleedhara N.; Layton, Blythe; Raith, Meredith; Boehm, Alexandria B.; Griffith, John F.; Holden, Patricia A.; Shanks, Orin C.; Weisberg, Stephen B.; Jay, Jennifer A.

    2014-01-01

    Some molecular methods for tracking fecal pollution in environmental waters have both PCR and quantitative PCR (qPCR) assays available for use. To assist managers in deciding whether to implement newer qPCR techniques in routine monitoring programs, we compared detection limits (LODs) and costs of PCR and qPCR assays with identical targets that are relevant to beach water quality assessment. For human-associated assays targeting Bacteroidales HF183 genetic marker, qPCR LODs were 70 times lower and there was no effect of target matrix (artificial freshwater, environmental creek water, and environmental marine water) on PCR or qPCR LODs. The PCR startup and annual costs were the lowest, while the per reaction cost was 62% lower than the Taqman based qPCR and 180% higher than the SYBR based qPCR. For gull-associated assays, there was no significant difference between PCR and qPCR LODs, target matrix did not effect PCR or qPCR LODs, and PCR startup, annual, and per reaction costs were lower. Upgrading to qPCR involves greater startup and annual costs, but this increase may be justified in the case of the human-associated assays with lower detection limits and reduced cost per sample.

  16. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  17. Rapid Quantitative Detection of Lactobacillus sakei in Meat and Fermented Sausages by Real-Time PCR

    PubMed Central

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-01-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages. PMID:16957227

  18. Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

    PubMed

    Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

    2017-07-01

    Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  19. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    PubMed

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  20. Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells

    PubMed Central

    Min, Irene M.; Waterfall, Joshua J.; Core, Leighton J.; Munroe, Robert J.; Schimenti, John; Lis, John T.

    2011-01-01

    Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, “bivalent” ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5′ proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation. PMID:21460038

  1. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  2. Comparison of Enterococcus qPCR analysis results from fresh and marine water samples on two real-time instruments -

    EPA Science Inventory

    EPA is currently considering a quantitative polymerase chain reaction (qPCR) method, targeting Enterococcus spp., for beach monitoring. Improvements in the method’s cost-effectiveness may be realized by the use of newer instrumentation such as the Applied Biosystems StepOneTM a...

  3. Development of a duplex ddPCR assay for detection of “Candidatus Liberibacter asiaticus”

    USDA-ARS?s Scientific Manuscript database

    Huanglongbing (HLB) (aka citrus greening) is a devastating citrus disease associated with “Candidatus Liberibacter asiaticus” (CLas). Currently, diagnosis of CLas in regulatory samples is based on a real-time quantitative polymerase chain reaction (qPCR) assay using 16S rRNA gene specific primers/pr...

  4. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula)

    USDA-ARS?s Scientific Manuscript database

    Quantitative real-time polymerase chain reaction (qRT-PCR) is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference gene...

  5. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    ERIC Educational Resources Information Center

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  6. DNA-Based Analyses of Molds in Singapore Public Buildings Results in a Proposed Singapore Environmental Relative Moldiness Index

    EPA Science Inventory

    Dust samples (n=75) were collected from shopping malls, hotels and libraries in Singapore and then analyzed using Mold Specific Quantitative Polymerase Chain Reaction(MSQPCR) for the 36 molds that make up the Environmental Relative Moldiness Index (ERMI). Most of these molds (23/...

  7. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  8. Evaluation of reference genes for expression studies in ash (Fraxinus spp.)

    Treesearch

    Loren Rivera-Vega; Praveen Mamidala; Jennifer L. Koch; Mary E. Mason; Omprakash Mittapalli

    2012-01-01

    Ash (Fraxinus spp.) is a dominant tree species in North America, in both managed and natural landscapes. However, due to the rapid invasion by the emerald ash borer (Agrilus planipennis), an exotic invasive insect pest, millions of North American ash trees have been killed. Real-time quantitative polymerase chain reaction (RTq-PCR...

  9. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  10. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    PubMed

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  11. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  13. Identification of Mediator Kinase Substrates in Human Cells using Cortistatin A and Quantitative Phosphoproteomics.

    PubMed

    Poss, Zachary C; Ebmeier, Christopher C; Odell, Aaron T; Tangpeerachaikul, Anupong; Lee, Thomas; Pelish, Henry E; Shair, Matthew D; Dowell, Robin D; Old, William M; Taatjes, Dylan J

    2016-04-12

    Cortistatin A (CA) is a highly selective inhibitor of the Mediator kinases CDK8 and CDK19. Using CA, we now report a large-scale identification of Mediator kinase substrates in human cells (HCT116). We identified over 16,000 quantified phosphosites including 78 high-confidence Mediator kinase targets within 64 proteins, including DNA-binding transcription factors and proteins associated with chromatin, DNA repair, and RNA polymerase II. Although RNA-seq data correlated with Mediator kinase targets, the effects of CA on gene expression were limited and distinct from CDK8 or CDK19 knockdown. Quantitative proteome analyses, tracking around 7,000 proteins across six time points (0-24 hr), revealed that CA selectively affected pathways implicated in inflammation, growth, and metabolic regulation. Contrary to expectations, increased turnover of Mediator kinase targets was not generally observed. Collectively, these data support Mediator kinases as regulators of chromatin and RNA polymerase II activity and suggest their roles extend beyond transcription to metabolism and DNA repair. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Using Reference Quantitative Polymerase Chain Reaction to Assess the Clinical Performance of the Paracheck-Pf® Rapid Diagnostic Test in a Field Setting in Uganda.

    PubMed

    Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K

    2018-06-04

    Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.

  15. A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods.

    PubMed

    Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A

    2014-12-01

    Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.

  16. An intra-laboratory cultural and real-time PCR method comparison and evaluation for the detection of subclinical paratuberculosis in dairy herds.

    PubMed

    Heuvelink, Annet; Hassan, Abdulwahed Ahmed; van Weering, Hilmar; van Engelen, Erik; Bülte, Michael; Akineden, Ömer

    2017-05-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is a vigorous microorganism which causes incurable chronic enteritis, Johne's disease (JD) in cattle. A target of control programmes for JD is to accurately detect MAP-infected cattle early to reduce disease transmission. The present study evaluated the efficacy of two different cultural procedures and a TaqMan real-time PCR assay for detection of subclinical paratuberculosis in dairy herds. Therefore, sixty-one faecal samples were collected from two Dutch dairy herds (n = 40 and n = 21, respectively) which were known to be MAP-ELISA positive. All individual samples were assessed using two different cultural protocols in two different laboratories. The first cultural protocol (first laboratory) included a decontamination step with 0.75% hexadecylpyridinium chloride (HPC) followed by inoculation on Herrold's egg yolk media (HEYM). The second protocol (second laboratory) comprised of a decontamination step using 4% NaOH and malachite green-oxalic acid followed by inoculation on two media, HEYM and in parallel on modified Löwenstein-Jensen media (mLJ). For the TaqMan real-time PCR assay, all faecal samples were tested in two different laboratories using TaqMan® MAP (Johne's) reagents (Life Technologies). The cultural procedures revealed positive reactions in 1.64% of the samples for cultivation protocol 1 and 6.56 and 8.20% of the samples for cultivation protocol 2, respectively. The results of the TaqMan real-time PCR performed in two different laboratories yielded 13.11 and 19.76% positive reaction. The kappa test showed proportional agreement 0.54 between the mLJ media (second laboratory) and TaqMan® real-time PCR method (second laboratory). In conclusion, the TaqMan real-time PCR could be a strongly useful and efficient assay for the detection of subclinical paratuberculosis in dairy cattle leading to an improvement in the efficiency of MAP control strategies.

  17. Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

    PubMed

    Panicker, Gitika; Bej, Asim K

    2005-10-01

    We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

  18. Defining the Status of RNA Polymerase at Promoters

    PubMed Central

    Core, Leighton J.; Waterfall, Joshua J.; Gilchrist, Daniel A.; Fargo, David C.; Kwak, Hojoong; Adelman, Karen; Lis, John T.

    2012-01-01

    Summary Recent genome-wide studies in metazoans have shown that RNA Polymerase II (Pol II) accumulates to high densities on many promoters at a rate-limited step in transcription. However, the status of this Pol II remains an area of debate. Here, we compare quantitative outputs of GRO-seq and ChIP-seq assays and demonstrate the majority of the Pol II on Drosophila promoters is transcriptionally-engaged - very little exists in a preinitiation or arrested complex. These promoter-proximal polymerases are inhibited from further elongation by detergent sensitive factors, and knockdown of negative elongation factor, NELF, reduces their levels. These results not only solidify that pausing occurs at most promoters, but demonstrate that it is the major rate-limiting step in early transcription at these promoters. Finally, the divergent elongation complexes seen at mammalian promoters are far less prevalent in Drosophila, and this specificity in orientation correlates with directional core promoter elements, which are abundant in Drosophila. PMID:23062713

  19. Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

    PubMed

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

    2007-04-01

    Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

  20. Anti-Caries Effects of Dental Adhesives Containing Quaternary Ammonium Methacrylates with Different Chain Lengths

    PubMed Central

    Han, Qi; Li, Bolei; Zhou, Xuedong; Ge, Yang; Wang, Suping; Li, Mingyun; Ren, Biao; Wang, Haohao; Zhang, Keke; Xu, Hockin H. K.; Peng, Xian; Feng, Mingye; Weir, Michael D.; Chen, Yu; Cheng, Lei

    2017-01-01

    The objectives of this study were to investigate the effects of dental adhesives containing quaternary ammonium methacrylates (QAMs) with different alkyl chain lengths (CL) on ecological caries prevention in vitro. Five QAMs were synthesized with a CL = 3, 6, 9, 12, and 16 and incorporated into adhesives. Micro-tensile bond strength and surface charge density were used to measure the physical properties of the adhesives. The proportion change in three-species biofilms consisting of Streptococcus mutans, Streptococcus sanguinis, and Streptococcus gordonii was tested using the TaqMan real-time polymerase chain reaction. Lactic acid assay, MTT [3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, exopolysaccharide staining, live/dead staining, scanning electron microscopy (SEM), and transverse microradiography (TMR) were performed to study the anti-biofilm and anti-demineralization effects of the dental adhesives. The results showed that incorporating QAMs with different alkyl chain lengths into the adhesives had no obvious effect on the dentin bond strength. The adhesives containing QAMs with a longer alkyl chain developed healthier biofilms. The surface charge density, anti-biofilm, and anti-demineralization effects of the adhesives increased with a CL of the QAMs from 3 to 12, but decreased slightly with a CL from 12 to 16. In conclusion, adhesives containing QAMs with a tailored chain length are promising for preventing secondary caries in an “ecological way”. PMID:28773004

  1. Associations between interleukin and interleukin receptor gene polymorphisms and risk of gout.

    PubMed

    Liu, Shiguo; Zhou, Zheng; Wang, Can; Guo, Mingzhen; Chu, Nan; Li, Changgui

    2015-09-24

    Gout is a self-limiting, auto-inflammatory arthritis induced by the deposition of monosodium urate crystals in the synovial fluid and periarticular tissues. The aim of this study was to investigate the associations between genetic variants in the interleukin (IL) and interleukin receptor (ILR) genes IL-33, IL-1RL1, IL-23R, and signal transducer and activator of transcription 4 (STAT4) and susceptibility to gout in Chinese Han male individuals. The genetic distributions of rs3939286 in IL-33, rs13015714 in IL-1RL1, rs10889677 in IL-23R, and rs7574865 in STAT4 were detected in 1100 men with gout and 1227 ethnically matched controls, using Taqman allelic discrimination real-time polymerase chain reaction (PCR). Differences in these polymorphisms between the groups were investigated using χ(2) tests. The genotype-phenotype relationship among gout patients was tested by analysis of variance. There was a significant difference in genotypic frequencies of IL-23R rs10889677 between gout patients and controls (χ(2) = 81.386, P < 0.001). However, there were no significant differences in distributions of the other polymorphisms between the groups. Our results revealed that the rs10889677 variant in IL-23R may be involved in the development of gout in Chinese Han male individuals. However, further studies in other ethnic groups are needed to confirm these results.

  2. Herpesviruses viral loads and levels of proinflammatory cytokines in apical periodontitis.

    PubMed

    Jakovljevic, A; Knezevic, A; Nikolic, N; Soldatovic, I; Jovanovic, T; Milasin, J; Andric, M

    2018-07-01

    This study aimed to analyse Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) viral loads in symptomatic and asymptomatic apical periodontitis lesions, to determine levels of TNF-α, IL-1β and IL-6 in these lesions and to investigate a possible correlation between herpesviral copy numbers and levels of proinflammatory cytokines. A total of 100 samples of apical periodontitis were subjected to HCMV and EBV copy numbers analysis by nested polymerase chain reaction (PCR) and TaqMan real-time PCR. The concentrations of TNF-α, IL-1β and IL-6 were determined by ELISA method. SPSS software was used for statistical analysis. There were no significant differences in the occurrence of EBV and HCMV between symptomatic and asymptomatic periapical lesions (p = .686, p = .879, respectively). Only 12 of 74 EBV (16.2%) and four of 54 HCMV (13.5%) nested PCR-positive samples showed increased viral copy numbers above the limit of 125 copies/ml. There was no significant correlation between the levels of analysed proinflammatory cytokines and herpesviral copy numbers in our sample. The observed low viral loads point to a relatively rare occurrence of active EBV and HCMV infection in our sample. Latent herpesviral infection does not enhance the production of investigated proinflammatory cytokines. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved.

  3. Field detection of avian influenza virus in wild birds: evaluation of a portable rRT-PCR system and freeze-dried reagents

    USGS Publications Warehouse

    Takekawa, John Y.; Iverson, Samuel A.; Schultz, Annie K.; Hill, Nichola J.; Cardona, Carol J.; Boyce, Walter M.; Dudley, Joseph P.

    2010-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAIV) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds is often conducted in remote regions, but results are often delayed because of limited local analytical capabilities, difficulties with sample transportation and permitting, or problems keeping samples cold in the field. In response to these challenges, the performance of a portable real-time, reverse transcriptase-polymerase chain reaction (rRT-PCR) unit (RAPID(Registered), Idaho Technologies, Salt Lake City, UT) that employed lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies) was compared to virus isolation combined with real-time RT-PCR conducted in a laboratory. This study included both field and experimental-based sampling. Field samples were collected from migratory shorebirds captured in northern California, while experimental samples were prepared by spiking fecal material with an H6N2 AIV isolate. Results indicated that the portable rRT-PCR unit had equivalent specificity to virus isolation with no false positives, but sensitivity was compromised at low viral titers. Use of portable rRT-PCR with lyophilized reagents may expedite surveillance results, paving the way to a better understanding of wild bird involvement in HPAIV H5N1 transmission.

  4. The impact of HLA-G, LILRB1 and LILRB2 gene polymorphisms on susceptibility to and severity of endometriosis.

    PubMed

    Bylińska, Aleksandra; Wilczyńska, Karolina; Malejczyk, Jacek; Milewski, Łukasz; Wagner, Marta; Jasek, Monika; Niepiekło-Miniewska, Wanda; Wiśniewski, Andrzej; Płoski, Rafał; Barcz, Ewa; Roszkowski, Piotr; Kamiński, Paweł; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Kuśnierczyk, Piotr; Nowak, Izabela

    2018-06-01

    Endometriosis is a disease in which endometriotic tissue occurs outside the uterus. Its pathogenesis is still unknown. The most widespread hypothesis claims that ectopic endometrium appears as a result of retrograde menstruation and its insufficient elimination by immunocytes. Some reports have shown expression of non-classical HLA-G molecules on ectopic endometrium. HLA-G is recognized by KIR2DL4, LILRB1 and LILRB2 receptors on natural killer (NK) and other cells. These receptors are polymorphic, which may affect their activity. In this study we investigated whether HLA-G, KIR2DL4, LILRB1 and LILRB2 polymorphisms may influence susceptibility to endometriosis and disease progression. We used polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP) and allelic discrimination methods with TaqMan SNP Genotyping Assays for typing of 276 patients with endometriosis and 314 healthy fertile women. The HLA-G rs1632947:GG genotype was associated with protection against the disease and its severe stages; HLA-G rs1233334:CT protected against progression; LILRB1 rs41308748:AA and LILRB2 rs383369:AG predisposed to the disease and its progression. No effect of KIR2DL4 polymorphism was observed. These results support the role of polymorphisms of HLA-G and its receptors LILRB1 and LILRB2 in susceptibility to endometriosis and its progression.

  5. Establishment of a universal and rational gene detection strategy through three-way junction-based remote transduction.

    PubMed

    Tang, Yidan; Lu, Baiyang; Zhu, Zhentong; Li, Bingling

    2018-01-21

    The polymerase chain reaction and many isothermal amplifications are able to achieve super gene amplification. Unfortunately, most commonly-used transduction methods, such as dye staining and Taqman-like probing, still suffer from shortcomings including false signals or difficult probe design, or are incompatible with multi-analysis. Here a universal and rational gene detection strategy has been established by translating isothermal amplicons to enzyme-free strand displacement circuits via three-way junction-based remote transduction. An assistant transduction probe was imported to form a partial hybrid with the target single-stranded nucleic acid. After systematic optimization the hybrid could serve as an associative trigger to activate a downstream circuit detector via a strand displacement reaction across the three-way junction. By doing so, the detection selectivity can be double-guaranteed through both amplicon-transducer recognition and the amplicon-circuit reaction. A well-optimized circuit can be immediately applied to a new target detection through simply displacing only 10-12 nt on only one component, according to the target. More importantly, this property for the first time enables multi-analysis and logic-analysis in a single reaction, sharing a single fluorescence reporter. In an applicable model, trace amounts of Cronobacter and Enterobacteria genes have been clearly distinguished from samples with no bacteria or one bacterium, with ultra-high sensitivity and selectivity.

  6. No association between polymorphisms/haplotypes of the vascular endothelial growth factor gene and preeclampsia

    PubMed Central

    2011-01-01

    Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227

  7. Entomologic investigations during an outbreak of West Nile virus disease in Maricopa County, Arizona, 2010.

    PubMed

    Godsey, Marvin S; Burkhalter, Kristen; Young, Ginger; Delorey, Mark; Smith, Kirk; Townsend, John; Levy, Craig; Mutebi, John-Paul

    2012-12-01

    Entomologic investigations were conducted during an intense outbreak of West Nile virus (WNV) disease in Maricopa County, Arizona during July 31-August 9, 2010. The investigations compared the East Valley outbreak area, and a demographically similar control area in northwestern metropolitan Phoenix where no human cases were reported. Five mosquito species were identified in each area, and species composition was similar in both areas. Significantly more Culex quinquefasciatus females were collected by gravid traps at Outbreak sites (22.2 per trap night) than at control sites (8.9 per trap night), indicating higher Cx. quinquefasciatus abundance in the outbreak area. Twenty-eight WNV TaqMan reverse transcription-polymerase chain reaction-positive mosquito pools were identified, including 24 of Cx. quinquefasciatus, 3 of Psorophora columbiae, and 1 of Culex sp. However, Cx. quinquefasciatus WNV infection rates did not differ between outbreak and control sites. At outbreak sites, 30 of 39 engorged Cx. quinquefasciatus had fed on birds, 8 of 39 on humans, and 1 of 39 on a lizard. At control sites, 20 of 20 identified blood meals were from birds. Data suggest that Cx. quinquefasciatus was the primary enzootic and epidemic vector of this outbreak. The most important parameters in the outbreak were vector abundance and blood meal analysis, which suggested more frequent contact between Cx. quinquefasciatus and human hosts in the outbreak area compared with the control area.

  8. Entomologic Investigations during an Outbreak of West Nile Virus Disease in Maricopa County, Arizona, 2010

    PubMed Central

    Godsey, Marvin S.; Burkhalter, Kristen; Young, Ginger; Delorey, Mark; Smith, Kirk; Townsend, John; Levy, Craig; Mutebi, John-Paul

    2012-01-01

    Entomologic investigations were conducted during an intense outbreak of West Nile virus (WNV) disease in Maricopa County, Arizona during July 31–August 9, 2010. The investigations compared the East Valley outbreak area, and a demographically similar control area in northwestern metropolitan Phoenix where no human cases were reported. Five mosquito species were identified in each area, and species composition was similar in both areas. Significantly more Culex quinquefasciatus females were collected by gravid traps at Outbreak sites (22.2 per trap night) than at control sites (8.9 per trap night), indicating higher Cx. quinquefasciatus abundance in the outbreak area. Twenty-eight WNV TaqMan reverse transcription-polymerase chain reaction–positive mosquito pools were identified, including 24 of Cx. quinquefasciatus, 3 of Psorophora columbiae, and 1 of Culex sp. However, Cx. quinquefasciatus WNV infection rates did not differ between outbreak and control sites. At outbreak sites, 30 of 39 engorged Cx. quinquefasciatus had fed on birds, 8 of 39 on humans, and 1 of 39 on a lizard. At control sites, 20 of 20 identified blood meals were from birds. Data suggest that Cx. quinquefasciatus was the primary enzootic and epidemic vector of this outbreak. The most important parameters in the outbreak were vector abundance and blood meal analysis, which suggested more frequent contact between Cx. quinquefasciatus and human hosts in the outbreak area compared with the control area. PMID:23109372

  9. Association analysis of calpain 10 gene variants/haplotypes with gestational diabetes mellitus among Mexican women.

    PubMed

    Castro-Martínez, Anna Gabriela; Sánchez-Corona, José; Vázquez-Vargas, Adriana Patricia; García-Zapién, Alejandra Guadalupe; López-Quintero, Andres; Villalpando-Velazco, Héctor Javier; Flores-Martínez, Silvia Esperanza

    2018-02-28

    Gestational diabetes mellitus (GDM) is a metabolically complex disease with major genetic determinants. GDM has been associated with insulin resistance and dysfunction of pancreatic beta cells, so the GDM candidate genes are those that encode proteins modulating the function and secretion of insulin, such as that for calpain 10 (CAPN10). This study aimed to assess whether single nucleotide polymorphism (SNP)-43, SNP-44, SNP-63, and the indel-19 variant, and specific haplotypes of the CAPN10 gene were associated with gestational diabetes mellitus. We studied 116 patients with gestational diabetes mellitus and 83 women with normal glucose tolerance. Measurements of anthropometric and biochemical parameters were performed. SNP-43, SNP-44, and SNP-63 were identified by polymerase chain reaction (PCR)-restriction fragment length polymorphisms, while the indel-19 variant was detected by TaqMan qPCR assays.  The allele, genotype, and haplotype frequencies of the four variants did not differ significantly between women with gestational diabetes mellitus and controls. However, in women with gestational diabetes mellitus, glucose levels were significantly higher bearing the 3R/3R genotype than in carriers of the 3R/2R genotype of the indel-19 variant (p = 0.006). In conclusion, the 3R/3R genotype of the indel-19 variant of the CAPN-10 gene influenced increased glucose levels in these Mexican women with gestational diabetes mellitus.

  10. A prospective clinical study of Epstein-Barr virus and host interactions during acute infectious mononucleosis.

    PubMed

    Balfour, Henry H; Holman, Carol J; Hokanson, Kristin M; Lelonek, Meghan M; Giesbrecht, Jill E; White, Dana R; Schmeling, David O; Webb, Chiu-Ho; Cavert, Winston; Wang, David H; Brundage, Richard C

    2005-11-01

    Characterizing virus-host interactions during self-limited infectious mononucleosis could explain how Epstein-Barr virus (EBV) replication is normally controlled and provide insight into why certain immunocompromised patients fail to contain it. University students had an average of 7 clinical and virologic evaluations during acute infectious mononucleosis. EBV was quantified in 697 samples of oral wash fluid, whole blood, peripheral blood mononuclear cells (PBMCs), and plasma by a real-time (TaqMan) polymerase chain reaction (qEBV) assay developed in our laboratory. Twenty of 25 subjects had serologically confirmed primary EBV infection. EBV was cleared from whole blood by a first-order process with a median half-life of 3 days, and its quantity was associated with severity of illness (r2=0.82). Oral shedding persisted at a median of >or=1x104 copies/mL for 32 weeks and was unrelated to severity of illness. Subjects with nonprimary EBV infection shed virus intermittently, and median quantities for all samples became undetectable within 4 weeks. Using a novel qEBV assay, we demonstrated that young adults with primary EBV infection rapidly cleared virus from blood but not from the oropharynx. High oral concentrations of EBV in asymptomatic persons who have resumed normal activities support the concept that infectious mononucleosis is most likely acquired by kissing.

  11. 64Cu-DOTATATE PET/MRI for Detection of Activated Macrophages in Carotid Atherosclerotic Plaques: Studies in Patients Undergoing Endarterectomy.

    PubMed

    Pedersen, Sune Folke; Sandholt, Benjamin Vikjær; Keller, Sune Høgild; Hansen, Adam Espe; Clemmensen, Andreas Ettrup; Sillesen, Henrik; Højgaard, Liselotte; Ripa, Rasmus Sejersten; Kjær, Andreas

    2015-07-01

    A feature of vulnerable atherosclerotic plaques of the carotid artery is high activity and abundance of lesion macrophages. There is consensus that this is of importance for plaque vulnerability, which may lead to clinical events, such as stroke and transient ischemic attack. We used positron emission tomography (PET) and the novel PET ligand [(64)Cu] [1,4,7,10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid]-d-Phe1,Tyr3-octreotate ((64)Cu-DOTATATE) to specifically target macrophages via the somatostatin receptor subtype-2 in vivo. Ten patients underwent simultaneous PET/MRI to measure (64)Cu-DOTATATE uptake in carotid artery plaques before carotid endarterectomy. (64)Cu-DOTATATE uptake was significantly higher in symptomatic plaque versus the contralateral carotid artery (P<0.001). Subsequently, a total of 62 plaque segments were assessed for gene expression of selected markers of plaque vulnerability using real-time quantitative polymerase chain reaction. These results were compared with in vivo (64)Cu-DOTATATE uptake calculated as the mean standardized uptake value. Univariate analysis of real-time quantitative polymerase chain reaction and PET showed that cluster of differentiation 163 (CD163) and CD68 gene expression correlated significantly but weakly with mean standardized uptake value in scans performed 85 minutes post injection (P<0.001 and P=0.015, respectively). Subsequent multivariate analysis showed that CD163 correlated independently with (64)Cu-DOTATATE uptake (P=0.031) whereas CD68 did not contribute significantly to the final model. The novel PET tracer (64)Cu-DOTATATE accumulates in atherosclerotic plaques of the carotid artery. CD163 gene expression correlated independently with (64)Cu-DOTATATE uptake measured by real-time quantitative polymerase chain reaction in the final multivariate model, indicating that (64)Cu-DOTATATE PET is detecting alternatively activated macrophages. This association could potentially improve noninvasive identification and characterization of vulnerable plaques. © 2015 The Authors.

  12. Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species

    PubMed Central

    Arif, Mohammad; Opit, George; Mendoza-Yerbafría, Abigail; Dobhal, Shefali; Li, Zhihong; Kučerová, Zuzana; Ochoa-Corona, Francisco M.

    2015-01-01

    Several species of the genus Liposcelis are common insect pests that cause serious qualitative and quantitative losses to various stored grains and processed grain products. They also can contaminate foods, transmit pathogenic microorganisms and cause allergies in humans. The common occurrence of multi-species infestations and the fact that it is difficult to identify and discriminate Liposcelis spp. make accurate, rapid detection and discriminatory tools absolutely necessary for confirmation of their identity. In this study, PCR primers and probes specific to different Liposcelis spp. were designed based on nucleotide sequences of the cytochrome oxidase 1 (CO1) gene. Primer sets ObsCo13F/13R, PeaCo15F/14R, BosCO7F/7R, BruCo5F/5R, and DecCo11F/11R were used to specifically detect Liposcelis obscura Broadhead, Liposcelis pearmani Lienhard, Liposcelis bostrychophila Badonnel, Liposcelis brunnea Motschulsky and Liposcelis decolor (Pearman) in multiplex endpoint PCRs, which amplified products of 438-, 351-, 191-, 140-, and 87-bp, respectively. In multiplex TaqMan qPCR assays, orange, yellow, red, crimson and green channels corresponding to reporter dyes 6-ROXN, HEX, Cy5, Quasar705 and 6-FAM specifically detected L. obscura, L. brunnea, L. bostrychophila, L. pearmani and L. decolor, respectively. All developed primer and probe sets allowed specific amplification of corresponding targeted Liposcelis species. The development of multiplex endpoint PCR and multiplex TaqMan qPCR will greatly facilitate psocid identification and their management. The use of APCs will streamline and standardize PCR assays. APC will also provide the opportunity to have all positive controls in a single tube, which reduces maintenance cost and labor, but increases the accuracy and reliability of the assays. These novel methods from our study will have applications in pest management, biosecurity, quarantine, food safety, and routine diagnostics. PMID:26086728

  13. Identification of suitable reference genes for hepatic microRNA quantitation.

    PubMed

    Lamba, Vishal; Ghodke-Puranik, Yogita; Guan, Weihua; Lamba, Jatinder K

    2014-03-07

    MicroRNAs (miRNAs) are short (~22 nt) endogenous RNAs that play important roles in regulating expression of a wide variety of genes involved in different cellular processes. Alterations in microRNA expression patterns have been associated with a number of human diseases. Accurate quantitation of microRNA levels is important for their use as biomarkers and in determining their functions. Real time PCR is the gold standard and the most frequently used technique for miRNA quantitation. Real time PCR data analysis includes normalizing the amplification data to suitable endogenous control/s to ensure that microRNA quantitation is not affected by the variability that is potentially introduced at different experimental steps. U6 (RNU6A) and RNU6B are two commonly used endogenous controls in microRNA quantitation. The present study was designed to investigate inter-individual variability and gender differences in hepatic microRNA expression as well as to identify the best endogenous control/s that could be used for normalization of real-time expression data in liver samples. We used Taqman based real time PCR to quantitate hepatic expression levels of 22 microRNAs along with U6 and RNU6B in 50 human livers samples (25 M, 25 F). To identify the best endogenous controls for use in data analysis, we evaluated the amplified candidates for their stability (least variability) in expression using two commonly used software programs: Normfinder and GeNormplus, Both Normfinder and GeNormplus identified U6 to be among the least stable of all the candidates analyzed, and RNU6B was also not among the top genes in stability. mir-152 and mir-23b were identified to be the two most stable candidates by both Normfinder and GeNormplus in our analysis, and were used as endogenous controls for normalization of hepatic miRNA levels. Measurements of microRNA stability indicate that U6 and RNU6B are not suitable for use as endogenous controls for normalizing microRNA relative quantitation data in hepatic tissue, and their use can led to possibly erroneous conclusions.

  14. Multicenter evaluation of the new Abbott RealTime assays for quantitative detection of human immunodeficiency virus type 1 and hepatitis C virus RNA.

    PubMed

    Schutten, M; Peters, D; Back, N K T; Beld, M; Beuselinck, K; Foulongne, V; Geretti, A-M; Pandiani, L; Tiemann, C; Niesters, H G M

    2007-06-01

    The analytical performances of the new Abbott RealTime hepatitis C virus (HCV) and human immunodeficiency virus type 1 viral load assays were compared at nine laboratories with different competitor assays. These included the Abbott LcX, Bayer Versant bDNA, Roche COBAS Amplicor, and Roche COBAS TaqMan assays. Two different protocols used during the testing period with and without a pre-m1000 RNA isolation spin were compared. The difference proved to be nonsignificant. A uracil-N-glycosylase (UNG) contamination control option in the HCV test for previous Roche COBAS Amplicor users was evaluated. It proved to decrease amplicon carryover by 100-fold independent of the amplicon input concentration. The protocol including UNG proved to overcome problems with false-positive negative controls. Comparison with other assays revealed only minor differences. The largest difference was observed between the Abbott HCV RealTime assay and the Roche COBAS Amplicor HCV Monitor version 2.0 assay.

  15. Detection of adulterated murine components in meat products by TaqMan© real-time PCR.

    PubMed

    Fang, Xin; Zhang, Chi

    2016-02-01

    Using murine meat to substitute mutton has been identified as a new type of meat fraud in China, yet no detection method for murine species has been reported. Here, three kinds of rodent were used as target species to establish a murine-specific real-time PCR method of detection. The mitochondrial cytochrome b gene (cytb) of each target was sequenced and a TaqMan probe was designed based on the cytb. Simultaneously, an internal positive control (IPC) plasmid along with its respective probe were designed to monitor the PCR reaction. As a result, the duplex real-time PCR system was verified to be specific. The limit of detection (LOD) was lower than 1 pg of DNA per reaction and 0.1% murine contamination in meat mixtures. Standard curves were generated for a quantitative analysis. Thus, this study provided a new tool to control the quality of meat products for official and third-party laboratories. Copyright © 2015. Published by Elsevier Ltd.

  16. Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA

    USGS Publications Warehouse

    Hunter, Margaret; Dorazio, Robert M.; Butterfield, John S.; Meigs-Friend, Gaia; Nico, Leo; Ferrante, Jason A.

    2017-01-01

    A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species’ presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty – indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis, and forensic and clinical diagnostics.

  17. Rapid Detection of Ceratocystis platani Inoculum by Quantitative Real-Time PCR Assay

    PubMed Central

    Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

    2013-01-01

    Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10−2 to 1.4 × 10−2 pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management. PMID:23811499

  18. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

    USDA-ARS?s Scientific Manuscript database

    Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

  19. Evaluation and selection of internal reference genes from two- and six-row U.S. malting barley varieties throughout micromalting for use in RT-qPCR

    USDA-ARS?s Scientific Manuscript database

    Reverse Transcription quantitative Polymerase Chain Reaction (qRT-PCR) is a popular method for measuring transcript abundance. The most commonly used method of interpretation is relative quantification and thus necessitates the use of normalization controls (i.e. reference genes) to standardize tran...

  20. Group specific quantitative real-time polymerase chain reaction (qRT-PCR) analysis of methanogenic archaea in stored swine manure

    USDA-ARS?s Scientific Manuscript database

    Consolidated storage of swine manure is associated with the production of a variety of odors and emissions which result from anaerobic digestion of materials present in the manure. Methanogenic archaea are a diverse group of anaerobic microorganisms responsible for the production of methane. In th...

  1. MEASURING GROWTH OF A PHENANTHRENE DEGRADING BACTERIAL INOCULUM IN SOIL WITH A QUANTITATIVE COMPETITIVE POLYMERASE CHAIN REACTION METHOD. (R825433)

    EPA Science Inventory

    We measured growth of a phenanthrene-degrading bacterium, Arthrobacter, strain RP17, in Forbes soil, amended with 500 small mu, Greekg g−1 phenanthrene using a quantitati...

  2. Development of Highly Sensitive Bulk Acoustic Wave Device Biosensor Arrays for Screening and Early Detection of Prostate Cancer

    DTIC Science & Technology

    2009-01-01

    Partin, P. C. Walsh, J. I. Epstein, and D. Sidransky, "Quantitative GSTP1 Methylation and the Detection of Prostate Adenocarcinoma in Sextant Biopsies...island methylation changes near the GSTP1 gene in prostatic carcinoma cells detected using the polymerase chain reaction: a new prostate cancer

  3. Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

    Treesearch

    Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

    2018-01-01

    Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

  4. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  5. Influences of sample interference and interference controls on quantification of enterococci fecal indicator bacteria in surface water samples by the qPCR method

    EPA Science Inventory

    A quantitative polymerase chain reaction (qPCR) method for the detection of entercocci fecal indicator bacteria has been shown to be generally applicable for the analysis of temperate fresh (Great Lakes) and marine coastal waters and for providing risk-based determinations of wat...

  6. FECAL INDICATOR BACTERIA MEASUREMENTS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS IN FRESH ARCHIVED DNA EXTRACT OF WATER SAMPLE FILTRATES

    EPA Science Inventory

    The U.S. EPA has initiated a new recreational water study to evaluate the correlation between illness rates in swimmers and Enterococcus concentrations determined by the mEI agar membrane filter (MF) method and several new technologies including QPCR analysis. Results of this stu...

  7. Low Frequencies of Interference to EPA Quantitative Polymerase Chain Reaction (qPCR) Methods for Microbial Water Quality Monitoring in U.S. Rivers and Streams and Coastal Waters

    EPA Science Inventory

    In collaboration with U.S States and Tribes, the United States Environmental Protection Agency (EPA) conducts periodic and rotating, statistically based surveys of U.S. rivers and streams (National Rivers and Streams Assessment, NRSA), estuarine and Great Lakes nearshore coastal ...

  8. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    USDA-ARS?s Scientific Manuscript database

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  9. The Escherichia coli cAMP receptor protein bound at a single target can activate transcription initiation at divergent promoters: a systematic study that exploits new promoter probe plasmids.

    PubMed Central

    El-Robh, Mohamed Samir; Busby, Stephen J W

    2002-01-01

    We report the first detailed quantitative study of divergent promoters dependent on the Escherichia coli cAMP receptor protein (CRP), a factor known to activate transcription initiation at target promoters by making direct interactions with the RNA polymerase holoenzyme. In this work, we show that CRP bound at a single target site is able to activate transcription at two divergently organized promoters. Experiments using promoter probe plasmids, designed to study divergent promoters in vivo and in vitro, show that the divergent promoters function independently. Further in vitro experiments show that two holo RNA polymerase molecules cannot be accommodated simultaneously at the divergent promoters. PMID:12350222

  10. ESR1, ERBB2, and Ki67 mRNA expression predicts stage and grade of non-muscle-invasive bladder carcinoma (NMIBC).

    PubMed

    Breyer, Johannes; Wirtz, Ralph M; Laible, Mark; Schlombs, Kornelia; Erben, Philipp; Kriegmair, Maximilian Christian; Stoehr, Robert; Eidt, Sebastian; Denzinger, Stefan; Burger, Maximilian; Hartmann, Arndt; Otto, Wolfgang

    2016-11-01

    Pathological staging and grading are crucial for risk assessment in non-muscle-invasive bladder cancer (NMIBC). Molecular grading might support pathological evaluation and minimize interobserver variability. In this study, the well-established breast cancer markers ESR1, PGR, ERBB2, and MKI67 were evaluated as potential molecular markers to support grading and staging in NMIBC. We retrospectively analyzed clinical data and formalin-fixed paraffin-embedded tissues (FFPE) of patients with NMIBC. Messenger RNA (mRNA) expression of the aforementioned markers was measured by single-step reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) using RNA-specific TaqMan assays. Relative gene expression was determined by normalization to two reference genes (CALM2 and B2M) using the 40 -ΔΔCT method and correlated to histopathological stage and grade. Pathological assessment was performed by an experienced uropathologist. Statistical analysis was performed using the SAS software JMP 9.0.0 version and GraphPad Prism 5.04. Of 381 cases of NMIBC, samples of 100 pTa and 255 pT1 cases were included in the final study. Spearman rank correlation revealed significant correlations between grade and expression of MKI67 (r = 0.52, p < 0.0001), ESR1 (r = 0.25, p < 0.0001), and ERBB2 (r = 0.18, p = 0.0008). In Mann-Whitney tests, MKI67 was significantly different between all grades (p < 0.0001), while ESR1 (p = 0.0006) and ERBB2 (p = 0.027) were significantly different between G2 and G3. Higher expression of MKI67 (r = 0.49; p < 0.0001), ERBB2 (r = 0.22; p < 0.0001), and ESR1 (r = 0.18; p = 0.0009) mRNA was positively correlated with higher stage. MKI67 (p < 0.0001), ERBB2 (p = 0.0058), and PGR (p = 0.0007) were significantly different between pTa and pT1. In NMIBC expression of ESR1, ERBB2 and MKI67 are significantly different between stage and grade. This potentially provides objective parameters for pathological evaluation.

  11. Human cytomegalovirus DNA polymerase catalytic subunit pUL54 possesses independently acting nuclear localization and ppUL44 binding motifs.

    PubMed

    Alvisi, Gualtiero; Ripalti, Alessandro; Ngankeu, Apollinaire; Giannandrea, Maila; Caraffi, Stefano G; Dias, Manisha M; Jans, David A

    2006-10-01

    The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reported to be sufficient for ppUL44 binding in vitro. Although believed to be important for functioning in the nuclei of infected cells, no data are available on either the interaction of pUL54 with ppUL44 in living mammalian cells or the mechanism of pUL54 nuclear transport and its relationship with that of ppUL44. The present study examines for the first time the nuclear import pathway of pUL54 and its interaction with ppUL44 using dual color, quantitative confocal laser scanning microscopy on live transfected cells and quantitative gel mobility shift assays. We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. We also showed that pUL54 residues 1213-1242 are sufficient to confer ppUL44 binding abilities on GFP and that pUL54 and ppUL44 can be transported to the nucleus as a complex. Our work thus identified distinct sites within the HCMV DNA polymerase, which represent potential therapeutic targets and establishes the molecular basis of UL54 nuclear import.

  12. A universal TaqMan-based RT-PCR protocol for cost-efficient detection of small noncoding RNA.

    PubMed

    Jung, Ulrike; Jiang, Xiaoou; Kaufmann, Stefan H E; Patzel, Volker

    2013-12-01

    Several methods for the detection of RNA have been developed over time. For small RNA detection, a stem-loop reverse primer-based protocol relying on TaqMan RT-PCR has been described. This protocol requires an individual specific TaqMan probe for each target RNA and, hence, is highly cost-intensive for experiments with small sample sizes or large numbers of different samples. We describe a universal TaqMan-based probe protocol which can be used to detect any target sequence and demonstrate its applicability for the detection of endogenous as well as artificial eukaryotic and bacterial small RNAs. While the specific and the universal probe-based protocol showed the same sensitivity, the absolute sensitivity of detection was found to be more than 100-fold lower for both than previously reported. In subsequent experiments, we found previously unknown limitations intrinsic to the method affecting its feasibility in determination of mature template RISC incorporation as well as in multiplexing. Both protocols were equally specific in discriminating between correct and incorrect small RNA targets or between mature miRNA and its unprocessed RNA precursor, indicating the stem-loop RT-primer, but not the TaqMan probe, triggers target specificity. The presented universal TaqMan-based RT-PCR protocol represents a cost-efficient method for the detection of small RNAs.

  13. Report for the NGFA-5 project.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaing, C; Jackson, P; Thissen, J

    The objective of this project is to provide DHS a comprehensive evaluation of the current genomic technologies including genotyping, TaqMan PCR, multiple locus variable tandem repeat analysis (MLVA), microarray and high-throughput DNA sequencing in the analysis of biothreat agents from complex environmental samples. To effectively compare the sensitivity and specificity of the different genomic technologies, we used SNP TaqMan PCR, MLVA, microarray and high-throughput illumine and 454 sequencing to test various strains from B. anthracis, B. thuringiensis, BioWatch aerosol filter extracts or soil samples that were spiked with B. anthracis, and samples that were previously collected during DHS and EPAmore » environmental release exercises that were known to contain B. thuringiensis spores. The results of all the samples against the various assays are discussed in this report.« less

  14. [Method validation according to ISO 15189 and SH GTA 04: application for the detection of KRAS mutations using PCR TaqMan assay].

    PubMed

    Harlé, Alexandre; Dubois, Cindy; Rouyer, Marie; Merlin, Jean-Louis

    2013-01-01

    Since January 16(th) 2010, the French legislation requires that the medical laboratories must be accredited according to ISO 15189 standards. Thus, all medical laboratories in France must be accredited for at least part of their biological tests before the end of October 2013. Molecular biology tests are also concerned by the accreditation. Validation of molecular biology methods is made difficult, for reasons related to the methods, but also by the type of analytes that are basically rare. This article describes the validation of the qualitative detection of KRAS mutations in metastatic colorectal cancer using TaqMan PCR according to ISO 15189 and to the technical guide for accreditation in Human Health, SH-GTA-04, edited by the COFRAC.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S; Jaing, C

    The goal of this project is to develop forensic genotyping assays for select agent viruses, addressing a significant capability gap for the viral bioforensics and law enforcement community. We used a multipronged approach combining bioinformatics analysis, PCR-enriched samples, microarrays and TaqMan assays to develop high resolution and cost effective genotyping methods for strain level forensic discrimination of viruses. We have leveraged substantial experience and efficiency gained through year 1 on software development, SNP discovery, TaqMan signature design and phylogenetic signature mapping to scale up the development of forensics signatures in year 2. In this report, we have summarized the Taqmanmore » signature development for South American hemorrhagic fever viruses, tick-borne encephalitis viruses and henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus and Japanese encephalitis virus.« less

  16. A Novel Real-Time PCR for Listeria monocytogenes That Monitors Analytical Performance via an Internal Amplification Control

    PubMed Central

    Rodríguez-Lázaro, David; Pla, Maria; Scortti, Mariela; Monzó, Héctor J.; Vázquez-Boland, José A.

    2005-01-01

    We describe a novel quantitative real-time (Q)-PCR assay for Listeria monocytogenes based on the coamplification of a target hly gene fragment and an internal amplification control (IAC). The IAC is a chimeric double-stranded DNA containing a fragment of the rapeseed BnACCg8 gene flanked by the hly-specific target sequences. This IAC is detected using a second TaqMan probe labeled with a different fluorophore, enabling the simultaneous monitoring of the hly and IAC signals. The hly-IAC assay had a specificity and sensitivity of 100%, as assessed using 49 L. monocytogenes isolates of different serotypes and 96 strains of nontarget bacteria, including 51 Listeria isolates. The detection and quantification limits were 8 and 30 genome equivalents, and the coefficients for PCR linearity (R2) and efficiency (E) were 0.997 and 0.80, respectively. We tested the performance of the hly-IAC Q-PCR assay using various broth media and food matrices. Fraser and half-Fraser media, raw pork, and raw or cold-smoked salmon were strongly PCR-inhibitory. This Q-PCR assay for L. monocytogenes, the first incorporating an IAC to be described for quantitative detection of a food-borne pathogen, is a simple and robust tool facilitating the identification of false negatives or underestimations of contamination loads due to PCR failure. PMID:16332910

  17. Performance evaluation of new automated hepatitis B viral markers in the clinical laboratory: two quantitative hepatitis B surface antigen assays and an HBV core-related antigen assay.

    PubMed

    Park, Yongjung; Hong, Duck Jin; Shin, Saeam; Cho, Yonggeun; Kim, Hyon-Suk

    2012-05-01

    We evaluated quantitative hepatitis B surface antigen (qHBsAg) assays and a hepatitis B virus (HBV) core-related antigen (HBcrAg) assay. A total of 529 serum samples from patients with hepatitis B were tested. HBsAg levels were determined by using the Elecsys (Roche Diagnostics, Indianapolis, IN) and Architect (Abbott Laboratories, Abbott Park, IL) qHBsAg assays. HBcrAg was measured by using Lumipulse HBcrAg assay (Fujirebio, Tokyo, Japan). Serum aminotransferases and HBV DNA were respectively quantified by using the Hitachi 7600 analyzer (Hitachi High-Technologies, Tokyo, Japan) and the Cobas AmpliPrep/Cobas TaqMan test (Roche). Precision of the qHBsAg and HBcrAg assays was assessed, and linearity of the qHBsAg assays was verified. All assays showed good precision performance with coefficients of variation between 4.5% and 5.3% except for some levels. Both qHBsAg assays showed linearity from 0.1 to 12,000.0 IU/mL and correlated well (r = 0.9934). HBsAg levels correlated with HBV DNA (r = 0.3373) and with HBcrAg (r = 0.5164), and HBcrAg also correlated with HBV DNA (r = 0.5198; P < .0001). This observation could provide impetus for further research to elucidate the clinical usefulness of the qHBsAg and HBcrAg assays.

  18. Development and comparative evaluation of SYBR Green I-based one-step real-time RT-PCR assay for detection and quantification of West Nile virus in human patients.

    PubMed

    Kumar, Jyoti S; Saxena, Divyasha; Parida, Manmohan

    2014-01-01

    The recent outbreaks of West Nile Virus (WNV) in the Northeastern American continents and other regions of the world have made it essential to develop an efficient protocol for surveillance of WN virus. Nucleic acid based techniques like, RT-PCR have the advantage of sensitivity, specificity and rapidity. A one step single tube Env gene specific real-time RT-PCR was developed for early and reliable clinical diagnosis of WNV infection in clinical samples. The applicability of this assay for clinical diagnosis was validated with 105 suspected acute-phase serum and plasma samples from the recent epidemic of mysterious fever in Tamil Nadu, India in 2009-10. The comparative evaluation revealed the higher sensitivity of real-time RT-PCR assay by picking up 4 additional samples with low copy number of template in comparison to conventional RT-PCR. All the real-time positive samples further confirmed by CDC reported TaqMan real-time RT-PCR and quantitative real-time RT-PCR assays for the simultaneous detection of WNV lineage 1 and 2 strains. The quantitation of the viral load samples was done using a standard curve. These findings demonstrated that the assay has the potential usefulness for clinical diagnosis due to detection and quantification of WNV in acute-phase patient serum samples. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. High-throughput real-time quantitative reverse transcription PCR.

    PubMed

    Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

    2006-02-01

    Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

  20. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies.

    PubMed

    Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S

    2006-07-01

    The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, p<10(-5)) and non-CIMP MSS tumours (6.6%, p<10(-4)), respectively). CIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.

  1. Quantitative real-time polymerase chain reaction for monitoring minimal residual disease in patients with advanced indolent lymphomas treated with rituximab, fludarabine, mitoxantrone, and dexamethasone.

    PubMed

    Sarris, Andreas H; Jiang, Yunfang; Tsimberidou, Apostolia M; Thomaides, Athanasios; Rassidakis, George Z; Ford, Richard J; Medeiros, L Jeffrey; Cabanillas, Fernando; McLaughlin, Peter

    2002-02-01

    Fludarabine and rituximab (Rituxan; Genentech, Inc, South San Francisco, CA, and IDEC Pharmaceuticals, San Diego, CA) are active against indolent lymphomas. We have previously shown the safety and efficacy of the combination of FND (fludarabine/mitoxantrone/dexamethasone) in relapsed and subsequently untreated patients with stage IV indolent lymphomas. Currently, we treat patients with stage IV indolent lymphomas who are previously untreated, younger than 60 years, human immunodeficiency virus-negative, and have adequate organ and marrow function with FND and random assignment to concurrent or delayed administration of rituximab. We have developed a quantitative real-time polymerase chain reaction assay for t(14;18). With 1 μg of DNA, this assay detects 0.6 copies in 55% of reactions, as expected for the Poisson distribution. When 1μg of DNA was analyzed in duplicate, cells with the t(14;18) were detected in peripheral blood of 22% of 152 volunteer blood donors. Quantitation showed that numbers of t(14;18) cells were higher than the statistical upper normal limit (mean of all volunteer values plus standard deviations) in 2% of volunteer blood donors. By contrast, 36% of blood or marrow specimens from follicular lymphoma patients were positive, and the number of cells with t(14;18) was higher than the normal upper limit in 26%. The presence of cells with t(14;18) and their numbers are prospectively quantitated in blood and marrow of patients treated with FND plus rituximab to determine their clinical significance both at presentation and during therapy. Semin Oncol 29 (suppl 2):48-55. Copyright © 2002 by W.B. Saunders Company. Copyright © 2002 W.B. Saunders Company. All rights reserved.

  2. MATERIALS SUPPORTING THE NEW RECREATIONAL ...

    EPA Pesticide Factsheets

    EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures. The methods are supported by a series of epidemiology studies evaluating the rate of GI illness resulting from swimming events. Implementation of BEACH Act amendments

  3. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products

    EPA Science Inventory

    Escherichia coli is one of the most commonly used fecal indicator organisms for drinking water and groundwater systems. In order to understand various biogeochemical and biophysical factors affecting its interactions with biofilms, E. coli K12 was chosen as a model organism. A Ta...

  4. A simple and rapid DNA extraction method for Chlamydia trachomatis detection from urogenital swabs.

    PubMed

    Butzler, Matthew A; Reed, Jennifer L; McFall, Sally M

    2017-11-01

    A highly sensitive and specific Chlamydia trachomatis (CT) diagnostic test was developed by combining filtration isolation of nucleic acid (FINA) extraction with quantitative polymerase chain reaction including an internal control to identify test inhibition. A pilot study of 40 clinical specimens yielded 100% sensitivity and specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Bioelectrochemical Systems Workshop:Standardized Analyses, Design Benchmarks, and Reporting

    DTIC Science & Technology

    2012-01-01

    related to the exoelectrogenic biofilm activity, and to investigate whether the community structure is a function of design and operational parameters...where should biofilm samples be collected? The most prevalent methods of community characterization in BES studies have entailed phylogenetic ...of function associated with this genetic marker, and in methods that involve polymerase chain reaction (PCR) amplification the quantitative

  6. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less

  7. Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction.

    PubMed

    Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C

    2000-09-01

    The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.

  8. Usefulness of quantitative polymerase chain reaction in amniotic fluid as early prognostic marker of fetal infection with Toxoplasma gondii.

    PubMed

    Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane

    2004-03-01

    Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.

  9. Expression of Fra-1 in human hepatocellular carcinoma and its prognostic significance.

    PubMed

    Gao, Xiao-Qiang; Ge, Yong-Sheng; Shu, Qing-Hua; Ma, Hua-Xing

    2017-06-01

    This study aimed to explore the clinical significance and prognostic value of Fra-1 in hepatocellular carcinoma patients after curative resection. Fra-1 expression was investigated using a combination of techniques: immunohistochemistry for 66 samples of hepatocellular carcinoma and quantitative real-time polymerase chain reaction and western blotting assays for 19 matched hepatocellular carcinoma specimens. Fra-1 was present in 38 of 66 (57.6%) tumor tissues, with intense staining in the nuclei. There was also positive staining in 14 of 66 (21.2%) adjacent peritumoral tissues, with weak staining in the cytoplasm. Quantitative real-time polymerase chain reaction and western blotting assays confirmed higher expression of Fra-1 messenger RNA and Fra-1 protein in tumor tissues than adjacent non-tumor tissues for 19 hepatocellular carcinoma samples (p < 0.001). Positive expression of Fra-1 was significantly related to vascular invasion and serum alpha-fetoprotein. Kaplan-Meier survival analysis found that overexpressed Fra-1 was correlated with poor overall survival and disease-free survival. Multivariate analysis identified Fra-1 as an independent prognostic factor. Fra-1 may be involved in the progress of hepatocellular carcinoma and could be a promising molecular candidate in the diagnosis and treatment of hepatocellular carcinoma.

  10. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

    PubMed

    Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

    2014-12-01

    A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

  11. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

    PubMed

    Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

    2015-12-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

  12. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  13. The cervical mucus plug inhibits, but does not block, the passage of ascending bacteria from the vagina during pregnancy.

    PubMed

    Hansen, Lea K; Becher, Naja; Bastholm, Sara; Glavind, Julie; Ramsing, Mette; Kim, Chong J; Romero, Roberto; Jensen, Jørgen S; Uldbjerg, Niels

    2014-01-01

    To evaluate the microbial load and the inflammatory response in the distal and proximal parts of the cervical mucus plug. Experimental research. Twenty women with a normal, singleton pregnancy. Vaginal swabs and specimens from the distal and proximal parts of the cervical mucus plug. Immunohistochemistry, enzyme-linked immunosorbent assay, quantitative polymerase chain reaction and histology. The total bacterial load (16S rDNA) was significantly lower in the cervical mucus plug compared with the vagina (p = 0.001). Among women harboring Ureaplasma parvum, the median genome equivalents/g were 1574 (interquartile range 2526) in the proximal part, 657 (interquartile range 1620) in the distal part and 60,240 (interquartile range 96,386) in the vagina. Histological examinations and quantitative polymerase chain reaction revealed considerable amounts of lactobacilli and inflammatory cells in both parts of the cervical mucus plug. The matrix metalloproteinase-8 concentration was decreased in the proximal part of the plug compared with the distal part (p = 0.08). The cervical mucus plug inhibits, but does not block, the passage of Ureaplasma parvum during its ascending route from the vagina through the cervical canal. © 2013 Nordic Federation of Societies of Obstetrics and Gynecology.

  14. Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

    PubMed

    Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

    2004-11-12

    Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

  15. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  16. Comparison of culture-based, vital stain and PMA-qPCR methods for the quantitative detection of viable hookworm ova.

    PubMed

    Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

    2017-06-01

    Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P < 0.05) lower than vital stain and PMA-qPCR methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.

  17. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  18. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  19. Occupancy of RNA Polymerase II Phosphorylated on Serine 5 (RNAP S5P) and RNAP S2P on Varicella-Zoster Virus Genes 9, 51, and 66 Is Independent of Transcript Abundance and Polymerase Location within the Gene.

    PubMed

    Henderson, Heather H; Timberlake, Kensey B; Austin, Zoe A; Badani, Hussain; Sanford, Bridget; Tremblay, Keriann; Baird, Nicholas L; Jones, Kenneth; Rovnak, Joel; Frietze, Seth; Gilden, Don; Cohrs, Randall J

    2016-02-01

    Regulation of gene transcription in varicella-zoster virus (VZV), a ubiquitous human neurotropic alphaherpesvirus, requires coordinated binding of multiple host and virus proteins onto specific regions of the virus genome. Chromatin immunoprecipitation (ChIP) is widely used to determine the location of specific proteins along a genomic region. Since the size range of sheared virus DNA fragments governs the limit of accurate protein localization, particularly for compact herpesvirus genomes, we used a quantitative PCR (qPCR)-based assay to determine the efficiency of VZV DNA shearing before ChIP, after which the assay was used to determine the relationship between transcript abundance and the occupancy of phosphorylated RNA polymerase II (RNAP) on the gene promoter, body, and terminus of VZV genes 9, 51, and 66. The abundance of VZV gene 9, 51, and 66 transcripts in VZV-infected human fetal lung fibroblasts was determined by reverse transcription-linked quantitative PCR. Our results showed that the C-terminal domain of RNAP is hyperphosphorylated at serine 5 (S5(P)) on VZV genes 9, 51, and 66 independently of transcript abundance and the location within the virus gene at both 1 and 3 days postinfection (dpi). In contrast, phosphorylated serine 2 (S2(P))-modified RNAP was not detected at any virus gene location at 3 dpi and was detected at levels only slightly above background levels at 1 dpi. Regulation of herpesvirus gene transcription is an elaborate choreography between proteins and DNA that is revealed by chromatin immunoprecipitation (ChIP). We used a quantitative PCR-based assay to determine fragment size after DNA shearing, a critical parameter in ChIP assays, and exposed a basic difference in the mechanism of transcription between mammalian cells and VZV. We found that hyperphosphorylation at serine 5 of the C-terminal domain of RNAP along the lengths of VZV genes (the promoter, body, and transcription termination site) was independent of mRNA abundance. In contrast, little to no enrichment of serine 3 phosphorylation of RNAP was detected at these virus gene regions. This is distinct from the findings for RNAP at highly regulated host genes, where RNAP S5(P) occupancy decreased and S2(P) levels increased as the polymerase transited through the gene. Overall, these results suggest that RNAP associates with human and virus transcriptional units through different mechanisms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Genome shuffling of Saccharomyces cerevisiae for enhanced glutathione yield and relative gene expression analysis using fluorescent quantitation reverse transcription polymerase chain reaction.

    PubMed

    Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming

    2016-08-01

    Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Glycosyltransferases as marker genes for the quantitative polymerase chain reaction-based detection of circulating tumour cells from blood samples of patients with breast cancer undergoing adjuvant therapy.

    PubMed

    Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich

    2015-08-01

    Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.

  2. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    PubMed

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  3. Detection of nucleophosmin 1 mutations by quantitative real-time polymerase chain reaction versus capillary electrophoresis: a comparative study.

    PubMed

    Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang

    2011-08-01

    Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.

  4. Development of TaqMan probes targeting the four major celiac disease epitopes found in α-gliadin sequences of spelt (Triticum aestivum ssp. spelta) and bread wheat (Triticum aestivum ssp. aestivum).

    PubMed

    Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique

    2017-01-01

    Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the Asian spelt accessions studied.

  5. Recommendations for the standardization of bone marrow disease assessment and reporting in children with neuroblastoma on behalf of the International Neuroblastoma Response Criteria Bone Marrow Working Group.

    PubMed

    Burchill, Susan A; Beiske, Klaus; Shimada, Hiroyuki; Ambros, Peter F; Seeger, Robert; Tytgat, Godelieve A M; Brock, Penelope R; Haber, Michelle; Park, Julie R; Berthold, Frank

    2017-04-01

    The current study was conducted to expedite international standardized reporting of bone marrow disease in children with neuroblastoma and to improve equivalence of care. A multidisciplinary International Neuroblastoma Response Criteria Bone Marrow Working Group was convened by the US National Cancer Institute in January 2012 with representation from Europe, North America, and Australia. Practical transferable recommendations to standardize the reporting of bone marrow disease were developed. To the authors' knowledge, the current study is the first to comprehensively present consensus criteria for the collection, analysis, and reporting of the percentage area of bone marrow parenchyma occupied by tumor cells in trephine-biopsies. The quantitative analysis of neuroblastoma content in bone marrow aspirates by immunocytology and reverse transcriptase-quantitative polymerase chain reaction are revised. The inclusion of paired-like homeobox 2b (PHOX2B) for immunohistochemistry and reverse transcriptase-quantitative polymerase chain reaction is recommended. Recommendations for recording bone marrow response are provided. The authors endorse the quantitative assessment of neuroblastoma cell content in bilateral core needle biopsies-trephines and aspirates in all children with neuroblastoma, with the exception of infants, in whom the evaluation of aspirates alone is advised. It is interesting to note that 5% disease is accepted as an internationally achievable level for disease assessment. The quantitative assessment of neuroblastoma cells is recommended to provide data from which evidence-based numerical criteria for the reporting of bone marrow response can be realized. This is particularly important in the minimal disease setting and when neuroblastoma detection in bone marrow is intermittent, where clinical impact has yet to be validated. The wide adoption of these harmonized criteria will enhance the ability to compare outcomes from different trials and facilitate collaborative trial design. Cancer 2017;123:1095-1105. © 2016 American Cancer Society. © 2016 American Cancer Society.

  6. Analytical characteristics and comparative evaluation of Aptima HCV quant Dx assay with the Abbott RealTime HCV assay and Roche COBAS AmpliPrep/COBAS TaqMan HCV quantitative test v2.0.

    PubMed

    Worlock, A; Blair, D; Hunsicker, M; Le-Nguyen, T; Motta, C; Nguyen, C; Papachristou, E; Pham, J; Williams, A; Vi, M; Vinluan, B; Hatzakis, A

    2017-04-04

    The Aptima HCV Quant Dx assay (Aptima assay) is a fully automated quantitative assay on the Panther® system. This assay is intended for confirmation of diagnosis and monitoring of HCV RNA in plasma and serum specimens. The purpose of the testing described in this paper was to evaluate the performance of the Aptima assay. The analytical sensitivity, analytical specificity, precision, and linearity of the Aptima assay were assessed. The performance of the Aptima assay was compared to two commercially available HCV assays; the Abbott RealTime HCV assay (Abbott assay, Abbott Labs Illinois, USA) and the Roche COBAS Ampliprep/COBAS Taqman HCV Quantitative Test v2.0 (Roche Assay, Roche Molecular Systems, Pleasanton CA, USA). The 95% Lower Limit of Detection (LoD) of the assay was determined from dilutions of the 2nd HCV WHO International Standard (NIBSC 96/798 genotype 1) and HCV positive clinical specimens in HCV negative human plasma and serum. Probit analysis was performed to generate the 95% predicted detection limits. The Lower Limit of Quantitation (LLoQ) was established for each genotype by diluting clinical specimens and the 2nd HCV WHO International Standard (NIBSC 96/798 genotype 1) in HCV negative human plasma and serum. Specificity was determined using 200 fresh and 536 frozen HCV RNA negative clinical specimens including 370 plasma specimens and 366 serum specimens. Linearity for genotypes 1 to 6 was established by diluting armored RNA or HCV positive clinical specimens in HCV negative serum or plasma from 8.08 log IU/mL to below 1 log IU/mL. Precision was tested using a 10 member panel made by diluting HCV positive clinical specimens or spiking armored RNA into HCV negative plasma and serum. A method comparison was conducted against the Abbott assay using 1058 clinical specimens and against the Roche assay using 608 clinical specimens from HCV infected patients. In addition, agreement between the Roche assay and the Aptima assay using specimens with low HCV concentrations (

  7. Shikonin, an ingredient of Lithospermum erythrorhizon, down-regulates the expression of steroid sulfatase genes in breast cancer cells.

    PubMed

    Zhang, Yi; Qian, Rui-Qin; Li, Ping-Ping

    2009-10-18

    Steroid sulfatase (STS) has an important role in regulating the biosynthesis of estrogen within breast tumors. We aimed to investigate whether shikonin, an ingredient of Lithospermum erythrorhizon, could modulate STS expression in breast cancer cells. By MTT assay, shikonin inhibited the cell proliferation of breast cancer cells MCF-7 and SK-BR-3. Moreover, by semi-quantitative/quantitative reverse transcription polymerase chain reaction and dual-luciferase reporter based bioluminescent measurements, the mRNA and enzymatic activity levels of STS were decreased after shikonin treatment. Concluding, shikonin could act as a selective estrogen enzyme modulator by down-regulating the STS expression.

  8. Quantitative phylogenetic assessment of microbial communities in diverse environments.

    PubMed

    von Mering, C; Hugenholtz, P; Raes, J; Tringe, S G; Doerks, T; Jensen, L J; Ward, N; Bork, P

    2007-02-23

    The taxonomic composition of environmental communities is an important indicator of their ecology and function. We used a set of protein-coding marker genes, extracted from large-scale environmental shotgun sequencing data, to provide a more direct, quantitative, and accurate picture of community composition than that provided by traditional ribosomal RNA-based approaches depending on the polymerase chain reaction. Mapping marker genes from four diverse environmental data sets onto a reference species phylogeny shows that certain communities evolve faster than others. The method also enables determination of preferred habitats for entire microbial clades and provides evidence that such habitat preferences are often remarkably stable over time.

  9. BCR-ABL PCR testing in chronic myelogenous leukemia: molecular diagnosis for targeted cancer therapy and monitoring.

    PubMed

    Luu, Martin H; Press, Richard D

    2013-09-01

    The use of tyrosine kinase inhibitors (TKIs) to treat chronic myeloid leukemia (CML) represents the paradigm for modern targeted cancer therapy. Importantly, molecular monitoring using BCR-ABL real-time quantitative reverse transcription polymerase chain reaction (RQ-PCR) for assessing treatment efficacy and quantitating minimal residual disease is a major determinate of practical therapeutic decision-making in the long-term management of this now chronic disease. Herein, we present an overview of CML and the use of TKIs for targeted CML therapy, with an emphasis on the role, application and future aspects of PCR-based molecular monitoring.

  10. Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

    PubMed Central

    2009-01-01

    Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916

  11. A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species.

    PubMed

    Linck, Holger; Krüger, Erika; Reineke, Annette

    2017-01-01

    Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect). This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers.

  12. A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species

    PubMed Central

    Krüger, Erika; Reineke, Annette

    2017-01-01

    Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect). This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers. PMID:28545043

  13. Real-time PCR detection chemistry.

    PubMed

    Navarro, E; Serrano-Heras, G; Castaño, M J; Solera, J

    2015-01-15

    Real-time PCR is the method of choice in many laboratories for diagnostic and food applications. This technology merges the polymerase chain reaction chemistry with the use of fluorescent reporter molecules in order to monitor the production of amplification products during each cycle of the PCR reaction. Thus, the combination of excellent sensitivity and specificity, reproducible data, low contamination risk and reduced hand-on time, which make it a post-PCR analysis unnecessary, has made real-time PCR technology an appealing alternative to conventional PCR. The present paper attempts to provide a rigorous overview of fluorescent-based methods for nucleic acid analysis in real-time PCR described in the literature so far. Herein, different real-time PCR chemistries have been classified into two main groups; the first group comprises double-stranded DNA intercalating molecules, such as SYBR Green I and EvaGreen, whereas the second includes fluorophore-labeled oligonucleotides. The latter, in turn, has been divided into three subgroups according to the type of fluorescent molecules used in the PCR reaction: (i) primer-probes (Scorpions, Amplifluor, LUX, Cyclicons, Angler); (ii) probes; hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon, MGB-Pleiades, MGB-Eclipse, ResonSense, Yin-Yang or displacing); and (iii) analogues of nucleic acids (PNA, LNA, ZNA, non-natural bases: Plexor primer, Tiny-Molecular Beacon). In addition, structures, mechanisms of action, advantages and applications of such real-time PCR probes and analogues are depicted in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa.

    PubMed

    Huber, D P W; Erickson, M L; Leutenegger, C M; Bohlmann, J; Seybold, S J

    2007-06-01

    We have identified cDNAs and characterized the expression of 13 novel cytochrome P450 genes of potential importance in host colonization and reproduction by the California fivespined ips, Ips paraconfusus. Twelve are of the Cyp4 family and one is of the Cyp9 family. Following feeding on host Pinus ponderosa phloem, bark beetle transcript levels of several of the Cyp4 genes increased or decreased in males only or in both sexes. In one instance (IparaCyp4A5) transcript accumulated significantly in females, but declined significantly in males. The Cyp9 gene (Cyp9T1) transcript levels in males were > 85 000 x higher at 8 h and > 25 000 x higher at 24 h after feeding compared with nonfed controls. Transcript levels in females were approximately 150 x higher at 24 h compared with nonfed controls. Cyp4G27 transcript was present constitutively regardless of sex or feeding and served as a better housekeeping gene than beta-actin or 18S rRNA for the real-time TaqMan polymerase chain reaction analysis. The expression patterns of Cyp4AY1, Cyp4BG1, and, especially, Cyp9T1 in males suggest roles for these genes in male-specific aggregation pheromone production. The differential transcript accumulation patterns of these bark beetle P450s provide insight into ecological interactions of I. paraconfusus with its host pines.

  15. Copy number variants and genetic polymorphisms in TBX21, GATA3, Rorc, Foxp3 and susceptibility to Behcet's disease and Vogt-Koyanagi-Harada syndrome.

    PubMed

    Liao, Dan; Hou, Shengping; Zhang, Jun; Fang, Jing; Liu, Yunjia; Bai, Lin; Cao, Qingfeng; Kijlstra, Aize; Yang, Peizeng

    2015-04-15

    This study aimed to investigate the role of genetic variants including single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) of TBX21, GATA3, Rorc and Foxp3 genes in Behcet's disease (BD) and Vogt-Koyanagi-Harada (VKH) syndrome in a Chinese Han population. Genotyping of 25 SNPs was performed by iPLEX system (Sequenom) or polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). TaqMan real time PCR was used to assess CNVs. The expression of Rorc and Foxp3 were examined by real-time PCR and cytokine production was measured by ELISA. High Rorc CNV was associated with the susceptibility to BD (P = 8.99 × 10(-8), OR = 3.0), and low Foxp3 CNV predisposed to BD in female patients (P = 1.92 × 10(-5), OR = 3.1). CNVs for the investigated genes were not altered in VKH syndrome. Further functional studies demonstrated that the relative mRNA expression levels of Rorc were increased in individuals with high Rorc copy number, but not for Foxp3. Increased production of IL-1β and IL-6 was found in individuals carrying a high CNV of Rorc. Our study showed that high CNVs of Rorc and low CNVs of Foxp3 confer risk for BD but not for VKH syndrome. The tested 25 SNPs in TBX21, GATA3, Rorc and Foxp3 did not associate with BD and VKH syndrome.

  16. Association of caspase-1 polymorphisms with Chagas cardiomyopathy among individuals in Santa Cruz, Bolivia.

    PubMed

    Fu, Katherine Yih-Jia; Zamudio, Roxana; Henderson-Frost, Jo; Almuedo, Alex; Steinberg, Hannah; Clipman, Steven Joseph; Duran, Gustavo; Marcus, Rachel; Crawford, Thomas; Alyesh, Daniel; Colanzi, Rony; Flores, Jorge; Gilman, Robert Hugh; Bern, Caryn

    2017-01-01

    Trypanosoma cruzi (Tc) infection is usually acquired in childhood in endemic areas, leading to Chagas disease, which progresses to Chagas cardiomyopathy in 20-30% of infected individuals over decades. The pathogenesis of Chagas cardiomyopathy involves the host inflammatory response to T. cruzi, in which upstream caspase-1 activation prompts the cascade of inflammatory chemokines/cytokines, cardiac remodeling, and myocardial dysfunction. The aim of the present study was to examine the association of two caspase-1 single nucleotide polymorphisms (SNPs) with cardiomyopathy. We recruited infected (Tc+, n = 149) and uninfected (Tc-, n = 87) participants in a hospital in Santa Cruz, Bolivia. Cardiac status was classified (I, II, III, IV) based on Chagas cardiomyopathy-associated electrocardiogram findings and ejection fractions on echocardiogram. Genotypes were determined using Taqman probes via reverse transcription-polymerase chain reaction of peripheral blood DNA. Genotype frequencies were analyzed according to three inheritance patterns (dominant, recessive, additive) using logistic regression adjusted for age and sex. The AA allele for the caspase-1 SNP rs501192 was more frequent in Tc+ cardiomyopathy (classes II, III, IV) patients compared to those with a normal cardiac status (class I) [odds ratio (OR) = -2.18, p = 0.117]. This trend approached statistical significant considering only Tc+ patients in class I and II (OR = -2.64, p = 0.064). Caspase-1 polymorphisms may play a role in Chagas cardiomyopathy development and could serve as markers to identify individuals at higher risk for priority treatment.

  17. DNA barcoding and real-time PCR detection of Bactrocera xanthodes (Tephritidae: Diptera) complex.

    PubMed

    Li, D; Waite, D W; Gunawardana, D N; McCarthy, B; Anderson, D; Flynn, A; George, S

    2018-05-06

    Immature fruit fly stages of the family Tephritidae are commonly intercepted on breadfruit from Pacific countries at the New Zealand border but are unable to be identified to the species level using morphological characters. Subsequent molecular identification showed that they belong to Bactrocera xanthodes, which is part of a species complex that includes Bactrocera paraxanthodes, Bactrocera neoxanthodes and an undescribed species. To establish a more reliable molecular identification system for B. xanthodes, a reference database of DNA barcode sequences for the 5'-fragment of COI gene region was constructed for B. xanthodes from Fiji, Samoa and Tonga. To better understand the species complex, B. neoxanthodes from Vanuatu and B. paraxanthodes from New Caledonia were also barcoded. Using the results of this analysis, real-time TaqMan polymerase chain reaction (PCR) assays for the detection of B. xanthodes complex and for the three individual species of the complex were developed and validated. The assay showed high specificity for the target species, with no cross-reaction observed for closely related organisms. Each of the real-time PCR assays is sensitive, detecting the target sequences at concentrations as low as ten copies µl-1 and can be used as either singleplex or multiplex formats. This real-time PCR assay for B. xanthodes has been successfully applied at the borders in New Zealand, leading to the rapid identification of intercepted Tephritidae eggs and larvae. The developed assays will be useful biosecurity tools for rapid detection of species in the B. xanthodes complex worldwide.

  18. Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

    PubMed

    González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

    2018-02-03

    The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

  19. Development and evaluation of a real-time polymerase chain reaction assay for the rapid detection of Talaromyces marneffei MP1 gene in human plasma.

    PubMed

    Hien, Ha Thuc Ai; Thanh, Tran Tan; Thu, Nguyen Thi Mai; Nguyen, Ashley; Thanh, Nguyen Tat; Lan, Nguyen Phu Huong; Simmons, Cameron; Shikuma, Cecilia; Chau, Nguyen Van Vinh; Thwaites, Guy; Le, Thuy

    2016-12-01

    Penicilliosis caused by Talaromyces marneffei is a common AIDS-defining illness in South and Southeast Asia. Diagnosis is based on culture which can take up to 14 days for identification, leading to treatment delay and increased mortality. We developed a TaqMan real-time PCR assay targeting the MP1 gene encoding an abundant cell wall protein specific to T. marneffei. The assay's performance was evaluated in MP1-containing plasmids, clinical isolates, and plasma from HIV-infected patients with and without penicilliosis. The assay consistently detected 10 copies of MP1-containing plasmids per reaction and 100 T. marneffei yeast cells per millilitre plasma. There were no amplification with seven other Penicillium species and six other HIV-associated fungal pathogens tested. The assay was evaluated in 70 patients with AIDS: 50 patients with culture-confirmed penicilliosis and 20 patients with opportunistic infections other than penicilliosis. The diagnostic sensitivity was 70.4% (19/27, 95% CI: 51.5-84.1%) and 52.2% (12/23, 95% CI: 33.0-70.8%) in plasma samples collected prior to and within 48 h of antifungal therapy respectively. The diagnostic specificity was 100% (20/20, 95% CI: 83.9-100%). This assay provides a useful tool for the rapid diagnosis of T. marneffei infection and has the potential to improve the management of patients with penicilliosis. © 2016 The Authors. Mycoses Published by Blackwell Verlag GmbH.

  20. Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

    PubMed

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2015-02-01

    In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

Top