target binding pocket: Topics by Science.gov

Sample records for target binding pocket

Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

PubMed

Schumann, Marcel; Armen, Roger S

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").
Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

PubMed Central

Schumann, Marcel; Armen, Roger S.

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782
Insights into an original pocket-ligand pair classification: a promising tool for ligand profile prediction.

PubMed

Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude

2013-01-01

Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding.
Insights into an Original Pocket-Ligand Pair Classification: A Promising Tool for Ligand Profile Prediction

PubMed Central

Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A.; Villoutreix, Bruno O.; Camproux, Anne-Claude

2013-01-01

Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding. PMID:23840299
Investigating the Importance of the Pocket-estimation Method in Pocket-based Approaches: An Illustration Using Pocket-ligand Classification.

PubMed

Caumes, Géraldine; Borrel, Alexandre; Abi Hussein, Hiba; Camproux, Anne-Claude; Regad, Leslie

2017-09-01

Small molecules interact with their protein target on surface cavities known as binding pockets. Pocket-based approaches are very useful in all of the phases of drug design. Their first step is estimating the binding pocket based on protein structure. The available pocket-estimation methods produce different pockets for the same target. The aim of this work is to investigate the effects of different pocket-estimation methods on the results of pocket-based approaches. We focused on the effect of three pocket-estimation methods on a pocket-ligand (PL) classification. This pocket-based approach is useful for understanding the correspondence between the pocket and ligand spaces and to develop pharmacological profiling models. We found pocket-estimation methods yield different binding pockets in terms of boundaries and properties. These differences are responsible for the variation in the PL classification results that can have an impact on the detected correspondence between pocket and ligand profiles. Thus, we highlighted the importance of the pocket-estimation method choice in pocket-based approaches. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

PubMed Central

Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

2017-01-01

Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708
Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

PubMed

Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

2010-08-01

Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.
Response of SCP-2L domain of human MFE-2 to ligand removal: binding site closure and burial of peroxisomal targeting signal.

PubMed

Lensink, M F; Haapalainen, A M; Hiltunen, J K; Glumoff, T; Juffer, A H

2002-10-11

In the study of the structure and function relationship of human MFE-2, we have investigated the dynamics of human MFE-2SCP-2L (hSCP-2L) and its response to ligand removal. A comparison was made with homologous rabbit SCP-2. Breathing and a closing motion are found, identifiable with an adjustment in size and a closing off of the binding pocket. Crucial residues for structural integrity have been identified. Particularly mobile areas of the protein are loop 1 that is connecting helices A and C in space, and helix D, next to the entrance of the pocket. In hSCP-2L, the binding pocket gets occupied by Phe93, which is making a tight hydrophobic contact with Trp36. In addition, it is found that the C-terminal peroxisomal targeting signal (PTS1) that is solvent exposed in the complexed structure becomes buried when no ligand is present. Moreover, an anti-correlation exists between burial of PTS1 and the size of the binding pocket. The results are in accordance with plant nsLTPs, where a similar accommodation of binding pocket size was found after ligand binding/removal. Furthermore, the calculations support the suggestion of a ligand-assisted targeting mechanism.
Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

PubMed Central

Naz, Sadia; Ngo, Tony; Farooq, Umar

2017-01-01

Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099
Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

PubMed

Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

2017-01-01

The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.
Assessment of Drug Binding Potential of Pockets in the NS2B/NS3 Dengue Virus Protein

NASA Astrophysics Data System (ADS)

Amelia, F.; Iryani; Sari, P. Y.; Parikesit, A. A.; Bakri, R.; Toepak, E. P.; Tambunan, U. S. F.

2018-04-01

Every year an endemic dengue fever estimated to affect over 390 million cases in over 128 countries occurs. However, the antigen types which stimulate the human immune response are variable, as a result, neither effective vaccines nor antiviral treatments have been successfully developed for this disease. The NS2B/NS3 protease of the dengue virus (DENV) responsible for viral replication is a potential drug target. The ligand-enzyme binding site determination is a key role in the success of virtual screening of new inhibitors. The NS2B/NS3 protease of DENV (PDB ID: 2FOM) has two pockets consisting of 37 (Pocket 1) and 27 (Pocket 2) amino acid residues in each pocket. In this research, we characterized the amino acid residues for binding sites in NS3/NS2B based on the hydrophobicity, the percentage of charged residues, volume, depth, ΔGbinding, hydrogen bonding and bond length. The hydrophobic percentages of both pockets are high, 59 % (Pocket 1) and 41% (Pocket 2) and the percentage of charged residues in Pocket 1 and 2 are 22% and 48%, and the pocket volume is less than 700 Å3. An interaction analysis using molecular docking showed that interaction between the ligand complex and protein in Pocket 1 is more negative than Pocket 2. As a result, Pocket 1 is the better potential target for a ligand to inhibit the action of NS2B/NS3 DENV.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Drug-like density: a method of quantifying the "bindability" of a protein target based on a very large set of pockets and drug-like ligands from the Protein Data Bank.

PubMed

Sheridan, Robert P; Maiorov, Vladimir N; Holloway, M Katharine; Cornell, Wendy D; Gao, Ying-Duo

2010-11-22

One approach to estimating the "chemical tractability" of a candidate protein target where we know the atomic resolution structure is to examine the physical properties of potential binding sites. A number of other workers have addressed this issue. We characterize ~290,000 "pockets" from ~42,000 protein crystal structures in terms of a three parameter "pocket space": volume, buriedness, and hydrophobicity. A metric DLID (drug-like density) measures how likely a pocket is to bind a drug-like molecule. This is calculated from the count of other pockets in its local neighborhood in pocket space that contain drug-like cocrystallized ligands and the count of total pockets in the neighborhood. Surprisingly, despite being defined locally, a global trend in DLID can be predicted by a simple linear regression on log(volume), buriedness, and hydrophobicity. Two levels of simplification are necessary to relate the DLID of individual pockets to "targets": taking the best DLID per Protein Data Bank (PDB) entry (because any given crystal structure can have many pockets), and taking the median DLID over all PDB entries for the same target (because different crystal structures of the same protein can vary because of artifacts and real conformational changes). We can show that median DLIDs for targets that are detectably homologous in sequence are reasonably similar and that median DLIDs correlate with the "druggability" estimate of Cheng et al. (Nature Biotechnology 2007, 25, 71-75).
PatchSurfers: Two methods for local molecular property-based binding ligand prediction.

PubMed

Shin, Woong-Hee; Bures, Mark Gregory; Kihara, Daisuke

2016-01-15

Protein function prediction is an active area of research in computational biology. Function prediction can help biologists make hypotheses for characterization of genes and help interpret biological assays, and thus is a productive area for collaboration between experimental and computational biologists. Among various function prediction methods, predicting binding ligand molecules for a target protein is an important class because ligand binding events for a protein are usually closely intertwined with the proteins' biological function, and also because predicted binding ligands can often be directly tested by biochemical assays. Binding ligand prediction methods can be classified into two types: those which are based on protein-protein (or pocket-pocket) comparison, and those that compare a target pocket directly to ligands. Recently, our group proposed two computational binding ligand prediction methods, Patch-Surfer, which is a pocket-pocket comparison method, and PL-PatchSurfer, which compares a pocket to ligand molecules. The two programs apply surface patch-based descriptions to calculate similarity or complementarity between molecules. A surface patch is characterized by physicochemical properties such as shape, hydrophobicity, and electrostatic potentials. These properties on the surface are represented using three-dimensional Zernike descriptors (3DZD), which are based on a series expansion of a 3 dimensional function. Utilizing 3DZD for describing the physicochemical properties has two main advantages: (1) rotational invariance and (2) fast comparison. Here, we introduce Patch-Surfer and PL-PatchSurfer with an emphasis on PL-PatchSurfer, which is more recently developed. Illustrative examples of PL-PatchSurfer performance on binding ligand prediction as well as virtual drug screening are also provided. Copyright © 2015 Elsevier Inc. All rights reserved.
Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.
Generating "fragment-based virtual library" using pocket similarity search of ligand-receptor complexes.

PubMed

Khashan, Raed S

2015-01-01

As the number of available ligand-receptor complexes is increasing, researchers are becoming more dedicated to mine these complexes to aid in the drug design and development process. We present free software which is developed as a tool for performing similarity search across ligand-receptor complexes for identifying binding pockets which are similar to that of a target receptor. The search is based on 3D-geometric and chemical similarity of the atoms forming the binding pocket. For each match identified, the ligand's fragment(s) corresponding to that binding pocket are extracted, thus forming a virtual library of fragments (FragVLib) that is useful for structure-based drug design. The program provides a very useful tool to explore available databases.
Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

PubMed

Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

2017-07-05

Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.
Structure-based design, synthesis and crystallization of 2-arylquinazolines as lipid pocket ligands of p38α MAPK

PubMed Central

Bührmann, Mike; Wiedemann, Bianca M.; Müller, Matthias P.; Hardick, Julia; Ecke, Maria

2017-01-01

In protein kinase research, identifying and addressing small molecule binding sites other than the highly conserved ATP-pocket are of intense interest because this line of investigation extends our understanding of kinase function beyond the catalytic phosphotransfer. Such alternative binding sites may be involved in altering the activation state through subtle conformational changes, control cellular enzyme localization, or in mediating and disrupting protein-protein interactions. Small organic molecules that target these less conserved regions might serve as tools for chemical biology research and to probe alternative strategies in targeting protein kinases in disease settings. Here, we present the structure-based design and synthesis of a focused library of 2-arylquinazoline derivatives to target the lipophilic C-terminal binding pocket in p38α MAPK, for which a clear biological function has yet to be identified. The interactions of the ligands with p38α MAPK was analyzed by SPR measurements and validated by protein X-ray crystallography. PMID:28892510
Docking and scoring with ICM: the benchmarking results and strategies for improvement

PubMed Central

Neves, Marco A. C.; Totrov, Maxim; Abagyan, Ruben

2012-01-01

Flexible docking and scoring using the Internal Coordinate Mechanics software (ICM) was benchmarked for ligand binding mode prediction against the 85 co-crystal structures in the modified Astex data set. The ICM virtual ligand screening was tested against the 40 DUD target benchmarks and 11-target WOMBAT sets. The self-docking accuracy was evaluated for the top 1 and top 3 scoring poses at each ligand binding site with near native conformations below 2 Å RMSD found in 91% and 95% of the predictions, respectively. The virtual ligand screening using single rigid pocket conformations provided the median area under the ROC curves equal to 69.4 with 22.0% true positives recovered at 2% false positive rate. Significant improvements up to ROC AUC= 82.2 and ROC(2%)= 45.2 were achieved following our best practices for flexible pocket refinement and out-of-pocket binding rescore. The virtual screening can be further improved by considering multiple conformations of the target. PMID:22569591
An alternate binding site for PPARγ ligands

PubMed Central

Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2014-01-01

PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

Molecular Docking Studies to Explore Potential Binding Pockets and Inhibitors for Chikungunya Virus Envelope Glycoproteins.

PubMed

Nguyen, Phuong T V; Yu, Haibo; Keller, Paul A

2017-03-11

The chikungunya virus (CHIKV) envelope glycoproteins are considered important potential targets for anti-CHIKV drug discovery due to their crucial roles in virus attachment and virus entry. In this study, using two available crystal structures of the immature and mature forms of envelope glycoproteins, virtual screenings based on blind dockings and focused dockings were carried out to identify potential binding pockets and hit compounds for the virus. The chemical library database of compounds, NCI Diversity Set II, was used in these docking studies. In addition to reproducing previously reported examples, new binding pockets were identified, e.g., Pocket 2 in the 3N40, and Pocket 2 and Pocket 3 in the 3N42. Convergences in conformational sampling in docking using AutoDock Vina were evaluated. An analysis of docking results was carried out to understand interactions of the envelope glycoproteins complexes. Some key residues for interactions, for example Gly91 and His230, are identified as possessing important roles in the fusion process.
Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

PubMed Central

Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

2012-01-01

Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778
Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

PubMed

Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

2012-01-01

Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.
Molecular basis for defect in Alix-binding by alternatively spliced isoform of ALG-2 (ALG-2DeltaGF122) and structural roles of F122 in target recognition.

PubMed

Inuzuka, Tatsutoshi; Suzuki, Hironori; Kawasaki, Masato; Shibata, Hideki; Wakatsuki, Soichi; Maki, Masatoshi

2010-08-06

ALG-2 (a gene product of PDCD6) belongs to the penta-EF-hand (PEF) protein family and Ca2+-dependently interacts with various intracellular proteins including mammalian Alix, an adaptor protein in the ESCRT system. Our previous X-ray crystal structural analyses revealed that binding of Ca2+ to EF3 enables the side chain of R125 to move enough to make a primary hydrophobic pocket (Pocket 1) accessible to a short fragment of Alix. The side chain of F122, facing a secondary hydrophobic pocket (Pocket 2), interacts with the Alix peptide. An alternatively spliced shorter isoform, designated ALG-2DeltaGF122, lacks Gly121Phe122 and does not bind Alix, but the structural basis of the incompetence has remained to be elucidated. We solved the X-ray crystal structure of the PEF domain of ALG-2DeltaGF122 in the Ca2+-bound form and compared it with that of ALG-2. Deletion of the two residues shortened alpha-helix 5 (alpha5) and changed the configuration of the R125 side chain so that it partially blocked Pocket 1. A wall created by the main chain of 121-GFG-123 and facing the two pockets was destroyed. Surprisingly, however, substitution of F122 with Ala or Gly, but not with Trp, increased the Alix-binding capacity in binding assays. The F122 substitutions exhibited different effects on binding of ALG-2 to other known interacting proteins, including TSG101 (Tumor susceptibility gene 101) and annexin A11. The X-ray crystal structure of the F122A mutant revealed that removal of the bulky F122 side chain not only created an additional open space in Pocket 2 but also abolished inter-helix interactions with W95 and V98 (present in alpha4) and that alpha5 inclined away from alpha4 to expand Pocket 2, suggesting acquirement of more appropriate positioning of the interacting residues to accept Alix. We found that the inability of the two-residue shorter ALG-2 isoform to bind Alix is not due to the absence of bulky side chain of F122 but due to deformation of a main-chain wall facing pockets 1 and 2. Moreover, a residue at the position of F122 contributes to target specificity and a smaller side chain is preferable for Alix binding but not favored to bind annexin A11.
Optimization of a binding fragment targeting the "enlarged methionine pocket" leads to potent Trypanosoma brucei methionyl-tRNA synthetase inhibitors.

PubMed

Huang, Wenlin; Zhang, Zhongsheng; Ranade, Ranae M; Gillespie, J Robert; Barros-Álvarez, Ximena; Creason, Sharon A; Shibata, Sayaka; Verlinde, Christophe L M J; Hol, Wim G J; Buckner, Frederick S; Fan, Erkang

2017-06-15

Potent inhibitors of Trypanosoma brucei methionyl-tRNA synthetase were previously designed using a structure-guided approach. Compounds 1 and 2 were the most active compounds in the cyclic and linear linker series, respectively. To further improve cellular potency, SAR investigation of a binding fragment targeting the "enlarged methionine pocket" (EMP) was performed. The optimization led to the identification of a 6,8-dichloro-tetrahydroquinoline ring as a favorable fragment to bind the EMP. Replacement of 3,5-dichloro-benzyl group (the EMP binding fragment) of inhibitor 2 using this tetrahydroquinoline fragment resulted in compound 13, that exhibited an EC 50 of 4nM. Copyright © 2017 Elsevier Ltd. All rights reserved.
PoSSuM v.2.0: data update and a new function for investigating ligand analogs and target proteins of small-molecule drugs.

PubMed

Ito, Jun-ichi; Ikeda, Kazuyoshi; Yamada, Kazunori; Mizuguchi, Kenji; Tomii, Kentaro

2015-01-01

PoSSuM (http://possum.cbrc.jp/PoSSuM/) is a database for detecting similar small-molecule binding sites on proteins. Since its initial release in 2011, PoSSuM has grown to provide information related to 49 million pairs of similar binding sites discovered among 5.5 million known and putative binding sites. This enlargement of the database is expected to enhance opportunities for biological and pharmaceutical applications, such as predictions of new functions and drug discovery. In this release, we have provided a new service named PoSSuM drug search (PoSSuMds) at http://possum.cbrc.jp/PoSSuM/drug_search/, in which we selected 194 approved drug compounds retrieved from ChEMBL, and detected their known binding pockets and pockets that are similar to them. Users can access and download all of the search results via a new web interface, which is useful for finding ligand analogs as well as potential target proteins. Furthermore, PoSSuMds enables users to explore the binding pocket universe within PoSSuM. Additionally, we have improved the web interface with new functions, including sortable tables and a viewer for visualizing and downloading superimposed pockets. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Revealing the favorable dissociation pathway of type II kinase inhibitors via enhanced sampling simulations and two-end-state calculations.

PubMed

Sun, Huiyong; Tian, Sheng; Zhou, Shunye; Li, Youyong; Li, Dan; Xu, Lei; Shen, Mingyun; Pan, Peichen; Hou, Tingjun

2015-02-13

How does a type II inhibitor bind to/unbind from a kinase target is still a confusing question because the small molecule occupies both the ATP pocket and the allosteric pocket of the kinase binding site. Here, by using enhanced sampling simulations (umbrella sampling, US) and two-end-state free energy calculations (MM/GSBA), we systemically studied the dissociation processes of two distinct small molecules escaping from the binding pocket of p38 MAP kinase through the allosteric channel and the ATP channel. The results show that the unbinding pathways along the allosteric channel have much lower PMF depths than those along the ATP channel, suggesting that the allosteric channel is more favorable for the dissociations of the two inhibitors and thereby supporting the general understanding that the largest channel of a target is usually the entry/exit pathway for the binding/dissociation of small molecules. Interestingly, the MM/GBSA approach yielded similar PMF profiles compared with those based on US, a much time consuming approach, indicating that for a general study, such as detecting the important transition state of a ligand binding/unbinding process, MM/GBSA may be a feasible choice.
A Novel Antiviral Target Structure Involved in the RNA Binding, Dimerization, and Nuclear Export Functions of the Influenza A Virus Nucleoprotein

PubMed Central

Yamada, Kazunori; Kondoh, Yasumitsu; Hikono, Hirokazu; Osada, Hiroyuki; Tomii, Kentaro; Saito, Takehiko; Aida, Yoko

2015-01-01

Developing antiviral therapies for influenza A virus (IAV) infection is an ongoing process because of the rapid rate of antigenic mutation and the emergence of drug-resistant viruses. The ideal strategy is to develop drugs that target well-conserved, functionally restricted, and unique surface structures without affecting host cell function. We recently identified the antiviral compound, RK424, by screening a library of 50,000 compounds using cell-based infection assays. RK424 showed potent antiviral activity against many different subtypes of IAV in vitro and partially protected mice from a lethal dose of A/WSN/1933 (H1N1) virus in vivo. Here, we show that RK424 inhibits viral ribonucleoprotein complex (vRNP) activity, causing the viral nucleoprotein (NP) to accumulate in the cell nucleus. In silico docking analysis revealed that RK424 bound to a small pocket in the viral NP. This pocket was surrounded by three functionally important domains: the RNA binding groove, the NP dimer interface, and nuclear export signal (NES) 3, indicating that it may be involved in the RNA binding, oligomerization, and nuclear export functions of NP. The accuracy of this binding model was confirmed in a NP-RK424 binding assay incorporating photo-cross-linked RK424 affinity beads and in a plaque assay evaluating the structure-activity relationship of RK424. Surface plasmon resonance (SPR) and pull-down assays showed that RK424 inhibited both the NP-RNA and NP-NP interactions, whereas size exclusion chromatography showed that RK424 disrupted viral RNA-induced NP oligomerization. In addition, in vitro nuclear export assays confirmed that RK424 inhibited nuclear export of NP. The amino acid residues comprising the NP pocket play a crucial role in viral replication and are highly conserved in more than 7,000 NP sequences from avian, human, and swine influenza viruses. Furthermore, we found that the NP pocket has a surface structure different from that of the pocket in host molecules. Taken together, these results describe a promising new approach to developing influenza virus drugs that target a novel pocket structure within NP. PMID:26222066
Assembly-directed antivirals differentially bind quasiequivalent pockets to modify hepatitis B virus capsid tertiary and quaternary structure.

PubMed

Katen, Sarah P; Tan, Zhenning; Chirapu, Srinivas Reddy; Finn, M G; Zlotnick, Adam

2013-08-06

Hepatitis B virus (HBV) is a major cause of liver disease. Assembly of the HBV capsid is a critical step in virus production and an attractive target for new antiviral therapies. We determined the structure of HBV capsid in complex with AT-130, a member of the phenylpropenamide family of assembly effectors. AT-130 causes tertiary and quaternary structural changes but does not disrupt capsid structure. AT-130 binds a hydrophobic pocket that also accommodates the previously characterized heteroaryldihydropyrimidine compounds but favors a unique quasiequivalent location on the capsid surface. Thus, this pocket is a promiscuous drug-binding site and a likely target for different assembly effectors with a broad range of mechanisms of activity. That AT-130 successfully decreases virus production by increasing capsid assembly rate without disrupting capsid structure delineates a paradigm in antiviral design, that disrupting reaction timing is a viable strategy for assembly effectors of HBV and other viruses. Copyright © 2013 Elsevier Ltd. All rights reserved.
Crystal Structure of Silkworm Bombyx mori JHBP in Complex With 2-Methyl-2,4-Pentanediol: Plasticity of JH-Binding Pocket and Ligand-Induced Conformational Change of the Second Cavity in JHBP

PubMed Central

Fujimoto, Zui; Suzuki, Rintaro; Shiotsuki, Takahiro; Tsuchiya, Wataru; Tase, Akira; Momma, Mitsuru; Yamazaki, Toshimasa

2013-01-01

Juvenile hormones (JHs) control a diversity of crucial life events in insects. In Lepidoptera which major agricultural pests belong to, JH signaling is critically controlled by a species-specific high-affinity, low molecular weight JH-binding protein (JHBP) in hemolymph, which transports JH from the site of its synthesis to target tissues. Hence, JHBP is expected to be an excellent target for the development of novel specific insect growth regulators (IGRs) and insecticides. A better understanding of the structural biology of JHBP should pave the way for the structure-based drug design of such compounds. Here, we report the crystal structure of the silkworm Bombyx mori JHBP in complex with two molecules of 2-methyl-2,4-pentanediol (MPD), one molecule (MPD1) bound in the JH-binding pocket while the other (MPD2) in a second cavity. Detailed comparison with the apo-JHBP and JHBP-JH II complex structures previously reported by us led to a number of intriguing findings. First, the JH-binding pocket changes its size in a ligand-dependent manner due to flexibility of the gate α1 helix. Second, MPD1 mimics interactions of the epoxide moiety of JH previously observed in the JHBP-JH complex, and MPD can compete with JH in binding to the JH-binding pocket. We also confirmed that methoprene, which has an MPD-like structure, inhibits the complex formation between JHBP and JH while the unepoxydated JH III (methyl farnesoate) does not. These findings may open the door to the development of novel IGRs targeted against JHBP. Third, binding of MPD to the second cavity of JHBP induces significant conformational changes accompanied with a cavity expansion. This finding, together with MPD2-JHBP interaction mechanism identified in the JHBP-MPD complex, should provide important guidance in the search for the natural ligand of the second cavity. PMID:23437107
Gating by tryptophan 73 exposes a cryptic pocket at the protein-binding interface of the oncogenic eIF4E protein.

PubMed

Lama, Dilraj; Brown, Christopher J; Lane, David P; Verma, Chandra S

2015-10-27

Targeting protein-protein interacting sites for potential therapeutic applications is a challenge in the development of inhibitors, and this becomes more difficult when these interfaces are relatively planar, as in the eukaryotic translation initiation factor 4E (eIF4E) protein. eIF4E is an oncogene that is overexpressed in numerous forms of cancer, making it a prime target as a therapeutic molecule. We report here the presence of a cryptic pocket at the protein-binding interface of eIF4E, which opens transiently during molecular dynamics simulations of the protein in solvent water and is observed to be stable when solvent water is mixed with benzene molecules. This pocket can also be seen in the ensemble of structures available from the solution-state conformations of eIF4E. The accessibility of the pocket is gated by the side-chain transitions of an evolutionarily conserved tryptophan residue. It is found to be feasible for accommodating clusters of benzene molecules, which signify the plasticity and ligandability of the pocket. We also observe that the newly formed cavity provides a favorable binding environment for interaction of a well-recognized small molecule inhibitor of eIF4E. The occurrence of this transiently accessible cavity highlights the existence of a more pronounced binding groove in a region that has traditionally been considered to be planar. Together, the data suggest that an alternate binding cavity exists on eIF4E and could be exploited for the rational design and development of a new class of lead compounds against the protein.
Genetic Pathway of HIV-1 Resistance to Novel Fusion Inhibitors Targeting the Gp41 Pocket

PubMed Central

Su, Yang; Chong, Huihiui; Xiong, Shengwen; Qiao, Yuanyuan; Qiu, Zonglin

2015-01-01

ABSTRACT The peptide drug enfuvirtide (T20) is the only HIV-1 fusion inhibitor in clinical use, but it easily induces drug resistance, calling for new strategies for developing effective drugs. On the basis of the M-T hook structure, we recently developed highly potent short-peptide HIV-1 fusion inhibitors (MTSC22 and HP23), which mainly target the conserved gp41 pocket and possess high genetic barriers to resistance. Here, we focused on the selection and characterization of HIV-1 escape mutants of MTSC22, which revealed new resistance pathways and mechanisms. Two mutations (E49K and L57R) located at the inhibitor-binding site and two mutations (N126K and E136G) located at the C-terminal heptad repeat region of gp41 were identified as conferring high resistance either singly or in combination. While E49K reduced the C-terminal binding of inhibitors via an electrostatic repulsion, L57R dramatically disrupted the N-terminal binding of M-T hook structure and pocket-binding domain. Unlike E49K and N126K, which enhanced the stability of the endogenous viral six-helical bundle core (6-HB), L57R and E136G conversely destabilized the 6-HB structure. We also demonstrated that both primary and secondary mutations caused the structural changes in 6-HB and severely impaired the capability for HIV-1 entry. Collectively, our data provide novel insights into the mechanisms of short-peptide fusion inhibitors targeting the gp41 pocket site and help increase our understanding of the structure and function of gp41 and HIV-1 evolution. IMPORTANCE The deep pocket on the N-trimer of HIV-1 gp41 has been considered an ideal drug target because of its high degree of conservation and essential role in viral entry. Short-peptide fusion inhibitors, which contain an M-T hook structure and mainly target the pocket site, show extremely high binding and inhibitory activities as well as high genetic barriers to resistance. In this study, the HIV-1 mutants resistant to MTSC22 were selected and characterized, which revealed that the E49K and L57R substitutions at the inhibitor-binding site and the N126K and E136G substitutions at the C-terminal heptad repeat region of gp41 critically determine the resistance phenotype. The data provide novel insights into the mechanisms of action of the M-T hook structure-based fusion inhibitors which will help further our understanding of the structure-function relationship of gp41 and molecular pathways of HIV-1 evolution and eventually facilitate the development of new anti-HIV drugs. PMID:26446597
Rational Design of Novel Allosteric Dihydrofolate Reductase Inhibitors Showing Antibacterial Effects on Drug-Resistant Escherichia coli Escape Variants.

PubMed

Srinivasan, Bharath; Rodrigues, João V; Tonddast-Navaei, Sam; Shakhnovich, Eugene; Skolnick, Jeffrey

2017-07-21

In drug discovery, systematic variations of substituents on a common scaffold and bioisosteric replacements are often used to generate diversity and obtain molecules with better biological effects. However, this could saturate the small-molecule diversity pool resulting in drug resistance. On the other hand, conventional drug discovery relies on targeting known pockets on protein surfaces leading to drug resistance by mutations of critical pocket residues. Here, we present a two-pronged strategy of designing novel drugs that target unique pockets on a protein's surface to overcome the above problems. Dihydrofolate reductase, DHFR, is a critical enzyme involved in thymidine and purine nucleotide biosynthesis. Several classes of compounds that are structural analogues of the substrate dihydrofolate have been explored for their antifolate activity. Here, we describe 10 novel small-molecule inhibitors of Escherichia coli DHFR, EcDHFR, belonging to the stilbenoid, deoxybenzoin, and chalcone family of compounds discovered by a combination of pocket-based virtual ligand screening and systematic scaffold hopping. These inhibitors show a unique uncompetitive or noncompetitive inhibition mechanism, distinct from those reported for all known inhibitors of DHFR, indicative of binding to a unique pocket distinct from either substrate or cofactor-binding pockets. Furthermore, we demonstrate that rescue mutants of EcDHFR, with reduced affinity to all known classes of DHFR inhibitors, are inhibited at the same concentration as the wild-type. These compounds also exhibit antibacterial activity against E. coli harboring the drug-resistant variant of DHFR. This discovery is the first report on a novel class of inhibitors targeting a unique pocket on EcDHFR.
Function and dynamics of aptamers: A case study on the malachite green aptamer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tianjiao

Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH - is sterically excluded frommore » the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD simulation and experimental verification. The former has potential application in controlling metabolic reactions and protein modifications by small reactants and the latter may serve as a general approach to study the dynamics of aptamer-target interaction for new insights into mechanisms of aptamer-target recognition.« less
Human Cytomegalovirus Major Immediate Early 1 Protein Targets Host Chromosomes by Docking to the Acidic Pocket on the Nucleosome Surface

PubMed Central

Mücke, Katrin; Paulus, Christina; Bernhardt, Katharina; Gerrer, Katrin; Schön, Kathrin; Fink, Alina; Sauer, Eva-Maria; Asbach-Nitzsche, Alexandra; Harwardt, Thomas; Kieninger, Bärbel; Kremer, Werner; Kalbitzer, Hans Robert

2014-01-01

The 72-kDa immediate early 1 (IE1) protein encoded by human cytomegalovirus (hCMV) is a nuclearly localized promiscuous regulator of viral and cellular transcription. IE1 has long been known to associate with host mitotic chromatin, yet the mechanisms underlying this interaction have not been specified. In this study, we identify the cellular chromosome receptor for IE1. We demonstrate that the viral protein targets human nucleosomes by directly binding to core histones in a nucleic acid-independent manner. IE1 exhibits two separable histone-interacting regions with differential binding specificities for H2A-H2B and H3-H4. The H2A-H2B binding region was mapped to an evolutionarily conserved 10-amino-acid motif within the chromatin-tethering domain (CTD) of IE1. Results from experimental approaches combined with molecular modeling indicate that the IE1 CTD adopts a β-hairpin structure, docking with the acidic pocket formed by H2A-H2B on the nucleosome surface. IE1 binds to the acidic pocket in a way similar to that of the latency-associated nuclear antigen (LANA) of the Kaposi's sarcoma-associated herpesvirus. Consequently, the IE1 and LANA CTDs compete for binding to nucleosome cores and chromatin. Our work elucidates in detail how a key viral regulator is anchored to human chromosomes and identifies the nucleosomal acidic pocket as a joint target of proteins from distantly related viruses. Based on the striking similarities between the IE1 and LANA CTDs and the fact that nucleosome targeting by IE1 is dispensable for productive replication even in “clinical” strains of hCMV, we speculate that the two viral proteins may serve analogous functions during latency of their respective viruses. PMID:24227840
PockDrug-Server: a new web server for predicting pocket druggability on holo and apo proteins

PubMed Central

Hussein, Hiba Abi; Borrel, Alexandre; Geneix, Colette; Petitjean, Michel; Regad, Leslie; Camproux, Anne-Claude

2015-01-01

Predicting protein pocket's ability to bind drug-like molecules with high affinity, i.e. druggability, is of major interest in the target identification phase of drug discovery. Therefore, pocket druggability investigations represent a key step of compound clinical progression projects. Currently computational druggability prediction models are attached to one unique pocket estimation method despite pocket estimation uncertainties. In this paper, we propose ‘PockDrug-Server’ to predict pocket druggability, efficient on both (i) estimated pockets guided by the ligand proximity (extracted by proximity to a ligand from a holo protein structure) and (ii) estimated pockets based solely on protein structure information (based on amino atoms that form the surface of potential binding cavities). PockDrug-Server provides consistent druggability results using different pocket estimation methods. It is robust with respect to pocket boundary and estimation uncertainties, thus efficient using apo pockets that are challenging to estimate. It clearly distinguishes druggable from less druggable pockets using different estimation methods and outperformed recent druggability models for apo pockets. It can be carried out from one or a set of apo/holo proteins using different pocket estimation methods proposed by our web server or from any pocket previously estimated by the user. PockDrug-Server is publicly available at: http://pockdrug.rpbs.univ-paris-diderot.fr. PMID:25956651
PockDrug-Server: a new web server for predicting pocket druggability on holo and apo proteins.

PubMed

Hussein, Hiba Abi; Borrel, Alexandre; Geneix, Colette; Petitjean, Michel; Regad, Leslie; Camproux, Anne-Claude

2015-07-01

Predicting protein pocket's ability to bind drug-like molecules with high affinity, i.e. druggability, is of major interest in the target identification phase of drug discovery. Therefore, pocket druggability investigations represent a key step of compound clinical progression projects. Currently computational druggability prediction models are attached to one unique pocket estimation method despite pocket estimation uncertainties. In this paper, we propose 'PockDrug-Server' to predict pocket druggability, efficient on both (i) estimated pockets guided by the ligand proximity (extracted by proximity to a ligand from a holo protein structure) and (ii) estimated pockets based solely on protein structure information (based on amino atoms that form the surface of potential binding cavities). PockDrug-Server provides consistent druggability results using different pocket estimation methods. It is robust with respect to pocket boundary and estimation uncertainties, thus efficient using apo pockets that are challenging to estimate. It clearly distinguishes druggable from less druggable pockets using different estimation methods and outperformed recent druggability models for apo pockets. It can be carried out from one or a set of apo/holo proteins using different pocket estimation methods proposed by our web server or from any pocket previously estimated by the user. PockDrug-Server is publicly available at: http://pockdrug.rpbs.univ-paris-diderot.fr. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Searching for protein binding sites from Molecular Dynamics simulations and paramagnetic fragment-based NMR studies.

PubMed

Bernini, Andrea; Henrici De Angelis, Lucia; Morandi, Edoardo; Spiga, Ottavia; Santucci, Annalisa; Assfalg, Michael; Molinari, Henriette; Pillozzi, Serena; Arcangeli, Annarosa; Niccolai, Neri

2014-03-01

Hotspot delineation on protein surfaces represents a fundamental step for targeting protein-protein interfaces. Disruptors of protein-protein interactions can be designed provided that the sterical features of binding pockets, including the transient ones, can be defined. Molecular Dynamics, MD, simulations have been used as a reliable framework for identifying transient pocket openings on the protein surface. Accessible surface area and intramolecular H-bond involvement of protein backbone amides are proposed as descriptors for characterizing binding pocket occurrence and evolution along MD trajectories. TEMPOL induced paramagnetic perturbations on (1)H-(15)N HSQC signals of protein backbone amides have been analyzed as a fragment-based search for surface hotspots, in order to validate MD predicted pockets. This procedure has been applied to CXCL12, a small chemokine responsible for tumor progression and proliferation. From combined analysis of MD data and paramagnetic profiles, two CXCL12 sites suitable for the binding of small molecules were identified. One of these sites is the already well characterized CXCL12 region involved in the binding to CXCR4 receptor. The other one is a transient pocket predicted by Molecular Dynamics simulations, which could not be observed from static analysis of CXCL12 PDB structures. The present results indicate how TEMPOL, instrumental in identifying this transient pocket, can be a powerful tool to delineate minor conformations which can be highly relevant in dynamic discovery of antitumoral drugs. Copyright © 2013 Elsevier B.V. All rights reserved.
Assessing the binding of cholinesterase inhibitors by docking and molecular dynamics studies.

PubMed

Ali, M Rejwan; Sadoqi, Mostafa; Møller, Simon G; Boutajangout, Allal; Mezei, Mihaly

2017-09-01

In this report we assessed by docking and molecular dynamics the binding mechanisms of three FDA-approved Alzheimer drugs, inhibitors of the enzyme acetylcholinesterase (AChE): donepezil, galantamine and rivastigmine. Dockings by the softwares Autodock-Vina, PatchDock and Plant reproduced the docked conformations of the inhibitor-enzyme complexes within 2Å of RMSD of the X-ray structure. Free-energy scores show strong affinity of the inhibitors for the enzyme binding pocket. Three independent Molecular Dynamics simulation runs indicated general stability of donepezil, galantamine and rivastigmine in their respective enzyme binding pocket (also referred to as gorge) as well as the tendency to form hydrogen bonds with the water molecules. The binding of rivastigmine in the Torpedo California AChE binding pocket is interesting as it eventually undergoes carbamylation and breaks apart according to the X-ray structure of the complex. Similarity search in the ZINC database and targeted docking on the gorge region of the AChE enzyme gave new putative inhibitor molecules with high predicted binding affinity, suitable for potential biophysical and biological assessments. Copyright © 2017 Elsevier Inc. All rights reserved.
Structural, Functional, and Genetic Analysis of Sorangicin Inhibition of Bacterial RNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell,E.; Pavlova, O.; Zenkin, N.

2005-01-01

A combined structural, functional, and genetic approach was used to investigate inhibition of bacterial RNA polymerase (RNAP) by sorangicin (Sor), a macrolide polyether antibiotic. Sor lacks chemical and structural similarity to the ansamycin rifampicin (Rif), an RNAP inhibitor widely used to treat tuberculosis. Nevertheless, structural analysis revealed Sor binds in the same RNAP {beta} subunit pocket as Rif, with almost complete overlap of RNAP binding determinants, and functional analysis revealed that both antibiotics inhibit transcription by directly blocking the path of the elongating transcript at a length of 2-3 nucleotides. Genetic analysis indicates that Rif binding is extremely sensitive tomore » mutations expected to change the shape of the antibiotic binding pocket, while Sor is not. We suggest that conformational flexibility of Sor, in contrast to the rigid conformation of Rif, allows Sor to adapt to changes in the binding pocket. This has important implications for drug design against rapidly mutating targets.« less

Steric and thermodynamic limits of design for the incorporation of large unnatural amino acids in aminoacyl-tRNA synthetase enzymes.

PubMed

Armen, Roger S; Schiller, Stefan M; Brooks, Charles L

2010-06-01

Orthogonal aminoacyl-tRNA synthetase/tRNA pairs from archaea have been evolved to facilitate site specific in vivo incorporation of unnatural amino acids into proteins in Escherichia coli. Using this approach, unnatural amino acids have been successfully incorporated with high translational efficiency and fidelity. In this study, CHARMM-based molecular docking and free energy calculations were used to evaluate rational design of specific protein-ligand interactions for aminoacyl-tRNA synthetases. A series of novel unnatural amino acid ligands were docked into the p-benzoyl-L-phenylalanine tRNA synthetase, which revealed that the binding pocket of the enzyme does not provide sufficient space for significantly larger ligands. Specific binding site residues were mutated to alanine to create additional space to accommodate larger target ligands, and then mutations were introduced to improve binding free energy. This approach was used to redesign binding sites for several different target ligands, which were then tested against the standard 20 amino acids to verify target specificity. Only the synthetase designed to bind Man-alpha-O-Tyr was predicted to be sufficiently selective for the target ligand and also thermodynamically stable. Our study suggests that extensive redesign of the tRNA synthatase binding pocket for large bulky ligands may be quite thermodynamically unfavorable.
Enhanced SH3/Linker Interaction Overcomes Abl Kinase Activation by Gatekeeper and Myristic Acid Binding Pocket Mutations and Increases Sensitivity to Small Molecule Inhibitors*

PubMed Central

Panjarian, Shoghag; Iacob, Roxana E.; Chen, Shugui; Wales, Thomas E.; Engen, John R.; Smithgall, Thomas E.

2013-01-01

Multidomain kinases such as c-Src and c-Abl are regulated by complex allosteric interactions involving their noncatalytic SH3 and SH2 domains. Here we show that enhancing natural allosteric control of kinase activity by SH3/linker engagement has long-range suppressive effects on the kinase activity of the c-Abl core. Surprisingly, enhanced SH3/linker interaction also dramatically sensitized the Bcr-Abl tyrosine kinase associated with chronic myelogenous leukemia to small molecule inhibitors that target either the active site or the myristic acid binding pocket in the kinase domain C-lobe. Dynamics analyses using hydrogen exchange mass spectrometry revealed a remarkable allosteric network linking the SH3 domain, the myristic acid binding pocket, and the active site of the c-Abl core, providing a structural basis for the biological observations. These results suggest a rational strategy for enhanced drug targeting of Bcr-Abl and other multidomain kinase systems that use multiple small molecules to exploit natural mechanisms of kinase control. PMID:23303187
Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations.

PubMed

Oleinikovas, Vladimiras; Saladino, Giorgio; Cossins, Benjamin P; Gervasio, Francesco L

2016-11-02

Cryptic pockets, that is, sites on protein targets that only become apparent when drugs bind, provide a promising alternative to classical binding sites for drug development. Here, we investigate the nature and dynamical properties of cryptic sites in four pharmacologically relevant targets, while comparing the efficacy of various simulation-based approaches in discovering them. We find that the studied cryptic sites do not correspond to local minima in the computed conformational free energy landscape of the unliganded proteins. They thus promptly close in all of the molecular dynamics simulations performed, irrespective of the force-field used. Temperature-based enhanced sampling approaches, such as Parallel Tempering, do not improve the situation, as the entropic term does not help in the opening of the sites. The use of fragment probes helps, as in long simulations occasionally it leads to the opening and binding to the cryptic sites. Our observed mechanism of cryptic site formation is suggestive of an interplay between two classical mechanisms: induced-fit and conformational selection. Employing this insight, we developed a novel Hamiltonian Replica Exchange-based method "SWISH" (Sampling Water Interfaces through Scaled Hamiltonians), which combined with probes resulted in a promising general approach for cryptic site discovery. We also addressed the issue of "false-positives" and propose a simple approach to distinguish them from druggable cryptic pockets. Our simulations, whose cumulative sampling time was more than 200 μs, help in clarifying the molecular mechanism of pocket formation, providing a solid basis for the choice of an efficient computational method.
Exploration of the conformational landscape in pregnane X receptor reveals a new binding pocket

PubMed Central

Chandran, Aneesh

2016-01-01

Abstract Ligand‐regulated pregnane X receptor (PXR), a member of the nuclear receptor superfamily, plays a central role in xenobiotic metabolism. Despite its critical role in drug metabolism, PXR activation can lead to adverse drug‐drug interactions and early stage metabolism of drugs. Activated PXR can induce cancer drug resistance and enhance the onset of malignancy. Since promiscuity in ligand binding makes it difficult to develop competitive inhibitors targeting PXR ligand binding pocket (LBP), it is essential to identify allosteric sites for effective PXR antagonism. Here, molecular dynamics (MD) simulation studies unravelled the existence of two different conformational states, namely “expanded” and “contracted”, in apo PXR ligand binding domain (LBD). Ligand binding events shifted this conformational equilibrium and locked the LBD in a single “ligand‐adaptable” conformational state. Ensemble‐based computational solvent mapping identified a transiently open potential small molecule binding pocket between α5 and α8 helices, named “α8 pocket”, whose opening‐closing mechanism directly correlated with the conformational shift in LBD. A virtual hit identified through structure‐based virtual screening against α8 pocket locks the pocket in its open conformation. MD simulations further revealed that the presence of small molecule at allosteric site disrupts the LBD dynamics and locks the LBD in a “tightly‐contracted” conformation. The molecular details provided here could guide new structural studies to understand PXR activation and antagonism. PMID:27515410
Ondansetron and granisetron binding orientation in the 5-HT(3) receptor determined by unnatural amino acid mutagenesis.

PubMed

Duffy, Noah H; Lester, Henry A; Dougherty, Dennis A

2012-10-19

The serotonin type 3 receptor (5-HT(3)R) is a ligand-gated ion channel found in the central and peripheral nervous systems. The 5-HT(3)R is a therapeutic target, and the clinically available drugs ondansetron and granisetron inhibit receptor activity. Their inhibitory action is through competitive binding to the native ligand binding site, although the binding orientation of the drugs at the receptor has been a matter of debate. Here we heterologously express mouse 5-HT(3)A receptors in Xenopus oocytes and use unnatural amino acid mutagenesis to establish a cation-π interaction for both ondansetron and granisetron to tryptophan 183 in the ligand binding pocket. This cation-π interaction establishes a binding orientation for both ondansetron and granisetron within the binding pocket.
Ondansetron and Granisetron Binding Orientation in the 5-HT3 Receptor Determined by Unnatural Amino Acid Mutagenesis

PubMed Central

Duffy, Noah H.; Lester, Henry A.; Dougherty, Dennis A.

2012-01-01

The serotonin type 3 receptor (5-HT3R) is a ligand-gated ion channel that mediates fast synaptic transmission in the central and peripheral nervous systems. The 5-HT3R is a therapeutic target, and the clinically available drugs ondansetron and granisetron inhibit receptor activity. Their inhibitory action is through competitive binding to the native ligand binding site, although the binding orientation of the drugs at the receptor has been a matter of debate. Here we heterologously express mouse 5-HT3A receptors in Xenopus oocytes and use unnatural amino acid mutagenesis to establish a cation-π interaction for both ondansetron and granisetron to tryptophan 183 in the ligand binding pocket. This cation-π interaction establishes a binding orientation for both ondansetron and granisetron within the binding pocket. PMID:22873819
A synthetic peptide targeting the BH4 domain of Bcl-2 induces apoptosis in multiple myeloma and follicular lymphoma cells alone or in combination with agents targeting the BH3-binding pocket of Bcl-2.

PubMed

Lavik, Andrew R; Zhong, Fei; Chang, Ming-Jin; Greenberg, Edward; Choudhary, Yuvraj; Smith, Mitchell R; McColl, Karen S; Pink, John; Reu, Frederic J; Matsuyama, Shigemi; Distelhorst, Clark W

2015-09-29

Bcl-2 inhibits apoptosis by two distinct mechanisms but only one is targeted to treat Bcl-2-positive malignancies. In this mechanism, the BH1-3 domains of Bcl-2 form a hydrophobic pocket, binding and inhibiting pro-apoptotic proteins, including Bim. In the other mechanism, the BH4 domain mediates interaction of Bcl-2 with inositol 1,4, 5-trisphosphate receptors (IP3Rs), inhibiting pro-apoptotic Ca2+ signals. The current anti-Bcl-2 agents, ABT-263 (Navitoclax) and ABT-199 (Venetoclax), induce apoptosis by displacing pro-apoptotic proteins from the hydrophobic pocket, but do not inhibit Bcl-2-IP3R interaction. Therefore, to target this interaction we developed BIRD-2 (Bcl-2 IP3 Receptor Disruptor-2), a decoy peptide that binds to the BH4 domain, blocking Bcl-2-IP3R interaction and thus inducing Ca2+-mediated apoptosis in chronic lymphocytic leukemia, multiple myeloma, and follicular lymphoma cells, including cells resistant to ABT-263, ABT-199, or the Bruton's tyrosine kinase inhibitor Ibrutinib. Moreover, combining BIRD-2 with ABT-263 or ABT-199 enhances apoptosis induction compared to single agent treatment. Overall, these findings provide strong rationale for developing novel therapeutic agents that mimic the action of BIRD-2 in targeting the BH4 domain of Bcl-2 and disrupting Bcl-2-IP3R interaction.
Proteome-wide prediction of targets for aspirin: new insight into the molecular mechanism of aspirin

PubMed Central

Dai, Shao-Xing; Li, Wen-Xing

2016-01-01

Besides its anti-inflammatory, analgesic and anti-pyretic properties, aspirin is used for the prevention of cardiovascular disease and various types of cancer. The multiple activities of aspirin likely involve several molecular targets and pathways rather than a single target. Therefore, systematic identification of these targets of aspirin can help us understand the underlying mechanisms of the activities. In this study, we identified 23 putative targets of aspirin in the human proteome by using binding pocket similarity detecting tool combination with molecular docking, free energy calculation and pathway analysis. These targets have diverse folds and are derived from different protein family. However, they have similar aspirin-binding pockets. The binding free energy with aspirin for newly identified targets is comparable to that for the primary targets. Pathway analysis revealed that the targets were enriched in several pathways such as vascular endothelial growth factor (VEGF) signaling, Fc epsilon RI signaling and arachidonic acid metabolism, which are strongly involved in inflammation, cardiovascular disease and cancer. Therefore, the predicted target profile of aspirin suggests a new explanation for the disease prevention ability of aspirin. Our findings provide a new insight of aspirin and its efficacy of disease prevention in a systematic and global view. PMID:26989626
Proteome-wide prediction of targets for aspirin: new insight into the molecular mechanism of aspirin.

PubMed

Dai, Shao-Xing; Li, Wen-Xing; Li, Gong-Hua; Huang, Jing-Fei

2016-01-01

Besides its anti-inflammatory, analgesic and anti-pyretic properties, aspirin is used for the prevention of cardiovascular disease and various types of cancer. The multiple activities of aspirin likely involve several molecular targets and pathways rather than a single target. Therefore, systematic identification of these targets of aspirin can help us understand the underlying mechanisms of the activities. In this study, we identified 23 putative targets of aspirin in the human proteome by using binding pocket similarity detecting tool combination with molecular docking, free energy calculation and pathway analysis. These targets have diverse folds and are derived from different protein family. However, they have similar aspirin-binding pockets. The binding free energy with aspirin for newly identified targets is comparable to that for the primary targets. Pathway analysis revealed that the targets were enriched in several pathways such as vascular endothelial growth factor (VEGF) signaling, Fc epsilon RI signaling and arachidonic acid metabolism, which are strongly involved in inflammation, cardiovascular disease and cancer. Therefore, the predicted target profile of aspirin suggests a new explanation for the disease prevention ability of aspirin. Our findings provide a new insight of aspirin and its efficacy of disease prevention in a systematic and global view.
pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

PubMed Central

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

2014-01-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248
Development of purely structure-based pharmacophores for the topoisomerase I-DNA-ligand binding pocket

NASA Astrophysics Data System (ADS)

Drwal, Malgorzata N.; Agama, Keli; Pommier, Yves; Griffith, Renate

2013-12-01

Purely structure-based pharmacophores (SBPs) are an alternative method to ligand-based approaches and have the advantage of describing the entire interaction capability of a binding pocket. Here, we present the development of SBPs for topoisomerase I, an anticancer target with an unusual ligand binding pocket consisting of protein and DNA atoms. Different approaches to cluster and select pharmacophore features are investigated, including hierarchical clustering and energy calculations. In addition, the performance of SBPs is evaluated retrospectively and compared to the performance of ligand- and complex-based pharmacophores. SBPs emerge as a valid method in virtual screening and a complementary approach to ligand-focussed methods. The study further reveals that the choice of pharmacophore feature clustering and selection methods has a large impact on the virtual screening hit lists. A prospective application of the SBPs in virtual screening reveals that they can be used successfully to identify novel topoisomerase inhibitors.
Structural Analysis of the Complex between Penta-EF-Hand ALG-2 Protein and Sec31A Peptide Reveals a Novel Target Recognition Mechanism of ALG-2

PubMed Central

Takahashi, Takeshi; Kojima, Kyosuke; Zhang, Wei; Sasaki, Kanae; Ito, Masaru; Suzuki, Hironori; Kawasaki, Masato; Wakatsuki, Soichi; Takahara, Terunao; Shibata, Hideki; Maki, Masatoshi

2015-01-01

ALG-2, a 22-kDa penta-EF-hand protein, is involved in cell death, signal transduction, membrane trafficking, etc., by interacting with various proteins in mammalian cells in a Ca2+-dependent manner. Most known ALG-2-interacting proteins contain proline-rich regions in which either PPYPXnYP (type 1 motif) or PXPGF (type 2 motif) is commonly found. Previous X-ray crystal structural analysis of the complex between ALG-2 and an ALIX peptide revealed that the peptide binds to the two hydrophobic pockets. In the present study, we resolved the crystal structure of the complex between ALG-2 and a peptide of Sec31A (outer shell component of coat complex II, COPII; containing the type 2 motif) and found that the peptide binds to the third hydrophobic pocket (Pocket 3). While amino acid substitution of Phe85, a Pocket 3 residue, with Ala abrogated the interaction with Sec31A, it did not affect the interaction with ALIX. On the other hand, amino acid substitution of Tyr180, a Pocket 1 residue, with Ala caused loss of binding to ALIX, but maintained binding to Sec31A. We conclude that ALG-2 recognizes two types of motifs at different hydrophobic surfaces. Furthermore, based on the results of serial mutational analysis of the ALG-2-binding sites in Sec31A, the type 2 motif was newly defined. PMID:25667979
Steric and Thermodynamic Limits of Design for the Incorporation of Large UnNatural Amino Acids in Aminoacyl-tRNA Synthetase Enzymes

PubMed Central

Armen, Roger S.; Schiller, Stefan M.; Brooks, Charles L.

2015-01-01

Orthogonal aminoacyl-tRNA synthetase/tRNA pairs from archaea have been evolved to facilitate site specific in vivo incorporation of unnatural amino acids into proteins in Escherichia coli. Using this approach, unnatural amino acids have been successfully incorporated with high translational efficiency and fidelity. In this study, CHARMM-based molecular docking and free energy calculations were used to evaluate rational design of specific protein-ligand interactions for aminoacyl-tRNA synthetases. A series of novel unnatural amino acid ligands were docked into the p-benzoyl-L-phenylalanine tRNA synthetase, which revealed that the binding pocket of the enzyme does not provide sufficient space for significantly larger ligands. Specific binding site residues were mutated to alanine to create additional space to accommodate larger target ligands, and then mutations were introduced to improve binding free energy. This approach was used to redesign binding sites for several different target ligands, which were then tested against the standard 20 amino acids to verify target specificity. Only the synthetase designed to bind Man-α-O-Tyr was predicted to be sufficiently selective for the target ligand and also thermodynamically stable. Our study suggests that extensive redesign of the tRNA synthatase binding pocket for large bulky ligands may be quite thermodynamically unfavorable. PMID:20310065
Computational approaches for identification of conserved/unique binding pockets in the A chain of ricin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ecale Zhou, C L; Zemla, A T; Roe, D

2005-01-29

Specific and sensitive ligand-based protein detection assays that employ antibodies or small molecules such as peptides, aptamers, or other small molecules require that the corresponding surface region of the protein be accessible and that there be minimal cross-reactivity with non-target proteins. To reduce the time and cost of laboratory screening efforts for diagnostic reagents, we developed new methods for evaluating and selecting protein surface regions for ligand targeting. We devised combined structure- and sequence-based methods for identifying 3D epitopes and binding pockets on the surface of the A chain of ricin that are conserved with respect to a set ofmore » ricin A chains and unique with respect to other proteins. We (1) used structure alignment software to detect structural deviations and extracted from this analysis the residue-residue correspondence, (2) devised a method to compare corresponding residues across sets of ricin structures and structures of closely related proteins, (3) devised a sequence-based approach to determine residue infrequency in local sequence context, and (4) modified a pocket-finding algorithm to identify surface crevices in close proximity to residues determined to be conserved/unique based on our structure- and sequence-based methods. In applying this combined informatics approach to ricin A we identified a conserved/unique pocket in close proximity (but not overlapping) the active site that is suitable for bi-dentate ligand development. These methods are generally applicable to identification of surface epitopes and binding pockets for development of diagnostic reagents, therapeutics, and vaccines.« less
Synthesis and stereospecificity of 4,5-disubstituted oxazolidinone ligands binding to T-box riboswitch RNA.

PubMed

Orac, Crina M; Zhou, Shu; Means, John A; Boehm, David; Bergmeier, Stephen C; Hines, Jennifer V

2011-10-13

The enantiomers and the cis isomers of two previously studied 4,5-disubstituted oxazolidinones have been synthesized, and their binding to the T-box riboswitch antiterminator model RNA has been investigated in detail. Characterization of ligand affinities and binding site localization indicates that there is little stereospecific discrimination for binding antiterminator RNA alone. This binding similarity between enantiomers is likely due to surface binding, which accommodates ligand conformations that result in comparable ligand-antiterminator contacts. These results have significant implications for T-box antiterminator-targeted drug discovery and, in general, for targeting other medicinally relevant RNA that do not present deep binding pockets.
Synthesis and stereospecificity of 4,5-disubstituted oxazolidinone ligands binding to T-box riboswitch RNA

PubMed Central

Orac, Crina M.; Zhou, Shu; Means, John A.; Boehm, David; Bergmeier, Stephen C.; Hines, Jennifer V.

2012-01-01

The enantiomers and the cis isomers of two previously studied 4,5-disubstituted oxazolidinones have been synthesized and their binding to the T-box riboswitch antiterminator model RNA investigated in detail. Characterization of ligand affinities and binding site localization indicate that there is little stereospecific discrimination for binding antiterminator RNA alone. This binding similarity between enantiomers is likely due to surface binding, which accommodates ligand conformations that result in comparable ligand-antiterminator contacts. These results have significant implications for T-box antiterminator-targeted drug discovery and, in general, for targeting other medicinally relevant RNA that do not present deep binding pockets. PMID:21812425
Imbalance in chemical space: How to facilitate the identification of protein-protein interaction inhibitors.

PubMed

Kuenemann, Mélaine A; Labbé, Céline M; Cerdan, Adrien H; Sperandio, Olivier

2016-04-01

Protein-protein interactions (PPIs) play vital roles in life and provide new opportunities for therapeutic interventions. In this large data analysis, 3,300 inhibitors of PPIs (iPPIs) were compared to 17 reference datasets of collectively ~566,000 compounds (including natural compounds, existing drugs, active compounds on conventional targets, etc.) using a chemoinformatics approach. Using this procedure, we showed that comparable classes of PPI targets can be formed using either the similarity of their ligands or the shared properties of their binding cavities, constituting a proof-of-concept that not only can binding pockets be used to group PPI targets, but that these pockets certainly condition the properties of their corresponding ligands. These results demonstrate that matching regions in both chemical space and target space can be found. Such identified classes of targets could lead to the design of PPI-class-specific chemical libraries and therefore facilitate the development of iPPIs to the stage of drug candidates.
Computational study of bindings of HK20 Fab and D5 Fab to HIV-1 gp41.

PubMed

Hartono, Yossa Dwi; Lazim, Raudah; Yip, Yew Mun; Zhang, Dawei

2012-02-15

Antibodies HK20 and D5 have been shown to target HIV-1 gp41, thereby inhibiting membrane fusion that facilitates viral entry. The binding picture is static, based on the X-ray crystal structures of the Fab regions and gp41 mimetic five-helix bundle. In this study, we carried out molecular dynamics simulation to provide the dynamic binding picture. Calculated binding free energies are within reasonable range of and follow the trend of the experimental values: -15.28 kcal/mol for HK20 Fab (expt. -11.60 kcal/mol) and -17.90 kcal/mol for D5 Fab (expt. -11.70 kcal/mol). Alanine scanning at protein-protein interface reveals that the highest contributors to binding for HK20 Fab are F54 and I56, both of V(H) region, as well as R30' of V(L) region; whereas for D5 Fab, F54 of V(H) region, as well as W32' and Y94' of V(L) region. HK20 F54 and I56, as well as D5 I52, F54, and T56, bind to the gp41 hydrophobic binding pocket, an important region targeted by many other fusion inhibitors. Hydrogen bonding analysis also identifies high-occupancy hydrogen bonds at the periphery of gp41 hydrophobic pocket. Considering that almost all interface residues are turn residues, further work may be directed to turn mimics. Pre-orientation by the hydrogen bonds to poise this particular turn towards the binding pocket may also be a point worth pursuing. Copyright © 2011 Elsevier Ltd. All rights reserved.
A crystal structure of the bifunctional antibiotic simocyclinone D8, bound to DNA gyrase.

PubMed

Edwards, Marcus J; Flatman, Ruth H; Mitchenall, Lesley A; Stevenson, Clare E M; Le, Tung B K; Clarke, Thomas A; McKay, Adam R; Fiedler, Hans-Peter; Buttner, Mark J; Lawson, David M; Maxwell, Anthony

2009-12-04

Simocyclinones are bifunctional antibiotics that inhibit bacterial DNA gyrase by preventing DNA binding to the enzyme. We report the crystal structure of the complex formed between the N-terminal domain of the Escherichia coli gyrase A subunit and simocyclinone D8, revealing two binding pockets that separately accommodate the aminocoumarin and polyketide moieties of the antibiotic. These are close to, but distinct from, the quinolone-binding site, consistent with our observations that several mutations in this region confer resistance to both agents. Biochemical studies show that the individual moieties of simocyclinone D8 are comparatively weak inhibitors of gyrase relative to the parent compound, but their combination generates a more potent inhibitor. Our results should facilitate the design of drug molecules that target these unexploited binding pockets.
A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

PubMed

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

2014-07-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Structures of BIR domains from human NAIP and cIAP2.

PubMed

Herman, Maria Dolores; Moche, Martin; Flodin, Susanne; Welin, Martin; Trésaugues, Lionel; Johansson, Ida; Nilsson, Martina; Nordlund, Pär; Nyman, Tomas

2009-11-01

The inhibitor of apoptosis (IAP) family of proteins contains key modulators of apoptosis and inflammation that interact with caspases through baculovirus IAP-repeat (BIR) domains. Overexpression of IAP proteins frequently occurs in cancer cells, thus counteracting the activated apoptotic program. The IAP proteins have therefore emerged as promising targets for cancer therapy. In this work, X-ray crystallography was used to determine the first structures of BIR domains from human NAIP and cIAP2. Both structures harbour an N-terminal tetrapeptide in the conserved peptide-binding groove. The structures reveal that these two proteins bind the tetrapeptides in a similar mode as do other BIR domains. Detailed interactions are described for the P1'-P4' side chains of the peptide, providing a structural basis for peptide-specific recognition. An arginine side chain in the P3' position reveals favourable interactions with its hydrophobic moiety in the binding pocket, while hydrophobic residues in the P2' and P4' pockets make similar interactions to those seen in other BIR domain-peptide complexes. The structures also reveal how a serine in the P1' position is accommodated in the binding pockets of NAIP and cIAP2. In addition to shedding light on the specificity determinants of these two proteins, the structures should now also provide a framework for future structure-based work targeting these proteins.
Structures of BIR domains from human NAIP and cIAP2

PubMed Central

Herman, Maria Dolores; Moche, Martin; Flodin, Susanne; Welin, Martin; Trésaugues, Lionel; Johansson, Ida; Nilsson, Martina; Nordlund, Pär; Nyman, Tomas

2009-01-01

The inhibitor of apoptosis (IAP) family of proteins contains key modulators of apoptosis and inflammation that interact with caspases through baculovirus IAP-repeat (BIR) domains. Overexpression of IAP proteins frequently occurs in cancer cells, thus counteracting the activated apoptotic program. The IAP proteins have therefore emerged as promising targets for cancer therapy. In this work, X-ray crystallography was used to determine the first structures of BIR domains from human NAIP and cIAP2. Both structures harbour an N-terminal tetrapeptide in the conserved peptide-binding groove. The structures reveal that these two proteins bind the tetrapeptides in a similar mode as do other BIR domains. Detailed interactions are described for the P1′–P4′ side chains of the peptide, providing a structural basis for peptide-specific recognition. An arginine side chain in the P3′ position reveals favourable interactions with its hydrophobic moiety in the binding pocket, while hydrophobic residues in the P2′ and P4′ pockets make similar interactions to those seen in other BIR domain–peptide complexes. The structures also reveal how a serine in the P1′ position is accommodated in the binding pockets of NAIP and cIAP2. In addition to shedding light on the specificity determinants of these two proteins, the structures should now also provide a framework for future structure-based work targeting these proteins. PMID:19923725
A Novel Cofactor-binding Mode in Bacterial IMP Dehydrogenases Explains Inhibitor Selectivity*

PubMed Central

Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R.; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej

2015-01-01

The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5′-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD+, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD+ and XMP/NAD+. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD+-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD+-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. PMID:25572472
Novel quinolone chalcones targeting colchicine-binding pocket kill multidrug-resistant cancer cells by inhibiting tubulin activity and MRP1 function.

PubMed

Lindamulage, I Kalhari; Vu, Hai-Yen; Karthikeyan, Chandrabose; Knockleby, James; Lee, Yi-Fang; Trivedi, Piyush; Lee, Hoyun

2017-08-31

Agents targeting colchicine-binding pocket usually show a minimal drug-resistance issue, albeit often associated with high toxicity. Chalcone-based compounds, which may bind to colchicine-binding site, are found in many edible fruits, suggesting that they can be effective drugs with less toxicity. Therefore, we synthesized and examined 24 quinolone chalcone compounds, from which we identified ((E)-3-(3-(2-Methoxyphenyl)-3-oxoprop-1-enyl) quinolin-2(1H)-one) (CTR-17) and ((E)-6-Methoxy-3-(3-(2-methoxyphenyl)-3-oxoprop-1-enyl) quinolin-2(1H)-one) (CTR-20) as promising leads. In particular, CTR-20 was effective against 65 different cancer cell lines originated from 12 different tissues, largely in a cancer cell-specific manner. We found that both CTR-17 and CTR-20 reversibly bind to the colchicine-binding pocket on β-tubulin. Interestingly however, both the CTRs were highly effective against multidrug-resistant cancer cells while colchicine, paclitaxel and vinblastine were not. Our study with CTR-20 showed that it overcomes multidrug-resistance through its ability to impede MRP1 function while maintaining strong inhibition against microtubule activity. Data from mice engrafted with the MDA-MB-231 triple-negative breast cancer cells showed that both CTR-17 and CTR-20 possess strong anticancer activity, alone or in combination with paclitaxel, without causing any notable side effects. Together, our data demonstrates that both the CTRs can be effective and safe drugs against many different cancers, especially against multidrug-resistant tumors.
Structural Insights into Central Hypertension Regulation by Human Aminopeptidase A*

PubMed Central

Yang, Yang; Liu, Chang; Lin, Yi-Lun; Li, Fang

2013-01-01

Hypertension is regulated through both the central and systemic renin-angiotensin systems. In the central renin-angiotensin system, zinc-dependent aminopeptidase A (APA) up-regulates blood pressure by specifically cleaving the N-terminal aspartate, but not the adjacent arginine, from angiotensin II, a process facilitated by calcium. Here, we determined the crystal structures of human APA and its complexes with different ligands and identified a calcium-binding site in the S1 pocket of APA. Without calcium, the S1 pocket can bind both acidic and basic residues through formation of salt bridges with the charged side chains. In the presence of calcium, the binding of acidic residues is enhanced as they ligate the cation, whereas the binding of basic residues is no longer favorable due to charge repulsion. Of the peptidomimetic inhibitors of APA, amastatin has higher potency than bestatin by fitting better in the S1 pocket and interacting additionally with the S3′ subsite. These results explain the calcium-modulated substrate specificity of APA in central hypertension regulation and can guide the design and development of brain-targeting antihypertensive APA inhibitors. PMID:23888046
Structural insights into central hypertension regulation by human aminopeptidase A.

PubMed

Yang, Yang; Liu, Chang; Lin, Yi-Lun; Li, Fang

2013-08-30

Hypertension is regulated through both the central and systemic renin-angiotensin systems. In the central renin-angiotensin system, zinc-dependent aminopeptidase A (APA) up-regulates blood pressure by specifically cleaving the N-terminal aspartate, but not the adjacent arginine, from angiotensin II, a process facilitated by calcium. Here, we determined the crystal structures of human APA and its complexes with different ligands and identified a calcium-binding site in the S1 pocket of APA. Without calcium, the S1 pocket can bind both acidic and basic residues through formation of salt bridges with the charged side chains. In the presence of calcium, the binding of acidic residues is enhanced as they ligate the cation, whereas the binding of basic residues is no longer favorable due to charge repulsion. Of the peptidomimetic inhibitors of APA, amastatin has higher potency than bestatin by fitting better in the S1 pocket and interacting additionally with the S3' subsite. These results explain the calcium-modulated substrate specificity of APA in central hypertension regulation and can guide the design and development of brain-targeting antihypertensive APA inhibitors.
Cavity Versus Ligand Shape Descriptors: Application to Urokinase Binding Pockets.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Camproux, Anne-Claude; Petitjean, Michel

2017-11-01

We analyzed 78 binding pockets of the human urokinase plasminogen activator (uPA) catalytic domain extracted from a data set of crystallized uPA-ligand complexes. These binding pockets were computed with an original geometric method that does NOT involve any arbitrary parameter, such as cutoff distances, angles, and so on. We measured the deviation from convexity of each pocket shape with the pocket convexity index (PCI). We defined a new pocket descriptor called distributional sphericity coefficient (DISC), which indicates to which extent the protein atoms of a given pocket lie on the surface of a sphere. The DISC values were computed with the freeware PCI. The pocket descriptors and their high correspondences with ligand descriptors are crucial for polypharmacology prediction. We found that the protein heavy atoms lining the urokinases binding pockets are either located on the surface of their convex hull or lie close to this surface. We also found that the radii of the urokinases binding pockets and the radii of their ligands are highly correlated (r = 0.9).
Identification and Structure-Activity Relationship of HDAC6 Zinc-Finger Ubiquitin Binding Domain Inhibitors.

PubMed

Ferreira de Freitas, Renato; Harding, Rachel J; Franzoni, Ivan; Ravichandran, Mani; Mann, Mandeep K; Ouyang, Hui; Lautens, Mark; Santhakumar, Vijayaratnam; Arrowsmith, Cheryl H; Schapira, Matthieu

2018-05-24

HDAC6 plays a central role in the recruitment of protein aggregates for lysosomal degradation and is a promising target for combination therapy with proteasome inhibitors in multiple myeloma. Pharmacologically displacing ubiquitin from the zinc-finger ubiquitin-binding domain (ZnF-UBD) of HDAC6 is an underexplored alternative to catalytic inhibition. Here, we present the discovery of an HDAC6 ZnF-UBD-focused chemical series and its progression from virtual screening hits to low micromolar inhibitors. A carboxylate mimicking the C-terminal extremity of ubiquitin, and an extended aromatic system stacking with W1182 and R1155, are necessary for activity. One of the compounds induced a conformational remodeling of the binding site where the primary binding pocket opens up onto a ligand-able secondary pocket that may be exploited to increase potency. The preliminary structure-activity relationship accompanied by nine crystal structures should enable further optimization into a chemical probe to investigate the merit of targeting the ZnF-UBD of HDAC6 in multiple myeloma and other diseases.
Cryptic binding sites on proteins: definition, detection, and druggability.

PubMed

Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

2018-05-22

Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.
Classification of small molecule protein kinase inhibitors based upon the structures of their drug-enzyme complexes.

PubMed

Roskoski, Robert

2016-01-01

Because dysregulation and mutations of protein kinases play causal roles in human disease, this family of enzymes has become one of the most important drug targets over the past two decades. The X-ray crystal structures of 21 of the 27 FDA-approved small molecule inhibitors bound to their target protein kinases are depicted in this paper. The structure of the enzyme-bound antagonist complex is used in the classification of these inhibitors. Type I inhibitors bind to the active protein kinase conformation (DFG-Asp in, αC-helix in). Type I½ inhibitors bind to a DFG-Asp in inactive conformation while Type II inhibitors bind to a DFG-Asp out inactive conformation. Type I, I½, and type II inhibitors occupy part of the adenine binding pocket and form hydrogen bonds with the hinge region connecting the small and large lobes of the enzyme. Type III inhibitors bind next to the ATP-binding pocket and type IV inhibitors do not bind to the ATP or peptide substrate binding sites. Type III and IV inhibitors are allosteric in nature. Type V inhibitors bind to two different regions of the protein kinase domain and are therefore bivalent inhibitors. The type I-V inhibitors are reversible. In contrast, type VI inhibitors bind covalently to their target enzyme. Type I, I½, and II inhibitors are divided into A and B subtypes. The type A inhibitors bind in the front cleft, the back cleft, and near the gatekeeper residue, all of which occur within the region separating the small and large lobes of the protein kinase. The type B inhibitors bind in the front cleft and gate area but do not extend into the back cleft. An analysis of the limited available data indicates that type A inhibitors have a long residence time (minutes to hours) while the type B inhibitors have a short residence time (seconds to minutes). The catalytic spine includes residues from the small and large lobes and interacts with the adenine ring of ATP. Nearly all of the approved protein kinase inhibitors occupy the adenine-binding pocket; thus it is not surprising that these inhibitors interact with nearby catalytic spine (CS) residues. Moreover, a significant number of approved drugs also interact with regulatory spine (RS) residues. Copyright © 2015 Elsevier Ltd. All rights reserved.
AlphaSpace: Fragment-Centric Topographical Mapping To Target Protein–Protein Interaction Interfaces

PubMed Central

2016-01-01

Inhibition of protein–protein interactions (PPIs) is emerging as a promising therapeutic strategy despite the difficulty in targeting such interfaces with drug-like small molecules. PPIs generally feature large and flat binding surfaces as compared to typical drug targets. These features pose a challenge for structural characterization of the surface using geometry-based pocket-detection methods. An attractive mapping strategy—that builds on the principles of fragment-based drug discovery (FBDD)—is to detect the fragment-centric modularity at the protein surface and then characterize the large PPI interface as a set of localized, fragment-targetable interaction regions. Here, we introduce AlphaSpace, a computational analysis tool designed for fragment-centric topographical mapping (FCTM) of PPI interfaces. Our approach uses the alpha sphere construct, a geometric feature of a protein’s Voronoi diagram, to map out concave interaction space at the protein surface. We introduce two new features—alpha-atom and alpha-space—and the concept of the alpha-atom/alpha-space pair to rank pockets for fragment-targetability and to facilitate the evaluation of pocket/fragment complementarity. The resulting high-resolution interfacial map of targetable pocket space can be used to guide the rational design and optimization of small molecule or biomimetic PPI inhibitors. PMID:26225450
Molecular Chaperone Hsp70/Hsp90 Prepares the Mitochondrial Outer Membrane Translocon Receptor Tom71 for Preprotein Loading

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jingzhi; Qian, Xinguo; Hu, Junbin

2010-11-03

The preproteins targeted to the mitochondria are transported through the translocase of the outer membrane complex. Tom70/Tom71 is a major surface receptor of the translocase of the outer membrane complex for mitochondrial preproteins. The preproteins are escorted to Tom70/Tom71 by molecular chaperones Hsp70 and Hsp90. Here we present the high resolution crystal structures of Tom71 and the protein complexes between Tom71 and the Hsp70/Hsp90 C terminus. The crystal structures indicate that Tom70/Tom71 may exhibit two distinct states. In the closed state, the N-terminal domain of Tom70/Tom71 partially blocks the preprotein-binding pocket. In the open state, the N-terminal domain moves away,more » and the preprotein-binding pocket is fully exposed. The complex formation between the C-terminal EEVD motif of Hsp70/Hsp90 and Tom71 could lock Tom71 in the open state where the preprotein-binding pocket of Tom71 is ready to receive preproteins. The interactions between Hsp70/Hsp90 and Tom71 N-terminal domain generate conformational changes that may increase the volume of the preprotein-binding pocket. The complex formation of Hsp70/Hsp90 and Tom71 also generates significant domain rearrangement within Tom71, which may position the preprotein-binding pocket closer to Hsp70/Hsp90 to facilitate the preprotein transfer from the molecular chaperone to Tom71. Therefore, molecular chaperone Hsp70/Hsp90 may function to prepare the mitochondrial outer membrane receptor Tom71 for preprotein loading.« less
Cavity Versus Ligand Shape Descriptors: Application to Urokinase Binding Pockets

PubMed Central

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Camproux, Anne-Claude

2017-01-01

Abstract We analyzed 78 binding pockets of the human urokinase plasminogen activator (uPA) catalytic domain extracted from a data set of crystallized uPA–ligand complexes. These binding pockets were computed with an original geometric method that does NOT involve any arbitrary parameter, such as cutoff distances, angles, and so on. We measured the deviation from convexity of each pocket shape with the pocket convexity index (PCI). We defined a new pocket descriptor called distributional sphericity coefficient (DISC), which indicates to which extent the protein atoms of a given pocket lie on the surface of a sphere. The DISC values were computed with the freeware PCI. The pocket descriptors and their high correspondences with ligand descriptors are crucial for polypharmacology prediction. We found that the protein heavy atoms lining the urokinases binding pockets are either located on the surface of their convex hull or lie close to this surface. We also found that the radii of the urokinases binding pockets and the radii of their ligands are highly correlated (r = 0.9). PMID:28570103
A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity

DOE PAGES

Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; ...

2015-01-09

The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD +, which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexesmore » with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD + and XMP/NAD +. In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD+ adenosine moiety. More importantly, this new NAD +-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD +-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. As a result, these findings offer a potential strategy for further ligand optimization.« less
A novel cofactor-binding mode in bacterial IMP dehydrogenases explains inhibitor selectivity.

PubMed

Makowska-Grzyska, Magdalena; Kim, Youngchang; Maltseva, Natalia; Osipiuk, Jerzy; Gu, Minyi; Zhang, Minjia; Mandapati, Kavitha; Gollapalli, Deviprasad R; Gorla, Suresh Kumar; Hedstrom, Lizbeth; Joachimiak, Andrzej

2015-02-27

The steadily rising frequency of emerging diseases and antibiotic resistance creates an urgent need for new drugs and targets. Inosine 5'-monophosphate dehydrogenase (IMP dehydrogenase or IMPDH) is a promising target for the development of new antimicrobial agents. IMPDH catalyzes the oxidation of IMP to XMP with the concomitant reduction of NAD(+), which is the pivotal step in the biosynthesis of guanine nucleotides. Potent inhibitors of bacterial IMPDHs have been identified that bind in a structurally distinct pocket that is absent in eukaryotic IMPDHs. The physiological role of this pocket was not understood. Here, we report the structures of complexes with different classes of inhibitors of Bacillus anthracis, Campylobacter jejuni, and Clostridium perfringens IMPDHs. These structures in combination with inhibition studies provide important insights into the interactions that modulate selectivity and potency. We also present two structures of the Vibrio cholerae IMPDH in complex with IMP/NAD(+) and XMP/NAD(+). In both structures, the cofactor assumes a dramatically different conformation than reported previously for eukaryotic IMPDHs and other dehydrogenases, with the major change observed for the position of the NAD(+) adenosine moiety. More importantly, this new NAD(+)-binding site involves the same pocket that is utilized by the inhibitors. Thus, the bacterial IMPDH-specific NAD(+)-binding mode helps to rationalize the conformation adopted by several classes of prokaryotic IMPDH inhibitors. These findings offer a potential strategy for further ligand optimization. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
PL-PatchSurfer: a novel molecular local surface-based method for exploring protein-ligand interactions.

PubMed

Hu, Bingjie; Zhu, Xiaolei; Monroe, Lyman; Bures, Mark G; Kihara, Daisuke

2014-08-27

Structure-based computational methods have been widely used in exploring protein-ligand interactions, including predicting the binding ligands of a given protein based on their structural complementarity. Compared to other protein and ligand representations, the advantages of a surface representation include reduced sensitivity to subtle changes in the pocket and ligand conformation and fast search speed. Here we developed a novel method named PL-PatchSurfer (Protein-Ligand PatchSurfer). PL-PatchSurfer represents the protein binding pocket and the ligand molecular surface as a combination of segmented surface patches. Each patch is characterized by its geometrical shape and the electrostatic potential, which are represented using the 3D Zernike descriptor (3DZD). We first tested PL-PatchSurfer on binding ligand prediction and found it outperformed the pocket-similarity based ligand prediction program. We then optimized the search algorithm of PL-PatchSurfer using the PDBbind dataset. Finally, we explored the utility of applying PL-PatchSurfer to a larger and more diverse dataset and showed that PL-PatchSurfer was able to provide a high early enrichment for most of the targets. To the best of our knowledge, PL-PatchSurfer is the first surface patch-based method that treats ligand complementarity at protein binding sites. We believe that using a surface patch approach to better understand protein-ligand interactions has the potential to significantly enhance the design of new ligands for a wide array of drug-targets.
PL-PatchSurfer: A Novel Molecular Local Surface-Based Method for Exploring Protein-Ligand Interactions

PubMed Central

Hu, Bingjie; Zhu, Xiaolei; Monroe, Lyman; Bures, Mark G.; Kihara, Daisuke

2014-01-01

Structure-based computational methods have been widely used in exploring protein-ligand interactions, including predicting the binding ligands of a given protein based on their structural complementarity. Compared to other protein and ligand representations, the advantages of a surface representation include reduced sensitivity to subtle changes in the pocket and ligand conformation and fast search speed. Here we developed a novel method named PL-PatchSurfer (Protein-Ligand PatchSurfer). PL-PatchSurfer represents the protein binding pocket and the ligand molecular surface as a combination of segmented surface patches. Each patch is characterized by its geometrical shape and the electrostatic potential, which are represented using the 3D Zernike descriptor (3DZD). We first tested PL-PatchSurfer on binding ligand prediction and found it outperformed the pocket-similarity based ligand prediction program. We then optimized the search algorithm of PL-PatchSurfer using the PDBbind dataset. Finally, we explored the utility of applying PL-PatchSurfer to a larger and more diverse dataset and showed that PL-PatchSurfer was able to provide a high early enrichment for most of the targets. To the best of our knowledge, PL-PatchSurfer is the first surface patch-based method that treats ligand complementarity at protein binding sites. We believe that using a surface patch approach to better understand protein-ligand interactions has the potential to significantly enhance the design of new ligands for a wide array of drug-targets. PMID:25167137
4′-O-substitutions determine selectivity of aminoglycoside antibiotics

PubMed Central

Perez-Fernandez, Déborah; Shcherbakov, Dmitri; Matt, Tanja; Leong, Ng Chyan; Kudyba, Iwona; Duscha, Stefan; Boukari, Heithem; Patak, Rashmi; Dubbaka, Srinivas Reddy; Lang, Kathrin; Meyer, Martin; Akbergenov, Rashid; Freihofer, Pietro; Vaddi, Swapna; Thommes, Pia; Ramakrishnan, V.; Vasella, Andrea; Böttger, Erik C.

2014-01-01

Clinical use of 2-deoxystreptamine aminoglycoside antibiotics, which target the bacterial ribosome, is compromised by adverse effects related to limited drug selectivity. Here we present a series of 4′,6′-O-acetal and 4′-O-ether modifications on glucopyranosyl ring I of aminoglycosides. Chemical modifications were guided by measuring interactions between the compounds synthesized and ribosomes harbouring single point mutations in the drug-binding site, resulting in aminoglycosides that interact poorly with the drug-binding pocket of eukaryotic mitochondrial or cytosolic ribosomes. Yet, these compounds largely retain their inhibitory activity for bacterial ribosomes and show antibacterial activity. Our data indicate that 4′-O-substituted aminoglycosides possess increased selectivity towards bacterial ribosomes and little activity for any of the human drug-binding pockets. PMID:24473108
The 2.1Å Crystal Structure of an Acyl-CoA Synthetase from Methanosarcina acetivorans reveals an alternate acyl binding pocket for small branched acyl substrates†,‡

PubMed Central

Shah, Manish B.; Ingram-Smith, Cheryl; Cooper, Leroy L.; Qu, Jun; Meng, Yu; Smith, Kerry S.; Gulick, Andrew M.

2009-01-01

The acyl-AMP forming family of adenylating enzymes catalyze two-step reactions to activate a carboxylate with the chemical energy derived from ATP hydrolysis. X-ray crystal structures have been determined for multiple members of this family and, together with biochemical studies, provide insights into the active site and catalytic mechanisms used by these enzymes. These studies have shown that the enzymes use a domain rotation of 140° to reconfigure a single active site to catalyze the two partial reactions. We present here the crystal structure of a new medium chain acyl-CoA synthetase from Methanosarcina acetivorans. The binding pocket for the three substrates is analyzed, with many conserved residues present in the AMP binding pocket. The CoA binding pocket is compared to the pockets of both acetyl-CoA synthetase and 4-chlorobenzoate:CoA ligase. Most interestingly, the acyl binding pocket of the new structure is compared with other acyl- and aryl-CoA synthetases. A comparison of the acyl-binding pocket of the acyl-CoA synthetase from M. acetivorans with other structures identifies a shallow pocket that is used to bind the medium chain carboxylates. These insights emphasize the high sequence and structural diversity among this family in the area of the acyl binding pocket. PMID:19544569

Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ

PubMed Central

Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu

2011-01-01

Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563
SERS and MD simulation studies of a kinase inhibitor demonstrate the emergence of a potential drug discovery tool.

PubMed

Karthigeyan, Dhanasekaran; Siddhanta, Soumik; Kishore, Annavarapu Hari; Perumal, Sathya S R R; Ågren, Hans; Sudevan, Surabhi; Bhat, Akshay V; Balasubramanyam, Karanam; Subbegowda, Rangappa Kanchugarakoppal; Kundu, Tapas K; Narayana, Chandrabhas

2014-07-22

We demonstrate the use of surface-enhanced Raman spectroscopy (SERS) as an excellent tool for identifying the binding site of small molecules on a therapeutically important protein. As an example, we show the specific binding of the common antihypertension drug felodipine to the oncogenic Aurora A kinase protein via hydrogen bonding interactions with Tyr-212 residue to specifically inhibit its activity. Based on SERS studies, molecular docking, molecular dynamics simulation, biochemical assays, and point mutation-based validation, we demonstrate the surface-binding mode of this molecule in two similar hydrophobic pockets in the Aurora A kinase. These binding pockets comprise the same unique hydrophobic patches that may aid in distinguishing human Aurora A versus human Aurora B kinase in vivo. The application of SERS to identify the specific interactions between small molecules and therapeutically important proteins by differentiating competitive and noncompetitive inhibition demonstrates its ability as a complementary technique. We also present felodipine as a specific inhibitor for oncogenic Aurora A kinase. Felodipine retards the rate of tumor progression in a xenografted nude mice model. This study reveals a potential surface pocket that may be useful for developing small molecules by selectively targeting the Aurora family kinases.
Differential recognition of syk-binding sites by each of the two phosphotyrosine-binding pockets of the Vav SH2 domain.

PubMed

Chen, Chih-Hong; Piraner, Dan; Gorenstein, Nina M; Geahlen, Robert L; Beth Post, Carol

2013-11-01

The association of spleen tyrosine kinase (Syk), a central tyrosine kinase in B cell signaling, with Vav SH2 domain is controlled by phosphorylation of two closely spaced tyrosines in Syk linker B: Y342 and Y346. Previous studies established both singly phosphorylated and doubly phosphorylated forms play a role in signaling. The structure of the doubly phosphorylated form identified a new recognition of phosphotyrosine whereby two phosphotyrosines bind simultaneously to the Vav SH2 domain, one in the canonical pTyr pocket and one in the specificity pocket on the opposite side of the central β-sheet. It is unknown if the specificity pocket can bind phosphotyrosine independent of phosphotyrosine binding the pTyr pocket. To address this gap in knowledge, we determined the structure of the complex between Vav1 SH2 and a peptide (SykLB-YpY) modeling the singly phosphorylated-Y346 form of Syk with unphosphorylated Y342. The nuclear magnetic resonance (NMR) data conclusively establish that recognition of phosphotyrosine is swapped between the two pockets; phosphorylated pY346 binds the specificity pocket of Vav1 SH2, and unphosphorylated Y342 occupies what is normally the pTyr binding pocket. Nearly identical changes in chemical shifts occurred upon binding all three forms of singly and doubly phosphorylated peptides; however, somewhat smaller shift perturbations for SykLB-YpY from residues in regions of high internal mobility suggest that internal motions are coupled to binding affinity. The differential recognition that includes this swapped binding of phosphotyrosine to the specificity pocket of Vav SH2 increases the repertoire of possible phosphotyrosine binding by SH2 domains in regulating protein-protein interactions in cellular signaling. Copyright © 2013 Wiley Periodicals, Inc.
Detecting Local Ligand-Binding Site Similarity in Non-Homologous Proteins by Surface Patch Comparison

PubMed Central

Sael, Lee; Kihara, Daisuke

2012-01-01

Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. PMID:22275074
Detecting local ligand-binding site similarity in nonhomologous proteins by surface patch comparison.

PubMed

Sael, Lee; Kihara, Daisuke

2012-04-01

Functional elucidation of proteins is one of the essential tasks in biology. Function of a protein, specifically, small ligand molecules that bind to a protein, can be predicted by finding similar local surface regions in binding sites of known proteins. Here, we developed an alignment free local surface comparison method for predicting a ligand molecule which binds to a query protein. The algorithm, named Patch-Surfer, represents a binding pocket as a combination of segmented surface patches, each of which is characterized by its geometrical shape, the electrostatic potential, the hydrophobicity, and the concaveness. Representing a pocket by a set of patches is effective to absorb difference of global pocket shape while capturing local similarity of pockets. The shape and the physicochemical properties of surface patches are represented using the 3D Zernike descriptor, which is a series expansion of mathematical 3D function. Two pockets are compared using a modified weighted bipartite matching algorithm, which matches similar patches from the two pockets. Patch-Surfer was benchmarked on three datasets, which consist in total of 390 proteins that bind to one of 21 ligands. Patch-Surfer showed superior performance to existing methods including a global pocket comparison method, Pocket-Surfer, which we have previously introduced. Particularly, as intended, the accuracy showed large improvement for flexible ligand molecules, which bind to pockets in different conformations. Copyright © 2011 Wiley Periodicals, Inc.
Molecular Mechanisms of Prostate Cancer Progression

DTIC Science & Technology

2003-01-01

other drugs ( novobiocin and related hsp90 inhibitors have been shown to bind to the N-ter- coumarins) that are reported to target hsp90 are now be...undesirable for an indirect method of telomerase inhibition (data not shown). However, radicicol, which binds in the ATP- binding pocket of hsp90 and...compounds (e.g. novobiocin ) to block chaperone function using a totally different mechanism of hsp90 inhbition, as well as innovative genetic approaches
Identification of Small Molecules against Botulinum Neurotoxin B Binding to Neuronal Cells at Ganglioside GT1b Binding Site with Low to Moderate Affinity

DTIC Science & Technology

2014-10-01

BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the BoNT/B/trisaccharide (GT1b) complex ( PDB ...trisaccharide and all the water from the structure and identified four potential binding pockets (Pocket-1, Pocket-2, and Pocket-4) as shown in...four potential binding sites or pockets on BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the
Hydrophobic pocket targeting probes for enteroviruses.

PubMed

Martikainen, Mari; Salorinne, Kirsi; Lahtinen, Tanja; Malola, Sami; Permi, Perttu; Häkkinen, Hannu; Marjomäki, Varpu

2015-11-07

Visualization and tracking of viruses without compromising their functionality is crucial in order to understand virus targeting to cells and tissues, and to understand the subsequent subcellular steps leading to virus uncoating and replication. Enteroviruses are important human pathogens causing a vast number of acute infections, and are also suggested to contribute to the development of chronic diseases like type I diabetes. Here, we demonstrate a novel method to target site-specifically the hydrophobic pocket of enteroviruses. A probe, a derivative of Pleconaril, was developed and conjugated to various labels that enabled the visualization of enteroviruses under light and electron microscopes. The probe mildly stabilized the virus particle by increasing the melting temperature by 1-3 degrees, and caused a delay in the uncoating of the virus in the cellular endosomes, but could not however inhibit the receptor binding, cellular entry or infectivity of the virus. The hydrophobic pocket binding moiety of the probe was shown to bind to echovirus 1 particle by STD and tr-NOESY NMR methods. Furthermore, binding to echovirus 1 and Coxsackievirus A9, and to a lesser extent to Coxsackie virus B3 was verified by using a gold nanocluster labeled probe by TEM analysis. Molecular modelling suggested that the probe fits the hydrophobic pockets of EV1 and CVA9, but not of CVB3 as expected, correlating well with the variations in the infectivity and stability of the virus particles. EV1 conjugated to the fluorescent dye labeled probe was efficiently internalized into the cells. The virus-fluorescent probe conjugate accumulated in the cytoplasmic endosomes and caused infection starting from 6 hours onwards. Remarkably, before and during the time of replication, the fluorescent probe was seen to leak from the virus-positive endosomes and thus separate from the capsid proteins that were left in the endosomes. These results suggest that, like the physiological hydrophobic content, the probe may be released upon virus uncoating. Our results collectively thus show that the gold and fluorescently labeled probes may be used to track and visualize the studied enteroviruses during the early phases of infection opening new avenues to follow virus uncoating in cells.
Elucidation of the Inhibitory Effect of Phytochemicals with Kir6.2 Wild-Type and Mutant Models Associated in Type-1 Diabetes through Molecular Docking Approach

PubMed Central

Jagadeb, Manaswini; Konkimalla, V Badireenath; Das, Rohit Pritam

2014-01-01

Among all serious diseases globally, diabetes (type 1 and type 2) still poses a major challenge to the world population. Several target proteins have been identified, and the etiology causing diabetes has been reasonably well studied. But, there is still a gap in deciding on the choice of a drug, especially when the target is mutated. Mutations in the KCNJ11 gene, encoding the kir6.2 channel, are reported to be associated with congenital hyperinsulinism, having a major impact in causing type 1 diabetes, and due to the lack of its 3D structure, an attempt has been made to predict the structure of kir6.2, applying fold recognition methods. The current work is intended to investigate the affinity of four phytochemicals namely, curcumin (Curcuma longa), genistein (Genista tinctoria), piperine (Piper nigrum), and pterostilbene (Vitis vinifera) in a normal as well as in a mutant kir6.2 model by adopting a molecular docking methodology. The phytochemicals were docked in both wild and mutated kir6.2 models in two rounds: blind docking followed by ATP-binding pocket-specific docking. From the binding pockets, the common interacting amino acid residues participating strongly within the binding pocket were identified and compared. From the study, we conclude that these phytochemicals have strong affinity in both the normal and mutant kir6.2 model. This work would be helpful for further study of the phytochemicals above for the treatment of type 1 diabetes by targeting the kir6.2 channel. PMID:25705171
Compound activity prediction using models of binding pockets or ligand properties in 3D

PubMed Central

Kufareva, Irina; Chen, Yu-Chen; Ilatovskiy, Andrey V.; Abagyan, Ruben

2014-01-01

Transient interactions of endogenous and exogenous small molecules with flexible binding sites in proteins or macromolecular assemblies play a critical role in all biological processes. Current advances in high-resolution protein structure determination, database development, and docking methodology make it possible to design three-dimensional models for prediction of such interactions with increasing accuracy and specificity. Using the data collected in the Pocketome encyclopedia, we here provide an overview of two types of the three-dimensional ligand activity models, pocket-based and ligand property-based, for two important classes of proteins, nuclear and G-protein coupled receptors. For half the targets, the pocket models discriminate actives from property matched decoys with acceptable accuracy (the area under ROC curve, AUC, exceeding 84%) and for about one fifth of the targets with high accuracy (AUC > 95%). The 3D ligand property field models performed better than 95% in half of the cases. The high performance models can already become a basis of activity predictions for new chemicals. Family-wide benchmarking of the models highlights strengths of both approaches and helps identify their inherent bottlenecks and challenges. PMID:23116466
Structure of CC chemokine receptor 2 with orthosteric and allosteric antagonists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Yi; Qin, Ling; Zacarías, Natalia V. Ortiz

CC chemokine receptor 2 (CCR2) is one of 19 members of the chemokine receptor subfamily of human class A G-protein-coupled receptors. CCR2 is expressed on monocytes, immature dendritic cells, and T-cell subpopulations, and mediates their migration towards endogenous CC chemokine ligands such as CCL2 (ref. 1). CCR2 and its ligands are implicated in numerous inflammatory and neurodegenerative diseases2 including atherosclerosis, multiple sclerosis, asthma, neuropathic pain, and diabetic nephropathy, as well as cancer3. These disease associations have motivated numerous preclinical studies and clinical trials4 (see http://www.clinicaltrials.gov) in search of therapies that target the CCR2–chemokine axis. To aid drug discovery efforts5, heremore » we solve a structure of CCR2 in a ternary complex with an orthosteric (BMS-681 (ref. 6)) and allosteric (CCR2-RA-[R]7) antagonist. BMS-681 inhibits chemokine binding by occupying the orthosteric pocket of the receptor in a previously unseen binding mode. CCR2-RA-[R] binds in a novel, highly druggable pocket that is the most intracellular allosteric site observed in class A G-protein-coupled receptors so far; this site spatially overlaps the G-protein-binding site in homologous receptors. CCR2-RA-[R] inhibits CCR2 non-competitively by blocking activation-associated conformational changes and formation of the G-protein-binding interface. The conformational signature of the conserved microswitch residues observed in double-antagonist-bound CCR2 resembles the most inactive G-protein-coupled receptor structures solved so far. Like other protein–protein interactions, receptor–chemokine complexes are considered challenging therapeutic targets for small molecules, and the present structure suggests diverse pocket epitopes that can be exploited to overcome obstacles in drug design.« less
Structure of CC Chemokine Receptor 2 with Orthosteric and Allosteric Antagonists

PubMed Central

Zheng, Yi; Qin, Ling; Ortiz Zacarías, Natalia V.; de Vries, Henk; Han, Gye Won; Gustavsson, Martin; Dabros, Marta; Zhao, Chunxia; Cherney, Robert J.; Carter, Percy; Stamos, Dean; Abagyan, Ruben; Cherezov, Vadim; Stevens, Raymond C.; IJzerman, Adriaan P.; Heitman, Laura H.; Tebben, Andrew; Kufareva, Irina; Handel, Tracy M.

2016-01-01

Summary CC chemokine receptor 2 (CCR2) is one of 19 members of the chemokine receptor subfamily of human Class A G protein-coupled receptors (GPCRs). CCR2 is expressed on monocytes, immature dendritic cells and T cell subpopulations, and mediates their migration towards endogenous CC chemokine ligands such as CCL21. CCR2 and its ligands are implicated in numerous inflammatory and neurodegenerative diseases2 including atherosclerosis, multiple sclerosis, asthma, neuropathic pain, and diabetic nephropathy, as well as cancer3. These disease associations have motivated numerous preclinical studies and clinical trials4 (see ClinicalTrials.gov) in search of therapies that target the CCR2:chemokine axis. To aid drug discovery efforts5, we solved a structure of CCR2 in a ternary complex with an orthosteric (BMS-6816) and allosteric (CCR2-RA-[R]7) antagonist. BMS-681 inhibits chemokine binding by occupying the orthosteric pocket of the receptor in a previously unseen binding mode. CCR2-RA-[R] binds in a novel, highly druggable pocket that is the most intracellular allosteric site observed in Class A GPCRs to date; this site spatially overlaps the G protein-binding site in homologous receptors. CCR2-RA-[R] inhibits CCR2 non-competitively by blocking activation-associated conformational changes and formation of the G protein-binding interface. The conformational signature of the conserved microswitch residues observed in double-antagonist-bound CCR2 resembles the most inactive GPCR structures solved to date. Like other protein:protein interactions, receptor:chemokine complexes are considered challenging therapeutic targets for small molecules, and the present structure suggests diverse pocket epitopes that can be exploited to overcome drug design obstacles. PMID:27926736
The molecular basis of resilience to the effect of the Lys103Asn mutation in non-nucleoside HIV-1 reverse transcriptase inhibitors studied by targeted molecular dynamics simulations.

PubMed

Rodríguez-Barrios, Fátima; Balzarini, Jan; Gago, Federico

2005-05-25

A series of targeted molecular dynamics simulations have been carried out in an attempt to assess the effect that the common Lys103Asn mutation in HIV-1 reverse transcriptase (RT) has on the binding of three representative non-nucleoside RT inhibitors (NNRTI), nevirapine, efavirenz, and etravirine. We have shown previously that, in the absence of an incoming inhibitor, creation of the NNRTI binding pocket is hampered due to the existence of a hydrogen bond between the side chains of Asn103 and Tyr188 for which no equivalent exists in the wild-type enzyme. As an extension of this work, we now apply the same methodology to drive the enzyme's conformation from the unbound state to the drug-bound state in the presence of the NNRTI. The location of each drug outside the binding pocket was determined by an automated docking program, and steering into the binding pocket followed a route that is likely to represent the actual entrance pathway. The additional hurdle to inhibitor entry imposed by the extra Asn103-Tyr188 hydrogen bond is seen to affect each NNRTI differently, with the ability to disrupt this interaction increasing in the order etravirine > efavirenz > or = nevirapine, in good accord with the experimental findings. This coherent picture strongly suggests that attempts to overcome resistance through structure-based drug design may be considerably more successful if dynamic structural aspects of the type studied here are considered, particularly in cases where binding energy-based structure-activity relationship methods are unable to provide the required information.
PoLi: A Virtual Screening Pipeline Based On Template Pocket And Ligand Similarity

PubMed Central

Roy, Ambrish; Srinivasan, Bharath; Skolnick, Jeffrey

2015-01-01

Often in pharmaceutical research, the goal is to identify small molecules that can interact with and appropriately modify the biological behavior of a new protein target. Unfortunately, most proteins lack both known structures and small molecule binders, prerequisites of many virtual screening, VS, approaches. For such proteins, ligand homology modeling, LHM, that copies ligands from homologous and perhaps evolutionarily distant template proteins, has been shown to be a powerful VS approach to identify possible binding ligands. However, if we want to target a specific pocket for which there is no homologous holo template protein structure, then LHM will not work. To address this issue, in a new pocket based approach, PoLi, we generalize LHM by exploiting the fact that the number of distinct small molecule ligand binding pockets in proteins is small. PoLi identifies similar ligand binding pockets in a holo-template protein library, selectively copies relevant parts of template ligands and uses them for VS. In practice, PoLi is a hybrid structure and ligand based VS algorithm that integrates 2D fingerprint-based and 3D shape-based similarity metrics for improved virtual screening performance. On standard DUD and DUD-E benchmark databases, using modeled receptor structures, PoLi achieves an average enrichment factor of 13.4 and 9.6 respectively, in the top 1% of the screened library. In contrast, traditional docking based VS using AutoDock Vina and homology-based VS using FINDSITEfilt have an average enrichment of 1.6 (3.0) and 9.0 (7.9) on the DUD (DUD-E) sets respectively. Experimental validation of PoLi predictions on dihydrofolate reductase, DHFR, using differential scanning fluorimetry, DSF, identifies multiple ligands with diverse molecular scaffolds, thus demonstrating the advantage of PoLi over current state-of-the-art VS methods. PMID:26225536
Doubling the Size of the Glucocorticoid Receptor Ligand Binding Pocket by Deacylcortivazol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suino-Powell, Kelly; Xu, Yong; Zhang, Chenghai

A common feature of nuclear receptor ligand binding domains (LBD) is a helical sandwich fold that nests a ligand binding pocket within the bottom half of the domain. Here we report that the ligand pocket of glucocorticoid receptor (GR) can be continuously extended into the top half of the LBD by binding to deacylcortivazol (DAC), an extremely potent glucocorticoid. It has been puzzling for decades why DAC, which contains a phenylpyrazole replacement at the conserved 3-ketone of steroid hormones that are normally required for activation of their cognate receptors, is a potent GR activator. The crystal structure of the GRmore » LBD bound to DAC and the fourth LXXLL motif of steroid receptor coactivator 1 reveals that the GR ligand binding pocket is expanded to a size of 1,070 {angstrom}{sup 3}, effectively doubling the size of the GR dexamethasone-binding pocket of 540 {angstrom}{sup 3} and yet leaving the structure of the coactivator binding site intact. DAC occupies only {approx}50% of the space of the pocket but makes intricate interactions with the receptor around the phenylpyrazole group that accounts for the high-affinity binding of DAC. The dramatic expansion of the DAC-binding pocket thus highlights the conformational adaptability of GR to ligand binding. The new structure also allows docking of various nonsteroidal ligands that cannot be fitted into the previous structures, thus providing a new rational template for drug discovery of steroidal and nonsteroidal glucocorticoids that can be specifically designed to reach the unoccupied space of the expanded pocket.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yanli; Sheng, Gang; Juranek, Stefan

The slicer activity of the RNA-induced silencing complex is associated with argonaute, the RNase H-like PIWI domain of which catalyses guide-strand-mediated sequence-specific cleavage of target messenger RNA. Here we report on the crystal structure of Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-base DNA guide strand, thereby identifying the nucleic-acid-binding channel positioned between the PAZ- and PIWI-containing lobes, as well as the pivot-like conformational changes associated with complex formation. The bound guide strand is anchored at both of its ends, with the solvent-exposed Watson-Crick edges of stacked bases 2 to 6 positioned for nucleation with the mRNA target, whereas twomore » critically positioned arginines lock bases 10 and 11 at the cleavage site into an unanticipated orthogonal alignment. Biochemical studies indicate that key amino acid residues at the active site and those lining the 5'-phosphate-binding pocket made up of the Mid domain are critical for cleavage activity, whereas alterations of residues lining the 2-nucleotide 3'-end-binding pocket made up of the PAZ domain show little effect.« less
Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

PubMed Central

Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

2018-01-01

Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348
Detailed conformation dynamics and activation process of wild type c-Abl and T315I mutant

NASA Astrophysics Data System (ADS)

Yang, Li-Jun; Zhao, Wen-Hua; Liu, Qian

2014-10-01

Bcr-Abl is an important target for therapy against chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). The synergistic effect between myristyl pocket and the ATP pocket has been found. But its detailed information based on molecular level still has not been achieved. In this study, conventional molecular dynamics (CMD) and target molecular dynamics (TMD) simulations were performed to explore the effect of T315I mutation on dynamics and activation process of Abl containing the N-terminal cap (Ncap). The CMD simulation results reveal the increasing flexibility of ATP pocket in kinase domain (KD) after T315I mutation which confirms the disability of ATP-pocket inhibitors to the Abl-T315I mutant. On the contrary, the T315I mutation decreased the flexibility of remote helix αI which suggests the synergistic effect between them. The mobility of farther regions containing Ncap, SH3, SH2 and SH2-KD linker were not affected by T315I mutation. The TMD simulation results show that the activation process of wild type Abl and Abl-T315I mutant experienced global conformation change. Their differences were elucidated by the activation motion of subsegments including A-loop, P-loop and Ncap. Besides, the T315I mutation caused decreasing energy barrier and increasing intermediate number in activation process, which results easier activation process. The TMD and CMD results indicate that a drug targeting only the ATP pocket is not enough to inhibit the Abl-T315I mutant. An effective way to inhibit the abnormal activity of Abl-T315I mutant is to combine the ATP-pocket inhibitors with inhibitors binding at non-ATP pockets mainly related to Ncap, SH2-KD linker and myristyl pocket.
Displacement of disordered water molecules from hydrophobic pocket creates enthalpic signature: binding of phosphonamidate to the S₁'-pocket of thermolysin.

PubMed

Englert, L; Biela, A; Zayed, M; Heine, A; Hangauer, D; Klebe, G

2010-11-01

Prerequisite for the design of tight binding protein inhibitors and prediction of their properties is an in-depth understanding of the structural and thermodynamic details of the binding process. A series of closely related phosphonamidates was studied to elucidate the forces underlying their binding affinity to thermolysin. The investigated inhibitors are identical except for the parts penetrating into the hydrophobic S₁'-pocket. A correlation of structural, kinetic and thermodynamic data was carried out by X-ray crystallography, kinetic inhibition assay and isothermal titration calorimetry. Binding affinity increases with larger ligand hydrophobic P₁'-moieties accommodating the S₁'-pocket. Surprisingly, larger P₁'-side chain modifications are accompanied by an increase in the enthalpic contribution to binding. In agreement with other studies, it is suggested that the release of largely disordered waters from an imperfectly hydrated pocket results in an enthalpically favourable integration of these water molecules into bulk water upon inhibitor binding. This enthalpically favourable process contributes more strongly to the binding energetics than the entropy increase resulting from the release of water molecules from the S₁'-pocket or the formation of apolar interactions between protein and inhibitor. Displacement of highly disordered water molecules from a rather imperfectly hydrated and hydrophobic specificity pocket can reveal an enthalpic signature of inhibitor binding. Copyright © 2010 Elsevier B.V. All rights reserved.
Computational analysis of EBNA1 ``druggability'' suggests novel insights for Epstein-Barr virus inhibitor design

NASA Astrophysics Data System (ADS)

Gianti, Eleonora; Messick, Troy E.; Lieberman, Paul M.; Zauhar, Randy J.

2016-04-01

The Epstein-Barr Nuclear Antigen 1 (EBNA1) is a critical protein encoded by the Epstein-Barr Virus (EBV). During latent infection, EBNA1 is essential for DNA replication and transcription initiation of viral and cellular genes and is necessary to immortalize primary B-lymphocytes. Nonetheless, the concept of EBNA1 as drug target is novel. Two EBNA1 crystal structures are publicly available and the first small-molecule EBNA1 inhibitors were recently discovered. However, no systematic studies have been reported on the structural details of EBNA1 "druggable" binding sites. We conducted computational identification and structural characterization of EBNA1 binding pockets, likely to accommodate ligand molecules (i.e. "druggable" binding sites). Then, we validated our predictions by docking against a set of compounds previously tested in vitro for EBNA1 inhibition (PubChem AID-2381). Finally, we supported assessments of pocket druggability by performing induced fit docking and molecular dynamics simulations paired with binding affinity predictions by Molecular Mechanics Generalized Born Surface Area calculations for a number of hits belonging to druggable binding sites. Our results establish EBNA1 as a target for drug discovery, and provide the computational evidence that active AID-2381 hits disrupt EBNA1:DNA binding upon interacting at individual sites. Lastly, structural properties of top scoring hits are proposed to support the rational design of the next generation of EBNA1 inhibitors.

Recent Progress in the Design and Discovery of RXR Modulators Targeting Alternate Binding Sites of the Receptor.

PubMed

Su, Ying; Zeng, Zhiping; Chen, Ziwen; Xu, Dan; Zhang, Weidong; Zhang, Xiao-Kun

2017-01-01

Retinoid X receptors (RXRs) occupy a central position within the nuclear receptor superfamily. They not only function as important transcriptional factors but also exhibit diverse nongenomic biological activities. The pleiotropic actions of RXRs under both physiological and pathophysiological conditions confer RXRs important drug targets for the treatment of cancer, and metabolic and neurodegenerative diseases. RXR modulators have been studied for the purpose of developing both drug molecules and chemical tools for biological investigation of RXR. Development of RXR modulators has focused on small molecules targeting the canonical ligand-binding pocket. However, accumulating results have demonstrated that there are other binding mechanisms by which small molecules interact with RXR to act as RXR modulators. This review discusses the recent development in the design and discovery of RXR modulators with a focus on those targeting novel binding sites on RXR.
Non-canonical modulators of nuclear receptors.

PubMed

Tice, Colin M; Zheng, Ya-Jun

2016-09-01

Like G protein-coupled receptors (GPCRs) and protein kinases, nuclear receptors (NRs) are a rich source of pharmaceutical targets. Over 80 NR-targeting drugs have been approved for 18 NRs. The focus of drug discovery in NRs has hitherto been on identifying ligands that bind to the canonical ligand binding pockets of the C-terminal ligand binding domains (LBDs). Due to the development of drug resistance and selectivity concerns, there has been considerable interest in exploring other, non-canonical ligand binding sites. Unfortunately, the potencies of compounds binding at other sites have generally not been sufficient for clinical development. However, the situation has changed dramatically over the last 3years, as compounds with sufficient potency have been reported for several NR targets. Here we review recent developments in this area from a medicinal chemistry point of view in the hope of stimulating further interest in this area of research. Copyright © 2016 Elsevier Ltd. All rights reserved.
A High-Throughput TNP-ATP Displacement Assay for Screening Inhibitors of ATP-Binding in Bacterial Histidine Kinases

PubMed Central

Guarnieri, Michael T.; Blagg, Brian S. J.

2011-01-01

Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069
Protein-protein interface analysis and hot spots identification for chemical ligand design.

PubMed

Chen, Jing; Ma, Xiaomin; Yuan, Yaxia; Pei, Jianfeng; Lai, Luhua

2014-01-01

Rational design for chemical compounds targeting protein-protein interactions has grown from a dream to reality after a decade of efforts. There are an increasing number of successful examples, though major challenges remain in the field. In this paper, we will first give a brief review of the available methods that can be used to analyze protein-protein interface and predict hot spots for chemical ligand design. New developments of binding sites detection, ligandability and hot spots prediction from the author's group will also be described. Pocket V.3 is an improved program for identifying hot spots in protein-protein interface using only an apo protein structure. It has been developed based on Pocket V.2 that can derive receptor-based pharmacophore model for ligand binding cavity. Given similarities and differences between the essence of pharmacophore and hot spots for guiding design of chemical compounds, not only energetic but also spatial properties of protein-protein interface are used in Pocket V.3 for dealing with protein-protein interface. In order to illustrate the capability of Pocket V.3, two datasets have been used. One is taken from ASEdb and BID having experimental alanine scanning results for testing hot spots prediction. The other is taken from the 2P2I database containing complex structures of protein-ligand binding at the original protein-protein interface for testing hot spots application in ligand design.
Structural basis for the inhibition of poly(ADP-ribose) polymerases 1 and 2 by BMN 673, a potent inhibitor derived from dihydropyridophthalazinone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoyagi-Scharber, Mika, E-mail: maoyagi@bmrn.com; Gardberg, Anna S.; Yip, Bryan K.

2014-08-29

BMN 673, a novel PARP1/2 inhibitor in clinical development with substantial tumor cytotoxicity, forms extensive hydrogen-bonding and π-stacking in the nicotinamide pocket, with its unique disubstituted scaffold extending towards the less conserved edges of the pocket. These interactions might provide structural insight into the ability of BMN 673 to both inhibit catalysis and affect DNA-binding activity. Poly(ADP-ribose) polymerases 1 and 2 (PARP1 and PARP2), which are involved in DNA damage response, are targets of anticancer therapeutics. BMN 673 is a novel PARP1/2 inhibitor with substantially increased PARP-mediated tumor cytotoxicity and is now in later-stage clinical development for BRCA-deficient breast cancers.more » In co-crystal structures, BMN 673 is anchored to the nicotinamide-binding pocket via an extensive network of hydrogen-bonding and π-stacking interactions, including those mediated by active-site water molecules. The novel di-branched scaffold of BMN 673 extends the binding interactions towards the outer edges of the pocket, which exhibit the least sequence homology among PARP enzymes. The crystallographic structural analyses reported here therefore not only provide critical insights into the molecular basis for the exceptionally high potency of the clinical development candidate BMN 673, but also new opportunities for increasing inhibitor selectivity.« less
Fragment-based protein-protein interaction antagonists of a viral dimeric protease

PubMed Central

Gable, Jonathan E.; Lee, Gregory M.; Acker, Timothy M.; Hulce, Kaitlin R.; Gonzalez, Eric R.; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J.; Craik, Charles S.

2016-01-01

Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi’s sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose response determination was performed as a confirmation screen and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed via NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80% of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogs. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. PMID:26822284
Residues remote from the binding pocket control the antagonist selectivity towards the corticotropin-releasing factor receptor-1

NASA Astrophysics Data System (ADS)

Sun, Xianqiang; Cheng, Jianxin; Wang, Xu; Tang, Yun; Ågren, Hans; Tu, Yaoquan

2015-01-01

The corticotropin releasing factors receptor-1 and receptor-2 (CRF1R and CRF2R) are therapeutic targets for treating neurological diseases. Antagonists targeting CRF1R have been developed for the potential treatment of anxiety disorders and alcohol addiction. It has been found that antagonists targeting CRF1R always show high selectivity, although CRF1R and CRF2R share a very high rate of sequence identity. This has inspired us to study the origin of the selectivity of the antagonists. We have therefore built a homology model for CRF2R and carried out unbiased molecular dynamics and well-tempered metadynamics simulations for systems with the antagonist CP-376395 in CRF1R or CRF2R to address this issue. We found that the side chain of Tyr6.63 forms a hydrogen bond with the residue remote from the binding pocket, which allows Tyr6.63 to adopt different conformations in the two receptors and results in the presence or absence of a bottleneck controlling the antagonist binding to or dissociation from the receptors. The rotameric switch of the side chain of Tyr3566.63 allows the breaking down of the bottleneck and is a perquisite for the dissociation of CP-376395 from CRF1R.
Residues remote from the binding pocket control the antagonist selectivity towards the corticotropin-releasing factor receptor-1.

PubMed

Sun, Xianqiang; Cheng, Jianxin; Wang, Xu; Tang, Yun; Ågren, Hans; Tu, Yaoquan

2015-01-28

The corticotropin releasing factors receptor-1 and receptor-2 (CRF1R and CRF2R) are therapeutic targets for treating neurological diseases. Antagonists targeting CRF1R have been developed for the potential treatment of anxiety disorders and alcohol addiction. It has been found that antagonists targeting CRF1R always show high selectivity, although CRF1R and CRF2R share a very high rate of sequence identity. This has inspired us to study the origin of the selectivity of the antagonists. We have therefore built a homology model for CRF2R and carried out unbiased molecular dynamics and well-tempered metadynamics simulations for systems with the antagonist CP-376395 in CRF1R or CRF2R to address this issue. We found that the side chain of Tyr(6.63) forms a hydrogen bond with the residue remote from the binding pocket, which allows Tyr(6.63) to adopt different conformations in the two receptors and results in the presence or absence of a bottleneck controlling the antagonist binding to or dissociation from the receptors. The rotameric switch of the side chain of Tyr356(6.63) allows the breaking down of the bottleneck and is a perquisite for the dissociation of CP-376395 from CRF1R.
Investigation of the intermolecular recognition mechanism between the E3 ubiquitin ligase Keap1 and substrate based on multiple substrates analysis.

PubMed

Jiang, Zheng-Yu; Xu, Li-Li; Lu, Meng-Chen; Pan, Yang; Huang, Hao-Ze; Zhang, Xiao-Jin; Sun, Hao-Peng; You, Qi-Dong

2014-12-01

E3 ubiquitin ligases are attractive drug targets due to their specificity to the ubiquitin machinery. However, the development of E3 ligase inhibitors has proven challenging for the fact that they must disrupt protein-protein interactions (PPIs). The E3 ligase involved in interactome provide new hope for the discovery of the E3 ligase inhibitors. These currently known natural binding partners of the E3 ligase can benefit the discovery of other unknown substrates and also the E3 ligase inhibitors. Herein, we present a novel strategy that using multiple substrates to elucidate the molecular recognition mechanism of E3 ubiquitin ligase. Molecular dynamics simulation, molecular mechanics-generalized born surface area (MM-GBSA) binding energy calculation and energy decomposition scheme were incorporated to evaluate the quantitative contributions of sub-pocket and per-residue to binding. In this case, Kelch-like ECH-associated protein-1 (Keap1), a substrate adaptor component of the Cullin-RING ubiquitin ligases complex, is applied for the investigation of how it recognize its substrates, especially Nrf2, a master regulator of the antioxidant response. By analyzing multiple substrates binding determinants, we found that both the polar sub-pockets (P1 and P2) and the nonpolar sub-pockets (P4 and P5) of Keap1 can make remarkable contributions to intermolecular interactions. This finding stresses the requirement for substrates to interact with the polar and nonpolar sub-pockets simultaneously. The results discussed in this paper not only show the binding determinants of the Keap1 substrates but also provide valuable implications for both Keap1 substrate discovery and PPI inhibitor design.
Investigation of the intermolecular recognition mechanism between the E3 ubiquitin ligase Keap1 and substrate based on multiple substrates analysis

NASA Astrophysics Data System (ADS)

Jiang, Zheng-Yu; Xu, Li-Li; Lu, Meng-Chen; Pan, Yang; Huang, Hao-Ze; Zhang, Xiao-Jin; Sun, Hao-Peng; You, Qi-Dong

2014-12-01

E3 ubiquitin ligases are attractive drug targets due to their specificity to the ubiquitin machinery. However, the development of E3 ligase inhibitors has proven challenging for the fact that they must disrupt protein-protein interactions (PPIs). The E3 ligase involved in interactome provide new hope for the discovery of the E3 ligase inhibitors. These currently known natural binding partners of the E3 ligase can benefit the discovery of other unknown substrates and also the E3 ligase inhibitors. Herein, we present a novel strategy that using multiple substrates to elucidate the molecular recognition mechanism of E3 ubiquitin ligase. Molecular dynamics simulation, molecular mechanics-generalized born surface area (MM-GBSA) binding energy calculation and energy decomposition scheme were incorporated to evaluate the quantitative contributions of sub-pocket and per-residue to binding. In this case, Kelch-like ECH-associated protein-1 (Keap1), a substrate adaptor component of the Cullin-RING ubiquitin ligases complex, is applied for the investigation of how it recognize its substrates, especially Nrf2, a master regulator of the antioxidant response. By analyzing multiple substrates binding determinants, we found that both the polar sub-pockets (P1 and P2) and the nonpolar sub-pockets (P4 and P5) of Keap1 can make remarkable contributions to intermolecular interactions. This finding stresses the requirement for substrates to interact with the polar and nonpolar sub-pockets simultaneously. The results discussed in this paper not only show the binding determinants of the Keap1 substrates but also provide valuable implications for both Keap1 substrate discovery and PPI inhibitor design.
Structural Basis for Suppression of a Host Antiviral Response by Influenza A Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das,K.; Ma, L.; Xiao, R.

2008-01-01

Influenza A viruses are responsible for seasonal epidemics and high mortality pandemics. A major function of the viral NS1A protein, a virulence factor, is the inhibition of the production of IFN-{beta}{beta} mRNA and other antiviral mRNAs. The NS1A protein of the human influenza A/Udorn/72 (Ud) virus inhibits the production of these antiviral mRNAs by binding the cellular 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF30), which is required for the 3' end processing of all cellular pre-mRNAs. Here we report the 1.95- Angstroms resolution X-ray crystal structure of the complex formed between the second and third zinc fingermore » domain (F2F3) of CPSF30 and the C-terminal domain of the Ud NS1A protein. The complex is a tetramer, in which each of two F2F3 molecules wraps around two NS1A effector domains that interact with each other head-to-head. This structure identifies a CPSF30 binding pocket on NS1A comprised of amino acid residues that are highly conserved among human influenza A viruses. Single amino acid changes within this binding pocket eliminate CPSF30 binding, and a recombinant Ud virus expressing an NS1A protein with such a substitution is attenuated and does not inhibit IFN-{beta} pre-mRNA processing. This binding pocket is a potential target for antiviral drug development. The crystal structure also reveals that two amino acids outside of this pocket, F103 and M106, which are highly conserved (>99%) among influenza A viruses isolated from humans, participate in key hydrophobic interactions with F2F3 that stabilize the complex.« less
Structure of the Trehalose-6-phosphate Phosphatase from Brugia malayi Reveals Key Design Principles for Anthelmintic Drugs

PubMed Central

Farelli, Jeremiah D.; Galvin, Brendan D.; Li, Zhiru; Liu, Chunliang; Aono, Miyuki; Garland, Megan; Hallett, Olivia E.; Causey, Thomas B.; Ali-Reynolds, Alana; Saltzberg, Daniel J.; Carlow, Clotilde K. S.; Dunaway-Mariano, Debra; Allen, Karen N.

2014-01-01

Parasitic nematodes are responsible for devastating illnesses that plague many of the world's poorest populations indigenous to the tropical areas of developing nations. Among these diseases is lymphatic filariasis, a major cause of permanent and long-term disability. Proteins essential to nematodes that do not have mammalian counterparts represent targets for therapeutic inhibitor discovery. One promising target is trehalose-6-phosphate phosphatase (T6PP) from Brugia malayi. In the model nematode Caenorhabditis elegans, T6PP is essential for survival due to the toxic effect(s) of the accumulation of trehalose 6-phosphate. T6PP has also been shown to be essential in Mycobacterium tuberculosis. We determined the X-ray crystal structure of T6PP from B. malayi. The protein structure revealed a stabilizing N-terminal MIT-like domain and a catalytic C-terminal C2B-type HAD phosphatase fold. Structure-guided mutagenesis, combined with kinetic analyses using a designed competitive inhibitor, trehalose 6-sulfate, identified five residues important for binding and catalysis. This structure-function analysis along with computational mapping provided the basis for the proposed model of the T6PP-trehalose 6-phosphate complex. The model indicates a substrate-binding mode wherein shape complementarity and van der Waals interactions drive recognition. The mode of binding is in sharp contrast to the homolog sucrose-6-phosphate phosphatase where extensive hydrogen-bond interactions are made to the substrate. Together these results suggest that high-affinity inhibitors will be bi-dentate, taking advantage of substrate-like binding to the phosphoryl-binding pocket while simultaneously utilizing non-native binding to the trehalose pocket. The conservation of the key residues that enforce the shape of the substrate pocket in T6PP enzymes suggest that development of broad-range anthelmintic and antibacterial therapeutics employing this platform may be possible. PMID:24992307
Raf Kinase Inhibitory Protein Function Is Regulated via a Flexible Pocket and Novel Phosphorylation-Dependent Mechanism▿ †

PubMed Central

Granovsky, Alexey E.; Clark, Matthew C.; McElheny, Dan; Heil, Gary; Hong, Jia; Liu, Xuedong; Kim, Youngchang; Joachimiak, Grazyna; Joachimiak, Andrzej; Koide, Shohei; Rosner, Marsha Rich

2009-01-01

Raf kinase inhibitory protein (RKIP/PEBP1), a member of the phosphatidylethanolamine binding protein family that possesses a conserved ligand-binding pocket, negatively regulates the mammalian mitogen-activated protein kinase (MAPK) signaling cascade. Mutation of a conserved site (P74L) within the pocket leads to a loss or switch in the function of yeast or plant RKIP homologues. However, the mechanism by which the pocket influences RKIP function is unknown. Here we show that the pocket integrates two regulatory signals, phosphorylation and ligand binding, to control RKIP inhibition of Raf-1. RKIP association with Raf-1 is prevented by RKIP phosphorylation at S153. The P74L mutation increases kinase interaction and RKIP phosphorylation, enhancing Raf-1/MAPK signaling. Conversely, ligand binding to the RKIP pocket inhibits kinase interaction and RKIP phosphorylation by a noncompetitive mechanism. Additionally, ligand binding blocks RKIP association with Raf-1. Nuclear magnetic resonance studies reveal that the pocket is highly dynamic, rationalizing its capacity to interact with distinct partners and be involved in allosteric regulation. Our results show that RKIP uses a flexible pocket to integrate ligand binding- and phosphorylation-dependent interactions and to modulate the MAPK signaling pathway. This mechanism is an example of an emerging theme involving the regulation of signaling proteins and their interaction with effectors at the level of protein dynamics. PMID:19103740
Raf kinase inhibitory protein function is regulated via a flexible pocket and novel phosphorylation-dependent mechanism.

PubMed

Granovsky, Alexey E; Clark, Matthew C; McElheny, Dan; Heil, Gary; Hong, Jia; Liu, Xuedong; Kim, Youngchang; Joachimiak, Grazyna; Joachimiak, Andrzej; Koide, Shohei; Rosner, Marsha Rich

2009-03-01

Raf kinase inhibitory protein (RKIP/PEBP1), a member of the phosphatidylethanolamine binding protein family that possesses a conserved ligand-binding pocket, negatively regulates the mammalian mitogen-activated protein kinase (MAPK) signaling cascade. Mutation of a conserved site (P74L) within the pocket leads to a loss or switch in the function of yeast or plant RKIP homologues. However, the mechanism by which the pocket influences RKIP function is unknown. Here we show that the pocket integrates two regulatory signals, phosphorylation and ligand binding, to control RKIP inhibition of Raf-1. RKIP association with Raf-1 is prevented by RKIP phosphorylation at S153. The P74L mutation increases kinase interaction and RKIP phosphorylation, enhancing Raf-1/MAPK signaling. Conversely, ligand binding to the RKIP pocket inhibits kinase interaction and RKIP phosphorylation by a noncompetitive mechanism. Additionally, ligand binding blocks RKIP association with Raf-1. Nuclear magnetic resonance studies reveal that the pocket is highly dynamic, rationalizing its capacity to interact with distinct partners and be involved in allosteric regulation. Our results show that RKIP uses a flexible pocket to integrate ligand binding- and phosphorylation-dependent interactions and to modulate the MAPK signaling pathway. This mechanism is an example of an emerging theme involving the regulation of signaling proteins and their interaction with effectors at the level of protein dynamics.
Structural Basis for Molecular Discrimination by a 3',3'-cGAMP Sensing Riboswitch

DOE PAGES

Ren, Aiming; Wang, Xin C.; Kellenberger, Colleen A.; ...

2015-04-07

Cyclic dinucleotides are second messengers that target the adaptor STING and stimulate the innate immune response in mammals. Besides protein receptors, there are bacterial riboswitches that selectively recognize cyclic dinucleotides. We recently discovered a natural riboswitch that targets 3',3'-cGAMP, which is distinguished from the endogenous mammalian signal 2',3'-cGAMP by its backbone connectivity. Here, we report on structures of the aptamer domain of the 3',3'-cGAMP riboswitch from Geobacter in the 3',3'-cGAMP and c-di-GMP bound states. The riboswitch adopts a tuning forklike architecture with a junctional ligand-binding pocket and different orientations of the arms are correlated with the identity of the boundmore » cyclic dinucleotide. Subsequent biochemical experiments revealed that specificity of ligand recognition can be affected by point mutations outside of the binding pocket, which has implications for both the assignment and reengineering of riboswitches in this structural class.« less
A Hidden Active Site in the Potential Drug Target Mycobacterium tuberculosis dUTPase Is Accessible through Small Amplitude Protein Conformational Changes*

PubMed Central

Lopata, Anna; Leveles, Ibolya; Bendes, Ábris Ádám; Viskolcz, Béla; Vértessy, Beáta G.; Jójárt, Balázs; Tóth, Judit

2016-01-01

dUTPases catalyze the hydrolysis of dUTP into dUMP and pyrophosphate to maintain the proper nucleotide pool for DNA metabolism. Recent evidence suggests that dUTPases may also represent a selective drug target in mycobacteria because of the crucial role of these enzymes in maintaining DNA integrity. Nucleotide-hydrolyzing enzymes typically harbor a buried ligand-binding pocket at interdomain or intersubunit clefts, facilitating proper solvent shielding for the catalyzed reaction. The mechanism by which substrate binds this hidden pocket and product is released in dUTPases is unresolved because of conflicting crystallographic and spectroscopic data. We sought to resolve this conflict by using a combination of random acceleration molecular dynamics (RAMD) methodology and structural and biochemical methods to study the dUTPase from Mycobacterium tuberculosis. In particular, the RAMD approach used in this study provided invaluable insights into the nucleotide dissociation process that reconciles all previous experimental observations. Specifically, our data suggest that nucleotide binding takes place as a small stretch of amino acids transiently slides away and partially uncovers the active site. The in silico data further revealed a new dUTPase conformation on the pathway to a relatively open active site. To probe this model, we developed the Trp21 reporter and collected crystallographic, spectroscopic, and kinetic data that confirmed the interaction of Trp21 with the active site shielding C-terminal arm, suggesting that the RAMD method is effective. In summary, our computational simulations and spectroscopic results support the idea that small loop movements in dUTPase allow the shuttlingof the nucleotides between the binding pocket and the solvent. PMID:27815500
Crystal Structure of the Marburg Virus Nucleoprotein Core Domain Chaperoned by a VP35 Peptide Reveals a Conserved Drug Target for Filovirus.

PubMed

Zhu, Tengfei; Song, Hao; Peng, Ruchao; Shi, Yi; Qi, Jianxun; Gao, George F

2017-09-15

Filovirus nucleoprotein (NP), viral protein 35 (VP35), and polymerase L are essential for viral replication and nucleocapsid formation. Here, we identify a 28-residue peptide (NP binding peptide [NPBP]) from Marburg virus (MARV) VP35 through sequence alignment with previously identified Ebola virus (EBOV) NPBP, which bound to the core region (residues 18 to 344) of the N-terminal portion of MARV NP with high affinity. The crystal structure of the MARV NP core/NPBP complex at a resolution of 2.6 Å revealed that NPBP binds to the C-terminal region of the NP core via electrostatic and nonpolar interactions. Further structural analysis revealed that the MARV and EBOV NP cores hold a conserved binding pocket for NPBP, and this pocket could serve as a promising target for the design of universal drugs against filovirus infection. In addition, cross-binding assays confirmed that the NP core of MARV or EBOV can bind the NPBP from the other virus, although with moderately reduced binding affinities that result from termini that are distinct between the MARV and EBOV NPBPs. IMPORTANCE Historically, Marburg virus (MARV) has caused severe disease with up to 90% lethality. Among the viral proteins produced by MARV, NP and VP35 are both multifunctional proteins that are essential for viral replication. In its relative, Ebola virus (EBOV), an N-terminal peptide from VP35 binds to the NP N-terminal region with high affinity. Whether this is a common mechanism among filoviruses is an unsolved question. Here, we present the crystal structure of a complex that consists of the core domain of MARV NP and the NPBP peptide from VP35. As we compared MARV NPBP with EBOV NPBP, several different features at the termini were identified. Although these differences reduce the affinity of the NP core for NPBPs across genera, a conserved pocket in the C-terminal region of the NP core makes cross-species binding possible. Our results expand our knowledge of filovirus NP-VP35 interactions and provide more details for therapeutic intervention. Copyright © 2017 American Society for Microbiology.
Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA

PubMed Central

2016-01-01

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results. PMID:27983843
Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA.

PubMed

Hayatshahi, Hamed S; Roe, Daniel R; Galindo-Murillo, Rodrigo; Hall, Kathleen B; Cheatham, Thomas E

2017-01-26

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results.
Ultra-High-Throughput Structure-Based Virtual Screening for Small-Molecule Inhibitors of Protein-Protein Interactions

PubMed Central

Johnson, David K.; Karanicolas, John

2016-01-01

Protein-protein interactions play important roles in virtually all cellular processes, making them enticing targets for modulation by small-molecule therapeutics: specific examples have been well validated in diseases ranging from cancer and autoimmune disorders, to bacterial and viral infections. Despite several notable successes, however, overall these remain a very challenging target class. Protein interaction sites are especially challenging for computational approaches, because the target protein surface often undergoes a conformational change to enable ligand binding: this confounds traditional approaches for virtual screening. Through previous studies, we demonstrated that biased “pocket optimization” simulations could be used to build collections of low-energy pocket-containing conformations, starting from an unbound protein structure. Here, we demonstrate that these pockets can further be used to identify ligands that complement the protein surface. To do so, we first build from a given pocket its “exemplar”: a perfect, but non-physical, pseudo-ligand that would optimally match the shape and chemical features of the pocket. In our previous studies, we used these exemplars to quantitatively compare protein surface pockets to one another. Here, we now introduce this exemplar as a template for pharmacophore-based screening of chemical libraries. Through a series of benchmark experiments, we demonstrate that this approach exhibits comparable performance as traditional docking methods for identifying known inhibitors acting at protein interaction sites. However, because this approach is predicated on ligand/exemplar overlays, and thus does not require explicit calculation of protein-ligand interactions, exemplar screening provides a tremendous speed advantage over docking: 6 million compounds can be screened in about 15 minutes on a single 16-core, dual-GPU computer. The extreme speed at which large compound libraries can be traversed easily enables screening against a “pocket-optimized” ensemble of protein conformations, which in turn facilitates identification of more diverse classes of active compounds for a given protein target. PMID:26726827

GPR17: molecular modeling and dynamics studies of the 3-D structure and purinergic ligand binding features in comparison with P2Y receptors.

PubMed

Parravicini, Chiara; Ranghino, Graziella; Abbracchio, Maria P; Fantucci, Piercarlo

2008-06-04

GPR17 is a G-protein-coupled receptor located at intermediate phylogenetic position between two distinct receptor families: the P2Y and CysLT receptors for extracellular nucleotides and cysteinyl-LTs, respectively. We previously showed that GPR17 can indeed respond to both classes of endogenous ligands and to synthetic compounds active at the above receptor families, thus representing the first fully characterized non-peptide "hybrid" GPCR. In a rat brain focal ischemia model, the selective in vivo knock down of GPR17 by anti-sense technology or P2Y/CysLT antagonists reduced progression of ischemic damage, thus highlighting GPR17 as a novel therapeutic target for stroke. Elucidation of the structure of GPR17 and of ligand binding mechanisms are the necessary steps to obtain selective and potent drugs for this new potential target. On this basis, a 3-D molecular model of GPR17 embedded in a solvated phospholipid bilayer and refined by molecular dynamics simulations has been the first aim of this study. To explore the binding mode of the "purinergic" component of the receptor, the endogenous agonist UDP and two P2Y receptor antagonists demonstrated to be active on GPR17 (MRS2179 and cangrelor) were then modeled on the receptor. Molecular dynamics simulations suggest that GPR17 nucleotide binding pocket is similar to that described for the other P2Y receptors, although only one of the three basic residues that have been typically involved in ligand recognition is conserved (Arg255). The binding pocket is enclosed between the helical bundle and covered at the top by EL2. Driving interactions are H-bonds and salt bridges between the 6.55 and 6.52 residues and the phosphate moieties of the ligands. An "accessory" binding site in a region formed by the EL2, EL3 and the Nt was also found. Nucleotide binding to GPR17 occurs on the same receptor regions identified for already known P2Y receptors. Agonist/antagonist binding mode are similar, but not identical. An accessory external binding site could guide small ligands to the deeper principal binding site in a multi-step mechanism of activation. The nucleotide binding pocket appears to be unable to allocate the leukotrienic type ligands in the same effective way.
Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

PubMed

Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

2017-05-30

A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.
Hydrophobic pocket targeting probes for enteroviruses

NASA Astrophysics Data System (ADS)

Martikainen, Mari; Salorinne, Kirsi; Lahtinen, Tanja; Malola, Sami; Permi, Perttu; Häkkinen, Hannu; Marjomäki, Varpu

2015-10-01

Visualization and tracking of viruses without compromising their functionality is crucial in order to understand virus targeting to cells and tissues, and to understand the subsequent subcellular steps leading to virus uncoating and replication. Enteroviruses are important human pathogens causing a vast number of acute infections, and are also suggested to contribute to the development of chronic diseases like type I diabetes. Here, we demonstrate a novel method to target site-specifically the hydrophobic pocket of enteroviruses. A probe, a derivative of Pleconaril, was developed and conjugated to various labels that enabled the visualization of enteroviruses under light and electron microscopes. The probe mildly stabilized the virus particle by increasing the melting temperature by 1-3 degrees, and caused a delay in the uncoating of the virus in the cellular endosomes, but could not however inhibit the receptor binding, cellular entry or infectivity of the virus. The hydrophobic pocket binding moiety of the probe was shown to bind to echovirus 1 particle by STD and tr-NOESY NMR methods. Furthermore, binding to echovirus 1 and Coxsackievirus A9, and to a lesser extent to Coxsackie virus B3 was verified by using a gold nanocluster labeled probe by TEM analysis. Molecular modelling suggested that the probe fits the hydrophobic pockets of EV1 and CVA9, but not of CVB3 as expected, correlating well with the variations in the infectivity and stability of the virus particles. EV1 conjugated to the fluorescent dye labeled probe was efficiently internalized into the cells. The virus-fluorescent probe conjugate accumulated in the cytoplasmic endosomes and caused infection starting from 6 hours onwards. Remarkably, before and during the time of replication, the fluorescent probe was seen to leak from the virus-positive endosomes and thus separate from the capsid proteins that were left in the endosomes. These results suggest that, like the physiological hydrophobic content, the probe may be released upon virus uncoating. Our results collectively thus show that the gold and fluorescently labeled probes may be used to track and visualize the studied enteroviruses during the early phases of infection opening new avenues to follow virus uncoating in cells.Visualization and tracking of viruses without compromising their functionality is crucial in order to understand virus targeting to cells and tissues, and to understand the subsequent subcellular steps leading to virus uncoating and replication. Enteroviruses are important human pathogens causing a vast number of acute infections, and are also suggested to contribute to the development of chronic diseases like type I diabetes. Here, we demonstrate a novel method to target site-specifically the hydrophobic pocket of enteroviruses. A probe, a derivative of Pleconaril, was developed and conjugated to various labels that enabled the visualization of enteroviruses under light and electron microscopes. The probe mildly stabilized the virus particle by increasing the melting temperature by 1-3 degrees, and caused a delay in the uncoating of the virus in the cellular endosomes, but could not however inhibit the receptor binding, cellular entry or infectivity of the virus. The hydrophobic pocket binding moiety of the probe was shown to bind to echovirus 1 particle by STD and tr-NOESY NMR methods. Furthermore, binding to echovirus 1 and Coxsackievirus A9, and to a lesser extent to Coxsackie virus B3 was verified by using a gold nanocluster labeled probe by TEM analysis. Molecular modelling suggested that the probe fits the hydrophobic pockets of EV1 and CVA9, but not of CVB3 as expected, correlating well with the variations in the infectivity and stability of the virus particles. EV1 conjugated to the fluorescent dye labeled probe was efficiently internalized into the cells. The virus-fluorescent probe conjugate accumulated in the cytoplasmic endosomes and caused infection starting from 6 hours onwards. Remarkably, before and during the time of replication, the fluorescent probe was seen to leak from the virus-positive endosomes and thus separate from the capsid proteins that were left in the endosomes. These results suggest that, like the physiological hydrophobic content, the probe may be released upon virus uncoating. Our results collectively thus show that the gold and fluorescently labeled probes may be used to track and visualize the studied enteroviruses during the early phases of infection opening new avenues to follow virus uncoating in cells. Electronic supplementary information (ESI) available: Details of the synthesis of the probes, UV-Vis absorption spectra of the probe (2), PAGE separation and the absorption spectra of the gold labeled probe (3), details of the NMR experiments, determination of the cytotoxicity of the studied molecules, TEM micrographs of the gold labeled probe (3) with enteroviruses, live cell imaging of the fluorescent probe (4) in cells, and additional details of modeling of the hydrophobic pockets. See DOI: 10.1039/c5nr04139b
KRAS G12C Drug Development: Discrimination between Switch II Pocket Configurations Using Hydrogen/Deuterium-Exchange Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Jia; Harrison, Rane A.; Li, Lianbo

KRAS G12C, the most common RAS mutation found in non-small-cell lung cancer, has been the subject of multiple recent covalent small-molecule inhibitor campaigns including efforts directed at the guanine nucleotide pocket and separate work focused on an inducible pocket adjacent to the switch motifs. Multiple conformations of switch II have been observed, suggesting that switch II pocket (SIIP) binders may be capable of engaging a range of KRAS conformations. Here we report the use of hydrogen/deuterium-exchange mass spectrometry (HDX MS) to discriminate between conformations of switch II induced by two chemical classes of SIIP binders. We investigated the structural basismore » for differences in HDX MS using X-ray crystallography and discovered a new SIIP configuration in response to binding of a quinazoline chemotype. These results have implications for structure-guided drug design targeting the RAS SIIP.« less
Unveiling a novel transient druggable pocket in BACE-1 through molecular simulations: Conformational analysis and binding mode of multisite inhibitors

PubMed Central

Di Pietro, Ornella; Laughton, Charles A.

2017-01-01

The critical role of BACE-1 in the formation of neurotoxic ß-amyloid peptides in the brain makes it an attractive target for an efficacious treatment of Alzheimer’s disease. However, the development of clinically useful BACE-1 inhibitors has proven to be extremely challenging. In this study we examine the binding mode of a novel potent inhibitor (compound 1, with IC50 80 nM) designed by synergistic combination of two fragments—huprine and rhein—that individually are endowed with very low activity against BACE-1. Examination of crystal structures reveals no appropriate binding site large enough to accommodate 1. Therefore we have examined the conformational flexibility of BACE-1 through extended molecular dynamics simulations, paying attention to the highly flexible region shaped by loops 8–14, 154–169 and 307–318. The analysis of the protein dynamics, together with studies of pocket druggability, has allowed us to detect the transient formation of a secondary binding site, which contains Arg307 as a key residue for the interaction with small molecules, at the edge of the catalytic cleft. The formation of this druggable “floppy” pocket would enable the binding of multisite inhibitors targeting both catalytic and secondary sites. Molecular dynamics simulations of BACE-1 bound to huprine-rhein hybrid compounds support the feasibility of this hypothesis. The results provide a basis to explain the high inhibitory potency of the two enantiomeric forms of 1, together with the large dependence on the length of the oligomethylenic linker. Furthermore, the multisite hypothesis has allowed us to rationalize the inhibitory potency of a series of tacrine-chromene hybrid compounds, specifically regarding the apparent lack of sensitivity of the inhibition constant to the chemical modifications introduced in the chromene unit. Overall, these findings pave the way for the exploration of novel functionalities in the design of optimized BACE-1 multisite inhibitors. PMID:28505196
POVME 2.0: An Enhanced Tool for Determining Pocket Shape and Volume Characteristics

PubMed Central

2015-01-01

Analysis of macromolecular/small-molecule binding pockets can provide important insights into molecular recognition and receptor dynamics. Since its release in 2011, the POVME (POcket Volume MEasurer) algorithm has been widely adopted as a simple-to-use tool for measuring and characterizing pocket volumes and shapes. We here present POVME 2.0, which is an order of magnitude faster, has improved accuracy, includes a graphical user interface, and can produce volumetric density maps for improved pocket analysis. To demonstrate the utility of the algorithm, we use it to analyze the binding pocket of RNA editing ligase 1 from the unicellular parasite Trypanosoma brucei, the etiological agent of African sleeping sickness. The POVME analysis characterizes the full dynamics of a potentially druggable transient binding pocket and so may guide future antitrypanosomal drug-discovery efforts. We are hopeful that this new version will be a useful tool for the computational- and medicinal-chemist community. PMID:25400521
Rational Design of a Transferrin-Binding Peptide Sequence Tailored to Targeted Nanoparticle Internalization.

PubMed

Santi, Melissa; Maccari, Giuseppe; Mereghetti, Paolo; Voliani, Valerio; Rocchiccioli, Silvia; Ucciferri, Nadia; Luin, Stefano; Signore, Giovanni

2017-02-15

The transferrin receptor (TfR) is a promising target in cancer therapy owing to its overexpression in most solid tumors and on the blood-brain barrier. Nanostructures chemically derivatized with transferrin are employed in TfR targeting but often lose their functionality upon injection in the bloodstream. As an alternative strategy, we rationally designed a peptide coating able to bind transferrin on suitable pockets not involved in binding to TfR or iron by using an iterative multiscale-modeling approach coupled with quantitative structure-activity and relationship (QSAR) analysis and evolutionary algorithms. We tested that selected sequences have low aspecific protein adsorption and high binding energy toward transferrin, and one of them is efficiently internalized in cells with a transferrin-dependent pathway. Furthermore, it promotes transferrin-mediated endocytosis of gold nanoparticles by modifying their protein corona and promoting oriented adsorption of transferrin. This strategy leads to highly effective nanostructures, potentially useful in diagnostic and therapeutic applications, which exploit (and do not suffer) the protein solvation for achieving a better targeting.
Niemann-Pick type C disease: a QM/MM study of conformational changes in cholesterol in the NPC1(NTD) and NPC2 binding pockets.

PubMed

Elghobashi-Meinhardt, Nadia

2014-10-21

Niemann-Pick Type C disease is characterized by disrupted lipid trafficking within the late endosomal (LE)/lysosomal (Lys) cellular compartments. Cholesterol transport within the LE/Lys is believed to take place via a concerted hand-off mechanism in which a small (131aa) soluble cholesterol binding protein, NPC2, transfers cholesterol to the N-terminal domain (NTD) of a larger (1278aa) membrane-bound protein, NPC1(NTD). The transfer is thought to occur through the formation of a stable intermediate complex NPC1(NTD)-NPC2, in which the sterol apertures of the two proteins align to allow passage of the cholesterol molecule. In the working model of the NPC1(NTD)-NPC2 complex, the sterol apertures are aligned, but the binding pockets are bent with respect to one another. In order for cholesterol to slide from one binding pocket to the other, a conformational change must occur in the proteins, in the ligand, or in both. Here, we investigate the possibility that the ligand undergoes a conformational change, or isomerization, to accommodate the bent transfer pathway. To understand what structural factors influence the isomerization rate, we calculate the energy barrier to cholesterol isomerization in both the NPC1(NTD) and NPC2 binding pockets. Here, we use a combined quantum mechanical/molecular mechanical (QM/MM) energy function to calculate the isomerization barrier within the native NPC1(NTD) and NPC2 binding pockets before protein-protein docking as well as in the binding pockets of the NPC1(NTD)-NPC2 complex after docking has occurred. The results indicate that cholesterol isomerization in the NPC2 binding pocket is energetically favorable, both before and after formation of the NPC1(NTD)-NPC2 complex. The NPC1(NTD) binding pocket is energetically unfavorable to conformational rearrangement of the hydrophobic ligand because it contains more water molecules near the ligand tail and amino acids with polar side chains. For three NPC1(NTD) mutants investigated, L175Q/L176Q, L175A/L176A, and E191A/Y192A, the isomerization barriers were all found to be higher than the barrier calculated in the NPC2 binding pocket. Our results indicate that cholesterol isomerization in the NPC2 binding pocket, either before or after docking, may ensure an efficient transfer of cholesterol to NPC1(NTD).
Insights into the Impact of Linker Flexibility and Fragment Ionization on the Design of CK2 Allosteric Inhibitors: Comparative Molecular Dynamics Simulation Studies.

PubMed

Zhou, Yue; Zhang, Na; Qi, Xiaoqian; Tang, Shan; Sun, Guohui; Zhao, Lijiao; Zhong, Rugang; Peng, Yongzhen

2018-01-01

Protein kinase is a novel therapeutic target for human diseases. The off-target and side effects of ATP-competitive inhibitors preclude them from the clinically relevant drugs. The compounds targeting the druggable allosteric sites outside the highly conversed ATP binding pocket have been identified as promising alternatives to overcome current barriers of ATP-competitive inhibitors. By simultaneously interacting with the αD region (new allosteric site) and sub-ATP binding pocket, the attractive compound CAM4066 was named as allosteric inhibitor of CK2α. It has been demonstrated that the rigid linker and non-ionizable substituted fragment resulted in significant decreased inhibitory activities of compounds. The molecular dynamics simulations and energy analysis revealed that the appropriate coupling between the linker and pharmacophore fragments were essential for binding of CAM4066 with CK2α. The lower flexible linker of compound 21 lost the capability of coupling fragments A and B to αD region and positive area, respectively, whereas the methyl benzoate of fragment B induced the re-orientated Pre-CAM4066 with the inappropriate polar interactions. Most importantly, the match between the optimized linker and pharmacophore fragments is the challenging work of fragment-linking based drug design. These results provide rational clues to further structural modification and development of highly potent allosteric inhibitors of CK2.
Insights into the Impact of Linker Flexibility and Fragment Ionization on the Design of CK2 Allosteric Inhibitors: Comparative Molecular Dynamics Simulation Studies

PubMed Central

Zhou, Yue; Zhang, Na; Qi, Xiaoqian; Tang, Shan; Zhao, Lijiao; Zhong, Rugang; Peng, Yongzhen

2018-01-01

Protein kinase is a novel therapeutic target for human diseases. The off-target and side effects of ATP-competitive inhibitors preclude them from the clinically relevant drugs. The compounds targeting the druggable allosteric sites outside the highly conversed ATP binding pocket have been identified as promising alternatives to overcome current barriers of ATP-competitive inhibitors. By simultaneously interacting with the αD region (new allosteric site) and sub-ATP binding pocket, the attractive compound CAM4066 was named as allosteric inhibitor of CK2α. It has been demonstrated that the rigid linker and non-ionizable substituted fragment resulted in significant decreased inhibitory activities of compounds. The molecular dynamics simulations and energy analysis revealed that the appropriate coupling between the linker and pharmacophore fragments were essential for binding of CAM4066 with CK2α. The lower flexible linker of compound 21 lost the capability of coupling fragments A and B to αD region and positive area, respectively, whereas the methyl benzoate of fragment B induced the re-orientated Pre-CAM4066 with the inappropriate polar interactions. Most importantly, the match between the optimized linker and pharmacophore fragments is the challenging work of fragment-linking based drug design. These results provide rational clues to further structural modification and development of highly potent allosteric inhibitors of CK2. PMID:29301250
Residues remote from the binding pocket control the antagonist selectivity towards the corticotropin-releasing factor receptor-1

PubMed Central

Sun, Xianqiang; Cheng, Jianxin; Wang, Xu; Tang, Yun; Ågren, Hans; Tu, Yaoquan

2015-01-01

The corticotropin releasing factors receptor-1 and receptor-2 (CRF1R and CRF2R) are therapeutic targets for treating neurological diseases. Antagonists targeting CRF1R have been developed for the potential treatment of anxiety disorders and alcohol addiction. It has been found that antagonists targeting CRF1R always show high selectivity, although CRF1R and CRF2R share a very high rate of sequence identity. This has inspired us to study the origin of the selectivity of the antagonists. We have therefore built a homology model for CRF2R and carried out unbiased molecular dynamics and well-tempered metadynamics simulations for systems with the antagonist CP-376395 in CRF1R or CRF2R to address this issue. We found that the side chain of Tyr6.63 forms a hydrogen bond with the residue remote from the binding pocket, which allows Tyr6.63 to adopt different conformations in the two receptors and results in the presence or absence of a bottleneck controlling the antagonist binding to or dissociation from the receptors. The rotameric switch of the side chain of Tyr3566.63 allows the breaking down of the bottleneck and is a perquisite for the dissociation of CP-376395 from CRF1R. PMID:25628267
Insights from the docking and molecular dynamics simulation of the Phosphopantetheinyl transferase (PptT) structural model from Mycobacterium tuberculosis.

PubMed

Rohini, Karunakaran; Srikumar, Padmalayam Sadanandan

2013-01-01

A great challenge is posed to the treatment of tuberculosis due to the evolution of multidrug-resistant (MDR) and extensively drugresistant (XDR) strains of Mycobacterium tuberculosis in recent times. The complex cell envelope of the bacterium contains unusual structures of lipids which protects the bacterium from host enzymes and escape immune response. To overcome the drug resistance, targeting "drug targets" which have a critical role in growth and virulence factor is a novel approach for better tuberculosis treatment. The enzyme Phosphopantetheinyl transferase (PptT) is an attractive drug target as it is primarily involved in post translational modification of various types-I polyketide synthases and assembly of mycobactin, which is required for lipid virulence factors. Our in silico studies reported that the structural model of M.tuberculosis PptT characterizes the structure-function activity. The refinement of the model was carried out with molecular dynamics simulations and was analyzed with root mean square deviation (RMSD), and radius of gyration (Rg). This confirmed the structural behavior of PptT in dynamic system. Molecular docking with substrate coenzyme A (CoA) identified the binding pocket and key residues His93, Asp114 and Arg169 involved in PptT-CoA binding. In conclusion, our results show that the M.tuberculosis PptT model and critical CoA binding pocket initiate the inhibitor design of PptT towards tuberculosis treatment.
Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors

PubMed Central

Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

2010-01-01

Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259
Real-time ligand binding pocket database search using local surface descriptors.

PubMed

Chikhi, Rayan; Sael, Lee; Kihara, Daisuke

2010-07-01

Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.
An Augmented Pocketome: Detection and Analysis of Small-Molecule Binding Pockets in Proteins of Known 3D Structure.

PubMed

Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma

2018-03-06

Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.
Fragment-Based Protein-Protein Interaction Antagonists of a Viral Dimeric Protease.

PubMed

Gable, Jonathan E; Lee, Gregory M; Acker, Timothy M; Hulce, Kaitlin R; Gonzalez, Eric R; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J; Craik, Charles S

2016-04-19

Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi's sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose-response determination was performed as a confirmation screen, and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed by NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80 % of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogues. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Discovery of Novel Irreversible Inhibitors of Interleukin (IL)-2-inducible Tyrosine Kinase (Itk) by Targeting Cysteine 442 in the ATP Pocket

PubMed Central

Harling, John D.; Deakin, Angela M.; Campos, Sébastien; Grimley, Rachel; Chaudry, Laiq; Nye, Catherine; Polyakova, Oxana; Bessant, Christina M.; Barton, Nick; Somers, Don; Barrett, John; Graves, Rebecca H.; Hanns, Laura; Kerr, William J.; Solari, Roberto

2013-01-01

IL-2-inducible tyrosine kinase (Itk) plays a key role in antigen receptor signaling in T cells and is considered an important target for anti-inflammatory drug discovery. In order to generate inhibitors with the necessary potency and selectivity, a compound that targeted cysteine 442 in the ATP binding pocket and with an envisaged irreversible mode of action was designed. We incorporated a high degree of molecular recognition and specific design features making the compound suitable for inhaled delivery. This study confirms the irreversible covalent binding of the inhibitor to the kinase by x-ray crystallography and enzymology while demonstrating potency, selectivity, and prolonged duration of action in in vitro biological assays. The biosynthetic turnover of the kinase was also examined as a critical factor when designing irreversible inhibitors for extended duration of action. The exemplified Itk inhibitor demonstrated inhibition of both TH1 and TH2 cytokines, was additive with fluticasone propionate, and inhibited cytokine release from human lung fragments. Finally, we describe an in vivo pharmacodynamic assay that allows rapid preclinical development without animal efficacy models. PMID:23935099
A Role for Fragment-Based Drug Design in Developing Novel Lead Compounds for Central Nervous System Targets.

PubMed

Wasko, Michael J; Pellegrene, Kendy A; Madura, Jeffry D; Surratt, Christopher K

2015-01-01

Hundreds of millions of U.S. dollars are invested in the research and development of a single drug. Lead compound development is an area ripe for new design strategies. Therapeutic lead candidates have been traditionally found using high-throughput in vitro pharmacological screening, a costly method for assaying thousands of compounds. This approach has recently been augmented by virtual screening (VS), which employs computer models of the target protein to narrow the search for possible leads. A variant of VS is fragment-based drug design (FBDD), an emerging in silico lead discovery method that introduces low-molecular weight fragments, rather than intact compounds, into the binding pocket of the receptor model. These fragments serve as starting points for "growing" the lead candidate. Current efforts in virtual FBDD within central nervous system (CNS) targets are reviewed, as is a recent rule-based optimization strategy in which new molecules are generated within a 3D receptor-binding pocket using the fragment as a scaffold. This process not only places special emphasis on creating synthesizable molecules but also exposes computational questions worth addressing. Fragment-based methods provide a viable, relatively low-cost alternative for therapeutic lead discovery and optimization that can be applied to CNS targets to augment current design strategies.
A Role for Fragment-Based Drug Design in Developing Novel Lead Compounds for Central Nervous System Targets

PubMed Central

Wasko, Michael J.; Pellegrene, Kendy A.; Madura, Jeffry D.; Surratt, Christopher K.

2015-01-01

Hundreds of millions of U.S. dollars are invested in the research and development of a single drug. Lead compound development is an area ripe for new design strategies. Therapeutic lead candidates have been traditionally found using high-throughput in vitro pharmacological screening, a costly method for assaying thousands of compounds. This approach has recently been augmented by virtual screening (VS), which employs computer models of the target protein to narrow the search for possible leads. A variant of VS is fragment-based drug design (FBDD), an emerging in silico lead discovery method that introduces low-molecular weight fragments, rather than intact compounds, into the binding pocket of the receptor model. These fragments serve as starting points for “growing” the lead candidate. Current efforts in virtual FBDD within central nervous system (CNS) targets are reviewed, as is a recent rule-based optimization strategy in which new molecules are generated within a 3D receptor-binding pocket using the fragment as a scaffold. This process not only places special emphasis on creating synthesizable molecules but also exposes computational questions worth addressing. Fragment-based methods provide a viable, relatively low-cost alternative for therapeutic lead discovery and optimization that can be applied to CNS targets to augment current design strategies. PMID:26441817
Free enthalpies of replacing water molecules in protein binding pockets.

PubMed

Riniker, Sereina; Barandun, Luzi J; Diederich, François; Krämer, Oliver; Steffen, Andreas; van Gunsteren, Wilfred F

2012-12-01

Water molecules in the binding pocket of a protein and their role in ligand binding have increasingly raised interest in recent years. Displacement of such water molecules by ligand atoms can be either favourable or unfavourable for ligand binding depending on the change in free enthalpy. In this study, we investigate the displacement of water molecules by an apolar probe in the binding pocket of two proteins, cyclin-dependent kinase 2 and tRNA-guanine transglycosylase, using the method of enveloping distribution sampling (EDS) to obtain free enthalpy differences. In both cases, a ligand core is placed inside the respective pocket and the remaining water molecules are converted to apolar probes, both individually and in pairs. The free enthalpy difference between a water molecule and a CH(3) group at the same location in the pocket in comparison to their presence in bulk solution calculated from EDS molecular dynamics simulations corresponds to the binding free enthalpy of CH(3) at this location. From the free enthalpy difference and the enthalpy difference, the entropic contribution of the displacement can be obtained too. The overlay of the resulting occupancy volumes of the water molecules with crystal structures of analogous ligands shows qualitative correlation between experimentally measured inhibition constants and the calculated free enthalpy differences. Thus, such an EDS analysis of the water molecules in the binding pocket may give valuable insight for potency optimization in drug design.

Free enthalpies of replacing water molecules in protein binding pockets

NASA Astrophysics Data System (ADS)

Riniker, Sereina; Barandun, Luzi J.; Diederich, François; Krämer, Oliver; Steffen, Andreas; van Gunsteren, Wilfred F.

2012-12-01

Water molecules in the binding pocket of a protein and their role in ligand binding have increasingly raised interest in recent years. Displacement of such water molecules by ligand atoms can be either favourable or unfavourable for ligand binding depending on the change in free enthalpy. In this study, we investigate the displacement of water molecules by an apolar probe in the binding pocket of two proteins, cyclin-dependent kinase 2 and tRNA-guanine transglycosylase, using the method of enveloping distribution sampling (EDS) to obtain free enthalpy differences. In both cases, a ligand core is placed inside the respective pocket and the remaining water molecules are converted to apolar probes, both individually and in pairs. The free enthalpy difference between a water molecule and a CH3 group at the same location in the pocket in comparison to their presence in bulk solution calculated from EDS molecular dynamics simulations corresponds to the binding free enthalpy of CH3 at this location. From the free enthalpy difference and the enthalpy difference, the entropic contribution of the displacement can be obtained too. The overlay of the resulting occupancy volumes of the water molecules with crystal structures of analogous ligands shows qualitative correlation between experimentally measured inhibition constants and the calculated free enthalpy differences. Thus, such an EDS analysis of the water molecules in the binding pocket may give valuable insight for potency optimization in drug design.
Kuwanon-L as a New Allosteric HIV-1 Integrase Inhibitor: Molecular Modeling and Biological Evaluation.

PubMed

Esposito, Francesca; Tintori, Cristina; Martini, Riccardo; Christ, Frauke; Debyser, Zeger; Ferrarese, Roberto; Cabiddu, Gianluigi; Corona, Angela; Ceresola, Elisa Rita; Calcaterra, Andrea; Iovine, Valentina; Botta, Bruno; Clementi, Massimo; Canducci, Filippo; Botta, Maurizio; Tramontano, Enzo

2015-11-01

HIV-1 integrase (IN) active site inhibitors are the latest class of drugs approved for HIV treatment. The selection of IN strand-transfer drug-resistant HIV strains in patients supports the development of new agents that are active as allosteric IN inhibitors. Here, a docking-based virtual screening has been applied to a small library of natural ligands to identify new allosteric IN inhibitors that target the sucrose binding pocket. From theoretical studies, kuwanon-L emerged as the most promising binder and was thus selected for biological studies. Biochemical studies showed that kuwanon-L is able to inhibit the HIV-1 IN catalytic activity in the absence and in the presence of LEDGF/p75 protein, the IN dimerization, and the IN/LEDGF binding. Kuwanon-L also inhibited HIV-1 replication in cell cultures. Overall, docking and biochemical results suggest that kuwanon-L binds to an allosteric binding pocket and can be considered an attractive lead for the development of new allosteric IN antiviral agents. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.

PubMed

Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

2014-03-04

Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Adhikary, Suraj; Eichman, Brandt F.

DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity,more » although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.« less
Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

NASA Astrophysics Data System (ADS)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

PubMed

Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

2016-02-23

The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.
Targeting Ligandable Pockets on Plant Homeodomain (PHD) Zinc Finger Domains by a Fragment-Based Approach

PubMed Central

2018-01-01

Plant homeodomain (PHD) zinc fingers are histone reader domains that are often associated with human diseases. Despite this, they constitute a poorly targeted class of readers, suggesting low ligandability. Here, we describe a successful fragment-based campaign targeting PHD fingers from the proteins BAZ2A and BAZ2B as model systems. We validated a pool of in silico fragments both biophysically and structurally and solved the first crystal structures of PHD zinc fingers in complex with fragments bound to an anchoring pocket at the histone binding site. The best-validated hits were found to displace a histone H3 tail peptide in competition assays. This work identifies new chemical scaffolds that provide suitable starting points for future ligand optimization using structure-guided approaches. The demonstrated ligandability of the PHD reader domains could pave the way for the development of chemical probes to drug this family of epigenetic readers. PMID:29529862
Targeting Ligandable Pockets on Plant Homeodomain (PHD) Zinc Finger Domains by a Fragment-Based Approach.

PubMed

Amato, Anastasia; Lucas, Xavier; Bortoluzzi, Alessio; Wright, David; Ciulli, Alessio

2018-04-20

Plant homeodomain (PHD) zinc fingers are histone reader domains that are often associated with human diseases. Despite this, they constitute a poorly targeted class of readers, suggesting low ligandability. Here, we describe a successful fragment-based campaign targeting PHD fingers from the proteins BAZ2A and BAZ2B as model systems. We validated a pool of in silico fragments both biophysically and structurally and solved the first crystal structures of PHD zinc fingers in complex with fragments bound to an anchoring pocket at the histone binding site. The best-validated hits were found to displace a histone H3 tail peptide in competition assays. This work identifies new chemical scaffolds that provide suitable starting points for future ligand optimization using structure-guided approaches. The demonstrated ligandability of the PHD reader domains could pave the way for the development of chemical probes to drug this family of epigenetic readers.
FadA5 a thiolase from Mycobacterium tuberculosis - a unique steroid-binding pocket reveals the potential for drug development against tuberculosis

PubMed Central

Schaefer, Christin M.; Lu, Rui; Nesbitt, Natasha M.; Schiebel, Johannes; Sampson, Nicole S.; Kisker, Caroline

2014-01-01

Summary With the exception of HIV, tuberculosis (TB) is the leading cause of mortality among infectious diseases. The urgent need to develop new anti-tubercular drugs is apparent due to the increasing number of drug resistant Mycobacterium tuberculosis (Mtb) strains. Proteins involved in cholesterol import and metabolism have recently been discovered as potent targets against TB. FadA5, a thiolase from Mtb, is catalyzing the last step of the β-oxidation reaction of the cholesterol side-chain degradation under release of critical metabolites and was shown to be of importance during the chronic stage of TB infections. To gain structural and mechanistic insight on FadA5 we characterized the enzyme in different stages of the cleavage reaction and with a steroid bound to the binding pocket. Structural comparisons to human thiolases revealed that it should be possible to target FadA5 specifically and the steroid-bound structure provides a solid basis for the development of inhibitors against FadA5. PMID:25482540
Visualisation of variable binding pockets on protein surfaces by probabilistic analysis of related structure sets.

PubMed

Ashford, Paul; Moss, David S; Alex, Alexander; Yeap, Siew K; Povia, Alice; Nobeli, Irene; Williams, Mark A

2012-03-14

Protein structures provide a valuable resource for rational drug design. For a protein with no known ligand, computational tools can predict surface pockets that are of suitable size and shape to accommodate a complementary small-molecule drug. However, pocket prediction against single static structures may miss features of pockets that arise from proteins' dynamic behaviour. In particular, ligand-binding conformations can be observed as transiently populated states of the apo protein, so it is possible to gain insight into ligand-bound forms by considering conformational variation in apo proteins. This variation can be explored by considering sets of related structures: computationally generated conformers, solution NMR ensembles, multiple crystal structures, homologues or homology models. It is non-trivial to compare pockets, either from different programs or across sets of structures. For a single structure, difficulties arise in defining particular pocket's boundaries. For a set of conformationally distinct structures the challenge is how to make reasonable comparisons between them given that a perfect structural alignment is not possible. We have developed a computational method, Provar, that provides a consistent representation of predicted binding pockets across sets of related protein structures. The outputs are probabilities that each atom or residue of the protein borders a predicted pocket. These probabilities can be readily visualised on a protein using existing molecular graphics software. We show how Provar simplifies comparison of the outputs of different pocket prediction algorithms, of pockets across multiple simulated conformations and between homologous structures. We demonstrate the benefits of use of multiple structures for protein-ligand and protein-protein interface analysis on a set of complexes and consider three case studies in detail: i) analysis of a kinase superfamily highlights the conserved occurrence of surface pockets at the active and regulatory sites; ii) a simulated ensemble of unliganded Bcl2 structures reveals extensions of a known ligand-binding pocket not apparent in the apo crystal structure; iii) visualisations of interleukin-2 and its homologues highlight conserved pockets at the known receptor interfaces and regions whose conformation is known to change on inhibitor binding. Through post-processing of the output of a variety of pocket prediction software, Provar provides a flexible approach to the analysis and visualization of the persistence or variability of pockets in sets of related protein structures.
Analysis and prediction of calcium-binding pockets from apo-protein structures exhibiting calcium-induced localized conformational changes

PubMed Central

Wang, Xue; Zhao, Kun; Kirberger, Michael; Wong, Hing; Chen, Guantao; Yang, Jenny J

2010-01-01

Calcium binding in proteins exhibits a wide range of polygonal geometries that relate directly to an equally diverse set of biological functions. The binding process stabilizes protein structures and typically results in local conformational change and/or global restructuring of the backbone. Previously, we established the MUG program, which utilized multiple geometries in the Ca2+-binding pockets of holoproteins to identify such pockets, ignoring possible Ca2+-induced conformational change. In this article, we first report our progress in the analysis of Ca2+-induced conformational changes followed by improved prediction of Ca2+-binding sites in the large group of Ca2+-binding proteins that exhibit only localized conformational changes. The MUGSR algorithm was devised to incorporate side chain torsional rotation as a predictor. The output from MUGSR presents groups of residues where each group, typically containing two to five residues, is a potential binding pocket. MUGSR was applied to both X-ray apo structures and NMR holo structures, which did not use calcium distance constraints in structure calculations. Predicted pockets were validated by comparison with homologous holo structures. Defining a “correct hit” as a group of residues containing at least two true ligand residues, the sensitivity was at least 90%; whereas for a “correct hit” defined as a group of residues containing at least three true ligand residues, the sensitivity was at least 78%. These data suggest that Ca2+-binding pockets are at least partially prepositioned to chelate the ion in the apo form of the protein. PMID:20512971
Binding ligand prediction for proteins using partial matching of local surface patches.

PubMed

Sael, Lee; Kihara, Daisuke

2010-01-01

Functional elucidation of uncharacterized protein structures is an important task in bioinformatics. We report our new approach for structure-based function prediction which captures local surface features of ligand binding pockets. Function of proteins, specifically, binding ligands of proteins, can be predicted by finding similar local surface regions of known proteins. To enable partial comparison of binding sites in proteins, a weighted bipartite matching algorithm is used to match pairs of surface patches. The surface patches are encoded with the 3D Zernike descriptors. Unlike the existing methods which compare global characteristics of the protein fold or the global pocket shape, the local surface patch method can find functional similarity between non-homologous proteins and binding pockets for flexible ligand molecules. The proposed method improves prediction results over global pocket shape-based method which was previously developed by our group.
Binding Ligand Prediction for Proteins Using Partial Matching of Local Surface Patches

PubMed Central

Sael, Lee; Kihara, Daisuke

2010-01-01

Functional elucidation of uncharacterized protein structures is an important task in bioinformatics. We report our new approach for structure-based function prediction which captures local surface features of ligand binding pockets. Function of proteins, specifically, binding ligands of proteins, can be predicted by finding similar local surface regions of known proteins. To enable partial comparison of binding sites in proteins, a weighted bipartite matching algorithm is used to match pairs of surface patches. The surface patches are encoded with the 3D Zernike descriptors. Unlike the existing methods which compare global characteristics of the protein fold or the global pocket shape, the local surface patch method can find functional similarity between non-homologous proteins and binding pockets for flexible ligand molecules. The proposed method improves prediction results over global pocket shape-based method which was previously developed by our group. PMID:21614188
MSPocket: an orientation-independent algorithm for the detection of ligand binding pockets.

PubMed

Zhu, Hongbo; Pisabarro, M Teresa

2011-02-01

Identification of ligand binding pockets on proteins is crucial for the characterization of protein functions. It provides valuable information for protein-ligand docking and rational engineering of small molecules that regulate protein functions. A major number of current prediction algorithms of ligand binding pockets are based on cubic grid representation of proteins and, thus, the results are often protein orientation dependent. We present the MSPocket program for detecting pockets on the solvent excluded surface of proteins. The core algorithm of the MSPocket approach does not use any cubic grid system to represent proteins and is therefore independent of protein orientations. We demonstrate that MSPocket is able to achieve an accuracy of 75% in predicting ligand binding pockets on a test dataset used for evaluating several existing methods. The accuracy is 92% if the top three predictions are considered. Comparison to one of the recently published best performing methods shows that MSPocket reaches similar performance with the additional feature of being protein orientation independent. Interestingly, some of the predictions are different, meaning that the two methods can be considered complementary and combined to achieve better prediction accuracy. MSPocket also provides a graphical user interface for interactive investigation of the predicted ligand binding pockets. In addition, we show that overlap criterion is a better strategy for the evaluation of predicted ligand binding pockets than the single point distance criterion. The MSPocket source code can be downloaded from http://appserver.biotec.tu-dresden.de/MSPocket/. MSPocket is also available as a PyMOL plugin with a graphical user interface.
Exploration of the effect of sequence variations located inside the binding pocket of HIV-1 and HIV-2 proteases.

PubMed

Triki, Dhoha; Billot, Telli; Visseaux, Benoit; Descamps, Diane; Flatters, Delphine; Camproux, Anne-Claude; Regad, Leslie

2018-04-10

HIV-2 protease (PR2) is naturally resistant to most FDA (Food and Drug Administration)-approved HIV-1 protease inhibitors (PIs), a major antiretroviral class. In this study, we compared the PR1 and PR2 binding pockets extracted from structures complexed with 12 ligands. The comparison of PR1 and PR2 pocket properties showed that bound PR2 pockets were more hydrophobic with more oxygen atoms and fewer nitrogen atoms than PR1 pockets. The structural comparison of PR1 and PR2 pockets highlighted structural changes induced by their sequence variations and that were consistent with these property changes. Specifically, substitutions at residues 31, 46, and 82 induced structural changes in their main-chain atoms that could affect PI binding in PR2. In addition, the modelling of PR1 mutant structures containing V32I and L76M substitutions revealed a cooperative mechanism leading to structural deformation of flap-residue 45 that could modify PR2 flexibility. Our results suggest that substitutions in the PR1 and PR2 pockets can modify PI binding and flap flexibility, which could underlie PR2 resistance against PIs. These results provide new insights concerning the structural changes induced by PR1 and PR2 pocket variation changes, improving the understanding of the atomic mechanism of PR2 resistance to PIs.
Druggable protein interaction sites are more predisposed to surface pocket formation than the rest of the protein surface.

PubMed

Johnson, David K; Karanicolas, John

2013-01-01

Despite intense interest and considerable effort via high-throughput screening, there are few examples of small molecules that directly inhibit protein-protein interactions. This suggests that many protein interaction surfaces may not be intrinsically "druggable" by small molecules, and elevates in importance the few successful examples as model systems for improving our fundamental understanding of druggability. Here we describe an approach for exploring protein fluctuations enriched in conformations containing surface pockets suitable for small molecule binding. Starting from a set of seven unbound protein structures, we find that the presence of low-energy pocket-containing conformations is indeed a signature of druggable protein interaction sites and that analogous surface pockets are not formed elsewhere on the protein. We further find that ensembles of conformations generated with this biased approach structurally resemble known inhibitor-bound structures more closely than equivalent ensembles of unbiased conformations. Collectively these results suggest that "druggability" is a property encoded on a protein surface through its propensity to form pockets, and inspire a model in which the crude features of the predisposed pocket(s) restrict the range of complementary ligands; additional smaller conformational changes then respond to details of a particular ligand. We anticipate that the insights described here will prove useful in selecting protein targets for therapeutic intervention.
Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.
A novel structure-based multimode QSAR method affords predictive models for phosphodiesterase inhibitors.

PubMed

Dong, Xialan; Ebalunode, Jerry O; Cho, Sung Jin; Zheng, Weifan

2010-02-22

Quantitative structure-activity relationship (QSAR) methods aim to build quantitatively predictive models for the discovery of new molecules. It has been widely used in medicinal chemistry for drug discovery. Many QSAR techniques have been developed since Hansch's seminal work, and more are still being developed. Motivated by Hopfinger's receptor-dependent QSAR (RD-QSAR) formalism and the Lukacova-Balaz scheme to treat multimode issues, we have initiated studies that focus on a structure-based multimode QSAR (SBMM QSAR) method, where the structure of the target protein is used in characterizing the ligand, and the multimode issue of ligand binding is systematically treated with a modified Lukacova-Balaz scheme. All ligand molecules are first docked to the target binding pocket to obtain a set of aligned ligand poses. A structure-based pharmacophore concept is adopted to characterize the binding pocket. Specifically, we represent the binding pocket as a geometric grid labeled by pharmacophoric features. Each pose of the ligand is also represented as a labeled grid, where each grid point is labeled according to the atom types of nearby ligand atoms. These labeled grids or three-dimensional (3D) maps (both the receptor map (R-map) and the ligand map (L-map)) are compared to each other to derive descriptors for each pose of the ligand, resulting in a multimode structure-activity relationship (SAR) table. Iterative partial least-squares (PLS) is employed to build the QSAR models. When we applied this method to analyze PDE-4 inhibitors, predictive models have been developed, obtaining models with excellent training correlation (r(2) = 0.65-0.66), as well as test correlation (R(2) = 0.64-0.65). A comparative analysis with 4 other QSAR techniques demonstrates that this new method affords better models, in terms of the prediction power for the test set.
An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

NASA Astrophysics Data System (ADS)

Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

2017-01-01

The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.
The Retinoid X Receptors and Their Ligands

PubMed Central

Dawson, Marcia I.; Xia, Zebin

2014-01-01

This chapter presents an overview of the current status of studies on the structural and molecular biology of the retinoid X receptor subtypes α, β, and γ (RXRs, NR2B1–3), their nuclear and cytoplasmic functions, post-transcriptional processing, and recently reported ligands. Points of interest are the different changes in the ligand-binding pocket induced by variously shaped agonists, the communication of the ligand–bound pocket with the coactivator binding surface and the heterodimerization interface, and recently identified ligands that are natural products, those that function as environmental toxins or drugs that had been originally designed to interact with other targets, as well as those that were deliberately designed as RXR-selective transcriptional agonists, synergists, or antagonists. Of these synthetic ligands, the general trend in design appears to be away from fully aromatic rigid structures to those containing partial elements of the flexible tetraene side chain of 9-cis-retinoic acid. PMID:22020178

Effect of the Flexible Regions of the Oncoprotein Mouse Double Minute X on Inhibitor Binding Affinity.

PubMed

Qin, Lingyun; Liu, Huili; Chen, Rong; Zhou, Jingjing; Cheng, Xiyao; Chen, Yao; Huang, Yongqi; Su, Zhengding

2017-11-07

The oncoprotein MdmX (mouse double minute X) is highly homologous to Mdm2 (mouse double minute 2) in terms of their amino acid sequences and three-dimensional conformations, but Mdm2 inhibitors exhibit very weak affinity for MdmX, providing an excellent model for exploring how protein conformation distinguishes and alters inhibitor binding. The intrinsic conformation flexibility of proteins plays pivotal roles in determining and predicting the binding properties and the design of inhibitors. Although the molecular dynamics simulation approach enables us to understand protein-ligand interactions, the mechanism underlying how a flexible binding pocket adapts an inhibitor has been less explored experimentally. In this work, we have investigated how the intrinsic flexible regions of the N-terminal domain of MdmX (N-MdmX) affect the affinity of the Mdm2 inhibitor nutlin-3a using protein engineering. Guided by heteronuclear nuclear Overhauser effect measurements, we identified the flexible regions that affect inhibitor binding affinity around the ligand-binding pocket on N-MdmX. A disulfide engineering mutant, N-MdmX C25-C110/C76-C88 , which incorporated two staples to rigidify the ligand-binding pocket, allowed an affinity for nutlin-3a higher than that of wild-type N-MdmX (K d ∼ 0.48 vs K d ∼ 20.3 μM). Therefore, this mutant provides not only an effective protein model for screening and designing of MdmX inhibitors but also a valuable clue for enhancing the intermolecular interactions of the pharmacophores of a ligand with pronounced flexible regions. In addition, our results revealed an allosteric ligand-binding mechanism of N-MdmX in which the ligand initially interacts with a compact core, followed by augmenting intermolecular interactions with intrinsic flexible regions. This strategy should also be applicable to many other protein targets to accelerate drug discovery.
Potent D-peptide inhibitors of HIV-1 entry

PubMed Central

Welch, Brett D.; VanDemark, Andrew P.; Heroux, Annie; Hill, Christopher P.; Kay, Michael S.

2007-01-01

During HIV-1 entry, the highly conserved gp41 N-trimer pocket region becomes transiently exposed and vulnerable to inhibition. Using mirror-image phage display and structure-assisted design, we have discovered protease-resistant D-amino acid peptides (D-peptides) that bind the N-trimer pocket with high affinity and potently inhibit viral entry. We also report high-resolution crystal structures of two of these D-peptides in complex with a pocket mimic that suggest sources of their high potency. A trimeric version of one of these peptides is the most potent pocket-specific entry inhibitor yet reported by three orders of magnitude (IC50 = 250 pM). These results are the first demonstration that D-peptides can form specific and high-affinity interactions with natural protein targets and strengthen their promise as therapeutic agents. The D-peptides described here address limitations associated with current L-peptide entry inhibitors and are promising leads for the prevention and treatment of HIV/AIDS. PMID:17942675
Structure-Based Design of N-Substituted 1-Hydroxy-4-sulfamoyl-2-naphthoates as Selective Inhibitors of the Mcl-1 Oncoprotein

PubMed Central

Lanning, Maryanna E.; Yu, Wenbo; Yap, Jeremy L.; Chauhan, Jay; Chen, Lijia; Whiting, Ellis; Pidugu, Lakshmi S.; Atkinson, Tyler; Bailey, Hala; Li, Willy; Roth, Braden M.; Hynicka, Lauren; Chesko, Kirsty; Toth, Eric A.; Shapiro, Paul; MacKerell, Alexander D.; Wilder, Paul T.; Fletcher, Steven

2016-01-01

Structure-based drug design was utilized to develop novel, 1-hydroxy-2-naphthoate-based small-molecule inhibitors of Mcl-1. Ligand design was driven by exploiting a salt bridge with R263 and interactions with the p2 and p3 pockets of the protein. Significantly, target molecules were accessed in just two synthetic steps, suggesting further optimization will require minimal synthetic effort. Molecular modeling using the Site-Identification by Ligand Competitive Saturation (SILCS) approach was used to qualitatively direct ligand design as well as develop quantitative models for inhibitor binding affinity to Mcl-1 and the Bcl-2 relative Bcl-xL as well as for the specificity of binding to the two proteins. Results indicated hydrophobic interactions with the p2 pockets dominate the affinity of the most favourable binding ligand (3bl: Ki = 31 nM). Compounds were up to 20-fold selective for Mcl-1 over Bcl-xL. Selectivity of the inhibitors was driven by interactions with the deeper p2 pocket in Mcl-1 versus Bcl-xL. The SILCS-based SAR of the present compounds represents the foundation for the development of Mcl-1 specific inhibitors with the potential to treat a wide range of solid tumours and hematological cancers, including acute myeloid leukaemia. PMID:26985630
Ligand-binding pocket shape differences between S1P1 and S1P3 determine efficiency of chemical probe identification by uHTS

PubMed Central

Schürer, Stephan C.; Brown, Steven J.; Cabrera, Pedro Gonzales; Schaeffer, Marie-Therese; Chapman, Jacqueline; Jo, Euijung; Chase, Peter; Spicer, Tim; Hodder, Peter; Rosen, Hugh

2008-01-01

We have studied the Sphingosine 1-phosphate (S1P) receptor system to better understand why certain molecular targets within a closely related family are much more tractable when identifying compelling chemical leads. Five medically important G protein-coupled receptors for S1P regulate heart rate, coronary artery caliber, endothelial barrier integrity, and lymphocyte trafficking. Selective S1P receptor agonist probes would be of great utility to study receptor subtype-specific function. Through systematic screening of the same libraries, we identified novel selective agonists chemotypes for each of the S1P1 and S1P3 receptors. uHTS for S1P1 was more effective than for S1P3, with many selective, low nanomolar hits of proven mechanism emerging for. Receptor structure modeling and ligand docking reveal differences between the receptor binding pockets, which are the basis for sub-type selectivity. Novel selective agonists interact primarily in the hydrophobic pocket of the receptor in the absence of head-group interactions. Chemistry-space and shape-based analysis of the screening libraries in combination with the binding models explain the observed differential hit rates and enhanced efficiency for lead discovery for S1P1 vs. S1P3 in this closely related receptor family. PMID:18590333
Selectivity by Small-Molecule Inhibitors of Protein Interactions Can Be Driven by Protein Surface Fluctuations

PubMed Central

Johnson, David K.; Karanicolas, John

2015-01-01

Small-molecules that inhibit interactions between specific pairs of proteins have long represented a promising avenue for therapeutic intervention in a variety of settings. Structural studies have shown that in many cases, the inhibitor-bound protein adopts a conformation that is distinct from its unbound and its protein-bound conformations. This plasticity of the protein surface presents a major challenge in predicting which members of a protein family will be inhibited by a given ligand. Here, we use biased simulations of Bcl-2-family proteins to generate ensembles of low-energy conformations that contain surface pockets suitable for small molecule binding. We find that the resulting conformational ensembles include surface pockets that mimic those observed in inhibitor-bound crystal structures. Next, we find that the ensembles generated using different members of this protein family are overlapping but distinct, and that the activity of a given compound against a particular family member (ligand selectivity) can be predicted from whether the corresponding ensemble samples a complementary surface pocket. Finally, we find that each ensemble includes certain surface pockets that are not shared by any other family member: while no inhibitors have yet been identified to take advantage of these pockets, we expect that chemical scaffolds complementing these “distinct” pockets will prove highly selective for their targets. The opportunity to achieve target selectivity within a protein family by exploiting differences in surface fluctuations represents a new paradigm that may facilitate design of family-selective small-molecule inhibitors of protein-protein interactions. PMID:25706586
Enzyme specificity under dynamic control

NASA Astrophysics Data System (ADS)

Ota, Nobuyuki; Agard, David A.

2002-03-01

The contributions of conformational dynamics to substrate specificity have been examined by the application of principal component analysis to molecular dynamics trajectories of alpha-lytic protease. The wild-type alpha-lytic protease is highly specific for substrates with small hydrophobic side chains at the specificity pocket, while the Met190Ala binding pocket mutant has a much broader specificity, actively hydrolyzing substrates ranging from Ala to Phe. We performed a principal component analysis using 1-nanosecond molecular dynamics simulations using solvent boundary condition. We found that the walls of the wild-type substrate binding pocket move in tandem with one another, causing the pocket size to remain fixed so that only small substrates are recognized. In contrast, the M190A mutant shows uncoupled movement of the binding pocket walls, allowing the pocket to sample both smaller and larger sizes, which appears to be the cause of the observed broad specificity. The results suggest that the protein dynamics of alpha-lytic protease may play a significant role in defining the patterns of substrate specificity.
The nuclear receptor PPARγ individually responds to serotonin- and fatty acid-metabolites

PubMed Central

Waku, Tsuyoshi; Shiraki, Takuma; Oyama, Takuji; Maebara, Kanako; Nakamori, Rinna; Morikawa, Kosuke

2010-01-01

The nuclear receptor, peroxisome proliferator-activated receptor γ (PPARγ), recognizes various synthetic and endogenous ligands by the ligand-binding domain. Fatty-acid metabolites reportedly activate PPARγ through conformational changes of the Ω loop. Here, we report that serotonin metabolites act as endogenous agonists for PPARγ to regulate macrophage function and adipogenesis by directly binding to helix H12. A cyclooxygenase inhibitor, indomethacin, is a mimetic agonist of these metabolites. Crystallographic analyses revealed that an indole acetate functions as a common moiety for the recognition by the sub-pocket near helix H12. Intriguingly, a serotonin metabolite and a fatty-acid metabolite each bind to distinct sub-pockets, and the PPARγ antagonist, T0070907, blocked the fatty-acid agonism, but not that of the serotonin metabolites. Mutational analyses on receptor-mediated transcription and coactivator binding revealed that each metabolite individually uses coregulator and/or heterodimer interfaces in a ligand-type-specific manner. Furthermore, the inhibition of the serotonin metabolism reduced the expression of the endogenous PPARγ-target gene. Collectively, these results suggest a novel agonism, in which PPARγ functions as a multiple sensor in response to distinct metabolites. PMID:20717101
A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhagavat, Raghu; Kim, Heung -Bok; Kim, Chang -Yub

Nucleoside tri-phosphates (NTP) form an important class of small molecule ligands that participate in, and are essential to a large number of biological processes. Here, we seek to identify the NTP binding proteome (NTPome) in M. tuberculosis (M.tb), a deadly pathogen. Identifying the NTPome is useful not only for gaining functional insights of the individual proteins but also for identifying useful drug targets. From an earlier study, we had structural models of M.tb at a proteome scale from which a set of 13,858 small molecule binding pockets were identified. We use a set of NTP binding sub-structural motifs derived frommore » a previous study and scan the M.tb pocketome, and find that 1,768 proteins or 43% of the proteome can theoretically bind NTP ligands. Using an experimental proteomics approach involving dye-ligand affinity chromatography, we confirm NTP binding to 47 different proteins, of which 4 are hypothetical proteins. Our analysis also provides the precise list of binding site residues in each case, and the probable ligand binding pose. In conclusion, as the list includes a number of known and potential drug targets, the identification of NTP binding can directly facilitate structure-based drug design of these targets.« less
A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis

DOE PAGES

Bhagavat, Raghu; Kim, Heung -Bok; Kim, Chang -Yub; ...

2017-10-02

Nucleoside tri-phosphates (NTP) form an important class of small molecule ligands that participate in, and are essential to a large number of biological processes. Here, we seek to identify the NTP binding proteome (NTPome) in M. tuberculosis (M.tb), a deadly pathogen. Identifying the NTPome is useful not only for gaining functional insights of the individual proteins but also for identifying useful drug targets. From an earlier study, we had structural models of M.tb at a proteome scale from which a set of 13,858 small molecule binding pockets were identified. We use a set of NTP binding sub-structural motifs derived frommore » a previous study and scan the M.tb pocketome, and find that 1,768 proteins or 43% of the proteome can theoretically bind NTP ligands. Using an experimental proteomics approach involving dye-ligand affinity chromatography, we confirm NTP binding to 47 different proteins, of which 4 are hypothetical proteins. Our analysis also provides the precise list of binding site residues in each case, and the probable ligand binding pose. In conclusion, as the list includes a number of known and potential drug targets, the identification of NTP binding can directly facilitate structure-based drug design of these targets.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)

Fox, Jerome M.; Kang, Kyungtae; Sastry, Madhavi

In this study we use mutants of human carbonic anhydrase (HCAII) to examine how changes in the organization of water within a binding pocket can alter the thermodynamics of protein–ligand association. Results from calorimetric, crystallographic, and theoretical analyses suggest that most mutations strengthen networks of water-mediated hydrogen bonds and reduce binding affinity by increasing the enthalpic cost and, to a lesser extent, the entropic benefit of rearranging those networks during binding. The organization of water within a binding pocket can thus determine whether the hydrophobic interactions in which it engages are enthalpy-driven or entropy-driven. Our findings highlight a possible asymmetrymore » in protein–ligand association by suggesting that, within the confines of the binding pocket of HCAII, binding events associated with enthalpically favorable rearrangements of water are stronger than those associated with entropically favorable ones.« less
An SH2 domain model of STAT5 in complex with phospho-peptides define ``STAT5 Binding Signatures''

NASA Astrophysics Data System (ADS)

Gianti, Eleonora; Zauhar, Randy J.

2015-05-01

The signal transducer and activator of transcription 5 (STAT5) is a member of the STAT family of proteins, implicated in cell growth and differentiation. STAT activation is regulated by phosphorylation of protein monomers at conserved tyrosine residues, followed by binding to phospho-peptide pockets and subsequent dimerization. STAT5 is implicated in the development of severe pathological conditions, including many cancer forms. However, nowadays a few STAT5 inhibitors are known, and only one crystal structure of the inactive STAT5 dimer is publicly available. With a view to enabling structure-based drug design, we have: (1) analyzed phospho-peptide binding pockets on SH2 domains of STAT5, STAT1 and STAT3; (2) generated a model of STAT5 bound to phospho-peptides; (3) assessed our model by docking against a class of known STAT5 inhibitors (Müller et al. in ChemBioChem 9:723-727, 2008); (4) used molecular dynamics simulations to optimize the molecular determinants responsible for binding and (5) proposed unique "Binding Signatures" of STAT5. Our results put in place the foundations to address STAT5 as a target for rational drug design, from sequence, structural and functional perspectives.
On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

PubMed

Speranskiy, Kirill; Kurnikova, Maria

2005-08-30

Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.
The Second Transmembrane Domain of the Human Type 1 Angiotensin II Receptor Participates in the Formation of the Ligand Binding Pocket and Undergoes Integral Pivoting Movement during the Process of Receptor Activation*

PubMed Central

Domazet, Ivana; Holleran, Brian J.; Martin, Stéphane S.; Lavigne, Pierre; Leduc, Richard; Escher, Emanuel; Guillemette, Gaétan

2009-01-01

The octapeptide hormone angiotensin II (AngII) exerts a wide variety of cardiovascular effects through the activation of the angiotensin II type-1 (AT1) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein-coupled receptors, the AT1 receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. In order to identify those residues in the second transmembrane domain (TMD2) that contribute to the formation of the binding pocket of the AT1 receptor, we used the substituted cysteine accessibility method. All of the residues within the Leu-70 to Trp-94 region were mutated one at a time to a cysteine, and, after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of D74C-AT1, L81C-AT1, A85C-AT1, T88C-AT1, and A89C-AT1 mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT1 receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD2 reporter cysteines engineered in a constitutively active N111G-AT1 receptor background. Indeed, mutant D74C-N111G-AT1 became insensitive to MTSEA, whereas mutant L81C-N111G-AT1 lost some sensitivity and mutant V86C-N111G-AT1 became sensitive to MTSEA. Our results suggest that constitutive activation of the AT1 receptor causes TMD2 to pivot, bringing the top of TMD2 closer to the binding pocket and pushing the bottom of TMD2 away from the binding pocket. PMID:19276075
The second transmembrane domain of the human type 1 angiotensin II receptor participates in the formation of the ligand binding pocket and undergoes integral pivoting movement during the process of receptor activation.

PubMed

Domazet, Ivana; Holleran, Brian J; Martin, Stéphane S; Lavigne, Pierre; Leduc, Richard; Escher, Emanuel; Guillemette, Gaétan

2009-05-01

The octapeptide hormone angiotensin II (AngII) exerts a wide variety of cardiovascular effects through the activation of the angiotensin II type-1 (AT(1)) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein-coupled receptors, the AT(1) receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. In order to identify those residues in the second transmembrane domain (TMD2) that contribute to the formation of the binding pocket of the AT(1) receptor, we used the substituted cysteine accessibility method. All of the residues within the Leu-70 to Trp-94 region were mutated one at a time to a cysteine, and, after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of D74C-AT(1), L81C-AT(1), A85C-AT(1), T88C-AT(1), and A89C-AT(1) mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT(1) receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD2 reporter cysteines engineered in a constitutively active N111G-AT(1) receptor background. Indeed, mutant D74C-N111G-AT(1) became insensitive to MTSEA, whereas mutant L81C-N111G-AT(1) lost some sensitivity and mutant V86C-N111G-AT(1) became sensitive to MTSEA. Our results suggest that constitutive activation of the AT(1) receptor causes TMD2 to pivot, bringing the top of TMD2 closer to the binding pocket and pushing the bottom of TMD2 away from the binding pocket.
Structural integration in hypoxia-inducible factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Dalei; Potluri, Nalini; Lu, Jingping

The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less
Structural basis for subtype-specific inhibition of the P2X7 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karasawa, Akira; Kawate, Toshimitsu

The P2X7 receptor is a non-selective cation channel activated by extracellular adenosine triphosphate (ATP). Chronic activation of P2X7 underlies many health problems such as pathologic pain, yet we lack effective antagonists due to poorly understood mechanisms of inhibition. Here we present crystal structures of a mammalian P2X7 receptor complexed with five structurally-unrelated antagonists. Unexpectedly, these drugs all bind to an allosteric site distinct from the ATP-binding pocket in a groove formed between two neighboring subunits. This novel drug-binding pocket accommodates a diversity of small molecules mainly through hydrophobic interactions. Functional assays propose that these compounds allosterically prevent narrowing of themore » drug-binding pocket and the turret-like architecture during channel opening, which is consistent with a site of action distal to the ATP-binding pocket. These novel mechanistic insights will facilitate the development of P2X7-specific drugs for treating human diseases.« less
Characterization of the Raf kinase inhibitory protein (RKIP) binding pocket: NMR-based screening identifies small-molecule ligands.

PubMed

Shemon, Anne N; Heil, Gary L; Granovsky, Alexey E; Clark, Mathew M; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R; Koide, Shohei

2010-05-05

Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential.
Modeling of Arylamide Helix Mimetics in the p53 Peptide Binding Site of hDM2 Suggests Parallel and Anti-Parallel Conformations Are Both Stable

PubMed Central

Fuller, Jonathan C.; Jackson, Richard M.; Edwards, Thomas A.; Wilson, Andrew J.; Shirts, Michael R.

2012-01-01

The design of novel α-helix mimetic inhibitors of protein-protein interactions is of interest to pharmaceuticals and chemical genetics researchers as these inhibitors provide a chemical scaffold presenting side chains in the same geometry as an α-helix. This conformational arrangement allows the design of high affinity inhibitors mimicking known peptide sequences binding specific protein substrates. We show that GAFF and AutoDock potentials do not properly capture the conformational preferences of α-helix mimetics based on arylamide oligomers and identify alternate parameters matching solution NMR data and suitable for molecular dynamics simulation of arylamide compounds. Results from both docking and molecular dynamics simulations are consistent with the arylamides binding in the p53 peptide binding pocket. Simulations of arylamides in the p53 binding pocket of hDM2 are consistent with binding, exhibiting similar structural dynamics in the pocket as simulations of known hDM2 binders Nutlin-2 and a benzodiazepinedione compound. Arylamide conformations converge towards the same region of the binding pocket on the 20 ns time scale, and most, though not all dihedrals in the binding pocket are well sampled on this timescale. We show that there are two putative classes of binding modes for arylamide compounds supported equally by the modeling evidence. In the first, the arylamide compound lies parallel to the observed p53 helix. In the second class, not previously identified or proposed, the arylamide compound lies anti-parallel to the p53 helix. PMID:22916232
Pharmacophore screening of the protein data bank for specific binding site chemistry.

PubMed

Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

2010-03-22

A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Large-scale binding ligand prediction by improved patch-based method Patch-Surfer2.0

PubMed Central

Zhu, Xiaolei; Xiong, Yi; Kihara, Daisuke

2015-01-01

Motivation: Ligand binding is a key aspect of the function of many proteins. Thus, binding ligand prediction provides important insight in understanding the biological function of proteins. Binding ligand prediction is also useful for drug design and examining potential drug side effects. Results: We present a computational method named Patch-Surfer2.0, which predicts binding ligands for a protein pocket. By representing and comparing pockets at the level of small local surface patches that characterize physicochemical properties of the local regions, the method can identify binding pockets of the same ligand even if they do not share globally similar shapes. Properties of local patches are represented by an efficient mathematical representation, 3D Zernike Descriptor. Patch-Surfer2.0 has significant technical improvements over our previous prototype, which includes a new feature that captures approximate patch position with a geodesic distance histogram. Moreover, we constructed a large comprehensive database of ligand binding pockets that will be searched against by a query. The benchmark shows better performance of Patch-Surfer2.0 over existing methods. Availability and implementation: http://kiharalab.org/patchsurfer2.0/ Contact: dkihara@purdue.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25359888

Predictive 3D modelling of the interactions of pyrethroids with the voltage-gated sodium channels of ticks and mites.

PubMed

O'Reilly, Andrias O; Williamson, Martin S; González-Cabrera, Joel; Turberg, Andreas; Field, Linda M; Wallace, B A; Davies, T G Emyr

2014-03-01

The pyrethroid insecticides are a very successful group of compounds that target invertebrate voltage-gated sodium channels and are widely used in the control of insects, ticks and mites. It is well established that some pyrethroids are good insecticides whereas others are more effective as acaricides. This species specificity is advantageous for controlling particular pest(s) in the presence of another non-target invertebrate, for example controlling the Varroa mite in honeybee colonies. We applied in silico techniques to compare the voltage-gated sodium channels of insects versus ticks and mites and their interactions with a range of pyrethroids and DDT analogues. We identified a single amino acid difference within the pyrethroid binding pocket of ticks/mites that may have significant impact on the effectiveness of pyrethroids as acaricides. Other individual amino acid differences within the binding pocket in distinct tick and mite species may provide a basis for future acaricidal selectivity. Three-dimensional modelling of the pyrethroid/DDT receptor site has led to a new hypothesis to explain the preferential binding of acaricidal pyrethroids to the sodium channels of ticks/mites. This is important for understanding pyrethroid selectivity and the potential effects of mutations that can give rise to resistance to pyrethroids in commercially-important pest species. © 2013 Society of Chemical Industry.
Characterization of the allosteric binding pocket of human liver fructose-1,6-bisphosphatase by protein crystallography and inhibitor activity studies.

PubMed

Iversen, L F; Brzozowski, M; Hastrup, S; Hubbard, R; Kastrup, J S; Larsen, I K; Naerum, L; Nørskov-Lauridsen, L; Rasmussen, P B; Thim, L; Wiberg, F C; Lundgren, K

1997-05-01

The structures of three complexes of human fructose-1,6-bisphosphatase (FB) with the allosteric inhibitor AMP and two AMP analogues have been determined and all fully refined. The data used for structure determination were collected at cryogenic temperature (110 K), and with the use of synchrotron radiation. The structures reveal a common mode of binding for AMP and formycine monophosphate (FMP). 5-Amino-4-carboxamido-1 beta-D-5-phosphate-ribofuranosyl-1H-imidazole (AICAR-P) shows an unexpected mode of binding to FB, different from that of the other two ligands. The imidazole ring of AICAR-P is rotated 180 degrees compared to the AMP and FMP bases. This rotation results in a slightly different hydrogen bonding pattern and minor changes in the water structure in the binding pocket. Common features of binding are seen for the ribose and phosphate moieties of all three compounds. Although binding in a different mode, AICAR-P is still capable of making all the important interactions with the residues building the allosteric binding pocket. The IC50 values of AMP, FMP, and AICAR-P were determined to be 1.7, 1.4, and 20.9 microM, respectively. Thus, the approximately 10 times lower potency of AICAR-P is difficult to explain solely from the variations observed in the binding pocket. Only one water molecule in the allosteric binding pocket was found to be conserved in all four subunits in all three structures. This water molecule coordinates to a phosphate oxygen atom and the N7 atom of the AMP molecule, and to similarly situated atoms in the FMP and AICAR-P complexes. This implies an important role of the conserved water molecule in binding of the ligand.
Characterization of the allosteric binding pocket of human liver fructose-1,6-bisphosphatase by protein crystallography and inhibitor activity studies.

PubMed Central

Iversen, L. F.; Brzozowski, M.; Hastrup, S.; Hubbard, R.; Kastrup, J. S.; Larsen, I. K.; Naerum, L.; Nørskov-Lauridsen, L.; Rasmussen, P. B.; Thim, L.; Wiberg, F. C.; Lundgren, K.

1997-01-01

The structures of three complexes of human fructose-1,6-bisphosphatase (FB) with the allosteric inhibitor AMP and two AMP analogues have been determined and all fully refined. The data used for structure determination were collected at cryogenic temperature (110 K), and with the use of synchrotron radiation. The structures reveal a common mode of binding for AMP and formycine monophosphate (FMP). 5-Amino-4-carboxamido-1 beta-D-5-phosphate-ribofuranosyl-1H-imidazole (AICAR-P) shows an unexpected mode of binding to FB, different from that of the other two ligands. The imidazole ring of AICAR-P is rotated 180 degrees compared to the AMP and FMP bases. This rotation results in a slightly different hydrogen bonding pattern and minor changes in the water structure in the binding pocket. Common features of binding are seen for the ribose and phosphate moieties of all three compounds. Although binding in a different mode, AICAR-P is still capable of making all the important interactions with the residues building the allosteric binding pocket. The IC50 values of AMP, FMP, and AICAR-P were determined to be 1.7, 1.4, and 20.9 microM, respectively. Thus, the approximately 10 times lower potency of AICAR-P is difficult to explain solely from the variations observed in the binding pocket. Only one water molecule in the allosteric binding pocket was found to be conserved in all four subunits in all three structures. This water molecule coordinates to a phosphate oxygen atom and the N7 atom of the AMP molecule, and to similarly situated atoms in the FMP and AICAR-P complexes. This implies an important role of the conserved water molecule in binding of the ligand. PMID:9144768
Water-Restructuring Mutations Can Reverse the Thermodynamic Signature of Ligand Binding to Human Carbonic Anhydrase

DOE PAGES

Fox, Jerome M.; Kang, Kyungtae; Sastry, Madhavi; ...

2017-03-02

In this study we use mutants of human carbonic anhydrase (HCAII) to examine how changes in the organization of water within a binding pocket can alter the thermodynamics of protein–ligand association. Results from calorimetric, crystallographic, and theoretical analyses suggest that most mutations strengthen networks of water-mediated hydrogen bonds and reduce binding affinity by increasing the enthalpic cost and, to a lesser extent, the entropic benefit of rearranging those networks during binding. The organization of water within a binding pocket can thus determine whether the hydrophobic interactions in which it engages are enthalpy-driven or entropy-driven. Our findings highlight a possible asymmetrymore » in protein–ligand association by suggesting that, within the confines of the binding pocket of HCAII, binding events associated with enthalpically favorable rearrangements of water are stronger than those associated with entropically favorable ones.« less
Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

PubMed

Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

2017-10-01

While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Inhibition of Mycobacterium tuberculosis Methionine Aminopeptidases by Bengamide Derivatives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Jing-Ping; Yuan, Xiu-Hua; Yuan, Hai

Methionine aminopeptidase (MetAP) carries out an essential function of protein N-terminal processing in many bacteria and is a promising target for the development of novel antitubercular agents. Natural bengamides potently inhibit the proliferation of mammalian cells by targeting MetAP enzymes, and the X-ray crystal structure of human type 2 MetAP in complex with a bengamide derivative reveals the key interactions at the active site. By preserving the interactions with the conserved residues inside the binding pocket while exploring the differences between bacterial and human MetAPs around the binding pocket, seven bengamide derivatives were synthesized and evaluated for inhibition of MtMetAP1amore » and MtMetAP1c in different metalloforms, inhibition of M. tuberculosis growth in replicating and non-replicating states, and inhibition of human K562 cell growth. Potent inhibition of MtMetAP1a and MtMetAP1c and modest growth inhibition of M. tuberculosis were observed for some of these derivatives. Crystal structures of MtMetAP1c in complex with two of the derivatives provided valuable structural information for improvement of these inhibitors for potency and selectivity.« less
Druggable Protein Interaction Sites Are More Predisposed to Surface Pocket Formation than the Rest of the Protein Surface

PubMed Central

Johnson, David K.; Karanicolas, John

2013-01-01

Despite intense interest and considerable effort via high-throughput screening, there are few examples of small molecules that directly inhibit protein-protein interactions. This suggests that many protein interaction surfaces may not be intrinsically “druggable” by small molecules, and elevates in importance the few successful examples as model systems for improving our fundamental understanding of druggability. Here we describe an approach for exploring protein fluctuations enriched in conformations containing surface pockets suitable for small molecule binding. Starting from a set of seven unbound protein structures, we find that the presence of low-energy pocket-containing conformations is indeed a signature of druggable protein interaction sites and that analogous surface pockets are not formed elsewhere on the protein. We further find that ensembles of conformations generated with this biased approach structurally resemble known inhibitor-bound structures more closely than equivalent ensembles of unbiased conformations. Collectively these results suggest that “druggability” is a property encoded on a protein surface through its propensity to form pockets, and inspire a model in which the crude features of the predisposed pocket(s) restrict the range of complementary ligands; additional smaller conformational changes then respond to details of a particular ligand. We anticipate that the insights described here will prove useful in selecting protein targets for therapeutic intervention. PMID:23505360
Exploring Strategies for Labeling Viruses with Gold Nanoclusters through Non-equilibrium Molecular Dynamics Simulations.

PubMed

Pohjolainen, Emmi; Malola, Sami; Groenhof, Gerrit; Häkkinen, Hannu

2017-09-20

Biocompatible gold nanoclusters can be utilized as contrast agents in virus imaging. The labeling of viruses can be achieved noncovalently but site-specifically by linking the cluster to the hydrophobic pocket of a virus via a lipid-like pocket factor. We have estimated the binding affinities of three different pocket factors of echovirus 1 (EV1) in molecular dynamics simulations combined with non-equilibrium free-energy calculations. We have also studied the effects on binding affinities with a pocket factor linked to the Au 102 pMBA 44 nanocluster in different protonation states. Although the absolute binding affinities are over-estimated for all the systems, the trend is in agreement with recent experiments.3 Our results suggest that the natural pocket factor (palmitic acid) can be replaced by molecules pleconaril (drug) and its derivative Kirtan1 that have higher estimated binding affinities. Our results also suggest that including the gold nanocluster does not decrease the affinity of the pocket factor to the virus, but the affinity is sensitive to the protonation state of the nanocluster, i.e., to pH conditions. The methodology introduced in this work helps in the design of optimal strategies for gold-virus bioconjugation for virus detection and manipulation.
The RNA template channel of the RNA-dependent RNA polymerase as a target for development of antiviral therapy of multiple genera within a virus family.

PubMed

van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M

2015-03-01

The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the plasticity of picornavirus polymerases at the template binding site.
The RNA Template Channel of the RNA-Dependent RNA Polymerase as a Target for Development of Antiviral Therapy of Multiple Genera within a Virus Family

PubMed Central

van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria

2015-01-01

The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the plasticity of picornavirus polymerases at the template binding site. PMID:25799064
Rupture of DNA aptamer: New insights from simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

2015-10-28

Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less
Unique Structure and Dynamics of the EphA5 Ligand Binding Domain Mediate Its Binding Specificity as Revealed by X-ray Crystallography, NMR and MD Simulations

PubMed Central

Mitra, Sayantan; Zhu, Wanlong; Qin, Haina; Pasquale, Elena B.; Song, Jianxing

2013-01-01

The 16 EphA and EphB receptors represent the largest family of receptor tyrosine kinases, and their interactions with 9 ephrin-A and ephrin-B ligands initiate bidirectional signals controlling many physiological and pathological processes. Most interactions occur between receptor and ephrins of the same class, and only EphA4 can bind all A and B ephrins. To understand the structural and dynamic principles that enable Eph receptors to utilize the same jellyroll β-sandwich fold to bind ephrins, the VAPB-MSP domain, peptides and small molecules, we have used crystallography, NMR and molecular dynamics (MD) simulations to determine the first structure and dynamics of the EphA5 ligand-binding domain (LBD), which only binds ephrin-A ligands. Unexpectedly, despite being unbound, the high affinity ephrin-binding pocket of EphA5 resembles that of other Eph receptors bound to ephrins, with a helical conformation over the J–K loop and an open pocket. The openness of the pocket is further supported by NMR hydrogen/deuterium exchange data and MD simulations. Additionally, the EphA5 LBD undergoes significant picosecond-nanosecond conformational exchanges over the loops, as revealed by NMR and MD simulations, but lacks global conformational exchanges on the microsecond-millisecond time scale. This is markedly different from the EphA4 LBD, which shares 74% sequence identity and 87% homology. Consequently, the unbound EphA5 LBD appears to comprise an ensemble of open conformations that have only small variations over the loops and appear ready to bind ephrin-A ligands. These findings show how two proteins with high sequence homology and structural similarity are still able to achieve distinctive binding specificities through different dynamics, which may represent a general mechanism whereby the same protein fold can serve for different functions. Our findings also suggest that a promising strategy to design agonists/antagonists with high affinity and selectivity might be to target specific dynamic states of the Eph receptor LBDs. PMID:24086308
A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites.

PubMed Central

Sellers, W R; Rodgers, J W; Kaelin, W G

1995-01-01

An intact T/E1A-binding domain (the pocket) is necessary, but not sufficient, for the retinoblastoma protein (RB) to bind to DNA-protein complexes containing E2F and for RB to induce a G1/S block. Indirect evidence suggests that the binding of RB to E2F may, in addition to inhibiting E2F transactivation function, generate a complex capable of functioning as a transrepressor. Here we show that a chimera in which the E2F1 transactivation domain was replaced with the RB pocket could, in a DNA-binding and pocket-dependent manner, mimic the ability of RB to repress transcription and induce a cell cycle arrest. In contrast, a transdominant negative E2F1 mutant that is capable of blocking E2F-dependent transactivation did not. Fusion of the RB pocket to a heterologous DNA-binding domain unrelated to E2F likewise generated a transrepressor protein when scored against a suitable reporter. These results suggest that growth suppression by RB is due, at least in part, to transrepression mediated by the pocket domain bound to certain promoters via E2F. Images Fig. 4 Fig. 5 PMID:8524800
Virtual Screening and X-ray Crystallography for Human Kallikrein 6 Inhibitors with an Amidinothiophene P1 Group.

PubMed

Liang, Guyan; Chen, Xin; Aldous, Suzanne; Pu, Su-Fen; Mehdi, Shujaath; Powers, Elaine; Giovanni, Andrew; Kongsamut, Sathapana; Xia, Tianhui; Zhang, Ying; Wang, Rachel; Gao, Zhongli; Merriman, Gregory; McLean, Larry R; Morize, Isabelle

2012-02-09

A series of compounds with an amidinothiophene P1 group and a pyrrolidinone-sulphonamide scaffold linker was identified as potent inhibitors of human kallikrein 6 by structure-based virtual screening based on the union accessible binding space of serine proteases. As the first series of potent nonmechanism-based hK6 inhibitors, they may be used as tool compounds for target validation. An X-ray structure of a representative compound complexed with hK6, resolved at a resolution of 1.88 Å, revealed that the amidinothiophene moiety bound in the S1 pocket and the pyrrolidinone-sulphonamide linker projected the aromatic tail into the S' pocket.
Discovery of a Manduca sexta Allatotropin Antagonist from a Manduca sexta Allatotropin Receptor Homology Model.

PubMed

Kai, Zhen-Peng; Zhu, Jing-Jing; Deng, Xi-Le; Yang, Xin-Ling; Chen, Shan-Shan

2018-04-03

Insect G protein coupled receptors (GPCRs) have important roles in modulating biology, physiology and behavior. They have been identified as candidate targets for next-generation insecticides, yet these targets have been relatively poorly exploited for insect control. In this study, we present a pipeline of novel Manduca sexta allatotropin (Manse-AT) antagonist discovery with homology modeling, docking, molecular dynamics simulation and structure-activity relationship. A series of truncated and alanine-replacement analogs of Manse-AT were assayed for the stimulation of juvenile hormone biosynthesis. The minimum sequence required to retain potent biological activity is the C -terminal amidated octapeptide Manse-AT (6-13). We identified three residues essential for bioactivity (Thr⁴, Arg6 and Phe⁸) by assaying alanine-replacement analogs of Manse-AT (6-13). Alanine replacement of other residues resulted in reduced potency but bioactivity was retained. The 3D structure of the receptor (Manse-ATR) was built and the binding pocket was identified. The binding affinities of all the analogs were estimated by calculating the free energy of binding. The calculated binding affinities corresponded to the biological activities of the analogs, which supporting our localization of the binding pocket. Then, based on the docking and molecular dynamics studies of Manse-AT (10-13), we described it can act as a potent Manse-AT antagonist. The antagonistic effect on JH biosynthesis of Manse-AT (10-13) validated our hypothesis. The IC 50 value of antagonist Manse-AT (10-13) is 0.9 nM. The structure-activity relationship of antagonist Manse-AT (10-13) was also studied for the further purpose of investigating theoretically the structure factors influencing activity. These data will be useful for the design of new Manse-AT agonist and antagonist as potential pest control agents.
Raf Kinase Inhibitory Protein protects cells against locostatin-mediated inhibition of migration.

PubMed

Shemon, Anne N; Eves, Eva M; Clark, Matthew C; Heil, Gary; Granovsky, Alexey; Zeng, Lingchun; Imamoto, Akira; Koide, Shohei; Rosner, Marsha Rich

2009-06-24

Raf Kinase Inhibitory Protein (RKIP, also PEBP1), a member of the Phosphatidylethanolamine Binding Protein family, negatively regulates growth factor signaling by the Raf/MAP kinase pathway. Since an organic compound, locostatin, was reported to bind RKIP and inhibit cell migration by a Raf-dependent mechanism, we addressed the role of RKIP in locostatin function. We analyzed locostatin interaction with RKIP and examined the biological consequences of locostatin binding on RKIP function. NMR studies show that a locostatin precursor binds to the conserved phosphatidylethanolamine binding pocket of RKIP. However, drug binding to the pocket does not prevent RKIP association with its inhibitory target, Raf-1, nor affect RKIP phosphorylation by Protein Kinase C at a regulatory site. Similarly, exposure of wild type, RKIP-depleted HeLa cells or RKIP-deficient (RKIP(-/-)) mouse embryonic fibroblasts (MEFs) to locostatin has no effect on MAP kinase activation. Locostatin treatment of wild type MEFs causes inhibition of cell migration following wounding. RKIP deficiency impairs migration further, indicating that RKIP protects cells against locostatin-mediated inhibition of migration. Locostatin treatment of depleted or RKIP(-/-) MEFs reveals cytoskeletal disruption and microtubule abnormalities in the spindle. These results suggest that locostatin's effects on cytoskeletal structure and migration are caused through mechanisms independent of its binding to RKIP and Raf/MAP kinase signaling. The protective effect of RKIP against drug inhibition of migration suggests a new role for RKIP in potentially sequestering toxic compounds that may have deleterious effects on cells.
Structural mechanism for the carriage and release of thyroxine in the blood.

PubMed

Zhou, Aiwu; Wei, Zhenquan; Read, Randy J; Carrell, Robin W

2006-09-05

The hormones that most directly control tissue activities in health and disease are delivered by two noninhibitory members of the serpin family of protease inhibitors, thyroxine-binding globulin (TBG) and corticosteroid-binding globulin. The structure of TBG bound to tetra-iodo thyroxine, solved here at 2.8 A, shows how the thyroxine is carried in a surface pocket on the molecule. This unexpected binding site is confirmed by mutations associated with a loss of hormone binding in both TBG and also homologously in corticosteroid-binding globulin. TBG strikingly differs from other serpins in having the upper half of its main beta-sheet fully opened, so its reactive center peptide loop can readily move in and out of the sheet to give an equilibrated binding and release of thyroxine. The entry of the loop triggers a conformational change, with a linked contraction of the binding pocket and release of the bound thyroxine. The ready reversibility of this change is due to the unique presence in the reactive loop of TBG of a proline that impedes the full and irreversible entry of the loop that occurs in other serpins. Thus, TBG has adapted the serpin inhibitory mechanism to give a reversible flip-flop transition, from a high-affinity to a low-affinity form. The complexity and ready triggering of this conformational mechanism strongly indicates that TBG has evolved to allow a modulated and targeted delivery of thyroxine to the tissues.
Fluorescent-responsive synthetic C1b domains of protein kinase Cδ as reporters of specific high-affinity ligand binding.

PubMed

Ohashi, Nami; Nomura, Wataru; Narumi, Tetsuo; Lewin, Nancy E; Itotani, Kyoko; Blumberg, Peter M; Tamamura, Hirokazu

2011-01-19

Protein kinase C (PKC) is a critical cell signaling pathway involved in many disorders such as cancer and Alzheimer-type dementia. To date, evaluation of PKC ligand binding affinity has been performed by competitive studies against radiolabeled probes that are problematic for high-throughput screening. In the present study, we have developed a fluorescent-based binding assay system for identifying ligands that target the PKC ligand binding domain (C1 domain). An environmentally sensitive fluorescent dye (solvatochromic fluorophore), which has been used in multiple applications to assess protein-binding interactions, was inserted in proximity to the binding pocket of a novel PKCδ C1b domain. These resultant fluorescent-labeled δC1b domain analogues underwent a significant change in fluorescent intensity upon ligand binding, and we further demonstrate that the fluorescent δC1b domain analogues can be used to evaluate ligand binding affinity.
Binding preference of carbon nanotube over proline-rich motif ligand on SH3-domain: a comparison with different force fields.

PubMed

Shi, Biyun; Zuo, Guanghong; Xiu, Peng; Zhou, Ruhong

2013-04-04

With the widespread applications of nanomaterials such as carbon nanotubes, there is a growing concern on the biosafety of these engineered nanoparticles, in particular their interactions with proteins. In molecular simulations of nanoparticle-protein interactions, the choice of empirical parameters (force fields) plays a decisive role, and thus is of great importance and should be examined carefully before wider applications. Here we compare three commonly used force fields, CHARMM, OPLSAA, and AMBER in study of the competitive binding of a single wall carbon nanotube (SWCNT) with a native proline-rich motif (PRM) ligand on its target protein SH3 domain, a ubiquitous protein-protein interaction mediator involved in signaling and regulatory pathways. We find that the SWCNT displays a general preference over the PRM in binding with SH3 domain in all the three force fields examined, although the degree of preference can be somewhat different, with the AMBER force field showing the highest preference. The SWCNT prevents the ligand from reaching its native binding pocket by (i) occupying the binding pocket directly, and (ii) binding with the ligand itself and then being trapped together onto some off-sites. The π-π stacking interactions between the SWCNT and aromatic residues are found to play a significant role in its binding to the SH3 domain in all the three force fields. Further analyses show that even the SWCNT-ligand binding can also be relatively more stable than the native ligand-protein binding, indicating a serious potential disruption to the protein SH3 function.
Optimization of triazine nitriles as rhodesain inhibitors: structure-activity relationships, bioisosteric imidazopyridine nitriles, and X-ray crystal structure analysis with human cathepsin L.

PubMed

Ehmke, Veronika; Winkler, Edwin; Banner, David W; Haap, Wolfgang; Schweizer, W Bernd; Rottmann, Matthias; Kaiser, Marcel; Freymond, Céline; Schirmeister, Tanja; Diederich, François

2013-06-01

The cysteine protease rhodesain of Trypanosoma brucei parasites causing African sleeping sickness has emerged as a target for the development of new drug candidates. Based on a triazine nitrile moiety as electrophilic headgroup, optimization studies on the substituents for the S1, S2, and S3 pockets of the enzyme were performed using structure-based design and resulted in inhibitors with inhibition constants in the single-digit nanomolar range. Comprehensive structure-activity relationships clarified the binding preferences of the individual pockets of the active site. The S1 pocket tolerates various substituents with a preference for flexible and basic side chains. Variation of the S2 substituent led to high-affinity ligands with inhibition constants down to 2 nM for compounds bearing cyclohexyl substituents. Systematic investigations on the S3 pocket revealed its potential to achieve high activities with aromatic vectors that undergo stacking interactions with the planar peptide backbone forming part of the pocket. X-ray crystal structure analysis with the structurally related enzyme human cathepsin L confirmed the binding mode of the triazine ligand series as proposed by molecular modeling. Sub-micromolar inhibition of the proliferation of cultured parasites was achieved for ligands decorated with the best substituents identified through the optimization cycles. In cell-based assays, the introduction of a basic side chain on the inhibitors resulted in a 35-fold increase in antitrypanosomal activity. Finally, bioisosteric imidazopyridine nitriles were studied in order to prevent off-target effects with unselective nucleophiles by decreasing the inherent electrophilicity of the triazine nitrile headgroup. Using this ligand, the stabilization by intramolecular hydrogen bonding of the thioimidate intermediate, formed upon attack of the catalytic cysteine residue, compensates for the lower reactivity of the headgroup. The imidazopyridine nitrile ligand showed excellent stability toward the thiol nucleophile glutathione in a quantitative in vitro assay and fourfold lower cytotoxicity than the parent triazine nitrile. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

PubMed

Abou-Zied, Osama K

2015-01-01

Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Large-scale binding ligand prediction by improved patch-based method Patch-Surfer2.0.

PubMed

Zhu, Xiaolei; Xiong, Yi; Kihara, Daisuke

2015-03-01

Ligand binding is a key aspect of the function of many proteins. Thus, binding ligand prediction provides important insight in understanding the biological function of proteins. Binding ligand prediction is also useful for drug design and examining potential drug side effects. We present a computational method named Patch-Surfer2.0, which predicts binding ligands for a protein pocket. By representing and comparing pockets at the level of small local surface patches that characterize physicochemical properties of the local regions, the method can identify binding pockets of the same ligand even if they do not share globally similar shapes. Properties of local patches are represented by an efficient mathematical representation, 3D Zernike Descriptor. Patch-Surfer2.0 has significant technical improvements over our previous prototype, which includes a new feature that captures approximate patch position with a geodesic distance histogram. Moreover, we constructed a large comprehensive database of ligand binding pockets that will be searched against by a query. The benchmark shows better performance of Patch-Surfer2.0 over existing methods. http://kiharalab.org/patchsurfer2.0/ CONTACT: dkihara@purdue.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Characterization of the Raf Kinase Inhibitory Protein (RKIP) Binding Pocket: NMR-Based Screening Identifies Small-Molecule Ligands

PubMed Central

Granovsky, Alexey E.; Clark, Mathew M.; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R.; Koide, Shohei

2010-01-01

Background Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. Methods/Findings In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. Conclusions/Significance This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential. PMID:20463977
Selective mode of action of guanidine-containing non-peptides at human NPFF receptors.

PubMed

Findeisen, Maria; Würker, Cäcilia; Rathmann, Daniel; Meier, René; Meiler, Jens; Olsson, Roger; Beck-Sickinger, Annette G

2012-07-12

The binding pocket of both NPFF receptors was investigated, focusing on subtype-selective behavior. By use of four nonpeptidic compounds and the peptide mimetics RF9 and BIBP3226, agonistic and antagonistic properties were characterized. A set of Ala receptor mutants was generated. The binding pocket was narrowed down to the upper part of transmembrane helices V, VI, VII and the extracellular loop 2. Positions 5.27 and 6.59 have been shown to have a strong impact on receptor activation and were suggested to form an acidic, negatively charged binding pocket in both NPFF receptor subtypes. Additionally, position 7.35 was identified to play an important role in functional selectivity. According to docking experiments, the aryl group of AC-216 interacts with position 7.35 in the NPFF(1) but not in the NPFF(2) receptor. These results provide distinct insights into the receptor specific binding pockets, which is necessary for the development of drugs to address the NPFF system.
Selective mode of action of guanidine-containing non-peptides at human NPFF receptors

PubMed Central

Findeisen, Maria; Würker, Cäcilia; Rathmann, Daniel; Meier, René; Meiler, Jens; Olsson, Roger; Beck-Sickinger, Annette G.

2012-01-01

The binding pocket of both NPFF receptors was investigated, focusing on subtype-selective behavior. By using four non-peptidic compounds and the peptide mimetics RF9 and BIBP3226 agonistic and antagonistic properties were characterized. A set of Ala receptor mutants was generated, the binding pocket was narrowed down to the upper part of transmembrane helices V, VI, VII, and the extracellular loop 2. Positions 5.27 and 6.59 have been shown to have a strong impact on receptor activation and were suggested to form an acidic, negatively charged binding pocket in both NPFF receptor subtypes. Additionally, position 7.35 was identified to play an important role in functional selectivity. According to docking experiments, the aryl group of AC-216 interacts with position 7.35 in the NPFF1 but not in the NPFF2 receptor. These results provide distinct insights into the receptor specific binding pockets, which is necessary for the development of drugs to address the NPFF system. PMID:22708927
Theoretical studies on the selective mechanisms of GSK3β and CDK2 by molecular dynamics simulations and free energy calculations.

PubMed

Zhao, Sufang; Zhu, Jingyu; Xu, Lei; Jin, Jian

2017-06-01

Glycogen synthase kinase 3 (GSK3) is a serine/threonine protein kinase which is widely involved in cell signaling and controls a broad number of cellular functions. GSK3 contains α and β isoforms, and GSK3β has received more attention and becomes an attractive drug target for the treatment of several diseases. The binding pocket of cyclin-dependent kinase 2 (CDK2) shares high sequence identity to that of GSK3β, and therefore, the design of highly selective inhibitors toward GSK3β remains a big challenge. In this study, a computational strategy, which combines molecular docking, molecular dynamics simulations, free energy calculations, and umbrella sampling simulations, was employed to explore the binding mechanisms of two selective inhibitors to GSK3β and CDK2. The simulation results highlighted the key residues critical for GSK3β selectivity. It was observed that although GSK3β and CDK2 share the conserved ATP-binding pockets, some different residues have significant contributions to protein selectivity. This study provides valuable information for understanding the GSK3β-selective binding mechanisms and the rational design of selective GSK3β inhibitors. © 2016 John Wiley & Sons A/S.
Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

PubMed

Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

2017-08-01

The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.
Single 23S rRNA mutations at the ribosomal peptidyl transferase centre confer resistance to valnemulin and other antibiotics in Mycobacterium smegmatis by perturbation of the drug binding pocket.

PubMed

Long, Katherine S; Poehlsgaard, Jacob; Hansen, Lykke H; Hobbie, Sven N; Böttger, Erik C; Vester, Birte

2009-03-01

Tiamulin and valnemulin target the peptidyl transferase centre (PTC) on the bacterial ribosome. They are used in veterinary medicine to treat infections caused by a variety of bacterial pathogens, including the intestinal spirochetes Brachyspira spp. Mutations in ribosomal protein L3 and 23S rRNA have previously been associated with tiamulin resistance in Brachyspira spp. isolates, but as multiple mutations were isolated together, the roles of the individual mutations are unclear. In this work, individual 23S rRNA mutations associated with pleuromutilin resistance at positions 2055, 2447, 2504 and 2572 (Escherichia coli numbering) are introduced into a Mycobacterium smegmatis strain with a single rRNA operon. The single mutations each confer a significant and similar degree of valnemulin resistance and those at 2447 and 2504 also confer cross-resistance to other antibiotics that bind to the PTC in M. smegmatis. Antibiotic footprinting experiments on mutant ribosomes show that the introduced mutations cause structural perturbations at the PTC and reduced binding of pleuromutilin antibiotics. This work underscores the fact that mutations at nucleotides distant from the pleuromutilin binding site can confer the same level of valnemulin resistance as those at nucleotides abutting the bound drug, and suggests that the former function indirectly by altering local structure and flexibility at the drug binding pocket.
Structural mechanism of JH delivery in hemolymph by JHBP of silkworm, Bombyx mori

PubMed Central

Suzuki, Rintaro; Fujimoto, Zui; Shiotsuki, Takahiro; Tsuchiya, Wataru; Momma, Mitsuru; Tase, Akira; Miyazawa, Mitsuhiro; Yamazaki, Toshimasa

2011-01-01

Juvenile hormone (JH) plays crucial roles in many aspects of the insect life. All the JH actions are initiated by transport of JH in the hemolymph as a complex with JH-binding protein (JHBP) to target tissues. Here, we report structural mechanism of JH delivery by JHBP based upon the crystal and solution structures of apo and JH-bound JHBP. In solution, apo-JHBP exists in equilibrium of multiple conformations with different orientations of the gate helix for the hormone-binding pocket ranging from closed to open forms. JH-binding to the gate-open form results in the fully closed JHBP-JH complex structure where the bound JH is completely buried inside the protein. JH-bound JHBP opens the gate helix to release the bound hormone likely by sensing the less polar environment at the membrane surface of target cells. This is the first report that provides structural insight into JH signaling. PMID:22355650
Mechanism of action and epitopes of Clostridium difficile toxin B-neutralizing antibody bezlotoxumab revealed by X-ray crystallography.

PubMed

Orth, Peter; Xiao, Li; Hernandez, Lorraine D; Reichert, Paul; Sheth, Payal R; Beaumont, Maribel; Yang, Xiaoyu; Murgolo, Nicholas; Ermakov, Grigori; DiNunzio, Edward; Racine, Fred; Karczewski, Jerzy; Secore, Susan; Ingram, Richard N; Mayhood, Todd; Strickland, Corey; Therien, Alex G

2014-06-27

The symptoms of Clostridium difficile infections are caused by two exotoxins, TcdA and TcdB, which target host colonocytes by binding to unknown cell surface receptors, at least in part via their combined repetitive oligopeptide (CROP) domains. A combination of the anti-TcdA antibody actoxumab and the anti-TcdB antibody bezlotoxumab is currently under development for the prevention of recurrent C. difficile infections. We demonstrate here through various biophysical approaches that bezlotoxumab binds to specific regions within the N-terminal half of the TcdB CROP domain. Based on this information, we solved the x-ray structure of the N-terminal half of the TcdB CROP domain bound to Fab fragments of bezlotoxumab. The structure reveals that the TcdB CROP domain adopts a β-solenoid fold consisting of long and short repeats and that bezlotoxumab binds to two homologous sites within the CROP domain, partially occluding two of the four putative carbohydrate binding pockets located in TcdB. We also show that bezlotoxumab neutralizes TcdB by blocking binding of TcdB to mammalian cells. Overall, our data are consistent with a model wherein a single molecule of bezlotoxumab neutralizes TcdB by binding via its two Fab regions to two epitopes within the N-terminal half of the TcdB CROP domain, partially blocking the carbohydrate binding pockets of the toxin and preventing toxin binding to host cells. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Molecular Basis for Failure of “Atypical” C1 Domain of Vav1 to Bind Diacylglycerol/Phorbol Ester*

PubMed Central

Geczy, Tamas; Peach, Megan L.; El Kazzouli, Saïd; Sigano, Dina M.; Kang, Ji-Hye; Valle, Christopher J.; Selezneva, Julia; Woo, Wonhee; Kedei, Noemi; Lewin, Nancy E.; Garfield, Susan H.; Lim, Langston; Mannan, Poonam; Marquez, Victor E.; Blumberg, Peter M.

2012-01-01

C1 domains, the recognition motif of the second messenger diacylglycerol and of the phorbol esters, are classified as typical (ligand-responsive) or atypical (not ligand-responsive). The C1 domain of Vav1, a guanine nucleotide exchange factor, plays a critical role in regulation of Vav activity through stabilization of the Dbl homology domain, which is responsible for exchange activity of Vav. Although the C1 domain of Vav1 is classified as atypical, it retains a binding pocket geometry homologous to that of the typical C1 domains of PKCs. This study clarifies the basis for its failure to bind ligands. Substituting Vav1-specific residues into the C1b domain of PKCδ, we identified five crucial residues (Glu9, Glu10, Thr11, Thr24, and Tyr26) along the rim of the binding cleft that weaken binding potency in a cumulative fashion. Reciprocally, replacing these incompatible residues in the Vav1 C1 domain with the corresponding residues from PKCδ C1b (δC1b) conferred high potency for phorbol ester binding. Computer modeling predicts that these unique residues in Vav1 increase the hydrophilicity of the rim of the binding pocket, impairing membrane association and thereby preventing formation of the ternary C1-ligand-membrane binding complex. The initial design of diacylglycerol-lactones to exploit these Vav1 unique residues showed enhanced selectivity for C1 domains incorporating these residues, suggesting a strategy for the development of ligands targeting Vav1. PMID:22351766
A combination of 19F NMR and surface plasmon resonance for site-specific hit selection and validation of fragment molecules that bind to the ATP-binding site of a kinase.

PubMed

Nagatoishi, Satoru; Yamaguchi, Sou; Katoh, Etsuko; Kajita, Keita; Yokotagawa, Takane; Kanai, Satoru; Furuya, Toshio; Tsumoto, Kouhei

2018-05-01

19 F NMR has recently emerged as an efficient, sensitive tool for analyzing protein binding to small molecules, and surface plasmon resonance (SPR) is also a popular tool for this purpose. Herein a combination of 19 F NMR and SPR was used to find novel binders to the ATP-binding pocket of MAP kinase extracellular regulated kinase 2 (ERK2) by fragment screening with an original fluorinated-fragment library. The 19 F NMR screening yielded a high primary hit rate of binders to the ERK2 ATP-binding pocket compared with the rate for the SPR screening. Hit compounds were evaluated and categorized according to their ability to bind to different binding sites in the ATP-binding pocket. The binding manner was characterized by using isothermal titration calorimetry and docking simulation. Combining 19 F NMR with other biophysical methods allows the identification of multiple types of hit compounds, thereby increasing opportunities for drug design using preferred fragments. Copyright © 2018 Elsevier Ltd. All rights reserved.
Reversal of the Drug Binding Pocket Defects of the AcrB Multidrug Efflux Pump Protein of Escherichia coli

PubMed Central

Soparkar, Ketaki; Kinana, Alfred D.; Weeks, Jon W.; Morrison, Keith D.; Nikaido, Hiroshi

2015-01-01

ABSTRACT The AcrB protein of Escherichia coli, together with TolC and AcrA, forms a contiguous envelope conduit for the capture and extrusion of diverse antibiotics and cellular metabolites. In this study, we sought to expand our knowledge of AcrB by conducting genetic and functional analyses. We began with an AcrB mutant bearing an F610A substitution in the drug binding pocket and obtained second-site substitutions that overcame the antibiotic hypersusceptibility phenotype conferred by the F610A mutation. Five of the seven unique single amino acid substitutions—Y49S, V127A, V127G, D153E, and G288C—mapped in the periplasmic porter domain of AcrB, with the D153E and G288C mutations mapping near and at the distal drug binding pocket, respectively. The other two substitutions—F453C and L486W—were mapped to transmembrane (TM) helices 5 and 6, respectively. The nitrocefin efflux kinetics data suggested that all periplasmic suppressors significantly restored nitrocefin binding affinity impaired by the F610A mutation. Surprisingly, despite increasing MICs of tested antibiotics and the efflux of N-phenyl-1-naphthylamine, the TM suppressors did not improve the nitrocefin efflux kinetics. These data suggest that the periplasmic substitutions act by influencing drug binding affinities for the distal binding pocket, whereas the TM substitutions may indirectly affect the conformational dynamics of the drug binding domain. IMPORTANCE The AcrB protein and its homologues confer multidrug resistance in many important human bacterial pathogens. A greater understanding of how these efflux pump proteins function will lead to the development of effective inhibitors against them. The research presented in this paper investigates drug binding pocket mutants of AcrB through the isolation and characterization of intragenic suppressor mutations that overcome the drug susceptibility phenotype of mutations affecting the drug binding pocket. The data reveal a remarkable structure-function plasticity of the AcrB protein pertaining to its drug efflux activity. PMID:26240069
Discovery of new sites for drug binding to the hypertension-related renin-angiotensinogen complex.

PubMed

Brás, Natércia F; Fernandes, Pedro A; Ramos, Maria J

2014-04-01

Renin (REN) is a key drug target to stop the hypertension cascade, but thus far only one direct inhibitor has been made commercially available. In this study, we assess an innovative REN inhibition strategy, by targeting the interface of the renin:angiotensinogen (REN:ANG) complex. We characterized the energetic role of interfacial residues of REN:ANG and identified the ones responsible for protein:protein binding, which can serve as drug targets for disruption of the REN:ANG association. For this purpose, we applied a computational alanine scanning mutagenesis protocol, which measures the contribution of each side chain for the protein:protein binding free energy with an accuracy of ≈ 1 kcal/mol. As a result, in REN and ANG, six and eight residues were found to be critical for binding, respectively. The leading force behind REN:ANG complexation was found to be the hydrophobic effect. The binding free energy per residue was found to be proportional to the buried area. Residues responsible for binding were occluded from water at the complex, which promotes an efficient pairing between the two proteins. Two druggable pockets involving critical residues for binding were found on the surface of REN, where small druglike molecules can bind and disrupt the ANG:REN association that may provide an efficient way to achieve REN inhibition and control hypertension.
Optimized hydrophobic interactions and hydrogen bonding at the target-ligand interface leads the pathways of drug-designing.

PubMed

Patil, Rohan; Das, Suranjana; Stanley, Ashley; Yadav, Lumbani; Sudhakar, Akulapalli; Varma, Ashok K

2010-08-16

Weak intermolecular interactions such as hydrogen bonding and hydrophobic interactions are key players in stabilizing energetically-favored ligands, in an open conformational environment of protein structures. However, it is still poorly understood how the binding parameters associated with these interactions facilitate a drug-lead to recognize a specific target and improve drugs efficacy. To understand this, comprehensive analysis of hydrophobic interactions, hydrogen bonding and binding affinity have been analyzed at the interface of c-Src and c-Abl kinases and 4-amino substituted 1H-pyrazolo [3, 4-d] pyrimidine compounds. In-silico docking studies were performed, using Discovery Studio software modules LigandFit, CDOCKER and ZDOCK, to investigate the role of ligand binding affinity at the hydrophobic pocket of c-Src and c-Abl kinase. Hydrophobic and hydrogen bonding interactions of docked molecules were compared using LigPlot program. Furthermore, 3D-QSAR and MFA calculations were scrutinized to quantify the role of weak interactions in binding affinity and drug efficacy. The in-silico method has enabled us to reveal that a multi-targeted small molecule binds with low affinity to its respective targets. But its binding affinity can be altered by integrating the conformationally favored functional groups at the active site of the ligand-target interface. Docking studies of 4-amino-substituted molecules at the bioactive cascade of the c-Src and c-Abl have concluded that 3D structural folding at the protein-ligand groove is also a hallmark for molecular recognition of multi-targeted compounds and for predicting their biological activity. The results presented here demonstrate that hydrogen bonding and optimized hydrophobic interactions both stabilize the ligands at the target site, and help alter binding affinity and drug efficacy.
Optimized Hydrophobic Interactions and Hydrogen Bonding at the Target-Ligand Interface Leads the Pathways of Drug-Designing

PubMed Central

Stanley, Ashley; Yadav, Lumbani; Sudhakar, Akulapalli; Varma, Ashok K.

2010-01-01

Background Weak intermolecular interactions such as hydrogen bonding and hydrophobic interactions are key players in stabilizing energetically-favored ligands, in an open conformational environment of protein structures. However, it is still poorly understood how the binding parameters associated with these interactions facilitate a drug-lead to recognize a specific target and improve drugs efficacy. To understand this, comprehensive analysis of hydrophobic interactions, hydrogen bonding and binding affinity have been analyzed at the interface of c-Src and c-Abl kinases and 4-amino substituted 1H-pyrazolo [3, 4-d] pyrimidine compounds. Methodology In-silico docking studies were performed, using Discovery Studio software modules LigandFit, CDOCKER and ZDOCK, to investigate the role of ligand binding affinity at the hydrophobic pocket of c-Src and c-Abl kinase. Hydrophobic and hydrogen bonding interactions of docked molecules were compared using LigPlot program. Furthermore, 3D-QSAR and MFA calculations were scrutinized to quantify the role of weak interactions in binding affinity and drug efficacy. Conclusions The in-silico method has enabled us to reveal that a multi-targeted small molecule binds with low affinity to its respective targets. But its binding affinity can be altered by integrating the conformationally favored functional groups at the active site of the ligand-target interface. Docking studies of 4-amino-substituted molecules at the bioactive cascade of the c-Src and c-Abl have concluded that 3D structural folding at the protein-ligand groove is also a hallmark for molecular recognition of multi-targeted compounds and for predicting their biological activity. The results presented here demonstrate that hydrogen bonding and optimized hydrophobic interactions both stabilize the ligands at the target site, and help alter binding affinity and drug efficacy. PMID:20808434
Allelic variation in key peptide-binding pockets discriminates between closely related diabetes-protective and diabetes-susceptible HLA-DQB1*06 alleles.

PubMed

Ettinger, Ruth A; Papadopoulos, George K; Moustakas, Antonis K; Nepom, Gerald T; Kwok, William W

2006-02-01

HLA-DQA1*0102-DQB1*0602 is associated with protection against type 1 diabetes (T1D). A similar allele, HLA-DQA1*0102-DQB1*0604, contributes to T1D susceptibility in certain populations but differs only at seven amino acids from HLA-DQA1*0102-DQB1*0602. Five of these polymorphisms are found within the peptide-binding groove, suggesting that differences in peptide binding contribute to the mechanism of their association with T1D. In this study, we determine the peptide-binding motif for HLA-DQA1*0102-DQB1*0604 allelic protein (DQ0604) in comparison to the established HLA-DQA1*0102-DQB1*0602 (DQ0602) motif using binding assays with model peptides from T1D autoantigens and homology modeling using the coordinates of the DQ0602-hypocretin 1-13 crystal structure. The peptide binding preferences were deduced with a peptide from insulin that bound both with a 2- to 3-fold difference in avidity using the same amino acids in the peptide as anchors. Peptide binding differences directly influenced by the polymorphisms in or nearby pockets 1, 6, and 9 were observed. In pocket 1, DQ0604 was better able to accommodate aromatic residues due to the beta86 and beta87 polymorphisms. A negatively charged amino acid was preferred by DQ0604 in pocket 6 due to the positively charged beta30His. In pocket 9, DQ0604 preferred aromatic amino acids due to the beta9 and beta30 polymorphisms and had low tolerance of acidic residues. beta57Val in DQ0604 functions differently than beta57Ala, in that it pushes alpha76Arg outside of the pocket, preventing the formation of a salt bridge with an acidic amino acid in the peptide. This study furthers our understanding of the structure-function relationships of MHC class II polymorphisms.
YC-1 BINDING TO THE BETA SUBUNIT OF SOLUBLE GUANYLYL CYCLASE OVERCOMES ALLOSTERIC INHIBITION BY THE ALPHA SUBUNIT

PubMed Central

Purohit, Rahul; Fritz, Bradley G.; The, Juliana; Issaian, Aaron; Weichsel, Andrzej; David, Cynthia L.; Campbell, Eric; Hausrath, Andrew C.; Rassouli-Taylor, Leida; Garcin, Elsa D.; Gage, Matthew J.; Montfort, William R.

2014-01-01

Soluble guanylate cyclase (sGC) is a heterodimeric heme protein and the primary nitric oxide receptor. NO binding stimulates cyclase activity, leading to regulation of cardiovascular physiology and making sGC an attractive target for drug discovery. YC-1 and related compounds stimulate sGC both independently and synergistically with NO and CO binding; however, where the compounds bind and how they work remains unknown. Using linked-equilibria binding measurements, surface plasmon resonance, and domain truncations in Manduca sexta and bovine sGC, we demonstrate that YC-1 binds near or directly to the heme-containing domain of the beta subunit. In the absence of CO, YC-1 binds with Kd = 9–21 μM, depending on construct. In the presence of CO, these values decrease to 0.6–1.1 μM. Pfizer compound 25 bound ~10-fold weaker than YC-1 in the absence of CO whereas compound BAY 41–2272 bound particularly tightly in the presence of CO (Kd = 30–90 nM). Additionally, we found that CO binding is much weaker to heterodimeric sGC proteins (Kd = 50–100 μM) than to the isolated heme domain (Kd = 0.2 μM for Manduca beta H-NOX/PAS). YC-1 greatly enhanced CO binding to heterodimeric sGC, as expected (Kd = ~1 μM). These data indicate the alpha subunit induces a heme pocket conformation with lower affinity for CO and NO. YC-1 family compounds bind near the heme domain, overcoming the alpha subunit effect and inducing a heme pocket conformation with high affinity. We propose this high-affinity conformation is required for the full-length protein to achieve high catalytic activity. PMID:24328155
Probing the nucleotide binding domain of the osmoregulator EnvZ using fluorescent nucleotide derivatives.

PubMed

Plesniak, Leigh; Horiuchi, Yuki; Sem, Daniel; Meinenger, David; Stiles, Linda; Shaffer, Jennifer; Jennings, Patricia A; Adams, Joseph A

2002-11-26

EnvZ is a histidine protein kinase important for osmoregulation in bacteria. While structural data are available for this enzyme, the nucleotide binding pocket is not well characterized. The ATP binding domain (EnvZB) was expressed, and its ability to bind nucleotide derivatives was assessed using equilbrium and stopped-flow fluorescence spectroscopy. The fluorescence emission of the trinitrophenyl derivatives, TNP-ATP and TNP-ADP, increase upon binding to EnvZB. The fluorescence enhancements were quantitatively abolished in the presence of excess ADP, indicating that the fluorescent probes occupy the nucleotide binding pocket. Both TNP-ATP and TNP-ADP bind to EnvZB with high affinity (K(d) = 2-3 microM). The TNP moiety attached to the ribose ring does not impede access of the fluorescent nucleotide into the binding pocket. The association rate constant for TNP-ADP is 7 microM(-1) s(-1), a value consistent with those for natural nucleotides and the eucaryotic protein kinases. Using competition experiments, it was found that ATP and ADP bind 30- and 150-fold more poorly, respectively, than the corresponding TNP-derivatized forms. Surprisingly, the physiological metal Mg(2+) is not required for ADP binding and only enhances ATP affinity by 3-fold. Although portions of the nucleotide pocket are disordered, the recombinant enzyme is highly stable, unfolding only at temperatures in excess of 70 degrees C. The unusually high affinity of the TNP derivatives compared to the natural nucleotides suggests that hydrophobic substitutions on the ribose ring enforce an altered binding mode that may be exploited for drug design strategies.
Allosteric regulation of epigenetic modifying enzymes.

PubMed

Zucconi, Beth E; Cole, Philip A

2017-08-01

Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.

What induces pocket openings on protein surface patches involved in protein-protein interactions?

PubMed

Eyrisch, Susanne; Helms, Volkhard

2009-02-01

We previously showed for the proteins BCL-X(L), IL-2, and MDM2 that transient pockets at their protein-protein binding interfaces can be identified by applying the PASS algorithm to molecular dynamics (MD) snapshots. We now investigated which aspects of the natural conformational dynamics of proteins induce the formation of such pockets. The pocket detection protocol was applied to three different conformational ensembles for the same proteins that were extracted from MD simulations of the inhibitor bound crystal conformation in water and the free crystal/NMR structure in water and in methanol. Additional MD simulations studied the impact of backbone mobility. The more efficient CONCOORD or normal mode analysis (NMA) techniques gave significantly smaller pockets than MD simulations, whereas tCONCOORD generated pockets comparable to those observed in MD simulations for two of the three systems. Our findings emphasize the influence of solvent polarity and backbone rearrangements on the formation of pockets on protein surfaces and should be helpful in future generation of transient pockets as putative ligand binding sites at protein-protein interfaces.
What induces pocket openings on protein surface patches involved in protein-protein interactions?

NASA Astrophysics Data System (ADS)

Eyrisch, Susanne; Helms, Volkhard

2009-02-01

We previously showed for the proteins BCL-XL, IL-2, and MDM2 that transient pockets at their protein-protein binding interfaces can be identified by applying the PASS algorithm to molecular dynamics (MD) snapshots. We now investigated which aspects of the natural conformational dynamics of proteins induce the formation of such pockets. The pocket detection protocol was applied to three different conformational ensembles for the same proteins that were extracted from MD simulations of the inhibitor bound crystal conformation in water and the free crystal/NMR structure in water and in methanol. Additional MD simulations studied the impact of backbone mobility. The more efficient CONCOORD or normal mode analysis (NMA) techniques gave significantly smaller pockets than MD simulations, whereas tCONCOORD generated pockets comparable to those observed in MD simulations for two of the three systems. Our findings emphasize the influence of solvent polarity and backbone rearrangements on the formation of pockets on protein surfaces and should be helpful in future generation of transient pockets as putative ligand binding sites at protein-protein interfaces.
Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Chunyan; Morohashi, Keita; Plotnikov, Alexander N.

Chromobox homolog 7 (CBX7) plays an important role in gene transcription in a wide array of cellular processes, ranging from stem cell self-renewal and differentiation to tumor progression. CBX7 functions through its N-terminal chromodomain (ChD), which recognizes tri-methylated lysine 27 of histone 3 (H3K27me3), a conserved epigenetic mark that signifies gene transcriptional repression. Here in this study, we report discovery of small molecules that inhibit CBX7ChD binding to H3K27me3. Our crystal structures reveal the binding modes of these molecules that compete against H3K27me3 binding through interactions with key residues in the methyl-lysine binding pocket of CBX7ChD. We further show thatmore » a lead compound MS37452, derepresses transcription of Polycomb repressive complex target gene p16/CDKN2A by displacing CBX7 binding to the INK4A/ARF locus in prostate cancer cells. Ultimately, these small molecules have the potential to be developed into high-potency chemical modulators that target CBX7 functions in gene transcription in different disease pathways.« less
Role of Desolvation in Thermodynamics and Kinetics of Ligand Binding to a Kinase

PubMed Central

2015-01-01

Computer simulations are used to determine the free energy landscape for the binding of the anticancer drug Dasatinib to its src kinase receptor and show that before settling into a free energy basin the ligand must surmount a free energy barrier. An analysis based on using both the ligand-pocket separation and the pocket-water occupancy as reaction coordinates shows that the free energy barrier is a result of the free energy cost for almost complete desolvation of the binding pocket. The simulations further show that the barrier is not a result of the reorganization free energy of the binding pocket. Although a continuum solvent model gives the location of free energy minima, it is not able to reproduce the intermediate free energy barrier. Finally, it is shown that a kinetic model for the on rate constant in which the ligand diffuses up to a doorway state and then surmounts the desolvation free energy barrier is consistent with published microsecond time-scale simulations of the ligand binding kinetics for this system [Shaw, D. E. et al. J. Am. Chem. Soc.2011, 133, 9181−918321545110]. PMID:25516727
Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.
Natural Iminosugar (+)-Lentiginosine Inhibits ATPase and Chaperone Activity of Hsp90

PubMed Central

Dal Piaz, Fabrizio; Vassallo, Antonio; Chini, Maria Giovanna; Cordero, Franca M.; Cardona, Francesca; Pisano, Claudio; Bifulco, Giuseppe; De Tommasi, Nunziatina; Brandi, Alberto

2012-01-01

Heat shock protein 90 (Hsp90) is a significant target in the development of rational cancer therapy due to its role at the crossroads of multiple signaling pathways associated with cell proliferation and cell viability. The relevance of Hsp90 as a therapeutic target for numerous diseases states has prompted the identification and optimization of novel Hsp90 inhibitors as an emerging therapeutic strategy. We performed a screening aimed to identify novel Hsp90 inhibitors among several natural compounds and we focused on the iminosugar (+)-lentiginosine, a natural amyloglucosidases inhibitor, for its peculiar bioactivity profile. Characterization of Hsp90 inhibition was performed using a panel of chemical and biological approaches, including limited proteolysis, biochemical and cellular assays. Our result suggested that the middle domain of Hsp90, as opposed to its ATP-binding pocket, is a promising binding site for new classes of Hsp90 inhibitors with multi-target anti-cancer potential. PMID:22916240
Raf Kinase Inhibitory Protein Protects Cells against Locostatin-Mediated Inhibition of Migration

PubMed Central

Shemon, Anne N.; Eves, Eva M.; Clark, Matthew C.; Heil, Gary; Granovsky, Alexey; Zeng, Lingchun; Imamoto, Akira

2009-01-01

Background Raf Kinase Inhibitory Protein (RKIP, also PEBP1), a member of the Phosphatidylethanolamine Binding Protein family, negatively regulates growth factor signaling by the Raf/MAP kinase pathway. Since an organic compound, locostatin, was reported to bind RKIP and inhibit cell migration by a Raf-dependent mechanism, we addressed the role of RKIP in locostatin function. Methods/Findings We analyzed locostatin interaction with RKIP and examined the biological consequences of locostatin binding on RKIP function. NMR studies show that a locostatin precursor binds to the conserved phosphatidylethanolamine binding pocket of RKIP. However, drug binding to the pocket does not prevent RKIP association with its inhibitory target, Raf-1, nor affect RKIP phosphorylation by Protein Kinase C at a regulatory site. Similarly, exposure of wild type, RKIP-depleted HeLa cells or RKIP-deficient (RKIP−/−) mouse embryonic fibroblasts (MEFs) to locostatin has no effect on MAP kinase activation. Locostatin treatment of wild type MEFs causes inhibition of cell migration following wounding. RKIP deficiency impairs migration further, indicating that RKIP protects cells against locostatin-mediated inhibition of migration. Locostatin treatment of depleted or RKIP−/− MEFs reveals cytoskeletal disruption and microtubule abnormalities in the spindle. Conclusions/Significance These results suggest that locostatin's effects on cytoskeletal structure and migration are caused through mechanisms independent of its binding to RKIP and Raf/MAP kinase signaling. The protective effect of RKIP against drug inhibition of migration suggests a new role for RKIP in potentially sequestering toxic compounds that may have deleterious effects on cells. PMID:19551145
Sulforaphane inhibits the engagement of LPS with TLR4/MD2 complex by preferential binding to Cys133 in MD2.

PubMed

Koo, Jung Eun; Park, Zee-Yong; Kim, Nam Doo; Lee, Joo Young

2013-05-10

Toll-like receptors (TLRs) are key pattern-recognition receptors that recognize invading pathogens and non-microbial endogenous molecules to induce innate and adaptive immune responses. Since activation of TLRs is deeply implicated in the pathological progress of autoimmune diseases, sepsis, metabolic diseases, and cancer, modulation of TLR activity is considered one of the most important therapeutic approaches. Lipopolysaccharide (LPS), an endotoxin of gram-negative bacteria, is a well-known agonist for TLR4 triggering inflammation and septic shock. LPS interacts with TLR4 through binding to a hydrophobic pocket in myeloid differentiation 2 (MD2), a co-receptor of TLR4. In this study, we showed that sulforaphane (SFN) interfered with the binding of LPS to MD2 as determined by in vitro binding assay and co-immunoprecipitation of MD2 and LPS in a cell system. The inhibitory effect of SFN on the interaction of LPS and MD2 was reversed by thiol supplementation with N-acetyl-L-cysteine or dithiothreitol showing that the inhibitory effect of SFN is dependent on its thiol-modifying activity. Indeed, micro LC-MS/MS analysis showed that SFN preferentially formed adducts with Cys133 in the hydrophobic pocket of MD2, but not with Cys95 and Cys105. Molecular modeling showed that SFN bound to Cys133 blocks the engagement of LPS and lipid IVa to hydrophobic pocket of MD2. Our results demonstrate that SFN interrupts LPS engagement to TLR4/MD2 complex by direct binding to Cys133 in MD2. Our data suggest a novel mechanism for the anti-inflammatory activity of SFN, and provide a novel target for the regulation of TLR4-mediated inflammatory and immune responses by phytochemicals. Copyright © 2013 Elsevier Inc. All rights reserved.
Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site,more » confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.« less
Homology modeling and molecular dynamics simulation of N-myristoyltransferase from protozoan parasites: active site characterization and insights into rational inhibitor design

NASA Astrophysics Data System (ADS)

Sheng, Chunquan; Ji, Haitao; Miao, Zhenyuan; Che, Xiaoyin; Yao, Jianzhong; Wang, Wenya; Dong, Guoqiang; Guo, Wei; Lü, Jiaguo; Zhang, Wannian

2009-06-01

Myristoyl-CoA:protein N-myristoyltransferase (NMT) is a cytosolic monomeric enzyme that catalyzes the transfer of the myristoyl group from myristoyl-CoA to the N-terminal glycine of a number of eukaryotic cellular and viral proteins. Recent experimental data suggest NMT from parasites could be a promising new target for the design of novel antiparasitic agents with new mode of action. However, the active site topology and inhibitor specificity of these enzymes remain unclear. In this study, three-dimensional models of NMT from Plasmodium falciparum (PfNMT), Leishmania major (LmNMT) and Trypanosoma brucei (TbNMT) were constructed on the basis of the crystal structures of fungal NMTs using homology modeling method. The models were further refined by energy minimization and molecular dynamics simulations. The active sites of PfNMT, LmNMT and TbNMT were characterized by multiple copy simultaneous search (MCSS). MCSS functional maps reveal that PfNMT, LmNMT and TbNMT share a similar active site topology, which is defined by two hydrophobic pockets, a hydrogen-bonding (HB) pocket, a negatively-charged HB pocket and a positively-charged HB pocket. Flexible docking approaches were then employed to dock known inhibitors into the active site of PfNMT. The binding mode, structure-activity relationships and selectivity of inhibitors were investigated in detail. From the results of molecular modeling, the active site architecture and certain key residues responsible for inhibitor binding were identified, which provided insights for the design of novel inhibitors of parasitic NMTs.
Targeting kinase signaling pathways with constrained peptide scaffolds

PubMed Central

Hanold, Laura E.; Fulton, Melody D.; Kennedy, Eileen J.

2017-01-01

Kinases are amongst the largest families in the human proteome and serve as critical mediators of a myriad of cell signaling pathways. Since altered kinase activity is implicated in a variety of pathological diseases, kinases have become a prominent class of proteins for targeted inhibition. Although numerous small molecule and antibody-based inhibitors have already received clinical approval, several challenges may still exist with these strategies including resistance, target selection, inhibitor potency and in vivo activity profiles. Constrained peptide inhibitors have emerged as an alternative strategy for kinase inhibition. Distinct from small molecule inhibitors, peptides can provide a large binding surface area that allows them to bind shallow protein surfaces rather than defined pockets within the target protein structure. By including chemical constraints within the peptide sequence, additional benefits can be bestowed onto the peptide scaffold such as improved target affinity and target selectivity, cell permeability and proteolytic resistance. In this review, we highlight examples of diverse chemistries that are being employed to constrain kinase-targeting peptide scaffolds and highlight their application to modulate kinase signaling as well as their potential clinical implications. PMID:28185915
Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newberry, K.J.; Huffman, J.L.; Miller, M.C.

2009-05-22

BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets,more » that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.« less
High-throughput screening identifies small molecules that bind to the RAS:SOS:RAS complex and perturb RAS signaling.

PubMed

Burns, Michael C; Howes, Jennifer E; Sun, Qi; Little, Andrew J; Camper, DeMarco V; Abbott, Jason R; Phan, Jason; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

2018-05-01

K-RAS is mutated in approximately 30% of human cancers, resulting in increased RAS signaling and tumor growth. Thus, RAS is a highly validated therapeutic target, especially in tumors of the pancreas, lung and colon. Although directly targeting RAS has proven to be challenging, it may be possible to target other proteins involved in RAS signaling, such as the guanine nucleotide exchange factor Son of Sevenless (SOS). We have previously reported on the discovery of small molecules that bind to SOS1, activate SOS-mediated nucleotide exchange on RAS, and paradoxically inhibit ERK phosphorylation (Burns et al., PNAS, 2014). Here, we describe the discovery of additional, structurally diverse small molecules that also bind to SOS1 in the same pocket and elicit similar biological effects. We tested >160,000 compounds in a fluorescence-based assay to assess their effects on SOS-mediated nucleotide exchange. X-Ray structures revealed that these small molecules bind to the CDC25 domain of SOS1. Compounds that elicited high levels of nucleotide exchange activity in vitro increased RAS-GTP levels in cells, and inhibited phospho ERK levels at higher treatment concentrations. The identification of structurally diverse SOS1 binding ligands may assist in the discovery of new molecules designed to target RAS-driven tumors. Copyright © 2018 Elsevier Inc. All rights reserved.
Novel cyclo-peptides inhibit Ebola pseudotyped virus entry by targeting primed GP protein.

PubMed

Li, Quanjie; Ma, Ling; Yi, Dongrong; Wang, Han; Wang, Jing; Zhang, Yongxin; Guo, Ying; Li, Xiaoyu; Zhou, Jinming; Shi, Yi; Gao, George F; Cen, Shan

2018-07-01

Ebola virus (EBOV) causes fatal hemorrhagic fever with high death rates in human. Currently, there are no available clinically-approved prophylactic or therapeutic treatments. The recently solved crystal structure of cleavage-primed EBOV glycoprotein (GPcl) in complex with the C domain of endosomal protein Niemann-Pick C1 (NPC1) provides a new target for the development of EBOV entry inhibitors. In this work, a computational approach using docking and molecular dynamic simulations is carried out for the rational design of peptide inhibitors. A novel cyclo-peptide (Pep-3.3) was identified to target at the late stage of EBOV entry and exhibit specific inhibitory activity against EBOV-GP pseudotyped viruses, with 50% inhibitory concentration (IC50) of 5.1 μM. In vitro binding assay and molecular simulations revealed that Pep-3.3 binds to GPcl with a KD value of 69.7 μM, through interacting with predicted residues in the hydrophobic binding pocket of GPcl. Mutation of predicted residues T83 caused resistance to Pep-3.3 inhibition in viral infectivity, providing preliminary support for the model of the peptide binding to GPcl. This study demonstrates the feasibility of inhibiting EBOV entry by targeting GPcl with peptides. Copyright © 2018 Elsevier B.V. All rights reserved.
Tyrosine Kinase Inhibitors Induce Down-Regulation of c-Kit by Targeting the ATP Pocket

PubMed Central

Descarpentries, Clotilde; Frisan, Emilie; Adam, Kevin; Verdier, Frederique; Floquet, Célia; Dubreuil, Patrice; Lacombe, Catherine; Fontenay, Michaela; Mayeux, Patrick; Kosmider, Olivier

2013-01-01

The stem cell factor receptor (SCF) c-Kit plays a pivotal role in regulating cell proliferation and survival in many cell types. In particular, c-Kit is required for early amplification of erythroid progenitors, while it must disappear from cell surface for the cell entering the final steps of maturation in an erythropoietin-dependent manner. We initially observed that imatinib (IM), an inhibitor targeting the tyrosine kinase activity of c-Kit concomitantly down-regulated the expression of c-Kit and accelerated the Epo-driven differentiation of erythroblasts in the absence of SCF. We investigated the mechanism by which IM or related masitinib (MA) induce c-Kit down-regulation in the human UT-7/Epo cell line. We found that the down-regulation of c-Kit in the presence of IM or MA was inhibited by a pre-incubation with methyl-β-cyclodextrin suggesting that c-Kit was internalized in the absence of ligand. By contrast to SCF, the internalization induced by TKI was independent of the E3 ubiquitin ligase c-Cbl. Furthermore, c-Kit was degraded through lysosomal, but not proteasomal pathway. In pulse-chase experiments, IM did not modulate c-Kit synthesis or maturation. Analysis of phosphotyrosine peptides in UT-7/Epo cells treated or not with IM show that IM did not modify overall tyrosine phosphorylation in these cells. Furthermore, we showed that a T670I mutation preventing the full access of IM to the ATP binding pocket, did not allow the internalization process in the presence of IM. Altogether these data show that TKI-induced internalization of c-Kit is linked to a modification of the integrity of ATP binding pocket. PMID:23637779
Small-Molecule Modulators of Methyl-Lysine Binding for the CBX7 Chromodomain

DOE PAGES

Ren, Chunyan; Morohashi, Keita; Plotnikov, Alexander N.; ...

2015-02-05

Chromobox homolog 7 (CBX7) plays an important role in gene transcription in a wide array of cellular processes, ranging from stem cell self-renewal and differentiation to tumor progression. CBX7 functions through its N-terminal chromodomain (ChD), which recognizes tri-methylated lysine 27 of histone 3 (H3K27me3), a conserved epigenetic mark that signifies gene transcriptional repression. Here in this study, we report discovery of small molecules that inhibit CBX7ChD binding to H3K27me3. Our crystal structures reveal the binding modes of these molecules that compete against H3K27me3 binding through interactions with key residues in the methyl-lysine binding pocket of CBX7ChD. We further show thatmore » a lead compound MS37452, derepresses transcription of Polycomb repressive complex target gene p16/CDKN2A by displacing CBX7 binding to the INK4A/ARF locus in prostate cancer cells. Ultimately, these small molecules have the potential to be developed into high-potency chemical modulators that target CBX7 functions in gene transcription in different disease pathways.« less
DARC: Mapping Surface Topography by Ray-Casting for Effective Virtual Screening at Protein Interaction Sites.

PubMed

Gowthaman, Ragul; Miller, Sven A; Rogers, Steven; Khowsathit, Jittasak; Lan, Lan; Bai, Nan; Johnson, David K; Liu, Chunjing; Xu, Liang; Anbanandam, Asokan; Aubé, Jeffrey; Roy, Anuradha; Karanicolas, John

2016-05-12

Protein-protein interactions represent an exciting and challenging target class for therapeutic intervention using small molecules. Protein interaction sites are often devoid of the deep surface pockets presented by "traditional" drug targets, and crystal structures reveal that inhibitors typically engage these sites using very shallow binding modes. As a consequence, modern virtual screening tools developed to identify inhibitors of traditional drug targets do not perform as well when they are instead deployed at protein interaction sites. To address the need for novel inhibitors of important protein interactions, here we introduce an alternate docking strategy specifically designed for this regime. Our method, termed DARC (Docking Approach using Ray-Casting), matches the topography of a surface pocket "observed" from within the protein to the topography "observed" when viewing a potential ligand from the same vantage point. We applied DARC to carry out a virtual screen against the protein interaction site of human antiapoptotic protein Mcl-1 and found that four of the top-scoring 21 compounds showed clear inhibition in a biochemical assay. The Ki values for these compounds ranged from 1.2 to 21 μM, and each had ligand efficiency comparable to promising small-molecule inhibitors of other protein-protein interactions. These hit compounds do not resemble the natural (protein) binding partner of Mcl-1, nor do they resemble any known inhibitors of Mcl-1. Our results thus demonstrate the utility of DARC for identifying novel inhibitors of protein-protein interactions.
Charge effects in the selection of NPF motifs by the EH domain of EHD1.

PubMed

Henry, Gillian D; Corrigan, Daniel J; Dineen, Joseph V; Baleja, James D

2010-04-27

The Eps15 homology (EH) domain is found in proteins associated with endocytosis and vesicle trafficking. EH domains bind to their target proteins through an asparagine-proline-phenylalanine (NPF) motif. We have measured the interaction energetics of the EH domain from EHD1 with peptides derived from two of its binding partners: Rabenosyn-5 (Ac-GPSLNPFDEED-NH(2)) and Rab11-Fip2 (Ac-YESTNPFTAK-NH(2)). Heteronuclear single quantum coherence (HSQC) spectroscopy shows that both peptides bind in the canonical binding pocket of EHD1 EH and induce identical structural changes, yet the affinity of the negatively charged Ac-GPSLNPFDEED-NH(2) (K(a) = 8 x 10(5) M(-1)) is tighter by 2 orders of magnitude. The thermodynamic profiles (DeltaG, DeltaH, DeltaS) were measured for both peptides as a function of temperature. The enthalpies of binding are essentially identical, and the difference in affinity is a consequence of the difference in entropic cost. Ac-GPSLNPFDEED-NH(2) binding is salt-dependent, demonstrating an electrostatic component to the interaction, whereas Ac-YESTNPFTAK-NH(2) binding is independent of salt. Successive replacement of acidic residues in Ac-GPSLNPFDEED-NH(2) with neutral residues showed that all are important. Lysine side chains in EHD1 EH create a region of strong positive surface potential near the NPF binding pocket. Contributions by lysine epsilon-amino groups to complex formation with Ac-GPSLNPFDEED-NH(2) was shown using direct-observe (15)N NMR spectroscopy. These experiments have enabled us to define a new extended interaction motif for EHD proteins, N-P-F-[DE]-[DE]-[DE], which we have used to predict new interaction partners and hence broaden the range of cellular activities involving the EHD proteins.
Creating Novel Activated Factor XI Inhibitors through Fragment Based Lead Generation and Structure Aided Drug Design

PubMed Central

Fjellström, Ola; Akkaya, Sibel; Beisel, Hans-Georg; Eriksson, Per-Olof; Erixon, Karl; Gustafsson, David; Jurva, Ulrik; Kang, Daiwu; Karis, David; Knecht, Wolfgang; Nerme, Viveca; Nilsson, Ingemar; Olsson, Thomas; Redzic, Alma; Roth, Robert; Sandmark, Jenny; Tigerström, Anna; Öster, Linda

2015-01-01

Activated factor XI (FXIa) inhibitors are anticipated to combine anticoagulant and profibrinolytic effects with a low bleeding risk. This motivated a structure aided fragment based lead generation campaign to create novel FXIa inhibitor leads. A virtual screen, based on docking experiments, was performed to generate a FXIa targeted fragment library for an NMR screen that resulted in the identification of fragments binding in the FXIa S1 binding pocket. The neutral 6-chloro-3,4-dihydro-1H-quinolin-2-one and the weakly basic quinolin-2-amine structures are novel FXIa P1 fragments. The expansion of these fragments towards the FXIa prime side binding sites was aided by solving the X-ray structures of reported FXIa inhibitors that we found to bind in the S1-S1’-S2’ FXIa binding pockets. Combining the X-ray structure information from the identified S1 binding 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment and the S1-S1’-S2’ binding reference compounds enabled structure guided linking and expansion work to achieve one of the most potent and selective FXIa inhibitors reported to date, compound 13, with a FXIa IC50 of 1.0 nM. The hydrophilicity and large polar surface area of the potent S1-S1’-S2’ binding FXIa inhibitors compromised permeability. Initial work to expand the 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment towards the prime side to yield molecules with less hydrophilicity shows promise to afford potent, selective and orally bioavailable compounds. PMID:25629509

Tertiary structure prediction and identification of druggable pocket in the cancer biomarker – Osteopontin-c

PubMed Central

2014-01-01

Background Osteopontin (Eta, secreted sialoprotein 1, opn) is secreted from different cell types including cancer cells. Three splice variant forms namely osteopontin-a, osteopontin-b and osteopontin-c have been identified. The main astonishing feature is that osteopontin-c is found to be elevated in almost all types of cancer cells. This was the vital point to consider it for sequence analysis and structure predictions which provide ample chances for prognostic, therapeutic and preventive cancer research. Methods Osteopontin-c gene sequence was determined from Breast Cancer sample and was translated to protein sequence. It was then analyzed using various software and web tools for binding pockets, docking and druggability analysis. Due to the lack of homological templates, tertiary structure was predicted using ab-initio method server – I-TASSER and was evaluated after refinement using web tools. Refined structure was compared with known bone sialoprotein electron microscopic structure and docked with CD44 for binding analysis and binding pockets were identified for drug designing. Results Signal sequence of about sixteen amino acid residues was identified using signal sequence prediction servers. Due to the absence of known structures of similar proteins, three dimensional structure of osteopontin-c was predicted using I-TASSER server. The predicted structure was refined with the help of SUMMA server and was validated using SAVES server. Molecular dynamic analysis was carried out using GROMACS software. The final model was built and was used for docking with CD44. Druggable pockets were identified using pocket energies. Conclusions The tertiary structure of osteopontin-c was predicted successfully using the ab-initio method and the predictions showed that osteopontin-c is of fibrous nature comparable to firbronectin. Docking studies showed the significant similarities of QSAET motif in the interaction of CD44 and osteopontins between the normal and splice variant forms of osteopontins and binding pockets analyses revealed several pockets which paved the way to the identification of a druggable pocket. PMID:24401206
Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells.

PubMed

Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

2017-12-14

Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations.
Berberine binds RXRα to suppress β-catenin signaling in colon cancer cells

PubMed Central

Ruan, H; Zhan, Y Y; Hou, J; Xu, B; Chen, B; Tian, Y; Wu, D; Zhao, Y; Zhang, Y; Chen, X; Mi, P; Zhang, L; Zhang, S; Wang, X; Cao, H; Zhang, W; Wang, H; Li, H; Su, Y; Zhang, X K; Hu, T

2017-01-01

Berberine, an isoquinoline alkaloid, is a traditional oriental medicine used to treat diarrhea and gastroenteritis. Recently, we reported that it could inhibit the growth of intestinal polyp in animals and in patients with the familial adenomatous polyposis by downregulating β-catenin signaling. However, the intracellular target mediating the effects of berberine remains elusive. Here, we provide evidence that berberine inhibits β-catenin function via directly binding to a unique region comprising residues Gln275, Arg316 and Arg371 in nuclear receptor retinoid X receptor alpha (RXRα), where berberine concomitantly binding to and synergistically activating RXRα with 9-cis-retinoic acid (9-cis-RA), a natural ligand binding to the classical ligand-binding pocket of RXRα. Berberine binding promotes RXRα interaction with nuclear β-catenin, leading to c-Cbl mediated degradation of β-catenin, and consequently inhibits the proliferation of colon cancer cells. Furthermore, berberine suppresses the growth of human colon carcinoma xenograft in nude mice in an RXRα-dependent manner. Together, our study not only identifies RXRα as a direct protein target for berberine but also dissects their binding mode and validates that berberine indeed suppresses β-catenin signaling and cell growth in colon cancer via binding RXRα, which provide new strategies for the design of new RXRα-based antitumor agents and drug combinations. PMID:28846104
Structure of the human M2 muscarinic acetylcholine receptor bound to an antagonist

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haga, Kazuko; Kruse, Andrew C.; Asada, Hidetsugu

2012-03-15

The parasympathetic branch of the autonomic nervous system regulates the activity of multiple organ systems. Muscarinic receptors are G-protein-coupled receptors that mediate the response to acetylcholine released from parasympathetic nerves. Their role in the unconscious regulation of organ and central nervous system function makes them potential therapeutic targets for a broad spectrum of diseases. The M2 muscarinic acetylcholine receptor (M2 receptor) is essential for the physiological control of cardiovascular function through activation of G-protein-coupled inwardly rectifying potassium channels, and is of particular interest because of its extensive pharmacological characterization with both orthosteric and allosteric ligands. Here we report the structuremore » of the antagonist-bound human M2 receptor, the first human acetylcholine receptor to be characterized structurally, to our knowledge. The antagonist 3-quinuclidinyl-benzilate binds in the middle of a long aqueous channel extending approximately two-thirds through the membrane. The orthosteric binding pocket is formed by amino acids that are identical in all five muscarinic receptor subtypes, and shares structural homology with other functionally unrelated acetylcholine binding proteins from different species. A layer of tyrosine residues forms an aromatic cap restricting dissociation of the bound ligand. A binding site for allosteric ligands has been mapped to residues at the entrance to the binding pocket near this aromatic cap. The structure of the M2 receptor provides insights into the challenges of developing subtype-selective ligands for muscarinic receptors and their propensity for allosteric regulation.« less
Molecular Docking Studies of Catechin and Its Derivatives as Anti-bacterial Inhibitor for Glucosamine-6-Phosphate Synthase

NASA Astrophysics Data System (ADS)

Fikrika, H.; Ambarsari, L.; Sumaryada, T.

2016-01-01

Molecular docking simulation of catechin and its derivatives on Glucosamine-6- Phosphate Synthase (GlmS) has been performed in this research. GlmS inhibition by a particular ligand will suppress the production of bacterial cell wall and significantly reduce the population of invading bacteria. In this study, catechin derivatives i.e epicatechin, galloatechin and epigalloatechin were found to have stronger binding affinities as compared to natural ligand of GlmS, Fructose-6-Phosphate (F6P). Those three ligands were docked on the same pocket in GlmS target as F6P, with 70% binding sites similarity. Based on the docking results, gallocatechin turns out to be the most potent ligand for anti-bacterial agent with ΔG= -8.00 kcal/mol. The docking between GlmS and catechin derivatives are characterized by a constant present of a strong hydrogen bond between functional group O3 and Ser-349. This hydrogen bond most likely plays a significant role in the docking mechanism and binding modes selection. The surprising result is catechin itself exhibited a quite strong binding with GlmS (ΔG= -7.80 kcal.mol), but docked on a completely different pocket compared to other ligands. This results suggest that catechin might still have a curing effect but with a completely different pathway and mechanism as compared to its derivatives.
ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

PubMed Central

Lee, Jeong-Oog; Kim, Mi-Yeon

2015-01-01

Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111
Active sites prediction and binding analysis E1-E2 protein human papillomavirus with biphenylsulfonacetic acid

NASA Astrophysics Data System (ADS)

Iryani, I.; Amelia, F.; Iswendi, I.

2018-04-01

Cervix cancer triggered by Human papillomavirus infection is the second cause to woman death in worldwide. The binding site of E1-E2 protein of HPV 16 is not known from a 3-D structure yet, so in this study we address this issue to study the structure of E1-E2 protein from Human papillomavirus type 16 and to find its potential binding sites using biphenylsulfonacetic acid as inhibitor. Swiss model was used for 3D structure prediction and PDB: 2V9P (E1 protein) and 2NNU (E2 protein) having 52.32% and 100% identity respectively was selected as a template. The 3D model structure developed of E1 and E2 in the core and allowed regions were 99.2% and 99.5%. The ligand binding sites were predicted using online server meta pocket 2.0 and MOE 2009.10 was used for docking. E1-and E2 protein of HPV-16 has three potential binding site that can interact with the inhibitors. The Docking biphenylsulfonacetic acid using these binding sites shows that ligand interact with the protein through hydrogen bonds on Lys 403, Arg 410, His 551 in the first pocket, on Tyr 32, Leu 99 in the second pocket, and Lys 558m Lys 517 in the third pocket.
Light-up fluorescent probes utilizing binding behavior of perylenediimide derivatives to a hydrophobic pocket within DNA.

PubMed

Takada, Tadao; Yamaguchi, Kosato; Tsukamoto, Suguru; Nakamura, Mitsunobu; Yamana, Kazushige

2014-08-21

Here we study the binding behavior of perylenediimide () derivatives to a hydrophobic pocket created inside DNA and their photochemical properties capable of designing a light-up fluorescent sensor for short single-stranded DNA or RNA. The perylenediimide derivative with alkoxy groups () suppressing electron transfer quenching was examined. The bound randomly to DNA showed negligible fluorescence due to the aggregation-induced quenching, whereas the bound to the pocket as a monomeric form showed more than 100-fold fluorescence enhancement. Switching the binding states of the corresponded to a change in the fluorescence response for the hybridization event, which allowed us to design a fluorescent sensor of nucleic acids with a nanomolar detection limit.
Structural Basis of Membrane Targeting by the Dock180 Family of Rho Family Guanine Exchange Factors (Rho-GEFs)*

PubMed Central

Premkumar, Lakshmanane; Bobkov, Andrey A.; Patel, Manishha; Jaroszewski, Lukasz; Bankston, Laurie A.; Stec, Boguslaw; Vuori, Kristiina; Côté, Jean-Francois; Liddington, Robert C.

2010-01-01

The Dock180 family of atypical Rho family guanine nucleotide exchange factors (Rho-GEFs) regulate a variety of processes involving cellular or subcellular polarization, including cell migration and phagocytosis. Each contains a Dock homology region-1 (DHR-1) domain that is required to localize its GEF activity to a specific membrane compartment where levels of phosphatidylinositol (3,4,5)-trisphosphate (PtdIns(3,4,5)P3) are up-regulated by the local activity of PtdIns 3-kinase. Here we define the structural and energetic bases of phosphoinositide specificity by the DHR-1 domain of Dock1 (a GEF for Rac1), and show that DHR-1 utilizes a C2 domain scaffold and surface loops to create a basic pocket on its upper surface for recognition of the PtdIns(3,4,5)P3 head group. The pocket has many of the characteristics of those observed in pleckstrin homology domains. We show that point mutations in the pocket that abolish phospholipid binding in vitro ablate the ability of Dock1 to induce cell polarization, and propose a model that brings together recent mechanistic and structural studies to rationalize the central role of DHR-1 in dynamic membrane targeting of the Rho-GEF activity of Dock180. PMID:20167601
Protein-ligand docking using fitness learning-based artificial bee colony with proximity stimuli.

PubMed

Uehara, Shota; Fujimoto, Kazuhiro J; Tanaka, Shigenori

2015-07-07

Protein-ligand docking is an optimization problem, which aims to identify the binding pose of a ligand with the lowest energy in the active site of a target protein. In this study, we employed a novel optimization algorithm called fitness learning-based artificial bee colony with proximity stimuli (FlABCps) for docking. Simulation results revealed that FlABCps improved the success rate of docking, compared to four state-of-the-art algorithms. The present results also showed superior docking performance of FlABCps, in particular for dealing with highly flexible ligands and proteins with a wide and shallow binding pocket.
Structure-Based Design of Novel Dihydroalkoxybenzyloxopyrimidine Derivatives as Potent Nonnucleoside Inhibitors of the Human Immunodeficiency Virus Reverse Transcriptase

PubMed Central

Sudbeck, Elise A.; Mao, Chen; Vig, Rakesh; Venkatachalam, T. K.; Tuel-Ahlgren, Lisa; Uckun, Fatih M.

1998-01-01

Two highly potent dihydroalkoxybenzyloxopyrimidine (DABO) derivatives targeting the nonnucleoside inhibitor (NNI) binding site of human immunodeficiency virus (HIV) reverse transcriptase (RT) have been designed based on the structure of the NNI binding pocket and tested for anti-HIV activity. Our lead DABO derivative, 5-isopropyl-2-[(methylthiomethyl)thio]-6-(benzyl)-pyrimidin-4-(1H)-one, elicited potent inhibitory activity against purified recombinant HIV RT and abrogated HIV replication in peripheral blood mononuclear cells at nanomolar concentrations (50% inhibitory concentration, <1 nM) but showed no detectable cytotoxicity at concentrations as high as 100 μM. PMID:9835518
Riboswitches: emerging themes in RNA structure and function.

PubMed

Montange, Rebecca K; Batey, Robert T

2008-01-01

Riboswitches are RNAs capable of binding cellular metabolites using a diverse array of secondary and tertiary structures to modulate gene expression. The recent determination of the three-dimensional structures of parts of six different riboswitches illuminates common features that allow riboswitches to be grouped into one of two types. Type I riboswitches, as exemplified by the purine riboswitch, are characterized by a single, localized binding pocket supported by a largely pre-established global fold. This arrangement limits ligand-induced conformational changes in the RNA to a small region. In contrast, Type II riboswitches, such as the thiamine pyrophosphate riboswitch, contain binding pockets split into at least two spatially distinct sites. As a result, binding induces both local changes to the binding pocket and global architecture. Similar organizational themes are found in other noncoding RNAs, making it possible to begin to build a hierarchical classification of RNA structure based on the spatial organization of their active sites and associated secondary structural elements.
Deciphering Cryptic Binding Sites on Proteins by Mixed-Solvent Molecular Dynamics.

PubMed

Kimura, S Roy; Hu, Hai Peng; Ruvinsky, Anatoly M; Sherman, Woody; Favia, Angelo D

2017-06-26

In recent years, molecular dynamics simulations of proteins in explicit mixed solvents have been applied to various problems in protein biophysics and drug discovery, including protein folding, protein surface characterization, fragment screening, allostery, and druggability assessment. In this study, we perform a systematic study on how mixtures of organic solvent probes in water can reveal cryptic ligand binding pockets that are not evident in crystal structures of apo proteins. We examine a diverse set of eight PDB proteins that show pocket opening induced by ligand binding and investigate whether solvent MD simulations on the apo structures can induce the binding site observed in the holo structures. The cosolvent simulations were found to induce conformational changes on the protein surface, which were characterized and compared with the holo structures. Analyses of the biological systems, choice of probes and concentrations, druggability of the resulting induced pockets, and application to drug discovery are discussed here.
Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

DOE PAGES

Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong; ...

2016-09-01

DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less
Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Cuong The; Tanaka, Kiwamu; Cao, Yangrong

DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecularmore » interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. Finally, the in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues.« less
Ligand-induced expansion of the S1' site in the anthrax toxin lethal factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maize, Kimberly M.; Kurbanov, Elbek K.; Johnson, Rodney L.

2016-07-05

The Bacillus anthracis lethal factor (LF) is one component of a tripartite exotoxin partly responsible for persistent anthrax cytotoxicity after initial bacterial infection. Inhibitors of the zinc metalloproteinase have been investigated as potential therapeutic agents, but LF is a challenging target because inhibitors lack sufficient selectivity or possess poor pharmaceutical properties. These structural studies reveal an alternate conformation of the enzyme, induced upon binding of specific inhibitors, that opens a previously unobserved deep pocket termed S1'* which might afford new opportunities to design selective inhibitors that target this subsite.
Resistance of Akt kinases to dephosphorylation through ATP-dependent conformational plasticity.

PubMed

Chan, Tung O; Zhang, Jin; Rodeck, Ulrich; Pascal, John M; Armen, Roger S; Spring, Maureen; Dumitru, Calin D; Myers, Valerie; Li, Xue; Cheung, Joseph Y; Feldman, Arthur M

2011-11-15

Phosphorylation of a threonine residue (T308 in Akt1) in the activation loop of Akt kinases is a prerequisite for deregulated Akt activity frequently observed in neoplasia. Akt phosphorylation in vivo is balanced by the opposite activities of kinases and phosphatases. Here we describe that targeting Akt kinase to the cell membrane markedly reduced sensitivity of phosphorylated Akt to dephosphorylation by protein phosphatase 2A. This effect was amplified by occupancy of the ATP binding pocket by either ATP or ATP-competitive inhibitors. Mutational analysis revealed that R273 in Akt1 and the corresponding R274 in Akt2 are essential for shielding T308 in the activation loop against dephosphorylation. Thus, occupancy of the nucleotide binding pocket of Akt kinases enables intramolecular interactions that restrict phosphatase access and sustain Akt phosphorylation. This mechanism provides an explanation for the "paradoxical" Akt hyperphosphorylation induced by ATP-competitive inhibitor, A-443654. The lack of phosphatase resistance further contributes insight into the mechanism by which the human Akt2 R274H missense mutation may cause autosomal-dominant diabetes mellitus.
Structure-Based Design of an Iminoheterocyclic β-Site Amyloid Precursor Protein Cleaving Enzyme (BACE) Inhibitor that Lowers Central Aβ in Nonhuman Primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mandal, Mihirbaran; Wu, Yusheng; Misiaszek, Jeffrey

2016-04-14

We describe successful efforts to optimize the in vivo profile and address off-target liabilities of a series of BACE1 inhibitors represented by 6 that embodies the recently validated fused pyrrolidine iminopyrimidinone scaffold. Employing structure-based design, truncation of the cyanophenyl group of 6 that binds in the S3 pocket of BACE1 followed by modification of the thienyl group in S1 was pursued. Optimization of the pyrimidine substituent that binds in the S2'–S2'' pocket of BACE1 remediated time-dependent CYP3A4 inhibition of earlier analogues in this series and imparted high BACE1 affinity. These efforts resulted in the discovery of difluorophenyl analogue 9 (MBi-4),more » which robustly lowered CSF and cortex Aβ40 in both rats and cynomolgus monkeys following a single oral dose. Compound 9 represents a unique molecular shape among BACE inhibitors reported to potently lower central Aβ in nonrodent preclinical species.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Wei; Leal, Walter S.

Pheromone-binding proteins (PBPs) are involved in the uptake of pheromones from pores on the antennae, transport through an aqueous environment surrounding the olfactory receptor neurons, and fast delivery to pheromone receptors. We tested the hypothesis that a C-terminal segment and a flexible loop are involved in the release of pheromones to membrane-bound receptors. We expressed in Escherichia coli 11 mutants of the PBP from the silkworm moth, BmorPBP, taking into consideration structural differences between the forms with high and low binding affinity. The N-terminus was truncated and His-69, His-70 and His-95 at the base of a flexible loop, and amore » cluster of acidic residues at the C-terminus were mutated. Binding assays and circular dichroism analyses support a mechanism involving protonation of acidic residues Asp-132 and Glu-141 at the C-terminus and histidines, His-70 and His-95, in the base of a loop covering the binding pocket. The former leads to the formation of a new {alpha}-helix, which competes with pheromone for the binding pocket, whereas positive charge repulsion of the histidines opens the opposite side of the binding pocket.« less
A molecular dynamics simulation study of the association of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate enantiomers with a chiral molecular micelle

NASA Astrophysics Data System (ADS)

Morris, Kevin F.; Billiot, Eugene J.; Billiot, Fereshteh H.; Gladis, Ashley A.; Lipkowitz, Kenny B.; Southerland, William M.; Fang, Yayin

2014-08-01

Molecular dynamics (MD) simulations were used to investigate the binding of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate (BNP) enantiomers to the molecular micelle poly-(sodium undecyl-(L,L)-leucine-valine) (poly(SULV)). Poly(SULV) is used as a chiral selector in capillary electrophoresis separations. Four poly(SULV) binding pockets were identified and either (R)-BNP or (S)-BNP were docked into each pocket. MD simulations were then used to identify the preferred BNP binding site. Within the preferred site, both enantiomers formed hydrogen bonds with poly(SULV) and penetrated into the poly(SULV) core. Comparisons of BNP enantiomer binding to the preferred poly(SULV) pocket showed that (S)-BNP formed stronger hydrogen bonds, moved deeper into the binding site, and had a lower poly(SULV) binding free energy than the (R) enantiomer. Finally, MD simulation results were in agreement with capillary electrophoresis and NMR experiments. Each technique showed (S)-BNP interacted more strongly with poly(SULV) than (R)-BNP and that the site of chiral recognition was near the poly(SULV) leucine chiral center.

Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

PubMed

Lin, C H; Patel, D J

1997-11-01

Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.
An automated system for the analysis of G protein-coupled receptor transmembrane binding pockets: alignment, receptor-based pharmacophores, and their application.

PubMed

Kratochwil, Nicole A; Malherbe, Pari; Lindemann, Lothar; Ebeling, Martin; Hoener, Marius C; Mühlemann, Andreas; Porter, Richard H P; Stahl, Martin; Gerber, Paul R

2005-01-01

G protein-coupled receptors (GPCRs) share a common architecture consisting of seven transmembrane (TM) domains. Various lines of evidence suggest that this fold provides a generic binding pocket within the TM region for hosting agonists, antagonists, and allosteric modulators. Here, a comprehensive and automated method allowing fast analysis and comparison of these putative binding pockets across the entire GPCR family is presented. The method relies on a robust alignment algorithm based on conservation indices, focusing on pharmacophore-like relationships between amino acids. Analysis of conservation patterns across the GPCR family and alignment to the rhodopsin X-ray structure allows the extraction of the amino acids lining the TM binding pocket in a so-called ligand binding pocket vector (LPV). In a second step, LPVs are translated to simple 3D receptor pharmacophore models, where each amino acid is represented by a single spherical pharmacophore feature and all atomic detail is omitted. Applications of the method include the assessment of selectivity issues, support of mutagenesis studies, and the derivation of rules for focused screening to identify chemical starting points in early drug discovery projects. Because of the coarseness of this 3D receptor pharmacophore model, however, meaningful scoring and ranking procedures of large sets of molecules are not justified. The LPV analysis of the trace amine-associated receptor family and its experimental validation is discussed as an example. The value of the 3D receptor model is demonstrated for a class C GPCR family, the metabotropic glutamate receptors.
Targeting YAP/TAZ-TEAD protein-protein interactions using fragment-based and computational modeling approaches

PubMed Central

Verma, Chandra

2017-01-01

The Hippo signaling pathway, which is implicated in the regulation of organ size, has emerged as a potential target for the development of cancer therapeutics. YAP, TAZ (transcription co-activators) and TEAD (transcription factor) are the downstream transcriptional machinery and effectors of the pathway. Formation of the YAP/TAZ-TEAD complex leads to transcription of growth-promoting genes. Conversely, disrupting the interactions of the complex decreases cell proliferation. Herein, we screened a 1000-member fragment library using Thermal Shift Assay and identified a hit fragment. We confirmed its binding at the YAP/TAZ-TEAD interface by X-ray crystallography, and showed that it occupies the same hydrophobic pocket as a conserved phenylalanine of YAP/TAZ. This hit fragment serves as a scaffold for the development of compounds that have the potential to disrupt YAP/TAZ-TEAD interactions. Structure-activity relationship studies and computational modeling were also carried out to identify more potent compounds that may bind at this validated druggable binding site. PMID:28570566
Understanding the Basis of Drug Resistance of the Mutants of αβ-Tubulin Dimer via Molecular Dynamics Simulations

PubMed Central

Natarajan, Kathiresan; Senapati, Sanjib

2012-01-01

The vital role of tubulin dimer in cell division makes it an attractive drug target. Drugs that target tubulin showed significant clinical success in treating various cancers. However, the efficacy of these drugs is attenuated by the emergence of tubulin mutants that are unsusceptible to several classes of tubulin binding drugs. The molecular basis of drug resistance of the tubulin mutants is yet to be unraveled. Here, we employ molecular dynamics simulations, protein-ligand docking, and MMPB(GB)SA analyses to examine the binding of anticancer drugs, taxol and epothilone to the reported point mutants of tubulin - T274I, R282Q, and Q292E. Results suggest that the mutations significantly alter the tubulin structure and dynamics, thereby weaken the interactions and binding of the drugs, primarily by modifying the M loop conformation and enlarging the pocket volume. Interestingly, these mutations also affect the tubulin distal sites that are associated with microtubule building processes. PMID:22879949
Disoxaril mutants of Coxsackievirus B1: phenotypic characteristics and analysis of the target VP1 gene.

PubMed

Nikolova, Ivanka; Galabov, Angel S; Petkova, Rumena; Chakarov, Stoyan; Atanasov, Boris

2011-01-01

Disoxaril inhibits enterovirus replication by binding to the hydrophobic pocket within the VP1 coat protein, thus stabilizing the virion and blocking its uncoating. Disoxaril-resistant (RES) mutants of the Coxsackievirus B1 (CVB1/RES) were derived from the wild disoxaril-sensitive (SOF) strain (CVB1/SOF) using a selection approach. A disoxaril-dependent (DEP) mutant (CVB1/DEP) was obtained following nine consecutive passages of the disoxaril-resistant mutant in the presence of disoxaril. Phenotypic characteristics of the disoxaril mutants were investigated. A timing-of-addition study of the CVB1/DEP replication demonstrated that in the absence of disoxaril the virus particle assembly stopped. VP1 RNA sequences of disoxaril mutants were compared with the existing Gen Bank CVB1 reference structure. The amino acid sequence of a large VP1 196-258 peptide (disoxaril-binding region) of CVB1/RES was significantly different from that of the CVB1/SOF. Crucially important changes in CVB1/RES were two point mutations, M213H and F237L, both in the ligand-binding pocket. The sequence analysis of the CVB1/DEP showed some reversion to CVB1/SOF. The amino acid sequences of the three VP1 proteins are presented.
Structure-Guided Strategy for the Development of Potent Bivalent ERK Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lechtenberg, Bernhard C.; Mace, Peter D.; Sessions, E. Hampton

ERK is the effector kinase of the RAS-RAF-MEK-ERK signaling cascade, which promotes cell transformation and malignancy in many cancers and is thus a major drug target in oncology. Kinase inhibitors targeting RAF or MEK are already used for the treatment of certain cancers, such as melanoma. Although the initial response to these drugs can be dramatic, development of drug resistance is a major challenge, even with combination therapies targeting both RAF and MEK. Importantly, most resistance mechanisms still rely on activation of the downstream effector kinase ERK, making it a promising target for drug development efforts. Here, we report themore » design and structural/functional characterization of a set of bivalent ERK inhibitors that combine a small molecule inhibitor that binds to the ATP-binding pocket with a peptide that selectively binds to an ERK protein interaction surface, the D-site recruitment site (DRS). Our studies show that the lead bivalent inhibitor, SBP3, has markedly improved potency compared to the small molecule inhibitor alone. Unexpectedly, we found that SBP3 also binds to several ERK-related kinases that contain a DRS, highlighting the importance of experimentally verifying the predicted specificity of bivalent inhibitors. However, SBP3 does not target any other kinases belonging to the same CMGC branch of the kinome. Additionally, our modular click chemistry inhibitor design facilitates the generation of different combinations of small molecule inhibitors with ERK-targeting peptides.« less
ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

PubMed

Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

2014-06-01

In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. Copyright © 2014 Elsevier B.V. All rights reserved.
ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

PubMed Central

Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

2014-01-01

In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922
The Druggable Pocketome of Corynebacterium diphtheriae: A New Approach for in silico Putative Druggable Targets

PubMed Central

Hassan, Syed S.; Jamal, Syed B.; Radusky, Leandro G.; Tiwari, Sandeep; Ullah, Asad; Ali, Javed; Behramand; de Carvalho, Paulo V. S. D.; Shams, Rida; Khan, Sabir; Figueiredo, Henrique C. P.; Barh, Debmalya; Ghosh, Preetam; Silva, Artur; Baumbach, Jan; Röttger, Richard; Turjanski, Adrián G.; Azevedo, Vasco A. C.

2018-01-01

Diphtheria is an acute and highly infectious disease, previously regarded as endemic in nature but vaccine-preventable, is caused by Corynebacterium diphtheriae (Cd). In this work, we used an in silico approach along the 13 complete genome sequences of C. diphtheriae followed by a computational assessment of structural information of the binding sites to characterize the “pocketome druggability.” To this end, we first computed the “modelome” (3D structures of a complete genome) of a randomly selected reference strain Cd NCTC13129; that had 13,763 open reading frames (ORFs) and resulted in 1,253 (∼9%) structure models. The amino acid sequences of these modeled structures were compared with the remaining 12 genomes and consequently, 438 conserved protein sequences were obtained. The RCSB-PDB database was consulted to check the template structures for these conserved proteins and as a result, 401 adequate 3D models were obtained. We subsequently predicted the protein pockets for the obtained set of models and kept only the conserved pockets that had highly druggable (HD) values (137 across all strains). Later, an off-target host homology analyses was performed considering the human proteome using NCBI database. Furthermore, the gene essentiality analysis was carried out that gave a final set of 10-conserved targets possessing highly druggable protein pockets. To check the target identification robustness of the pipeline used in this work, we crosschecked the final target list with another in-house target identification approach for C. diphtheriae thereby obtaining three common targets, these were; hisE-phosphoribosyl-ATP pyrophosphatase, glpX-fructose 1,6-bisphosphatase II, and rpsH-30S ribosomal protein S8. Our predicted results suggest that the in silico approach used could potentially aid in experimental polypharmacological target determination in C. diphtheriae and other pathogens, thereby, might complement the existing and new drug-discovery pipelines. PMID:29487617
Asymmetric interactions in the adenosine-binding pockets of the MS2 coat protein dimer

PubMed Central

Powell, Amy J; Peabody, David S

2001-01-01

Background The X-ray structure of the MS2 coat protein-operator RNA complex reveals the existence of quasi-synmetric interactions of adenosines -4 and -10 in pockets formed on different subunits of the coat protein dimer. Both pockets utilize the same five amino acid residues, namely Val29, Thr45, Ser47, Thr59, and Lys61. We call these sites the adenosine-binding pockets. Results We present here a heterodimer complementation analysis of the contributions of individual A-pocket amino acids to the binding of A-4 and A-10 in different halves of the dimer. Various substitutions of A-pocket residues were introduced into one half of single-chain coat protein heterodimers where they were tested for their abilities to complement Y85H or T91I substitutions (defects in the A-4 and A-10 half-sites, respectively) present in the other dimer half. Conclusions These experiments provide functional tests of interactions predicted from structural analyses, demonstrating the importance of certain amino acid-nucleotide contacts observed in the crystal structure, and showing that others make little or no contribution to the stability of the complex. In summary, Val29 and Lys61 form important stabilizing interactions with both A-4 and A-10. Meanwhile, Ser47 and Thr59 interact primarily with A-10. The important interactions with Thr45 are restricted to A-4. PMID:11504563
Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

PubMed Central

Raman, E. Prabhu; MacKerell, Alexander D.

2015-01-01

The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202
Structure of calmodulin complexed with an olfactory CNG channel fragment and role of the central linker: residual dipolar couplings to evaluate calmodulin binding modes outside the kinase family.

PubMed

Contessa, Gian Marco; Orsale, Maria; Melino, Sonia; Torre, Vincent; Paci, Maurizio; Desideri, Alessandro; Cicero, Daniel O

2005-03-01

The NMR high-resolution structure of calmodulin complexed with a fragment of the olfactory cyclic-nucleotide gated channel is described. This structure shows features that are unique for this complex, including an active role of the linker connecting the N- and C-lobes of calmodulin upon binding of the peptide. Such linker is not only involved in the formation of an hydrophobic pocket to accommodate a bulky peptide residue, but it also provides a positively charged region complementary to a negative charge of the target. This complex of calmodulin with a target not belonging to the kinase family was used to test the residual dipolar coupling (RDC) approach for the determination of calmodulin binding modes to peptides. Although the complex here characterized belongs to the (1--14) family, high Q values were obtained with all the 1:1 complexes for which crystalline structures are available. Reduction of the RDC data set used for the correlation analysis to structured regions of the complex allowed a clear identification of the binding mode. Excluded regions comprise calcium binding loops and loops connecting the EF-hand motifs.
Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses

PubMed Central

Hendricks, Gabriel L.; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C.; Viswanathan, Karthik; Albers, Leila; Comolli, James C.; Shriver, Zachary; Knipe, David M.; Kurt-Jones, Evelyn A.; Fygenson, Deborah K.; Trevejo, Jose M.

2016-01-01

Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as ‘molecular sinks’ and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. PMID:25637710
Crystal structures reveal an induced-fit binding of a substrate-like Aza-peptide epoxide to SARS coronavirus main peptidase.

PubMed

Lee, Ting-Wai; Cherney, Maia M; Liu, Jie; James, Karen Ellis; Powers, James C; Eltis, Lindsay D; James, Michael N G

2007-02-23

The SARS coronavirus main peptidase (SARS-CoV M(pro)) plays an essential role in the life-cycle of the virus and is a primary target for the development of anti-SARS agents. Here, we report the crystal structure of M(pro) at a resolution of 1.82 Angstroms, in space group P2(1) at pH 6.0. In contrast to the previously reported structure of M(pro) in the same space group at the same pH, the active sites and the S1 specificity pockets of both protomers in the structure of M(pro) reported here are in the catalytically competent conformation, suggesting their conformational flexibility. We report two crystal structures of M(pro) having an additional Ala at the N terminus of each protomer (M(+A(-1))(pro)), both at a resolution of 2.00 Angstroms, in space group P4(3)2(1)2: one unbound and one bound by a substrate-like aza-peptide epoxide (APE). In the unbound form, the active sites and the S1 specificity pockets of both protomers of M(+A(-1))(pro) are observed in a collapsed (catalytically incompetent) conformation; whereas they are in an open (catalytically competent) conformation in the APE-bound form. The observed conformational flexibility of the active sites and the S1 specificity pockets suggests that these parts of M(pro) exist in dynamic equilibrium. The structural data further suggest that the binding of APE to M(pro) follows an induced-fit model. The substrate likely also binds in an induced-fit manner in a process that may help drive the catalytic cycle.
Characterization of Protein Tyrosine Phosphatase 1B Inhibition by Chlorogenic Acid and Cichoric Acid.

PubMed

Lipchock, James M; Hendrickson, Heidi P; Douglas, Bonnie B; Bird, Kelly E; Ginther, Patrick S; Rivalta, Ivan; Ten, Nicholas S; Batista, Victor S; Loria, J Patrick

2017-01-10

Protein tyrosine phosphatase 1B (PTP1B) is a known regulator of the insulin and leptin signaling pathways and is an active target for the design of inhibitors for the treatment of type II diabetes and obesity. Recently, cichoric acid (CHA) and chlorogenic acid (CGA) were predicted by docking methods to be allosteric inhibitors that bind distal to the active site. However, using a combination of steady-state inhibition kinetics, solution nuclear magnetic resonance experiments, and molecular dynamics simulations, we show that CHA is a competitive inhibitor that binds in the active site of PTP1B. CGA, while a noncompetitive inhibitor, binds in the second aryl phosphate binding site, rather than the predicted benzfuran binding pocket. The molecular dynamics simulations of the apo enzyme and cysteine-phosphoryl intermediate states with and without bound CGA suggest CGA binding inhibits PTP1B by altering hydrogen bonding patterns at the active site. This study provides a mechanistic understanding of the allosteric inhibition of PTP1B.
Identification of an allosteric binding site for RORγt inhibition

PubMed Central

Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc

2015-01-01

RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126
Interaction of human synovial phospholipase A2 with mixed lipid bilayers: a coarse-grain and all-atom molecular dynamics simulation study.

PubMed

Qin, Shan-Shan; Yu, Yang-Xin; Li, Qi-Kai; Yu, Zhi-Wu

2013-02-26

Human secreted phospholipase A2s have been shown to promote inflammation in mammals by catalyzing the first step of the arachidonic acid pathway by breaking down phospholipids, producing fatty acids, including arachidonic acid. They bind to the membrane water interface to access their phospholipid substrates from the membrane. Their binding modes on membrane surfaces are regulated by diverse factors, including membrane charge, fluidity, and heterogeneity. The influence of these factors on the binding modes of the enzymes is not well understood. Here we have studied several human synovial phospholipase A2 (hs-PLA2)/mixed bilayer systems through a combined coarse-grain and all-atom molecular dynamics simulation. It was found that hydrophobic residues Leu2, Val3, Ala18, Leu19, Phe23, Gly30, and Phe63 that form the edge of the entrance of the hydrophobic binding pocket in hs-PLA2 tend to penetrate into the hydrophobic area of lipid bilayers, and more than half of the total amino acid residues make contact with the lipid headgroups. Each enzyme molecule forms 19-38 hydrogen bonds with the bilayer to which it binds, most of which are with the phosphate groups. Analysis of the root-mean-square deviation (rmsd) shows that residues Val30-Thr40, Tyr66-Gln80, and Lys107-Arg118 have relatively large rmsds during all-atom molecular dynamics simulations, in accordance with the observation of an enlarged entrance region of the hydrophobic binding pocket. The amino acid sequences forming the entrance of the binding pocket prefer to interact with lipid molecules that are more fluid or negatively charged, and the opening of the binding pocket would be larger when the lipid components are more fluid.
Hydration structure of the α-chymotrypsin substrate binding pocket: the impact of constrained geometry

NASA Astrophysics Data System (ADS)

Carey, Christina; Cheng, Yuen-Kit; Rossky, Peter J.

2000-08-01

The concave substrate binding pocket of α-chymotrypsin binds specifically hydrophobic side chains. In order to understand the hydration structure present in the absence of substrate, and elucidate the character of the solvent displaced on binding, molecular dynamics computer simulation of the solvent in a fully hydrated protein has been carried out and analyzed. The pocket is found to be characterized in terms of a mixed polar and apolar macromolecular surface. It is shown that the simulated solvent structure within it is spatially consistent with that seen via crystallography. The solvent structure is energetically characterized by large losses in hydrogen bonding among solvent molecules except at the mouth of the pocket where exposure to bulk-like solvent is possible. The loss in hydrogen bonding is attributed to the highly constrained geometry available to the solvent, preventing formation of a hydrogen bonding network, with only partial compensation by interactions with the macromolecular surface. The solvent displacement concomitant with substrate binding will therefore be associated with a large enthalpic driving force. This result is at the extreme of a continuum of variable cases of "hydrophobic" hydration, which differ most basically in surface curvature. These range from convex solute surfaces, inducing clathrate-like structures, with negligible hydrogen bond loss, to flat surfaces with significant interfacial loss, to the present concave case with hydrogen bonding losses exceeding 50%.
Chemical Proteomics Reveals Ferrochelatase as a Common Off-target of Kinase Inhibitors.

PubMed

Klaeger, Susan; Gohlke, Bjoern; Perrin, Jessica; Gupta, Vipul; Heinzlmeir, Stephanie; Helm, Dominic; Qiao, Huichao; Bergamini, Giovanna; Handa, Hiroshi; Savitski, Mikhail M; Bantscheff, Marcus; Médard, Guillaume; Preissner, Robert; Kuster, Bernhard

2016-05-20

Many protein kinases are valid drug targets in oncology because they are key components of signal transduction pathways. The number of clinical kinase inhibitors is on the rise, but these molecules often exhibit polypharmacology, potentially eliciting desired and toxic effects. Therefore, a comprehensive assessment of a compound's target space is desirable for a better understanding of its biological effects. The enzyme ferrochelatase (FECH) catalyzes the conversion of protoporphyrin IX into heme and was recently found to be an off-target of the BRAF inhibitor Vemurafenib, likely explaining the phototoxicity associated with this drug in melanoma patients. This raises the question of whether FECH binding is a more general feature of kinase inhibitors. To address this, we applied a chemical proteomics approach using kinobeads to evaluate 226 clinical kinase inhibitors for their ability to bind FECH. Surprisingly, low or submicromolar FECH binding was detected for 29 of all compounds tested and isothermal dose response measurements confirmed target engagement in cells. We also show that Vemurafenib, Linsitinib, Neratinib, and MK-2461 reduce heme levels in K562 cells, verifying that drug binding leads to a loss of FECH activity. Further biochemical and docking experiments identified the protoporphyrin pocket in FECH as one major drug binding site. Since the genetic loss of FECH activity leads to photosensitivity in humans, our data strongly suggest that FECH inhibition by kinase inhibitors is the molecular mechanism triggering photosensitivity in patients. We therefore suggest that a FECH assay should generally be part of the preclinical molecular toxicology package for the development of kinase inhibitors.
Modulation of activation-loop phosphorylation by JAK inhibitors is binding mode dependent

PubMed Central

Bonenfant, Débora; Rubert, Joëlle; Vangrevelinghe, Eric; Scheufler, Clemens; Marque, Fanny; Régnier, Catherine H.; De Pover, Alain; Ryckelynck, Hugues; Bhagwat, Neha; Koppikar, Priya; Goel, Aviva; Wyder, Lorenza; Tavares, Gisele; Baffert, Fabienne; Pissot-Soldermann, Carole; Manley, Paul W.; Gaul, Christoph; Voshol, Hans; Levine, Ross L.; Sellers, William R.; Hofmann, Francesco; Radimerski, Thomas

2016-01-01

JAK inhibitors are being developed for the treatment of rheumatoid arthritis, psoriasis, myeloproliferative neoplasms and leukemias. Most of these drugs target the ATP-binding pocket and stabilize the active conformation of the JAK kinases. This type-I binding mode leads to an increase in JAK activation-loop phosphorylation, despite blockade of kinase function. Here we report that stabilizing the inactive state via type-II inhibition acts in the opposite manner, leading to a loss of activation-loop phosphorylation. We used X-ray crystallography to corroborate the binding mode and report for the first time the crystal structure of the JAK2 kinase domain in an inactive conformation. Importantly, JAK inhibitor-induced activation-loop phosphorylation requires receptor interaction, as well as intact kinase and pseudokinase domains. Hence, depending on the respective conformation stabilized by a JAK inhibitor, hyperphosphorylation of the activation-loop may or may not be elicited. PMID:22684457

Inhibition of CDC25B Phosphatase Through Disruption of Protein–Protein Interaction

DOE PAGES

Lund, George; Dudkin, Sergii; Borkin, Dmitry; ...

2014-11-25

CDC25 phosphatases are key cell cycle regulators and represent very attractive but challenging targets for anticancer drug discovery. Here in this paper, we explored whether fragment-based screening represents a valid approach to identify inhibitors of CDC25B. This resulted in identification of 2-fluoro-4-hydroxybenzonitrile, which directly binds to the catalytic domain of CDC25B. Interestingly, NMR data and the crystal structure demonstrate that this compound binds to the pocket distant from the active site and adjacent to the protein–protein interaction interface with CDK2/Cyclin A substrate. Furthermore, we developed a more potent analogue that disrupts CDC25B interaction with CDK2/Cyclin A and inhibits dephosphorylation ofmore » CDK2. Based on these studies, we provide a proof of concept that targeting CDC25 phosphatases by inhibiting their protein–protein interactions with CDK2/Cyclin A substrate represents a novel, viable opportunity to target this important class of enzymes.« less
What Can Crystal Structures of Aminergic Receptors Tell Us about Designing Subtype-Selective Ligands?

PubMed Central

Michino, Mayako; Beuming, Thijs; Donthamsetti, Prashant; Newman, Amy Hauck; Javitch, Jonathan A.

2015-01-01

G protein–coupled receptors (GPCRs) are integral membrane proteins that represent an important class of drug targets. In particular, aminergic GPCRs interact with a significant portion of drugs currently on the market. However, most drugs that target these receptors are associated with undesirable side effects, which are due in part to promiscuous interactions with close homologs of the intended target receptors. Here, based on a systematic analysis of all 37 of the currently available high-resolution crystal structures of aminergic GPCRs, we review structural elements that contribute to and can be exploited for designing subtype-selective compounds. We describe the roles of secondary binding pockets (SBPs), as well as differences in ligand entry pathways to the orthosteric binding site, in determining selectivity. In addition, using the available crystal structures, we have identified conformational changes in the SBPs that are associated with receptor activation and explore the implications of these changes for the rational development of selective ligands with tailored efficacy. PMID:25527701
Towards Coleoptera-specific high-throughput screening systems for compounds with ecdysone activity: development of EcR reporter assays using weevil (Anthonomus grandis)-derived cell lines and in silico analysis of ligand binding to A. grandis EcR ligand-binding pocket.

PubMed

Soin, Thomas; Iga, Masatoshi; Swevers, Luc; Rougé, Pierre; Janssen, Colin R; Smagghe, Guy

2009-08-01

Molting in insects is regulated by ecdysteroids and juvenile hormones. Several synthetic non-steroidal ecdysone agonists are on the market as insecticides. These ecdysone agonists are dibenzoylhydrazine (DBH) analogue compounds that manifest their toxicity via interaction with the ecdysone receptor (EcR). Of the four commercial available ecdysone agonists, three (tebufenozide, methoxyfenozide and chromafenozide) are highly lepidopteran specific, one (halofenozide) is used to control coleopteran and lepidopteran insects in turf and ornamentals. However, compared to the very high binding affinity of these DBH analogues to lepidopteran EcRs, halofenozide has a low binding affinity for coleopteran EcRs. For the discovery of ecdysone agonists that target non-lepidopteran insect groups, efficient screening systems that are based on the activation of the EcR are needed. We report here the development and evaluation of two coleopteran-specific reporter-based screening systems to discover and evaluate ecdysone agonists. The screening systems are based on the cell lines BRL-AG-3A and BRL-AG-3C that are derived from the weevil Anthonomus grandis, which can be efficiently transduced with an EcR reporter cassette for evaluation of induction of reporter activity by ecdysone agonists. We also cloned the almost full length coding sequence of EcR expressed in the cell line BRL-AG-3C and used it to make an initial in silico 3D-model of its ligand-binding pocket docked with ponasterone A and tebufenozide.
Structural insights into FRS2α PTB domain recognition by neurotrophin receptor TrkB.

PubMed

Zeng, Lei; Kuti, Miklos; Mujtaba, Shiraz; Zhou, Ming-Ming

2014-07-01

The fibroblast growth factor receptor (FGFR) substrate 2 (FRS2) family proteins function as scaffolding adapters for receptor tyrosine kinases (RTKs). The FRS2α proteins interact with RTKs through the phosphotyrosine-binding (PTB) domain and transfer signals from the activated receptors to downstream effector proteins. Here, we report the nuclear magnetic resonance structure of the FRS2α PTB domain bound to phosphorylated TrkB. The structure reveals that the FRS2α-PTB domain is comprised of two distinct but adjacent pockets for its mutually exclusive interaction with either nonphosphorylated juxtamembrane region of the FGFR, or tyrosine phosphorylated peptides TrkA and TrkB. The new structural insights suggest rational design of selective small molecules through targeting of the two conjunct pockets in the FRS2α PTB domain. © 2014 Wiley Periodicals, Inc.
Recognition and stabilization of geranylgeranylated human Rab5 by the GDP Dissociation Inhibitor (GDI).

PubMed

Edler, Eileen; Stein, Matthias

2017-10-25

The small GTPase Rab5 is the key regulator of early endosomal fusion. It is post-translationally modified by covalent attachment of two geranylgeranyl (GG) chains to adjacent cysteine residues of the C-terminal hypervariable region (HVR). The GDP dissociation inhibitor (GDI) recognizes membrane-associated Rab5(GDP) and serves to release it into the cytoplasm where it is kept in a soluble state. A detailed new structural and dynamic model for human Rab5(GDP) recognition and binding with human GDI at the early endosome membrane and in its dissociated state is presented. In the cytoplasm, the GDI protein accommodates the GG chains in a transient hydrophobic binding pocket. In solution, two different binding modes of the isoprenoid chains inserted into the hydrophobic pocket of the Rab5(GDP):GDI complex can be identified. This equilibrium between the two states helps to stabilize the protein-protein complex in solution. Interprotein contacts between the Rab5 switch regions and characteristic patches of GDI residues from the Rab binding platform (RBP) and the C-terminus coordinating region (CCR) reveal insight on the formation of such a stable complex. GDI binding to membrane-anchored Rab5(GDP) is initially mediated by the solvent accessible switch regions of the Rab-specific RBP. Formation of the membrane-associated Rab5(GDP):GDI complex induces a GDI reorientation to establish additional interactions with the Rab5 HVR. These results allow to devise a detailed structural model for the process of extraction of GG-Rab5(GDP) by GDI from the membrane and the dissociation from targeting factors and effector proteins prior to GDI binding.
Enfuvirtide (T20)-Based Lipopeptide Is a Potent HIV-1 Cell Fusion Inhibitor: Implications for Viral Entry and Inhibition.

PubMed

Ding, Xiaohui; Zhang, Xiujuan; Chong, Huihui; Zhu, Yuanmei; Wei, Huamian; Wu, Xiyuan; He, Jinsheng; Wang, Xinquan; He, Yuxian

2017-09-15

The peptide drug enfuvirtide (T20) is the only viral fusion inhibitor used in combination therapy for HIV-1 infection, but it has relatively low antiviral activity and easily induces drug resistance. Emerging studies demonstrate that lipopeptide-based fusion inhibitors, such as LP-11 and LP-19, which mainly target the gp41 pocket site, have greatly improved antiviral potency and in vivo stability. In this study, we focused on developing a T20-based lipopeptide inhibitor that lacks pocket-binding sequence and targets a different site. First, the C-terminal tryptophan-rich motif (TRM) of T20 was verified to be essential for its target binding and inhibition; then, a novel lipopeptide, termed LP-40, was created by replacing the TRM with a fatty acid group. LP-40 showed markedly enhanced binding affinity for the target site and dramatically increased inhibitory activity on HIV-1 membrane fusion, entry, and infection. Unlike LP-11 and LP-19, which required a flexible linker between the peptide sequence and the lipid moiety, addition of a linker to LP-40 sharply reduced its potency, implying different binding modes with the extended N-terminal helices of gp41. Also, interestingly, LP-40 showed more potent activity than LP-11 in inhibiting HIV-1 Env-mediated cell-cell fusion while it was less active than LP-11 in inhibiting pseudovirus entry, and the two inhibitors displayed synergistic antiviral effects. The crystal structure of LP-40 in complex with a target peptide revealed their key binding residues and motifs. Combined, our studies have not only provided a potent HIV-1 fusion inhibitor, but also revealed new insights into the mechanisms of viral inhibition. IMPORTANCE T20 is the only membrane fusion inhibitor available for treatment of viral infection; however, T20 requires high doses and has a low genetic barrier for resistance, and its inhibitory mechanism and structural basis remain unclear. Here, we report the design of LP-40, a T20-based lipopeptide inhibitor that has greatly improved anti-HIV activity and is a more potent inhibitor of cell-cell fusion than of cell-free virus infection. The binding modes of two classes of membrane-anchoring lipopeptides (LP-40 and LP-11) verify the current fusion model in which an extended prehairpin structure bridges the viral and cellular membranes, and their complementary effects suggest a vital strategy for combination therapy of HIV-1 infection. Moreover, our understanding of the mechanism of action of T20 and its derivatives benefits from the crystal structure of LP-40. Copyright © 2017 American Society for Microbiology.
Structural Insights into the Ligand Binding and Releasing Mechanism of Antheraea polyphemus PBP1: Role of the C-terminal Tail

PubMed Central

Katre, Uma V.; Mazumder, Suman; Mohanty, Smita

2013-01-01

Pheromone-binding proteins (PBPs) in lepidopteran moths selectively transport the hydrophobic pheromone molecules across the sensillar lymph to trigger the neuronal response. Moth PBPs are known to bind ligand at physiological pH and release it at acidic pH while undergoing a conformational change. Two molecular switches are considered to play a role in this mechanism: (i) Protonation of His70 and His95 situated at one end of binding pocket, and (ii) Switch of the unstructured C-terminus at the other end of the binding pocket to a helix that enters the pocket. We have reported previously the role of the histidine-driven switch in ligand release for Antheraea polyphemus PBP1 (ApolPBP1). Here we show that the C-terminus plays a role in ligand release and binding mechanism of ApolPBP1. The C-terminus truncated mutants of ApolPBP1 (ApolPBP1ΔP129-V142 and ApolPBP1H70A/H95AΔP129-V142) exist only in the bound conformation at all pH levels, and they fail to undergo pH- or ligand- dependent conformational switch. Although these proteins could bind ligands even at acidic pH unlike the wild-type ApolPBP1, they had ~4 fold reduced affinity towards the ligand at both acidic and physiological pH than that of ApolPBP1wt and ApolPBP1H70A/H95A. Thus, apart from helping in the ligand-release at acidic pH, the C-terminus in ApolPBP1 also plays an important role in ligand binding and/or locking the ligand in the binding pocket. Our results are in stark contrast to those reported for BmorPBP and AtraPBP, where C-terminus truncated proteins had similar or increased pheromone-binding affinity at any pH. PMID:23327454
Natural product (-)-gossypol inhibits colon cancer cell growth by targeting RNA-binding protein Musashi-1.

PubMed

Lan, Lan; Appelman, Carl; Smith, Amber R; Yu, Jia; Larsen, Sarah; Marquez, Rebecca T; Liu, Hao; Wu, Xiaoqing; Gao, Philip; Roy, Anuradha; Anbanandam, Asokan; Gowthaman, Ragul; Karanicolas, John; De Guzman, Roberto N; Rogers, Steven; Aubé, Jeffrey; Ji, Min; Cohen, Robert S; Neufeld, Kristi L; Xu, Liang

2015-08-01

Musashi-1 (MSI1) is an RNA-binding protein that acts as a translation activator or repressor of target mRNAs. The best-characterized MSI1 target is Numb mRNA, whose encoded protein negatively regulates Notch signaling. Additional MSI1 targets include the mRNAs for the tumor suppressor protein APC that regulates Wnt signaling and the cyclin-dependent kinase inhibitor P21(WAF-1). We hypothesized that increased expression of NUMB, P21 and APC, through inhibition of MSI1 RNA-binding activity might be an effective way to simultaneously downregulate Wnt and Notch signaling, thus blocking the growth of a broad range of cancer cells. We used a fluorescence polarization assay to screen for small molecules that disrupt the binding of MSI1 to its consensus RNA binding site. One of the top hits was (-)-gossypol (Ki = 476 ± 273 nM), a natural product from cottonseed, known to have potent anti-tumor activity and which has recently completed Phase IIb clinical trials for prostate cancer. Surface plasmon resonance and nuclear magnetic resonance studies demonstrate a direct interaction of (-)-gossypol with the RNA binding pocket of MSI1. We further showed that (-)-gossypol reduces Notch/Wnt signaling in several colon cancer cell lines having high levels of MSI1, with reduced SURVIVIN expression and increased apoptosis/autophagy. Finally, we showed that orally administered (-)-gossypol inhibits colon cancer growth in a mouse xenograft model. Our study identifies (-)-gossypol as a potential small molecule inhibitor of MSI1-RNA interaction, and suggests that inhibition of MSI1's RNA binding activity may be an effective anti-cancer strategy. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Enhanced fluorescence norfloxacin substituted naphthalimide derivatives: Molecular docking and antibacterial activity

NASA Astrophysics Data System (ADS)

Kumar, Santosh; Kumar, Gaurav; Tripathi, Amit Kumar; Seena, Sahadevan; Koh, Joonseok

2018-04-01

Hybrid derivatives are a fascinating and challenging process in the area of drug discovery. Naphthalimide derivatives with modified norfloxacin moiety were designed and synthesized. Docking simulations were done to assess the interactions of the derivatives with the E. coli type II topoisomerases Gyrase B and ParE ATP-binding pocket by taking novobiocin as a standard molecule. Results suggested that the norfloxacin substituted naphthalimide derivatives indicate red-shift emission maxima when compared to 4-bromo 1,8-naphthalic anhydride. The molecular docking simulation study revealed that the derivatives have similar interaction but a different mode of binding with the gyrase B ATP-binding pocket as compare to novobiocin. However, they bound to ParE ATP-binding pocket similarly to novobiocin. The antibacterial property was confirmed with disc diffusion method. Our study indicated that the norfloxacin substituted naphthalimide novel derivatives have pronounced fluorescence, anti-topoisomerase activity, and antibacterial properties; therefore, they could be developed into new drug candidates.
The acid pocket: a target for treatment in reflux disease?

PubMed

Kahrilas, Peter J; McColl, Kenneth; Fox, Mark; O'Rourke, Lisa; Sifrim, Daniel; Smout, Andre J P M; Boeckxstaens, Guy

2013-07-01

The nadir esophageal pH of reflux observed during pH monitoring in the postprandial period is often more acidic than the concomitant intragastric pH. This paradox prompted the discovery of the "acid pocket", an area of unbuffered gastric acid that accumulates in the proximal stomach after meals and serves as the reservoir for acid reflux in healthy individuals and gastroesophageal reflux disease (GERD) patients. However, there are differentiating features between these populations in the size and position of the acid pocket, with GERD patients predisposed to upward migration of the proximal margin onto the esophageal mucosa, particularly when supine. This upward migration of acid, sometimes referred to as an "acid film", likely contributes to mucosal pathology in the region of the squamocolumnar junction. Furthermore, movement of the acid pocket itself to a supradiaphragmatic location with hiatus hernia increases the propensity for acid reflux by all conventional mechanisms. Consequently, the acid pocket is an attractive target for GERD therapy. It may be targeted in a global way with proton pump inhibitors that attenuate acid pocket development, or with alginate/antacid combinations that colocalize with the acid pocket and displace it distally, thereby demonstrating the potential for selective targeting of the acid pocket in GERD.
Structural Basis for the Species-Selective Binding of N,C-Capped Dipeptides to the Mycobacterium tuberculosis Proteasome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsu, Hao-Chi; Singh, Pradeep K.; Fan, Hao

The Mycobacterium tuberculosis (Mtb) 20S proteasome is vital for the pathogen to survive under nitrosative stress in vitro and to persist in mice. To qualify for drug development, inhibitors targeting Mtb 20S must spare both the human constitutive proteasome (c-20S) and immunoproteasome (i-20S). We recently reported members of a family of noncovalently binding dipeptide proteasome inhibitors that are highly potent and selective for Mtb 20S over human c-20S and i-20S. To understand the structural basis of their potency and selectivity, we have studied the structure–activity relationship of six derivatives and solved their cocrystal structures with Mtb 20S. The dipeptide inhibitorsmore » form an antiparallel β-strand with the active site β-strands. Selectivity is conferred by several features of Mtb 20S relative to its mouse counterparts, including a larger S1 pocket, additional hydrogen bonds in the S3 pocket, and hydrophobic interactions in the S4 pocket. Serine-20 and glutamine-22 of Mtb 20S interact with the dipeptides and confer Mtb-specific inhibition over c-20S and i-20S. The Mtb 20S and mammalian i-20S have a serine-27 that interacts strongly with the dipeptides, potentially explaining the higher inhibitory activity of the dipeptides toward i-20S over c-20S. This detailed structural knowledge will aid in optimizing the dipeptides as anti-tuberculosis drugs.« less
Conservation and divergence of C-terminal domain structure in the retinoblastoma protein family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liban, Tyler J.; Medina, Edgar M.; Tripathi, Sarvind

The retinoblastoma protein (Rb) and the homologous pocket proteins p107 and p130 negatively regulate cell proliferation by binding and inhibiting members of the E2F transcription factor family. The structural features that distinguish Rb from other pocket proteins have been unclear but are critical for understanding their functional diversity and determining why Rb has unique tumor suppressor activities. We describe here important differences in how the Rb and p107 C-terminal domains (CTDs) associate with the coiled-coil and marked-box domains (CMs) of E2Fs. We find that although CTD–CM binding is conserved across protein families, Rb and p107 CTDs show clear preferences formore » different E2Fs. A crystal structure of the p107 CTD bound to E2F5 and its dimer partner DP1 reveals the molecular basis for pocket protein–E2F binding specificity and how cyclin-dependent kinases differentially regulate pocket proteins through CTD phosphorylation. Our structural and biochemical data together with phylogenetic analyses of Rb and E2F proteins support the conclusion that Rb evolved specific structural motifs that confer its unique capacity to bind with high affinity those E2Fs that are the most potent activators of the cell cycle.« less
Identification of a Cholesterol-Binding Pocket in Inward Rectifier K+ (Kir) Channels

PubMed Central

Fürst, Oliver; Nichols, Colin G.; Lamoureux, Guillaume; D’Avanzo, Nazzareno

2014-01-01

Cholesterol is the major sterol component of all mammalian plasma membranes. Recent studies have shown that cholesterol inhibits both bacterial (KirBac1.1 and KirBac3.1) and eukaryotic (Kir2.1) inward rectifier K+ (Kir) channels. Lipid-sterol interactions are not enantioselective, and the enantiomer of cholesterol (ent-cholesterol) does not inhibit Kir channel activity, suggesting that inhibition results from direct enantiospecific binding to the channel, and not indirect effects of changes to the bilayer. Furthermore, conservation of the effect of cholesterol among prokaryotic and eukaryotic Kir channels suggests an evolutionary conserved cholesterol-binding pocket, which we aimed to identify. Computational experiments were performed by docking cholesterol to the atomic structures of Kir2.2 (PDB: 3SPI) and KirBac1.1 (PDB: 2WLL) using Autodock 4.2. Poses were assessed to ensure biologically relevant orientation and then clustered according to location and orientation. The stability of cholesterol in each of these poses was then confirmed by molecular dynamics simulations. Finally, mutation of key residues (S95H and I171L) in this putative binding pocket found within the transmembrane domain of Kir2.1 channels were shown to lead to a loss of inhibition by cholesterol. Together, these data provide support for this location as a biologically relevant pocket. PMID:25517146
Naringenin and quercetin--potential anti-HCV agents for NS2 protease targets.

PubMed

Lulu, S Sajitha; Thabitha, A; Vino, S; Priya, A Mohana; Rout, Madhusmita

2016-01-01

Nonstructural proteins of hepatitis C virus had drawn much attention for the scientific fraternity in drug discovery due to its important role in the disease. 3D structure of the protein was predicted using molecular modelling protocol. Docking studies of 10 medicinal plant compounds and three drugs available in the market (control) with NS2 protease were employed by using rigid docking approach of AutoDock 4.2. Among the molecules tested for docking study, naringenin and quercetin revealed minimum binding energy of - 7.97 and - 7.95 kcal/mol with NS2 protease. All the ligands were docked deeply within the binding pocket region of the protein. The docking study results showed that these compounds are potential inhibitors of the target; and also all these docked compounds have good inhibition constant, vdW+Hbond+desolv energy with best RMSD value.
Revealing a steroid receptor ligand as a unique PPAR[gamma] agonist

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Shengchen; Han, Ying; Shi, Yuzhe

2012-06-28

Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) regulates metabolic homeostasis and is a molecular target for anti-diabetic drugs. We report here the identification of a steroid receptor ligand, RU-486, as an unexpected PPAR{gamma} agonist, thereby uncovering a novel signaling route for this steroid drug. Similar to rosiglitazone, RU-486 modulates the expression of key PPAR{gamma} target genes and promotes adipocyte differentiation, but with a lower adipogenic activity. Structural and functional studies of receptor-ligand interactions reveal the molecular basis for a unique binding mode for RU-486 in the PPAR{gamma} ligand-binding pocket with distinctive properties and epitopes, providing the molecular mechanisms for the discrimination ofmore » RU-486 from thiazolidinediones (TZDs) drugs. Our findings together indicate that steroid compounds may represent an alternative approach for designing non-TZD PPAR{gamma} ligands in the treatment of insulin resistance.« less
Engineering the meso-Diaminopimelate Dehydrogenase from Symbiobacterium thermophilum by Site Saturation Mutagenesis for d-Phenylalanine Synthesis

PubMed Central

Gao, Xiuzhen; Huang, Fang; Feng, Jinhui; Chen, Xi; Zhang, Hailing; Wang, Zhixiang; Wu, Qiaqing

2013-01-01

In order to enlarge the substrate binding pocket of the meso-diaminopimelate dehydrogenase from Symbiobacterium thermophilum to accommodate larger 2-keto acids, four amino acid residues (Phe146, Thr171, Arg181, and His227) were targeted for site saturation mutagenesis. Among all mutants, the single mutant H227V had a specific activity of 2.39 ± 0.06 U · mg−1, which was 35.1-fold enhancement over the wild-type enzyme. PMID:23728814
Engineering the meso-diaminopimelate dehydrogenase from Symbiobacterium thermophilum by site saturation mutagenesis for D-phenylalanine synthesis.

PubMed

Gao, Xiuzhen; Huang, Fang; Feng, Jinhui; Chen, Xi; Zhang, Hailing; Wang, Zhixiang; Wu, Qiaqing; Zhu, Dunming

2013-08-01

In order to enlarge the substrate binding pocket of the meso-diaminopimelate dehydrogenase from Symbiobacterium thermophilum to accommodate larger 2-keto acids, four amino acid residues (Phe146, Thr171, Arg181, and His227) were targeted for site saturation mutagenesis. Among all mutants, the single mutant H227V had a specific activity of 2.39 ± 0.06 U · mg(-1), which was 35.1-fold enhancement over the wild-type enzyme.
Similarities among receptor pockets and among compounds: analysis and application to in silico ligand screening.

PubMed

Fukunishi, Yoshifumi; Mikami, Yoshiaki; Nakamura, Haruki

2005-09-01

We developed a new method to evaluate the distances and similarities between receptor pockets or chemical compounds based on a multi-receptor versus multi-ligand docking affinity matrix. The receptors were classified by a cluster analysis based on calculations of the distance between receptor pockets. A set of low homologous receptors that bind a similar compound could be classified into one cluster. Based on this line of reasoning, we proposed a new in silico screening method. According to this method, compounds in a database were docked to multiple targets. The new docking score was a slightly modified version of the multiple active site correction (MASC) score. Receptors that were at a set distance from the target receptor were not included in the analysis, and the modified MASC scores were calculated for the selected receptors. The choice of the receptors is important to achieve a good screening result, and our clustering of receptors is useful to this purpose. This method was applied to the analysis of a set of 132 receptors and 132 compounds, and the results demonstrated that this method achieves a high hit ratio, as compared to that of a uniform sampling, using a receptor-ligand docking program, Sievgene, which was newly developed with a good docking performance yielding 50.8% of the reconstructed complexes at a distance of less than 2 A RMSD.
Incorporation of Tyrosine and Glutamine Residues into the Soluble Guanylate Cyclase Heme Distal Pocket Alters NO and O2 Binding*

PubMed Central

Derbyshire, Emily R.; Deng, Sarah; Marletta, Michael A.

2010-01-01

Nitric oxide (NO) is the physiologically relevant activator of the mammalian hemoprotein soluble guanylate cyclase (sGC). The heme cofactor of α1β1 sGC has a high affinity for NO but has never been observed to form a complex with oxygen. Introduction of a key tyrosine residue in the sGC heme binding domain β1(1–385) is sufficient to produce an oxygen-binding protein, but this mutation in the full-length enzyme did not alter oxygen affinity. To evaluate ligand binding specificity in full-length sGC we mutated several conserved distal heme pocket residues (β1 Val-5, Phe-74, Ile-145, and Ile-149) to introduce a hydrogen bond donor in proximity to the heme ligand. We found that the NO coordination state, NO dissociation, and enzyme activation were significantly affected by the presence of a tyrosine in the distal heme pocket; however, the stability of the reduced porphyrin and the proteins affinity for oxygen were unaltered. Recently, an atypical sGC from Drosophila, Gyc-88E, was shown to form a stable complex with oxygen. Sequence analysis of this protein identified two residues in the predicted heme pocket (tyrosine and glutamine) that may function to stabilize oxygen binding in the atypical cyclase. The introduction of these residues into the rat β1 distal heme pocket (Ile-145 → Tyr and Ile-149 → Gln) resulted in an sGC construct that oxidized via an intermediate with an absorbance maximum at 417 nm. This absorbance maximum is consistent with globin FeII-O2 complexes and is likely the first observation of a FeII-O2 complex in the full-length α1β1 protein. Additionally, these data suggest that atypical sGCs stabilize O2 binding by a hydrogen bonding network involving tyrosine and glutamine. PMID:20231286
Apolar Distal Pocket Mutants of Yeast Cytochrome c Peroxidase: Hydrogen Peroxide Reactivity and Cyanide Binding of the TriAla, TriVal, and TriLeu Variants

PubMed Central

Bidwai, Anil K.; Meyen, Cassandra; Kilheeney, Heather; Wroblewski, Damian; Vitello, Lidia B.; Erman, James E.

2012-01-01

Three yeast cytochrome c peroxidase (CcP) variants with apolar distal heme pockets have been constructed. The CcP variants have Arg48, Trp51, and His52 mutated to either all alanines, CcP(triAla), all valines, CcP(triVal), or all leucines, CcP(triLeu). The triple mutants have detectable enzymatic activity at pH 6 but the activity is less than 0.02% that of wild-type CcP. The activity loss is primarily due to the decreased rate of reaction between the triple mutants and H2O2 compared to wild-type CcP. Spectroscopic properties and cyanide binding characteristics of the triple mutants have been investigated over the pH stability region of CcP, pH 4 to 8. The absorption spectra indicate that the CcP triple mutants have hemes that are predominantly five-coordinate, high-spin at pH 5 and six-coordinate, low-spin at pH 8. Cyanide binding to the triple mutants is biphasic indicating that the triple mutants have two slowly-exchanging conformational states with different cyanide affinities. The binding affinity for cyanide is reduced at least two orders of magnitude in the triple mutants compared to wild-type CcP and the rate of cyanide binding is reduced by four to five orders of magnitude. Correlation of the reaction rates of CcP and 12 distal pocket mutants with H2O2 and HCN suggests that both reactions require ionization of the reactants within the distal heme pocket allowing the anion to bind the heme iron. Distal pocket features that promote substrate ionization (basic residues involved in base-catalyzed substrate ionization or polar residues that can stabilize substrate anions) increase the overall rate of reaction with H2O2 and HCN while features that inhibit substrate ionization slow the reactions. PMID:23022490

G protein-coupled receptor transmembrane binding pockets and their applications in GPCR research and drug discovery: a survey.

PubMed

Kratochwil, Nicole A; Gatti-McArthur, Silvia; Hoener, Marius C; Lindemann, Lothar; Christ, Andreas D; Green, Luke G; Guba, Wolfgang; Martin, Rainer E; Malherbe, Pari; Porter, Richard H P; Slack, Jay P; Winnig, Marcel; Dehmlow, Henrietta; Grether, Uwe; Hertel, Cornelia; Narquizian, Robert; Panousis, Constantinos G; Kolczewski, Sabine; Steward, Lucinda

2011-01-01

G protein-coupled receptors (GPCRs) share a common architecture consisting of seven transmembrane (TM) domains. Various lines of evidence suggest that this fold provides a generic binding pocket within the TM region for hosting agonists, antagonists, and allosteric modulators. Hence, an automated method was developed that allows a fast analysis and comparison of these generic ligand binding pockets across the entire GPCR family by providing the relevant information for all GPCRs in the same format. This methodology compiles amino acids lining the TM binding pocket including parts of the ECL2 loop in a so-called 1D ligand binding pocket vector and translates these 1D vectors in a second step into 3D receptor pharmacophore models. It aims to support various aspects of GPCR drug discovery in the pharmaceutical industry. Applications of pharmacophore similarity analysis of these 1D LPVs include definition of receptor subfamilies, prediction of species differences within subfamilies in regard to in vitro pharmacology and identification of nearest neighbors for GPCRs of interest to generate starting points for GPCR lead identification programs. These aspects of GPCR research are exemplified in the field of melanopsins, trace amine-associated receptors and somatostatin receptor subtype 5. In addition, it is demonstrated how 3D pharmacophore models of the LPVs can support the prediction of amino acids involved in ligand recognition, the understanding of mutational data in a 3D context and the elucidation of binding modes for GPCR ligands and their evaluation. Furthermore, guidance through 3D receptor pharmacophore modeling for the synthesis of subtype-specific GPCR ligands will be reported. Illustrative examples are taken from the GPCR family class C, metabotropic glutamate receptors 1 and 5 and sweet taste receptors, and from the GPCR class A, e.g. nicotinic acid and 5-hydroxytryptamine 5A receptor. © 2011 Bentham Science Publishers
Druggable orthosteric and allosteric hot spots to target protein-protein interactions.

PubMed

Ma, Buyong; Nussinov, Ruth

2014-01-01

Drug designing targeting protein-protein interactions is challenging. Because structural elucidation and computational analysis have revealed the importance of hot spot residues in stabilizing these interactions, there have been on-going efforts to develop drugs which bind the hot spots and out-compete the native protein partners. The question arises as to what are the key 'druggable' properties of hot spots in protein-protein interactions and whether these mimic the general hot spot definition. Identification of orthosteric (at the protein- protein interaction site) and allosteric (elsewhere) druggable hot spots is expected to help in discovering compounds that can more effectively modulate protein-protein interactions. For example, are there any other significant features beyond their location in pockets in the interface? The interactions of protein-protein hot spots are coupled with conformational dynamics of protein complexes. Currently increasing efforts focus on the allosteric drug discovery. Allosteric drugs bind away from the native binding site and can modulate the native interactions. We propose that identification of allosteric hot spots could similarly help in more effective allosteric drug discovery. While detection of allosteric hot spots is challenging, targeting drugs to these residues has the potential of greatly increasing the hot spot and protein druggability.
Structure of Yeast OSBP-Related Protein Osh1 Reveals Key Determinants for Lipid Transport and Protein Targeting at the Nucleus-Vacuole Junction.

PubMed

Manik, Mohammad Kawsar; Yang, Huiseon; Tong, Junsen; Im, Young Jun

2017-04-04

Yeast Osh1 belongs to the oxysterol-binding protein (OSBP) family of proteins and contains multiple targeting modules optimized for lipid transport at the nucleus-vacuole junction (NVJ). The key determinants for NVJ targeting and the role of Osh1 at NVJs have remained elusive because of unknown lipid specificities. In this study, we determined the structures of the ankyrin repeat domain (ANK), and OSBP-related domain (ORD) of Osh1, in complex with Nvj1 and ergosterol, respectively. The Osh1 ANK forms a unique bi-lobed structure that recognizes a cytosolic helical segment of Nvj1. We discovered that Osh1 ORD binds ergosterol and phosphatidylinositol 4-phosphate PI(4)P in a competitive manner, suggesting counter-transport function of the two lipids. Ergosterol is bound to the hydrophobic pocket in a head-down orientation, and the structure of the PI(4)P-binding site in Osh1 is well conserved. Our results suggest that Osh1 performs non-vesicular transport of ergosterol and PI(4)P at the NVJ. Copyright © 2017 Elsevier Ltd. All rights reserved.
CRISPR-Cas9-based target validation for p53-reactivating model compounds

PubMed Central

Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

2015-01-01

Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461
Interactions between Hofmeister anions and the binding pocket of a protein.

PubMed

Fox, Jerome M; Kang, Kyungtae; Sherman, Woody; Héroux, Annie; Sastry, G Madhavi; Baghbanzadeh, Mostafa; Lockett, Matthew R; Whitesides, George M

2015-03-25

This paper uses the binding pocket of human carbonic anhydrase II (HCAII, EC 4.2.1.1) as a tool to examine the properties of Hofmeister anions that determine (i) where, and how strongly, they associate with concavities on the surfaces of proteins and (ii) how, upon binding, they alter the structure of water within those concavities. Results from X-ray crystallography and isothermal titration calorimetry show that most anions associate with the binding pocket of HCAII by forming inner-sphere ion pairs with the Zn(2+) cofactor. In these ion pairs, the free energy of anion-Zn(2+) association is inversely proportional to the free energetic cost of anion dehydration; this relationship is consistent with the mechanism of ion pair formation suggested by the "law of matching water affinities". Iodide and bromide anions also associate with a hydrophobic declivity in the wall of the binding pocket. Molecular dynamics simulations suggest that anions, upon associating with Zn(2+), trigger rearrangements of water that extend up to 8 Å away from their surfaces. These findings expand the range of interactions previously thought to occur between ions and proteins by suggesting that (i) weakly hydrated anions can bind complementarily shaped hydrophobic declivities, and that (ii) ion-induced rearrangements of water within protein concavities can (in contrast with similar rearrangements in bulk water) extend well beyond the first hydration shells of the ions that trigger them. This study paints a picture of Hofmeister anions as a set of structurally varied ligands that differ in size, shape, and affinity for water and, thus, in their ability to bind to—and to alter the charge and hydration structure of—polar, nonpolar, and topographically complex concavities on the surfaces of proteins.
Identification of Novel Potential β-N-Acetyl-D-Hexosaminidase Inhibitors by Virtual Screening, Molecular Dynamics Simulation and MM-PBSA Calculations

PubMed Central

Liu, Jianling; Liu, Mengmeng; Yao, Yao; Wang, Jinan; Li, Yan; Li, Guohui; Wang, Yonghua

2012-01-01

Chitinolytic β-N-acetyl-d-hexosaminidases, as a class of chitin hydrolysis enzyme in insects, are a potential species-specific target for developing environmentally-friendly pesticides. Until now, pesticides targeting chitinolytic β-N-acetyl-d-hexosaminidase have not been developed. This study demonstrates a combination of different theoretical methods for investigating the key structural features of this enzyme responsible for pesticide inhibition, thus allowing for the discovery of novel small molecule inhibitors. Firstly, based on the currently reported crystal structure of this protein (OfHex1.pdb), we conducted a pre-screening of a drug-like compound database with 8 × 106 compounds by using the expanded pesticide-likeness criteria, followed by docking-based screening, obtaining 5 top-ranked compounds with favorable docking conformation into OfHex1. Secondly, molecular docking and molecular dynamics simulations are performed for the five complexes and demonstrate that one main hydrophobic pocket formed by residues Trp424, Trp448 and Trp524, which is significant for stabilization of the ligand–receptor complex, and key residues Asp477 and Trp490, are respectively responsible for forming hydrogen-bonding and π–π stacking interactions with the ligands. Finally, the molecular mechanics Poisson–Boltzmann surface area (MM-PBSA) analysis indicates that van der Waals interactions are the main driving force for the inhibitor binding that agrees with the fact that the binding pocket of OfHex1 is mainly composed of hydrophobic residues. These results suggest that screening the ZINC database can maximize the identification of potential OfHex1 inhibitors and the computational protocol will be valuable for screening potential inhibitors of the binding mode, which is useful for the future rational design of novel, potent OfHex1-specific pesticides. PMID:22605995
A New Class of Allosteric HIV-1 Integrase Inhibitors Identified by Crystallographic Fragment Screening of the Catalytic Core Domain.

PubMed

Patel, Disha; Antwi, Janet; Koneru, Pratibha C; Serrao, Erik; Forli, Stefano; Kessl, Jacques J; Feng, Lei; Deng, Nanjie; Levy, Ronald M; Fuchs, James R; Olson, Arthur J; Engelman, Alan N; Bauman, Joseph D; Kvaratskhelia, Mamuka; Arnold, Eddy

2016-11-04

HIV-1 integrase (IN) is essential for virus replication and represents an important multifunctional therapeutic target. Recently discovered quinoline-based allosteric IN inhibitors (ALLINIs) potently impair HIV-1 replication and are currently in clinical trials. ALLINIs exhibit a multimodal mechanism of action by inducing aberrant IN multimerization during virion morphogenesis and by competing with IN for binding to its cognate cellular cofactor LEDGF/p75 during early steps of HIV-1 infection. However, quinoline-based ALLINIs impose a low genetic barrier for the evolution of resistant phenotypes, which highlights a need for discovery of second-generation inhibitors. Using crystallographic screening of a library of 971 fragments against the HIV-1 IN catalytic core domain (CCD) followed by a fragment expansion approach, we have identified thiophenecarboxylic acid derivatives that bind at the CCD-CCD dimer interface at the principal lens epithelium-derived growth factor (LEDGF)/p75 binding pocket. The most active derivative (5) inhibited LEDGF/p75-dependent HIV-1 IN activity in vitro with an IC 50 of 72 μm and impaired HIV-1 infection of T cells at an EC 50 of 36 μm The identified lead compound, with a relatively small molecular weight (221 Da), provides an optimal building block for developing a new class of inhibitors. Furthermore, although structurally distinct thiophenecarboxylic acid derivatives target a similar pocket at the IN dimer interface as the quinoline-based ALLINIs, the lead compound, 5, inhibited IN mutants that confer resistance to quinoline-based compounds. Collectively, our findings provide a plausible path for structure-based development of second-generation ALLINIs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
T-Epitope Designer: A HLA-peptide binding prediction server.

PubMed

Kangueane, Pandjassarame; Sakharkar, Meena Kishore

2005-05-15

The current challenge in synthetic vaccine design is the development of a methodology to identify and test short antigen peptides as potential T-cell epitopes. Recently, we described a HLA-peptide binding model (using structural properties) capable of predicting peptides binding to any HLA allele. Consequently, we have developed a web server named T-EPITOPE DESIGNER to facilitate HLA-peptide binding prediction. The prediction server is based on a model that defines peptide binding pockets using information gleaned from X-ray crystal structures of HLA-peptide complexes, followed by the estimation of peptide binding to binding pockets. Thus, the prediction server enables the calculation of peptide binding to HLA alleles. This model is superior to many existing methods because of its potential application to any given HLA allele whose sequence is clearly defined. The web server finds potential application in T cell epitope vaccine design. http://www.bioinformation.net/ted/
X-Ray Crystal Structure of the Ancestral 3-Ketosteroid Receptor-Progesterone-Mifepristone Complex Shows Mifepristone Bound at the Coactivator Binding Interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Colucci, Jennifer K.; Ortlund, Eric A.

2013-12-12

Steroid receptors are a subfamily of nuclear receptors found throughout all metazoans. They are highly important in the regulation of development, inflammation, and reproduction and their misregulation has been implicated in hormone insensitivity syndromes and cancer. Steroid binding to SRs drives a conformational change in the ligand binding domain that promotes nuclear localization and subsequent interaction with coregulator proteins to affect gene regulation. SRs are important pharmaceutical targets, yet most SR-targeting drugs have off-target pharmacology leading to unwanted side effects. A better understanding of the structural mechanisms dictating ligand specificity and the evolution of the forces that created the SR-hormonemore » pairs will enable the design of better pharmaceutical ligands. In order to investigate this relationship, we attempted to crystallize the ancestral 3-ketosteroid receptor (ancSR2) with mifepristone, a SR antagonist. Here, we present the x-ray crystal structure of the ancestral 3-keto steroid receptor (ancSR2)-progesterone complex at a resolution of 2.05 Å. This improves upon our previously reported structure of the ancSR2-progesterone complex, permitting unambiguous assignment of the ligand conformation within the binding pocket. Surprisingly, we find mifepristone, fortuitously docked at the protein surface, poised to interfere with coregulator binding. Recent attention has been given to generating pharmaceuticals that block the coregulator binding site in order to obstruct coregulator binding and achieve tissue-specific SR regulation independent of hormone binding. Mifepristone’s interaction with the coactivator cleft of this SR suggests that it may be a useful molecular scaffold for further coactivator binding inhibitor development.« less
Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308
Profiling charge complementarity and selectivity for binding at the protein surface.

PubMed

Sulea, Traian; Purisima, Enrico O

2003-05-01

A novel analysis and representation of the protein surface in terms of electrostatic binding complementarity and selectivity is presented. The charge optimization methodology is applied in a probe-based approach that simulates the binding process to the target protein. The molecular surface is color coded according to calculated optimal charge or according to charge selectivity, i.e., the binding cost of deviating from the optimal charge. The optimal charge profile depends on both the protein shape and charge distribution whereas the charge selectivity profile depends only on protein shape. High selectivity is concentrated in well-shaped concave pockets, whereas solvent-exposed convex regions are not charge selective. This suggests the synergy of charge and shape selectivity hot spots toward molecular selection and recognition, as well as the asymmetry of charge selectivity at the binding interface of biomolecular systems. The charge complementarity and selectivity profiles map relevant electrostatic properties in a readily interpretable way and encode information that is quite different from that visualized in the standard electrostatic potential map of unbound proteins.
Broad-spectrum non-nucleoside inhibitors for caliciviruses.

PubMed

Netzler, Natalie E; Enosi Tuipulotu, Daniel; Eltahla, Auda A; Lun, Jennifer H; Ferla, Salvatore; Brancale, Andrea; Urakova, Nadya; Frese, Michael; Strive, Tanja; Mackenzie, Jason M; White, Peter A

2017-10-01

Viruses of the Caliciviridae cause significant and sometimes lethal diseases, however despite substantial research efforts, specific antivirals are lacking. Broad-spectrum antivirals could combat multiple viral pathogens, offering a rapid solution when no therapies exist. The RNA-dependent RNA polymerase (RdRp) is an attractive antiviral target as it is essential for viral replication and lacks mammalian homologs. To focus the search for pan-Caliciviridae antivirals, the RdRp was probed with non-nucleoside inhibitors (NNIs) developed against hepatitis C virus (HCV) to reveal both allosteric ligands for structure-activity relationship enhancement, and highly-conserved RdRp pockets for antiviral targeting. The ability of HCV NNIs to inhibit calicivirus RdRp activities was assessed using in vitro enzyme and murine norovirus cell culture assays. Results revealed that three NNIs which bound the HCV RdRp Thumb I (TI) site also inhibited transcriptional activities of six RdRps spanning the Norovirus, Sapovirus and Lagovirus genera of the Caliciviridae. These NNIs included JTK-109 (RdRp inhibition range: IC 50 4.3-16.6 μM), TMC-647055 (IC 50 range: 18.8-45.4 μM) and Beclabuvir (IC 50 range: 23.8->100 μM). In silico studies and site-directed mutagenesis indicated the JTK-109 binding site was within the calicivirus RdRp thumb domain, in a pocket termed Site-B, which is highly-conserved within all calicivirus RdRps. Additionally, RdRp inhibition assays revealed that JTK-109 was antagonistic with the previously reported RdRp inhibitor pyridoxal-5'-phosphate-6-(2'-naphthylazo-6'-nitro-4',8'-disulfonate) tetrasodium salt (PPNDS), that also binds to Site-B. Moreover, like JTK-109, PPNDS was also a potent inhibitor of polymerases from six viruses spanning the three Caliciviridae genera tested (IC 50 range: 0.1-2.3 μM). Together, this study demonstrates the potential for de novo development of broad-spectrum antivirals that target the highly-conserved RdRp thumb pocket, Site-B. We also revealed three broad-spectrum HCV NNIs that could be used as antiviral scaffolds for further development against caliciviruses and other viruses. Copyright © 2017 Elsevier B.V. All rights reserved.
Structures of D14 and D14L in the strigolactone and karrikin signaling pathways.

PubMed

Kagiyama, Megumi; Hirano, Yoshinori; Mori, Tomoyuki; Kim, Sun-Yong; Kyozuka, Junko; Seto, Yoshiya; Yamaguchi, Shinjiro; Hakoshima, Toshio

2013-02-01

Strigolactones (SLs) are plant hormones that inhibit shoot branching. DWARF14 (D14) inhibits rice tillering and is an SL receptor candidate in the branching inhibition pathway, whereas the close homologue DWARF14-LIKE (D14L) participates in the signaling pathway of karrikins (KARs), which are derived from burnt vegetation as smoke stimulants of seed germination. We provide the first evidence for direct binding of the bioactive SL analogue GR24 to D14. Isothermal titration calorimetry measurements show a D14-GR24 binding affinity in the sub-micromolar range. Similarly, bioactive KAR1 directly binds D14L in the micromolar range. The crystal structure of rice D14 shows a compact α-/β-fold hydrolase domain forming a deep ligand-binding pocket capable of accommodating GR24. Insertion of four α-helices between β6 strand and αD helix forms the helical cap of the pocket, although the pocket is open to the solvent. The pocket contains the conserved catalytic triad Ser-His-Asp aligned with the oxyanion hole, suggesting hydrolase activity. Although these structural characteristics are conserved in D14L, the D14L pocket is smaller than that of D14. The KAR-insensitive mutation kai2-1 is located at the prominent long β6-αD1 loop, which is characteristic in D14 and D14L, but not in related α-/β-fold hydrolases. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
Phosphate-binding pocket in Dicer-2 PAZ domain for high-fidelity siRNA production

PubMed Central

Kandasamy, Suresh K.

2016-01-01

The enzyme Dicer produces small silencing RNAs such as micro-RNAs (miRNAs) and small interfering RNAs (siRNAs). In Drosophila, Dicer-1 produces ∼22–24-nt miRNAs from pre-miRNAs, whereas Dicer-2 makes 21-nt siRNAs from long double-stranded RNAs (dsRNAs). How Dicer-2 precisely makes 21-nt siRNAs with a remarkably high fidelity is unknown. Here we report that recognition of the 5′-monophosphate of a long dsRNA substrate by a phosphate-binding pocket in the Dicer-2 PAZ (Piwi, Argonaute, and Zwille/Pinhead) domain is crucial for the length fidelity, but not the efficiency, in 21-nt siRNA production. Loss of the length fidelity, meaning increased length heterogeneity of siRNAs, caused by point mutations in the phosphate-binding pocket of the Dicer-2 PAZ domain decreased RNA silencing activity in vivo, showing the importance of the high fidelity to make 21-nt siRNAs. We propose that the 5′-monophosphate of a long dsRNA substrate is anchored by the phosphate-binding pocket in the Dicer-2 PAZ domain and the distance between the pocket and the RNA cleavage active site in the RNaseIII domain corresponds to the 21-nt pitch in the A-form duplex of a long dsRNA substrate, resulting in high-fidelity 21-nt siRNA production. This study sheds light on the molecular mechanism by which Dicer-2 produces 21-nt siRNAs with a remarkably high fidelity for efficient RNA silencing. PMID:27872309
Tetanus Neurotoxin Neutralizing Antibodies Screened from a Human Immune scFv Antibody Phage Display Library.

PubMed

Wang, Han; Yu, Rui; Fang, Ting; Yu, Ting; Chi, Xiangyang; Zhang, Xiaopeng; Liu, Shuling; Fu, Ling; Yu, Changming; Chen, Wei

2016-09-11

Tetanus neurotoxin (TeNT) produced by Clostridium tetani is one of the most poisonous protein substances. Neutralizing antibodies against TeNT can effectively prevent and cure toxicosis. Using purified Hc fragments of TeNT (TeNT-Hc) as an antigen, three specific neutralizing antibody clones recognizing different epitopes were selected from a human immune scFv antibody phage display library. The three antibodies (2-7G, 2-2D, and S-4-7H) can effectively inhibit the binding between TeNT-Hc and differentiated PC-12 cells in vitro. Moreover, 2-7G inhibited TeNT-Hc binding to the receptor via carbohydrate-binding sites of the W pocket while 2-2D and S-4-7H inhibited binding of the R pocket. Although no single mAb completely protected mice from the toxin, they could both prolong survival when challenged with 20 LD50s (50% of the lethal dose) of TeNT. When used together, the mAbs completely neutralized 1000 LD50s/mg Ab, indicating their high neutralizing potency in vivo. Antibodies recognizing different carbohydrate-binding pockets could have higher synergistic toxin neutralization activities than those that recognize the same pockets. These results could lead to further production of neutralizing antibody drugs against TeNT and indicate that using TeNT-Hc as an antigen for screening human antibodies for TeNT intoxication therapy from human immune antibody library was convenient and effective.
Structure–kinetic relationship study of CDK8/CycC specific compounds

PubMed Central

Schneider, Elisabeth V.; Böttcher, Jark; Huber, Robert; Maskos, Klaus; Neumann, Lars

2013-01-01

In contrast with the very well explored concept of structure–activity relationship, similar studies are missing for the dependency between binding kinetics and compound structure of a protein ligand complex, the structure–kinetic relationship. Here, we present a structure–kinetic relationship study of the cyclin-dependent kinase 8 (CDK8)/cyclin C (CycC) complex. The scaffold moiety of the compounds is anchored in the kinase deep pocket and extended with diverse functional groups toward the hinge region and the front pocket. These variations can cause the compounds to change from fast to slow binding kinetics, resulting in an improved residence time. The flip of the DFG motif (“DMG” in CDK8) to the inactive DFG-out conformation appears to have relatively little influence on the velocity of binding. Hydrogen bonding with the kinase hinge region contributes to the residence time but has less impact than hydrophobic complementarities within the kinase front pocket. PMID:23630251
Discovery of a Potent BTK Inhibitor with a Novel Binding Mode by Using Parallel Selections with a DNA-Encoded Chemical Library.

PubMed

Cuozzo, John W; Centrella, Paolo A; Gikunju, Diana; Habeshian, Sevan; Hupp, Christopher D; Keefe, Anthony D; Sigel, Eric A; Soutter, Holly H; Thomson, Heather A; Zhang, Ying; Clark, Matthew A

2017-05-04

We have identified and characterized novel potent inhibitors of Bruton's tyrosine kinase (BTK) from a single DNA-encoded library of over 110 million compounds by using multiple parallel selection conditions, including variation in target concentration and addition of known binders to provide competition information. Distinct binding profiles were observed by comparing enrichments of library building block combinations under these conditions; one enriched only at high concentrations of BTK and was competitive with ATP, and another enriched at both high and low concentrations of BTK and was not competitive with ATP. A compound representing the latter profile showed low nanomolar potency in biochemical and cellular BTK assays. Results from kinetic mechanism of action studies were consistent with the selection profiles. Analysis of the co-crystal structure of the most potent compound demonstrated a novel binding mode that revealed a new pocket in BTK. Our results demonstrate that profile-based selection strategies using DNA-encoded libraries form the basis of a new methodology to rapidly identify small molecule inhibitors with novel binding modes to clinically relevant targets. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Crystal Structure of the FGFR4/LY2874455 Complex Reveals Insights into the Pan-FGFR Selectivity of LY2874455.

PubMed

Wu, Daichao; Guo, Ming; Philips, Michael A; Qu, Lingzhi; Jiang, Longying; Li, Jun; Chen, Xiaojuan; Chen, Zhuchu; Chen, Lin; Chen, Yongheng

2016-01-01

Aberrant FGFR4 signaling has been documented abundantly in various human cancers. The majority of FGFR inhibitors display significantly reduced potency toward FGFR4 compared to FGFR1-3. However, LY2874455 has similar inhibition potency for FGFR1-4 with IC50 less than 6.4 nM. To date, there is no published crystal structure of LY2874455 in complex with any kinase. To better understand the pan-FGFR selectivity of LY2874455, we have determined the crystal structure of the FGFR4 kinase domain bound to LY2874455 at a resolution of 2.35 Å. LY2874455, a type I inhibitor for FGFR4, binds to the ATP-binding pocket of FGFR4 in a DFG-in active conformation with three hydrogen bonds and a number of van der Waals contacts. After alignment of the kinase domain sequence of 4 FGFRs, and superposition of the ATP binding pocket of 4 FGFRs, our structural analyses reveal that the interactions of LY2874455 to FGFR4 are largely conserved in 4 FGFRs, explaining at least partly, the broad inhibitory activity of LY2874455 toward 4 FGFRs. Consequently, our studies reveal new insights into the pan-FGFR selectivity of LY2874455 and provide a structural basis for developing novel FGFR inhibitors that target FGFR1-4 broadly.
Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serganov, A.; Huang, L; Patel, D

2009-01-01

The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains.more » FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.« less
Second-generation CK2α inhibitors targeting the αD pocket† †Electronic supplementary information (ESI) available: All experimental details, crystallographic data collection and refinement statistics, details of chemical synthesis, additional figures and tables. See DOI: 10.1039/c7sc05122k

PubMed Central

Iegre, Jessica; Brear, Paul; De Fusco, Claudia; Yoshida, Masao; Mitchell, Sophie L.; Rossmann, Maxim; Carro, Laura; Sore, Hannah F.

2018-01-01

CK2 is a critical cell cycle regulator that also promotes various anti-apoptotic mechanisms. Development of ATP-non-competitive inhibitors of CK2 is a very attractive strategy considering that the ATP binding site is highly conserved among other kinases. We have previously utilised a pocket outside the active site to develop a novel CK2 inhibitor, CAM4066. Whilst CAM4066 bound to this new pocket it was also interacting with the ATP site: herein, we describe an example of a CK2α inhibitor that binds completely outside the active site. This second generation αD-site binding inhibitor, compound CAM4712 (IC50 = 7 μM, GI50 = 10.0 ± 3.6 μM), has numerous advantages over the previously reported CAM4066, including a reduction in the number of rotatable bonds, the absence of amide groups susceptible to the action of proteases and improved cellular permeability. Unlike with CAM4066, there was no need to facilitate cellular uptake by making a prodrug. Moreover, CAM4712 displayed no drop off between its ability to inhibit the kinase in vitro (IC50) and the ability to inhibit cell proliferation (GI50). PMID:29732088

Repression of transcriptional activity of C/EBPalpha by E2F-dimerization partner complexes.

PubMed

Zaragoza, Katrin; Bégay, Valérie; Schuetz, Anja; Heinemann, Udo; Leutz, Achim

2010-05-01

The transcription factor CCAAT/enhancer-binding protein alpha (C/EBPalpha) coordinates proliferation arrest and the differentiation of myeloid progenitors, adipocytes, hepatocytes, keratinocytes, and cells of the lung and placenta. C/EBPalpha transactivates lineage-specific differentiation genes and inhibits proliferation by repressing E2F-regulated genes. The myeloproliferative C/EBPalpha BRM2 mutant serves as a paradigm for recurrent human C-terminal bZIP C/EBPalpha mutations that are involved in acute myeloid leukemogenesis. BRM2 fails to repress E2F and to induce adipogenesis and granulopoiesis. The data presented here show that, independently of pocket proteins, C/EBPalpha interacts with the dimerization partner (DP) of E2F and that C/EBPalpha-E2F/DP interaction prevents both binding of C/EBPalpha to its cognate sites on DNA and transactivation of C/EBP target genes. The BRM2 mutant, in addition, exhibits enhanced interaction with E2F-DP and reduced affinity toward DNA and yet retains transactivation potential and differentiation competence that becomes exposed when E2F/DP levels are low. Our data suggest a tripartite balance between C/EBPalpha, E2F/DP, and pocket proteins in the control of proliferation, differentiation, and tumorigenesis.
Sunitinib: from charge-density studies to interaction with proteins.

PubMed

Malińska, Maura; Jarzembska, Katarzyna N; Goral, Anna M; Kutner, Andrzej; Woźniak, Krzysztof; Dominiak, Paulina M

2014-05-01

Protein kinases are targets for the treatment of a number of diseases. Sunitinib malate is a type I inhibitor of tyrosine kinases and was approved as a drug in 2006. This contribution constitutes the first comprehensive analysis of the crystal structures of sunitinib malate and of complexes of sunitinib with a series of protein kinases. The high-resolution single-crystal X-ray measurement and aspherical atom databank approach served as a basis for reconstruction of the charge-density distribution of sunitinib and its protein complexes. Hirshfeld surface and topological analyses revealed a similar interaction pattern in the sunitinib malate crystal structure to that in the protein binding pockets. Sunitinib forms nine preserved bond paths corresponding to hydrogen bonds and also to the C-H···O and C-H···π contacts common to the VEGRF2, CDK2, G2, KIT and IT kinases. In general, sunitinib interacts with the studied proteins with a similar electrostatic interaction energy and can adjust its conformation to fit the binding pocket in such a way as to enhance the electrostatic interactions, e.g. hydrogen bonds in ligand-kinase complexes. Such behaviour may be responsible for the broad spectrum of action of sunitinib as a kinase inhibitor.
Structural basis for molecular recognition at serotonin receptors.

PubMed

Wang, Chong; Jiang, Yi; Ma, Jinming; Wu, Huixian; Wacker, Daniel; Katritch, Vsevolod; Han, Gye Won; Liu, Wei; Huang, Xi-Ping; Vardy, Eyal; McCorvy, John D; Gao, Xiang; Zhou, X Edward; Melcher, Karsten; Zhang, Chenghai; Bai, Fang; Yang, Huaiyu; Yang, Linlin; Jiang, Hualiang; Roth, Bryan L; Cherezov, Vadim; Stevens, Raymond C; Xu, H Eric

2013-05-03

Serotonin or 5-hydroxytryptamine (5-HT) regulates a wide spectrum of human physiology through the 5-HT receptor family. We report the crystal structures of the human 5-HT1B G protein-coupled receptor bound to the agonist antimigraine medications ergotamine and dihydroergotamine. The structures reveal similar binding modes for these ligands, which occupy the orthosteric pocket and an extended binding pocket close to the extracellular loops. The orthosteric pocket is formed by residues conserved in the 5-HT receptor family, clarifying the family-wide agonist activity of 5-HT. Compared with the structure of the 5-HT2B receptor, the 5-HT1B receptor displays a 3 angstrom outward shift at the extracellular end of helix V, resulting in a more open extended pocket that explains subtype selectivity. Together with docking and mutagenesis studies, these structures provide a comprehensive structural basis for understanding receptor-ligand interactions and designing subtype-selective serotonergic drugs.
Application of oxime-diversification to optimize ligand interactions within a cryptic pocket of the polo-like kinase 1 polo-box domain.

PubMed

Zhao, Xue Zhi; Hymel, David; Burke, Terrence R

2016-10-15

By a process involving initial screening of a set of 87 aldehydes using an oxime ligation-based strategy, we were able to achieve a several-fold affinity enhancement over one of the most potent previously known polo-like kinase 1 (Plk1) polo-box domain (PBD) binding inhibitors. This improved binding may result by accessing a newly identified auxiliary region proximal to a key hydrophobic cryptic pocket on the surface of the protein. Our findings could have general applicability to the design of PBD-binding antagonists. Published by Elsevier Ltd.
Targeting lysine specific demethylase 4A (KDM4A) tandem TUDOR domain - A fragment based approach.

PubMed

Upadhyay, Anup K; Judge, Russell A; Li, Leiming; Pithawalla, Ron; Simanis, Justin; Bodelle, Pierre M; Marin, Violeta L; Henry, Rodger F; Petros, Andrew M; Sun, Chaohong

2018-06-01

The tandem TUDOR domains present in the non-catalytic C-terminal half of the KDM4A, 4B and 4C enzymes play important roles in regulating their chromatin localizations and substrate specificities. They achieve this regulatory role by binding to different tri-methylated lysine residues on histone H3 (H3-K4me3, H3-K23me3) and histone H4 (H4-K20me3) depending upon the specific chromatin environment. In this work, we have used a 2D-NMR based fragment screening approach to identify a novel fragment (1a), which binds to the KDM4A-TUDOR domain and shows modest competition with H3-K4me3 binding in biochemical as well as in vitro cell based assays. A co-crystal structure of KDM4A TUDOR domain in complex with 1a shows that the fragment binds stereo-specifically to the methyl lysine binding pocket forming a network of strong hydrogen bonds and hydrophobic interactions. We anticipate that the fragment 1a can be further developed into a novel allosteric inhibitor of the KDM4 family of enzymes through targeting their C-terminal tandem TUDOR domain. Copyright © 2018 Elsevier Ltd. All rights reserved.
Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses.

PubMed

Hendricks, Gabriel L; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C; Viswanathan, Karthik; Albers, Leila; Comolli, James C; Shriver, Zachary; Knipe, David M; Kurt-Jones, Evelyn A; Fygenson, Deborah K; Trevejo, Jose M; Wang, Jennifer P; Finberg, Robert W

2015-04-01

Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as 'molecular sinks' and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. Copyright © 2015 Elsevier B.V. All rights reserved.
The human fatty acid-binding protein family: Evolutionary divergences and functions

PubMed Central

2011-01-01

Fatty acid-binding proteins (FABPs) are members of the intracellular lipid-binding protein (iLBP) family and are involved in reversibly binding intracellular hydrophobic ligands and trafficking them throughout cellular compartments, including the peroxisomes, mitochondria, endoplasmic reticulum and nucleus. FABPs are small, structurally conserved cytosolic proteins consisting of a water-filled, interior-binding pocket surrounded by ten anti-parallel beta sheets, forming a beta barrel. At the superior surface, two alpha-helices cap the pocket and are thought to regulate binding. FABPs have broad specificity, including the ability to bind long-chain (C16-C20) fatty acids, eicosanoids, bile salts and peroxisome proliferators. FABPs demonstrate strong evolutionary conservation and are present in a spectrum of species including Drosophila melanogaster, Caenorhabditis elegans, mouse and human. The human genome consists of nine putatively functional protein-coding FABP genes. The most recently identified family member, FABP12, has been less studied. PMID:21504868
Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L.

Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or themore » doubly phosphorylated form of p38-alpha kinase.« less
Molecular characterization of the receptor binding structure-activity relationships of influenza B virus hemagglutinin.

PubMed

Carbone, V; Kim, H; Huang, J X; Baker, M A; Ong, C; Cooper, M A; Li, J; Rockman, S; Velkov, T

2013-01-01

Selectivity of α2,6-linked human-like receptors by B hemagglutinin (HA) is yet to be fully understood. This study integrates binding data with structure-recognition models to examine the impact of regional-specific sequence variations within the receptor-binding pocket on selectivity and structure activity relationships (SAR). The receptor-binding selectivity of influenza B HAs corresponding to either B/Victoria/2/1987 or the B/Yamagata/16/88 lineages was examined using surface plasmon resonance, solid-phase ELISA and gel-capture assays. Our SAR data showed that the presence of asialyl sugar units is the main determinant of receptor preference of α2,6 versus α2,3 receptor binding. Changes to the type of sialyl-glycan linkage present on receptors exhibit only a minor effect upon binding affinity. Homology-based structural models revealed that structural properties within the HA pocket, such as a glyco-conjugate at Asn194 on the 190-helix, sterically interfere with binding to avian receptor analogs by blocking the exit path of the asialyl sugars. Similarly, naturally occurring substitutions in the C-terminal region of the 190-helix and near the N-terminal end of the 140-loop narrows the horizontal borders of the binding pocket, which restricts access of the avian receptor analog LSTa. This study helps bridge the gap between ligand structure and receptor recognition for influenza B HA; and provides a consensus SAR model for the binding of human and avian receptor analogs to influenza B HA.
Pyrrole-Based Macrocyclic Small-Molecule Inhibitors That Target Oocyte Maturation.

PubMed

Gunasekaran, Pethaiah; Lee, So-Rim; Jeong, Seung-Min; Kwon, Jeong-Woo; Takei, Toshiki; Asahina, Yuya; Bang, Geul; Kim, Seongnyeon; Ahn, Mija; Ryu, Eun Kyung; Kim, Hak Nam; Nam, Ki-Yub; Shin, Song Yub; Hojo, Hironobu; Namgoong, Suk; Kim, Nam-Hyung; Bang, Jeong Kyu

2017-04-20

Polo-like kinase 1 (PLK1) plays crucial roles in various stages of oocyte maturation. Recently, we reported that the peptidomimetic compound AB103-8, which targets the polo box domain (PBD) of PLK1, affects oocyte meiotic maturation and the resumption of meiosis. However, to overcome the drawbacks of peptidic compounds, we designed and synthesized a series of pyrrole-based small-molecule inhibitors and tested them for their effects on the rates of porcine oocyte maturation. Among them, the macrocyclic compound (E/Z)-3-(2,16-dioxo-19-(4-phenylbutyl)-3,19-diazabicyclo[15.2.1]icosa-1(20),6,17-trien-3-yl)propyl dihydrogen phosphate (4) showed the highest inhibitory activity with enhanced inhibition against embryonic blastocyst formation. Furthermore, the addition of this compound to culture media efficiently blocked the maturation of porcine and mouse oocytes, indicating its ability to penetrate the zona pellucida and cell membrane. We investigated mouse oocytes treated with compound 4, and the resulting impairment of spindle formation confirmed PLK1 inhibition. Finally, molecular modeling studies with PLK1 PBD also confirmed the presence of significant interactions between compound 4 and PLK1 PBD binding pocket residues, including those in the phosphate, tyrosine-rich, and pyrrolidine binding pockets. Collectively, these results suggest that the macrocyclic compound 4 may serve as a promising template for the development of novel contraceptive agents. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Conserved neutralizing epitope at globular head of hemagglutinin in H3N2 influenza viruses.

PubMed

Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Kurosawa, Yoshikazu; Yokoyama, Shigeyuki

2014-07-01

Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Conserved Neutralizing Epitope at Globular Head of Hemagglutinin in H3N2 Influenza Viruses

PubMed Central

Iba, Yoshitaka; Fujii, Yoshifumi; Ohshima, Nobuko; Sumida, Tomomi; Kubota-Koketsu, Ritsuko; Ikeda, Mariko; Wakiyama, Motoaki; Shirouzu, Mikako; Okada, Jun; Okuno, Yoshinobu; Yokoyama, Shigeyuki

2014-01-01

ABSTRACT Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171 to 173, 239, and 240) and R (residues 91, 92, 270 to 273, 284, and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope, including the glycan, should be immunogenic in humans and may induce production of broadly neutralizing antibodies against H3 viruses. IMPORTANCE Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing antibodies. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. Since mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines. PMID:24719430
Structure of a retro-binding peptide inhibitor complexed with human alpha-thrombin.

PubMed

Tabernero, L; Chang, C Y; Ohringer, S L; Lau, W F; Iwanowicz, E J; Han, W C; Wang, T C; Seiler, S M; Roberts, D G; Sack, J S

1995-02-10

The crystallographic structure of the ternary complex between human alpha-thrombin, hirugen and the peptidyl inhibitor Phe-alloThr-Phe-O-CH3, which is acylated at its N terminus with 4-guanidino butanoic acid (BMS-183507), has been determined at 2.6 A resolution. The structure reveals a unique "retro-binding" mode for this tripeptide active site inhibitor. The inhibitor binds with its alkyl-guanidine moiety in the primary specificity pocket and its two phenyl rings occupying the hydrophobic proximal and distal pockets of the thrombin active site. In this arrangement the backbone of the tripeptide forms a parallel beta-strand to the thrombin main-chain at the binding site. This is opposite to the orientation of the natural substrate, fibrinogen, and all the small active site-directed thrombin inhibitors whose bound structures have been previously reported. BMS-183507 is the first synthetic inhibitor proved to bind in a retro-binding fashion to thrombin, in a fashion similar to that of the N-terminal residues of the natural inhibitor hirudin. Furthermore, this new potent thrombin inhibitor (Ki = 17.2 nM) is selective for thrombin over other serine proteases tested and may be a template to be considered in designing hirudin-based thrombin inhibitors with interactions at the specificity pocket.
Mechanical coupling in myosin V: a simulation study.

PubMed

Ovchinnikov, Victor; Trout, Bernhardt L; Karplus, Martin

2010-01-29

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The interdomain coupling in myosin V is studied with restrained targeted molecular dynamics using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FSs) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The "minimal" FS that results in extensive structural changes in the overall myosin conformation is composed of ATP, switch 1, and the nearby HF, HG, and HH helices. Addition of switch 2 to the FS is required to achieve a complete opening of the actin-binding cleft. The restrained targeted molecular dynamics simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the relay helix, and switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of interdomain coupling in proteins.
A small-molecule fragment that emulates binding of receptor and broadly neutralizing antibodies to influenza A hemagglutinin.

PubMed

Kadam, Rameshwar U; Wilson, Ian A

2018-04-17

The influenza virus hemagglutinin (HA) glycoprotein mediates receptor binding and membrane fusion during viral entry in host cells. Blocking these key steps in viral infection has applications for development of novel antiinfluenza therapeutics as well as vaccines. However, the lack of structural information on how small molecules can gain a foothold in the small, shallow receptor-binding site (RBS) has hindered drug design against this important target on the viral pathogen. Here, we report on the serendipitous crystallization-based discovery of a small-molecule N -cyclohexyltaurine, commonly known as the buffering agent CHES, that is able to bind to both group-1 and group-2 HAs of influenza A viruses. X-ray structural characterization of group-1 H5N1 A/Vietnam/1203/2004 (H5/Viet) and group-2 H3N2 A/Hong Kong/1/1968 (H3/HK68) HAs at 2.0-Å and 2.57-Å resolution, respectively, revealed that N -cyclohexyltaurine binds to the heart of the conserved HA RBS. N -cyclohexyltaurine mimics the binding mode of the natural receptor sialic acid and RBS-targeting bnAbs through formation of similar hydrogen bonds and CH-π interactions with the HA. In H3/HK68, N -cyclohexyltaurine also binds to a conserved pocket in the stem region, thereby exhibiting a dual-binding mode in group-2 HAs. These long-awaited structural insights into RBS recognition by a noncarbohydrate-based small molecule enhance our knowledge of how to target this important functional site and can serve as a template to guide the development of novel broad-spectrum small-molecule therapeutics against influenza virus.
Unexpected fold in the circumsporozoite protein target of malaria vaccines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doud, Michael B.; Koksal, Adem C.; Mi, Li-Zhi

Circumsporozoite (CS) protein is the major surface component of Plasmodium falciparum sporozoites and is essential for host cell invasion. A vaccine containing tandem repeats, region III, and thrombospondin type-I repeat (TSR) of CS is efficacious in phase III trials but gives only a 35% reduction in severe malaria in the first year postimmunization. We solved crystal structures showing that region III and TSR fold into a single unit, an '{alpha}TSR' domain. The {alpha}TSR domain possesses a hydrophobic pocket and core, missing in TSR domains. CS binds heparin, but {alpha}TSR does not. Interestingly, polymorphic T-cell epitopes map to specialized {alpha}TSR regions.more » The N and C termini are unexpectedly close, providing clues for sporozoite sheath organization. Elucidation of a unique structure of a domain within CS enables rational design of next-generation subunit vaccines and functional and medicinal chemical investigation of the conserved hydrophobic pocket.« less
Identification of novel inhibitors for Pim-1 kinase using pharmacophore modeling based on a novel method for selecting pharmacophore generation subsets

NASA Astrophysics Data System (ADS)

Shahin, Rand; Swellmeen, Lubna; Shaheen, Omar; Aboalhaija, Nour; Habash, Maha

2016-01-01

Targeting Proviral integration-site of murine Moloney leukemia virus 1 kinase, hereafter called Pim-1 kinase, is a promising strategy for treating different kinds of human cancer. Headed for this a total list of 328 formerly reported Pim-1 kinase inhibitors has been explored and divided based on the pharmacophoric features of the most active molecules into 10 subsets projected to represent potential active binding manners accessible to ligands within the binding pocket of Pim-1 kinase. Discovery Studio 4.1 (DS 4.1) was employed to detect potential pharmacophoric active binding manners anticipated by Pim-1 Kinase inhibitors. The pharmacophoric models were then allowed to compete within Quantitative Structure Activity Relationship (QSAR) framework with other 2D descriptors. Accordingly Genetic algorithm and multiple linear regression investigation were engaged to find the finest QSAR equation that has the best predictive power r 262 2 = 0.70, F = 119.14, r LOO 2 = 0.693, r PRESS 2 against 66 external test inhibitors = 0.71 q2 = 0.55. Three different pharmacophores appeared in the successful QSAR equation this represents three different binding modes for inhibitors within the Pim-1 kinase binding pocket. Pharmacophoric models were later used to screen compounds within the National Cancer Institute database. Several low micromolar Pim-1 Kinase inhibitors were captured. The most potent hits show IC50 values of 0.77 and 1.03 µM. Also, upon analyzing the successful QSAR Equation we found that some polycyclic aromatic electron-rich structures namely 6-Chloro-2-methoxy-acridine can be considered as putative hits for Pim-1 kinase inhibition.
Characterization of a Bacillus subtilis transporter for petrobactin, an anthrax stealth siderophore

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zawadzka, A. M.; Kim, Y.; Maltseva, N

2009-12-22

Iron deprivation activates the expression of components of the siderophore-mediated iron acquisition systems in Bacillus subtilis, including not only the synthesis and uptake of its siderophore bacillibactin but also expression of multiple ABC transporters for iron scavenging using xenosiderophores. The yclNOPQ operon is shown to encode the complete transporter for petrobactin (PB), a photoreactive 3,4-catecholate siderophore produced by many members of the B. cereus group, including B. anthracis. Isogenic disruption mutants in the yclNOPQ transporter, including permease YclN, ATPase YclP, and a substrate-binding protein YclQ, are unable to use either PB or the photoproduct of FePB (FePB{sup {nu}}) for ironmore » delivery and growth, in contrast to the wild-type B. subtilis. Complementation of the mutations with the copies of the respective genes restores this capability. The YclQ receptor binds selectively iron-free and ferric PB, the PB precursor, 3,4-dihydroxybenzoic acid (3,4-DHB), and FePB{sup {nu}} with high affinity; the ferric complexes are seen in ESI-MS, implying strong electrostatic interaction between the protein-binding pocket and siderophore. The first structure of a Gram-positive siderophore receptor is presented. The 1.75-{angstrom} crystal structure of YclQ reveals a bilobal periplasmic binding protein (PBP) fold consisting of two {alpha}/{beta}/{alpha} sandwich domains connected by a long {alpha}-helix with the binding pocket containing conserved positively charged and aromatic residues and large enough to accommodate FePB. Orthologs of the B. subtilis PB-transporter YclNOPQ in PB-producing Bacilli are likely contributors to the pathogenicity of these species and provide a potential target for antibacterial strategies.« less
Comprehensive Experimental and Computational Analysis of Binding Energy Hot Spots at the NF-κB Essential Modulator (NEMO)/IKKβ Protein-Protein Interface

PubMed Central

Golden, Mary S.; Cote, Shaun M.; Sayeg, Marianna; Zerbe, Brandon S.; Villar, Elizabeth A.; Beglov, Dmitri; Sazinsky, Stephen L.; Georgiadis, Rosina M.; Vajda, Sandor; Kozakov, Dima; Whitty, Adrian

2013-01-01

We report a comprehensive analysis of binding energy hot spots at the protein-protein interaction (PPI) interface between NF-κB Essential Modulator (NEMO) and IκB kinase subunit β (IKKβ), an interaction that is critical for NF-κB pathway signaling, using experimental alanine scanning mutagenesis and also the FTMap method for computational fragment screening. The experimental results confirm that the previously identified NBD region of IKKβ contains the highest concentration of hot spot residues, the strongest of which are W739, W741 and L742 (ΔΔG = 4.3, 3.5 and 3.2 kcal/mol, respectively). The region occupied by these residues defines a potentially druggable binding site on NEMO that extends for ~16 Å to additionally include the regions that bind IKKβ L737 and F734. NBD residues D738 and S740 are also important for binding but do not make direct contact with NEMO, instead likely acting to stabilize the active conformation of surrounding residues. We additionally found two previously unknown hot spot regions centered on IKKβ residues L708/V709 and L719/I723. The computational approach successfully identified all three hot spot regions on IKKβ. Moreover, the method was able to accurately quantify the energetic importance of all hot spots residues involving direct contact with NEMO. Our results provide new information to guide the discovery of small molecule inhibitors that target the NEMO/IKKβ interaction. They additionally clarify the structural and energetic complementarity between “pocket-forming” and “pocket occupying” hot spot residues, and further validate computational fragment mapping as a method for identifying hot spots at PPI interfaces. PMID:23506214
Molecular adaptability of nucleoside diphosphate kinase b from trypanosomatid parasites: stability, oligomerization and structural determinants of nucleotide binding.

PubMed

Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T

2011-07-01

Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.

Discovering rules for protein-ligand specificity using support vector inductive logic programming.

PubMed

Kelley, Lawrence A; Shrimpton, Paul J; Muggleton, Stephen H; Sternberg, Michael J E

2009-09-01

Structural genomics initiatives are rapidly generating vast numbers of protein structures. Comparative modelling is also capable of producing accurate structural models for many protein sequences. However, for many of the known structures, functions are not yet determined, and in many modelling tasks, an accurate structural model does not necessarily tell us about function. Thus, there is a pressing need for high-throughput methods for determining function from structure. The spatial arrangement of key amino acids in a folded protein, on the surface or buried in clefts, is often the determinants of its biological function. A central aim of molecular biology is to understand the relationship between such substructures or surfaces and biological function, leading both to function prediction and to function design. We present a new general method for discovering the features of binding pockets that confer specificity for particular ligands. Using a recently developed machine-learning technique which couples the rule-discovery approach of inductive logic programming with the statistical learning power of support vector machines, we are able to discriminate, with high precision (90%) and recall (86%) between pockets that bind FAD and those that bind NAD on a large benchmark set given only the geometry and composition of the backbone of the binding pocket without the use of docking. In addition, we learn rules governing this specificity which can feed into protein functional design protocols. An analysis of the rules found suggests that key features of the binding pocket may be tied to conformational freedom in the ligand. The representation is sufficiently general to be applicable to any discriminatory binding problem. All programs and data sets are freely available to non-commercial users at http://www.sbg.bio.ic.ac.uk/svilp_ligand/.
Identification of transmembrane domain 6 & 7 residues that contribute to the binding pocket of the urotensin II receptor.

PubMed

Holleran, Brian J; Domazet, Ivana; Beaulieu, Marie-Eve; Yan, Li Ping; Guillemette, Gaétan; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard

2009-04-15

Urotensin II (U-II), a cyclic undecapeptide, is the natural ligand of the urotensin II (UT) receptor, a G protein-coupled receptor. In the present study, we used the substituted-cysteine accessibility method to identify specific residues in transmembrane domains (TMDs) six and seven of the rat urotensin II receptor (rUT) that contribute to the formation of the binding pocket of the receptor. Each residue in the R256(6.32)-Q283(6.59) fragment of TMD6 and the A295(7.31)-T321(7.57) fragment of TMD7 was mutated, individually, to a cysteine. The resulting mutants were expressed in COS-7 cells, which were subsequently treated with the positively charged methanethiosulfonate-ethylammonium (MTSEA) or the negatively charged methanethiosulfonate-ethylsulfonate (MTSES) sulfhydryl-specific alkylating agents. MTSEA treatment resulted in a significant reduction in the binding of TMD6 mutants F268C(6.44) and W278C(6.54) and TMD7 mutants L298C(7.34), T302C(7.38), and T303C(7.39) to (125)I-U-II. MTSES treatment resulted in a significant reduction in the binding of two additional mutants, namely L282C(6.58) in TMD6 and Y300C(7.36) in TMD7. These results suggest that specific residues orient themselves within the water-accessible binding pocket of the rUT receptor. This approach, which allowed us to identify key determinants in TMD6 and TMD7 that contribute to the UT receptor binding pocket, enabled us to further refine our homology-based model of how U-II interacts with its cognate receptor.
The fifth transmembrane domain of angiotensin II Type 1 receptor participates in the formation of the ligand-binding pocket and undergoes a counterclockwise rotation upon receptor activation.

PubMed

Domazet, Ivana; Martin, Stéphane S; Holleran, Brian J; Morin, Marie-Eve; Lacasse, Patrick; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard; Guillemette, Gaétan

2009-11-13

The octapeptide hormone angiotensin II exerts a wide variety of cardiovascular effects through the activation of the angiotensin II Type 1 (AT(1)) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein- coupled receptors, the AT(1) receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. The role of the fifth transmembrane domain (TMD5) was investigated using the substituted cysteine accessibility method. All of the residues within Thr-190 to Leu-217 region were mutated one at a time to cysteine, and after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of L197C-AT(1), N200C-AT(1), I201C-AT(1), G203C-AT(1), and F204C-AT(1) mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT(1) receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD5 reporter cysteines engineered in a constitutively active N111G-AT(1) receptor background. Indeed, mutant I201C-N111G-AT(1) became more sensitive to MTSEA, whereas mutant G203C-N111G-AT(1) lost some sensitivity. Our results suggest that constitutive activation of AT(1) receptor causes an apparent counterclockwise rotation of TMD5 as viewed from the extracellular side.
Differential Epitope Mapping by STD NMR Spectroscopy To Reveal the Nature of Protein-Ligand Contacts.

PubMed

Monaco, Serena; Tailford, Louise E; Juge, Nathalie; Angulo, Jesus

2017-11-27

Saturation transfer difference (STD) NMR spectroscopy is extensively used to obtain epitope maps of ligands binding to protein receptors, thereby revealing structural details of the interaction, which is key to direct lead optimization efforts in drug discovery. However, it does not give information about the nature of the amino acids surrounding the ligand in the binding pocket. Herein, we report the development of the novel method differential epitope mapping by STD NMR (DEEP-STD NMR) for identifying the type of protein residues contacting the ligand. The method produces differential epitope maps through 1) differential frequency STD NMR and/or 2) differential solvent (D 2 O/H 2 O) STD NMR experiments. The two approaches provide different complementary information on the binding pocket. We demonstrate that DEEP-STD NMR can be used to readily obtain pharmacophore information on the protein. Furthermore, if the 3D structure of the protein is known, this information also helps in orienting the ligand in the binding pocket. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Identification of new benzamide inhibitor against α-subunit of tryptophan synthase from Mycobacterium tuberculosis through structure-based virtual screening, anti-tuberculosis activity and molecular dynamics simulations.

PubMed

Naz, Sadia; Farooq, Umar; Ali, Sajid; Sarwar, Rizwana; Khan, Sara; Abagyan, Ruben

2018-03-13

Multi-drug-resistant tuberculosis and extensively drug-resistant tuberculosis has emerged as global health threat, causing millions of deaths worldwide. Identification of new drug candidates for tuberculosis (TB) by targeting novel and less explored protein targets will be invaluable for antituberculosis drug discovery. We performed structure-based virtual screening of eMolecules database against a homology model of relatively unexplored protein target: the α-subunit of tryptophan synthase (α-TRPS) from Mycobacterium tuberculosis essential for bacterial survival. Based on physiochemical properties analysis and molecular docking, the seven candidate compounds were selected and evaluated through whole cell-based activity against the H37Rv strain of M. tuberculosis. A new Benzamide inhibitor against α-subunit of tryptophan synthase (α-TRPS) from M. tuberculosis has been identified causing 100% growth inhibition at 25 μg/ml and visible bactericidal activity at 6 μg/ml. This benzamide inhibitor displayed a good predicted binding score (-48.24 kcal/mol) with the α-TRPS binding pocket and has logP value (2.95) comparable to Rifampicin. Further refinement of docking results and evaluation of inhibitor-protein complex stability were investigated through Molecular dynamic (MD) simulations studies. Following MD simulations, Root mean square deviation, Root mean square fluctuation and secondary structure analysis confirmed that protein did not unfold and ligand stayed inside the active pocket of protein during the explored time scale. This identified benzamide inhibitor against the α-subunit of TRPS from M. tuberculosis could be considered as candidate for drug discovery against TB and will be further evaluated for enzyme-based inhibition in future studies.
The Application of Ligand-Mapping Molecular Dynamics Simulations to the Rational Design of Peptidic Modulators of Protein-Protein Interactions.

PubMed

Tan, Yaw Sing; Spring, David R; Abell, Chris; Verma, Chandra S

2015-07-14

A computational ligand-mapping approach to detect protein surface pockets that interact with hydrophobic moieties is presented. In this method, we incorporated benzene molecules into explicit solvent molecular dynamics simulations of various protein targets. The benzene molecules successfully identified the binding locations of hydrophobic hot-spot residues and all-hydrocarbon cross-links from known peptidic ligands. They also unveiled cryptic binding sites that are occluded by side chains and the protein backbone. Our results demonstrate that ligand-mapping molecular dynamics simulations hold immense promise to guide the rational design of peptidic modulators of protein-protein interactions, including that of stapled peptides, which show promise as an exciting new class of cell-penetrating therapeutic molecules.
Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bokoch, Michael P.; Zou, Yaozhong; Rasmussen, Søren G.F.

G-protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate most cellular responses to hormones and neurotransmitters. They are the largest group of therapeutic targets for a broad spectrum of diseases. Recent crystal structures of GPCRs have revealed structural conservation extending from the orthosteric ligand-binding site in the transmembrane core to the cytoplasmic G-protein-coupling domains. In contrast, the extracellular surface (ECS) of GPCRs is remarkably diverse and is therefore an ideal target for the discovery of subtype-selective drugs. However, little is known about the functional role of the ECS in receptor activation, or about conformational coupling of this surface to the nativemore » ligand-binding pocket. Here we use NMR spectroscopy to investigate ligand-specific conformational changes around a central structural feature in the ECS of the {beta}{sub 2} adrenergic receptor: a salt bridge linking extracellular loops 2 and 3. Small-molecule drugs that bind within the transmembrane core and exhibit different efficacies towards G-protein activation (agonist, neutral antagonist and inverse agonist) also stabilize distinct conformations of the ECS. We thereby demonstrate conformational coupling between the ECS and the orthosteric binding site, showing that drugs targeting this diverse surface could function as allosteric modulators with high subtype selectivity. Moreover, these studies provide a new insight into the dynamic behaviour of GPCRs not addressable by static, inactive-state crystal structures.« less
Leveraging structure determination with fragment screening for infectious disease drug targets: MECP synthase from Burkholderia pseudomallei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Begley, Darren W.; Hartley, Robert C.; Davies, Douglas R.

As part of the Seattle Structural Genomics Center for Infectious Disease, we seek to enhance structural genomics with ligand-bound structure data which can serve as a blueprint for structure-based drug design. We have adapted fragment-based screening methods to our structural genomics pipeline to generate multiple ligand-bound structures of high priority drug targets from pathogenic organisms. In this study, we report fragment screening methods and structure determination results for 2C-methyl-D-erythritol-2,4-cyclo-diphosphate (MECP) synthase from Burkholderia pseudomallei, the gram-negative bacterium which causes melioidosis. Screening by nuclear magnetic resonance spectroscopy as well as crystal soaking followed by X-ray diffraction led to the identification ofmore » several small molecules which bind this enzyme in a critical metabolic pathway. A series of complex structures obtained with screening hits reveal distinct binding pockets and a range of small molecules which form complexes with the target. Additional soaks with these compounds further demonstrate a subset of fragments to only bind the protein when present in specific combinations. This ensemble of fragment-bound complexes illuminates several characteristics of MECP synthase, including a previously unknown binding surface external to the catalytic active site. These ligand-bound structures now serve to guide medicinal chemists and structural biologists in rational design of novel inhibitors for this enzyme.« less
Species-Specific Involvement of Integrin αIIbβ3 in a Monoclonal Antibody CH12 Triggers Off-Target Thrombocytopenia in Cynomolgus Monkeys.

PubMed

Zhang, Yiting; Sun, Jianhua; Tan, Minjia; Liu, Yongzhen; Li, Qian; Jiang, Hua; Wang, Huamao; Li, Zonghai; Wan, Wei; Jiang, Hualiang; Lu, Henglei; Wang, Bingshun; Ren, Jin; Gong, Likun

2018-04-07

CH12 is a novel humanized monoclonal antibody against epidermal growth factor receptor variant III (EGFRvIII) for cancer treatment. Unfortunately, in pre-clinical safety evaluation studies, acute thrombocytopenia was observed after administration of CH12 in cynomolgus monkeys, but not rats. More importantly, in vitro experiments found that CH12 can bind and activate platelets in cynomolgus monkey, but not human peripheral blood samples. Cynomolgus monkey-specific thrombocytopenia has been reported previously; however, the underlying mechanism remains unclear. Here, we first showed that CH12 induced thrombocytopenia in cynomolgus monkeys through off-target platelet binding and activation, resulting in platelet destruction. We subsequently found that integrin αIIbβ3 (which is expressed on platelets) contributed to this off-target toxicity. Furthermore, three-dimensional structural modeling of the αIIbβ3 molecules in cynomolgus monkeys, humans, and rats suggested that an additional unique loop exists in the ligand-binding pocket of the αIIb subunit in cynomolgus monkeys, which may explain why CH12 binds to platelets only in cynomolgus monkeys. Moreover, this study supported the hypothesis that the minor differences between cynomolgus monkeys and humans can confuse human risk assessments and suggests that species differences can help the prediction of human risks and avoid losses in drug development. Copyright © 2018. Published by Elsevier Inc.
Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

2016-03-24

The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less
Inducible gene expression and protein translocation using nontoxic ligands identified by a mammalian three-hybrid screen

PubMed Central

Liberles, Stephen D.; Diver, Steven T.; Austin, David J.; Schreiber, Stuart L.

1997-01-01

The natural product rapamycin has been used to provide temporal and quantitative control of gene expression in animals through its ability to interact with two proteins simultaneously. A shortcoming of this approach is that rapamycin is an inhibitor of cell proliferation, the result of binding to FKBP12–rapamycin-associated protein (FRAP). To overcome this limitation, nontoxic derivatives of rapamycin bearing bulky substituents at its C16-position were synthesized, each in a single step. The isosteric isopropoxy and methallyl substituents with the nonnatural C16-configuration abolish both binding to FRAP and inhibition of T cell proliferation. Binding proteins for these derivatives were identified from libraries of cDNAs encoding mutants of the FKBP12–rapamycin-binding (FRB) domain of FRAP by using a mammalian three-hybrid transcription assay. Targeting of the mutations was guided by the structure of the FKBP12-rapamycin–FRB ternary complex. Three compensatory mutations in the FRB domain, all along one face of an α-helix in a rapamycin-binding pocket, were identified that together restore binding of the rapamycin derivatives. Using this mutant FRB domain, one of the nontoxic rapamycin derivatives induced targeted gene expression in Jurkat T cells with an EC50 below 10 nM. Another derivative was used to recruit a cytosolic protein to the plasma membrane, mimicking a process involved in many signaling pathways. PMID:9223271
Structural basis of AMPK regulation by small molecule activators

NASA Astrophysics Data System (ADS)

Xiao, Bing; Sanders, Matthew J.; Carmena, David; Bright, Nicola J.; Haire, Lesley F.; Underwood, Elizabeth; Patel, Bhakti R.; Heath, Richard B.; Walker, Philip A.; Hallen, Stefan; Giordanetto, Fabrizio; Martin, Stephen R.; Carling, David; Gamblin, Steven J.

2013-12-01

AMP-activated protein kinase (AMPK) plays a major role in regulating cellular energy balance by sensing and responding to increases in AMP/ADP concentration relative to ATP. Binding of AMP causes allosteric activation of the enzyme and binding of either AMP or ADP promotes and maintains the phosphorylation of threonine 172 within the activation loop of the kinase. AMPK has attracted widespread interest as a potential therapeutic target for metabolic diseases including type 2 diabetes and, more recently, cancer. A number of direct AMPK activators have been reported as having beneficial effects in treating metabolic diseases, but there has been no structural basis for activator binding to AMPK. Here we present the crystal structure of human AMPK in complex with a small molecule activator that binds at a site between the kinase domain and the carbohydrate-binding module, stabilising the interaction between these two components. The nature of the activator-binding pocket suggests the involvement of an additional, as yet unidentified, metabolite in the physiological regulation of AMPK. Importantly, the structure offers new opportunities for the design of small molecule activators of AMPK for treatment of metabolic disorders.
Characterization of Human and Murine T-Cell Immunoglobulin Mucin Domain 4 (TIM-4) IgV Domain Residues Critical for Ebola Virus Entry.

PubMed

Rhein, Bethany A; Brouillette, Rachel B; Schaack, Grace A; Chiorini, John A; Maury, Wendy

2016-07-01

Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amino-terminal IgV domain. While the residues within the TIM-1 IgV domain that are important for EBOV entry are characterized, the molecular details of virion-TIM-4 interactions have yet to be investigated. As sequences and structural alignments of the TIM proteins suggest distinct differences in the TIM-1 and TIM-4 IgV domain structures, we sought to characterize TIM-4 IgV domain residues required for EBOV entry. Using vesicular stomatitis virus pseudovirions bearing EBOV glycoprotein (EBOV GP/VSVΔG), we evaluated virus binding and entry into cells expressing TIM-4 molecules mutated within the IgV domain, allowing us to identify residues important for entry. Similar to TIM-1, residues in the PtdSer binding pocket of murine and human TIM-4 (mTIM-4 and hTIM-4) were found to be important for EBOV entry. However, additional TIM-4-specific residues were also found to impact EBOV entry, with a total of 8 mTIM-4 and 14 hTIM-4 IgV domain residues being critical for virion binding and internalization. Together, these findings provide a greater understanding of the interaction of TIM-4 with EBOV virions. With more than 28,000 cases and over 11,000 deaths during the largest and most recent Ebola virus (EBOV) outbreak, there has been increased emphasis on the development of therapeutics against filoviruses. Many therapies under investigation target EBOV cell entry. T-cell immunoglobulin mucin (TIM) domain proteins are cell surface factors important for the entry of many enveloped viruses, including EBOV. TIM family member TIM-4 is expressed on macrophages and dendritic cells, which are early cellular targets during EBOV infection. Here, we performed a mutagenesis screening of the IgV domain of murine and human TIM-4 to identify residues that are critical for EBOV entry. Surprisingly, we identified more human than murine TIM-4 IgV domain residues that are required for EBOV entry. Defining the TIM IgV residues needed for EBOV entry clarifies the virus-receptor interactions and paves the way for the development of novel therapeutics targeting virus binding to this cell surface receptor. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Characterization of Human and Murine T-Cell Immunoglobulin Mucin Domain 4 (TIM-4) IgV Domain Residues Critical for Ebola Virus Entry

PubMed Central

Rhein, Bethany A.; Brouillette, Rachel B.; Schaack, Grace A.; Chiorini, John A.

2016-01-01

ABSTRACT Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amino-terminal IgV domain. While the residues within the TIM-1 IgV domain that are important for EBOV entry are characterized, the molecular details of virion–TIM-4 interactions have yet to be investigated. As sequences and structural alignments of the TIM proteins suggest distinct differences in the TIM-1 and TIM-4 IgV domain structures, we sought to characterize TIM-4 IgV domain residues required for EBOV entry. Using vesicular stomatitis virus pseudovirions bearing EBOV glycoprotein (EBOV GP/VSVΔG), we evaluated virus binding and entry into cells expressing TIM-4 molecules mutated within the IgV domain, allowing us to identify residues important for entry. Similar to TIM-1, residues in the PtdSer binding pocket of murine and human TIM-4 (mTIM-4 and hTIM-4) were found to be important for EBOV entry. However, additional TIM-4-specific residues were also found to impact EBOV entry, with a total of 8 mTIM-4 and 14 hTIM-4 IgV domain residues being critical for virion binding and internalization. Together, these findings provide a greater understanding of the interaction of TIM-4 with EBOV virions. IMPORTANCE With more than 28,000 cases and over 11,000 deaths during the largest and most recent Ebola virus (EBOV) outbreak, there has been increased emphasis on the development of therapeutics against filoviruses. Many therapies under investigation target EBOV cell entry. T-cell immunoglobulin mucin (TIM) domain proteins are cell surface factors important for the entry of many enveloped viruses, including EBOV. TIM family member TIM-4 is expressed on macrophages and dendritic cells, which are early cellular targets during EBOV infection. Here, we performed a mutagenesis screening of the IgV domain of murine and human TIM-4 to identify residues that are critical for EBOV entry. Surprisingly, we identified more human than murine TIM-4 IgV domain residues that are required for EBOV entry. Defining the TIM IgV residues needed for EBOV entry clarifies the virus-receptor interactions and paves the way for the development of novel therapeutics targeting virus binding to this cell surface receptor. PMID:27122575
Molecular simulation to investigate the cofactor specificity for pichia stipitis Xylose reductase.

PubMed

Xia, Xiao-Le; Cong, Shan; Weng, Xiao-Rong; Chen, Jin-Hua; Wang, Jing-Fang; Chou, Kuo-Chen

2013-11-01

Xylose is one of the most abundant carbohydrates in nature, and widely used to produce bioethanol via fermentation in industry. Xylulose can produce two key enzymes: xylose reductase and xylitol dehydrogenase. Owing to the disparate cofactor specificities of xylose reductase and xylitol dehydrogenase, intracellular redox imbalance is detected during the xylose fermentation, resulting in low ethanol yields. To overcome this barrier, a common strategy is applied to artificially modify the cofactor specificity of xylose reductase. In this study, we utilized molecular simulation approaches to construct a 3D (three-dimensional) structural model for the NADP-dependent Pichia stipitis xylose reductase (PsXR). Based on the 3D model, the favourable binding modes for both cofactors NAD and NADP were obtained using the flexible docking procedure and molecular dynamics simulation. Structural analysis of the favourable binding modes showed that the cofactor binding site of PsXR was composed of 3 major components: a hydrophilic pocket, a hydrophobic pocket as well as a linker channel between the aforementioned two pockets. The hydrophilic pocket could recognize the nicotinamide moiety of the cofactors by hydrogen bonding networks, while the hydrophobic pocket functioned to position the adenine moiety of the cofactors by hydrophobic and Π-Π stacking interactions. The linker channel contained some key residues for ligand-binding; their mutation could have impact to the specificity of PsXR. Finally, it was found that any of the two single mutations, K21A and K270N, might reverse the cofactor specificity of PsXR from major NADP- to NADdependent, which was further confirmed by the additional experiments. Our findings may provide useful insights into the cofactor specificity of PsXR, stimulating new strategies for better designing xylose reductase and improving ethanol production in industry.
Key role of hydrazine to the interaction between oxaloacetic against phosphoenolpyruvic carboxykinase (PEPCK): ONIOM calculations.

PubMed

Prajongtat, Pongthep; Phromyothin, Darinee Sae-Tang; Hannongbua, Supa

2013-08-01

The interactions between oxaloacetic (OAA) and phosphoenolpyruvic carboxykinase (PEPCK) binding pocket in the presence and absence of hydrazine were carried out using quantum chemical calculations, based on the two-layered ONIOM (ONIOM2) approach. The complexes were partially optimized by ONIOM2 (B3LYP/6-31G(d):PM6) method while the interaction energies between OAA and individual residues surrounding the pocket were performed at the MP2/6-31G(d,p) level of theory. The calculated interaction energies (INT) indicated that Arg87, Gly237, Ser286, and Arg405 are key residues for binding to OAA with the INT values of -1.93, -2.06, -2.47, and -3.16 kcal mol(-1), respectively. The interactions are mainly due to the formation of hydrogen bonding interactions with OAA. Moreover, using ONIOM2 (B3LYP/6-31G(d):PM6) applied on the PEPCKHS complex, two proton transfers were observed; first, the proton was transferred from the carboxylic group of OAA to hydrazine while the second one was from Asp311 to Lys244. Such reactions cause the generation of binding strength of OAA to the pocket via electrostatic interaction. The orientations of Lys243, Lys244, His264, Asp311, Phe333, and Arg405 were greatly deviated after hydrazine incorporation. These indicate that hydrazine plays an important role in terms of not only changing the conformation of the binding pocket, but is also tightly bound to OAA resulting in its conformation change in the pocket. The understanding of such interaction can be useful for the design of hydrazine-based inhibitor for antichachexia agents.
Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region.

PubMed

Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L; Hood, Molly M; Lord, John W; Lu, Wei-Ping; Miller, David F; Patt, William C; Smith, Bryan D; Vogeti, Lakshminarayana; Kaufman, Michael D; Petillo, Peter A; Wise, Scott C; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L

2010-10-01

Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase. Copyright © 2010 Elsevier Ltd. All rights reserved.
Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

PubMed

Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

2011-05-03

DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.
Towards novel therapeutics for HIV through fragment-based screening and drug design.

PubMed

Tiefendbrunn, Theresa; Stout, C David

2014-01-01

Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.
Highly selective inhibition of myosin motors provides the basis of potential therapeutic application

PubMed Central

Sirigu, Serena; Hartman, James J.; Ropars, Virginie; Clancy, Sheila; Wang, Xi; Chuang, Grace; Qian, Xiangping; Lu, Pu-Ping; Barrett, Edward; Rudolph, Karin; Royer, Christopher; Morgan, Bradley P.; Stura, Enrico A.; Malik, Fady I.; Houdusse, Anne M.

2016-01-01

Direct inhibition of smooth muscle myosin (SMM) is a potential means to treat hypercontractile smooth muscle diseases. The selective inhibitor CK-2018571 prevents strong binding to actin and promotes muscle relaxation in vitro and in vivo. The crystal structure of the SMM/drug complex reveals that CK-2018571 binds to a novel allosteric pocket that opens up during the “recovery stroke” transition necessary to reprime the motor. Trapped in an intermediate of this fast transition, SMM is inhibited with high selectivity compared with skeletal muscle myosin (IC50 = 9 nM and 11,300 nM, respectively), although all of the binding site residues are identical in these motors. This structure provides a starting point from which to design highly specific myosin modulators to treat several human diseases. It further illustrates the potential of targeting transition intermediates of molecular machines to develop exquisitely selective pharmacological agents. PMID:27815532

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N
Crystal Structure of an LSD-Bound Human Serotonin Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wacker, Daniel; Wang, Sheng; McCorvy, John D.

The prototypical hallucinogen LSD acts via serotonin receptors, and here we describe the crystal structure of LSD in complex with the human serotonin receptor 5-HT2B. The complex reveals conformational rearrangements to accommodate LSD, providing a structural explanation for the conformational selectivity of LSD’s key diethylamide moiety. LSD dissociates exceptionally slow from both 5-HT2BR and 5-HT2AR—a major target for its psychoactivity. Molecular dynamics (MD) simulations suggest that LSD’s slow binding kinetics may be due to a “lid” formed by extracellular loop 2 (EL2) at the entrance to the binding pocket. A mutation predicted to increase the mobility of this lid greatlymore » accelerates LSD’s binding kinetics and selectively dampens LSD-mediated β-arrestin2 recruitment. This study thus reveals an unexpected binding mode of LSD; illuminates key features of its kinetics, stereochemistry, and signaling; and provides a molecular explanation for LSD’s actions at human serotonin receptors.« less
Crystal Structure of an LSD-Bound Human Serotonin Receptor.

PubMed

Wacker, Daniel; Wang, Sheng; McCorvy, John D; Betz, Robin M; Venkatakrishnan, A J; Levit, Anat; Lansu, Katherine; Schools, Zachary L; Che, Tao; Nichols, David E; Shoichet, Brian K; Dror, Ron O; Roth, Bryan L

2017-01-26

The prototypical hallucinogen LSD acts via serotonin receptors, and here we describe the crystal structure of LSD in complex with the human serotonin receptor 5-HT 2B . The complex reveals conformational rearrangements to accommodate LSD, providing a structural explanation for the conformational selectivity of LSD's key diethylamide moiety. LSD dissociates exceptionally slow from both 5-HT 2B R and 5-HT 2A R-a major target for its psychoactivity. Molecular dynamics (MD) simulations suggest that LSD's slow binding kinetics may be due to a "lid" formed by extracellular loop 2 (EL2) at the entrance to the binding pocket. A mutation predicted to increase the mobility of this lid greatly accelerates LSD's binding kinetics and selectively dampens LSD-mediated β-arrestin2 recruitment. This study thus reveals an unexpected binding mode of LSD; illuminates key features of its kinetics, stereochemistry, and signaling; and provides a molecular explanation for LSD's actions at human serotonin receptors. PAPERCLIP. Copyright © 2017 Elsevier Inc. All rights reserved.
NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Dalei; Su, Xiaoyu; Potluri, Nalini

Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less
NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

DOE PAGES

Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; ...

2016-10-26

Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less
Structural and mechanistic insights into phospholipid transfer by Ups1-Mdm35 in mitochondria

NASA Astrophysics Data System (ADS)

Watanabe, Yasunori; Tamura, Yasushi; Kawano, Shin; Endo, Toshiya

2015-08-01

Eukaryotic cells are compartmentalized into membrane-bounded organelles whose functions rely on lipid trafficking to achieve membrane-specific compositions of lipids. Here we focused on the Ups1-Mdm35 system, which mediates phosphatidic acid (PA) transfer between the outer and inner mitochondrial membranes, and determined the X-ray structures of Mdm35 and Ups1-Mdm35 with and without PA. The Ups1-Mdm35 complex constitutes a single domain that has a deep pocket and flexible Ω-loop lid. Structure-based mutational analyses revealed that a basic residue at the pocket bottom and the Ω-loop lid are important for PA extraction from the membrane following Ups1 binding. Ups1 binding to the membrane is enhanced by the dissociation of Mdm35. We also show that basic residues around the pocket entrance are important for Ups1 binding to the membrane and PA extraction. These results provide a structural basis for understanding the mechanism of PA transfer between mitochondrial membranes.
Structural insights into μ-opioid receptor activation

PubMed Central

Huang, Weijiao; Manglik, Aashish; Venkatakrishnan, A. J.; Laeremans, Toon; Feinberg, Evan N.; Sanborn, Adrian L.; Kato, Hideaki E.; Livingston, Kathryn E.; Thorsen, Thor S.; Kling, Ralf; Granier, Sébastien; Gmeiner, Peter; Husbands, Stephen M.; Traynor, John R.; Weis, William I.; Steyaert, Jan; Dror, Ron O.; Kobilka, Brian K.

2015-01-01

Summary Activation of the μ-opioid receptor (μOR) is responsible for the efficacy of the most effective analgesics. To understand the structural basis for μOR activation, we obtained a 2.1 Å X-ray crystal structure of the μOR bound to the morphinan agonist BU72 and stabilized by a G protein-mimetic camelid-antibody fragment. The BU72-stabilized changes in the μOR binding pocket are subtle and differ from those observed for agonist-bound structures of the β2 adrenergic receptor (β2AR) and the M2 muscarinic receptor (M2R). Comparison with active β2AR reveals a common rearrangement in the packing of three conserved amino acids in the core of the μOR, and molecular dynamics simulations illustrate how the ligand-binding pocket is conformationally linked to this conserved triad. Additionally, an extensive polar network between the ligand-binding pocket and the cytoplasmic domains appears to play a similar role in signal propagation for all three GPCRs. PMID:26245379
The structure of the SBP-Tag–streptavidin complex reveals a novel helical scaffold bridging binding pockets on separate subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrette-Ng, Isabelle H.; Wu, Sau-Ching; Tjia, Wai-Mui

2013-05-01

The structure of the SBP-Tag–streptavidin complex reveals a novel mode of peptide recognition in which a single peptide binds simultaneously to biotin-binding pockets from adjacent subunits of streptavidin. The molecular details of peptide recognition suggest how the SBP-Tag can be further modified to become an even more useful tag for a wider range of biotechnological applications. The 38-residue SBP-Tag binds to streptavidin more tightly (K{sub d} ≃ 2.5–4.9 nM) than most if not all other known peptide sequences. Crystallographic analysis at 1.75 Å resolution shows that the SBP-Tag binds to streptavidin in an unprecedented manner by simultaneously interacting with biotin-bindingmore » pockets from two separate subunits. An N-terminal HVV peptide sequence (residues 12–14) and a C-terminal HPQ sequence (residues 31–33) form the bulk of the direct interactions between the SBP-Tag and the two biotin-binding pockets. Surprisingly, most of the peptide spanning these two sites (residues 17–28) adopts a regular α-helical structure that projects three leucine side chains into a groove formed at the interface between two streptavidin protomers. The crystal structure shows that residues 1–10 and 35–38 of the original SBP-Tag identified through in vitro selection and deletion analysis do not appear to contact streptavidin and thus may not be important for binding. A 25-residue peptide comprising residues 11–34 (SBP-Tag2) was synthesized and shown using surface plasmon resonance to bind streptavidin with very similar affinity and kinetics when compared with the SBP-Tag. The SBP-Tag2 was also added to the C-terminus of β-lactamase and was shown to be just as effective as the full-length SBP-Tag in affinity purification. These results validate the molecular structure of the SBP-Tag–streptavidin complex and establish a minimal bivalent streptavidin-binding tag from which further rational design and optimization can proceed.« less
Discovery and evaluation of triple inhibitors of VEGFR-2, TIE-2 and EphB4 as anti-angiogenic and anti-cancer agents

PubMed Central

Zhang, Lin; Shan, Yuanyuan; Ji, Xingyue; Zhu, Mengyuan; Li, Chuansheng; Sun, Ying; Si, Ru; Pan, Xiaoyan; Wang, Jinfeng; Ma, Weina; Dai, Bingling; Wang, Binghe; Zhang, Jie

2017-01-01

Receptor tyrosine kinases (RTKs), especially VEGFR-2, TIE-2, and EphB4, play a crucial role in both angiogenesis and tumorigenesis. Moreover, complexity and heterogeneity of angiogenesis make it difficult to treat such pathological traits with single-target agents. Herein, we developed two classes of multi-target RTK inhibitors (RTKIs) based on the highly conserved ATP-binding pocket of VEGFR-2/TIE-2/EphB4, using previously reported BPS-7 as a lead compound. These multi-target RTKIs exhibited considerable potential as novel anti-angiogenic and anticancer agents. Among them, QDAU5 displayed the most promising potency and selectivity. It significantly suppressed viability of EA.hy926 and proliferation of several cancer cells. Further investigations indicated that QDAU5 showed high affinity to VEGFR-2 and reduced the phosphorylation of VEGFR-2. We identified QDAU5 as a potent multiple RTKs inhibitor exhibiting prominent anti-angiogenic and anticancer potency both in vitro and in vivo. Moreover, quinazolin-4(3H)-one has been identified as an excellent hinge binding moiety for multi-target inhibitors of angiogenic VEGFR-2, Tie-2, and EphB4. PMID:29285210
SVM prediction of ligand-binding sites in bacterial lipoproteins employing shape and physio-chemical descriptors.

PubMed

Kadam, Kiran; Prabhakar, Prashant; Jayaraman, V K

2012-11-01

Bacterial lipoproteins play critical roles in various physiological processes including the maintenance of pathogenicity and numbers of them are being considered as potential candidates for generating novel vaccines. In this work, we put forth an algorithm to identify and predict ligand-binding sites in bacterial lipoproteins. The method uses three types of pocket descriptors, namely fpocket descriptors, 3D Zernike descriptors and shell descriptors, and combines them with Support Vector Machine (SVM) method for the classification. The three types of descriptors represent shape-based properties of the pocket as well as its local physio-chemical features. All three types of descriptors, along with their hybrid combinations are evaluated with SVM and to improve classification performance, WEKA-InfoGain feature selection is applied. Results obtained in the study show that the classifier successfully differentiates between ligand-binding and non-binding pockets. For the combination of three types of descriptors, 10 fold cross-validation accuracy of 86.83% is obtained for training while the selected model achieved test Matthews Correlation Coefficient (MCC) of 0.534. Individually or in combination with new and existing methods, our model can be a very useful tool for the prediction of potential ligand-binding sites in bacterial lipoproteins.
Genetic and biochemical analysis of the interaction of Bacillus subtilis CodY with branched-chain amino acids.

PubMed

Villapakkam, Anuradha C; Handke, Luke D; Belitsky, Boris R; Levdikov, Vladimir M; Wilkinson, Anthony J; Sonenshein, Abraham L

2009-11-01

Bacillus subtilis CodY protein is a DNA-binding global transcriptional regulator that responds to branched-chain amino acids (isoleucine, leucine, and valine) and GTP. Crystal structure studies have shown that the N-terminal region of the protein includes a GAF domain that contains a hydrophobic pocket within which isoleucine and valine bind. This region is well conserved in CodY homologs. Site-directed mutagenesis was employed to understand the roles of some of the residues in the GAF domain and hydrophobic pocket in interaction with isoleucine and GTP. The F40A, F71E, and F98A forms of CodY were inactive in vivo. They were activatable by GTP but to a much lesser extent by branched-chain amino acids in vitro. The CodY mutant R61A retained partial repression of target promoters in vivo and was able to respond to GTP in vitro but also responded poorly to branched-chain amino acids in vitro unless GTP was simultaneously present. Thus, the GAF domain includes residues essential for full activation of CodY by branched-chain amino acids, but these residues are not critical for activation by GTP. Binding studies with branched-chain amino acids and their analogs revealed that an amino group at position 2 and a methyl group at position 3 of valine are critical components of the recognition of the amino acids by CodY.
Structural mechanisms of DREAM complex assembly and regulation

PubMed Central

Guiley, Keelan Z.; Liban, Tyler J.; Felthousen, Jessica G.; Ramanan, Parameshwaran

2015-01-01

The DREAM complex represses cell cycle genes during quiescence through scaffolding MuvB proteins with E2F4/5 and the Rb tumor suppressor paralog p107 or p130. Upon cell cycle entry, MuvB dissociates from p107/p130 and recruits B-Myb and FoxM1 for up-regulating mitotic gene expression. To understand the biochemical mechanisms underpinning DREAM function and regulation, we investigated the structural basis for DREAM assembly. We identified a sequence in the MuvB component LIN52 that binds directly to the pocket domains of p107 and p130 when phosphorylated on the DYRK1A kinase site S28. A crystal structure of the LIN52–p107 complex reveals that LIN52 uses a suboptimal LxSxExL sequence together with the phosphate at nearby S28 to bind the LxCxE cleft of the pocket domain with high affinity. The structure explains the specificity for p107/p130 over Rb in the DREAM complex and how the complex is disrupted by viral oncoproteins. Based on insights from the structure, we addressed how DREAM is disassembled upon cell cycle entry. We found that p130 and B-Myb can both bind the core MuvB complex simultaneously but that cyclin-dependent kinase phosphorylation of p130 weakens its association. Together, our data inform a novel target interface for studying MuvB and p130 function and the design of inhibitors that prevent tumor escape in quiescence. PMID:25917549
Structure-based Understanding of Binding Affinity and Mode of Estrogen Receptor α Agonists and Antagonists.

EPA Science Inventory

The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interact...
Structure-Based Understanding of Binding Affinity and Mode of Estrogen Receptor α Agonists and Antagonists

EPA Science Inventory

The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interact...
Structural basis of substrate discrimination and integrin binding by autotaxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hausmann, Jens; Kamtekar, Satwik; Christodoulou, Evangelos

2013-09-25

Autotaxin (ATX, also known as ectonucleotide pyrophosphatase/phosphodiesterase-2, ENPP2) is a secreted lysophospholipase D that generates the lipid mediator lysophosphatidic acid (LPA), a mitogen and chemoattractant for many cell types. ATX-LPA signaling is involved in various pathologies including tumor progression and inflammation. However, the molecular basis of substrate recognition and catalysis by ATX and the mechanism by which it interacts with target cells are unclear. Here, we present the crystal structure of ATX, alone and in complex with a small-molecule inhibitor. We have identified a hydrophobic lipid-binding pocket and mapped key residues for catalysis and selection between nucleotide and phospholipid substrates.more » We have shown that ATX interacts with cell-surface integrins through its N-terminal somatomedin B-like domains, using an atypical mechanism. Our results define determinants of substrate discrimination by the ENPP family, suggest how ATX promotes localized LPA signaling and suggest new approaches for targeting ATX with small-molecule therapeutic agents.« less
CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

PubMed

Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

2018-05-10

CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Analysis of the Glutamate Agonist LY404,039 Binding to Nonstatic Dopamine Receptor D2 Dimer Structures and Consensus Docking.

PubMed

Salmas, Ramin Ekhteiari; Seeman, Philip; Aksoydan, Busecan; Erol, Ismail; Kantarcioglu, Isik; Stein, Matthias; Yurtsever, Mine; Durdagi, Serdar

2017-06-21

Dopamine receptor D2 (D2R) plays an important role in the human central nervous system and is a focal target of antipsychotic agents. The D2 High R and D2 Low R dimeric models previously developed by our group are used to investigate the prediction of binding affinity of the LY404,039 ligand and its binding mechanism within the catalytic domain. The computational data obtained using molecular dynamics simulations fit well with the experimental results. The calculated binding affinities of LY404,039 using MM/PBSA for the D2 High R and D2 Low R targets were -12.04 and -9.11 kcal/mol, respectively. The experimental results suggest that LY404,039 binds to D2 High R and D2 Low R with binding affinities (K i ) of 8.2 and 1640 nM, respectively. The high binding affinity of LY404,039 in terms of binding to [ 3 H]domperidone was inhibited by the presence of a guanine nucleotide, indicating an agonist action of the drug at D2 High R. The interaction analysis demonstrated that while Asp114 was among the most critical amino acids for D2 High R binding, residues Ser193 and Ser197 were significantly more important within the binding cavity of D2 Low R. Molecular modeling analyses are extended to ensemble docking as well as structure-based pharmacophore model (E-pharmacophore) development using the bioactive conformation of LY404,039 at the binding pocket as a template and screening of small-molecule databases with derived pharmacophore models.
BI-2 destabilizes HIV-1 cores during infection and Prevents Binding of CPSF6 to the HIV-1 Capsid.

PubMed

Fricke, Thomas; Buffone, Cindy; Opp, Silvana; Valle-Casuso, Jose; Diaz-Griffero, Felipe

2014-12-11

The recently discovered small-molecule BI-2 potently blocks HIV-1 infection. BI-2 binds to the N-terminal domain of HIV-1 capsid. BI-2 utilizes the same capsid pocket used by the small molecule PF74. Although both drugs bind to the same pocket, it has been proposed that BI-2 uses a different mechanism to block HIV-1 infection when compared to PF74. This work demonstrates that BI-2 destabilizes the HIV-1 core during infection, and prevents the binding of the cellular factor CPSF6 to the HIV-1 core. Overall this short-form paper suggests that BI-2 is using a similar mechanism to the one used by PF74 to block HIV-1 infection.
Optimal affinity ranking for automated virtual screening validated in prospective D3R grand challenges

NASA Astrophysics Data System (ADS)

Wingert, Bentley M.; Oerlemans, Rick; Camacho, Carlos J.

2018-01-01

The goal of virtual screening is to generate a substantially reduced and enriched subset of compounds from a large virtual chemistry space. Critical in these efforts are methods to properly rank the binding affinity of compounds. Prospective evaluations of ranking strategies in the D3R grand challenges show that for targets with deep pockets the best correlations (Spearman ρ 0.5) were obtained by our submissions that docked compounds to the holo-receptors with the most chemically similar ligand. On the other hand, for targets with open pockets using multiple receptor structures is not a good strategy. Instead, docking to a single optimal receptor led to the best correlations (Spearman ρ 0.5), and overall performs better than any other method. Yet, choosing a suboptimal receptor for crossdocking can significantly undermine the affinity rankings. Our submissions that evaluated the free energy of congeneric compounds were also among the best in the community experiment. Error bars of around 1 kcal/mol are still too large to significantly improve the overall rankings. Collectively, our top of the line predictions show that automated virtual screening with rigid receptors perform better than flexible docking and other more complex methods.
Profiling Charge Complementarity and Selectivity for Binding at the Protein Surface

PubMed Central

Sulea, Traian; Purisima, Enrico O.

2003-01-01

A novel analysis and representation of the protein surface in terms of electrostatic binding complementarity and selectivity is presented. The charge optimization methodology is applied in a probe-based approach that simulates the binding process to the target protein. The molecular surface is color coded according to calculated optimal charge or according to charge selectivity, i.e., the binding cost of deviating from the optimal charge. The optimal charge profile depends on both the protein shape and charge distribution whereas the charge selectivity profile depends only on protein shape. High selectivity is concentrated in well-shaped concave pockets, whereas solvent-exposed convex regions are not charge selective. This suggests the synergy of charge and shape selectivity hot spots toward molecular selection and recognition, as well as the asymmetry of charge selectivity at the binding interface of biomolecular systems. The charge complementarity and selectivity profiles map relevant electrostatic properties in a readily interpretable way and encode information that is quite different from that visualized in the standard electrostatic potential map of unbound proteins. PMID:12719221

Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

PubMed

Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

2006-12-01

The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD.
Relative positioning of classical benzodiazepines to the γ2-subunit of GABAA receptors.

PubMed

Middendorp, Simon J; Hurni, Evelyn; Schönberger, Matthias; Stein, Marco; Pangerl, Michael; Trauner, Dirk; Sigel, Erwin

2014-08-15

GABAA receptors are the major inhibitory neurotransmitter receptors in the brain. Benzodiazepine exert their action via a high affinity-binding site at the α/γ subunit interface on some of these receptors. Diazepam has sedative, hypnotic, anxiolytic, muscle relaxant, and anticonvulsant effects. It acts by potentiating the current evoked by the agonist GABA. Understanding specific interaction of benzodiazepines in the binding pocket of different GABAA receptor isoforms might help to separate these divergent effects. As a first step, we characterized the interaction between diazepam and the major GABAA receptor isoform α1β2γ2. We mutated several amino acid residues on the γ2-subunit assumed to be located near or in the benzodiazepine binding pocket individually to cysteine and studied the interaction with three ligands that are modified with a cysteine-reactive isothiocyanate group (-NCS). When the reactive NCS group is in apposition to the cysteine residue this leads to a covalent reaction. In this way, three amino acid residues, γ2Tyr58, γ2Asn60, and γ2Val190 were located relative to classical benzodiazepines in their binding pocket on GABAA receptors.
Simulation optimization of spherical non-polar guest recognition by deep-cavity cavitands

PubMed Central

Wanjari, Piyush P.; Gibb, Bruce C.; Ashbaugh, Henry S.

2013-01-01

Biomimetic deep-cavity cavitand hosts possess unique recognition and encapsulation properties that make them capable of selectively binding a range of non-polar guests within their hydrophobic pocket. Adamantane based derivatives which snuggly fit within the pocket of octa-acid deep cavity cavitands exhibit some of the strongest host binding. Here we explore the roles of guest size and attractiveness on optimizing guest binding to form 1:1 complexes with octa-acid cavitands in water. Specifically we simulate the water-mediated interactions of the cavitand with adamantane and a range of simple Lennard-Jones guests of varying diameter and attractive well-depth. Initial simulations performed with methane indicate hydrated methanes preferentially reside within the host pocket, although these guests frequently trade places with water and other methanes in bulk solution. The interaction strength of hydrophobic guests increases with increasing size from sizes slightly smaller than methane to Lennard-Jones guests comparable in size to adamantane. Over this guest size range the preferential guest binding location migrates from the bottom of the host pocket upwards. For guests larger than adamantane, however, binding becomes less favorable as the minimum in the potential-of-mean force shifts to the cavitand face around the portal. For a fixed guest diameter, the Lennard-Jones well-depth is found to systematically shift the guest-host potential-of-mean force to lower free energies, however, the optimal guest size is found to be insensitive to increasing well-depth. Ultimately our simulations show that adamantane lies within the optimal range of guest sizes with significant attractive interactions to match the most tightly bound Lennard-Jones guests studied. PMID:24359375
Structural Plasticity of Malaria Dihydroorotate Dehydrogenase Allows Selective Binding of Diverse Chemical Scaffolds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Xiaoyi; Gujjar, Ramesh; El Mazouni, Farah

Malaria remains a major global health burden and current drug therapies are compromised by resistance. Plasmodium falciparum dihydroorotate dehydrogenase (PfDHODH) was validated as a new drug target through the identification of potent and selective triazolopyrimidine-based DHODH inhibitors with anti-malarial activity in vivo. Here we report x-ray structure determination of PfDHODH bound to three inhibitors from this series, representing the first of the enzyme bound to malaria specific inhibitors. We demonstrate that conformational flexibility results in an unexpected binding mode identifying a new hydrophobic pocket on the enzyme. Importantly this plasticity allows PfDHODH to bind inhibitors from different chemical classes andmore » to accommodate inhibitor modifications during lead optimization, increasing the value of PfDHODH as a drug target. A second discovery, based on small molecule crystallography, is that the triazolopyrimidines populate a resonance form that promotes charge separation. These intrinsic dipoles allow formation of energetically favorable H-bond interactions with the enzyme. The importance of delocalization to binding affinity was supported by site-directed mutagenesis and the demonstration that triazolopyrimidine analogs that lack this intrinsic dipole are inactive. Finally, the PfDHODH-triazolopyrimidine bound structures provide considerable new insight into species-selective inhibitor binding in this enzyme family. Together, these studies will directly impact efforts to exploit PfDHODH for the development of anti-malarial chemotherapy.« less
K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions

PubMed Central

Ostrem, Jonathan M.; Peters, Ulf; Sos, Martin L.; Wells, James A.; Shokat, Kevan M.

2014-01-01

Somatic mutations in the small GTPase K-Ras are the most common activating lesions found in human cancer, and are generally associated with poor response to standard therapies1–3. Efforts to target this oncogene directly have faced difficulties owing to its picomolar affinity for GTP/GDP4 and the absence of known allosteric regulatory sites. Oncogenic mutations result in functional activation of Ras family proteins by impairing GTP hydrolysis5,6. With diminished regulation by GTPase activity, the nucleotide state of Ras becomes more dependent on relative nucleotide affinity and concentration. This gives GTP an advantage over GDP7 and increases the proportion of active GTP-bound Ras. Here we report the development of small molecules that irreversibly bind to a common oncogenic mutant, K-Ras(G12C). These compounds rely on the mutant cysteine for binding and therefore do not affect the wild-type protein. Crystallographic studies reveal the formation of a new pocket that is not apparent in previous structures of Ras, beneath the effector binding switch-II region. Binding of these inhibitors to K-Ras(G12C) disrupts both switch-I and switch-II, subverting the native nucleotide preference to favour GDP over GTP and impairing binding to Raf. Our data provide structure-based validation of a new allosteric regulatory site on Ras that is targetable in a mutant-specific manner. PMID:24256730
Conformational changes induced in the eukaryotic translation initiation factor eIF4E by a clinically relevant inhibitor, ribavirin triphosphate

PubMed Central

Volpon, Laurent; Osborne, Michael J.; Zahreddine, Hiba; Romeo, Andrea A.; Borden, Katherine L.B.

2013-01-01

The eukaryotic translation initiation factor eIF4E is highly elevated in human cancers including acute myeloid leukemia (AML). A potential anticancer agent, ribavirin, targets eIF4E activity in AML patients corresponding to clinical responses. To date, ribavirin is the only direct inhibitor of eIF4E to reach clinical trials. We showed that ribavirin acts as a competitive inhibitor of the methyl 7-guanosine (m7G) cap, the natural ligand of eIF4E. Here we examine the conformational changes occurring in human eIF4E upon binding the active metabolite of ribavirin, ribavirin triphosphate (RTP). Our NMR data revealed an unexpected concentration dependence on RTP affinity for eIF4E. We observed NMR spectra characteristic of tight binding at low micromolar concentrations (2-5μM eIF4E) but much weaker affinity at more typical NMR concentrations (50-200μM). Comparison of chemical shift perturbation and line broadening suggest that the two eIF4E-RTP complexes differ in the precise positioning of RTP within the cap binding pocket, with the high affinity complex showing more extensive changes to the central β-sheet and dorsal surface of eIF4E, similar to m7G cap. The differences between high and low affinity complexes arise due to concentration dependent aggregation of eIF4E and RTP. Given the intracellular concentrations of eIF4E and RTP and the differential binding toward the W56A eIF4E mutant the high affinity complex is the most physiologically relevant. In summary, these findings demonstrate that RTP binds in the cap-binding site but also suggests new features of this pocket that should be considered in both drug design efforts and reveal new insights into ligand eIF4E recognition. PMID:23583375
Molecular basis and quantitative assessment of TRF1 and TRF2 protein interactions with TIN2 and Apollo peptides.

PubMed

Kalathiya, Umesh; Padariya, Monikaben; Baginski, Maciej

2017-03-01

Shelterin is a six-protein complex (TRF1, TRF2, POT1, RAP1, TIN2, and TPP1) that also functions in smaller subsets in regulation and protection of human telomeres. Two closely related proteins, TRF1 and TRF2, make high-affinity contact directly with double-stranded telomeric DNA and serve as a molecular platform. Protein TIN2 binds to TRF1 and TRF2 dimer-forming domains, whereas Apollo makes interaction only with TRF2. To elucidate the molecular basis of these interactions, we employed molecular dynamics (MD) simulations of TRF1 TRFH -TIN2 TBM and TRF2 TRFH -TIN2 TBM /Apollo TBM complexes and of the isolated proteins. MD enabled a structural and dynamical comparison of protein-peptide complexes including H-bond interactions and interfacial residues that may regulate TRF protein binding to the given peptides, especially focusing on interactions described in crystallographic data. Residues with a selective function in both TRF1 TRFH and TRF2 TRFH and forming a stable hydrogen bond network with TIN2 TBM or Apollo TBM peptides were traced. Our study revealed that TIN2 TBM forms a well-defined binding mode with TRF1 TRFH as compared to TRF2 TRFH , and that the binding pocket of TIN2 TBM is deeper for TRF2 TRFH protein than Apollo TBM . The MD data provide a basis for the reinterpretation of mutational data obtained in crystallographic work for the TRF proteins. Together, the previously determined X-ray structure and our MD provide a detailed view of the TRF-peptide binding mode and the structure of TRF1/2 binding pockets. Particular TRF-peptide interactions are very specific for the formation of each protein-peptide complex, identifying TRF proteins as potential targets for the design of inhibitors/drugs modulating telomere machinery for anticancer therapy.
Automatic phylogenetic classification of bacterial beta-lactamase sequences including structural and antibiotic substrate preference information.

PubMed

Ma, Jianmin; Eisenhaber, Frank; Maurer-Stroh, Sebastian

2013-12-01

Beta lactams comprise the largest and still most effective group of antibiotics, but bacteria can gain resistance through different beta lactamases that can degrade these antibiotics. We developed a user friendly tree building web server that allows users to assign beta lactamase sequences to their respective molecular classes and subclasses. Further clinically relevant information includes if the gene is typically chromosomal or transferable through plasmids as well as listing the antibiotics which the most closely related reference sequences are known to target and cause resistance against. This web server can automatically build three phylogenetic trees: the first tree with closely related sequences from a Tachyon search against the NCBI nr database, the second tree with curated reference beta lactamase sequences, and the third tree built specifically from substrate binding pocket residues of the curated reference beta lactamase sequences. We show that the latter is better suited to recover antibiotic substrate assignments through nearest neighbor annotation transfer. The users can also choose to build a structural model for the query sequence and view the binding pocket residues of their query relative to other beta lactamases in the sequence alignment as well as in the 3D structure relative to bound antibiotics. This web server is freely available at http://blac.bii.a-star.edu.sg/.
Molecular mechanism of extreme mechanostability in a pathogen adhesin.

PubMed

Milles, Lukas F; Schulten, Klaus; Gaub, Hermann E; Bernardi, Rafael C

2018-03-30

High resilience to mechanical stress is key when pathogens adhere to their target and initiate infection. Using atomic force microscopy-based single-molecule force spectroscopy, we explored the mechanical stability of the prototypical staphylococcal adhesin SdrG, which targets a short peptide from human fibrinogen β. Steered molecular dynamics simulations revealed, and single-molecule force spectroscopy experiments confirmed, the mechanism by which this complex withstands forces of over 2 nanonewtons, a regime previously associated with the strength of a covalent bond. The target peptide, confined in a screwlike manner in the binding pocket of SdrG, distributes forces mainly toward the peptide backbone through an intricate hydrogen bond network. Thus, these adhesins can attach to their target with exceptionally resilient mechanostability, virtually independent of peptide side chains. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Extensions of PDZ domains as important structural and functional elements.

PubMed

Wang, Conan K; Pan, Lifeng; Chen, Jia; Zhang, Mingjie

2010-08-01

'Divide and conquer' has been the guiding strategy for the study of protein structure and function. Proteins are divided into domains with each domain having a canonical structural definition depending on its type. In this review, we push forward with the interesting observation that many domains have regions outside of their canonical definition that affect their structure and function; we call these regions 'extensions'. We focus on the highly abundant PDZ (PSD-95, DLG1 and ZO-1) domain. Using bioinformatics, we find that many PDZ domains have potential extensions and we developed an openly-accessible website to display our results ( http://bcz102.ust.hk/pdzex/ ). We propose, using well-studied PDZ domains as illustrative examples, that the roles of PDZ extensions can be classified into at least four categories: 1) protein dynamics-based modulation of target binding affinity, 2) provision of binding sites for macro-molecular assembly, 3) structural integration of multi-domain modules, and 4) expansion of the target ligand-binding pocket. Our review highlights the potential structural and functional importance of domain extensions, highlighting the significance of looking beyond the canonical boundaries of protein domains in general.
Structural basis of HIV-1 capsid recognition by PF74 and CPSF6

DOE PAGES

Bhattacharya, Akash; Alam, Steven L.; Fricke, Thomas; ...

2014-12-17

Upon infection of susceptible cells by HIV-1, the conical capsid formed by ~250 hexamers and 12 pentamers of the CA protein is delivered to the cytoplasm. In this study, the capsid shields the RNA genome and proteins required for reverse transcription. In addition, the surface of the capsid mediates numerous host–virus interactions, which either promote infection or enable viral restriction by innate immune responses. In the intact capsid, there is an intermolecular interface between the N-terminal domain (NTD) of one subunit and the C-terminal domain (CTD) of the adjacent subunit within the same hexameric ring. The NTD–CTD interface is criticalmore » for capsid assembly, both as an architectural element of the CA hexamer and pentamer and as a mechanistic element for generating lattice curvature. Here we report biochemical experiments showing that PF-3450074 (PF74), a drug that inhibits HIV-1 infection, as well as host proteins cleavage and polyadenylation specific factor 6 (CPSF6) and nucleoporin 153 kDa (NUP153), bind to the CA hexamer with at least 10-fold higher affinities compared with nonassembled CA or isolated CA domains. The crystal structure of PF74 in complex with the CA hexamer reveals that PF74 binds in a preformed pocket encompassing the NTD–CTD interface, suggesting that the principal inhibitory target of PF74 is the assembled capsid. Likewise, CPSF6 binds in the same pocket. Given that the NTD–CTD interface is a specific molecular signature of assembled hexamers in the capsid, binding of NUP153 at this site suggests that key features of capsid architecture remain intact upon delivery of the preintegration complex to the nucleus.« less
Interpreting linear support vector machine models with heat map molecule coloring

PubMed Central

2011-01-01

Background Model-based virtual screening plays an important role in the early drug discovery stage. The outcomes of high-throughput screenings are a valuable source for machine learning algorithms to infer such models. Besides a strong performance, the interpretability of a machine learning model is a desired property to guide the optimization of a compound in later drug discovery stages. Linear support vector machines showed to have a convincing performance on large-scale data sets. The goal of this study is to present a heat map molecule coloring technique to interpret linear support vector machine models. Based on the weights of a linear model, the visualization approach colors each atom and bond of a compound according to its importance for activity. Results We evaluated our approach on a toxicity data set, a chromosome aberration data set, and the maximum unbiased validation data sets. The experiments show that our method sensibly visualizes structure-property and structure-activity relationships of a linear support vector machine model. The coloring of ligands in the binding pocket of several crystal structures of a maximum unbiased validation data set target indicates that our approach assists to determine the correct ligand orientation in the binding pocket. Additionally, the heat map coloring enables the identification of substructures important for the binding of an inhibitor. Conclusions In combination with heat map coloring, linear support vector machine models can help to guide the modification of a compound in later stages of drug discovery. Particularly substructures identified as important by our method might be a starting point for optimization of a lead compound. The heat map coloring should be considered as complementary to structure based modeling approaches. As such, it helps to get a better understanding of the binding mode of an inhibitor. PMID:21439031
A Lipid Pathway for Ligand Binding Is Necessary for a Cannabinoid G Protein-coupled Receptor*

PubMed Central

Hurst, Dow P.; Grossfield, Alan; Lynch, Diane L.; Feller, Scott; Romo, Tod D.; Gawrisch, Klaus; Pitman, Michael C.; Reggio, Patricia H.

2010-01-01

Recent isothiocyanate covalent labeling studies have suggested that a classical cannabinoid, (−)-7′-isothiocyanato-11-hydroxy-1′,1′dimethylheptyl-hexahydrocannabinol (AM841), enters the cannabinoid CB2 receptor via the lipid bilayer (Pei, Y., Mercier, R. W., Anday, J. K., Thakur, G. A., Zvonok, A. M., Hurst, D., Reggio, P. H., Janero, D. R., and Makriyannis, A. (2008) Chem. Biol. 15, 1207–1219). However, the sequence of steps involved in such a lipid pathway entry has not yet been elucidated. Here, we test the hypothesis that the endogenous cannabinoid sn-2-arachidonoylglycerol (2-AG) attains access to the CB2 receptor via the lipid bilayer. To this end, we have employed microsecond time scale all-atom molecular dynamics (MD) simulations of the interaction of 2-AG with CB2 via a palmitoyl-oleoyl-phosphatidylcholine lipid bilayer. Results suggest the following: 1) 2-AG first partitions out of bulk lipid at the transmembrane α-helix (TMH) 6/7 interface; 2) 2-AG then enters the CB2 receptor binding pocket by passing between TMH6 and TMH7; 3) the entrance of the 2-AG headgroup into the CB2 binding pocket is sufficient to trigger breaking of the intracellular TMH3/6 ionic lock and the movement of the TMH6 intracellular end away from TMH3; and 4) subsequent to protonation at D3.49/D6.30, further 2-AG entry into the ligand binding pocket results in both a W6.48 toggle switch change and a large influx of water. To our knowledge, this is the first demonstration via unbiased molecular dynamics that a ligand can access the binding pocket of a class A G protein-coupled receptor via the lipid bilayer and the first demonstration via molecular dynamics of G protein-coupled receptor activation triggered by a ligand binding event. PMID:20220143
The Fifth Transmembrane Domain of Angiotensin II Type 1 Receptor Participates in the Formation of the Ligand-binding Pocket and Undergoes a Counterclockwise Rotation upon Receptor Activation*

PubMed Central

Domazet, Ivana; Martin, Stéphane S.; Holleran, Brian J.; Morin, Marie-Ève; Lacasse, Patrick; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard; Guillemette, Gaétan

2009-01-01

The octapeptide hormone angiotensin II exerts a wide variety of cardiovascular effects through the activation of the angiotensin II Type 1 (AT1) receptor, which belongs to the G protein-coupled receptor superfamily. Like other G protein- coupled receptors, the AT1 receptor possesses seven transmembrane domains that provide structural support for the formation of the ligand-binding pocket. The role of the fifth transmembrane domain (TMD5) was investigated using the substituted cysteine accessibility method. All of the residues within Thr-190 to Leu-217 region were mutated one at a time to cysteine, and after expression in COS-7 cells, the mutant receptors were treated with the sulfhydryl-specific alkylating agent methanethiosulfonate-ethylammonium (MTSEA). MTSEA reacts selectively with water-accessible, free sulfhydryl groups of endogenous or introduced point mutation cysteines. If a cysteine is found in the binding pocket, the covalent modification will affect the binding kinetics of the ligand. MTSEA substantially decreased the binding affinity of L197C-AT1, N200C-AT1, I201C-AT1, G203C-AT1, and F204C-AT1 mutant receptors, which suggests that these residues orient themselves within the water-accessible binding pocket of the AT1 receptor. Interestingly, this pattern of acquired MTSEA sensitivity was altered for TMD5 reporter cysteines engineered in a constitutively active N111G-AT1 receptor background. Indeed, mutant I201C-N111G-AT1 became more sensitive to MTSEA, whereas mutant G203C-N111G-AT1 lost some sensitivity. Our results suggest that constitutive activation of AT1 receptor causes an apparent counterclockwise rotation of TMD5 as viewed from the extracellular side. PMID:19773549
Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

PubMed

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

2017-11-01

Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Structural basis of rifampin inactivation by rifampin phosphotransferase

PubMed Central

Qi, Xiaofeng; Lin, Wei; Ma, Miaolian; Wang, Chengyuan; He, Yang; He, Nisha; Gao, Jing; Zhou, Hu; Xiao, Youli; Wang, Yong

2016-01-01

Rifampin (RIF) is a first-line drug used for the treatment of tuberculosis and other bacterial infections. Various RIF resistance mechanisms have been reported, and recently an RIF-inactivation enzyme, RIF phosphotransferase (RPH), was reported to phosphorylate RIF at its C21 hydroxyl at the cost of ATP. However, the underlying molecular mechanism remained unknown. Here, we solve the structures of RPH from Listeria monocytogenes (LmRPH) in different conformations. LmRPH comprises three domains: an ATP-binding domain (AD), an RIF-binding domain (RD), and a catalytic His-containing domain (HD). Structural analyses reveal that the C-terminal HD can swing between the AD and RD, like a toggle switch, to transfer phosphate. In addition to its catalytic role, the HD can bind to the AD and induce conformational changes that stabilize ATP binding, and the binding of the HD to the RD is required for the formation of the RIF-binding pocket. A line of hydrophobic residues forms the RIF-binding pocket and interacts with the 1-amino, 2-naphthol, 4-sulfonic acid and naphthol moieties of RIF. The R group of RIF points toward the outside of the pocket, explaining the low substrate selectivity of RPH. Four residues near the C21 hydroxyl of RIF, His825, Arg666, Lys670, and Gln337, were found to play essential roles in the phosphorylation of RIF; among these the His825 residue may function as the phosphate acceptor and donor. Our study reveals the molecular mechanism of RIF phosphorylation catalyzed by RPH and will guide the development of a new generation of rifamycins. PMID:27001859
Fragment-Based Optimization of Small Molecule CXCL12 Inhibitors for Antagonizing the CXCL12/CXCR4 Interaction

PubMed Central

Ziarek, Joshua J.; Liu, Yan; Smith, Emmanuel; Zhang, Guolin; Peterson, Francis C.; Chen, Jun; Yu, Yongping; Chen, Yu; Volkman, Brian F.; Li, Rongshi

2013-01-01

The chemokine CXCL12 and its G protein-coupled receptor (GPCR) CXCR4 are high-priority clinical targets because of their involvement in metastatic cancers (also implicated in autoimmune disease and cardiovascular disease). Because chemokines interact with two distinct sites to bind and activate their receptors, both the GPCRs and chemokines are potential targets for small molecule inhibition. A number of chemokines have been validated as targets for drug development, but virtually all drug discovery efforts focus on the GPCRs. However, all CXCR4 receptor antagonists with the exception of MSX-122 have failed in clinical trials due to unmanageable toxicities, emphasizing the need for alternative strategies to interfere with CXCL12/CXCR4-guided metastatic homing. Although targeting the relatively featureless surface of CXCL12 was presumed to be challenging, focusing efforts at the sulfotyrosine (sY) binding pockets proved successful for procuring initial hits. Using a hybrid structure-based in silico/NMR screening strategy, we recently identified a ligand that occludes the receptor recognition site. From this initial hit, we designed a small fragment library containing only nine tetrazole derivatives using a fragment-based and bioisostere approach to target the sY binding sites of CXCL12. Compound binding modes and affinities were studied by 2D NMR spectroscopy, X-ray crystallography, molecular docking and cell-based functional assays. Our results demonstrate that the sY binding sites are conducive to the development of high affinity inhibitors with better ligand efficiency (LE) than typical protein-protein interaction inhibitors (LE ≤ 0.24). Our novel tetrazole-based fragment 18 was identified to bind the sY21 site with a Kd of 24 μM (LE = 0.30). Optimization of 18 yielded compound 25 which specifically inhibits CXCL12-induced migration with an improvement in potency over the initial hit 9. The fragment from this library that exhibited the highest affinity and ligand efficiency (11: Kd = 13 μM, LE = 0.33) may serve as a starting point for development of inhibitors targeting the sY12 site. PMID:23368099
Structural and functional analysis of the YAP-binding domain of human TEAD2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Wei; Yu, Jianzhong; Tomchick, Diana R.

2010-06-15

The Hippo pathway controls organ size and suppresses tumorigenesis in metazoans by blocking cell proliferation and promoting apoptosis. The TEAD1-4 proteins (which contain a DNA-binding domain but lack an activation domain) interact with YAP (which lacks a DNA-binding domain but contains an activation domain) to form functional heterodimeric transcription factors that activate proliferative and prosurvival gene expression programs. The Hippo pathway inhibits the YAP-TEAD hybrid transcription factors by phosphorylating and promoting cytoplasmic retention of YAP. Here we report the crystal structure of the YAP-binding domain (YBD) of human TEAD2. TEAD2 YBD adopts an immunoglobulin-like {beta}-sandwich fold with two extra helix-turn-helixmore » inserts. NMR studies reveal that the TEAD-binding domain of YAP is natively unfolded and that TEAD binding causes localized conformational changes in YAP. In vitro binding and in vivo functional assays define an extensive conserved surface of TEAD2 YBD as the YAP-binding site. Therefore, our studies suggest that a short segment of YAP adopts an extended conformation and forms extensive contacts with a rigid surface of TEAD. Targeting a surface-exposed pocket of TEAD might be an effective strategy to disrupt the YAP-TEAD interaction and to reduce the oncogenic potential of YAP.« less
Structural basis for microRNA targeting

DOE PAGES

Schirle, Nicole T.; Sheu-Gruttadauria, Jessica; MacRae, Ian J.

2014-10-31

MicroRNAs (miRNAs) control expression of thousands of genes in plants and animals. miRNAs function by guiding Argonaute proteins to complementary sites in messenger RNAs (mRNAs) targeted for repression. In this paper, we determined crystal structures of human Argonaute-2 (Ago2) bound to a defined guide RNA with and without target RNAs representing miRNA recognition sites. These structures suggest a stepwise mechanism, in which Ago2 primarily exposes guide nucleotides (nt) 2 to 5 for initial target pairing. Pairing to nt 2 to 5 promotes conformational changes that expose nt 2 to 8 and 13 to 16 for further target recognition. Interactions withmore » the guide-target minor groove allow Ago2 to interrogate target RNAs in a sequence-independent manner, whereas an adenosine binding-pocket opposite guide nt 1 further facilitates target recognition. Spurious slicing of miRNA targets is avoided through an inhibitory coordination of one catalytic magnesium ion. Finally, these results explain the conserved nucleotide-pairing patterns in animal miRNA target sites first observed over two decades ago.« less

Structural basis for PPAR partial or full activation revealed by a novel ligand binding mode

NASA Astrophysics Data System (ADS)

Capelli, Davide; Cerchia, Carmen; Montanari, Roberta; Loiodice, Fulvio; Tortorella, Paolo; Laghezza, Antonio; Cervoni, Laura; Pochetti, Giorgio; Lavecchia, Antonio

2016-10-01

The peroxisome proliferator-activated receptors (PPARs) are nuclear receptors involved in the regulation of the metabolic homeostasis and therefore represent valuable therapeutic targets for the treatment of metabolic diseases. The development of more balanced drugs interacting with PPARs, devoid of the side-effects showed by the currently marketed PPARγ full agonists, is considered the major challenge for the pharmaceutical companies. Here we present a structure-based virtual screening approach that let us identify a novel PPAR pan-agonist with a very attractive activity profile and its crystal structure in the complex with PPARα and PPARγ, respectively. In PPARα this ligand occupies a new pocket whose filling is allowed by the ligand-induced switching of the F273 side chain from a closed to an open conformation. The comparison between this pocket and the corresponding cavity in PPARγ provides a rationale for the different activation of the ligand towards PPARα and PPARγ, suggesting a novel basis for ligand design.
The Protein Kinase, RSK2, A Novel Drug Target for Breast Cancer

DTIC Science & Technology

2005-05-01

kaempferol, the flavonoid constituent of SL010l, forming the ATP-binding pocket of RSK with that of p70 S6K, was determined to be 15 iumol/L for RSK (Fig...and RSK2 Supplemental Fig. 2). Kaempferol, the flavonoid constituent of A. B. MCF-7 MCF-10A 180 PM 50 pM SLO101 U0126 Vehicle SLO101 U0126 vehicle...refracta. This flavonoid glycoside is specific inhibitor of p90 ribosomal S6 kinase (RSK) with a dissociation constant, Ki, of 1 [AM. In intact cells
Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

PubMed

Forman, Stuart A; Miller, Keith W

2016-11-01

IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.
Structural and mechanistic insights into phospholipid transfer by Ups1–Mdm35 in mitochondria

PubMed Central

Watanabe, Yasunori; Tamura, Yasushi; Kawano, Shin; Endo, Toshiya

2015-01-01

Eukaryotic cells are compartmentalized into membrane-bounded organelles whose functions rely on lipid trafficking to achieve membrane-specific compositions of lipids. Here we focused on the Ups1–Mdm35 system, which mediates phosphatidic acid (PA) transfer between the outer and inner mitochondrial membranes, and determined the X-ray structures of Mdm35 and Ups1–Mdm35 with and without PA. The Ups1–Mdm35 complex constitutes a single domain that has a deep pocket and flexible Ω-loop lid. Structure-based mutational analyses revealed that a basic residue at the pocket bottom and the Ω-loop lid are important for PA extraction from the membrane following Ups1 binding. Ups1 binding to the membrane is enhanced by the dissociation of Mdm35. We also show that basic residues around the pocket entrance are important for Ups1 binding to the membrane and PA extraction. These results provide a structural basis for understanding the mechanism of PA transfer between mitochondrial membranes. PMID:26235513
Switch loop flexibility affects substrate transport of the AcrB efflux pump

DOE PAGES

Muller, Reinke T.; Travers, Timothy; Cha, Hi-jea; ...

2017-10-05

The functionally important switch-loop of the trimeric multidrug transporter AcrB separates the access and deep drug binding pockets in every protomer. This loop, comprising 11 amino acid residues, has been shown to be crucial for substrate transport, as drugs have to travel past the loop to reach the deep binding pocket and from there are transported outside the cell via the connected AcrA and TolC channels. It contains four symmetrically arranged glycine residues suggesting that flexibility is a key feature for pump activity. Upon combinatorial substitution of these glycine residues to proline, functional and structural asymmetry was observed. Proline substitutionsmore » on the PC1 proximal side completely abolished transport and reduced backbone flexibility of the switch loop, which adopted a conformation restricting the pathway towards the deep binding pocket. Here, two phenylalanine residues located adjacent to the substitution sensitive glycine residues play a role in blocking the pathway upon rigidification of the loop, since the removal of the phenyl rings from the rigid loop restores drug transport activity.« less
Switch loop flexibility affects substrate transport of the AcrB efflux pump

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muller, Reinke T.; Travers, Timothy; Cha, Hi-jea

The functionally important switch-loop of the trimeric multidrug transporter AcrB separates the access and deep drug binding pockets in every protomer. This loop, comprising 11 amino acid residues, has been shown to be crucial for substrate transport, as drugs have to travel past the loop to reach the deep binding pocket and from there are transported outside the cell via the connected AcrA and TolC channels. It contains four symmetrically arranged glycine residues suggesting that flexibility is a key feature for pump activity. Upon combinatorial substitution of these glycine residues to proline, functional and structural asymmetry was observed. Proline substitutionsmore » on the PC1 proximal side completely abolished transport and reduced backbone flexibility of the switch loop, which adopted a conformation restricting the pathway towards the deep binding pocket. Here, two phenylalanine residues located adjacent to the substitution sensitive glycine residues play a role in blocking the pathway upon rigidification of the loop, since the removal of the phenyl rings from the rigid loop restores drug transport activity.« less
F pocket flexibility influences the tapasin dependence of two differentially disease-associated MHC Class I proteins.

PubMed

Abualrous, Esam T; Fritzsche, Susanne; Hein, Zeynep; Al-Balushi, Mohammed S; Reinink, Peter; Boyle, Louise H; Wellbrock, Ursula; Antoniou, Antony N; Springer, Sebastian

2015-04-01

The human MHC class I protein HLA-B*27:05 is statistically associated with ankylosing spondylitis, unlike HLA-B*27:09, which differs in a single amino acid in the F pocket of the peptide-binding groove. To understand how this unique amino acid difference leads to a different behavior of the proteins in the cell, we have investigated the conformational stability of both proteins using a combination of in silico and experimental approaches. Here, we show that the binding site of B*27:05 is conformationally disordered in the absence of peptide due to a charge repulsion at the bottom of the F pocket. In agreement with this, B*27:05 requires the chaperone protein tapasin to a greater extent than the conformationally stable B*27:09 in order to remain structured and to bind peptide. Taken together, our data demonstrate a method to predict tapasin dependence and physiological behavior from the sequence and crystal structure of a particular class I allotype. Also watch the Video Abstract. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Virtual Screening Techniques to Probe the Antimalarial Activity of some Traditionally Used Phytochemicals.

PubMed

Shibi, Indira G; Aswathy, Lilly; Jisha, Radhakrishnan S; Masand, Vijay H; Gajbhiye, Jayant M

2016-01-01

Malaria parasites show resistance to most of the antimalarial drugs and hence developing antimalarials which can act on multitargets rather than a single target will be a promising strategy of drug design. Here we report a new approach by which virtual screening of 292 unique phytochemicals present in 72 traditionally important herbs is used for finding out inhibitors of plasmepsin-2 and falcipain-2 for antimalarial activity against P. falciparum. Initial screenings of the selected molecules by Random Forest algorithm model of Weka using the bioassay datasets AID 504850 and AID 2302 screened 120 out of the total 292 phytochemicals to be active against the targets. Toxtree scan cautioned 21 compounds to be either carcinogenic or mutagenic and were thus removed for further analysis. Out of the remaining 99 compounds, only 46 compounds offered drug-likeness as per the 'rule of five' criteria. Out of ten antimalarial drug targets, only two target proteins such as 3BPF and 3PNR of falcipain-2 and 1PFZ and 2BJU of plasmepsin-2 are selected as targets. The potential binding of the selected 46 compounds to the active sites of these four targets was analyzed using MOE software. The docked conformations and the interactions with the binding pocket residues of the target proteins were understood by 'Ligplot' analysis. It has been found that 8 compounds are dual inhibitors of falcipain-2 and plasmepsin-2, with the best binding energies. Compound 117 (6aR, 12aS)-12a-Hydroxy-9-methoxy-2,3-dimethylenedioxy-8-prenylrotenone (Usaratenoid C) present in the plant Millettia usaramensis showed maximum molecular docking score.
Contributions of pocket depth and electrostatic interactions to affinity and selectivity of receptors for methylated lysine in water.

PubMed

Beaver, Joshua E; Peacor, Brendan C; Bain, Julianne V; James, Lindsey I; Waters, Marcey L

2015-03-21

Dynamic combinatorial chemistry was used to generate a set of receptors for peptides containing methylated lysine (KMen, n = 0-3) and study the contribution of electrostatic effects and pocket depth to binding affinity and selectivity. We found that changing the location of a carboxylate resulted in an increase in preference for KMe2, presumably based on ability to form a salt bridge with KMe2. The number of charged groups on either the receptor or peptide guest systematically varied the binding affinities to all guests by approximately 1-1.5 kcal mol(-1), with little influence on selectivity. Lastly, formation of a deeper pocket led to both increased affinity and selectivity for KMe3 over the lower methylation states. From these studies, we identified that the tightest binder was a receptor with greater net charge, with a Kd of 0.2 μM, and the receptor with the highest selectivity was the one with the deepest pocket, providing 14-fold selectivity between KMe3 and KMe2 and a Kd for KMe3 of 0.3 μM. This work provides key insights into approaches to improve binding affinity and selectivity in water, while also demonstrating the versatility of dynamic combinatorial chemistry for rapidly exploring the impact of subtle changes in receptor functionality on molecular recognition in water.
Structure of Epstein-Barr Virus Glycoprotein 42 Suggests a Mechanism for Triggering Receptor-Activated Virus Entry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirschner, Austin N.; Sorem, Jessica; Longnecker, Richard

Epstein-Barr virus requires glycoproteins gH/gL, gB, and gp42 to fuse its lipid envelope with B cells. Gp42 is a type II membrane protein consisting of a flexible N-terminal region, which binds gH/gL, and a C-terminal lectin-like domain that binds to the B-cell entry receptor human leukocyte antigen (HLA) class II. Gp42 triggers membrane fusion after HLA binding, a process that requires simultaneous binding to gH/gL and a functional hydrophobic pocket in the lectin domain adjacent to the HLA binding site. Here we present the structure of gp42 in its unbound form. Comparisons to the previously determined structure of a gp42:HLAmore » complex reveals additional N-terminal residues forming part of the gH/gL binding site and structural changes in the receptor binding domain. Although the core of the lectin domain remains similar, significant shifts in two loops and an {alpha} helix bordering the essential hydrophobic pocket suggest a structural mechanism for triggering fusion.« less
Design and characterization of an engineered gp41 protein from human immunodeficiency virus-1 as a tool for drug discovery

NASA Astrophysics Data System (ADS)

Stewart, Kent D.; Steffy, Kevin; Harris, Kevin; Harlan, John E.; Stoll, Vincent S.; Huth, Jeffrey R.; Walter, Karl A.; Gramling-Evans, Emily; Mendoza, Renaldo R.; Severin, Jean M.; Richardson, Paul L.; Barrett, Leo W.; Matayoshi, Edmund D.; Swift, Kerry M.; Betz, Stephen F.; Muchmore, Steve W.; Kempf, Dale J.; Molla, Akhter

2007-01-01

Two new proteins of approximately 70 amino acids in length, corresponding to an unnaturally-linked N- and C-helix of the ectodomain of the gp41 protein from the human immunodeficiency virus (HIV) type 1, were designed and characterized. A designed tripeptide links the C-terminus of the C-helix with the N-terminus of the N-helix in a circular permutation so that the C-helix precedes the N-helix in sequence. In addition to the artificial peptide linkage, the C-helix is truncated at its N-terminus to expose a region of the N-helix known as the "Trp-Trp-Ile" binding pocket. Sedimentation, crystallographic, and nuclear magnetic resonance studies confirmed that the protein had the desired trimeric structure with an unoccupied binding site. Spectroscopic and centrifugation studies demonstrated that the engineered protein had ligand binding characteristics similar to previously reported constructs. Unlike previous constructs which expose additional, shallow, non-conserved, and undesired binding pockets, only the single deep and conserved Trp-Trp-Ile pocket is exposed in the proteins of this study. This engineered version of gp41 protein will be potentially useful in research programs aimed at discovery of new drugs for therapy of HIV-infection in humans.
Calculating an optimal box size for ligand docking and virtual screening against experimental and predicted binding pockets.

PubMed

Feinstein, Wei P; Brylinski, Michal

2015-01-01

Computational approaches have emerged as an instrumental methodology in modern research. For example, virtual screening by molecular docking is routinely used in computer-aided drug discovery. One of the critical parameters for ligand docking is the size of a search space used to identify low-energy binding poses of drug candidates. Currently available docking packages often come with a default protocol for calculating the box size, however, many of these procedures have not been systematically evaluated. In this study, we investigate how the docking accuracy of AutoDock Vina is affected by the selection of a search space. We propose a new procedure for calculating the optimal docking box size that maximizes the accuracy of binding pose prediction against a non-redundant and representative dataset of 3,659 protein-ligand complexes selected from the Protein Data Bank. Subsequently, we use the Directory of Useful Decoys, Enhanced to demonstrate that the optimized docking box size also yields an improved ranking in virtual screening. Binding pockets in both datasets are derived from the experimental complex structures and, additionally, predicted by eFindSite. A systematic analysis of ligand binding poses generated by AutoDock Vina shows that the highest accuracy is achieved when the dimensions of the search space are 2.9 times larger than the radius of gyration of a docking compound. Subsequent virtual screening benchmarks demonstrate that this optimized docking box size also improves compound ranking. For instance, using predicted ligand binding sites, the average enrichment factor calculated for the top 1 % (10 %) of the screening library is 8.20 (3.28) for the optimized protocol, compared to 7.67 (3.19) for the default procedure. Depending on the evaluation metric, the optimal docking box size gives better ranking in virtual screening for about two-thirds of target proteins. This fully automated procedure can be used to optimize docking protocols in order to improve the ranking accuracy in production virtual screening simulations. Importantly, the optimized search space systematically yields better results than the default method not only for experimental pockets, but also for those predicted from protein structures. A script for calculating the optimal docking box size is freely available at www.brylinski.org/content/docking-box-size. Graphical AbstractWe developed a procedure to optimize the box size in molecular docking calculations. Left panel shows the predicted binding pose of NADP (green sticks) compared to the experimental complex structure of human aldose reductase (blue sticks) using a default protocol. Right panel shows the docking accuracy using an optimized box size.
Structural and Functional Studies Indicate That the EPEC Effector, EspG, Directly Binds p21-Activated Kinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Germane, Katherine L.; Spiller, Benjamin W.

2011-09-20

Bacterial pathogens secrete effectors into their hosts that subvert host defenses and redirect host processes. EspG is a type three secretion effector with a disputed function that is found in enteropathogenic Escherichia coli. Here we show that EspG is structurally similar to VirA, a Shigella virulence factor; EspG has a large, conserved pocket on its surface; EspG binds directly to the amino-terminal inhibitory domain of human p21-activated kinase (PAK); and mutations to conserved residues in the surface pocket disrupt the interaction with PAK.
Active Pin1 is a key target of all-trans retinoic acid in acute promyelocytic leukemia and breast cancer.

PubMed

Wei, Shuo; Kozono, Shingo; Kats, Lev; Nechama, Morris; Li, Wenzong; Guarnerio, Jlenia; Luo, Manli; You, Mi-Hyeon; Yao, Yandan; Kondo, Asami; Hu, Hai; Bozkurt, Gunes; Moerke, Nathan J; Cao, Shugeng; Reschke, Markus; Chen, Chun-Hau; Rego, Eduardo M; Lo-Coco, Francesco; Cantley, Lewis C; Lee, Tae Ho; Wu, Hao; Zhang, Yan; Pandolfi, Pier Paolo; Zhou, Xiao Zhen; Lu, Kun Ping

2015-05-01

A common key regulator of oncogenic signaling pathways in multiple tumor types is the unique isomerase Pin1. However, available Pin1 inhibitors lack the required specificity and potency for inhibiting Pin1 function in vivo. By using mechanism-based screening, here we find that all-trans retinoic acid (ATRA)--a therapy for acute promyelocytic leukemia (APL) that is considered the first example of targeted therapy in cancer, but whose drug target remains elusive--inhibits and degrades active Pin1 selectively in cancer cells by directly binding to the substrate phosphate- and proline-binding pockets in the Pin1 active site. ATRA-induced Pin1 ablation degrades the protein encoded by the fusion oncogene PML-RARA and treats APL in APL cell and animal models as well as in human patients. ATRA-induced Pin1 ablation also potently inhibits triple-negative breast cancer cell growth in human cells and in animal models by acting on many Pin1 substrate oncogenes and tumor suppressors. Thus, ATRA simultaneously blocks multiple Pin1-regulated cancer-driving pathways, an attractive property for treating aggressive and drug-resistant tumors.
Targeting Allosteric Control Mechanisms in Heat Shock Protein 70 (Hsp70).

PubMed

Li, Xiaokai; Shao, Hao; Taylor, Isabelle R; Gestwicki, Jason E

2016-01-01

Heat shock protein 70 (Hsp70) is a molecular chaperone that plays critical roles in protein homeostasis. Hsp70's chaperone activity is coordinated by intra-molecular interactions between its two domains, as well as inter-molecular interactions between Hsp70 and its co-chaperones. Each of these contacts represents a potential opportunity for the development of chemical inhibitors. To illustrate this concept, we review three classes of recently identified molecules that bind distinct pockets on Hsp70. Although all three compounds share the ability to interrupt core biochemical functions of Hsp70, they stabilize different conformers. Accordingly, each compound appears to interrupt a specific subset of inter- and intra-molecular interactions. Thus, an accurate definition of an Hsp70 inhibitor may require a particularly detailed understanding of the molecule's binding site and its effects on protein-protein interactions.
Structural Chemistry of Human RNA Methyltransferases.

PubMed

Schapira, Matthieu

2016-03-18

RNA methyltransferases (RNMTs) play important roles in RNA stability, splicing, and epigenetic mechanisms. They constitute a promising target class that is underexplored by the medicinal chemistry community. Information of relevance to drug design can be extracted from the rich structural coverage of human RNMTs. In this work, the structural chemistry of this protein family is analyzed in depth. Unlike most methyltransferases, RNMTs generally feature a substrate-binding site that is largely open on the cofactor-binding pocket, favoring the design of bisubstrate inhibitors. Substrate purine or pyrimidines are often sandwiched between hydrophobic walls that can accommodate planar ring systems. When the substrate base is laying on a shallow surface, a 5' flanking base is sometimes anchored in a druggable cavity. The cofactor-binding site is structurally more diverse than in protein methyltransferases and more druggable in SPOUT than in Rossman-fold enzymes. Finally, conformational plasticity observed both at the substrate and cofactor binding sites may be a challenge for structure-based drug design. The landscape drawn here may inform ongoing efforts toward the discovery of the first human RNMT inhibitors.
H1PVAT is a novel and potent early-stage inhibitor of poliovirus replication that targets VP1.

PubMed

Tijsma, Aloys; Thibaut, Hendrik Jan; Spieser, Stéphane A H; De Palma, Armando; Koukni, Mohamed; Rhoden, Eric; Oberste, Steve; Pürstinger, Gerhard; Volny-Luraghi, Antonia; Martin, Javier; Marchand, Arnaud; Chaltin, Patrick; Neyts, Johan; Leyssen, Pieter

2014-10-01

A novel small molecule, H1PVAT, was identified as a potent and selective inhibitor of the in vitro replication of all three poliovirus serotypes, whereas no activity was observed against other enteroviruses. Time-of-drug-addition studies revealed that the compound interfered with an early stage of virus replication. Four independently-selected H1PVAT-resistant virus variants uniformly carried the single amino acid substitution I194F in the VP1 capsid protein. Poliovirus type 1 strain Sabin, reverse-engineered to contain this substitution, proved to be completely insensitive to the antiviral effect of H1PVAT and was cross-resistant to the capsid-binding inhibitors V-073 and pirodavir. The VP1 I194F mutant had a smaller plaque phenotype than wild-type virus, and the amino acid substitution rendered the virus more susceptible to heat inactivation. Both for the wild-type and VP1 I194F mutant virus, the presence of H1PVAT increased the temperature at which the virus was inactivated, providing evidence that the compound interacts with the viral capsid, and that capsid stabilization and antiviral activity are not necessarily correlated. Molecular modeling suggested that H1PVAT binds with high affinity in the pocket underneath the floor of the canyon that is involved in receptor binding. Introduction of the I194F substitution in the model of VP1 induced a slight concerted rearrangement of the core β-barrel in this pocket, which disfavors binding of the compound. Taken together, the compound scaffold, to which H1PVAT belongs, may represent another promising class of poliovirus capsid-binding inhibitors next to V-073 and pirodavir. Potent antivirals against poliovirus will be essential in the poliovirus eradication end-game. Copyright © 2014. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Jiusheng; van den Bedem, Henry; Brunger, Axel T.

Calmodulin (CaM) is the primary calcium signaling protein in eukaryotes and has been extensively studied using various biophysical techniques. Prior crystal structures have noted the presence of ambiguous electron density in both hydrophobic binding pockets of Ca 2+-CaM, but no assignment of these features has been made. In addition, Ca 2+-CaM samples many conformational substates in the crystal and accurately modeling the full range of this functionally important disorder is challenging. In order to characterize these features in a minimally biased manner, a 1.0 Å resolution single-wavelength anomalous diffraction data set was measured for selenomethionine-substituted Ca 2+-CaM. Density-modified electron-density mapsmore » enabled the accurate assignment of Ca 2+-CaM main-chain and side-chain disorder. These experimental maps also substantiate complex disorder models that were automatically built using low-contour features of model-phased electron density. Furthermore, experimental electron-density maps reveal that 2-methyl-2,4-pentanediol (MPD) is present in the C-terminal domain, mediates a lattice contact between N-terminal domains and may occupy the N-terminal binding pocket. The majority of the crystal structures of target-free Ca 2+-CaM have been derived from crystals grown using MPD as a precipitant, and thus MPD is likely to be bound in functionally critical regions of Ca 2+-CaM in most of these structures. The adventitious binding of MPD helps to explain differences between the Ca 2+-CaM crystal and solution structures and is likely to favor more open conformations of the EF-hands in the crystal.« less
Structural Characterization of H-1 Parvovirus: Comparison of Infectious Virions to Empty Capsids

PubMed Central

Halder, Sujata; Nam, Hyun-Joo; Govindasamy, Lakshmanan; Vogel, Michèle; Dinsart, Christiane; Salomé, Nathalie; McKenna, Robert

2013-01-01

The structure of single-stranded DNA (ssDNA) packaging H-1 parvovirus (H-1PV), which is being developed as an antitumor gene delivery vector, has been determined for wild-type (wt) virions and noninfectious (empty) capsids to 2.7- and 3.2-Å resolution, respectively, using X-ray crystallography. The capsid viral protein (VP) structure consists of an α-helix and an eight-stranded anti-parallel β-barrel with large loop regions between the strands. The β-barrel and loops form the capsid core and surface, respectively. In the wt structure, 600 nucleotides are ordered in an interior DNA binding pocket of the capsid. This accounts for ∼12% of the H-1PV genome. The wt structure is identical to the empty capsid structure, except for side chain conformation variations at the nucleotide binding pocket. Comparison of the H-1PV nucleotides to those observed in canine parvovirus and minute virus of mice, two members of the genus Parvovirus, showed both similarity in structure and analogous interactions. This observation suggests a functional role, such as in capsid stability and/or ssDNA genome recognition for encapsulation. The VP structure differs from those of other parvoviruses in surface loop regions that control receptor binding, tissue tropism, pathogenicity, and antibody recognition, including VP sequences reported to determine tumor cell tropism for oncotropic rodent parvoviruses. These structures of H-1PV provide insight into structural features that dictate capsid stabilization following genome packaging and three-dimensional information applicable for rational design of tumor-targeted recombinant gene delivery vectors. PMID:23449783
Synthesis, bioactivity, 3D-QSAR studies of novel dibenzofuran derivatives as PTP-MEG2 inhibitors

PubMed Central

Zhang, Yu-Ze; Jin, Wen-Yan; Li, Hong-Lian; Zhou, Hui; Cheng, Xian-Chao; Wang, Run-Ling

2017-01-01

PTP-MEG2 plays a critical role in the diverse cell signalling processes, so targeting PTP-MEG2 is a promising strategy for various human diseases treatments. In this study, a series of novel dibenzofuran derivatives was synthesized and assayed for their PTP-MEG2 inhibitory activities. 10a with highest inhibitory activity (320 nM) exhibited significant selectivity for PTP-MEG2 over its close homolog SHP2, CDC25 (IC50 > 50 μM). By means of the powerful “HipHop” technique, a 3D-QSAR study was carried out to explore structure activity relationship of these molecules. The generated pharmacophore model revealed that the one RA, three Hyd, and two HBA features play an important role in binding to the active site of the target protein-PTP-MEG2. Docking simulation study indicated that 10a achieved its potency and specificity for PTP-MEG2 by targeting unique nearby peripheral binding pockets and the active site. The absorption, distribution, metabolism and excretion (ADME) predictions showed that the 11 compounds hold high potential to be novel lead compounds for targeting PTP-MEG2. Our findings here can provide a new strategy or useful insights for designing the effective PTP-MEG2 inhibitors. PMID:28388567

Mechanical coupling in myosin V: a simulation study

PubMed Central

Ovchinnikov, Victor; Trout, Bernhardt L.

2009-01-01

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The inter-domain coupling in myosin V is studied with Restrained Targeted Molecular Dynamics (RTMD) using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FS) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The ‘minimal’ FS that results in extensive structural changes in the overall myosin conformation is comprised of the ATP, Switch 1, and the nearby HF, HG and HH helices. Addition of switch 2 to the forcing set is required to achieve a complete opening of the actin-binding cleft. The RTMD simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft, and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the Relay helix, and Switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of inter-domain coupling in proteins. PMID:19853615
Structure of the Mycobacterium tuberculosis D-Alanine:D-Alanine Ligase, a Target of the Antituberculosis Drug D-Cycloserine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruning, John B.; Murillo, Ana C.; Chacon, Ofelia

D-Alanine:D-alanine ligase (EC 6.3.2.4; Ddl) catalyzes the ATP-driven ligation of two D-alanine (D-Ala) molecules to form the D-alanyl:D-alanine dipeptide. This molecule is a key building block in peptidoglycan biosynthesis, making Ddl an attractive target for drug development. D-Cycloserine (DCS), an analog of D-Ala and a prototype Ddl inhibitor, has shown promise for the treatment of tuberculosis. Here, we report the crystal structure of Mycobacterium tuberculosis Ddl at a resolution of 2.1 {angstrom}. This structure indicates that Ddl is a dimer and consists of three discrete domains; the ligand binding cavity is at the intersection of all three domains and conjoinedmore » by several loop regions. The M. tuberculosis apo Ddl structure shows a novel conformation that has not yet been observed in Ddl enzymes from other species. The nucleotide and D-alanine binding pockets are flexible, requiring significant structural rearrangement of the bordering regions for entry and binding of both ATP and D-Ala molecules. Solution affinity and kinetic studies showed that DCS interacts with Ddl in a manner similar to that observed for D-Ala. Each ligand binds to two binding sites that have significant differences in affinity, with the first binding site exhibiting high affinity. DCS inhibits the enzyme, with a 50% inhibitory concentration (IC{sub 50}) of 0.37 mM under standard assay conditions, implicating a preferential and weak inhibition at the second, lower-affinity binding site. Moreover, DCS binding is tighter at higher ATP concentrations. The crystal structure illustrates potential drugable sites that may result in the development of more-effective Ddl inhibitors.« less
K-Ras protein as a drug target.

PubMed

McCormick, Frank

2016-03-01

K-Ras proteins are major drivers of human cancers, playing a direct causal role in about one million cancer cases/year. In cancers driven by mutant K-Ras, the protein is locked in the active, GTP-bound state constitutively, through a defect in the off-switch mechanism. As such, the mutant protein resembles the normal K-Ras protein from a structural perspective, making therapeutic attack extremely challenging. K-Ras is a member of a large family of related proteins, which share very similar GDP/GTP-binding domains, making specific therapies more difficult. Furthermore, Ras proteins lack pockets to which small molecules can bind with high affinity, with a few interesting exceptions. However, new insights into the structure and function of K-Ras proteins reveal opportunities for intervention that were not appreciated many years ago, when efforts were launched to develop K-Ras therapies. Furthermore, K-Ras undergoes post-translational modification and interactions with cellular signaling proteins that present additional therapeutic opportunities, such as specific binding to calmodulin and regulation of non-canonical Wnt signaling.
Oxime Ethers of (E)-11-Isonitrosostrychnine as Highly Potent Glycine Receptor Antagonists.

PubMed

Mohsen, Amal M Y; Mandour, Yasmine M; Sarukhanyan, Edita; Breitinger, Ulrike; Villmann, Carmen; Banoub, Maha M; Breitinger, Hans-Georg; Dandekar, Thomas; Holzgrabe, Ulrike; Sotriffer, Christoph; Jensen, Anders A; Zlotos, Darius P

2016-12-23

A series of (E)-11-isonitrosostrychnine oxime ethers, 2-aminostrychnine, (strychnine-2-yl)propionamide, 18-oxostrychnine, and N-propylstrychnine bromide were synthesized and evaluated pharmacologically at human α1 and α1β glycine receptors in a functional fluorescence-based and a whole-cell patch-clamp assay and in [ 3 H]strychnine binding studies. 2-Aminostrychnine and the methyl, allyl, and propargyl oxime ethers were the most potent α1 and α1β antagonists in the series, displaying IC 50 values similar to those of strychnine at the two receptors. Docking experiments to the strychnine binding site of the crystal structure of the α3 glycine receptor indicated the same orientation of the strychnine core for all analogues. For the most potent oxime ethers, the ether substituent was accommodated in a lipophilic receptor binding pocket. The findings identify the oxime hydroxy group as a suitable attachment point for linking two strychnine pharmacophores by a polymethylene spacer and are, therefore, important for the design of bivalent ligands targeting glycine receptors.
Structure-based design and mechanisms of allosteric inhibitors for mitochondrial branched-chain α-ketoacid dehydrogenase kinase

PubMed Central

Qi, Xiangbing; Gui, Wen-Jun; Morlock, Lorraine K.; Wallace, Amy L.; Ahmed, Kamran; Laxman, Sunil; Campeau, Philippe M.; Lee, Brendan H.; Hutson, Susan M.; Tu, Benjamin P.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

2013-01-01

The branched-chain amino acids (BCAAs) leucine, isoleucine, and valine are elevated in maple syrup urine disease, heart failure, obesity, and type 2 diabetes. BCAA homeostasis is controlled by the mitochondrial branched-chain α-ketoacid dehydrogenase complex (BCKDC), which is negatively regulated by the specific BCKD kinase (BDK). Here, we used structure-based design to develop a BDK inhibitor, (S)-α-chloro-phenylpropionic acid [(S)-CPP]. Crystal structures of the BDK-(S)-CPP complex show that (S)-CPP binds to a unique allosteric site in the N-terminal domain, triggering helix movements in BDK. These conformational changes are communicated to the lipoyl-binding pocket, which nullifies BDK activity by blocking its binding to the BCKDC core. Administration of (S)-CPP to mice leads to the full activation and dephosphorylation of BCKDC with significant reduction in plasma BCAA concentrations. The results buttress the concept of targeting mitochondrial BDK as a pharmacological approach to mitigate BCAA accumulation in metabolic diseases and heart failure. PMID:23716694
Identification of an hexapeptide that binds to a surface pocket in cyclin A and inhibits the catalytic activity of the complex cyclin-dependent kinase 2-cyclin A.

PubMed

Canela, Núria; Orzáez, Mar; Fucho, Raquel; Mateo, Francesca; Gutierrez, Ricardo; Pineda-Lucena, Antonio; Bachs, Oriol; Pérez-Payá, Enrique

2006-11-24

The protein-protein complexes formed between different cyclins and cyclin-dependent kinases (CDKs) are central to cell cycle regulation. These complexes represent interesting points of chemical intervention for the development of antineoplastic molecules. Here we describe the identification of an all d-amino acid hexapeptide, termed NBI1, that inhibits the kinase activity of the cyclin-dependent kinase 2 (cdk2)-cyclin A complex through selective binding to cyclin A. The mechanism of inhibition is non-competitive for ATP and non-competitive for protein substrates. In contrast to the existing CDKs peptide inhibitors, the hexapeptide NBI1 interferes with the formation of the cdk2-cyclin A complex. Furthermore, a cell-permeable derivative of NBI1 induces apoptosis and inhibits proliferation of tumor cell lines. Thus, the NBI1-binding site on cyclin A may represent a new target site for the selective inhibition of activity cdk2-cyclin A complex.
i-bodies, Human Single Domain Antibodies That Antagonize Chemokine Receptor CXCR4*

PubMed Central

Dolezal, Olan; Cao, Benjamin; See, Heng B.; Pfleger, Kevin D. G.; Gorry, Paul R.; Pow, Andrew; Viduka, Katerina; Lim, Kevin; Lu, Bernadine G. C.; Chang, Denison H. C.; Murray-Rust, Thomas; Dogovski, Con; Doerflinger, Marcel; Zhang, Yuan; Parisi, Kathy; Casey, Joanne L.; Nuttall, Stewart D.; Foley, Michael

2016-01-01

CXCR4 is a G protein-coupled receptor with excellent potential as a therapeutic target for a range of clinical conditions, including stem cell mobilization, cancer prognosis and treatment, fibrosis therapy, and HIV infection. We report here the development of a fully human single-domain antibody-like scaffold termed an “i-body,” the engineering of which produces an i-body library possessing a long complementarity determining region binding loop, and the isolation and characterization of a panel of i-bodies with activity against human CXCR4. The CXCR4-specific i-bodies show antagonistic activity in a range of in vitro and in vivo assays, including inhibition of HIV infection, cell migration, and leukocyte recruitment but, importantly, not the mobilization of hematopoietic stem cells. Epitope mapping of the three CXCR4 i-bodies AM3-114, AM4-272, and AM3-523 revealed binding deep in the binding pocket of the receptor. PMID:27036939
Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

PubMed

Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

2018-01-09

Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Identification of small molecular ligands as potent inhibitors of fatty acid metabolism in Mycobacterium tuberculosis

NASA Astrophysics Data System (ADS)

Malikanti, Ramesh; Vadija, Rajender; Veeravarapu, Hymavathi; Mustyala, Kiran Kumar; Malkhed, Vasavi; Vuruputuri, Uma

2017-12-01

Tuberculosis (Tb) is one of the major health challenges for the global scientific community. The 3-hydroxy butyryl-CoA dehydrogenase (Fad B2) protein belongs to 3-hydroxyl acetyl-CoA dehydrogenase family, which plays a key role in the fatty acid metabolism and β-oxidation in the cell membrane of Mycobacterium tuberculosis (Mtb). In the present study the Fad B2 protein is targeted for the identification of potential drug candidates for tuberculosis. The 3D model of the target protein Fad B2, was generated using homology modeling approach and was validated. The plausible binding site of the Fad B2 protein was identified from computational binding pocket prediction tools, which ranges from ASN120 to VAL150 amino acid residues. Virtual screening was carried out with the databases, Ligand box UOS and hit definder, at the binding site region. 133 docked complex structures were generated as an output. The identified ligands show good glide scores and glide energies. All the ligand molecules contain benzyl amine pharmacophore in common, which show specific and selective binding interactions with the SER122 and ASN146 residues of the Fad B2 protein. The ADME properties of all the ligand molecules were observed to be within the acceptable range. It is suggested from the result of the present study that the docked molecular structures with a benzyl amine pharmacophore act as potential ligands for Fad B2 protein binding and as leads in Tb drug discovery.
Structural basis for the recruitment and activation of the Legionella phospholipase VipD by the host GTPase Rab5

PubMed Central

Lucas, María; Gaspar, Andrew H.; Pallara, Chiara; Rojas, Adriana Lucely; Fernández-Recio, Juan; Machner, Matthias P.; Hierro, Aitor

2014-01-01

A challenge for microbial pathogens is to assure that their translocated effector proteins target only the correct host cell compartment during infection. The Legionella pneumophila effector vacuolar protein sorting inhibitor protein D (VipD) localizes to early endosomal membranes and alters their lipid and protein composition, thereby protecting the pathogen from endosomal fusion. This process requires the phospholipase A1 (PLA1) activity of VipD that is triggered specifically on VipD binding to the host cell GTPase Rab5, a key regulator of endosomes. Here, we present the crystal structure of VipD in complex with constitutively active Rab5 and reveal the molecular mechanism underlying PLA1 activation. An active site-obstructing loop that originates from the C-terminal domain of VipD is repositioned on Rab5 binding, thereby exposing the catalytic pocket within the N-terminal PLA1 domain. Substitution of amino acid residues located within the VipD–Rab5 interface prevented Rab5 binding and PLA1 activation and caused a failure of VipD mutant proteins to target to Rab5-enriched endosomal structures within cells. Experimental and computational analyses confirmed an extended VipD-binding interface on Rab5, explaining why this L. pneumophila effector can compete with cellular ligands for Rab5 binding. Together, our data explain how the catalytic activity of a microbial effector can be precisely linked to its subcellular localization. PMID:25114243
A molecular characterization of the agonist binding site of a nematode cys-loop GABA receptor

PubMed Central

Kaji, Mark D; Kwaka, Ariel; Callanan, Micah K; Nusrat, Humza; Desaulniers, Jean-Paul; Forrester, Sean G

2015-01-01

Background and Purpose Cys-loop GABA receptors represent important targets for human chemotherapeutics and insecticides and are potential targets for novel anthelmintics (nematicides). However, compared with insect and mammalian receptors, little is known regarding the pharmacological characteristics of nematode Cys-loop GABA receptors. Here we have investigated the agonist binding site of the Cys-loop GABA receptor UNC-49 (Hco-UNC-49) from the parasitic nematode Haemonchus contortus. Experimental Approach We used two-electrode voltage-clamp electrophysiology to measure channel activation by classical GABA receptor agonists on Hco-UNC-49 expressed in Xenopus laevis oocytes, along with site-directed mutagenesis and in silico homology modelling. Key Results The sulphonated molecules P4S and taurine had no effect on Hco-UNC-49. Other classical Cys-loop GABAA receptor agonists tested on the Hco-UNC-49B/C heteromeric channel had a rank order efficacy of GABA > trans-4-aminocrotonic acid > isoguvacine > imidazole-4-acetic acid (IMA) > (R)-(−)-4-amino-3-hydroxybutyric acid [R(−)-GABOB] > (S)-(+)-4-amino-3-hydroxybutyric acid [S(+)-GABOB] > guanidinoacetic acid > isonipecotic acid > 5-aminovaleric acid (DAVA) (partial agonist) > β-alanine (partial agonist). In silico ligand docking revealed some variation in binding between agonists. Mutagenesis of a key serine residue in binding loop C to threonine had minimal effects on GABA and IMA but significantly increased the maximal response to DAVA and decreased twofold the EC50 for R(−)- and S(+)-GABOB. Conclusions and Implications The pharmacological profile of Hco-UNC-49 differed from that of vertebrate Cys-loop GABA receptors and insect resistance to dieldrin receptors, suggesting differences in the agonist binding pocket. These findings could be exploited to develop new drugs that specifically target GABA receptors of parasitic nematodes. PMID:25850584
A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.

2014-10-02

GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1)more » an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.« less
Adaptive evolution and elucidating the potential inhibitor against schizophrenia to target DAOA (G72) isoforms.

PubMed

Sehgal, Sheikh Arslan; Mannan, Shazia; Kanwal, Sumaira; Naveed, Ishrat; Mir, Asif

2015-01-01

Schizophrenia (SZ), a chronic mental and heritable disorder characterized by neurophysiological impairment and neuropsychological abnormalities, is strongly associated with D-amino acid oxidase activator (DAOA, G72). Research studies emphasized that overexpression of DAOA may be responsible for improper functioning of neurotransmitters, resulting in neurological disorders like SZ. In the present study, a hybrid approach of comparative modeling and molecular docking followed by inhibitor identification and structure modeling was employed. Screening was performed by two-dimensional similarity search against selected inhibitor, keeping in view the physiochemical properties of the inhibitor. Here, we report an inhibitor compound which showed maximum binding affinity against four selected isoforms of DAOA. Docking studies revealed that Glu-53, Thr-54, Lys-58, Val-85, Ser-86, Tyr-87, Leu-88, Glu-90, Leu-95, Val-98, Ser-100, Glu-112, Tyr-116, Lys-120, Asp-121, and Arg-122 are critical residues for receptor-ligand interaction. The C-terminal of selected isoforms is conserved, and binding was observed on the conserved region of isoforms. We propose that selected inhibitor might be more potent on the basis of binding energy values. Further analysis of this inhibitor through site-directed mutagenesis could be helpful for exploring the details of ligand-binding pockets. Overall, the findings of this study may be helpful in designing novel therapeutic targets to cure SZ.
Exploring the binding mechanisms of diaminopimelic acid analogs to meso-diaminopimelate dehydrogenase by molecular modeling.

PubMed

Wang, Huiqun; Kellogg, Glen E; Xu, Ping; Zhang, Yan

2018-06-02

Meso-Diaminopimelic acid (meso-2,6-diamino-heptanedioic acid, DAP) is an important component of the cell wall of many bacteria. Meso-diaminopimelate dehydrogenase (m-Ddh) is a critical enzyme in the process of converting tetrahydrodipicolinate to DAP. Here, we are proposing that DAP analogs targeting m-Ddh may be considered as potential antibiotics. Four DAP analogs without significant structural change from DAP have been obtained and their inhibitory potencies against m-Ddh from the P. gingivalis strain W83 show significant differences from that of DAP. However, their inhibitory mechanisms as for how simple structural change influences the inhibitory potency remain unknown. Therefore, we employed molecular modeling methods to obtain insight into the inhibitory mechanisms of DAP and analogs with m-Ddh. The predicted binding mode of DAP was highly consistent with the experimental structural data and disclosed the important roles played by the binding pocket residues. According to our predictions, the isoxazoline ring of compounds 1 and 2 and the double bonds in compounds 3 and 4 had distinct influences on these compounds' binding to m-Ddh. This enriched understanding of the inhibitory mechanisms of DAP and these four analogs to m-Ddh has provided new and relevant information for future rational development of potent inhibitors targeting m-Ddh. Copyright © 2018. Published by Elsevier Inc.
Adaptive evolution and elucidating the potential inhibitor against schizophrenia to target DAOA (G72) isoforms

PubMed Central

Sehgal, Sheikh Arslan; Mannan, Shazia; Kanwal, Sumaira; Naveed, Ishrat; Mir, Asif

2015-01-01

Schizophrenia (SZ), a chronic mental and heritable disorder characterized by neurophysiological impairment and neuropsychological abnormalities, is strongly associated with D-amino acid oxidase activator (DAOA, G72). Research studies emphasized that overexpression of DAOA may be responsible for improper functioning of neurotransmitters, resulting in neurological disorders like SZ. In the present study, a hybrid approach of comparative modeling and molecular docking followed by inhibitor identification and structure modeling was employed. Screening was performed by two-dimensional similarity search against selected inhibitor, keeping in view the physiochemical properties of the inhibitor. Here, we report an inhibitor compound which showed maximum binding affinity against four selected isoforms of DAOA. Docking studies revealed that Glu-53, Thr-54, Lys-58, Val-85, Ser-86, Tyr-87, Leu-88, Glu-90, Leu-95, Val-98, Ser-100, Glu-112, Tyr-116, Lys-120, Asp-121, and Arg-122 are critical residues for receptor–ligand interaction. The C-terminal of selected isoforms is conserved, and binding was observed on the conserved region of isoforms. We propose that selected inhibitor might be more potent on the basis of binding energy values. Further analysis of this inhibitor through site-directed mutagenesis could be helpful for exploring the details of ligand-binding pockets. Overall, the findings of this study may be helpful in designing novel therapeutic targets to cure SZ. PMID:26170631
Insights into the complex formed by matrix metalloproteinase-2 and alloxan inhibitors: molecular dynamics simulations and free energy calculations.

PubMed

Giangreco, Ilenia; Lattanzi, Gianluca; Nicolotti, Orazio; Catto, Marco; Laghezza, Antonio; Leonetti, Francesco; Stefanachi, Angela; Carotti, Angelo

2011-01-01

Matrix metalloproteinases (MMP) are well-known biological targets implicated in tumour progression, homeostatic regulation, innate immunity, impaired delivery of pro-apoptotic ligands, and the release and cleavage of cell-surface receptors. Hence, the development of potent and selective inhibitors targeting these enzymes continues to be eagerly sought. In this paper, a number of alloxan-based compounds, initially conceived to bias other therapeutically relevant enzymes, were rationally modified and successfully repurposed to inhibit MMP-2 (also named gelatinase A) in the nanomolar range. Importantly, the alloxan core makes its debut as zinc binding group since it ensures a stable tetrahedral coordination of the catalytic zinc ion in concert with the three histidines of the HExxHxxGxxH metzincin signature motif, further stabilized by a hydrogen bond with the glutamate residue belonging to the same motif. The molecular decoration of the alloxan core with a biphenyl privileged structure allowed to sample the deep S(1)' specificity pocket of MMP-2 and to relate the high affinity towards this enzyme with the chance of forming a hydrogen bond network with the backbone of Leu116 and Asn147 and the side chains of Tyr144, Thr145 and Arg149 at the bottom of the pocket. The effect of even slight structural changes in determining the interaction at the S(1)' subsite of MMP-2 as well as the nature and strength of the binding is elucidated via molecular dynamics simulations and free energy calculations. Among the herein presented compounds, the highest affinity (pIC(50) = 7.06) is found for BAM, a compound exhibiting also selectivity (>20) towards MMP-2, as compared to MMP-9, the other member of the gelatinases.
Flipped Phenyl Ring Orientations of Dopamine Binding with Human and Drosophila Dopamine Transporters: Remarkable Role of Three Nonconserved Residues.

PubMed

Yuan, Yaxia; Zhu, Jun; Zhan, Chang-Guo

2018-03-09

Molecular modeling and molecular dynamics simulations were performed in the present study to examine the modes of dopamine binding with human and Drosophila dopamine transporters (hDAT and dDAT). The computational data revealed flipped binding orientations of dopamine in hDAT and dDAT due to the major differences in three key residues (S149, G153, and A423 of hDAT vs A117, D121, and S422 of dDAT) in the binding pocket. These three residues dictate the binding orientation of dopamine in the binding pocket, as the aromatic ring of dopamine tends to take an orientation with both the para- and meta-hydroxyl groups being close to polar residues and away from nonpolar residues of the protein. The flipped binding orientations of dopamine in hDAT and dDAT clearly demonstrate a generally valuable insight concerning how the species difference could drastically affect the protein-ligand binding modes, demonstrating that the species difference, which is a factor rarely considered in early drug design stage, must be accounted for throughout the ligand/drug design and discovery processes in general.
Sampling and energy evaluation challenges in ligand binding protein design

PubMed Central

Dou, Jiayi; Doyle, Lindsey; Jr. Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L.

2017-01-01

Abstract The steroid hormone 17α‐hydroxylprogesterone (17‐OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17‐OHP containing an extended, nonpolar, shape‐complementary binding pocket for the four‐ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17‐OHP with micromolar affinity. A co‐crystal structure of one of the designs revealed that 17‐OHP is rotated 180° around a pseudo‐two‐fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same “flipped” orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two‐fold symmetry of the molecule. PMID:28980354
N-Myristoyltransferase inhibitors as new leads to treat sleeping sickness

PubMed Central

Frearson, Julie A.; Brand, Stephen; McElroy, Stuart P.; Cleghorn, Laura A.T.; Smid, Ondrej; Stojanovski, Laste; Price, Helen P.; Guther, M. Lucia S.; Torrie, Leah S.; Robinson, David A.; Hallyburton, Irene; Mpamhanga, Chidochangu P.; Brannigan, James A.; Wilkinson, Anthony J.; Hodgkinson, Michael; Hui, Raymond; Qiu, Wei; Raimi, Olawale G.; van Aalten, Daan M. F.; Brenk, Ruth; Gilbert, Ian H.; Read, Kevin D.; Fairlamb, Alan H.; Ferguson, Michael A. J.; Smith, Deborah F.; Wyatt, Paul G.

2010-01-01

African sleeping sickness or human African trypanosomiasis (HAT), caused by Trypanosoma brucei spp., is responsible for ~30,000 deaths each year. Available treatments for this neglected disease are poor, with unacceptable efficacy and safety profiles, particularly in the late stage of the disease, when the parasite has infected the central nervous system. Here, we report the validation of a molecular target and discovery of associated lead compounds with potential to address this unmet need. Inhibition of this target, T. brucei N-myristoyltransferase (TbNMT), leads to rapid killing of trypanosomes both in vitro and in vivo and cures trypanosomiasis in mice. These high affinity inhibitors bind into the peptide substrate pocket of the enzyme and inhibit protein N-myristoylation in trypanosomes. The compounds identified have very promising pharmaceutical properties and represent an exciting opportunity to develop oral drugs to treat this devastating disease. Our studies validate TbNMT as a promising therapeutic target for HAT. PMID:20360736
The development of Bruton's tyrosine kinase (BTK) inhibitors from 2012 to 2017: A mini-review.

PubMed

Liang, Chengyuan; Tian, Danni; Ren, Xiaodong; Ding, Shunjun; Jia, Minyi; Xin, Minhang; Thareja, Suresh

2018-05-10

Bruton's tyrosine kinase (BTK) has emerged as a promising drug target for multiple diseases, particularly haematopoietic malignancies and autoimmune diseases related to B lymphocytes. This review focuses on the diverse, small-molecule inhibitors of BTK kinase that have shown good prospects for clinical application. Individual examples of these inhibitors, including both reversible and irreversible inhibitors and a recently developed reversible covalent inhibitor of BTK, are discussed. Considerable progress has been made in the development of irreversible inhibitors, most of which target the SH3 pocket and the cysteine 481 residue of BTK. The present review also surveys the pharmacological advantages and deficiencies of both reversible and irreversible BTK drugs, with a focus on the structure-activity relationship (SARs) and binding modes of representative drugs, which could inspire critical thinking and new ideas for developing potent BTK inhibitors with less unwanted off-target effects. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Structural Overview of the Nuclear Receptor Superfamily: Insights into Physiology and Therapeutics

PubMed Central

Huang, Pengxiang; Chandra, Vikas; Rastinejad, Fraydoon

2013-01-01

As ligand-regulated transcription factors, the nuclear hormone receptors are nearly ideal drug targets, with internal pockets that bind to hydrophobic, drug-like molecules and well-characterized ligand-induced conformational changes that recruit transcriptional coregulators to promoter elements. Yet, due to the multitude of genes under the control of a single receptor, the major challenge has been the identification of ligands with gene-selective actions, impacting disease outcomes through a narrow subset of target genes and not across their entire gene-regulatory repertoire. Here, we summarize the concepts and work to date underlying the development of steroidal and nonsteroidal receptor ligands, including the use of crystal structures, high-throughput screens, and rational design approaches for finding useful therapeutic molecules. Difficulties in finding selective receptor modulators require a more complete understanding of receptor interdomain communications, posttranslational modifications, and receptor-protein interactions that could be exploited for target gene selectivity. PMID:20148675
Twisting a β-Carotene, an Adaptive Trick from Nature for Dissipating Energy during Photoprotection*

PubMed Central

Sobotka, Roman; Kish, Elizabeth; Shukla, Mahendra Kumar; Pascal, Andrew A.; Polívka, Tomáš; Robert, Bruno

2017-01-01

Cyanobacteria possess a family of one-helix high light-inducible proteins (Hlips) that are homologous to light-harvesting antenna of plants and algae. An Hlip protein, high light-inducible protein D (HliD) purified as a small complex with the Ycf39 protein is evaluated using resonance Raman spectroscopy. We show that the HliD binds two different β-carotenes, each present in two non-equivalent binding pockets with different conformations, having their (0,0) absorption maxima at 489 and 522 nm, respectively. Both populations of β-carotene molecules were in all-trans configuration and the absorption position of the farthest blue-shifted β-carotene was attributed entirely to the polarizability of the environment in its binding pocket. In contrast, the absorption maximum of the red-shifted β-carotene was attributed to two different factors: the polarizability of the environment in its binding pocket and, more importantly, to the conformation of its β-rings. This second β-carotene has highly twisted β-rings adopting a flat conformation, which implies that the effective conjugation length N is extended up to 10.5 modifying the energetic levels. This increase in N will also result in a lower S1 energy state, which may provide a permanent energy dissipation channel. Analysis of the carbonyl stretching region for chlorophyll a excitations indicates that the HliD binds six chlorophyll a molecules in five non-equivalent binding sites, with at least one chlorophyll a presenting a slight distortion to its macrocycle. The binding modes and conformations of HliD-bound pigments are discussed with respect to the known structures of LHCII and CP29. PMID:27994060
Cofactor-binding sites in proteins of deviating sequence: comparative analysis and clustering in torsion angle, cavity, and fold space.

PubMed

Stegemann, Björn; Klebe, Gerhard

2012-02-01

Small molecules are recognized in protein-binding pockets through surface-exposed physicochemical properties. To optimize binding, they have to adopt a conformation corresponding to a local energy minimum within the formed protein-ligand complex. However, their conformational flexibility makes them competent to bind not only to homologous proteins of the same family but also to proteins of remote similarity with respect to the shape of the binding pockets and folding pattern. Considering drug action, such observations can give rise to unexpected and undesired cross reactivity. In this study, datasets of six different cofactors (ADP, ATP, NAD(P)(H), FAD, and acetyl CoA, sharing an adenosine diphosphate moiety as common substructure), observed in multiple crystal structures of protein-cofactor complexes exhibiting sequence identity below 25%, have been analyzed for the conformational properties of the bound ligands, the distribution of physicochemical properties in the accommodating protein-binding pockets, and the local folding patterns next to the cofactor-binding site. State-of-the-art clustering techniques have been applied to group the different protein-cofactor complexes in the different spaces. Interestingly, clustering in cavity (Cavbase) and fold space (DALI) reveals virtually the same data structuring. Remarkable relationships can be found among the different spaces. They provide information on how conformations are conserved across the host proteins and which distinct local cavity and fold motifs recognize the different portions of the cofactors. In those cases, where different cofactors are found to be accommodated in a similar fashion to the same fold motifs, only a commonly shared substructure of the cofactors is used for the recognition process. Copyright © 2011 Wiley Periodicals, Inc.
Phage Display on the Anti‐infective Target 1‐Deoxy‐d‐xylulose‐5‐phosphate Synthase Leads to an Acceptor–Substrate Competitive Peptidic Inhibitor

PubMed Central

Marcozzi, Alessio; Masini, Tiziana; Zhu, Di; Pesce, Diego; Illarionov, Boris; Fischer, Markus

2017-01-01

Abstract Enzymes of the 2‐C‐methyl‐d‐erythritol‐4‐phosphate pathway for the biosynthesis of isoprenoid precursors are validated drug targets. By performing phage display on 1‐deoxy‐d‐xylulose‐5‐phosphate synthase (DXS), which catalyzes the first step of this pathway, we discovered several peptide hits and recognized false‐positive hits. The enriched peptide binder P12 emerged as a substrate (d‐glyceraldehyde‐3‐phosphate)‐competitive inhibitor of Deinococcus radiodurans DXS. The results indicate possible overlap of the cofactor‐ and acceptor‐substrate‐binding pockets and provide inspiration for the design of inhibitors of DXS with a unique and novel mechanism of inhibition. PMID:29119720
Allosteric Fine-Tuning of the Binding Pocket Dynamics in the ITK SH2 Domain by a Distal Molecular Switch: An Atomistic Perspective.

PubMed

Momin, Mohamed; Xin, Yao; Hamelberg, Donald

2017-06-29

Although the regulation of function of proteins by allosteric interactions has been identified in many subcellular processes, molecular switches are also known to induce long-range conformational changes in proteins. A less well understood molecular switch involving cis-trans isomerization of a peptidyl-prolyl bond could induce a conformational change directly to the backbone that is propagated to other parts of the protein. However, these switches are elusive and hard to identify because they are intrinsic to biomolecules that are inherently dynamic. Here, we explore the conformational dynamics and free energy landscape of the SH2 domain of interleukin-2-inducible T-cell or tyrosine kinase (ITK) to fully understand the conformational coupling between the distal cis-trans molecular switch and its binding pocket of the phosphotyrosine motif. We use multiple microsecond-long all-atom molecular dynamics simulations in explicit water for over a total of 60 μs. We show that cis-trans isomerization of the Asn286-Pro287 peptidyl-prolyl bond is directly coupled to the dynamics of the binding pocket of the phosphotyrosine motif, in agreement with previous NMR experiments. Unlike the cis state that is localized and less dynamic in a single free energy basin, the trans state samples two distinct conformations of the binding pocket-one that recognizes the phosphotyrosine motif and the other that is somewhat similar to that of the cis state. The results provide an atomic-level description of a less well understood allosteric regulation by a peptidyl-prolyl cis-trans molecular switch that could aid in the understanding of normal and aberrant subcellular processes and the identification of these elusive molecular switches in other proteins.
Influence of GTP/GDP and magnesium ion on the solvated structure of the protein FtsZ: a molecular dynamics study.

PubMed

Jamous, Carla; Basdevant, Nathalie; Ha-Duong, Tap

2014-01-01

We present here a structural analysis of ten extensive all-atom molecular dynamics simulations of the monomeric protein FtsZ in various binding states. Since the polymerization and GTPase activities of FtsZ depend on the nature of a bound nucleotide as well as on the presence of a magnesium ion, we studied the structural differences between the average conformations of the following five systems: FtsZ-Apo, FtsZ-GTP, FtsZ-GDP, FtsZ-GTP-Mg, and FtsZ-GDP-Mg. The in silico solvated average structure of FtsZ-Apo significantly differs from the crystallographic structure 1W59 of FtsZ which was crystallized in a dimeric form without nucleotide and magnesium. The simulated Apo form of the protein also clearly differs from the FtsZ structures when it is bound to its ligand, the most important discrepancies being located in the loops surrounding the nucleotide binding pocket. The three average structures of FtsZ-GTP, FtsZ-GDP, and FtsZ-GTP-Mg are overall similar, except for the loop T7 located at the opposite side of the binding pocket and whose conformation in FtsZ-GDP notably differs from the one in FtsZ-GTP and FtsZ-GTP-Mg. The presence of a magnesium ion in the binding pocket has no impact on the FtsZ conformation when it is bound to GTP. In contrast, when the protein is bound to GDP, the divalent cation causes a translation of the nucleotide outwards the pocket, inducing a significant conformational change of the loop H6-H7 and the top of helix H7.
Antigen clasping by two antigen-binding sites of an exceptionally specific antibody for histone methylation

DOE PAGES

Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.; ...

2016-02-09

Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less
Antigen clasping by two antigen-binding sites of an exceptionally specific antibody for histone methylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.

Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less
From hit to lead: Structure-based discovery of naphthalene-1-sulfonamide derivatives as potent and selective inhibitors of fatty acid binding protein 4.

PubMed

Gao, Ding-Ding; Dou, Hui-Xia; Su, Hai-Xia; Zhang, Ming-Ming; Wang, Ting; Liu, Qiu-Feng; Cai, Hai-Yan; Ding, Hai-Peng; Yang, Zhuo; Zhu, Wei-Liang; Xu, Ye-Chun; Wang, He-Yao; Li, Ying-Xia

2018-05-09

Fatty acid binding protein 4 (FABP4) plays a critical role in metabolism and inflammatory processes and therefore is a potential therapeutic target for immunometabolic diseases such as diabetes and atherosclerosis. Herein, we reported the identification of naphthalene-1-sulfonamide derivatives as novel, potent and selective FABP4 inhibitors by applying a structure-based design strategy. The binding affinities of compounds 16dk, 16do and 16du to FABP4, at the molecular level, are equivalent to or even better than that of BMS309403. The X-ray crystallography complemented by the isothermal titration calorimetry studies revealed the binding mode of this series of inhibitors and the pivotal network of ordered water molecules in the binding pocket of FABP4. Moreover, compounds 16dk and 16do showed good metabolic stabilities in liver microsomes. Further extensive in vivo study demonstrated that 16dk and 16do exhibited a dramatic improvement in glucose and lipid metabolism, by decreasing fasting blood glucose and serum lipid levels, enhancing insulin sensitivity, and ameliorating hepatic steatosis in obese diabetic (db/db) mice. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Rational design and validation of a Tip60 histone acetyltransferase inhibitor

NASA Astrophysics Data System (ADS)

Gao, Chunxia; Bourke, Emer; Scobie, Martin; Famme, Melina Arcos; Koolmeister, Tobias; Helleday, Thomas; Eriksson, Leif A.; Lowndes, Noel F.; Brown, James A. L.

2014-06-01

Histone acetylation is required for many aspects of gene regulation, genome maintenance and metabolism and dysfunctional acetylation is implicated in numerous diseases, including cancer. Acetylation is regulated by histone acetyltransferases (HATs) and histone deacetylases and currently, few general HAT inhibitors have been described. We identified the HAT Tip60 as an excellent candidate for targeted drug development, as Tip60 is a key mediator of the DNA damage response and transcriptional co-activator. Our modeling of Tip60 indicated that the active binding pocket possesses opposite charges at each end, with the positive charges attributed to two specific side chains. We used structure based drug design to develop a novel Tip60 inhibitor, TH1834, to fit this specific pocket. We demonstrate that TH1834 significantly inhibits Tip60 activity in vitro and treating cells with TH1834 results in apoptosis and increased unrepaired DNA damage (following ionizing radiation treatment) in breast cancer but not control cell lines. Furthermore, TH1834 did not affect the activity of related HAT MOF, as indicated by H4K16Ac, demonstrating specificity. The modeling and validation of the small molecule inhibitor TH1834 represents a first step towards developing additional specific, targeted inhibitors of Tip60 that may lead to further improvements in the treatment of breast cancer.
A22 disrupts the bacterial actin cytoskeleton by directly binding and inducing a low-affinity state in MreB.

PubMed

Bean, G J; Flickinger, S T; Westler, W M; McCully, M E; Sept, D; Weibel, D B; Amann, K J

2009-06-09

S-(3,4-Dichlorobenzyl)isothiourea (A22) disrupts the actin cytoskeleton of bacteria, causing defects of morphology and chromosome segregation. Previous studies have suggested that the actin homologue MreB itself is the target of A22, but there has been no direct observation of A22 binding to MreB and no mechanistic explanation of its mode of action. We show that A22 binds MreB with at least micromolar affinity in its nucleotide-binding pocket in a manner that is sterically incompatible with simultaneous ATP binding. A22 negatively affects both the time course and extent of MreB polymerization in vitro in the presence of ATP. A22 prevents assembly of MreB into long, rigid polymers, as determined by both fluorescence microscopy and sedimentation assays. A22 increases the critical concentration of ATP-bound MreB assembly from 500 nM to approximately 2000 nM. We therefore conclude that A22 is a competitive inhibitor of ATP binding to MreB. A22-bound MreB is capable of polymerization, but with assembly properties that more closely resemble those of the ADP-bound state. Because the cellular concentration of MreB is in the low micromolar range, this mechanism explains the ability of A22 to largely disassemble the actin cytoskeleton in bacterial cells. It also represents a novel mode of action for a cytoskeletal drug and the first biochemical characterization of the interaction between a small molecule inhibitor of the bacterial cytoskeleton and its target.
Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal

PubMed Central

Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

2014-01-01

Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a noncanonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided. PMID:25478840
Structures of holo wild-type human cellular retinol-binding protein II (hCRBPII) bound to retinol and retinal.

PubMed

Nossoni, Zahra; Assar, Zahra; Yapici, Ipek; Nosrati, Meisam; Wang, Wenjing; Berbasova, Tetyana; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James

2014-12-01

Cellular retinol-binding proteins (CRBPs) I and II, which are members of the intracellular lipid-binding protein (iLBP) family, are retinoid chaperones that are responsible for the intracellular transport and delivery of both retinol and retinal. Although structures of retinol-bound CRBPI and CRBPII are known, no structure of a retinal-bound CRBP has been reported. In addition, the retinol-bound human CRBPII (hCRBPII) structure shows partial occupancy of a noncanonical conformation of retinol in the binding pocket. Here, the structure of retinal-bound hCRBPII and the structure of retinol-bound hCRBPII with retinol fully occupying the binding pocket are reported. It is further shown that the retinoid derivative seen in both the zebrafish CRBP and the hCRBPII structures is likely to be the product of flux-dependent and wavelength-dependent X-ray damage during data collection. The structures of retinoid-bound CRBPs are compared and contrasted, and rationales for the differences in binding affinities for retinal and retinol are provided.
Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

PubMed

Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

2016-02-03

We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Discovery and Validation of a New Class of Small Molecule Toll-Like Receptor 4 (TLR4) Inhibitors

PubMed Central

Neal, Matthew D.; Jia, Hongpeng; Eyer, Benjamin; Good, Misty; Guerriero, Christopher J.; Sodhi, Chhinder P.; Afrazi, Amin; Prindle, Thomas; Ma, Congrong; Branca, Maria; Ozolek, John; Brodsky, Jeffrey L.; Wipf, Peter; Hackam, David J.

2013-01-01

Many inflammatory diseases may be linked to pathologically elevated signaling via the receptor for lipopolysaccharide (LPS), toll-like receptor 4 (TLR4). There has thus been great interest in the discovery of TLR4 inhibitors as potential anti-inflammatory agents. Recently, the structure of TLR4 bound to the inhibitor E5564 was solved, raising the possibility that novel TLR4 inhibitors that target the E5564-binding domain could be designed. We utilized a similarity search algorithm in conjunction with a limited screening approach of small molecule libraries to identify compounds that bind to the E5564 site and inhibit TLR4. Our lead compound, C34, is a 2-acetamidopyranoside (MW 389) with the formula C17H27NO9, which inhibited TLR4 in enterocytes and macrophages in vitro, and reduced systemic inflammation in mouse models of endotoxemia and necrotizing enterocolitis. Molecular docking of C34 to the hydrophobic internal pocket of the TLR4 co-receptor MD-2 demonstrated a tight fit, embedding the pyran ring deep inside the pocket. Strikingly, C34 inhibited LPS signaling ex-vivo in human ileum that was resected from infants with necrotizing enterocolitis. These findings identify C34 and the β-anomeric cyclohexyl analog C35 as novel leads for small molecule TLR4 inhibitors that have potential therapeutic benefit for TLR4-mediated inflammatory diseases. PMID:23776545
Unfolding the HIV-1 reverse transcriptase RNase H domain – how to lose a molecular tug-of-war

DOE PAGES

Zheng, Xunhai; Pedersen, Lars C.; Gabel, Scott A.; ...

2016-01-14

Formation of the mature HIV-1 reverse transcriptase (RT) p66/p51 heterodimer requires subunit-specific processing of the p66/p66' homodimer precursor. Since the ribonuclease H (RH) domain contains an occult cleavage site located near its center, cleavage must occur either prior to folding or subsequent to unfolding. Recent NMR studies have identified a slow, subunit-specific RH domain unfolding process proposed to result from a residue tug-of-war between the polymerase and RH domains on the functionally inactive, p66' subunit. Here, we describe a structural comparison of the isolated RH domain with a domain swapped RH dimer that reveals several intrinsically destabilizing characteristics of themore » isolated domain that facilitate excursions of Tyr427 from its binding pocket and separation of helices B and D. These studies provide independent support for the subunit-selective RH domain unfolding pathway in which instability of the Tyr427 binding pocket facilitates its release followed by domain transfer, acting as a trigger for further RH domain destabilization and subsequent unfolding. As further support for this pathway, NMR studies demonstrate that addition of an RH active site-directed isoquinolone ligand retards the subunit-selective RH' domain unfolding behavior of the p66/p66' homodimer. As a result, this study demonstrates the feasibility of directly targeting RT maturation with therapeutics.« less
Unfolding the HIV-1 reverse transcriptase RNase H domain – how to lose a molecular tug-of-war

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Xunhai; Pedersen, Lars C.; Gabel, Scott A.

Formation of the mature HIV-1 reverse transcriptase (RT) p66/p51 heterodimer requires subunit-specific processing of the p66/p66' homodimer precursor. Since the ribonuclease H (RH) domain contains an occult cleavage site located near its center, cleavage must occur either prior to folding or subsequent to unfolding. Recent NMR studies have identified a slow, subunit-specific RH domain unfolding process proposed to result from a residue tug-of-war between the polymerase and RH domains on the functionally inactive, p66' subunit. Here, we describe a structural comparison of the isolated RH domain with a domain swapped RH dimer that reveals several intrinsically destabilizing characteristics of themore » isolated domain that facilitate excursions of Tyr427 from its binding pocket and separation of helices B and D. These studies provide independent support for the subunit-selective RH domain unfolding pathway in which instability of the Tyr427 binding pocket facilitates its release followed by domain transfer, acting as a trigger for further RH domain destabilization and subsequent unfolding. As further support for this pathway, NMR studies demonstrate that addition of an RH active site-directed isoquinolone ligand retards the subunit-selective RH' domain unfolding behavior of the p66/p66' homodimer. As a result, this study demonstrates the feasibility of directly targeting RT maturation with therapeutics.« less
Alkylated hydroxylamine derivatives eliminate peripheral retinylidene Schiff bases but cannot enter the retinal binding pocket of light-activated rhodopsin.

PubMed

Piechnick, Ronny; Heck, Martin; Sommer, Martha E

2011-08-23

Besides Lys-296 in the binding pocket of opsin, all-trans-retinal forms adducts with peripheral lysine residues and phospholipids, thereby mimicking the spectral and chemical properties of metarhodopsin species. These pseudophotoproducts composed of nonspecific retinylidene Schiff bases have long plagued the investigation of rhodopsin deactivation and identification of decay products. We discovered that, while hydroxylamine can enter the retinal binding pocket of light-activated rhodopsin, the modified hydroxylamine compounds o-methylhydroxylamine (mHA), o-ethylhydroxylamine (eHA), o-tert-butylhydroxylamine (t-bHA), and o-(carboxymethyl)hydroxylamine (cmHA) are excluded. However, the alkylated hydroxylamines react quickly and efficiently with exposed retinylidene Schiff bases to form their respective retinal oximes. We further investigated how t-bHA affects light-activated rhodopsin and its interaction with binding partners. We found that both metarhodopsin II (Meta II) and Meta III are resistant to t-bHA, and neither arrestin nor transducin binding is affected by t-bHA. This discovery suggests that the hypothetical solvent channel that opens in light-activated rhodopsin is extremely stringent with regard to size and/or polarity. We believe that alkylated hydroxylamines will prove to be extremely useful reagents for the investigation of rhodopsin activation and decay mechanisms. Furthermore, the use of alkylated hydroxylamines should not be limited to in vitro studies and could help elucidate visual signal transduction mechanisms in the living cells of the retina. © 2011 American Chemical Society
Binding Specificity Determines the Cytochrome P450 3A4 Mediated Enantioselective Metabolism of Metconazole.

PubMed

Zhuang, Shulin; Zhang, Leili; Zhan, Tingjie; Lu, Liping; Zhao, Lu; Wang, Haifei; Morrone, Joseph A; Liu, Weiping; Zhou, Ruhong

2018-01-25

Cytochrome P450 3A4 (CYP3A4) is a promiscuous enzyme, mediating the biotransformations of ∼50% of clinically used drugs, many of which are chiral molecules. Probing the interactions between CYP3A4 and chiral chemicals is thus essential for the elucidation of molecular mechanisms of enantioselective metabolism. We developed a stepwise-restrained-molecular-dynamics (MD) method to model human CYP3A4 in a complex with cis-metconazole (MEZ) isomers and performed conventional MD simulations with a total simulation time of 2.2 μs to probe the molecular interactions. Our current study, which employs a combined experimental and theoretical approach, reports for the first time on the distinct conformational changes of CYP3A4 that are induced by the enantioselective binding of cis-MEZ enantiomers. CYP3A4 preferably metabolizes cis-RS MEZ over the cis-SR isomer, with the resultant enantiomer fraction for cis-MEZ increasing rapidly from 0.5 to 0.82. cis-RS MEZ adopts a more extended structure in the active pocket with its Cl atom exposed to the solvent, whereas cis-SR MEZ sits within the hydrophobic core of the active pocket. Free-energy-perturbation calculations indicate that unfavorable van der Waals interactions between the cis-MEZ isomers and the CYP3A4 binding pocket predominantly contribute to their binding-affinity differences. These results demonstrate that binding specificity determines the cytochrome P450 3A4 mediated enantioselective metabolism of cis-MEZ.
Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors

DOE PAGES

Thal, David M.; Sun, Bingfa; Feng, Dan; ...

2016-03-09

Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less

Crystal structures of the M 1 and M 4 muscarinic acetylcholine receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thal, David M.; Sun, Bingfa; Feng, Dan

Muscarinic M1–M5 acetylcholine receptors are G-protein-coupled receptors that regulate many vital functions of the central and peripheral nervous systems. In particular, the M1 and M4 receptor subtypes have emerged as attractive drug targets for treatments of neurological disorders, such as Alzheimer’s disease and schizophrenia, but the high conservation of the acetylcholine-binding pocket has spurred current research into targeting allosteric sites on these receptors. In this paper, we report the crystal structures of the M1 and M4 muscarinic receptors bound to the inverse agonist, tiotropium. Comparison of these structures with each other, as well as with the previously reported M2 andmore » M3 receptor structures, reveals differences in the orthosteric and allosteric binding sites that contribute to a role in drug selectivity at this important receptor family. Finally, we also report identification of a cluster of residues that form a network linking the orthosteric and allosteric sites of the M4 receptor, which provides new insight into how allosteric modulation may be transmitted between the two spatially distinct domains.« less
Selective BET bromodomain inhibition as an antifungal therapeutic strategy

PubMed Central

Mietton, Flore; Ferri, Elena; Champleboux, Morgane; Zala, Ninon; Maubon, Danièle; Zhou, Yingsheng; Harbut, Mike; Spittler, Didier; Garnaud, Cécile; Courçon, Marie; Chauvel, Murielle; d'Enfert, Christophe; Kashemirov, Boris A.; Hull, Mitchell; Cornet, Muriel; McKenna, Charles E.; Govin, Jérôme; Petosa, Carlo

2017-01-01

Invasive fungal infections cause significant morbidity and mortality among immunocompromised individuals, posing an urgent need for new antifungal therapeutic strategies. Here we investigate a chromatin-interacting module, the bromodomain (BD) from the BET family of proteins, as a potential antifungal target in Candida albicans, a major human fungal pathogen. We show that the BET protein Bdf1 is essential in C. albicans and that mutations inactivating its two BDs result in a loss of viability in vitro and decreased virulence in mice. We report small-molecule compounds that inhibit C. albicans Bdf1 with high selectivity over human BDs. Crystal structures of the Bdf1 BDs reveal binding modes for these inhibitors that are sterically incompatible with the human BET-binding pockets. Furthermore, we report a dibenzothiazepinone compound that phenocopies the effects of a Bdf1 BD-inactivating mutation on C. albicans viability. These findings establish BET inhibition as a promising antifungal therapeutic strategy and identify Bdf1 as an antifungal drug target that can be selectively inhibited without antagonizing human BET function. PMID:28516956
Spatial Decomposition of Translational Water–Water Correlation Entropy in Binding Pockets

PubMed Central

2015-01-01

A number of computational tools available today compute the thermodynamic properties of water at surfaces and in binding pockets by using inhomogeneous solvation theory (IST) to analyze explicit-solvent simulations. Such methods enable qualitative spatial mappings of both energy and entropy around a solute of interest and can also be applied quantitatively. However, the entropy estimates of existing methods have, to date, been almost entirely limited to the first-order terms in the IST’s entropy expansion. These first-order terms account for localization and orientation of water molecules in the field of the solute but not for the modification of water–water correlations by the solute. Here, we present an extension of the Grid Inhomogeneous Solvation Theory (GIST) approach which accounts for water–water translational correlations. The method involves rewriting the two-point density of water in terms of a conditional density and utilizes the efficient nearest-neighbor entropy estimation approach. Spatial maps of this second order term, for water in and around the synthetic host cucurbit[7]uril and in the binding pocket of the enzyme Factor Xa, reveal mainly negative contributions, indicating solute-induced water–water correlations relative to bulk water; particularly strong signals are obtained for sites at the entrances of cavities or pockets. This second-order term thus enters with the same, negative, sign as the first order translational and orientational terms. Numerical and convergence properties of the methodology are examined. PMID:26636620
Mechanism of the G-protein mimetic nanobody binding to a muscarinic G-protein-coupled receptor.

PubMed

Miao, Yinglong; McCammon, J Andrew

2018-03-20

Protein-protein binding is key in cellular signaling processes. Molecular dynamics (MD) simulations of protein-protein binding, however, are challenging due to limited timescales. In particular, binding of the medically important G-protein-coupled receptors (GPCRs) with intracellular signaling proteins has not been simulated with MD to date. Here, we report a successful simulation of the binding of a G-protein mimetic nanobody to the M 2 muscarinic GPCR using the robust Gaussian accelerated MD (GaMD) method. Through long-timescale GaMD simulations over 4,500 ns, the nanobody was observed to bind the receptor intracellular G-protein-coupling site, with a minimum rmsd of 2.48 Å in the nanobody core domain compared with the X-ray structure. Binding of the nanobody allosterically closed the orthosteric ligand-binding pocket, being consistent with the recent experimental finding. In the absence of nanobody binding, the receptor orthosteric pocket sampled open and fully open conformations. The GaMD simulations revealed two low-energy intermediate states during nanobody binding to the M 2 receptor. The flexible receptor intracellular loops contribute remarkable electrostatic, polar, and hydrophobic residue interactions in recognition and binding of the nanobody. These simulations provided important insights into the mechanism of GPCR-nanobody binding and demonstrated the applicability of GaMD in modeling dynamic protein-protein interactions.
Structural basis of recognition of farnesylated and methylated KRAS4b by PDEδ.

PubMed

Dharmaiah, Srisathiyanarayanan; Bindu, Lakshman; Tran, Timothy H; Gillette, William K; Frank, Peter H; Ghirlando, Rodolfo; Nissley, Dwight V; Esposito, Dominic; McCormick, Frank; Stephen, Andrew G; Simanshu, Dhirendra K

2016-11-01

Farnesylation and carboxymethylation of KRAS4b (Kirsten rat sarcoma isoform 4b) are essential for its interaction with the plasma membrane where KRAS-mediated signaling events occur. Phosphodiesterase-δ (PDEδ) binds to KRAS4b and plays an important role in targeting it to cellular membranes. We solved structures of human farnesylated-methylated KRAS4b in complex with PDEδ in two different crystal forms. In these structures, the interaction is driven by the C-terminal amino acids together with the farnesylated and methylated C185 of KRAS4b that binds tightly in the central hydrophobic pocket present in PDEδ. In crystal form II, we see the full-length structure of farnesylated-methylated KRAS4b, including the hypervariable region. Crystal form I reveals structural details of farnesylated-methylated KRAS4b binding to PDEδ, and crystal form II suggests the potential binding mode of geranylgeranylated-methylated KRAS4b to PDEδ. We identified a 5-aa-long sequence motif (Lys-Ser-Lys-Thr-Lys) in KRAS4b that may enable PDEδ to bind both forms of prenylated KRAS4b. Structure and sequence analysis of various prenylated proteins that have been previously tested for binding to PDEδ provides a rationale for why some prenylated proteins, such as KRAS4a, RalA, RalB, and Rac1, do not bind to PDEδ. Comparison of all four available structures of PDEδ complexed with various prenylated proteins/peptides shows the presence of additional interactions due to a larger protein-protein interaction interface in KRAS4b-PDEδ complex. This interface might be exploited for designing an inhibitor with minimal off-target effects.
Resveratrol inhibits phorbol ester-induced membrane translocation of presynaptic Munc13-1.

PubMed

Pany, Satyabrata; Ghosh, Anamitra; You, Youngki; Nguyen, Nga; Das, Joydip

2017-11-01

Resveratrol (1) is a naturally occurring polyphenol that has been implicated in neuroprotection. One of resveratrol's several biological targets is Ca 2+ -sensitive protein kinase C alpha (PKCα). Resveratrol inhibits PKCα by binding to its activator-binding C1 domain. Munc13-1 is a C1 domain-containing Ca 2+ -sensitive SNARE complex protein essential for vesicle priming and neurotransmitter release. To test if resveratrol could also bind and inhibit Munc13-1, we studied the interaction of resveratrol and its derivatives, (E)-1,3-dimethoxy-5-(4-methoxystyryl)benzene, (E)-5,5'-(ethene-1,2-diyl)bis(benzene-1,2,3-triol), (E)-1,2-bis(3,4,5-trimethoxyphenyl)ethane, and (E)-5-(4-(hexadecyloxy)-3,5-dihydroxystyryl)benzene-1,2,3-triol with Munc13-1 by studying its membrane translocation from cytosol to plasma membrane in HT22 cells and primary hippocampal neurons. Resveratrol, but not the derivatives inhibited phorbol ester-induced Munc13-1 translocation from cytosol to membrane in HT22 cells and primary hippocampal neurons, as evidenced by immunoblot analysis and confocal microscopy. Resveratrol did not show any effect on Munc13-1 H567K , a mutant which is not sensitive to phorbol ester. Binding studies with Munc13-1 C1 indicated that resveratrol competes with phorbol ester for the binding site. Molecular docking and dynamics studies suggested that hydroxyl groups of resveratrol interact with phorbol-ester binding residues in the binding pocket. This study characterizes Munc13-1 as a target of resveratrol and highlights the importance of dietary polyphenol in the management of neurodegenerative diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Structures of Trypanosome Vacuolar Soluble Pyrophosphatases: Anti-Parasitic Drug Targets

PubMed Central

Yang, Yunyun; Ko, Tzu-Ping; Chen, Chun-Chi; Huang, Guozhong; Zheng, Yingying; Liu, Weidong; Wang, Iren; Ho, Meng-Ru; Danny Hsu, Shang-Te; O’Dowd, Bing; Huff, Hannah C.; Huang, Chun-Hsiang; Docampo, Roberto; Oldfield, Eric; Guo, Rey-Ting

2016-01-01

Trypanosomatid parasites are the causative agents of many neglected tropical diseases including the leishmaniases, Chagas disease, and human African trypanosomiasis. They exploit unusual vacuolar soluble pyrophosphatases (VSPs), absent in humans, for cell growth and virulence and as such, are drug targets. Here, we report the crystal structures of VSP1s from Trypanosoma cruzi and T. brucei, together with that of the T. cruzi protein bound to a bisphosphonate inhibitor. Both VSP1s form a hybrid structure containing an (N-terminal) EF-hand domain fused to a (C-terminal) pyrophosphatase domain. The two domains are connected via an extended loop of about 17 residues. Crystallographic analysis and size exclusion chromatography indicate that the VSP1s form tetramers containing head-to-tail dimers. Phosphate and diphosphate ligands bind in the PPase substrate-binding pocket and interact with several conserved residues, and a bisphosphonate inhibitor (BPH-1260) binds to the same site. Based on Cytoscape and other bioinformatics analyses it is apparent that similar folds will be found in most if not all trypanosomatid VSP1s, including those found in insects (Angomonas deanei, Strigomonas culicis), plant pathogens (Phytomonas spp.) and Leishmania spp. Overall, the results are of general interest since they open the way to structure-based drug design for many of the neglected tropical diseases. PMID:26907161
Crystal Structure of Calmodulin Binding Domain of Orai1 in Complex with Ca2+•Calmodulin Displays a Unique Binding Mode*

PubMed Central

Liu, Yanshun; Zheng, Xunhai; Mueller, Geoffrey A.; Sobhany, Mack; DeRose, Eugene F.; Zhang, Yingpei; London, Robert E.; Birnbaumer, Lutz

2012-01-01

Orai1 is a plasma membrane protein that in its tetrameric form is responsible for calcium influx from the extracellular environment into the cytosol in response to interaction with the Ca2+-depletion sensor STIM1. This is followed by a fast Ca2+·calmodulin (CaM)-dependent inhibition, resulting from CaM binding to an Orai1 region called the calmodulin binding domain (CMBD). The interaction between Orai1 and CaM at the atomic level remains unknown. Here, we report the crystal structure of a CaM·Orai1-CMBD complex showing one CMBD bound to the C-terminal lobe of CaM, differing from other CaM-target protein complexes, in which both N- and C-terminal lobes of CaM (CaM-N and CaM-C) are involved in target binding. Orai1-CMBD binds CaM-C mainly through hydrophobic interactions, primarily involving residue Trp76 of Orai1-CMBD, which interacts with the hydrophobic pocket of CaM-C. However, NMR data, isothermal titration calorimetry data, and pulldown assays indicated that CaM-N and CaM-C both can bind Orai1-CMBD, with CaM-N having ∼4 times weaker affinity than CaM-C. Pulldown assays of a Orai1-CMBD(W76E) mutant, gel filtration chromatography data, and NOE signals indicated that CaM-N and CaM-C can each bind one Orai1-CMBD. Thus our studies support an unusual, extended 1:2 binding mode of CaM to Orai1-CMBDs, and quantify the affinity of Orai1 for CaM. We propose a two-step mechanism for CaM-dependent Orai1 inactivation initiated by binding of the C-lobe of CaM to the CMBD of one Orai1 followed by the binding of the N-lobe of CaM to the CMBD of a neighboring Orai1. PMID:23109337
An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

PubMed Central

Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

2016-01-01

The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952
Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua

Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less
Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less
Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633
2-Oxoglutarate levels control adenosine nucleotide binding by Herbaspirillum seropedicae PII proteins.

PubMed

Oliveira, Marco A S; Gerhardt, Edileusa C M; Huergo, Luciano F; Souza, Emanuel M; Pedrosa, Fábio O; Chubatsu, Leda S

2015-12-01

Nitrogen metabolism in Proteobacteria is controlled by the Ntr system, in which PII proteins play a pivotal role, controlling the activity of target proteins in response to the metabolic state of the cell. Characterization of the binding of molecular effectors to these proteins can provide information about their regulation. Here, the binding of ATP, ADP and 2-oxoglutarate (2-OG) to the Herbaspirillum seropedicae PII proteins, GlnB and GlnK, was characterized using isothermal titration calorimetry. Results show that these proteins can bind three molecules of ATP, ADP and 2-OG with homotropic negative cooperativity, and 2-OG binding stabilizes the binding of ATP. Results also show that the affinity of uridylylated forms of GlnB and GlnK for nucleotides is significantly lower than that of the nonuridylylated proteins. Furthermore, fluctuations in the intracellular concentration of 2-OG in response to nitrogen availability are shown. Results suggest that under nitrogen-limiting conditions, PII proteins tend to bind ATP and 2-OG. By contrast, after an ammonium shock, a decrease in the 2-OG concentration is observed causing a decrease in the affinity of PII proteins for ATP. This phenomenon may facilitate the exchange of ATP for ADP on the ligand-binding pocket of PII proteins, thus it is likely that under low ammonium, low 2-OG levels would favor the ADP-bound state. © 2015 FEBS.
A molecular description of ligand binding to the two overlapping binding pockets of the nuclear vitamin D receptor (VDR): structure-function implications

PubMed Central

Mizwicki, Mathew T.; Menegaz, Danusa; Yaghmaei, Sepideh; Henry, Helen L.; Norman, Anthony W.

2010-01-01

Molecular modeling results indicate that the VDR contains two overlapping ligand binding pockets (LBP). Differential ligand stability and fractional occupancy of the two LBP has been physiochemically linked to the regulation of VDR-dependent genomic and non-genomic cellular responses. The purpose of this report is to develop an unbiased molecular modeling protocol that serves as a good starting point in simulating the dynamic interaction between 1α,25(OH)2-vitamin D3 (1,25D3) and the VDR LBP. To accomplish this goal, the flexible docking protocol developed allowed for flexibility in the VDR ligand and the VDR atoms that form the surfaces of the VDR LBP. This approach blindly replicated the 1,25D3 conformation and side-chain dynamics observed in the VDR x-ray structure. The results are also consistent with the previously published tenants of the vitamin D sterol (VDS)-VDR conformational ensemble model. Furthermore, we used flexible docking in combination with whole cell patch clamp electrophysiology and steroid competition assays to demonstrate that a) new non-vitamin D VDR ligands show a different pocket selectivity when compared to 1,25D3 that is qualitatively consistent with their ability to stimulate chloride channels and b) a new route of ligand binding provides a novel hypothesis describing the structural nuances that underlie hypercalceamia. PMID:20398762
Factorization of the association rate coefficient in ligand rebinding to heme proteins

NASA Astrophysics Data System (ADS)

Young, Robert D.

1984-01-01

A stochastic theory of ligand migration in biomolecules is used to analyze the recombination of small ligands to heme proteins after flash photolysis. The stochastic theory is based on a generalized sequential barrier model in which a ligand binds by overcoming a series of barriers formed by the solvent protein interface, the protein matrix, and the heme distal histidine system. The stochastic theory shows that the association rate coefficient λon factorizes into three terms λon =γ12Nout, where γ12 is the rate coefficient from the heme pocket to the heme binding site, is the equilibrium pocket occupation factor, and Nout is the fraction of heme proteins which do not undergo geminate recombination of a flashed-off ligand. The factorization of λon holds for any number of barriers and with no assumptions regarding the various rate coefficients so long as the exponential solvent process occurs. Transitions of a single ligand are allowed between any two sites with two crucial exceptions: (i) the heme binding site acts as a trap so that thermal dissociation of a bound ligand does not occur within the time of the measurement; (ii) the final step in the rebinding process always has a ligand in the heme pocket from where the ligand binds to the heme iron.
Preparation and biological evaluation of conformationally constrained BACE1 inhibitors.

PubMed

Winneroski, Leonard L; Schiffler, Matthew A; Erickson, Jon A; May, Patrick C; Monk, Scott A; Timm, David E; Audia, James E; Beck, James P; Boggs, Leonard N; Borders, Anthony R; Boyer, Robert D; Brier, Richard A; Hudziak, Kevin J; Klimkowski, Valentine J; Garcia Losada, Pablo; Mathes, Brian M; Stout, Stephanie L; Watson, Brian M; Mergott, Dustin J

2015-07-01

The BACE1 enzyme is a key target for Alzheimer's disease. During our BACE1 research efforts, fragment screening revealed that bicyclic thiazine 3 had low millimolar activity against BACE1. Analysis of the co-crystal structure of 3 suggested that potency could be increased through extension toward the S3 pocket and through conformational constraint of the thiazine core. Pursuit of S3-binding groups produced low micromolar inhibitor 6, which informed the S3-design for constrained analogs 7 and 8, themselves prepared via independent, multi-step synthetic routes. Biological characterization of BACE inhibitors 6-8 is described. Copyright © 2015 Elsevier Ltd. All rights reserved.
Targeting Plasmodium PI(4)K to eliminate malaria.

PubMed

McNamara, Case W; Lee, Marcus Cs; Lim, Chek Shik; Lim, Siau Hoi; Roland, Jason; Simon, Oliver; Yeung, Bryan Ks; Chatterjee, Arnab K; McCormack, Susan L; Manary, Micah J; Zeeman, Anne-Marie; Dechering, Koen J; Kumar, Tr Santha; Henrich, Philipp P; Gagaring, Kerstin; Ibanez, Maureen; Kato, Nobutaka; Kuhen, Kelli L; Fischli, Christoph; Nagle, Advait; Rottmann, Matthias; Plouffe, David M; Bursulaya, Badry; Meister, Stephan; Rameh, Lucia; Trappe, Joerg; Haasen, Dorothea; Timmerman, Martijn; Sauerwein, Robert W; Suwanarusk, Rossarin; Russell, Bruce; Renia, Laurent; Nosten, Francois; Tully, David C; Kocken, Clemens Hm; Glynne, Richard J; Bodenreider, Christophe; Fidock, David A; Diagana, Thierry T; Winzeler, Elizabeth A

2013-12-12

Achieving the goal of malaria elimination will depend on targeting Plasmodium pathways essential across all life stages. Here we identify a lipid kinase, phosphatidylinositol-4-OH kinase (PI(4)K), as the target of imidazopyrazines, a new antimalarial compound class that inhibits the intracellular development of multiple Plasmodium species at each stage of infection in the vertebrate host. Imidazopyrazines demonstrate potent preventive, therapeutic, and transmission-blocking activity in rodent malaria models, are active against blood-stage field isolates of the major human pathogens P. falciparum and P. vivax, and inhibit liver-stage hypnozoites in the simian parasite P. cynomolgi. We show that imidazopyrazines exert their effect through inhibitory interaction with the ATP-binding pocket of PI(4)K, altering the intracellular distribution of phosphatidylinositol-4-phosphate. Collectively, our data define PI(4)K as a key Plasmodium vulnerability, opening up new avenues of target-based discovery to identify drugs with an ideal activity profile for the prevention, treatment and elimination of malaria.
Targeting Plasmodium PI(4)K to eliminate malaria

NASA Astrophysics Data System (ADS)

McNamara, Case W.; Lee, Marcus C. S.; Lim, Chek Shik; Lim, Siau Hoi; Roland, Jason; Nagle, Advait; Simon, Oliver; Yeung, Bryan K. S.; Chatterjee, Arnab K.; McCormack, Susan L.; Manary, Micah J.; Zeeman, Anne-Marie; Dechering, Koen J.; Kumar, T. R. Santha; Henrich, Philipp P.; Gagaring, Kerstin; Ibanez, Maureen; Kato, Nobutaka; Kuhen, Kelli L.; Fischli, Christoph; Rottmann, Matthias; Plouffe, David M.; Bursulaya, Badry; Meister, Stephan; Rameh, Lucia; Trappe, Joerg; Haasen, Dorothea; Timmerman, Martijn; Sauerwein, Robert W.; Suwanarusk, Rossarin; Russell, Bruce; Renia, Laurent; Nosten, Francois; Tully, David C.; Kocken, Clemens H. M.; Glynne, Richard J.; Bodenreider, Christophe; Fidock, David A.; Diagana, Thierry T.; Winzeler, Elizabeth A.

2013-12-01

Achieving the goal of malaria elimination will depend on targeting Plasmodium pathways essential across all life stages. Here we identify a lipid kinase, phosphatidylinositol-4-OH kinase (PI(4)K), as the target of imidazopyrazines, a new antimalarial compound class that inhibits the intracellular development of multiple Plasmodium species at each stage of infection in the vertebrate host. Imidazopyrazines demonstrate potent preventive, therapeutic, and transmission-blocking activity in rodent malaria models, are active against blood-stage field isolates of the major human pathogens P. falciparum and P. vivax, and inhibit liver-stage hypnozoites in the simian parasite P. cynomolgi. We show that imidazopyrazines exert their effect through inhibitory interaction with the ATP-binding pocket of PI(4)K, altering the intracellular distribution of phosphatidylinositol-4-phosphate. Collectively, our data define PI(4)K as a key Plasmodium vulnerability, opening up new avenues of target-based discovery to identify drugs with an ideal activity profile for the prevention, treatment and elimination of malaria.
A fluorescence anisotropy assay to discover and characterize ligands targeting the maytansine site of tubulin.

PubMed

Menchon, Grégory; Prota, Andrea E; Lucena-Agell, Daniel; Bucher, Pascal; Jansen, Rolf; Irschik, Herbert; Müller, Rolf; Paterson, Ian; Díaz, J Fernando; Altmann, Karl-Heinz; Steinmetz, Michel O

2018-05-29

Microtubule-targeting agents (MTAs) like taxol and vinblastine are among the most successful chemotherapeutic drugs against cancer. Here, we describe a fluorescence anisotropy-based assay that specifically probes for ligands targeting the recently discovered maytansine site of tubulin. Using this assay, we have determined the dissociation constants of known maytansine site ligands, including the pharmacologically active degradation product of the clinical antibody-drug conjugate trastuzumab emtansine. In addition, we discovered that the two natural products spongistatin-1 and disorazole Z with established cellular potency bind to the maytansine site on β-tubulin. The high-resolution crystal structures of spongistatin-1 and disorazole Z in complex with tubulin allowed the definition of an additional sub-site adjacent to the pocket shared by all maytansine-site ligands, which could be exploitable as a distinct, separate target site for small molecules. Our study provides a basis for the discovery and development of next-generation MTAs for the treatment of cancer.
Structure-based design of an osteoclast-selective, nonpeptide Src homology 2 inhibitor with in vivo antiresorptive activity

PubMed Central

Shakespeare, William; Yang, Michael; Bohacek, Regine; Cerasoli, Franklin; Stebbins, Karin; Sundaramoorthi, Raji; Azimioara, Mihai; Vu, Chi; Pradeepan, Selvi; Metcalf, Chester; Haraldson, Chad; Merry, Taylor; Dalgarno, David; Narula, Surinder; Hatada, Marcos; Lu, Xiaode; van Schravendijk, Marie Rose; Adams, Susan; Violette, Shelia; Smith, Jeremy; Guan, Wei; Bartlett, Catherine; Herson, Jay; Iuliucci, John; Weigele, Manfred; Sawyer, Tomi

2000-01-01

Targeted disruption of the pp60src (Src) gene has implicated this tyrosine kinase in osteoclast-mediated bone resorption and as a therapeutic target for the treatment of osteoporosis and other bone-related diseases. Herein we describe the discovery of a nonpeptide inhibitor (AP22408) of Src that demonstrates in vivo antiresorptive activity. Based on a cocrystal structure of the noncatalytic Src homology 2 (SH2) domain of Src complexed with citrate [in the phosphotyrosine (pTyr) binding pocket], we designed 3′,4′-diphosphonophenylalanine (Dpp) as a pTyr mimic. In addition to its design to bind Src SH2, the Dpp moiety exhibits bone-targeting properties that confer osteoclast selectivity, hence minimizing possible undesired effects on other cells that have Src-dependent activities. The chemical structure AP22408 also illustrates a bicyclic template to replace the post-pTyr sequence of cognate Src SH2 phosphopeptides such as Ac-pTyr-Glu-Glu-Ile (1). An x-ray structure of AP22408 complexed with Lck (S164C) SH2 confirmed molecular interactions of both the Dpp and bicyclic template of AP22408 as predicted from molecular modeling. Relative to the cognate phosphopeptide, AP22408 exhibits significantly increased Src SH2 binding affinity (IC50 = 0.30 μM for AP22408 and 5.5 μM for 1). Furthermore, AP22408 inhibits rabbit osteoclast-mediated resorption of dentine in a cellular assay, exhibits bone-targeting properties based on a hydroxyapatite adsorption assay, and demonstrates in vivo antiresorptive activity in a parathyroid hormone-induced rat model. PMID:10944210

A Novel AS1411 Aptamer-Based Three-Way Junction Pocket DNA Nanostructure Loaded with Doxorubicin for Targeting Cancer Cells in Vitro and in Vivo.

PubMed

Taghdisi, Seyed Mohammad; Danesh, Noor Mohammad; Ramezani, Mohammad; Yazdian-Robati, Rezvan; Abnous, Khalil

2018-05-07

Active targeting of nanostructures containing chemotherapeutic agents can improve cancer treatment. Here, a three-way junction pocket DNA nanostructure was developed for efficient doxorubicin (Dox) delivery into cancer cells. The three-way junction pocket DNA nanostructure is composed of three strands of AS1411 aptamer as both a therapeutic aptamer and nucleolin target, the potential biomarker of prostate (PC-3 cells) and breast (4T1 cells) cancers. The properties of the Dox-loaded three-way junction pocket DNA nanostructure were characterized and verified to have several advantages, including high serum stability and a pH-responsive property. Cellular uptake studies showed that the Dox-loaded DNA nanostructure was preferably internalized into target cancer cells (PC-3 and 4T1 cells). MTT cell viability assay demonstrated that the Dox-loaded DNA nanostructure had significantly higher cytotoxicity for PC-3 and 4T1 cells compared to that of nontarget cells (CHO cells, Chinese hamster ovary cell). The in vivo antitumor effect showed that the Dox-loaded DNA nanostructure was more effective in prohibition of the tumor growth compared to free Dox. These findings showed that the Dox-loaded three-way junction pocket DNA nanostructure could significantly reduce the cytotoxic effects of Dox against nontarget cells.
Medicinal plant phytochemicals and their inhibitory activities against pancreatic lipase: molecular docking combined with molecular dynamics simulation approach.

PubMed

Ahmed, Bilal; Ali Ashfaq, Usman; Usman Mirza, Muhammad

2018-05-01

Obesity is the worst health risk worldwide, which is linked to a number of diseases. Pancreatic lipase is considered as an affective cause of obesity and can be a major target for controlling the obesity. The present study was designed to find out best phytochemicals against pancreatic lipase through molecular docking combined with molecular dynamics (MD) simulation. For this purpose, a total of 3770 phytochemicals were docked against pancreatic lipase and ranked them on the basis of binding affinity. Finally, 10 molecules (Kushenol K, Rosmarinic acid, Reserpic acid, Munjistin, Leachianone G, Cephamycin C, Arctigenin, 3-O-acetylpadmatin, Geniposide and Obtusin) were selected that showed strong bonding with the pancreatic lipase. MD simulations were performed on top five compounds using AMBER16. The simulated complexes revealed stability and ligands remained inside the binding pocket. This study concluded that these finalised molecules can be used as drug candidate to control obesity.
Crystallographic Fragment Based Drug Discovery: Use of a Brominated Fragment Library Targeting HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Happer, Meaghan; Gonzalez, Ana; Tsai, Yingssu; Soltis, Michael; Elder, John H.; Olson, Arthur J.; Stout, C. David

2013-01-01

A library of 68 brominated fragments was screened against a new crystal form of inhibited HIV-1 protease in order to probe surface sites in soaking experiments. Often fragments are weak binders with partial occupancy, resulting in weak, difficult-to-fit electron density. The use of a brominated fragment library addresses this challenge, as bromine can be located unequivocally via anomalous scattering. Data collection was carried out in an automated fashion using AutoDrug at SSRL. Novel hits were identified in the known surface sites: 3-bromo-2,6-dimethoxybenzoic acid (Br6) in the flap site, and 1-bromo-2-naphthoic acid (Br27) in the exosite, expanding the chemistry of known fragments for development of higher affinity potential allosteric inhibitors. At the same time, mapping the binding sites of a number of weaker binding Br-fragments provides further insight into the nature of these surface pockets. PMID:23998903
Autoregulation of kinase dephosphorylation by ATP binding in AGC protein kinases.

PubMed

Chan, Tung O; Pascal, John M; Armen, Roger S; Rodeck, Ulrich

2012-02-01

AGC kinases, including the three Akt (protein kinase B) isoforms, protein kinase A (PKA) and all protein kinase C (PKC) isoforms, require activation loop phosphorylation (threonine 308 in Akt1) as well as phosphorylation of a C-terminal residue (serine 473 in Akt1) for catalytic activity and phosphorylation of downstream targets. Conversely, phosphatases reverse these phosphorylations. Virtually all cellular processes are affected by AGC kinases, a circumstance that has led to intense scrutiny of the molecular mechanisms that regulate phosphorylation of these kinases. Here, we review a new layer of control of phosphorylation in Akt, PKA and PKC pointing to ATP binding pocket occupancy as a means to decelerate dephosphorylation of these and, potentially, other kinases. This additional level of kinase regulation opens the door to search for new functional motifs for the rational design of non- ATP-competitive kinase inhibitors that discriminate within and between protein kinase families.
Autoregulation of kinase dephosphorylation by ATP binding to AGC protein kinases

PubMed Central

Pascal, John M; Armen, Roger S

2012-01-01

AGC kinases, including the three Akt (protein kinase B) isoforms, protein kinase A (PKA) and all protein kinase C (PKC) isoforms, require activation loop phosphorylation (threonine 308 in Akt1) as well as phosphorylation of a C-terminal residue (serine 473 in Akt1) for catalytic activity and phosphorylation of downstream targets. Conversely, phosphatases reverse these phosphorylations. Virtually all cellular processes are affected by AGC kinases, a circumstance that has led to intense scrutiny of the molecular mechanisms that regulate phosphorylation of these kinases. Here, we review a new layer of control of phosphorylation in Akt, PKA and PKC pointing to ATP binding pocket occupancy as a means to decelerate dephosphorylation of these and, potentially, other kinases. This additional level of kinase regulation opens the door to search for new functional motifs for the rational design of non-ATP-competitive kinase inhibitors that discriminate within and between protein kinase families. PMID:22262182
Targeting Allosteric Control Mechanisms in Heat Shock Protein 70 (Hsp70)

PubMed Central

Li, Xiaokai; Shao, Hao; Taylor, Isabelle R.; Gestwicki, Jason E.

2017-01-01

Heat shock protein 70 (Hsp70) is a molecular chaperone that plays critical roles in protein homeostasis. Hsp70’s chaperone activity is coordinated by intra-molecular interactions between its two domains, as well as inter-molecular interactions between Hsp70 and its co-chaperones. Each of these contacts represents a potential opportunity for the development of chemical inhibitors. To illustrate this concept, we review three classes of recently identified molecules that bind distinct pockets on Hsp70. Although all three compounds share the ability to interrupt core biochemical functions of Hsp70, they stabilize different conformers. Accordingly, each compound appears to interrupt a specific subset of inter- and intra-molecular interactions. Thus, an accurate definition of an Hsp70 inhibitor may require a particularly detailed understanding of the molecule’s binding site and its effects on protein-protein interactions. PMID:27072701
Target Residence Time-Guided Optimization on TTK Kinase Results in Inhibitors with Potent Anti-Proliferative Activity.

PubMed

Uitdehaag, Joost C M; de Man, Jos; Willemsen-Seegers, Nicole; Prinsen, Martine B W; Libouban, Marion A A; Sterrenburg, Jan Gerard; de Wit, Joeri J P; de Vetter, Judith R F; de Roos, Jeroen A D M; Buijsman, Rogier C; Zaman, Guido J R

2017-07-07

The protein kinase threonine tyrosine kinase (TTK; also known as Mps1) is a critical component of the spindle assembly checkpoint and a promising drug target for the treatment of aggressive cancers, such as triple negative breast cancer. While the first TTK inhibitors have entered clinical trials, little is known about how the inhibition of TTK with small-molecule compounds affects cellular activity. We studied the selective TTK inhibitor NTRC 0066-0, which was developed in our own laboratory, together with 11 TTK inhibitors developed by other companies, including Mps-BAY2b, BAY 1161909, BAY 1217389 (Bayer), TC-Mps1-12 (Shionogi), and MPI-0479605 (Myrexis). Parallel testing shows that the cellular activity of these TTK inhibitors correlates with their binding affinity to TTK and, more strongly, with target residence time. TTK inhibitors are therefore an example where target residence time determines activity in in vitro cellular assays. X-ray structures and thermal stability experiments reveal that the most potent compounds induce a shift of the glycine-rich loop as a result of binding to the catalytic lysine at position 553. This "lysine trap" disrupts the catalytic machinery. Based on these insights, we developed TTK inhibitors, based on a (5,6-dihydro)pyrimido[4,5-e]indolizine scaffold, with longer target residence times, which further exploit an allosteric pocket surrounding Lys553. Their binding mode is new for kinase inhibitors and can be classified as hybrid Type I/Type III. These inhibitors have very potent anti-proliferative activity that rivals classic cytotoxic therapy. Our findings will open up new avenues for more applications for TTK inhibitors in cancer treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

PubMed

De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

2017-07-01

Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.
Structures of Saccharomyces cerevisiae D-arabinose dehydrogenase Ara1 and its complex with NADPH: implications for cofactor-assisted substrate recognition.

PubMed

Hu, Xiao-Qian; Guo, Peng-Chao; Ma, Jin-Di; Li, Wei-Fang

2013-11-01

The primary role of yeast Ara1, previously mis-annotated as a D-arabinose dehydrogenase, is to catalyze the reduction of a variety of toxic α,β-dicarbonyl compounds using NADPH as a cofactor at physiological pH levels. Here, crystal structures of Ara1 in apo and NADPH-complexed forms are presented at 2.10 and 2.00 Å resolution, respectively. Ara1 exists as a homodimer, each subunit of which adopts an (α/β)8-barrel structure and has a highly conserved cofactor-binding pocket. Structural comparison revealed that induced fit upon NADPH binding yielded an intact active-site pocket that recognizes the substrate. Moreover, the crystal structures combined with computational simulation defined an open substrate-binding site to accommodate various substrates that possess a dicarbonyl group.
Sampling and energy evaluation challenges in ligand binding protein design.

PubMed

Dou, Jiayi; Doyle, Lindsey; Jr Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L; Baker, David

2017-12-01

The steroid hormone 17α-hydroxylprogesterone (17-OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17-OHP containing an extended, nonpolar, shape-complementary binding pocket for the four-ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17-OHP with micromolar affinity. A co-crystal structure of one of the designs revealed that 17-OHP is rotated 180° around a pseudo-two-fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same "flipped" orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two-fold symmetry of the molecule. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Design, synthesis and biological evaluation of (S)-valine thiazole-derived cyclic and non-cyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1)

PubMed Central

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E.; Patel, Bhargav A.; Ambudkar, Suresh V.; Talele, Tanaji T.

2014-01-01

Multidrug resistance (MDR) caused by ATP-binding cassette (ABC) transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure to cancer chemotherapy. Previously, selenazole containing cyclic peptides were reported as P-gp inhibitors and these were also used for co-crystallization with mouse P-gp, which has 87% homology to human P-gp. It has been reported that human P-gp, can simultaneously accommodate 2-3 moderate size molecules at the drug binding pocket. Our in-silico analysis based on the homology model of human P-gp spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at drug-binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity and the structural form (linear and cyclic) of valine-derived thiazole peptides that can accommodate well in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear- (13) and cyclic-trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 = 1.5 μM). Cyclic trimer and linear trimer being equipotent, future studies can be focused on non-cyclic counterparts of cyclic peptides maintaining linear trimer length. Binding model of the linear trimer (13) within the drug-binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the non-cyclic form. PMID:24288265
Design, synthesis, and biological evaluation of (S)-valine thiazole-derived cyclic and noncyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1).

PubMed

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E; Patel, Bhargav A; Ambudkar, Suresh V; Talele, Tanaji T

2014-01-03

Multidrug resistance caused by ATP binding cassette transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure in cancer chemotherapy. Previously, selenazole-containing cyclic peptides were reported as P-gp inhibitors and were also used for co-crystallization with mouse P-gp, which has 87 % homology to human P-gp. It has been reported that human P-gp can simultaneously accommodate two to three moderately sized molecules at the drug binding pocket. Our in silico analysis, based on the homology model of human P-gp, spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at the drug binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity, and structural form (linear or cyclic) of valine-derived thiazole peptides that can be accommodated in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear (13) and cyclic trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 =1.5 μM). As the cyclic trimer and linear trimer compounds are equipotent, future studies should focus on noncyclic counterparts of cyclic peptides maintaining linear trimer length. A binding model of the linear trimer 13 within the drug binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the noncyclic form. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Interaction of perfluoroalkyl acids with human liver fatty acid-binding protein.

PubMed

Sheng, Nan; Li, Juan; Liu, Hui; Zhang, Aiqian; Dai, Jiayin

2016-01-01

Perfluoroalkyl acids (PFAAs) are highly persistent and bioaccumulative, resulting in their broad distribution in humans and the environment. The liver is an important target for PFAAs, but the mechanisms behind PFAAs interaction with hepatocyte proteins remain poorly understood. We characterized the binding of PFAAs to human liver fatty acid-binding protein (hL-FABP) and identified critical structural features in their interaction. The binding interaction of PFAAs with hL-FABP was determined by fluorescence displacement and isothermal titration calorimetry (ITC) assay. Molecular simulation was conducted to define interactions at the binding sites. ITC measurement revealed that PFOA/PFNA displayed a moderate affinity for hL-FABP at a 1:1 molar ratio, a weak binding affinity for PFHxS and no binding for PFHxA. Moreover, the interaction was mainly mediated by electrostatic attraction and hydrogen bonding. Substitution of Asn111 with Asp caused loss of binding affinity to PFAA, indicating its crucial role for the initial PFAA binding to the outer binding site. Substitution of Arg122 with Gly caused only one molecule of PFAA to bind to hL-FABP. Molecular simulation showed that substitution of Arg122 increased the volume of the outer binding pocket, making it impossible to form intensive hydrophobic stacking and hydrogen bonds with PFOA, and highlighting its crucial role in the binding process. The binding affinity of PFAAs increased significantly with their carbon number. Arg122 and Asn111 played a pivotal role in these interactions. Our findings may help understand the distribution pattern, bioaccumulation, elimination, and toxicity of PFAAs in humans.
Structural basis of RND-type multidrug exporters

PubMed Central

Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

2015-01-01

Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway. PMID:25941524
Structural basis of RND-type multidrug exporters.

PubMed

Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

2015-01-01

Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway.
Using Metadynamics to Understand the Mechanism of Calmodulin/Target Recognition at Atomic Detail

PubMed Central

Fiorin, G.; Pastore, A.; Carloni, P.; Parrinello, M.

2006-01-01

The ability of calcium-bound calmodulin (CaM) to recognize most of its target peptides is caused by its binding to two hydrophobic residues (‘anchors’). In most of the CaM complexes, the anchors pack against the hydrophobic pockets of the CaM domains and are surrounded by fully conserved Met side chains. Here, by using metadynamics simulations, we investigate quantitatively the energetics of the final step of this process using the M13 peptide, which has a high affinity and spans the sequence of the skeletal myosin light chain kinase, an important natural CaM target. We established the accuracy of our calculations by a comparison between calculated and NMR-derived structural and dynamical properties. Our calculations provide novel insights into the mechanism of protein/peptide recognition: we show that the process is associated with a free energy gain similar to that experimentally measured for the CaM complex with the homologous smooth muscle MLCK peptide (Ehrhardt et al., 1995, Biochemistry 34, 2731). We suggest that binding is dominated by the entropic effect, in agreement with previous proposals. Furthermore, we explain the role of conserved methionines by showing that the large flexibility of these side chains is a key feature of the binding mechanism. Finally, we provide a rationale for the experimental observation that in all CaM complexes the C-terminal domain seems to be hierarchically more important in establishing the interaction. PMID:16877506
Investigate the Binding of Catechins to Trypsin Using Docking and Molecular Dynamics Simulation

PubMed Central

Cui, Fengchao; Yang, Kecheng; Li, Yunqi

2015-01-01

To explore the inhibitory mechanism of catechins for digestive enzymes, we investigated the binding mode of catechins to a typical digestive enzyme-trypsin and analyzed the structure-activity relationship of catechins, using an integration of molecular docking, molecular dynamics simulation and binding free energy calculation. We found that catechins with different structures bound to a conservative pocket S1 of trypsin, which is comprised of residues 189–195, 214–220 and 225–228. In the trypsin-catechin complexes, Asp189 by forming strong hydrogen bonding, and Gln192, Trp215 and Gly216 through hydrophobic interactions, all significantly contribute to the binding of catechins. The number and the position of hydroxyl and aromatic groups, the structure of stereoisomers, and the orientation of catechins in the binding pocket S1 of trypsin all affect the binding affinity. The binding affinity is in the order of Epigallocatechin gallate (EGCG) > Epicatechin gallate (ECG) > Epicatechin (EC) > Epigallocatechin (EGC), and 2R-3R EGCG shows the strongest binding affinity out of other stereoisomers. Meanwhile, the synergic conformational changes of residues and catechins were also analyzed. These findings will be helpful in understanding the knowledge of interactions between catechins and trypsin and referable for the design of novel polyphenol based functional food and nutriceutical formulas. PMID:25938485
From nonpeptide toward noncarbon protease inhibitors: Metallacarboranes as specific and potent inhibitors of HIV protease

PubMed Central

Cígler, Petr; Kožíšek, Milan; Řezáčová, Pavlína; Brynda, Jíří; Otwinowski, Zbyszek; Pokorná, Jana; Plešek, Jaromír; Grüner, Bohumír; Dolečková-Marešová, Lucie; Máša, Martin; Sedláček, Juraj; Bodem, Jochen; Kräusslich, Hans-Georg; Král, Vladimír; Konvalinka, Jan

2005-01-01

HIV protease (PR) represents a prime target for rational drug design, and protease inhibitors (PI) are powerful antiviral drugs. Most of the current PIs are pseudopeptide compounds with limited bioavailability and stability, and their use is compromised by high costs, side effects, and development of resistant strains. In our search for novel PI structures, we have identified a group of inorganic compounds, icosahedral metallacarboranes, as candidates for a novel class of nonpeptidic PIs. Here, we report the potent, specific, and selective competitive inhibition of HIV PR by substituted metallacarboranes. The most active compound, sodium hydrogen butylimino bis-8,8-[5-(3-oxa-pentoxy)-3-cobalt bis(1,2-dicarbollide)]di-ate, exhibited a Ki value of 2.2 nM and a submicromolar EC50 in antiviral tests, showed no toxicity in tissue culture, weakly inhibited human cathepsin D and pepsin, and was inactive against trypsin, papain, and amylase. The structure of the parent cobalt bis(1,2-dicarbollide) in complex with HIV PR was determined at 2.15 Å resolution by protein crystallography and represents the first carborane-protein complex structure determined. It shows the following mode of PR inhibition: two molecules of the parent compound bind to the hydrophobic pockets in the flap-proximal region of the S3 and S3′ subsites of PR. We suggest, therefore, that these compounds block flap closure in addition to filling the corresponding binding pockets as conventional PIs. This type of binding and inhibition, chemical and biological stability, low toxicity, and the possibility to introduce various modifications make boron clusters attractive pharmacophores for potent and specific enzyme inhibition. PMID:16227435
Differential Potency of 2,6-Dimethylcyclohexanol Isomers for Positive Modulation of GABAA Receptor Currents.

PubMed

Chowdhury, Luvana; Croft, Celine J; Goel, Shikha; Zaman, Naina; Tai, Angela C-S; Walch, Erin M; Smith, Kelly; Page, Alexandra; Shea, Kevin M; Hall, C Dennis; Jishkariani, D; Pillai, Girinath G; Hall, Adam C

2016-06-01

GABAA receptors meet all of the pharmacological requirements necessary to be considered important targets for the action of general anesthetic agents in the mammalian brain. In the following patch-clamp study, the relative modulatory effects of 2,6-dimethylcyclohexanol diastereomers were investigated on human GABAA (α1β3γ2s) receptor currents stably expressed in human embryonic kidney cells. Cis,cis-, trans,trans-, and cis,trans-isomers were isolated from commercially available 2,6-dimethylcyclohexanol and were tested for positive modulation of submaximal GABA responses. For example, the addition of 30 μM cis,cis-isomer resulted in an approximately 2- to 3-fold enhancement of the EC20 GABA current. Coapplications of 30 μM 2,6-dimethylcyclohexanol isomers produced a range of positive enhancements of control GABA responses with a rank order for positive modulation: cis,cis > trans,trans ≥ mixture of isomers > > cis,trans-isomer. In molecular modeling studies, the three cyclohexanol isomers bound with the highest binding energies to a pocket within transmembrane helices M1 and M2 of the β3 subunit through hydrogen-bonding interactions with a glutamine at the 224 position and a tyrosine at the 220 position. The energies for binding to and hydrogen-bond lengths within this pocket corresponded with the relative potencies of the agents for positive modulation of GABAA receptor currents (cis,cis > trans,trans > cis,trans-2,6-dimethylcyclohexanol). In conclusion, the stereochemical configuration within the dimethylcyclohexanols is an important molecular feature in conferring positive modulation of GABAA receptor activity and for binding to the receptor, a consideration that needs to be taken into account when designing novel anesthetics with enhanced therapeutic indices. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Studies on the contributions of steric and polarity effects to the H2S-binding properties of Vitreoscilla hemoglobin

NASA Astrophysics Data System (ADS)

Wang, Dandan; Wang, Hui; Li, Haichao; Liu, Li; Li, Zhengqiang

2017-01-01

We have reported recently that Vitreoscilla hemoglobin (VHb) is a potential H2S receptor and storage molecule in bacterial metabolism. In this study, molecular cloning and site-directed mutagenesis were employed to investigate the structural basis for H2S binding. Association and dissociation rate constants (kon and koff) were determined using stopped-flow rapid-scanning spectrophotometry and compared with those for wild type VHb. Several unanticipated factors were found to govern H2S binding properties, due to the distinct structure of VHb. The results presented in this paper show that: i) bulkier residues at positions E7 and E11 decrease H2S binding accessibility, while the residue located at position B10 blocks bound H2S from escaping. ii) hydroxyl sidechains within the distal heme pocket reduce H2S reactivity to VHb; iii) Pro(E8) is involved in moving the E7-E10 loop region to trigger opening of the distal heme pocket to facilitate H2S binding.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.