Sample records for target dna molecule

  1. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    PubMed

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules

    NASA Astrophysics Data System (ADS)

    Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna

    2017-12-01

    Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.

  3. Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

    PubMed

    Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

    2018-06-13

    The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

  4. Single molecule techniques in DNA repair: A primer

    PubMed Central

    Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.

    2016-01-01

    A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596

  5. Visualization of nanoconstructions with DNA-Aptamers for targeted molecules binding on the surface of screen-printed electrodes

    NASA Astrophysics Data System (ADS)

    Lapin, Ivan N.; Shabalina, Anastasiia V.; Svetlichyi, Valery A.; Kolovskaya, Olga S.

    2018-04-01

    Nanoconstructions of gold nanoparticles (NPs) obtained via pulsed laser ablation in liquid with DNA-aptamer specific to protein tumor marker were visualized on the surface of screen-printed electrode using scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). AuNPs/aptamer nanoconstuctions distribution on the solid surface was studied. More uniform coverage of the carbon electrode surface with the nanoconstuctions was showed in comparison with DNA-aptamer alone on the golden electrode surface. Targeted binding of the tumor marker molecules with the AuNPs/DNA-aptamer nanoconstuctions was approved.

  6. Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

    PubMed

    Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

    2015-12-14

    DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

  7. Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

    PubMed Central

    Mondal, Anupam; Bhattacherjee, Arnab

    2015-01-01

    DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

  8. Disentangling DNA molecules

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

  9. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    PubMed Central

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  10. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    PubMed

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  11. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  12. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  13. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    PubMed

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  14. Deformation of DNA molecules by hydrodynamic focusing

    NASA Astrophysics Data System (ADS)

    Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

    2003-12-01

    The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

  15. Enzymatic DNA molecules

    NASA Technical Reports Server (NTRS)

    Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

    1998-01-01

    The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.

  16. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    PubMed Central

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  17. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    PubMed

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  18. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  19. Development of a reference material of a single DNA molecule for the quality control of PCR testing.

    PubMed

    Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

    2014-09-02

    We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

  20. DNA-psoralen interaction: a single molecule experiment.

    PubMed

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  1. Two-Way Gold Nanoparticle Label-Free Sensing of Specific Sequence and Small Molecule Targets Using Switchable Concatemers.

    PubMed

    Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao

    2017-05-19

    A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.

  2. NMR-based investigations into target DNA search processes of proteins.

    PubMed

    Iwahara, Junji; Zandarashvili, Levani; Kemme, Catherine A; Esadze, Alexandre

    2018-05-10

    To perform their function, transcription factors and DNA-repair/modifying enzymes must first locate their targets in the vast presence of nonspecific, but structurally similar sites on genomic DNA. Before reaching their targets, these proteins stochastically scan DNA and dynamically move from one site to another on DNA. Solution NMR spectroscopy provides unique atomic-level insights into the dynamic DNA-scanning processes, which are difficult to gain by any other experimental means. In this review, we provide an introductory overview on the NMR methods for the structural, dynamic, and kinetic investigations of target DNA search by proteins. We also discuss advantages and disadvantages of these NMR methods over other methods such as single-molecule techniques and biochemical approaches. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Single-molecule DNA detection with an engineered MspA protein nanopore

    PubMed Central

    Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

    2008-01-01

    Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

  4. Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

    PubMed Central

    Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

    2016-01-01

    There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

  5. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by

  6. Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

    PubMed

    Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

    2012-12-01

    To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

  7. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    PubMed

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  8. Mitochondria and mitochondrial DNA as relevant targets for environmental contaminants.

    PubMed

    Roubicek, Deborah A; Souza-Pinto, Nadja C de

    2017-11-01

    The mitochondrial DNA (mtDNA) is a closed circular molecule that encodes, in humans, 13 polypeptides components of the oxidative phosphorylation complexes. Integrity of the mitochondrial genome is essential for mitochondrial function and cellular homeostasis, and mutations and deletions in the mtDNA lead to oxidative stress, mitochondrial dysfunction and cell death. In vitro and in situ studies suggest that when exposed to certain genotoxins, mtDNA accumulates more damage than nuclear DNA, likely owing to its organization and localization in the mitochondrial matrix, which tends to accumulate lipophilic, positively charged molecules. In that regard, several relevant environmental and occupational contaminants have physical-chemical characteristics that indicate that they might accumulate in mitochondria and target mtDNA. Nonetheless, very little is known so far about mtDNA damage and mitochondrial dysfunction due to environmental exposure, either in model organisms or in humans. In this article, we discuss some of the characteristics of mtDNA which render it a potentially relevant target for damage by environmental contaminants, as well as possible functional consequences of damage/mutation accumulation. In addition, we review the data available in the literature focusing on mitochondrial effects of the most common classes of environmental pollutants. From that, we conclude that several lines of experimental evidence support the idea that mitochondria and mtDNA are susceptible and biologically relevant targets for pollutants, and more studies, including mechanistic ones, are needed to shed more light into the contribution of mitochondrial dysfunction to the environmental and human health effects of chemical exposure. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Visualization of DNA molecules in time during electrophoresis

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1991-01-01

    For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

  10. Discovery and characterization of small molecules targeting the DNA-binding ETS domain of ERG in prostate cancer

    PubMed Central

    Kim, Ari; Yen, Paul; Mroczek, Marta; Nouri, Mannan; Lien, Scott; Axerio-Cilies, Peter; Dalal, Kush; Yau, Clement; Ghaidi, Fariba; Guo, Yubin; Yamazaki, Takeshi; Lawn, Sam; Gleave, Martin E.; Gregory-Evans, Cheryl Y.

    2017-01-01

    Genomic alterations involving translocations of the ETS-related gene ERG occur in approximately half of prostate cancer cases. These alterations result in aberrant, androgen-regulated production of ERG protein variants that directly contribute to disease development and progression. This study describes the discovery and characterization of a new class of small molecule ERG antagonists identified through rational in silico methods. These antagonists are designed to sterically block DNA binding by the ETS domain of ERG and thereby disrupt transcriptional activity. We confirmed the direct binding of a lead compound, VPC-18005, with the ERG-ETS domain using biophysical approaches. We then demonstrated VPC-18005 reduced migration and invasion rates of ERG expressing prostate cancer cells, and reduced metastasis in a zebrafish xenograft model. These results demonstrate proof-of-principal that small molecule targeting of the ERG-ETS domain can suppress transcriptional activity and reverse transformed characteristics of prostate cancers aberrantly expressing ERG. Clinical advancement of the developed small molecule inhibitors may provide new therapeutic agents for use as alternatives to, or in combination with, current therapies for men with ERG-expressing metastatic castration-resistant prostate cancer. PMID:28465491

  11. A single molecule study of G-quadruplex and short duplex DNA structures

    NASA Astrophysics Data System (ADS)

    Roy, William A., Jr.

    Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

  12. Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

    PubMed

    Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

    2018-02-07

    Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

  13. A nonenzymatic DNA nanomachine for biomolecular detection by target recycling of hairpin DNA cascade amplification.

    PubMed

    Zheng, Jiao; Li, Ningxing; Li, Chunrong; Wang, Xinxin; Liu, Yucheng; Mao, Guobin; Ji, Xinghu; He, Zhike

    2018-06-01

    Synthetic enzyme-free DNA nanomachine performs quasi-mechanical movements in response to external intervention, suggesting the promise of constructing sensitive and specific biosensors. Herein, a smart DNA nanomachine biosensor for biomolecule (such as nucleic acid, thrombin and adenosine) detection is developed by target-assisted enzyme-free hairpin DNA cascade amplifier. The whole DNA nanomachine system is constructed on gold nanoparticle which decorated with hundreds of locked hairpin substrate strands serving as DNA tracks, and the DNA nanomachine could be activated by target molecule toehold-mediated exchange on gold nanoparticle surface, resulted in the fluorescence recovery of fluorophore. The process is repeated so that each copy of the target can open multiplex fluorophore-labeled hairpin substrate strands, resulted in amplification of the fluorescence signal. Compared with the conventional biosensors of catalytic hairpin assembly (CHA) without substrate in solution, the DNA nanomachine could generate 2-3 orders of magnitude higher fluorescence signal. Furthermore, the DNA nanomachine could be used for nucleic acid, thrombin and adenosine highly sensitive specific detection based on isothermal, and homogeneous hairpin DNA cascade signal amplification in both buffer and a complicated biomatrix, and this kind of DNA nanomachine could be efficiently applied in the field of biomedical analysis. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Small-molecule inhibitors of DNA damage-repair pathways: an approach to overcome tumor resistance to alkylating anticancer drugs

    PubMed Central

    Srinivasan, Ajay; Gold, Barry

    2013-01-01

    A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253

  15. Improved and targeted delivery of bioactive molecules to cells with magnetic layer-by-layer assembled microcapsules

    NASA Astrophysics Data System (ADS)

    Pavlov, Anton M.; Gabriel, Samantha A.; Sukhorukov, Gleb B.; Gould, David J.

    2015-05-01

    Despite our increasing knowledge of cell biology and the recognition of an increasing repertoire of druggable intracellular therapeutic targets, there remain a limited number of approaches to deliver bioactive molecules to cells and even fewer that enable targeted delivery. Layer-by-layer (LbL) microcapsules are assembled using alternate layers of oppositely charged molecules and are potential cell delivery vehicles for applications in nanomedicine. There are a wide variety of charged molecules that can be included in the microcapsule structure including metal nanoparticles that introduce physical attributes. Delivery of bioactive molecules to cells with LbL microcapsules has recently been demonstrated, so in this study we explore the delivery of bioactive molecules (luciferase enzyme and plasmid DNA) to cells using biodegradable microcapsules containing a layer of magnetite nanoparticles. Interestingly, significantly improved intracellular luciferase enzyme activity (25 fold) and increased transfection efficiency with plasmid DNA (3.4 fold) was observed with magnetic microcapsules. The use of a neodymium magnet enabled efficient targeting of magnetic microcapsules which further improved the delivery efficiency of the cargoes as a consequence of increased microcapsule concentration at the magnetic site. Microcapsules were well tolerated by cells in these experiments and only displayed signs of toxicity at a capsule : cell ratio of 100 : 1 and with extended exposure. These studies illustrate how multi-functionalization of LbL microcapsules can improve and target delivery of bioactive molecules to cells.

  16. Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging

    PubMed Central

    Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid

    2015-01-01

    The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093

  17. Live-cell single-molecule tracking reveals co-recognition of H3K27me3 and DNA targets polycomb Cbx7-PRC1 to chromatin

    PubMed Central

    Zhen, Chao Yu; Tatavosian, Roubina; Huynh, Thao Ngoc; Duc, Huy Nguyen; Das, Raibatak; Kokotovic, Marko; Grimm, Jonathan B; Lavis, Luke D; Lee, Jun; Mejia, Frances J; Li, Yang; Yao, Tingting; Ren, Xiaojun

    2016-01-01

    The Polycomb PRC1 plays essential roles in development and disease pathogenesis. Targeting of PRC1 to chromatin is thought to be mediated by the Cbx family proteins (Cbx2/4/6/7/8) binding to histone H3 with a K27me3 modification (H3K27me3). Despite this prevailing view, the molecular mechanisms of targeting remain poorly understood. Here, by combining live-cell single-molecule tracking (SMT) and genetic engineering, we reveal that H3K27me3 contributes significantly to the targeting of Cbx7 and Cbx8 to chromatin, but less to Cbx2, Cbx4, and Cbx6. Genetic disruption of the complex formation of PRC1 facilitates the targeting of Cbx7 to chromatin. Biochemical analyses uncover that the CD and AT-hook-like (ATL) motif of Cbx7 constitute a functional DNA-binding unit. Live-cell SMT of Cbx7 mutants demonstrates that Cbx7 is targeted to chromatin by co-recognizing of H3K27me3 and DNA. Our data suggest a novel hierarchical cooperation mechanism by which histone modifications and DNA coordinate to target chromatin regulatory complexes. DOI: http://dx.doi.org/10.7554/eLife.17667.001 PMID:27723458

  18. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  19. Transformation of Escherichia coli with large DNA molecules by electroporation.

    PubMed Central

    Sheng, Y; Mancino, V; Birren, B

    1995-01-01

    We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828

  20. Single-Molecule Electrical Random Resequencing of DNA and RNA

    NASA Astrophysics Data System (ADS)

    Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

    2012-07-01

    Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

  1. Built-in adjuvanticity of genetically and protein-engineered chimeric molecules for targeting of influenza A peptide epitopes.

    PubMed

    Kerekov, Nikola S; Ivanova, Iva I; Mihaylova, Nikolina M; Nikolova, Maria; Prechl, Jozsef; Tchorbanov, Andrey I

    2014-10-01

    Highly purified, subunit, or synthetic viral antigens are known to be weakly immunogenic and potentate only the antibody, rather than cell-mediated immune responses. An alternative approach for inducing protective immunity with small viral peptides would be the direct targeting of viral epitopes to the immunocompetent cells by DNA vaccines encoding antibody fragments specific to activating cell surface co-receptor molecules. Here, we are exploring as a new genetic vaccine, a DNA chimeric molecule encoding a T and B cell epitope-containing influenza A virus hemagglutinin peptide joined to sequences encoding a single-chain variable fragment antibody fragment specific for the costimulatory B cell complement receptors 1 and 2. This recombinant DNA molecule was inserted into eukaryotic expression vector and used as a naked DNA vaccine in WT and CR1/2 KO mice. The intramuscular administration of the DNA construct resulted in the in vivo expression of an immunogenic chimeric protein, which cross-links cell surface receptors on influenza-specific B cells. The DNA vaccination was followed by prime-boosting with the protein-engineered replica of the DNA construct, thus delivering an activation intracellular signal. Immunization with an expression vector containing the described construct and boosting with the protein chimera induced a strong anti-influenza cytotoxic response, modulation of cytokine profile, and a weak antibody response in Balb/c mice. The same immunization scheme did not result in generation of influenza-specific response in mice lacking the target receptor, underlining the molecular adjuvant effect of receptor targeting.

  2. DNA-Based Single-Molecule Electronics: From Concept to Function.

    PubMed

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  3. DNA-Based Single-Molecule Electronics: From Concept to Function

    PubMed Central

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  4. Design, synthesis and selection of DNA-encoded small-molecule libraries.

    PubMed

    Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

    2009-09-01

    Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

  5. Target guided synthesis using DNA nano-templates for selectively assembling a G-quadruplex binding c-MYC inhibitor

    NASA Astrophysics Data System (ADS)

    Panda, Deepanjan; Saha, Puja; Das, Tania; Dash, Jyotirmayee

    2017-07-01

    The development of small molecules is essential to modulate the cellular functions of biological targets in living system. Target Guided Synthesis (TGS) approaches have been used for the identification of potent small molecules for biological targets. We herein demonstrate an innovative example of TGS using DNA nano-templates that promote Huisgen cycloaddition from an array of azide and alkyne fragments. A G-quadruplex and a control duplex DNA nano-template have been prepared by assembling the DNA structures on gold-coated magnetic nanoparticles. The DNA nano-templates facilitate the regioselective formation of 1,4-substituted triazole products, which are easily isolated by magnetic decantation. The G-quadruplex nano-template can be easily recovered and reused for five reaction cycles. The major triazole product, generated by the G-quadruplex inhibits c-MYC expression by directly targeting the c-MYC promoter G-quadruplex. This work highlights that the nano-TGS approach may serve as a valuable strategy to generate target-selective ligands for drug discovery.

  6. A lab-on-chip for biothreat detection using single-molecule DNA mapping.

    PubMed

    Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf

    2011-03-07

    Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.

  7. Single Molecule Study of Metalloregulatory Protein-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng

    2007-03-01

    Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.

  8. Torsional mechanics of DNA are regulated by small-molecule intercalation.

    PubMed

    Celedon, Alfredo; Wirtz, Denis; Sun, Sean

    2010-12-23

    Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

  9. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  10. New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

    PubMed

    Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

    2017-04-01

    Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    NASA Astrophysics Data System (ADS)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  12. Targeting Mycobacterium tuberculosis Topoisomerase I by Small-Molecule Inhibitors

    PubMed Central

    Godbole, Adwait Anand; Ahmed, Wareed; Bhat, Rajeshwari Subray; Bradley, Erin K.; Ekins, Sean

    2014-01-01

    We describe inhibition of Mycobacterium tuberculosis topoisomerase I (MttopoI), an essential mycobacterial enzyme, by two related compounds, imipramine and norclomipramine, of which imipramine is clinically used as an antidepressant. These molecules showed growth inhibition of both Mycobacterium smegmatis and M. tuberculosis cells. The mechanism of action of these two molecules was investigated by analyzing the individual steps of the topoisomerase I (topoI) reaction cycle. The compounds stimulated cleavage, thereby perturbing the cleavage-religation equilibrium. Consequently, these molecules inhibited the growth of the cells overexpressing topoI at a low MIC. Docking of the molecules on the MttopoI model suggested that they bind near the metal binding site of the enzyme. The DNA relaxation activity of the metal binding mutants harboring mutations in the DxDxE motif was differentially affected by the molecules, suggesting that the metal coordinating residues contribute to the interaction of the enzyme with the drug. Taken together, the results highlight the potential of these small molecules, which poison the M. tuberculosis and M. smegmatis topoisomerase I, as leads for the development of improved molecules to combat mycobacterial infections. Moreover, targeting metal coordination in topoisomerases might be a general strategy to develop new lead molecules. PMID:25534741

  13. DNA origami based Au-Ag-core-shell nanoparticle dimers with single-molecule SERS sensitivity

    NASA Astrophysics Data System (ADS)

    Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.; Bald, I.

    2016-03-01

    DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled.DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA

  14. Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

    PubMed

    Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

    2014-03-12

    The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

  15. Nanopore detection of DNA molecules in crowded neutral polymer solutions

    NASA Astrophysics Data System (ADS)

    Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven

    Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.

  16. Functional helicoidal model of DNA molecule with elastic nonlinearity

    NASA Astrophysics Data System (ADS)

    Tseytlin, Y. M.

    2013-06-01

    We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

  17. Single DNA molecule detection using nanopipettes and nanoparticles.

    PubMed

    Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

    2005-02-01

    Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

  18. Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

    PubMed Central

    Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

    2015-01-01

    CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

  19. Small-molecule inhibitors of APE1 DNA repair function: an overview.

    PubMed

    Al-Safi, Rasha I; Odde, Srinivas; Shabaik, Yumna; Neamati, Nouri

    2012-01-01

    APE1 is a multifaceted protein that orchestrates multiple activities in the cell, one of which is the preservation of genomic integrity; a vital process that takes place in the context of the base excision repair (BER) pathway. Studies have implicated APE1 in rendering cancerous cells less vulnerable to the effects of DNA-damaging agents that are commonly used for the treatment of cancer. Furthermore, suppression of APE1 expression in cancer cell lines is accompanied by the potentiation of the activity of cytotoxic agents. As a result, major efforts have been directed towards the identification of small-molecule inhibitors of this DNA-repair enzyme. Herein, we review all patented small-molecule APE1 inhibitors reported prior to 2011. Unfortunately, the potency and selectivity of many of the reported inhibitors were not disclosed by the original authors, and at present it is unclear if APE1 is a bona fide target for many of the purported inhibitors. Moreover, cellular activity and toxicity of many inhibitors remain to be established. Since this is the first comprehensive review of small molecule APE1 inhibitors, we present all compounds reported to inhibit APE1 activity with an IC50 value ≤ 25 μM. Efforts towards a careful validation and optimization of these compounds are warranted. Furthermore, we explore potential allosteric drug-binding sites on the protein as an alternative approach for modulating the activity of this multifunctional protein. In addition, we give an overview of APE2, as well as other APE1 homologues in some disease-causing pathogens. Finally, given the universal importance of DNA repair, as well as the considerable conservation of repair proteins across all living organisms, we propose targeting the AP endonuclease activity of pathogens by the compounds discussed in this review, thereby expanding their therapeutic potential and application.

  20. Single molecule targeted sequencing for cancer gene mutation detection.

    PubMed

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W; He, Jiankui

    2016-05-19

    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis.

  1. Small molecules targeting viral RNA.

    PubMed

    Hermann, Thomas

    2016-11-01

    Highly conserved noncoding RNA (ncRNA) elements in viral genomes and transcripts offer new opportunities to expand the repertoire of drug targets for the development of antiinfective therapy. Ligands binding to ncRNA architectures are able to affect interactions, structural stability or conformational changes and thereby block processes essential for viral replication. Proof of concept for targeting functional RNA by small molecule inhibitors has been demonstrated for multiple viruses with RNA genomes. Strategies to identify antiviral compounds as inhibitors of ncRNA are increasingly emphasizing consideration of drug-like properties of candidate molecules emerging from screening and ligand design. Recent efforts of antiviral lead discovery for RNA targets have provided drug-like small molecules that inhibit viral replication and include inhibitors of human immunodeficiency virus (HIV), hepatitis C virus (HCV), severe respiratory syndrome coronavirus (SARS CoV), and influenza A virus. While target selectivity remains a challenge for the discovery of useful RNA-binding compounds, a better understanding is emerging of properties that define RNA targets amenable for inhibition by small molecule ligands. Insight from successful approaches of targeting viral ncRNA in HIV, HCV, SARS CoV, and influenza A will provide a basis for the future exploration of RNA targets for therapeutic intervention in other viral pathogens which create urgent, unmet medical needs. Viruses for which targeting ncRNA components in the genome or transcripts may be promising include insect-borne flaviviruses (Dengue, Zika, and West Nile) and filoviruses (Ebola and Marburg). WIREs RNA 2016, 7:726-743. doi: 10.1002/wrna.1373 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  2. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    PubMed

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  3. DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

    NASA Astrophysics Data System (ADS)

    Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

    2007-02-01

    We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

  4. Homogeneous assay of target molecules based on chemiluminescence resonance energy transfer (CRET) using DNAzyme-linked aptamers.

    PubMed

    Mun, Hyoyoung; Jo, Eun-Jung; Li, Taihua; Joung, Hyou-Arm; Hong, Dong-Gu; Shim, Won-Bo; Jung, Cheulhee; Kim, Min-Gon

    2014-08-15

    We have designed a single-stranded DNAzyme-aptamer sensor for homogeneous target molecular detection based on chemiluminescence resonance energy transfer (CRET). The structure of the engineered single-stranded DNA (ssDNA) includes the horseradish peroxidase (HRP)-like DNAzyme, optimum-length linker (10-mer-length DNA), and target-specific aptamer sequences. A quencher dye was modified at the 3' end of the aptamer sequence. The incorporation of hemin into the G-quadruplex structure of DNAzyme yields an active HRP-like activity that catalyzes luminol to generate a chemiluminescence (CL) signal. In the presence of target molecules, such as ochratoxin A (OTA), adenosine triphosphate (ATP), or thrombin, the aptamer sequence was folded due to the formation of the aptamer/analyte complex, which induced the quencher dye close to the DNAzyme structure. Consequently, the CRET occurred between a DNAzyme-catalyzed chemiluminescence reaction and the quencher dye. Our results showed that CRET-based DNAzyme-aptamer biosensing enabled specific OTA analysis with a limit of detection of 0.27ng/mL. The CRET platform needs no external light source and avoids autofluorescence and photobleaching, and target molecules can be detected specifically and sensitively in a homogeneous manner. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA

    PubMed Central

    Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.

    2017-01-01

    Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846

  6. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    PubMed Central

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  7. SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

    PubMed Central

    Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

    1973-01-01

    Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

  8. Developing DNA nanotechnology using single-molecule fluorescence.

    PubMed

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  9. Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

    NASA Astrophysics Data System (ADS)

    Kowalczykowski, Stephen

    2013-03-01

    We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

  10. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    PubMed

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ito, Takashi

    2008-01-01

    This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

  12. Single-Molecule View of Small RNA-Guided Target Search and Recognition.

    PubMed

    Globyte, Viktorija; Kim, Sung Hyun; Joo, Chirlmin

    2018-05-20

    Most everyday processes in life involve a necessity for an entity to locate its target. On a cellular level, many proteins have to find their target to perform their function. From gene-expression regulation to DNA repair to host defense, numerous nucleic acid-interacting proteins use distinct target search mechanisms. Several proteins achieve that with the help of short RNA strands known as guides. This review focuses on single-molecule advances studying the target search and recognition mechanism of Argonaute and CRISPR (clustered regularly interspaced short palindromic repeats) systems. We discuss different steps involved in search and recognition, from the initial complex prearrangement into the target-search competent state to the final proofreading steps. We focus on target search mechanisms that range from weak interactions, to one- and three-dimensional diffusion, to conformational proofreading. We compare the mechanisms of Argonaute and CRISPR with a well-studied target search system, RecA.

  13. DNA nanotechnology-enabled biosensors.

    PubMed

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. A Synthetic DNA-Binding Domain Guides Distinct Chromatin-Modifying Small Molecules to Activate an Identical Gene Network.

    PubMed

    Han, Le; Pandian, Ganesh N; Chandran, Anandhakumar; Sato, Shinsuke; Taniguchi, Junichi; Kashiwazaki, Gengo; Sawatani, Yoshito; Hashiya, Kaori; Bando, Toshikazu; Xu, Yufang; Qian, Xuhong; Sugiyama, Hiroshi

    2015-07-20

    Synthetic dual-function ligands targeting specific DNA sequences and histone-modifying enzymes were applied to achieve regulatory control over multi-gene networks in living cells. Unlike the broad array of targeting small molecules for histone deacetylases (HDACs), few modulators are known for histone acetyltransferases (HATs), which play a central role in transcriptional control. As a novel chemical approach to induce selective HAT-regulated genes, we conjugated a DNA-binding domain (DBD) "I" to N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB), an artificial HAT activator. In vitro enzyme activity assays and microarray studies were used to demonstrate that distinct functional small molecules could be transformed to have identical bioactivity when conjugated with a targeting DBD. This proof-of-concept synthetic strategy validates the switchable functions of HDACs and HATs in gene regulation and provides a molecular basis for developing versatile bioactive ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. How to read and write mechanical information in DNA molecules

    NASA Astrophysics Data System (ADS)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  16. DNA curtains for high-throughput single-molecule optical imaging.

    PubMed

    Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis

    2010-01-01

    Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

    NASA Astrophysics Data System (ADS)

    Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

    2009-03-01

    We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

  18. Binary electrokinetic separation of target DNA from background DNA primers.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting themore » entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.« less

  19. Inhibition of bone resorption in vitro by antisense RNA and DNA molecules targeted against carbonic anhydrase II or two subunits of vacuolar H(+)-ATPase.

    PubMed Central

    Laitala, T; Väänänen, H K

    1994-01-01

    The bone resorbing cells, osteoclasts, express high levels of carbonic anhydrase II (CA II) and vacuolar H(+)-ATPase (V-ATPase) during bone resorption. We have used antisense RNA and DNA molecules targeted against CA II, and against 16- and 60-kD subunits of vacuolar H(+)-ATPase (V-ATPase), to block the expression of these proteins in vitro. Osteoclastic bone resorption was studied in two in vitro culture systems: release of 45Calcium from prelabeled newborn mouse calvaria cultures, and resorption pit assays performed with rat osteoclasts cultured on bovine bone slices. Both antisense RNA and DNA against CA II and the V-ATPase were used to compare their specificities as regards inhibiting bone resorption in vitro. The antisense molecules inhibited the synthesis of these proteins by decreasing the amounts of mRNA in the cells in a highly specific manner. In osteoclast cultures treated with the 16-kD V-ATPase antisense RNA, acidification of an unknown population of intracellular vesicles was highly stimulated. The acidification of these vesicles was not sensitive to amiloride or bafilomycin A1. This suggests the existence of a back-up system for acidification of intracellular vesicles, when the expression of the V-ATPase is blocked. Our results further indicate that blocking the expression of CA II and V-ATPase with antisense RNA or DNA leads to decreased bone resorption. Images PMID:8200964

  20. Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Stasiak, Andrzej

    2016-09-01

    Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

  1. Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

    NASA Astrophysics Data System (ADS)

    Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

    2010-03-01

    Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

  2. The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

    NASA Astrophysics Data System (ADS)

    Sharipov, T. I.; Bakhtizin, R. Z.

    2017-10-01

    An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

  3. Methods of DNA methylation detection

    NASA Technical Reports Server (NTRS)

    Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

    2010-01-01

    The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

  4. Topological events in single molecules of E. coli DNA confined in nanochannels

    PubMed Central

    Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

    2015-01-01

    We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

  5. Natural Compounds as Anticancer Agents Targeting DNA Topoisomerases

    PubMed Central

    Jain, Chetan Kumar; Majumder, Hemanta Kumar; Roychoudhury, Susanta

    2017-01-01

    DNA topoisomerases are important cellular enzymes found in almost all types of living cells (eukaryotic and prokaryotic). These enzymes are essential for various DNA metabolic processes e.g. replication, transcription, recombination, chromosomal decatenation etc. These enzymes are important molecular drug targets and inhibitors of these enzymes are widely used as effective anticancer and antibacterial drugs. However, topoisomerase inhibitors have some therapeutic limitations and they exert serious side effects during cancer chemotherapy. Thus, development of novel anticancer topoisomerase inhibitors is necessary for improving cancer chemotherapy. Nature serves as a repertoire of structurally and chemically diverse molecules and in the recent years many DNA topoisomerase inhibitors have been identified from natural sources. The present review discusses anticancer properties and therapeutic importance of eighteen recently identified natural topoisomerase inhibitors (from the year 2009 to 2015). Structural characteristics of these novel inhibitors provide backbones for designing and developing new anticancer drugs. PMID:28503091

  6. Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

    PubMed

    Chen, Xiang

    2013-09-01

    A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

  7. Winding single-molecule double-stranded DNA on a nanometer-sized reel

    PubMed Central

    You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

    2012-01-01

    A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

  8. Rational Design of Small Molecules Targeting Oncogenic Noncoding RNAs from Sequence.

    PubMed

    Disney, Matthew D; Angelbello, Alicia J

    2016-12-20

    The discovery of RNA catalysis in the 1980s and the dissemination of the human genome sequence at the start of this century inspired investigations of the regulatory roles of noncoding RNAs in biology. In fact, the Encyclopedia of DNA Elements (ENCODE) project has shown that only 1-2% of the human genome encodes protein, yet 75% is transcribed into RNA. Functional studies both preceding and following the ENCODE project have shown that these noncoding RNAs have important roles in regulating gene expression, developmental timing, and other critical functions. RNA's diverse roles are often a consequence of the various folds that it adopts. The single-stranded nature of the biopolymer enables it to adopt intramolecular folds with noncanonical pairings to lower its free energy. These folds can be scaffolds to bind proteins or to form frameworks to interact with other RNAs. Not surprisingly, dysregulation of certain noncoding RNAs has been shown to be causative of disease. Given this as the background, it is easy to see why it would be useful to develop methods that target RNA and manipulate its biology in rational and predictable ways. The antisense approach has afforded strategies to target RNAs via Watson-Crick base pairing and has typically focused on targeting partially unstructured regions of RNA. Small molecule strategies to target RNA would be desirable not only because compounds could be lead optimized via medicinal chemistry but also because structured regions within an RNA of interest could be targeted to directly interfere with RNA folds that contribute to disease. Additionally, small molecules have historically been the most successful drug candidates. Until recently, the ability to design small molecules that target non-ribosomal RNAs has been elusive, creating the perception that they are "undruggable". In this Account, approaches to demystify targeting RNA with small molecules are described. Rather than bulk screening for compounds that bind to singular

  9. Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

    NASA Astrophysics Data System (ADS)

    Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

    2016-07-01

    The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

  10. Targeting Extracellular DNA to Deliver IGF-1 to the Injured Heart

    NASA Astrophysics Data System (ADS)

    Khan, Raffay S.; Martinez, Mario D.; Sy, Jay C.; Pendergrass, Karl D.; Che, Pao-Lin; Brown, Milton E.; Cabigas, E. Bernadette; Dasari, Madhuri; Murthy, Niren; Davis, Michael E.

    2014-03-01

    There is a great need for the development of therapeutic strategies that can target biomolecules to damaged myocardium. Necrosis of myocardium during a myocardial infarction (MI) is characterized by extracellular release of DNA, which can serve as a potential target for ischemic tissue. Hoechst, a histological stain that binds to double-stranded DNA can be conjugated to a variety of molecules. Insulin-like growth factor-1 (IGF-1), a small protein/polypeptide with a short circulating-half life is cardioprotective following MI but its clinical use is limited by poor delivery, as intra-myocardial injections have poor retention and chronic systemic presence has adverse side effects. Here, we present a novel delivery vehicle for IGF-1, via its conjugation to Hoechst for targeting infarcted tissue. Using a mouse model of ischemia-reperfusion, we demonstrate that intravenous delivery of Hoechst-IGF-1 results in activation of Akt, a downstream target of IGF-1 and protects from cardiac fibrosis and dysfunction following MI.

  11. Single-molecule analysis of DNA uncoiling by a type II topoisomerase

    NASA Astrophysics Data System (ADS)

    Strick, Terence R.; Croquette, Vincent; Bensimon, David

    2000-04-01

    Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

  12. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    PubMed

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  13. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin

    2017-02-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

  14. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    PubMed

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  15. Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging

    PubMed Central

    2009-01-01

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980

  16. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    PubMed

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  17. Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haab, B.B.; Mathies, R.A.

    A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

  18. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  19. Fidelity by design: Yoctoreactor and binder trap enrichment for small-molecule DNA-encoded libraries and drug discovery.

    PubMed

    Blakskjaer, Peter; Heitner, Tara; Hansen, Nils Jakob Vest

    2015-06-01

    DNA-encoded small-molecule library (DEL) technology allows vast drug-like small molecule libraries to be efficiently synthesized in a combinatorial fashion and screened in a single tube method for binding, with an assay readout empowered by advances in next generation sequencing technology. This approach has increasingly been applied as a viable technology for the identification of small-molecule modulators to protein targets and as precursors to drugs in the past decade. Several strategies for producing and for screening DELs have been devised by both academic and industrial institutions. This review highlights some of the most significant and recent strategies along with important results. A special focus on the production of high fidelity DEL technologies with the ability to eliminate screening noise and false positives is included: using a DNA junction called the Yoctoreactor, building blocks (BBs) are spatially confined at the center of the junction facilitating both the chemical reaction between BBs and encoding of the synthetic route. A screening method, known as binder trap enrichment, permits DELs to be screened robustly in a homogeneous manner delivering clean data sets and potent hits for even the most challenging targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

    PubMed

    Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

    2017-01-01

    Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Studying DNA Looping by Single-Molecule FRET

    PubMed Central

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

  2. Studying DNA looping by single-molecule FRET.

    PubMed

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  3. Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

    NASA Astrophysics Data System (ADS)

    Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

    2017-05-01

    We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

  4. Molecular targets for small-molecule modulators of circadian clocks

    PubMed Central

    He, Baokun; Chen, Zheng

    2016-01-01

    Background Circadian clocks are endogenous timing systems that regulate various aspects of mammalian metabolism, physiology and behavior. Traditional chronotherapy refers to the administration of drugs in a defined circadian time window to achieve optimal pharmacokinetic and therapeutic efficacies. In recent years, substantial efforts have been dedicated to developing novel small-molecule modulators of circadian clocks. Methods Here, we review the recent progress in the identification of molecular targets of small-molecule clock modulators and their efficacies in clock-related disorders. Specifically, we examine the clock components and regulatory factors as possible molecular targets of small molecules, and we review several key clock-related disorders as promising venues for testing the preventive/therapeutic efficacies of these small molecules. Finally, we also discuss circadian regulation of drug metabolism. Results Small molecules can modulate the period, phase and/or amplitude of the circadian cycle. Core clock proteins, nuclear hormone receptors, and clock-related kinases and other epigenetic regulators are promising molecular targets for small molecules. Through these targets small molecules exert protective effects against clock-related disorders including the metabolic syndrome, immune disorders, sleep disorders and cancer. Small molecules can also modulate circadian drug metabolism and response to existing therapeutics. Conclusion Small-molecule clock modulators target clock components or diverse cellular pathways that functionally impinge upon the clock. Target identification of new small-molecule modulators will deepen our understanding of key regulatory nodes in the circadian network. Studies of clock modulators will facilitate their therapeutic applications, alone or in combination, for clock-related diseases. PMID:26750111

  5. Current-voltage characteristics of double stranded versus single stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

    2004-03-01

    Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

  6. DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

    NASA Astrophysics Data System (ADS)

    Golubovic, Leonardo

    2005-03-01

    We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

  7. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    PubMed

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation

    PubMed Central

    Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

    2017-01-01

    The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024

  9. Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.

    PubMed

    Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin

    2017-05-23

    The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.

  10. Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

    PubMed

    Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

    2012-03-21

    DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

  11. Polymer physics experiments with single DNA molecules

    NASA Astrophysics Data System (ADS)

    Smith, Douglas E.

    1999-11-01

    Bacteriophage DNA molecules were taken as a model flexible polymer chain for the experimental study of polymer dynamics at the single molecule level. Video fluorescence microscopy was used to directly observe the conformational dynamics of fluorescently labeled molecules, optical tweezers were used to manipulate individual molecules, and micro-fabricated flow cells were used to apply controlled hydrodynamic strain to molecules. These techniques constitute a powerful new experimental approach in the study of basic polymer physics questions. I have used these techniques to study the diffusion and relaxation of isolated and entangled polymer molecules and the hydrodynamic deformation of polymers in elongational and shear flows. These studies revealed a rich, and previously unobserved, ``molecular individualism'' in the dynamical behavior of single molecules. Individual measurements on ensembles of identical molecules allowed the average conformation to be determined as well as the underlying probability distributions for molecular conformation. Scaling laws, that predict the dependence of properties on chain length and concentration, were also tested. The basic assumptions of the reptation model were directly confirmed by visualizing the dynamics of entangled chains.

  12. An evolution based biosensor receptor DNA sequence generation algorithm.

    PubMed

    Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

    2010-01-01

    A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

  13. DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

    PubMed

    Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

    2013-02-18

    A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

  14. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, Huamin; Smith, Lloyd M.

    1997-01-01

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

  15. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  16. A 3D-DNA Molecule Made of PlayMais

    ERIC Educational Resources Information Center

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  17. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  18. DNA topoisomerase I and DNA gyrase as targets for TB therapy.

    PubMed

    Nagaraja, Valakunja; Godbole, Adwait A; Henderson, Sara R; Maxwell, Anthony

    2017-03-01

    Tuberculosis (TB) is the deadliest bacterial disease in the world. New therapeutic agents are urgently needed to replace existing drugs for which resistance is a significant problem. DNA topoisomerases are well-validated targets for antimicrobial and anticancer chemotherapies. Although bacterial topoisomerase I has yet to be exploited as a target for clinical antibiotics, DNA gyrase has been extensively targeted, including the highly clinically successful fluoroquinolones, which have been utilized in TB therapy. Here, we review the exploitation of topoisomerases as antibacterial targets and summarize progress in developing new agents to target DNA topoisomerase I and DNA gyrase from Mycobacterium tuberculosis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  19. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  20. Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

    PubMed

    Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

    2006-10-15

    The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

  1. Imaging and sizing of single DNA molecules on a mobile phone.

    PubMed

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2014-12-23

    DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

  2. Programmable and multiparameter DNA-based logic platform for cancer recognition and targeted therapy.

    PubMed

    You, Mingxu; Zhu, Guizhi; Chen, Tao; Donovan, Michael J; Tan, Weihong

    2015-01-21

    The specific inventory of molecules on diseased cell surfaces (e.g., cancer cells) provides clinicians an opportunity for accurate diagnosis and intervention. With the discovery of panels of cancer markers, carrying out analyses of multiple cell-surface markers is conceivable. As a trial to accomplish this, we have recently designed a DNA-based device that is capable of performing autonomous logic-based analysis of two or three cancer cell-surface markers. Combining the specific target-recognition properties of DNA aptamers with toehold-mediated strand displacement reactions, multicellular marker-based cancer analysis can be realized based on modular AND, OR, and NOT Boolean logic gates. Specifically, we report here a general approach for assembling these modular logic gates to execute programmable and higher-order profiling of multiple coexisting cell-surface markers, including several found on cancer cells, with the capacity to report a diagnostic signal and/or deliver targeted photodynamic therapy. The success of this strategy demonstrates the potential of DNA nanotechnology in facilitating targeted disease diagnosis and effective therapy.

  3. Programmable and Multiparameter DNA-Based Logic Platform For Cancer Recognition and Targeted Therapy

    PubMed Central

    2014-01-01

    The specific inventory of molecules on diseased cell surfaces (e.g., cancer cells) provides clinicians an opportunity for accurate diagnosis and intervention. With the discovery of panels of cancer markers, carrying out analyses of multiple cell-surface markers is conceivable. As a trial to accomplish this, we have recently designed a DNA-based device that is capable of performing autonomous logic-based analysis of two or three cancer cell-surface markers. Combining the specific target-recognition properties of DNA aptamers with toehold-mediated strand displacement reactions, multicellular marker-based cancer analysis can be realized based on modular AND, OR, and NOT Boolean logic gates. Specifically, we report here a general approach for assembling these modular logic gates to execute programmable and higher-order profiling of multiple coexisting cell-surface markers, including several found on cancer cells, with the capacity to report a diagnostic signal and/or deliver targeted photodynamic therapy. The success of this strategy demonstrates the potential of DNA nanotechnology in facilitating targeted disease diagnosis and effective therapy. PMID:25361164

  4. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    PubMed

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  5. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    NASA Astrophysics Data System (ADS)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  6. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    PubMed Central

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-01-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

  7. The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

    PubMed Central

    Eoff, Robert L.; Raney, Kevin D.

    2010-01-01

    Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

  8. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    PubMed Central

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  9. The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.

    PubMed

    Geel, T M; Ruiters, M H J; Cool, R H; Halby, L; Voshart, D C; Andrade Ruiz, L; Niezen-Koning, K E; Arimondo, P B; Rots, M G

    2018-06-05

    The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).

  10. Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.

    PubMed

    Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R

    2018-07-01

    DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50  = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.

  11. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  12. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    PubMed

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  13. Target molecules detection by waveguiding in a photonic silicon membrane

    DOEpatents

    Letant, Sonia E [Livermore, CA; Van Buuren, Anthony [Livermore, CA; Terminello, Louis [Danville, CA; Hart, Bradley R [Brentwood, CA

    2006-12-26

    Disclosed herein is a porous silicon filter capable of binding and detecting biological and chemical target molecules in liquid or gas samples. A photonic waveguiding silicon filter with chemical and/or biological anchors covalently attached to the pore walls bind target molecules. The system uses transmission curve engineering principles to allow measurements to be made in situ and in real time to detect the presence of various target molecules and calculate the concentration of bound target.

  14. Target molecules detection by waveguiding in a photonic silicon membrane

    DOEpatents

    Letant, Sonia; Van Buuren, Anthony; Terminello, Louis

    2004-08-31

    Disclosed herein is a photonic silicon filter capable of binding and detecting biological and chemical target molecules in liquid or gas samples. A photonic waveguiding silicon filter with chemical and/or biological anchors covalently attached to the pore walls selectively bind target molecules. The system uses transmission curve engineering principles to allow measurements to be made in situ and in real time to detect the presence of various target molecules and determine the concentration of bound target.

  15. Identification of Direct Protein Targets of Small Molecules

    PubMed Central

    2010-01-01

    Small-molecule target identification is a vital and daunting task for the chemical biology community as well as for researchers interested in applying the power of chemical genetics to impact biology and medicine. To overcome this “target ID” bottleneck, new technologies are being developed that analyze protein–drug interactions, such as drug affinity responsive target stability (DARTS), which aims to discover the direct binding targets (and off targets) of small molecules on a proteome scale without requiring chemical modification of the compound. Here, we review the DARTS method, discuss why it works, and provide new perspectives for future development in this area. PMID:21077692

  16. Oxidant-induced DNA damage of target cells.

    PubMed Central

    Schraufstätter, I; Hyslop, P A; Jackson, J H; Cochrane, C G

    1988-01-01

    In this study we examined the leukocytic oxidant species that induce oxidant damage of DNA in whole cells. H2O2 added extracellularly in micromolar concentrations (10-100 microM) induced DNA strand breaks in various target cells. The sensitivity of a specific target cell was inversely correlated to its catalase content and the rate of removal of H2O2 by the target cell. Oxidant species produced by xanthine oxidase/purine or phorbol myristate acetate-stimulated monocytes induced DNA breakage of target cells in proportion to the amount of H2O2 generated. These DNA strand breaks were prevented by extracellular catalase, but not by superoxide dismutase. Cytotoxic doses of HOCl, added to target cells, did not induce DNA strand breakage, and myeloperoxidase added extracellularly in the presence of an H2O2-generating system, prevented the formation of DNA strand breaks in proportion to its H2O2 degrading capacity. The studies also indicated that H2O2 formed hydroxyl radical (.OH) intracellularly, which appeared to be the most likely free radical responsible for DNA damage: .OH was detected in cells exposed to H2O2; the DNA base, deoxyguanosine, was hydroxylated in cells exposed to H2O2; and intracellular iron was essential for induction of DNA strand breaks. PMID:2843565

  17. Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

    PubMed

    Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

    2011-02-09

    Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

  18. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    PubMed

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

    PubMed

    Ozsolak, Fatih

    2016-01-01

    With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

  20. The Dynamics of Entangled DNA Networks using Single-Molecule Methods

    NASA Astrophysics Data System (ADS)

    Chapman, Cole David

    Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

  1. Nanostructure sensor of presence and concentration of a target molecule

    NASA Technical Reports Server (NTRS)

    Schipper, John F. (Inventor)

    2009-01-01

    Method and system (i) to determine when a selected target molecule is present or absent in a fluid, (2) to estimate concentration of the target molecule in the fluid and (3) estimate possible presence of a second (different) target molecule in the fluid, by analyzing differences in resonant frequencies of vibration of a thin beam suspended in the fluid, after the fluid has moved across the beam.

  2. Non-coding RNA generated following lariat-debranching mediates targeting of AID to DNA

    PubMed Central

    Zheng, Simin; Vuong, Bao Q.; Vaidyanathan, Bharat; Lin, Jia-Yu; Huang, Feng-Ting; Chaudhuri, Jayanta

    2015-01-01

    SUMMARY Transcription through immunoglobulin switch (S) regions is essential for class switch recombination (CSR) but no molecular function of the transcripts has been described. Likewise, recruitment of activation-induced cytidine deaminase (AID) to S regions is critical for CSR; however, the underlying mechanism has not been fully elucidated. Here, we demonstrate that intronic switch RNA acts in trans to target AID to S region DNA. AID binds directly to switch RNA through G-quadruplexes formed by the RNA molecules. Disruption of this interaction by mutation of a key residue in the putative RNA-binding domain of AID impairs recruitment of AID to S region DNA, thereby abolishing CSR. Additionally, inhibition of RNA lariat processing leads to loss of AID localization to S regions and compromises CSR; both defects can be rescued by exogenous expression of switch transcripts in a sequence-specific manner. These studies uncover an RNA-mediated mechanism of targeting AID to DNA. PMID:25957684

  3. DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

    PubMed Central

    Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

    2014-01-01

    Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

  4. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    NASA Astrophysics Data System (ADS)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  5. Target-induced Catalytic Assembly of Y-Shaped DNA and Its Application for In Situ Imaging of MicroRNAs.

    PubMed

    Xue, Chang; Zhang, Shu-Xin; Ouyang, Chang-He; Chang, Dingran; Salena, Bruno J; Li, Yingfu; Wu, Zai-Sheng

    2018-06-14

    DNA is a highly programmable material that can be configured into unique high-order structures, such as DNA branched junctions containing multiple helical arms converging at a center. Herein we show that DNA programmability can deliver in situ growth of a 3-way junction-based DNA structure (denoted Y-shaped DNA) with the use of three hairpin-shaped DNA molecules as precursors, a specific microRNA target as a recyclable trigger, and a DNA polymerase as a driver. We demonstrate that the Y-shaped configuration comes with the benefit of restricted freedom of movement in confined cellular environment, which makes the approach ideally suited for in situ imaging of small RNA targets, such as microRNAs. Comparative analysis illustrates that the proposed imaging technique is superior to both the classic fluorescence in situ hybridization (FISH) method and an analogous amplified imaging method via programmed growth of a double-stranded DNA (rather than Y-shaped DNA) product. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Identification of a small molecule that inhibits herpes simplex virus DNA Polymerase subunit interactions and viral replication.

    PubMed

    Pilger, Beatrice D; Cui, Can; Coen, Donald M

    2004-05-01

    The interaction between the catalytic subunit Pol and the processivity subunit UL42 of herpes simplex virus DNA polymerase has been characterized structurally and mutationally and is a potential target for novel antiviral drugs. We developed and validated an assay for small molecules that could disrupt the interaction of UL42 and a Pol-derived peptide and used it to screen approximately 16,000 compounds. Of 37 "hits" identified, four inhibited UL42-stimulated long-chain DNA synthesis by Pol in vitro, of which two exhibited little inhibition of polymerase activity by Pol alone. One of these specifically inhibited the physical interaction of Pol and UL42 and also inhibited viral replication at concentrations below those that caused cytotoxic effects. Thus, a small molecule can inhibit this protein-protein interaction, which provides a starting point for the discovery of new antiviral drugs.

  7. Small molecules targeting heterotrimeric G proteins.

    PubMed

    Ayoub, Mohammed Akli

    2018-05-05

    G protein-coupled receptors (GPCRs) represent the largest family of cell surface receptors regulating many human and animal physiological functions. Their implication in human pathophysiology is obvious with almost 30-40% medical drugs commercialized today directly targeting GPCRs as molecular entities. However, upon ligand binding GPCRs signal inside the cell through many key signaling, adaptor and regulatory proteins, including various classes of heterotrimeric G proteins. Therefore, G proteins are considered interesting targets for the development of pharmacological tools that are able to modulate their interaction with the receptors, as well as their activation/deactivation processes. In this review, old attempts and recent advances in the development of small molecules that directly target G proteins will be described with an emphasis on their utilization as pharmacological tools to dissect the mechanisms of activation of GPCR-G protein complexes. These molecules constitute a further asset for research in the "hot" areas of GPCR biology, areas such as multiple G protein coupling/signaling, GPCR-G protein preassembly, and GPCR functional selectivity or bias. Moreover, this review gives a particular focus on studies in vitro and in vivo supporting the potential applications of such small molecules in various GPCR/G protein-related diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  9. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    NASA Astrophysics Data System (ADS)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  10. Torsional stress in DNA limits collaboration among reverse gyrase molecules.

    PubMed

    Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko

    2016-04-01

    Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  11. Target-molecule-triggered rupture of aptamer-encapsulated polyelectrolyte microcapsules.

    PubMed

    Zhang, Xueru; Chabot, Denise; Sultan, Yasir; Monreal, Carlos; DeRosa, Maria C

    2013-06-26

    Polyelectrolyte microcapsules have great potential for serving as carriers for the delivery of their contents when triggered by an external stimulus. Aptamers are synthetic ssDNA or RNA that can bind to specific targets with high affinity and selectivity. Aptamers may retain these superior molecular recognition properties after encapsulation within polymer microcapsules. In this work, stable polyelectrolyte microcapsules with encapsulated aptamers were obtained by the layer-by-layer (LbL) method. Polyelectrolyte films were deposited onto a CaCO3 template that had been predoped with polystyrene sulfonate (PSS) and aptamer sequences (SA) that have an affinity for the dye sulforhodamine B (SRB). The PSS and aptamers are thought to serve as an internal scaffold supporting the microcapsule walls. These microcapsules would present target-molecule-triggered rupture properties. Microcapsule collapse was triggered by the binding of SRB to the encapsulated aptamer. The specificity of microcapsule collapse was investigated using a similar dye, tetramethylrosamine (TMR), which does not have affinity for SA. A high concentration of TMR did not lead to the collapse of the microcapsules. The effect of target binding on the microcapsules was confirmed by scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). These microcapsules may have potential applications in targeted delivery systems for the controlled release of drugs, pesticides, or other payloads.

  12. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    NASA Astrophysics Data System (ADS)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  13. Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

    PubMed

    Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

    2018-02-19

    Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  14. Opposing roles for DNA structure-specific proteins Rad1, Msh2, Msh3, and Sgs1 in yeast gene targeting.

    PubMed

    Langston, Lance D; Symington, Lorraine S

    2005-06-15

    Targeted gene replacement (TGR) in yeast and mammalian cells is initiated by the two free ends of the linear targeting molecule, which invade their respective homologous sequences in the chromosome, leading to replacement of the targeted locus with a selectable gene from the targeting DNA. To study the postinvasion steps in recombination, we examined the effects of DNA structure-specific proteins on TGR frequency and heteroduplex DNA formation. In strains deleted of RAD1, MSH2, or MSH3, we find that the frequency of TGR is reduced and the mechanism of TGR is altered while the reverse is true for deletion of SGS1, suggesting that Rad1 and Msh2:Msh3 facilitate TGR while Sgs1 opposes it. The altered mechanism of TGR in the absence of Msh2:Msh3 and Rad1 reveals a separate role for these proteins in suppressing an alternate gene replacement pathway in which incorporation of both homology regions from a single strand of targeting DNA into heteroduplex with the targeted locus creates a mismatch between the selectable gene on the targeting DNA and the targeted gene in the chromosome.

  15. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    PubMed

    Dolman, M Emmy M; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N; Molenaar, Jan J

    2015-01-01

    Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  16. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    PubMed

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Identification of Small Molecule Translesion Synthesis Inhibitors That Target the Rev1-CT/RIR Protein-Protein Interaction.

    PubMed

    Sail, Vibhavari; Rizzo, Alessandro A; Chatterjee, Nimrat; Dash, Radha C; Ozen, Zuleyha; Walker, Graham C; Korzhnev, Dmitry M; Hadden, M Kyle

    2017-07-21

    Translesion synthesis (TLS) is an important mechanism through which proliferating cells tolerate DNA damage during replication. The mutagenic Rev1/Polζ-dependent branch of TLS helps cancer cells survive first-line genotoxic chemotherapy and introduces mutations that can contribute to the acquired resistance so often observed with standard anticancer regimens. As such, inhibition of Rev1/Polζ-dependent TLS has recently emerged as a strategy to enhance the efficacy of first-line chemotherapy and reduce the acquisition of chemoresistance by decreasing tumor mutation rate. The TLS DNA polymerase Rev1 serves as an integral scaffolding protein that mediates the assembly of the active multiprotein TLS complexes. Protein-protein interactions (PPIs) between the C-terminal domain of Rev1 (Rev1-CT) and the Rev1-interacting region (RIR) of other TLS DNA polymerases play an essential role in regulating TLS activity. To probe whether disrupting the Rev1-CT/RIR PPI is a valid approach for developing a new class of targeted anticancer agents, we designed a fluorescence polarization-based assay that was utilized in a pilot screen for small molecule inhibitors of this PPI. Two small molecule scaffolds that disrupt this interaction were identified, and secondary validation assays confirmed that compound 5 binds to Rev1-CT at the RIR interface. Finally, survival and mutagenesis assays in mouse embryonic fibroblasts and human fibrosarcoma HT1080 cells treated with cisplatin and ultraviolet light indicate that these compounds inhibit mutagenic Rev1/Polζ-dependent TLS in cells, validating the Rev1-CT/RIR PPI for future anticancer drug discovery and identifying the first small molecule inhibitors of TLS that target Rev1-CT.

  18. Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

    NASA Astrophysics Data System (ADS)

    Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

    2008-06-01

    Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

  19. Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

    PubMed

    Gitman, A G; Graessmann, A; Loyter, A

    1985-11-01

    Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.

  20. Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

    PubMed Central

    Gitman, A G; Graessmann, A; Loyter, A

    1985-01-01

    Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783

  1. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    PubMed Central

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  2. Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers

    PubMed Central

    Eguchi, Asuka; Lee, Garrett O.; Wan, Fang; Erwin, Graham S.; Ansari, Aseem Z.

    2014-01-01

    Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate. PMID:25145439

  3. Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones

    PubMed Central

    2016-01-01

    Digital single-molecule technologies are expanding diagnostic capabilities, enabling the ultrasensitive quantification of targets, such as viral load in HIV and hepatitis C infections, by directly counting single molecules. Replacing fluorescent readout with a robust visual readout that can be captured by any unmodified cell phone camera will facilitate the global distribution of diagnostic tests, including in limited-resource settings where the need is greatest. This paper describes a methodology for developing a visual readout system for digital single-molecule amplification of RNA and DNA by (i) selecting colorimetric amplification-indicator dyes that are compatible with the spectral sensitivity of standard mobile phones, and (ii) identifying an optimal ratiometric image-process for a selected dye to achieve a readout that is robust to lighting conditions and camera hardware and provides unambiguous quantitative results, even for colorblind users. We also include an analysis of the limitations of this methodology, and provide a microfluidic approach that can be applied to expand dynamic range and improve reaction performance, allowing ultrasensitive, quantitative measurements at volumes as low as 5 nL. We validate this methodology using SlipChip-based digital single-molecule isothermal amplification with λDNA as a model and hepatitis C viral RNA as a clinically relevant target. The innovative combination of isothermal amplification chemistry in the presence of a judiciously chosen indicator dye and ratiometric image processing with SlipChip technology allowed the sequence-specific visual readout of single nucleic acid molecules in nanoliter volumes with an unmodified cell phone camera. When paired with devices that integrate sample preparation and nucleic acid amplification, this hardware-agnostic approach will increase the affordability and the distribution of quantitative diagnostic and environmental tests. PMID:26900709

  4. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  5. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heravi, Mitra; Department of Radiation Oncology, McGill University, Montreal; Segal Cancer Center, Jewish General Hospital, Montreal

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Westernmore » blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.« less

  6. Recent advances in developing small molecules targeting RNA.

    PubMed

    Guan, Lirui; Disney, Matthew D

    2012-01-20

    RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.

  7. Detecting single DNA molecule interactions with optical microcavities (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Vollmer, Frank

    2015-09-01

    Detecting molecules and their interactions lies at the heart of all biosensor devices, which have important applications in health, environmental monitoring and biomedicine. Achieving biosensing capability at the single molecule level is, moreover, a particularly important goal since single molecule biosensors would not only operate at the ultimate detection limit by resolving individual molecular interactions, but they could also monitor biomolecular properties which are otherwise obscured in ensemble measurements. For example, a single molecule biosensor could resolve the fleeting interaction kinetics between a molecule and its receptor, with immediate applications in clinical diagnostics. We have now developed a label-free biosensing platform that is capable of monitoring single DNA molecules and their interaction kinetics[1], hence achieving an unprecedented sensitivity in the optical domain, Figure 1. We resolve the specific contacts between complementary oligonucleotides, thereby detecting DNA strands with less than 2.4 kDa molecular weight. Furthermore we can discern strands with single nucleotide mismatches by monitoring their interaction kinetics. Our device utilizes small glass microspheres as optical transducers[1,2, 3], which are capable of increasing the number of interactions between a light beam and analyte molecules. A prism is used to couple the light beam into the microsphere. Ourr biosensing approach resolves the specific interaction kinetics between single DNA fragments. The optical transducer is assembled in a simple three-step protocol, and consists of a gold nanorod attached to a glass microsphere, where the surface of the nanorod is further modified with oligonucleotide receptors. The interaction kinetics of an oligonucleotide receptor with DNA fragments in the surrounding aqueous solution is monitored at the single molecule level[1]. The light remains confined inside the sphere where it is guided by total internal reflections along a

  8. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

    PubMed Central

    Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

    2003-01-01

    Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

  9. Cellular strategies for regulating DNA supercoiling: A single-molecule perspective

    PubMed Central

    Koster, Daniel A.; Crut, Aurélien; Shuman, Stewart; Bjornsti, Mary-Ann; Dekker, Nynke H.

    2010-01-01

    Summary Excess entangling and twisting of cellular DNA (i.e., DNA supercoiling) are problems inherent to the helical structure of double-stranded DNA. Supercoiling affects transcription, DNA replication, and chromosomal segregation. Consequently the cell must fine-tune supercoiling to optimize these key processes. Here, we summarize how supercoiling is generated and review experimental and theoretical insights into supercoil relaxation. We distinguish between the passive dissipation of supercoils by diffusion and the active removal of supercoils by topoisomerase enzymes. We also review single-molecule studies that elucidate the timescales and mechanisms of supercoil removal. PMID:20723754

  10. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

    PubMed

    Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

    2009-12-24

    Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

  11. Functional DNA-containing nanomaterials: cellular applications in biosensing, imaging, and targeted therapy.

    PubMed

    Liang, Hao; Zhang, Xiao-Bing; Lv, Yifan; Gong, Liang; Wang, Ruowen; Zhu, Xiaoyan; Yang, Ronghua; Tan, Weihong

    2014-06-17

    CONSPECTUS: DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell's nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer-micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand-receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA-nanomaterial complexes can enter cells more easily than free single

  12. Single-molecule analysis of DNA cross-links using nanopore technology

    NASA Astrophysics Data System (ADS)

    Wolna, Anna H.

    The alpha-hemolysin (alpha-HL) protein ion channel is a potential next-generation sequencing platform that has been extensively used to study nucleic acids at a single-molecule level. After applying a potential across a lipid bilayer, the imbedded alpha-HL allows monitoring of the duration and current levels of DNA translocation and immobilization. Because this method does not require DNA amplification prior to sequencing, all the DNA damage present in the cell at any given time will be present during the sequencing experiment. The goal of this research is to determine if these damage sites give distinguishable current levels beyond those observed for the canonical nucleobases. Because DNA cross-links are one of the most prevalent types of DNA damage occurring in vivo, the blockage current levels were determined for thymine-dimers, guanine(C8)-thymine(N3) cross-links and platinum adducts. All of these cross-links give a different blockage current level compared to the undamaged strands when immobilized in the ion channel, and they all can easily translocate across the alpha-HL channel. Additionally, the alpha-HL nanopore technique presents a unique opportunity to study the effects of DNA cross-links, such as thymine-dimers, on the secondary structure of DNA G-quadruplexes folded from the human telomere sequence. Using this single-molecule nanopore technique we can detect subtle structural differences that cannot be easily addressed using conventional methods. The human telomere plays crucial roles in maintaining genome stability. In the presence of suitable cations, the repetitive 5'-TTAGGG human telomere sequence can fold into G-quadruplexes that adopt the hybrid fold in vivo. The telomere sequence is hypersensitive to UV-induced thymine-dimer (T=T) formation, and yet the presence of thymine dimers does not cause telomere shortening. The potential structural disruption and thermodynamic stability of the T=T-containing natural telomere sequences were studied to

  13. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells

    PubMed Central

    Dolman, M. Emmy M.; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N.; Molenaar, Jan J.

    2015-01-01

    Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization. PMID:26716839

  14. Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.

    PubMed

    Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C

    1992-07-01

    A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.

  15. Development of a microcapillary column for detecting targeted messenger RNA molecules.

    PubMed

    Ohnishi, Michihiro

    2006-03-24

    A capillary column in a rapid-flow system has been developed for detecting targeted messenger RNA (mRNA) molecules. The column has a structure made of two beds-one bed of porous microbeads and one bed of microbeads with a polythymidine base sequence. The targeted eukaryotic mRNA molecules are detected by two-step hybridization (sandwich hybridization) composed of polyadenosine selection of mRNA molecules and formation of a probe-target (targeted mRNA) hybrid. The sandwich hybridization, which is accomplished within 1 h, was tested using synthetic polydeoxynucleotides. Ten picomoles of the targeted polydeoxynucleotide were detected.

  16. Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

    NASA Astrophysics Data System (ADS)

    Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

    We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

  17. Quantitative Detection of Small Molecule/DNA Complexes Employing a Force-Based and Label-Free DNA-Microarray

    PubMed Central

    Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.

    2009-01-01

    Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688

  18. Functional DNA-Containing Nanomaterials: Cellular Applications in Biosensing, Imaging, and Targeted Therapy

    PubMed Central

    2015-01-01

    Conspectus DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell’s nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer–micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand–receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA–nanomaterial complexes can enter cells more easily than free

  19. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  20. Target-responsive DNA-capped nanocontainer used for fabricating universal detector and performing logic operations

    PubMed Central

    Wu, Li; Ren, Jinsong; Qu, Xiaogang

    2014-01-01

    Nucleic acids have become a powerful tool in nanotechnology because of their controllable diverse conformational transitions and adaptable higher-order nanostructure. Using single-stranded DNA probes as the pore-caps for various target recognition, here we present an ultrasensitive universal electrochemical detection system based on graphene and mesoporous silica, and achieve sensitivity with all of the major classes of analytes and simultaneously realize DNA logic gate operations. The concept is based on the locking of the pores and preventing the signal-reporter molecules from escape by target-induced the conformational change of the tailored DNA caps. The coupling of ‘waking up’ gatekeeper with highly specific biochemical recognition is an innovative strategy for the detection of various targets, able to compete with classical methods which need expensive instrumentation and sophisticated experimental operations. The present study has introduced a new electrochemical signal amplification concept and also adds a new dimension to the function of graphene-mesoporous materials hybrids as multifunctional nanoscale logic devices. More importantly, the development of this approach would spur further advances in important areas, such as point-of-care diagnostics or detection of specific biological contaminations, and hold promise for use in field analysis. PMID:25249622

  1. Improving of enzyme immunoassay for detection and quantification of the target molecules using silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Syrvatka, Vasyl J.; Slyvchuk, Yurij I.; Rozgoni, Ivan I.; Gevkan, Ivan I.; Overchuk, Marta O.

    2014-02-01

    Modern routine enzyme immunoassays for detection and quantification of biomolecules have several disadvantages such as high cost, insufficient sensitivity, complexity and long-term execution. The surface plasmon resonance of silver nanoparticles gives reasons of creating new in the basis of simple, highly sensitive and low cost colorimetric assays that can be applied to the detection of small molecules, DNA, proteins and pollutants. The main aim of the study was the improving of enzyme immunoassay for detection and quantification of the target molecules using silver nanoparticles. For this purpose we developed method for synthesis of silver nanoparticles with hyaluronic acid and studied possibility of use these nanoparticles in direct determination of target molecules concentration (in particular proteins) and for improving of enzyme immunoassay. As model we used conventional enzyme immunoassays for determination of progesterone and estradiol concentration. We obtained the possibility to produce silver nanoparticles with hyaluronan homogeneous in size between 10 and 12 nm, soluble and stable in water during long term of storage using modified procedure of silver nanoparticles synthesis. New method allows to obtain silver nanoparticles with strong optical properties at the higher concentrations - 60-90 μg/ml with the peak of absorbance at the wavelength 400 nm. Therefore surface plasmon resonance of silver nanoparticles with hyaluronan and ultraviolet-visible spectroscopy provide an opportunity for rapid determination of target molecules concentration (especial protein). We used silver nanoparticles as enzyme carriers and signal enhancers. Our preliminary data show that silver nanoparticles increased absorbance of samples that allows improving upper limit of determination of estradiol and progesterone concentration.

  2. Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

    PubMed Central

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2014-01-01

    Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp–166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules. PMID:24918865

  3. Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

    NASA Astrophysics Data System (ADS)

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2014-06-01

    Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp-166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules.

  4. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    NASA Astrophysics Data System (ADS)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  5. Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

    PubMed

    Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

    2002-06-25

    A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

  6. Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

    PubMed Central

    McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

    2016-01-01

    We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

  7. Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

    PubMed

    Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

    2018-06-04

    The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Analysis of DNA interactions using single-molecule force spectroscopy.

    PubMed

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  9. Highly sensitive detection of mutations in CHO cell recombinant DNA using multi-parallel single molecule real-time DNA sequencing.

    PubMed

    Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C

    2018-06-01

    High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non

  10. An integrated optics microfluidic device for detecting single DNA molecules.

    PubMed

    Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W

    2007-12-01

    A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.

  11. Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

    PubMed

    Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

    2007-03-01

    Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

  12. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

    PubMed

    Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

    2016-04-15

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

  13. Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

    NASA Astrophysics Data System (ADS)

    Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

    1997-11-01

    We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

  14. Mapping DNA polymerase errors by single-molecule sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, David F.; Lu, Jenny; Chang, Seungwoo

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  15. Mapping DNA polymerase errors by single-molecule sequencing

    DOE PAGES

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

    2016-05-16

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  16. A novel nonenzymatic cascade amplification for ultrasensitive photoelectrochemical DNA sensing based on target driven to initiate cyclic assembly of hairpins.

    PubMed

    Wen, Guangming; Dong, Wenxia; Liu, Bin; Li, Zhongping; Fan, Lifang

    2018-05-29

    A novel cascade photoelectrochemical (PEC) signal amplification biosensing tactics was developed for DNA detection based on a target-driven DNA association to induce cyclic hairpin assembly. In the circulatory system there are two ssDNA (A and B) and two hairpins (C and D). The hybridization of these ssDNA led to the formation of an A-target-B structure. The close proximity of their toehold and branch-migration regions was able to induce the cyclic hairpin assembly. Afterwards, the assembly result further causes the separation of a double-stranded probe DNA (Q:F) to switch the PEC signal via toehold-mediated strand replacement. As such, the signal stranded DNA-CdS QDs (F) as the signal tag was released in the presence of the target DNA. The signal DNA-CdS QDs was then coated to F-doped tin oxide (FTO) electrode leading to the "signal-on" PEC signal. The designed biosensing strategy showed a low detection limit of 21.3 pM for target DNA and a broad linear range from 50 pM to 100 nM. This signal amplification PEC sensing method exhibited a potential application to detect protein molecules, RNA or metal ions via changing the sequence of A and B recognition. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

    NASA Astrophysics Data System (ADS)

    Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

    2006-09-01

    In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

  18. Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

    NASA Astrophysics Data System (ADS)

    Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

    2015-04-01

    Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

  19. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    PubMed

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  20. Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

    PubMed

    Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

    2013-04-01

    Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Single Molecule Nano-Metronome

    PubMed Central

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  2. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

    PubMed Central

    Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

    2016-01-01

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

  3. Single-Molecule Encoders for Tracking Motor Proteins on DNA

    NASA Astrophysics Data System (ADS)

    Lipman, Everett A.

    2012-02-01

    Devices such as inkjet printers and disk drives track position and velocity using optical encoders, which produce periodic signals precisely synchronized with linear or rotational motion. We have implemented this technique at the nanometer scale by labeling DNA with regularly spaced fluorescent dyes. The resulting molecular encoders can be used in several ways for high-resolution continuous tracking of individual motor proteins. These measurements do not require mechanical coupling to macroscopic instrumentation, are automatically calibrated by the underlying structure of DNA, and depend on signal periodicity rather than absolute level. I will describe the synthesis of single-molecule encoders, data from and modeling of experiments on a helicase and a DNA polymerase, and some ideas for future work.

  4. Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

    PubMed

    Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

    2006-07-01

    bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

  5. Multiplex detection of quality indicator molecule targets in urine using programmable hairpin probes based on a simple double-T type microchip electrophoresis platform and isothermal polymerase-catalyzed target recycling.

    PubMed

    Zhou, Lingying; Gan, Ning; Wu, Yongxiang; Hu, Futao; Lin, Jianyuan; Cao, Yuting; Wu, Dazhen

    2018-05-29

    Recently, it has been crucial to be able to detect and quantify small molecular targets simultaneously in biological samples. Herein, a simple and conventional double-T type microchip electrophoresis (MCE) based platform for the multiplex detection of quality indicator molecule targets in urine, using ampicillin (AMPI), adenosine triphosphate (ATP) and estradiol (E2) as models, was developed. Several programmable hairpin probes (PHPs) were designed for detecting different targets and triggering isothermal polymerase-catalyzed target recycling (IPCTR) for signal amplification. Based on the target-responsive aptamer structure of PHP (Domain I), target recognition can induce PHP conformational transition and produce extension duplex DNA (dsDNA), assisted by primers & Bst polymerase. Afterwards, the target can be displaced to react with another PHP and initiate the next cycle. After several rounds of reaction, the dsDNA can be produced in large amounts by IPCTR. Three targets can be simultaneously converted to dsDNA fragments with different lengths, which can be separated and detected using MCE. Thus, a simple double-T type MCE based platform was successfully built for the homogeneous detection of multiplex targets in one channel. Under optimal conditions, the assay exhibited high throughput (48 samples per hour at most, not including reaction time) and sensitivity to three targets in urine with a detection limit of 1 nM (ATP), 0.05 nM (AMPI) and 0.1 nM (E2) respectively. The multiplex assay was successfully employed for the above three targets in several urine samples and combined the advantages of the high specificity of programmable hairpin probes, the excellent signal amplification of IPCTR, and the high through-put of MCE which can be employed for screening in biochemical analysis.

  6. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    NASA Astrophysics Data System (ADS)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  7. Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

    PubMed Central

    Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

    2008-01-01

    Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

  8. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  9. Identification and characterization of DNAzymes targeting DNA methyltransferase I for suppressing bladder cancer proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Xiangbo; Zhang, Lu; Ding, Nianhua

    2015-05-29

    Epigenetic inactivation of genes plays a critical role in many important human diseases, especially in cancer. A core mechanism for epigenetic inactivation of the genes is methylation of CpG islands in genome DNA, which is catalyzed by DNA methyltransferases (DNMTs). The inhibition of DNMTs may lead to demethylation and expression of the silenced tumor suppressor genes. Although DNMT inhibitors are currently being developed as potential anticancer agents, only limited success is achieved due to substantial toxicity. Here, we utilized a multiplex selection system to generate efficient RNA-cleaving DNAzymes targeting DNMT1. The lead molecule from the selection was shown to possessmore » efficient kinetic profiles and high efficiency in inhibiting the enzyme activity. Transfection of the DNAzyme caused significant down-regulation of DNMT1 expression and reactivation of p16 gene, resulting in reduced cell proliferation of bladder cancers. This study provides an alternative for targeting DNMTs for potential cancer therapy. - Highlights: • Identified DNMT1-targeted DNAzymes by multiplex selection system. • Biochemically characterized a lead DNAzyme with high kinetic efficiency. • Validated DNMT1-targeted DNAzyme in its enzymatic and cellular activities.« less

  10. Liver cell-targeted delivery of therapeutic molecules.

    PubMed

    Kang, Jeong-Hun; Toita, Riki; Murata, Masaharu

    2016-01-01

    The liver is the largest internal organ in mammals and is involved in metabolism, detoxification, synthesis of proteins and lipids, secretion of cytokines and growth factors and immune/inflammatory responses. Hepatitis, alcoholic or non-alcoholic liver disease, hepatocellular carcinoma, hepatic veno-occlusive disease, and liver fibrosis and cirrhosis are the most common liver diseases. Safe and efficient delivery of therapeutic molecules (drugs, genes or proteins) into the liver is very important to increase the clinical efficacy of these molecules and to reduce their side effects in other organs. Several liver cell-targeted delivery systems have been developed and tested in vivo or ex vivo/in vitro. In this review, we discuss the literature concerning liver cell-targeted delivery systems, with a particular emphasis on the results of in vivo studies.

  11. Small mitochondria-targeting molecules as anti-cancer agents

    PubMed Central

    Wang, Feng; Ogasawara, Marcia A.; Huang, Peng

    2009-01-01

    Alterations in mitochondrial structure and functions have long been observed in cancer cells. Targeting mitochondria as a cancer therapeutic strategy has gained momentum in the recent years. The signaling pathways that govern mitochondrial function, apoptosis and molecules that affect mitochondrial integrity and cell viability have been important topics of the recent review in the literature. In this article, we first briefly summarize the rationale and biological basis for developing mitochondrial-targeted compounds as potential anticancer agents, and then provide key examples of small molecules that either directly impact mitochondria or functionally affect the metabolic alterations in cancer cells with mitochondrial dysfunction. The main focus is on the small molecular weight compounds with potential applications in cancer treatment. We also summarize information on the drug developmental stages of the key mitochondria-targeted compounds and their clinical trial status. The advantages and potential shortcomings of targeting the mitochondria for cancer treatment are also discussed. PMID:19995573

  12. Did the Pre-RNA World Rest Upon DNA Molecules?

    NASA Technical Reports Server (NTRS)

    Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.

    2004-01-01

    The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the

  13. Methods to enable the design of bioactive small molecules targeting RNA.

    PubMed

    Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L

    2014-02-21

    RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome.

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. DUBbing Cancer: Deubiquitylating Enzymes Involved in Epigenetics, DNA Damage and the Cell Cycle As Therapeutic Targets.

    PubMed

    Pinto-Fernandez, Adan; Kessler, Benedikt M

    2016-01-01

    Controlling cell proliferation is one of the hallmarks of cancer. A number of critical checkpoints ascertain progression through the different stages of the cell cycle, which can be aborted when perturbed, for instance by errors in DNA replication and repair. These molecular checkpoints are regulated by a number of proteins that need to be present at the right time and quantity. The ubiquitin system has emerged as a central player controlling the fate and function of such molecules such as cyclins, oncogenes and components of the DNA repair machinery. In particular, proteases that cleave ubiquitin chains, referred to as deubiquitylating enzymes (DUBs), have attracted recent attention due to their accessibility to modulation by small molecules. In this review, we describe recent evidence of the critical role of DUBs in aspects of cell cycle checkpoint control, associated DNA repair mechanisms and regulation of transcription, representing pathways altered in cancer. Therefore, DUBs involved in these processes emerge as potentially critical targets for the treatment of not only hematological, but potentially also solid tumors.

  16. DUBbing Cancer: Deubiquitylating Enzymes Involved in Epigenetics, DNA Damage and the Cell Cycle As Therapeutic Targets

    PubMed Central

    Pinto-Fernandez, Adan; Kessler, Benedikt M.

    2016-01-01

    Controlling cell proliferation is one of the hallmarks of cancer. A number of critical checkpoints ascertain progression through the different stages of the cell cycle, which can be aborted when perturbed, for instance by errors in DNA replication and repair. These molecular checkpoints are regulated by a number of proteins that need to be present at the right time and quantity. The ubiquitin system has emerged as a central player controlling the fate and function of such molecules such as cyclins, oncogenes and components of the DNA repair machinery. In particular, proteases that cleave ubiquitin chains, referred to as deubiquitylating enzymes (DUBs), have attracted recent attention due to their accessibility to modulation by small molecules. In this review, we describe recent evidence of the critical role of DUBs in aspects of cell cycle checkpoint control, associated DNA repair mechanisms and regulation of transcription, representing pathways altered in cancer. Therefore, DUBs involved in these processes emerge as potentially critical targets for the treatment of not only hematological, but potentially also solid tumors. PMID:27516771

  17. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    NASA Astrophysics Data System (ADS)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  18. Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

    PubMed

    Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

    2014-04-01

    Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

  19. Interaction of cationic surfactants with DNA: a single-molecule study

    PubMed Central

    Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

    2008-01-01

    The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

  20. Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

    NASA Astrophysics Data System (ADS)

    Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

    2017-04-01

    The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

  1. Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

    PubMed

    Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

    2017-12-01

    Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

  2. Single-Molecule Analysis for RISC Assembly and Target Cleavage.

    PubMed

    Sasaki, Hiroshi M; Tadakuma, Hisashi; Tomari, Yukihide

    2018-01-01

    RNA-induced silencing complex (RISC) is a small RNA-protein complex that mediates silencing of complementary target RNAs. Biochemistry has been successfully used to characterize the molecular mechanism of RISC assembly and function for nearly two decades. However, further dissection of intermediate states during the reactions has been warranted to fill in the gaps in our understanding of RNA silencing mechanisms. Single-molecule analysis with total internal reflection fluorescence (TIRF) microscopy is a powerful imaging-based approach to interrogate complex formation and dynamics at the individual molecule level with high sensitivity. Combining this technique with our recently established in vitro reconstitution system of fly Ago2-RISC, we have developed a single-molecule observation system for RISC assembly. In this chapter, we summarize the detailed protocol for single-molecule analysis of chaperone-assisted assembly of fly Ago2-RISC as well as its target cleavage reaction.

  3. Urea transporter proteins as targets for small-molecule diuretics.

    PubMed

    Esteva-Font, Cristina; Anderson, Marc O; Verkman, Alan S

    2015-02-01

    Conventional diuretics such as furosemide and thiazides target salt transporters in kidney tubules, but urea transporters (UTs) have emerged as alternative targets. UTs are a family of transmembrane channels expressed in a variety of mammalian tissues, in particular the kidney. UT knockout mice and humans with UT mutations exhibit reduced maximal urinary osmolality, demonstrating that UTs are necessary for the concentration of urine. Small-molecule screening has identified potent and selective inhibitors of UT-A, the UT protein expressed in renal tubule epithelial cells, and UT-B, the UT protein expressed in vasa recta endothelial cells. Data from UT knockout mice and from rodents administered UT inhibitors support the diuretic action of UT inhibition. The kidney-specific expression of UT-A1, together with high selectivity of the small-molecule inhibitors, means that off-target effects of such small-molecule drugs should be minimal. This Review summarizes the structure, expression and function of UTs, and looks at the evidence supporting the validity of UTs as targets for the development of salt-sparing diuretics with a unique mechanism of action. UT-targeted inhibitors may be useful alone or in combination with conventional diuretics for therapy of various oedemas and hyponatraemias, potentially including those refractory to treatment with current diuretics.

  4. Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

    PubMed

    Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

    2012-04-25

    A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

  5. Mannosylated biodegradable polyethyleneimine for targeted DNA delivery to dendritic cells

    PubMed Central

    Sun, Xun; Chen, Simu; Han, Jianfeng; Zhang, Zhirong

    2012-01-01

    Background To establish a potential gene-delivery system with the ability to deliver plasmid DNA to dendritic cells (DCs) more efficiently and specifically, we designed and synthesized a low-molecular-weight polyethyleneimine and triethyleneglycol polymer (PEI–TEG) and a series of its mannosylated derivatives. Methods PEI–TEG was synthesized from PEI2000 and PEI600 with TEG as the cross-linker. PEI–TEG was then linked to mannose via a phenylisothiocyanate bridge to obtain man-PEI–TEG conjugates. The DNA conveyance abilities of PEI–TEG, man-PEI–TEG, as well as control PEI25k were evaluated by measuring their zeta potential, particle size, and DNA-binding abilities. The in vitro cytotoxicity, cell uptake, and transfection efficiency of these PEI/DNA complexes were examined on the DC2.4 cell line. Finally, a maturation experiment evaluated the effect of costimulatory molecules CD40, CD80, and CD86 on murine bone marrow-derived DCs (BMDCs) using flow cytometry. Results PEI–TEG and man-PEI–TEG were successfully synthesized and were shown to retain the excellent properties of PEI25k for condensing DNA. Compared with PEI–TEG as well as PEI25k, the man-PEI–TEG had less cytotoxicity and performed better in both cellular uptake and transfection assays in vitro. The results of the maturation experiment showed that all the PEI/DNA complexes induced an adequate upregulation of surface markers for DC maturation. Conclusion These results demonstrated that man-PEI–TEG can be employed as a DC-targeting gene-delivery system. PMID:22745554

  6. Methods to enable the design of bioactive small molecules targeting RNA

    PubMed Central

    Disney, Matthew D.; Yildirim, Ilyas; Childs-Disney, Jessica L.

    2014-01-01

    RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including Structure-Activity Relationships Through Sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome. PMID:24357181

  7. An enhanced chemiluminescence resonance energy transfer system based on target recycling G-guadruplexes/hemin DNAzyme catalysis and its application in ultrasensitive detection of DNA.

    PubMed

    Chen, Jia; Huang, Yong; Vdovenko, Marina; Sakharov, Ivan Yu; Su, Guifa; Zhao, Shulin

    2015-06-01

    An enhanced chemiluminescence resonance energy transfer (CRET) system based on target recycling G-guadruplexes/hemin DNAzyme catalysis was developed for ultrasensitive detection of DNA. CRET system consists of luminol as chemiluminescent donor, and fluorescein isothiocyanate (FITC) as acceptor. The sensitive detection was achieved by using the system consisted of G-riched DNA, blocker DNA, and the Nb.BbvCI biocatalyst. Upon addition of target DNA to the system, target DNA hybridizes with the quasi-circular DNA structure, and forms a DNA duplex. The formation of DNA duplex triggers selective enzymatic cleavage of quasi-circular DNA by Nb.BbvCI, resulting in the release of target DNA and two G-riched DNAzyme segments. Released target DNA then hybridizes with another quasi-circular DNA structure to initiate the cleavage of the quasi-circular DNA structure. Eventually, each target DNA can go through many cycles, resulting in the digestion of many quasi-circular DNA structures, generating many G-riched DNAzyme segments. G-riched DNAzyme segment products assemble with hemin to form stable hemin/G-quadruplexes that exhibit peroxidase-like activity which can catalyze the oxidation of luminol by H2O2 to produce CL signals. In the presence of FITC, CL of luminol can excite FITC molecules, and thus produced CRET between the luminol and FITC. This unique analysis strategy gives a detection limit down to 80 fM, which is at least four orders of magnitude lower than that of unamplified DNA detection methods. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    NASA Astrophysics Data System (ADS)

    Zhang, Yuning; Reisner, Walter

    2012-02-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

  9. Mechanisms of DNA disentangling by type II topoisomerases. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Yan, Jie

    2016-09-01

    In this article [1] Dr. Vologodskii presents a comprehensive discussion on the mechanisms by which the type II topoisomerases unknot/disentangle DNA molecules. It is motivated by a mysterious capability of the nanometer-size enzymes to keep the steady-state probability of DNA entanglement/knot almost two orders of magnitude below that expected from thermal equilibrium [2-5]. In spite of obvious functional advantages of the enzymes, it raises a question regarding how such high efficiency could be achieved. The off-equilibrium steady state distribution of DNA topology is powered by ATP consumption. However, it remains unclear how this energy is utilized to bias the distribution toward disentangled/unknotted topological states of DNA.

  10. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    PubMed

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  11. Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.

    PubMed

    Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki

    2016-11-29

    DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.

  12. Single Molecule Study of DNA Organization and Recombination

    NASA Astrophysics Data System (ADS)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  13. [Exploring New Drug Targets through the Identification of Target Molecules of Bioactive Natural Products].

    PubMed

    Arai, Masayoshi

    2016-01-01

    With the development of cell biology and microbiology, it has become easy to culture many types of animal cells and microbes, and they are frequently used for phenotypic screening to explore medicinal seeds. On the other hand, it is recognized that cells and pathogenic microbes present in pathologic sites and infected regions of the human body display unique properties different from those under general culture conditions. We isolated several bioactive compounds from marine medicinal resources using constructed bioassay-guided separation focusing on the unique changes in the characteristics of cells and pathogenic microbes (Mycobacterium spp.) in the human body under disease conditions. In addition, we also carried out identification studies of target molecules of the bioactive compounds by methods utilizing the gene expression profile, transformants of cells or microbes, synthetic probe molecules of the isolated compounds, etc., since bioactive compounds isolated from the phenotypic screening system often target new molecules. This review presents our phenotypic screening systems, isolation of bioactive compounds from marine medicinal resources, and target identification of bioactive compounds.

  14. Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

    PubMed

    Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

    2013-01-01

    We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

  15. Signatures of DNA target selectivity by ETS transcription factors

    PubMed Central

    Kim, Hye Mi

    2017-01-01

    ABSTRACT The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation. PMID:28301293

  16. Signatures of DNA target selectivity by ETS transcription factors.

    PubMed

    Poon, Gregory M K; Kim, Hye Mi

    2017-05-27

    The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation.

  17. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    PubMed Central

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-01-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

  18. Therapeutic Targeting of the Mitochondria Initiates Excessive Superoxide Production and Mitochondrial Depolarization Causing Decreased mtDNA Integrity

    PubMed Central

    Pokrzywinski, Kaytee L.; Biel, Thomas G.; Kryndushkin, Dmitry; Rao, V. Ashutosh

    2016-01-01

    Mitochondrial dysregulation is closely associated with excessive reactive oxygen species (ROS) production. Altered redox homeostasis has been implicated in the onset of several diseases including cancer. Mitochondrial DNA (mtDNA) and proteins are particularly sensitive to ROS as they are in close proximity to the respiratory chain (RC). Mitoquinone (MitoQ), a mitochondria-targeted redox agent, selectively damages breast cancer cells possibly through damage induced via enhanced ROS production. However, the effects of MitoQ and other triphenylphosphonium (TPP+) conjugated agents on cancer mitochondrial homeostasis remain unknown. The primary objective of this study was to determine the impact of mitochondria-targeted agent [(MTAs) conjugated to TPP+: mitoTEMPOL, mitoquinone and mitochromanol-acetate] on mitochondrial physiology and mtDNA integrity in breast (MDA-MB-231) and lung (H23) cancer cells. The integrity of the mtDNA was assessed by quantifying the degree of mtDNA fragmentation and copy number, as well as by measuring mitochondrial proteins essential to mtDNA stability and maintenance (TFAM, SSBP1, TWINKLE, POLG and POLRMT). Mitochondrial status was evaluated by measuring superoxide production, mitochondrial membrane depolarization, oxygen consumption, extracellular acidification and mRNA or protein levels of the RC complexes along with TCA cycle activity. In this study, we demonstrated that all investigated MTAs impair mitochondrial health and decrease mtDNA integrity in MDA-MB-231 and H23 cells. However, differences in the degree of mitochondrial damage and mtDNA degradation suggest unique properties among each MTA that may be cell line, dose and time dependent. Collectively, our study indicates the potential for TPP+ conjugated molecules to impair breast and lung cancer cells by targeting mitochondrial homeostasis. PMID:28030582

  19. Therapeutic Targeting of the Mitochondria Initiates Excessive Superoxide Production and Mitochondrial Depolarization Causing Decreased mtDNA Integrity.

    PubMed

    Pokrzywinski, Kaytee L; Biel, Thomas G; Kryndushkin, Dmitry; Rao, V Ashutosh

    2016-01-01

    Mitochondrial dysregulation is closely associated with excessive reactive oxygen species (ROS) production. Altered redox homeostasis has been implicated in the onset of several diseases including cancer. Mitochondrial DNA (mtDNA) and proteins are particularly sensitive to ROS as they are in close proximity to the respiratory chain (RC). Mitoquinone (MitoQ), a mitochondria-targeted redox agent, selectively damages breast cancer cells possibly through damage induced via enhanced ROS production. However, the effects of MitoQ and other triphenylphosphonium (TPP+) conjugated agents on cancer mitochondrial homeostasis remain unknown. The primary objective of this study was to determine the impact of mitochondria-targeted agent [(MTAs) conjugated to TPP+: mitoTEMPOL, mitoquinone and mitochromanol-acetate] on mitochondrial physiology and mtDNA integrity in breast (MDA-MB-231) and lung (H23) cancer cells. The integrity of the mtDNA was assessed by quantifying the degree of mtDNA fragmentation and copy number, as well as by measuring mitochondrial proteins essential to mtDNA stability and maintenance (TFAM, SSBP1, TWINKLE, POLG and POLRMT). Mitochondrial status was evaluated by measuring superoxide production, mitochondrial membrane depolarization, oxygen consumption, extracellular acidification and mRNA or protein levels of the RC complexes along with TCA cycle activity. In this study, we demonstrated that all investigated MTAs impair mitochondrial health and decrease mtDNA integrity in MDA-MB-231 and H23 cells. However, differences in the degree of mitochondrial damage and mtDNA degradation suggest unique properties among each MTA that may be cell line, dose and time dependent. Collectively, our study indicates the potential for TPP+ conjugated molecules to impair breast and lung cancer cells by targeting mitochondrial homeostasis.

  20. Diffusion of isolated DNA molecules: dependence on length and topology.

    PubMed

    Robertson, Rae M; Laib, Stephan; Smith, Douglas E

    2006-05-09

    The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.

  1. A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes

    PubMed Central

    Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom

    2017-01-01

    This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528

  2. A new electrochemical method for the detection of cancer cells based on small molecule-linked DNA.

    PubMed

    Zhao, Jing; Zhu, Li; Guo, Chao; Gao, Tao; Zhu, Xiaoli; Li, Genxi

    2013-11-15

    Sensitive and accurate detection of cancer cells plays a crucial role in clinical diagnosis, treatment and prognosis of tumors. In this paper, we report a new electrochemical method for highly selective and sensitive detection of cancer cells by using small molecule-linked DNA as probes. The methodology is based on the fact that exonuclease I can catalyze the digestion of folate-linked DNA probes that are immobilized on an electrode surface; however, in the presence of the target cells, such as human breast cancer MCF-7 cells, the probes can be protected from digestion upon the binding with folate receptor that is over-expressed on the cell surface. Consequently, cancer cells can be efficiently detected by monitoring the status of the probe DNA with electrochemical techniques. In this study, the protection to exonuclease I-catalyzed digestion has also been proven by electrochemical studies. Moreover, the proposed method has been proven to linearly detect MCF-7 cells in a wide range from 10(2)-10(6) cell mL(-1) with a low detection limit of 67 cell mL(-1), which can also easily distinguish the folate receptor-negative normal cells, for instance, islet β cells. The reproduction of the detection is also satisfactory, since the relative standard deviations for three independent measurements of different concentration of MCF-7 cells are all within 10%. By replacing the small molecules linked on the DNA probe, other cancer cells can also be detected by making use of this proposed method. Therefore, our cytosensor may have great potential in clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  4. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  5. Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation.

    PubMed

    Hiatt, Joseph B; Pritchard, Colin C; Salipante, Stephen J; O'Roak, Brian J; Shendure, Jay

    2013-05-01

    The detection and quantification of genetic heterogeneity in populations of cells is fundamentally important to diverse fields, ranging from microbial evolution to human cancer genetics. However, despite the cost and throughput advances associated with massively parallel sequencing, it remains challenging to reliably detect mutations that are present at a low relative abundance in a given DNA sample. Here we describe smMIP, an assay that combines single molecule tagging with multiplex targeted capture to enable practical and highly sensitive detection of low-frequency or subclonal variation. To demonstrate the potential of the method, we simultaneously resequenced 33 clinically informative cancer genes in eight cell line and 45 clinical cancer samples. Single molecule tagging facilitated extremely accurate consensus calling, with an estimated per-base error rate of 8.4 × 10(-6) in cell lines and 2.6 × 10(-5) in clinical specimens. False-positive mutations in the single molecule consensus base-calls exhibited patterns predominantly consistent with DNA damage, including 8-oxo-guanine and spontaneous deamination of cytosine. Based on mixing experiments with cell line samples, sensitivity for mutations above 1% frequency was 83% with no false positives. At clinically informative sites, we identified seven low-frequency point mutations (0.2%-4.7%), including BRAF p.V600E (melanoma, 0.2% alternate allele frequency), KRAS p.G12V (lung, 0.6%), JAK2 p.V617F (melanoma, colon, two lung, 0.3%-1.4%), and NRAS p.Q61R (colon, 4.7%). We anticipate that smMIP will be broadly adoptable as a practical and effective method for accurately detecting low-frequency mutations in both research and clinical settings.

  6. Properties of targeted preamplification in DNA and cDNA quantification.

    PubMed

    Andersson, Daniel; Akrap, Nina; Svec, David; Godfrey, Tony E; Kubista, Mikael; Landberg, Göran; Ståhlberg, Anders

    2015-01-01

    Quantification of small molecule numbers often requires preamplification to generate enough copies for accurate downstream enumerations. Here, we studied experimental parameters in targeted preamplification and their effects on downstream quantitative real-time PCR (qPCR). To evaluate different strategies, we monitored the preamplification reaction in real-time using SYBR Green detection chemistry followed by melting curve analysis. Furthermore, individual targets were evaluated by qPCR. The preamplification reaction performed best when a large number of primer pairs was included in the primer pool. In addition, preamplification efficiency, reproducibility and specificity were found to depend on the number of template molecules present, primer concentration, annealing time and annealing temperature. The amount of nonspecific PCR products could also be reduced about 1000-fold using bovine serum albumin, glycerol and formamide in the preamplification. On the basis of our findings, we provide recommendations how to perform robust and highly accurate targeted preamplification in combination with qPCR or next-generation sequencing.

  7. Market uptake of biologic and small-molecule--targeted oncology drugs in Europe.

    PubMed

    Obradovic, Marko; Mrhar, Ales; Kos, Mitja

    2009-12-01

    The aim of this study was to investigate the market uptake of biologic and small-molecule-targeted oncology drugs in Europe. Targeted oncology drugs that were used in one of the selected European countries before the end of 2007 were eligible for inclusion in the analysis. The following European countries were included: Austria, Croatia, France, Germany, Hungary, Italy, Slovenia, and the United Kingdom. Monetary market uptake of targeted oncology drugs was assessed by using sales data (in euros) obtained from 2 large data- bases for the period 1997-2007. Market uptake was assessed in terms of expenditures for specific drugs in euros per capita and in market shares. The monetary market uptake of targeted oncology drugs had an exponential growth from 1997 to 2007 in all comparison countries and reached 40% of the total oncology drug market in 2007. Although the various European countries allocate substantially different amounts of resources per capita for oncology drugs, the share of expenditures attributed to targeted oncology drugs did not differ substantially among the countries. Biologic molecules were used in clinical practice before the small-molecule-targeted oncology drugs. Targeted oncology drugs that were introduced first to clinical practice in most of the comparison countries (ie, rituximab, trastuzumab, imatinib mesylate) maintained the leading positions on the market throughout the period of the analysis. In 2007, approximately 25% of all expenditures for oncology drugs were attributed to biologic oncology drugs, and approximately 15% were spent on small-molecule-targeted oncology drugs. Expenditures on targeted oncology drugs have been increasing exponentially in Europe throughout the past decade and have reached a 40% share of the oncology drug market. As of 2007, the market share of biologic oncology drugs was higher than the market share of small-molecule-targeted oncology drugs. Copyright 2009 Excerpta Medica Inc. All rights reserved.

  8. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    PubMed

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  9. Single Molecule Sensing by Nanopores and Nanopore Devices

    PubMed Central

    Gu, Li-Qun; Shim, Ji Wook

    2010-01-01

    Molecular-scale pore structures, called nanopores, can be assembled by protein ion channels through genetic engineering or be artificially fabricated on solid substrates using fashion nanotechnology. When target molecules interact with the functionalized lumen of a nanopore, they characteristically block the ion pathway. The resulting conductance changes allow for identification of single molecules and quantification of target species in the mixture. In this review, we first overview nanopore-based sensory techniques that have been created for the detection of myriad biomedical targets, from metal ions, drug compounds, and cellular second messengers to proteins and DNA. Then we introduce our recent discoveries in nanopore single molecule detection: (1) using the protein nanopore to study folding/unfolding of the G-quadruplex aptamer; (2) creating a portable and durable biochip that is integrated with a single-protein pore sensor (this chip is compared with recently developed protein pore sensors based on stabilized bilayers on glass nanopore membranes and droplet interface bilayer); and (3) creating a glass nanopore-terminated probe for single-molecule DNA detection, chiral enantiomer discrimination, and identification of the bioterrorist agent ricin with an aptamer-encoded nanopore. PMID:20174694

  10. The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

    PubMed Central

    2015-01-01

    Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

  11. DNA sequence analysis with droplet-based microfluidics

    PubMed Central

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

    2014-01-01

    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

  12. Approaches to Validate and Manipulate RNA Targets with Small Molecules in Cells.

    PubMed

    Childs-Disney, Jessica L; Disney, Matthew D

    2016-01-01

    RNA has become an increasingly important target for therapeutic interventions and for chemical probes that dissect and manipulate its cellular function. Emerging targets include human RNAs that have been shown to directly cause cancer, metabolic disorders, and genetic disease. In this review, we describe various routes to obtain bioactive compounds that target RNA, with a particular emphasis on the development of small molecules. We use these cases to describe approaches that are being developed for target validation, which include target-directed cleavage, classic pull-down experiments, and covalent cross-linking. Thus, tools are available to design small molecules to target RNA and to identify the cellular RNAs that are their targets.

  13. Mitochondrial targeting of recombinant RNAs modulates the level of a heteroplasmic mutation in human mitochondrial DNA associated with Kearns Sayre Syndrome

    PubMed Central

    Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2013-01-01

    Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375

  14. A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    T Wang; R Sha; J Birktoft

    2011-12-31

    We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.

  15. Cell signaling molecules as drug targets in lung cancer: an overview.

    PubMed

    Mukherjee, Tapan K; Paul, Karan; Mukhopadhyay, Srirupa

    2011-07-01

    Lung being one of the vital and essential organs in the body, lung cancer is a major cause of mortality in the modern human society. Lung cancer can be broadly subdivided into nonsmall cell lung cancer (NSCLC) and small cell lung cancer (SCLC). Although NSCLC is sometimes treated with surgery, the advanced and metastatic NSCLC and SCLC usually respond better to chemotherapy and radiation. The most important targets of these chemotherapeutic agents are various intracellular signaling molecules. The primary focus of this review article is to summarize the description of various cell signaling molecules involved in lung cancer development and their regulation by chemotherapeutic agents. Extensive research work in recent years has identified several cellular signaling molecules that may be intricately involved in the complexity of lung cancer. Some of these cell signaling molecules are epidermal growth factor receptors, vascular endothelial growth factor receptors, mammalian target of rapamycin, mitogen-activated protein kinase phosphatase-1, peroxisome proliferator-activated receptor-gamma, matrix metalloproteinases and receptor for advanced glycation end-products. The present review will strengthen our current knowledge regarding the efficacy of the above-mentioned cell signaling molecules as potential beneficial drug targets against lung cancer.

  16. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  17. Mechanism of Genome Interrogation: How CRISPR RNA-Guided Cas9 Proteins Locate Specific Targets on DNA.

    PubMed

    Shvets, Alexey A; Kolomeisky, Anatoly B

    2017-10-03

    The ability to precisely edit and modify a genome opens endless opportunities to investigate fundamental properties of living systems as well as to advance various medical techniques and bioengineering applications. This possibility is now close to reality due to a recent discovery of the adaptive bacterial immune system, which is based on clustered regularly interspaced short palindromic repeats (CRISPR)-associated proteins (Cas) that utilize RNA to find and cut the double-stranded DNA molecules at specific locations. Here we develop a quantitative theoretical approach to analyze the mechanism of target search on DNA by CRISPR RNA-guided Cas9 proteins, which is followed by a selective cleavage of nucleic acids. It is based on a discrete-state stochastic model that takes into account the most relevant physical-chemical processes in the system. Using a method of first-passage processes, a full dynamic description of the target search is presented. It is found that the location of specific sites on DNA by CRISPR Cas9 proteins is governed by binding first to protospacer adjacent motif sequences on DNA, which is followed by reversible transitions into DNA interrogation states. In addition, the search dynamics is strongly influenced by the off-target cutting. Our theoretical calculations allow us to explain the experimental observations and to give experimentally testable predictions. Thus, the presented theoretical model clarifies some molecular aspects of the genome interrogation by CRISPR RNA-guided Cas9 proteins. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  18. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

  19. Conjugates of classical DNA/RNA binder with nucleobase: chemical, biochemical and biomedical applications.

    PubMed

    Saftic, Dijana; Ban, Zeljka; Matic, Josipa; Tumir, Lidija-Marija; Piantanida, Ivo

    2018-05-07

    Among the most intensively studied classes of small molecules (molecular weight < 650) in biomedical research are small molecules that non-covalently bind to DNA/RNA, and another intensively studied class are nucleobase derivatives. Both classes have been intensively elaborated in many books and reviews. However, conjugates consisting of DNA/RNA binder covalently linked to nucleobase are much less studied and have not been reviewed in the last two decades. Therefore, this review summarized reports on the design of classical DNA/RNA binder - nucleobase conjugates, as well as data about their interactions with various DNA or RNA targets, and even in some cases protein targets involved. According to these data, the most important structural aspects of selective or even specific recognition between small molecule and target are proposed, and where possible related biochemical and biomedical aspects were discussed. The general conclusion is that this, rather new class of molecules showed an amazing set of recognition tools for numerous DNA or RNA targets in the last two decades, as well as few intriguing in vitro and in vivo selectivities. Several lead research lines show promising advancements toward either novel, highly selective markers or bioactive, potentially druggable molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  20. Thermodynamics of DNA target site recognition by homing endonucleases

    PubMed Central

    Eastberg, Jennifer H.; Smith, Audrey McConnell; Zhao, Lei; Ashworth, Justin; Shen, Betty W.; Stoddard, Barry L.

    2007-01-01

    The thermodynamic profiles of target site recognition have been surveyed for homing endonucleases from various structural families. Similar to DNA-binding proteins that recognize shorter target sites, homing endonucleases display a narrow range of binding free energies and affinities, mediated by structural interactions that balance the magnitude of enthalpic and entropic forces. While the balance of ΔH and TΔS are not strongly correlated with the overall extent of DNA bending, unfavorable ΔHbinding is associated with unstacking of individual base steps in the target site. The effects of deleterious basepair substitutions in the optimal target sites of two LAGLIDADG homing endonucleases, and the subsequent effect of redesigning one of those endonucleases to accommodate that DNA sequence change, were also measured. The substitution of base-specific hydrogen bonds in a wild-type endonuclease/DNA complex with hydrophobic van der Waals contacts in a redesigned complex reduced the ability to discriminate between sites, due to nonspecific ΔSbinding. PMID:17947319

  1. Targeting RNA in mammalian systems with small molecules.

    PubMed

    Donlic, Anita; Hargrove, Amanda E

    2018-05-03

    The recognition of RNA functions beyond canonical protein synthesis has challenged the central dogma of molecular biology. Indeed, RNA is now known to directly regulate many important cellular processes, including transcription, splicing, translation, and epigenetic modifications. The misregulation of these processes in disease has led to an appreciation of RNA as a therapeutic target. This potential was first recognized in bacteria and viruses, but discoveries of new RNA classes following the sequencing of the human genome have invigorated exploration of its disease-related functions in mammals. As stable structure formation is evolving as a hallmark of mammalian RNAs, the prospect of utilizing small molecules to specifically probe the function of RNA structural domains and their interactions is gaining increased recognition. To date, researchers have discovered bioactive small molecules that modulate phenotypes by binding to expanded repeats, microRNAs, G-quadruplex structures, and RNA splice sites in neurological disorders, cancers, and other diseases. The lessons learned from achieving these successes both call for additional studies and encourage exploration of the plethora of mammalian RNAs whose precise mechanisms of action remain to be elucidated. Efforts toward understanding fundamental principles of small molecule-RNA recognition combined with advances in methodology development should pave the way toward targeting emerging RNA classes such as long noncoding RNAs. Together, these endeavors can unlock the full potential of small molecule-based probing of RNA-regulated processes and enable us to discover new biology and underexplored avenues for therapeutic intervention in human disease. This article is categorized under: RNA Methods > RNA Analyses In Vitro and In Silico RNA Interactions with Proteins and Other Molecules > Small Molecule-RNA Interactions RNA in Disease and Development > RNA in Disease. © 2018 Wiley Periodicals, Inc.

  2. Synthetic lethality in DNA repair network: A novel avenue in targeted cancer therapy and combination therapeutics.

    PubMed

    Bhattacharjee, Sonali; Nandi, Saikat

    2017-12-01

    Synthetic lethality refers to a lethal phenotype that results from the simultaneous disruptions of two genes, while the disruption of either gene alone is viable. Many DNA double strand break repair (DSBR) genes have synthetic lethal relationships with oncogenes and tumor suppressor genes, which can be exploited for targeted cancer therapy, an approach referred to as combination therapy. DNA double-strand breaks (DSBs) are one of the most toxic lesions to a cell and can be repaired by non-homologous end joining (NHEJ) or homologous recombination (HR). HR and NHEJ genes are particularly attractive targets for cancer therapy because these genes have altered expression patterns in cancer cells when compared with normal cells and these genetic abnormalities can be targeted for selectively killing cancer cells. Here, we review recent advances in the development of small molecule inhibitors against HR and NHEJ genes to induce synthetic lethality and address the future directions and clinical relevance of this approach. © 2017 IUBMB Life, 69(12):929-937, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  3. DNA Looping Facilitates Targeting of a Chromatin Remodeling Enzyme

    PubMed Central

    Yadon, Adam N; Singh, Badri Nath; Hampsey, Michael; Tsukiyama, Toshio

    2013-01-01

    Summary ATP-dependent chromatin remodeling enzymes are highly abundant and play pivotal roles regulating DNA-dependent processes. The mechanisms by which they are targeted to specific loci have not been well understood on a genome-wide scale. Here we present evidence that a major targeting mechanism for the Isw2 chromatin remodeling enzyme to specific genomic loci is through sequence-specific transcription factor (TF)-dependent recruitment. Unexpectedly, Isw2 is recruited in a TF-dependent fashion to a large number of loci without TF binding sites. Using the 3C assay, we show that Isw2 can be targeted by Ume6- and TFIIB-dependent DNA looping. These results identify DNA looping as a previously unknown mechanism for the recruitment of a chromatin remodeling enzyme and defines a novel function for DNA looping. We also present evidence suggesting that Ume6-dependent DNA looping is involved in chromatin remodeling and transcriptional repression, revealing a mechanism by which the three-dimensional folding of chromatin affects DNA-dependent processes. PMID:23478442

  4. Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths

    PubMed Central

    Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

    2016-01-01

    As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011

  5. Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths.

    PubMed

    Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G

    2016-06-24

    As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.

  6. Conformational transitions in DNA polymerase I revealed by single-molecule FRET

    PubMed Central

    Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

    2010-01-01

    The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740

  7. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  8. RAD51 Is a Selective DNA Repair Target to Radiosensitize Glioma Stem Cells.

    PubMed

    King, Harry O; Brend, Tim; Payne, Helen L; Wright, Alexander; Ward, Thomas A; Patel, Karan; Egnuni, Teklu; Stead, Lucy F; Patel, Anjana; Wurdak, Heiko; Short, Susan C

    2017-01-10

    Patients with glioblastoma die from local relapse despite surgery and high-dose radiotherapy. Resistance to radiotherapy is thought to be due to efficient DNA double-strand break (DSB) repair in stem-like cells able to survive DNA damage and repopulate the tumor. We used clinical samples and patient-derived glioblastoma stem cells (GSCs) to confirm that the DSB repair protein RAD51 is highly expressed in GSCs, which are reliant on RAD51-dependent DSB repair after radiation. RAD51 expression and RAD51 foci numbers fall when these cells move toward astrocytic differentiation. In GSCs, the small-molecule RAD51 inhibitors RI-1 and B02 prevent RAD51 focus formation, reduce DNA DSB repair, and cause significant radiosensitization. We further demonstrate that treatment with these agents combined with radiation promotes loss of stem cells defined by SOX2 expression. This indicates that RAD51-dependent repair represents an effective and specific target in GSCs. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Dual targeting DNA gyrase B (GyrB) and topoisomerse IV (ParE) inhibitors: A review.

    PubMed

    Azam, Mohammed Afzal; Thathan, Janarthanan; Jubie, Selvaraj

    2015-10-01

    GyrB and ParE are type IIA topoisomerases and found in most bacteria. Its function is vital for DNA replication, repair and decatenation. The highly conserved ATP-binding subunits of DNA GyrB and ParE are structurally related and have been recognized as prime candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, no natural product or small molecule inhibitors targeting ATPase catalytic domain of both GyrB and ParE enzymes have succeeded in the clinic. Moreover, no inhibitors of these enzymes with broad-spectrum antibacterial activity against Gram-negative pathogens have been reported. Availability of high resolution crystal structures of GyrB and ParE made it possible for the design of many different classes of inhibitors with dual mechanism of action. Among them benzimidazoles, benzothiazoles, thiazolopyridines, imidiazopyridazoles, pyridines, indazoles, pyrazoles, imidazopyridines, triazolopyridines, pyrrolopyrimidines, pyrimidoindoles as well as related structures are disclosed in literatures. Unfortunately most of these inhibitors are found to be active against Gram-positive pathogens. In the present review we discuss about studies on novel dual targeting ATPase inhibitors. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Arabidopsis thaliana DNA gyrase is targeted to chloroplasts and mitochondria.

    PubMed

    Wall, Melisa K; Mitchenall, Lesley A; Maxwell, Anthony

    2004-05-18

    DNA gyrase is the bacterial DNA topoisomerase (topo) that supercoils DNA by using the free energy of ATP hydrolysis. The enzyme, an A(2)B(2) tetramer encoded by the gyrA and gyrB genes, catalyses topological changes in DNA during replication and transcription, and is the only topo that is able to introduce negative supercoils. Gyrase is essential in bacteria and apparently absent from eukaryotes and is, consequently, an important target for antibacterial agents (e.g., quinolones and coumarins). We have identified four putative gyrase genes in the model plant Arabidopsis thaliana; one gyrA and three gyrB homologues. DNA gyrase protein A (GyrA) has a dual translational initiation site targeting the mature protein to both chloroplasts and mitochondria, and there are individual targeting sequences for two of the DNA gyrase protein B (GyrB) homologues. N-terminal fusions of the organellar targeting sequences to GFPs support the hypothesis that one enzyme is targeted to the chloroplast and another to the mitochondrion, which correlates with supercoiling activity in isolated organelles. Treatment of seedlings and cultured cells with gyrase-specific drugs leads to growth inhibition. Knockout of A. thaliana gyrA is embryo-lethal whereas knockouts in the gyrB genes lead to seedling-lethal phenotypes or severely stunted growth and development. The A. thaliana genes have been cloned in Escherichia coli and found to complement gyrase temperature-sensitive strains. This report confirms the existence of DNA gyrase in eukaryotes and has important implications for drug targeting, organelle replication, and the evolution of topos in plants.

  11. Molecules that target nucleophosmin for cancer treatment: an update

    PubMed Central

    Di Matteo, Adele; Franceschini, Mimma; Chiarella, Sara; Rocchio, Serena; Travaglini-Allocatelli, Carlo; Federici, Luca

    2016-01-01

    Nucleophosmin is a highly and ubiquitously expressed protein, mainly localized in nucleoli but able to shuttle between nucleus and cytoplasm. Nucleophosmin plays crucial roles in ribosome maturation and export, centrosome duplication, cell cycle progression, histone assembly and response to a variety of stress stimuli. Much interest in this protein has arisen in the past ten years, since the discovery of heterozygous mutations in the terminal exon of the NPM1 gene, which are the most frequent genetic alteration in acute myeloid leukemia. Nucleophosmin is also frequently overexpressed in solid tumours and, in many cases, its overexpression correlates with mitotic index and metastatization. Therefore it is considered as a promising target for the treatment of both haematologic and solid malignancies. NPM1 targeting molecules may suppress different functions of the protein, interfere with its subcellular localization, with its oligomerization properties or drive its degradation. In the recent years, several such molecules have been described and here we review what is currently known about them, their interaction with nucleophosmin and the mechanistic basis of their toxicity. Collectively, these molecules exemplify a number of different strategies that can be adopted to target nucleophosmin and we summarize them at the end of the review. PMID:27058426

  12. Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation

    PubMed Central

    Hiatt, Joseph B.; Pritchard, Colin C.; Salipante, Stephen J.; O'Roak, Brian J.; Shendure, Jay

    2013-01-01

    The detection and quantification of genetic heterogeneity in populations of cells is fundamentally important to diverse fields, ranging from microbial evolution to human cancer genetics. However, despite the cost and throughput advances associated with massively parallel sequencing, it remains challenging to reliably detect mutations that are present at a low relative abundance in a given DNA sample. Here we describe smMIP, an assay that combines single molecule tagging with multiplex targeted capture to enable practical and highly sensitive detection of low-frequency or subclonal variation. To demonstrate the potential of the method, we simultaneously resequenced 33 clinically informative cancer genes in eight cell line and 45 clinical cancer samples. Single molecule tagging facilitated extremely accurate consensus calling, with an estimated per-base error rate of 8.4 × 10−6 in cell lines and 2.6 × 10−5 in clinical specimens. False-positive mutations in the single molecule consensus base-calls exhibited patterns predominantly consistent with DNA damage, including 8-oxo-guanine and spontaneous deamination of cytosine. Based on mixing experiments with cell line samples, sensitivity for mutations above 1% frequency was 83% with no false positives. At clinically informative sites, we identified seven low-frequency point mutations (0.2%–4.7%), including BRAF p.V600E (melanoma, 0.2% alternate allele frequency), KRAS p.G12V (lung, 0.6%), JAK2 p.V617F (melanoma, colon, two lung, 0.3%–1.4%), and NRAS p.Q61R (colon, 4.7%). We anticipate that smMIP will be broadly adoptable as a practical and effective method for accurately detecting low-frequency mutations in both research and clinical settings. PMID:23382536

  13. Mass Spectrometry Based Ultrasensitive DNA Methylation Profiling Using Target Fragmentation Assay.

    PubMed

    Lin, Xiang-Cheng; Zhang, Ting; Liu, Lan; Tang, Hao; Yu, Ru-Qin; Jiang, Jian-Hui

    2016-01-19

    Efficient tools for profiling DNA methylation in specific genes are essential for epigenetics and clinical diagnostics. Current DNA methylation profiling techniques have been limited by inconvenient implementation, requirements of specific reagents, and inferior accuracy in quantifying methylation degree. We develop a novel mass spectrometry method, target fragmentation assay (TFA), which enable to profile methylation in specific sequences. This method combines selective capture of DNA target from restricted cleavage of genomic DNA using magnetic separation with MS detection of the nonenzymatic hydrolysates of target DNA. This method is shown to be highly sensitive with a detection limit as low as 0.056 amol, allowing direct profiling of methylation using genome DNA without preamplification. Moreover, this method offers a unique advantage in accurately determining DNA methylation level. The clinical applicability was demonstrated by DNA methylation analysis using prostate tissue samples, implying the potential of this method as a useful tool for DNA methylation profiling in early detection of related diseases.

  14. DNA vaccines targeting the encoded antigens to dendritic cells induce potent antitumor immunity in mice.

    PubMed

    Cao, Jun; Jin, Yiqi; Li, Wei; Zhang, Bin; He, Yang; Liu, Hongqiang; Xia, Ning; Wei, Huafeng; Yan, Jian

    2013-08-14

    Although DNA vaccine holds a great potential for cancer immunotherapy, effective long-lasting antitumoral immunity sufficient to induce durable responses in cancer patients remains to be achieved. Considering the pivotal role of dendritic cells (DC) in the antigen processing and presentation, we prepared DC-targeting DNA vaccines by fusing tumor-associated antigen HER2/neu ectodomain to single chain antibody fragment (scFv) from NLDC-145 antibody specific for DC-restricted surface molecule DEC-205 (scFvNLDC-145), and explored its antitumoral efficacy and underlying mechanisms in mouse breast cancer models. In vivo targeting assay demonstrated that scFvNLDC-145 specifically delivered DNA vaccine-encoded antigen to DC. Compared with untargeted HER2/neu DNA vaccines, vaccination with scFvNLDC-145-HER2/neu markedly promoted the HER2/neu-specific cellular and humoral immune responses with long-lasting immune memory, resulting in effective protection against challenge of HER2/neu-positive D2F2/E2 breast tumor while ineffective in parental HER2/neu-negative D2F2 breast tumor. More importantly, in combination with temporary depletion of regulatory T cells (Treg) by low-dose cyclophosphamide, vaccination with scFvNLDC-145-HER2/neu induced the regression of established D2F2/E2 breast tumor and significantly retarded the development of spontaneous mammary carcinomas in transgenic BALB-neuT mice. Our findings demonstrate that DC-targeted DNA vaccines for in vivo direct delivery of tumor antigens to DC could induce potent antigen-specific cellular and humoral immune responses and, if additional combination with systemic Treg depletion, was able to elicit an impressively therapeutic antitumoral activity, providing a rationale for further development of this approach for cancer treatment.

  15. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    PubMed

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  16. Organization of 'nanocrystal molecules' using DNA

    NASA Astrophysics Data System (ADS)

    Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.

    1996-08-01

    PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.

  17. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    PubMed Central

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  18. Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

    PubMed

    Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

    2016-05-01

    The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright

  19. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    PubMed

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  20. Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

    PubMed

    Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

    2018-06-05

    We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

  1. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  2. Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

    PubMed Central

    Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

    2017-01-01

    ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

  3. Site-Specific Integration of Foreign DNA into Minimal Bacterial and Human Target Sequences Mediated by a Conjugative Relaxase

    PubMed Central

    Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen

    2012-01-01

    Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089

  4. A small molecule nanodrug consisting of amphiphilic targeting ligand-chemotherapy drug conjugate for targeted cancer therapy.

    PubMed

    Mou, Quanbing; Ma, Yuan; Zhu, Xinyuan; Yan, Deyue

    2016-05-28

    Targeted drug delivery is a broadly applicable approach for cancer therapy. However, the nanocarrier-based targeted delivery system suffers from batch-to-batch variation, quality concerns and carrier-related toxicity issues. Thus, to develop a carrier-free targeted delivery system with nanoscale characteristics is very attractive. Here, a novel targeting small molecule nanodrug self-delivery system consisting of targeting ligand and chemotherapy drug was constructed, which combined the advantages of small molecules and nano-assemblies together and showed excellent targeting ability and long blood circulation time with well-defined structure, high drug loading ratio and on-demand drug release behavior. As a proof-of-concept, lactose (Lac) and doxorubicin (DOX) were chosen as the targeting ligand and chemotherapy drug, respectively. Lac and DOX were conjugated through a pH-responsive hydrazone group. For its intrinsic amphiphilic property, Lac-DOX conjugate could self-assemble into nanoparticles in water. Both in vitro and in vivo assays indicated that Lac-DOX nanoparticles exhibited enhanced anticancer activity and weak side effects. This novel active targeting nanodrug delivery system shows great potential in cancer therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Target capture during Mos1 transposition.

    PubMed

    Pflieger, Aude; Jaillet, Jerôme; Petit, Agnès; Augé-Gouillou, Corinne; Renault, Sylvaine

    2014-01-03

    DNA transposition contributes to genomic plasticity. Target capture is a key step in the transposition process, because it contributes to the selection of new insertion sites. Nothing or little is known about how eukaryotic mariner DNA transposons trigger this step. In the case of Mos1, biochemistry and crystallography have deciphered several inverted terminal repeat-transposase complexes that are intermediates during transposition. However, the target capture complex is still unknown. Here, we show that the preintegration complex (i.e., the excised transposon) is the only complex able to capture a target DNA. Mos1 transposase does not support target commitment, which has been proposed to explain Mos1 random genomic integrations within host genomes. We demonstrate that the TA dinucleotide used as the target is crucial both to target recognition and in the chemistry of the strand transfer reaction. Bent DNA molecules are better targets for the capture when the target DNA is nicked two nucleotides apart from the TA. They improve strand transfer when the target DNA contains a mismatch near the TA dinucleotide.

  6. Target Capture during Mos1 Transposition*

    PubMed Central

    Pflieger, Aude; Jaillet, Jerôme; Petit, Agnès; Augé-Gouillou, Corinne; Renault, Sylvaine

    2014-01-01

    DNA transposition contributes to genomic plasticity. Target capture is a key step in the transposition process, because it contributes to the selection of new insertion sites. Nothing or little is known about how eukaryotic mariner DNA transposons trigger this step. In the case of Mos1, biochemistry and crystallography have deciphered several inverted terminal repeat-transposase complexes that are intermediates during transposition. However, the target capture complex is still unknown. Here, we show that the preintegration complex (i.e., the excised transposon) is the only complex able to capture a target DNA. Mos1 transposase does not support target commitment, which has been proposed to explain Mos1 random genomic integrations within host genomes. We demonstrate that the TA dinucleotide used as the target is crucial both to target recognition and in the chemistry of the strand transfer reaction. Bent DNA molecules are better targets for the capture when the target DNA is nicked two nucleotides apart from the TA. They improve strand transfer when the target DNA contains a mismatch near the TA dinucleotide. PMID:24269942

  7. DNA Molecules in Microfluidic Oscillatory Flow

    PubMed Central

    Chen, Y.-L.; Graham, M.D.; de Pablo, J.J.; Jo, K.; Schwartz, D.C.

    2008-01-01

    The conformation and dynamics of a single DNA molecule undergoing oscillatory pressure-driven flow in microfluidic channels is studied using Brownian dynamics simulations, accounting for hydrodynamic interactions between segments in the bulk and between the chain and the walls. Oscillatory flow provides a scenario under which the polymers may remain in the channel for an indefinite amount of time as they are stretched and migrate away from the channel walls. We show that by controlling the chain length, flow rate and oscillatory flow frequency, we are able to manipulate the chain extension and the chain migration from the channel walls. The chain stretch and the chain depletion layer thickness near the wall are found to increase as the Weissenberg number increases and as the oscillatory frequency decreases. PMID:19057656

  8. Simulation-based cheminformatic analysis of organelle-targeted molecules: lysosomotropic monobasic amines.

    PubMed

    Zhang, Xinyuan; Zheng, Nan; Rosania, Gus R

    2008-09-01

    Cell-based molecular transport simulations are being developed to facilitate exploratory cheminformatic analysis of virtual libraries of small drug-like molecules. For this purpose, mathematical models of single cells are built from equations capturing the transport of small molecules across membranes. In turn, physicochemical properties of small molecules can be used as input to simulate intracellular drug distribution, through time. Here, with mathematical equations and biological parameters adjusted so as to mimic a leukocyte in the blood, simulations were performed to analyze steady state, relative accumulation of small molecules in lysosomes, mitochondria, and cytosol of this target cell, in the presence of a homogenous extracellular drug concentration. Similarly, with equations and parameters set to mimic an intestinal epithelial cell, simulations were also performed to analyze steady state, relative distribution and transcellular permeability in this non-target cell, in the presence of an apical-to-basolateral concentration gradient. With a test set of ninety-nine monobasic amines gathered from the scientific literature, simulation results helped analyze relationships between the chemical diversity of these molecules and their intracellular distributions.

  9. Screening by imaging: scaling up single-DNA-molecule analysis with a novel parabolic VA-TIRF reflector and noise-reduction techniques.

    PubMed

    van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin

    2009-09-21

    Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.

  10. Repurposing the CRISPR-Cas9 system for targeted DNA methylation.

    PubMed

    Vojta, Aleksandar; Dobrinić, Paula; Tadić, Vanja; Bočkor, Luka; Korać, Petra; Julg, Boris; Klasić, Marija; Zoldoš, Vlatka

    2016-07-08

    Epigenetic studies relied so far on correlations between epigenetic marks and gene expression pattern. Technologies developed for epigenome editing now enable direct study of functional relevance of precise epigenetic modifications and gene regulation. The reversible nature of epigenetic modifications, including DNA methylation, has been already exploited in cancer therapy for remodeling the aberrant epigenetic landscape. However, this was achieved non-selectively using epigenetic inhibitors. Epigenetic editing at specific loci represents a novel approach that might selectively and heritably alter gene expression. Here, we developed a CRISPR-Cas9-based tool for specific DNA methylation consisting of deactivated Cas9 (dCas9) nuclease and catalytic domain of the DNA methyltransferase DNMT3A targeted by co-expression of a guide RNA to any 20 bp DNA sequence followed by the NGG trinucleotide. We demonstrated targeted CpG methylation in a ∼35 bp wide region by the fusion protein. We also showed that multiple guide RNAs could target the dCas9-DNMT3A construct to multiple adjacent sites, which enabled methylation of a larger part of the promoter. DNA methylation activity was specific for the targeted region and heritable across mitotic divisions. Finally, we demonstrated that directed DNA methylation of a wider promoter region of the target loci IL6ST and BACH2 decreased their expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Highly multiplexed targeted DNA sequencing from single nuclei.

    PubMed

    Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E

    2016-02-01

    Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.

  12. Target identification for small bioactive molecules: finding the needle in the haystack.

    PubMed

    Ziegler, Slava; Pries, Verena; Hedberg, Christian; Waldmann, Herbert

    2013-03-04

    Identification and confirmation of bioactive small-molecule targets is a crucial, often decisive step both in academic and pharmaceutical research. Through the development and availability of several new experimental techniques, target identification is, in principle, feasible, and the number of successful examples steadily grows. However, a generic methodology that can successfully be applied in the majority of the cases has not yet been established. Herein we summarize current methods for target identification of small molecules, primarily for a chemistry audience but also the biological community, for example, the chemist or biologist attempting to identify the target of a given bioactive compound. We describe the most frequently employed experimental approaches for target identification and provide several representative examples illustrating the state-of-the-art. Among the techniques currently available, protein affinity isolation using suitable small-molecule probes (pulldown) and subsequent mass spectrometric analysis of the isolated proteins appears to be most powerful and most frequently applied. To provide guidance for rapid entry into the field and based on our own experience we propose a typical workflow for target identification, which centers on the application of chemical proteomics as the key step to generate hypotheses for potential target proteins. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

    PubMed

    Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

    2015-11-10

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

  14. Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

    PubMed Central

    2015-01-01

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

  15. Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation.

    PubMed

    Zhang, Hui; Guo, Peixuan

    2014-05-15

    Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. A DNA Vaccine That Targets Hemagglutinin to Antigen-Presenting Cells Protects Mice against H7 Influenza

    PubMed Central

    Andersen, Tor Kristian; Zhou, Fan; Cox, Rebecca; Bogen, Bjarne

    2017-01-01

    ABSTRACT Zoonotic influenza H7 viral infections have a case fatality rate of about 40%. Currently, no or limited human to human spread has occurred, but we may be facing a severe pandemic threat if the virus acquires the ability to transmit between humans. Novel vaccines that can be rapidly produced for global distribution are urgently needed, and DNA vaccines may be the only type of vaccine that allows for the speed necessary to quench an emerging pandemic. Here, we constructed DNA vaccines encoding the hemagglutinin (HA) from influenza A/chicken/Italy/13474/99 (H7N1). In order to increase the efficacy of DNA vaccination, HA was targeted to either major histocompatibility complex class II molecules or chemokine receptors 1, 3, and 5 (CCR1/3/5) that are expressed on antigen-presenting cells (APC). A single DNA vaccination with APC-targeted HA significantly increased antibody levels in sera compared to nontargeted control vaccines. The antibodies were confirmed neutralizing in an H7 pseudotype-based neutralization assay. Furthermore, the APC-targeted vaccines increased the levels of antigen-specific cytotoxic T cells, and a single DNA vaccination could confer protection against a lethal challenge with influenza A/turkey/Italy/3889/1999 (H7N1) in mice. In conclusion, we have developed a vaccine that rapidly could contribute protection against a pandemic threat from avian influenza. IMPORTANCE Highly pathogenic avian influenza H7 constitute a pandemic threat that can cause severe illness and death in infected individuals. Vaccination is the main method of prophylaxis against influenza, but current vaccine strategies fall short in a pandemic situation due to a prolonged production time and insufficient production capabilities. In contrast, a DNA vaccine can be rapidly produced and deployed to prevent the potential escalation of a highly pathogenic influenza pandemic. We here demonstrate that a single DNA delivery of hemagglutinin from an H7 influenza could mediate full

  17. Probing the target search of DNA-binding proteins in mammalian cells using TetR as model searcher

    NASA Astrophysics Data System (ADS)

    Normanno, Davide; Boudarène, Lydia; Dugast-Darzacq, Claire; Chen, Jiji; Richter, Christian; Proux, Florence; Bénichou, Olivier; Voituriez, Raphaël; Darzacq, Xavier; Dahan, Maxime

    2015-07-01

    Many cellular functions rely on DNA-binding proteins finding and associating to specific sites in the genome. Yet the mechanisms underlying the target search remain poorly understood, especially in the case of the highly organized mammalian cell nucleus. Using as a model Tet repressors (TetRs) searching for a multi-array locus, we quantitatively analyse the search process in human cells with single-molecule tracking and single-cell protein-DNA association measurements. We find that TetRs explore the nucleus and reach their target by 3D diffusion interspersed with transient interactions with non-cognate sites, consistent with the facilitated diffusion model. Remarkably, nonspecific binding times are broadly distributed, underlining a lack of clear delimitation between specific and nonspecific interactions. However, the search kinetics is not determined by diffusive transport but by the low association rate to nonspecific sites. Altogether, our results provide a comprehensive view of the recruitment dynamics of proteins at specific loci in mammalian cells.

  18. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    PubMed

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  19. Inhibition of recombinase polymerase amplification by background DNA: a lateral flow-based method for enriching target DNA.

    PubMed

    Rohrman, Brittany; Richards-Kortum, Rebecca

    2015-02-03

    Recombinase polymerase amplification (RPA) may be used to detect a variety of pathogens, often after minimal sample preparation. However, previous work has shown that whole blood inhibits RPA. In this paper, we show that the concentrations of background DNA found in whole blood prevent the amplification of target DNA by RPA. First, using an HIV-1 RPA assay with known concentrations of nonspecific background DNA, we show that RPA tolerates more background DNA when higher HIV-1 target concentrations are present. Then, using three additional assays, we demonstrate that the maximum amount of background DNA that may be tolerated in RPA reactions depends on the DNA sequences used in the assay. We also show that changing the RPA reaction conditions, such as incubation time and primer concentration, has little effect on the ability of RPA to function when high concentrations of background DNA are present. Finally, we develop and characterize a lateral flow-based method for enriching the target DNA concentration relative to the background DNA concentration. This sample processing method enables RPA of 10(4) copies of HIV-1 DNA in a background of 0-14 μg of background DNA. Without lateral flow sample enrichment, the maximum amount of background DNA tolerated is 2 μg when 10(6) copies of HIV-1 DNA are present. This method requires no heating or other external equipment, may be integrated with upstream DNA extraction and purification processes, is compatible with the components of lysed blood, and has the potential to detect HIV-1 DNA in infant whole blood with high proviral loads.

  20. Off-Target Effects of Drugs that Disrupt Human Mitochondrial DNA Maintenance

    PubMed Central

    Young, Matthew J.

    2017-01-01

    Nucleoside reverse transcriptase inhibitors (NRTIs) were the first drugs used to treat human immunodeficiency virus (HIV) the cause of acquired immunodeficiency syndrome. Development of severe mitochondrial toxicity has been well documented in patients infected with HIV and administered NRTIs. In vitro biochemical experiments have demonstrated that the replicative mitochondrial DNA (mtDNA) polymerase gamma, Polg, is a sensitive target for inhibition by metabolically active forms of NRTIs, nucleotide reverse transcriptase inhibitors (NtRTIs). Once incorporated into newly synthesized daughter strands NtRTIs block further DNA polymerization reactions. Human cell culture and animal studies have demonstrated that cell lines and mice exposed to NRTIs display mtDNA depletion. Further complicating NRTI off-target effects on mtDNA maintenance, two additional DNA polymerases, Pol beta and PrimPol, were recently reported to localize to mitochondria as well as the nucleus. Similar to Polg, in vitro work has demonstrated both Pol beta and PrimPol incorporate NtRTIs into nascent DNA. Cell culture and biochemical experiments have also demonstrated that antiviral ribonucleoside drugs developed to treat hepatitis C infection act as off-target substrates for POLRMT, the mitochondrial RNA polymerase and primase. Accompanying the above-mentioned topics, this review examines: (1) mtDNA maintenance in human health and disease, (2) reports of DNA polymerases theta and zeta (Rev3) localizing to mitochondria, and (3) additional drugs with off-target effects on mitochondrial function. Lastly, mtDNA damage may induce cell death; therefore, the possibility of utilizing compounds that disrupt mtDNA maintenance to kill cancer cells is discussed. PMID:29214156

  1. DNA nanotechnology: On-command molecular Trojans

    NASA Astrophysics Data System (ADS)

    Niemeyer, Christof M.

    2017-12-01

    Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.

  2. Target-Catalyzed DNA Four-Way Junctions for CRET Imaging of MicroRNA, Concatenated Logic Operations, and Self-Assembly of DNA Nanohydrogels for Targeted Drug Delivery.

    PubMed

    Bi, Sai; Xiu, Bao; Ye, Jiayan; Dong, Ying

    2015-10-21

    Here we report a target-catalyzed DNA four-way junction (DNA-4WJ) on the basis of toehold-mediated DNA strand displacement reaction (TM-SDR), which is readily applied in enzyme-free amplified chemiluminescence resonance energy transfer (CRET) imaging of microRNA. In this system, the introduction of target microRNA-let-7a (miR-let-7a) activates a cascade of assembly steps with four DNA hairpins, followed by a disassembly step in which the target microRNA is displaced and released from DNA-4WJ to catalyze the self-assembly of additional branched junctions. As a result, G-quadruplex subunit sequences and fluorophore fluorescein amidite (FAM) are encoded in DNA-4WJ in a close proximity, stimulating a CRET process in the presence of hemin/K(+) to form horseradish peroxidase (HRP)-mimicking DNAzyme that catalyzes the generation of luminol/H2O2 chemiluminescence (CL), which further transfers to FAM. The background signal is easily reduced using magnetic graphene oxide (MGO) to remove unreacted species through magnetic separation, which makes a great contribution to improve the detection sensitivity and achieves a detection limit as low as 6.9 fM microRNA-let-7a (miR-let-7a). In addition, four-input concatenated logic circuits with an automatic reset function have been successfully constructed relying on the architecture of the proposed DNA-4WJ. More importantly, DNA nanohydrogels are self-assembled using DNA-4WJs as building units after centrifugation, which are driven by liquid crystallization and dense packaging of building units. Moreover, the DNA nanohydrogels are readily functionalized by incorporating with aptamers, bioimaging agents, and drug loading sites, which thus are served as efficient nanocarriers for targeted drug delivery and cancer therapy with high loading capacity and excellent biocompatibility.

  3. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    PubMed

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  4. Recent Advances in Aptamers Targeting Immune System.

    PubMed

    Hu, Piao-Ping

    2017-02-01

    The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.

  5. [Combi-molecules: a global approach towards better chemoselectivity and chemosensitivity].

    PubMed

    Matheson, Stéphanie; Qiu, Qiyu; Brahimi, Fouad; Dudouit, Fabienne; Banerjee, Ranjita; Rachid, Zakaria; Jean-Claude, Bertrand J

    2004-12-01

    It is now known that tumour cells possess many signaling pathways to repair damage inflicted by alkylating agents. However, most of these cytotoxic agents only target DNA and this does not suffice to induce sustained antiproliferative activity. Furthermore, the efficacy of antitumour alkylating agents is hampered by a lack of selectivity for tumour tissues. To circumvent these problems, we recently designed a novel strategy termed combi-targeting that sought to synthesize compounds capable of not only damaging DNA, but also blocking signaling associated with aggressive proliferation. The first prototypes described herein can block signaling associated with the epidermal growth factor receptor (EGFR) and significantly damage DNA. In addition to their binary EGFR/DNA targeting properties, we demonstrated that their effects are selective for cells to which EGFR has conferred a proliferative advantage. These novel agents with mixed targeting properties are termed "combi-molecules".

  6. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    NASA Astrophysics Data System (ADS)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  7. The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

    PubMed

    Magna, Melinda; Pisetsky, David S

    2016-05-01

    function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

  8. Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

    PubMed Central

    Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

    2017-01-01

    Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

  9. Interaction of HIV-1 Gag protein components with single DNA molecules

    NASA Astrophysics Data System (ADS)

    Cruceanu, Margareta; Gorelick, Robert J.; Williams, Mark C.

    2003-03-01

    The Gag protein of the HIV-1 retrovirus is cleaved into three major proteins as part of viral maturation: nucleocapsid (NC), capsid, and matrix. NC is the first of these proteins to be cleaved, and it is cleaved in three stages into NCp15, followed by NCp9, and finally NCp7. In this study, we use optical tweezers to investigate the capability of these NC proteins to alter the helix-coil transition of single DNA molecules. We have previously shown that the capability to alter the DNA helix-coil transition is an excellent probe of the nucleic acid chaperone activity of NC proteins, in which the secondary structure of nucleic acids is rearranged to facilitate reverse transcription. By examining the capability of NCp15, NCp9, and NCp7 to alter DNA stretching, the current studies will test the role of proteolytic cleavage of Gag in regulating the nucleic acid chaperone activity of NC. Whereas binding studies suggest that NCp9 and NCp15 bind more strongly to DNA than NCp7, our DNA stretching results indicate that these proteins all have similar effects on DNA stretching.

  10. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10.

    PubMed

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S; Disney, Matthew D

    2016-06-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells.

  11. Quantitative Single-Molecule Surface-Enhanced Raman Scattering by Optothermal Tuning of DNA Origami-Assembled Plasmonic Nanoantennas.

    PubMed

    Simoncelli, Sabrina; Roller, Eva-Maria; Urban, Patrick; Schreiber, Robert; Turberfield, Andrew J; Liedl, Tim; Lohmüller, Theobald

    2016-11-22

    DNA origami is a powerful approach for assembling plasmonic nanoparticle dimers and Raman dyes with high yields and excellent positioning control. Here we show how optothermal-induced shrinking of a DNA origami template can be employed to control the gap sizes between two 40 nm gold nanoparticles in a range from 1 to 2 nm. The high field confinement achieved with this optothermal approach was demonstrated by detection of surface-enhanced Raman spectroscopy (SERS) signals from single molecules that are precisely placed within the DNA origami template that spans the nanoparticle gap. By comparing the SERS intensity with respect to the field enhancement in the plasmonic hot-spot region, we found good agreement between measurement and theory. Our straightforward approach for the fabrication of addressable plasmonic nanosensors by DNA origami demonstrates a path toward future sensing applications with single-molecule resolution.

  12. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    PubMed Central

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  13. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    PubMed

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  14. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  15. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    PubMed

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1 (Cas12a).

    PubMed

    Singh, Digvijay; Mallon, John; Poddar, Anustup; Wang, Yanbo; Tippana, Ramreddy; Yang, Olivia; Bailey, Scott; Ha, Taekjip

    2018-05-22

    CRISPR-Cas9, which imparts adaptive immunity against foreign genomic invaders in certain prokaryotes, has been repurposed for genome-engineering applications. More recently, another RNA-guided CRISPR endonuclease called Cpf1 (also known as Cas12a) was identified and is also being repurposed. Little is known about the kinetics and mechanism of Cpf1 DNA interaction and how sequence mismatches between the DNA target and guide-RNA influence this interaction. We used single-molecule fluorescence analysis and biochemical assays to characterize DNA interrogation, cleavage, and product release by three Cpf1 orthologs. Our Cpf1 data are consistent with the DNA interrogation mechanism proposed for Cas9. They both bind any DNA in search of protospacer-adjacent motif (PAM) sequences, verify the target sequence directionally from the PAM-proximal end, and rapidly reject any targets that lack a PAM or that are poorly matched with the guide-RNA. Unlike Cas9, which requires 9 bp for stable binding and ∼16 bp for cleavage, Cpf1 requires an ∼17-bp sequence match for both stable binding and cleavage. Unlike Cas9, which does not release the DNA cleavage products, Cpf1 rapidly releases the PAM-distal cleavage product, but not the PAM-proximal product. Solution pH, reducing conditions, and 5' guanine in guide-RNA differentially affected different Cpf1 orthologs. Our findings have important implications on Cpf1-based genome engineering and manipulation applications.

  17. The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

    NASA Astrophysics Data System (ADS)

    Ashhadi, M.

    2018-07-01

    We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

  18. One Novel Multiple-Target Plasmid Reference Molecule Targeting Eight Genetically Modified Canola Events for Genetically Modified Canola Detection.

    PubMed

    Li, Zhuqing; Li, Xiang; Wang, Canhua; Song, Guiwen; Pi, Liqun; Zheng, Lan; Zhang, Dabing; Yang, Litao

    2017-09-27

    Multiple-target plasmid DNA reference materials have been generated and utilized as good substitutes of matrix-based reference materials in the analysis of genetically modified organisms (GMOs). Herein, we report the construction of one multiple-target plasmid reference molecule, pCAN, which harbors eight GM canola event-specific sequences (RF1, RF2, MS1, MS8, Topas 19/2, Oxy235, RT73, and T45) and a partial sequence of the canola endogenous reference gene PEP. The applicability of this plasmid reference material in qualitative and quantitative PCR assays of the eight GM canola events was evaluated, including the analysis of specificity, limit of detection (LOD), limit of quantification (LOQ), and performance of pCAN in the analysis of various canola samples, etc. The LODs are 15 copies for RF2, MS1, and RT73 assays using pCAN as the calibrator and 10 genome copies for the other events. The LOQ in each event-specific real-time PCR assay is 20 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and PEP assays are between 91% and 97%, and the squared regression coefficients (R 2 ) are all higher than 0.99. The quantification bias values varied from 0.47% to 20.68% with relative standard deviation (RSD) from 1.06% to 24.61% in the quantification of simulated samples. Furthermore, 10 practical canola samples sampled from imported shipments in the port of Shanghai, China, were analyzed employing pCAN as the calibrator, and the results were comparable with those assays using commercial certified materials as the calibrator. Concluding from these results, we believe that this newly developed pCAN plasmid is one good candidate for being a plasmid DNA reference material in the detection and quantification of the eight GM canola events in routine analysis.

  19. Directed self-organization of single DNA molecules in a nanoslit via embedded nanopit arrays

    PubMed Central

    Reisner, Walter; Larsen, Niels B.; Flyvbjerg, Henrik; Tegenfeldt, Jonas O.; Kristensen, Anders

    2009-01-01

    We show that arrays of nanopit structures etched in a nanoslit can control the positioning and conformation of single DNA molecules in nanofluidic devices. By adjusting the spacing, organization and placement of the nanopits it is possible to immobilize DNA at predetermined regions of a device without additional chemical modification and achieve a high degree of control over local DNA conformation. DNA can be extended between two nanopits and in closely spaced arrays will self-assemble into “connect-the-dots” conformations consisting of locally pinned segments joined by fluctuating linkers. These results have broad implications for nanotechnology fields that require methods for the nanoscale positioning and manipulation of DNA. PMID:19122138

  20. DNA targeting specificity of RNA-guided Cas9 nucleases.

    PubMed

    Hsu, Patrick D; Scott, David A; Weinstein, Joshua A; Ran, F Ann; Konermann, Silvana; Agarwala, Vineeta; Li, Yinqing; Fine, Eli J; Wu, Xuebing; Shalem, Ophir; Cradick, Thomas J; Marraffini, Luciano A; Bao, Gang; Zhang, Feng

    2013-09-01

    The Streptococcus pyogenes Cas9 (SpCas9) nuclease can be efficiently targeted to genomic loci by means of single-guide RNAs (sgRNAs) to enable genome editing. Here, we characterize SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. Our study evaluates >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. We find that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. We also show that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification. To facilitate mammalian genome engineering applications, we provide a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses.

  1. RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.

    PubMed

    Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko

    2018-05-17

    RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.

  2. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    NASA Astrophysics Data System (ADS)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  3. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores.

    PubMed

    Bell, Nicholas A W; Keyser, Ulrich F

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  4. TB Mobile: a mobile app for anti-tuberculosis molecules with known targets

    PubMed Central

    2013-01-01

    Background An increasing number of researchers are focused on strategies for developing inhibitors of Mycobacterium tuberculosis (Mtb) as tuberculosis (TB) drugs. Results In order to learn from prior work we have collated information on molecules screened versus Mtb and their targets which has been made available in the Collaborative Drug Discovery (CDD) database. This dataset contains published data on target, essentiality, links to PubMed, TBDB, TBCyc (which provides a pathway-based visualization of the entire cellular biochemical network) and human homolog information. The development of mobile cheminformatics apps could lower the barrier to drug discovery and promote collaboration. Therefore we have used this set of over 700 molecules screened versus Mtb and their targets to create a free mobile app (TB Mobile) that displays molecule structures and links to the bioinformatics data. By input of a molecular structures and performing a similarity search within the app we can infer potential targets or search by targets to retrieve compounds known to be active. Conclusions TB Mobile may assist researchers as part of their workflow in identifying potential targets for hits generated from phenotypic screening and in prioritizing them for further follow-up. The app is designed to lower the barriers to accessing this information, so that all researchers with an interest in combatting this deadly disease can use it freely to the benefit of their own efforts. PMID:23497706

  5. Diffusion modulation of DNA by toehold exchange

    NASA Astrophysics Data System (ADS)

    Rodjanapanyakul, Thanapop; Takabatake, Fumi; Abe, Keita; Kawamata, Ibuki; Nomura, Shinichiro M.; Murata, Satoshi

    2018-05-01

    We propose a method to control the diffusion speed of DNA molecules with a target sequence in a polymer solution. The interaction between solute DNA and diffusion-suppressing DNA that has been anchored to a polymer matrix is modulated by the concentration of the third DNA molecule called the competitor by a mechanism called toehold exchange. Experimental results show that the sequence-specific modulation of the diffusion coefficient is successfully achieved. The diffusion coefficient can be modulated up to sixfold by changing the concentration of the competitor. The specificity of the modulation is also verified under the coexistence of a set of DNA with noninteracting base sequences. With this mechanism, we are able to control the diffusion coefficient of individual DNA species by the concentration of another DNA species. This methodology introduces a programmability to a DNA-based reaction-diffusion system.

  6. Simulation-based cheminformatic analysis of organelle-targeted molecules: lysosomotropic monobasic amines

    PubMed Central

    Zhang, Xinyuan; Zheng, Nan

    2008-01-01

    Cell-based molecular transport simulations are being developed to facilitate exploratory cheminformatic analysis of virtual libraries of small drug-like molecules. For this purpose, mathematical models of single cells are built from equations capturing the transport of small molecules across membranes. In turn, physicochemical properties of small molecules can be used as input to simulate intracellular drug distribution, through time. Here, with mathematical equations and biological parameters adjusted so as to mimic a leukocyte in the blood, simulations were performed to analyze steady state, relative accumulation of small molecules in lysosomes, mitochondria, and cytosol of this target cell, in the presence of a homogenous extracellular drug concentration. Similarly, with equations and parameters set to mimic an intestinal epithelial cell, simulations were also performed to analyze steady state, relative distribution and transcellular permeability in this non-target cell, in the presence of an apical-to-basolateral concentration gradient. With a test set of ninety-nine monobasic amines gathered from the scientific literature, simulation results helped analyze relationships between the chemical diversity of these molecules and their intracellular distributions. Electronic supplementary material The online version of this article (doi:10.1007/s10822-008-9194-7) contains supplementary material, which is available to authorized users. PMID:18338229

  7. Threading the Needle: Small-Molecule Targeting of a Xenobiotic Receptor to Ablate Escherichia coli Polysaccharide Capsule Expression Without Altering Antibiotic Resistance.

    PubMed

    Arshad, Mehreen; Goller, Carlos C; Pilla, Danielle; Schoenen, Frank J; Seed, Patrick C

    2016-04-15

    Uropathogenic Escherichia coli (UPEC), a leading cause of urinary tract and invasive infections worldwide, is rapidly acquiring multidrug resistance, hastening the need for selective new anti-infective agents. Here we demonstrate the molecular target of DU011, our previously discovered potent, nontoxic, small-molecule inhibitor of UPEC polysaccharide capsule biogenesis and virulence. Real-time polymerase chain reaction analysis and a target-overexpression drug-suppressor screen were used to localize the putative inhibitor target. A thermal shift assay quantified interactions between the target protein and the inhibitor, and a novel DNase protection assay measured chemical inhibition of protein-DNA interactions. Virulence of a regulatory target mutant was assessed in a murine sepsis model. MprA, a MarR family transcriptional repressor, was identified as the putative target of the DU011 inhibitor. Thermal shift measurements indicated the formation of a stable DU011-MprA complex, and DU011 abrogated MprA binding to its DNA promoter site. Knockout of mprA had effects similar to that of DU011 treatment of wild-type bacteria: a loss of encapsulation and complete attenuation in a murine sepsis model, without any negative change in antibiotic resistance. MprA regulates UPEC polysaccharide encapsulation, is essential for UPEC virulence, and can be targeted without inducing antibiotic resistance. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  8. DNA repair targeted therapy: the past or future of cancer treatment?

    PubMed Central

    Gavande, Navnath S.; VanderVere-Carozza, Pamela S.; Hinshaw, Hilary D.; Jalal, Shadia I.; Sears, Catherine R.; Pawelczak, Katherine S.; Turchi, John J.

    2016-01-01

    The repair of DNA damage is a complex process that relies on particular pathways to remedy specific types of damage to DNA. The range of insults to DNA includes small, modest changes in structure including mismatched bases and simple methylation events to oxidized bases, intra- and interstrand DNA crosslinks, DNA double strand breaks and protein-DNA adducts. Pathways required for the repair of these lesions include mismatch repair, base excision repair, nucleotide excision repair, and the homology directed repair/Fanconi anemia pathway. Each of these pathways contributes to genetic stability, and mutations in genes encoding proteins involved in these pathways have been demonstrated to promote genetic instability and cancer. In fact, it has been suggested all cancers display defects in DNA repair. It has also been demonstrated that the ability of cancer cells to repair therapeutically induced DNA damage impacts therapeutic efficacy. This has led to targeting DNA repair pathways and proteins to develop anti-cancer agents that will increase sensitivity to traditional chemotherapeutics. While initial studies languished and were plagued by a lack of specificity and a defined mechanism of action, more recent approaches to exploit synthetic lethal interaction and develop high affinity chemical inhibitors have proven considerably more effective. In this review we will highlight recent advances and discuss previous failures in targeting DNA repair to pave the way for future DNA repair targeted agents and their use in cancer therapy. PMID:26896565

  9. Structure-based cleavage mechanism of Thermus thermophilus Argonaute DNA guide strand-mediated DNA target cleavage

    PubMed Central

    Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli

    2014-01-01

    We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628

  10. Anticancer molecules targeting fibroblast growth factor receptors.

    PubMed

    Liang, Guang; Liu, Zhiguo; Wu, Jianzhang; Cai, Yuepiao; Li, Xiaokun

    2012-10-01

    The fibroblast growth factor receptor (FGFR) family includes four highly conserved receptor tyrosine kinases: FGFR1-4. Upon ligand binding, FGFRs activate an array of downstream signaling pathways, such as the mitogen activated protein kinase (MAPK) and the phosphoinositide-3-kinase (PI3K)/Akt pathways. These FGFR cascades play crucial roles in tumor cell proliferation, angiogenesis, migration, and survival. The combination of knockdown studies and pharmaceutical inhibition in preclinical models demonstrates that FGFRs are attractive targets for therapeutic intervention in cancer. Multiple FGFR inhibitors with various structural skeletons have been designed, synthesized, and evaluated. Reviews on FGFRs have recently focused on FGFR signaling, pathophysiology, and functions in cancer or other diseases. In this article, we review recent advances in structure-activity relationships (SAR) of FGFR inhibitors, as well as the FGFR-targeting drug design strategies currently employed in targeting deregulated FGFRs by antibodies and small molecule inhibitors. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. A structural biology perspective on bioactive small molecules and their plant targets.

    PubMed

    Kumari, Selva; van der Hoorn, Renier A L

    2011-10-01

    Structural biology efforts in recent years have generated numerous co-crystal structures of bioactive small molecules interacting with their plant targets. These studies include the targets of various phytohormones, pathogen-derived effectors, herbicides and other bioactive compounds. Here we discuss that this collection of structures contains excellent examples of nine collective observations: molecular glues, allostery, inhibitors, molecular mimicry, promiscuous binding sites, unexpected electron densities, natural selection at atomic resolution, and applications in structure-guided mutagenesis and small molecule design. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    PubMed

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  13. Importance of target-mediated drug disposition for small molecules.

    PubMed

    Smith, Dennis A; van Waterschoot, Robert A B; Parrott, Neil J; Olivares-Morales, Andrés; Lavé, Thierry; Rowland, Malcolm

    2018-06-18

    Target concentration is typically not considered in drug discovery. However, if targets are expressed at relatively high concentrations and compounds have high affinity, such that most of the drug is bound to its target, in vitro screens can give unreliable information on compound affinity. In vivo, a similar situation will generate pharmacokinetic (PK) profiles that deviate greatly from those normally expected, owing to target binding affecting drug distribution and clearance. Such target-mediated drug disposition (TMDD) effects on small molecules have received little attention and might only become apparent during clinical trials, with the potential for data misinterpretation. TMDD also confounds human microdosing approaches by providing therapeutically unrepresentative PK profiles. Being aware of these phenomena will improve the likelihood of successful drug discovery and development. Copyright © 2018. Published by Elsevier Ltd.

  14. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    PubMed

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  15. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    PubMed

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  16. Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation

    NASA Astrophysics Data System (ADS)

    Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan

    2015-08-01

    Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.

  17. "DNA Origami Traffic Lights" with a Split Aptamer Sensor for a Bicolor Fluorescence Readout.

    PubMed

    Walter, Heidi-Kristin; Bauer, Jens; Steinmeyer, Jeannine; Kuzuya, Akinori; Niemeyer, Christof M; Wagenknecht, Hans-Achim

    2017-04-12

    A split aptamer for adenosine triphosphate (ATP) was embedded as a recognition unit into two levers of a nanomechanical DNA origami construct by extension and modification of selected staple strands. An additional optical module in the stem of the split aptamer comprised two different cyanine-styryl dyes that underwent an energy transfer from green (donor) to red (acceptor) emission if two ATP molecules were bound as target molecule to the recognition module and thereby brought the dyes in close proximity. As a result, the ATP as a target triggered the DNA origami shape transition and yielded a fluorescence color change from green to red as readout. Conventional atomic force microscopy (AFM) images confirmed the topology change from the open form of the DNA origami in the absence of ATP into the closed form in the presence of the target molecule. The obtained closed/open ratios in the absence and presence of target molecules tracked well with the fluorescence color ratios and thereby validated the bicolor fluorescence readout. The correct positioning of the split aptamer as the functional unit farthest away from the fulcrum of the DNA origami was crucial for the aptasensing by fluorescence readout. The fluorescence color change allowed additionally to follow the topology change of the DNA origami aptasensor in real time in solution. The concepts of fluorescence energy transfer for bicolor readout in a split aptamer in solution, and AFM on surfaces, were successfully combined in a single DNA origami construct to obtain a bimodal readout. These results are important for future custom DNA devices for chemical-biological and bioanalytical purposes because they are not only working as simple aptamers but are also visible by AFM on the single-molecule level.

  18. Partial DNA-guided Cas9 enables genome editing with reduced off-target activity

    PubMed Central

    Yin, Hao; Song, Chun-Qing; Suresh, Sneha; Kwan, Suet-Yan; Wu, Qiongqiong; Walsh, Stephen; Ding, Junmei; Bogorad, Roman L; Zhu, Lihua Julie; Wolfe, Scot A; Koteliansky, Victor; Xue, Wen; Langer, Robert; Anderson, Daniel G

    2018-01-01

    CRISPR–Cas9 is a versatile RNA-guided genome editing tool. Here we demonstrate that partial replacement of RNA nucleotides with DNA nucleotides in CRISPR RNA (crRNA) enables efficient gene editing in human cells. This strategy of partial DNA replacement retains on-target activity when used with both crRNA and sgRNA, as well as with multiple guide sequences. Partial DNA replacement also works for crRNA of Cpf1, another CRISPR system. We find that partial DNA replacement in the guide sequence significantly reduces off-target genome editing through focused analysis of off-target cleavage, measurement of mismatch tolerance and genome-wide profiling of off-target sites. Using the structure of the Cas9–sgRNA complex as a guide, the majority of the 3′ end of crRNA can be replaced with DNA nucleotide, and the 5 - and 3′-DNA-replaced crRNA enables efficient genome editing. Cas9 guided by a DNA–RNA chimera may provide a generalized strategy to reduce both the cost and the off-target genome editing in human cells. PMID:29377001

  19. Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

    PubMed Central

    Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2016-01-01

    Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

  20. Two distinct overstretched DNA structures revealed by single-molecule thermodynamics measurements

    PubMed Central

    Zhang, Xinghua; Chen, Hu; Fu, Hongxia; Doyle, Patrick S.; Yan, Jie

    2012-01-01

    Double-stranded DNA is a dynamic molecule whose structure can change depending on conditions. While there is consensus in the literature about many structures DNA can have, the state of highly-stretched DNA is still not clear. Several groups have shown that DNA in the torsion-unconstrained B-form undergoes an “overstretching” transition at a stretching force of around 65 pN, which leads to approximately 1.7-fold elongation of the DNA contour length. Recent experiments have revealed that two distinct structural transitions are involved in the overstretching process: (i) a hysteretic “peeling” off one strand from its complementary strand, and (ii) a nonhysteretic transition that leads to an undetermined DNA structure. We report the first simultaneous determination of the entropy (ΔS) and enthalpy changes (ΔH) pertaining to these respective transitions. For the hysteretic peeling transition, we determined ΔS ∼ 20 cal/(K.mol) and ΔH ∼ 7 kcal/mol. In the case of the nonhysteretic transition, ΔS ∼ -3 cal/(K.mol) and ΔH ∼ 1 kcal/mol. Furthermore, the response of the transition force to salt concentration implies that the two DNA strands are spatially separated after the hysteretic peeling transition. In contrast, the corresponding response after the nonhysteretic transition indicated that the strands remained in close proximity. The selection between the two transitions depends on DNA base-pair stability, and it can be illustrated by a multidimensional phase diagram. Our results provide important insights into the thermodynamics of DNA overstretching and conformational structures of overstretched DNA that may play an important role in vivo. PMID:22532662

  1. Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

    NASA Astrophysics Data System (ADS)

    Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

    2016-02-01

    We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

  2. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    PubMed

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

    PubMed

    Lin, C H; Patel, D J

    1997-11-01

    Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.

  4. Development of a New DNA Vaccine for Alzheimer Disease Targeting a Wide Range of Aβ Species and Amyloidogenic Peptides

    PubMed Central

    Matsumoto, Yoh; Niimi, Naoko; Kohyama, Kuniko

    2013-01-01

    It has recently been determined that not only Aβ oligomers, but also other Aβ species and amyloidogenic peptides are neurotoxic in Alzheimer disease (AD) and play a pivotal role in AD pathogenesis. In the present study, we attempted to develop new DNA vaccines targeting a wide range of Aβ species. For this purpose, we first performed in vitro assays with newly developed vaccines to evaluate Aβ production and Aβ secretion abilities and then chose an IgL-Aβx4-Fc-IL-4 vaccine (designated YM3711) for further studies. YM3711 was vaccinated to mice, rabbits and monkeys to evaluate anti-Aβ species antibody-producing ability and Aβ reduction effects. It was found that YM3711 vaccination induced significantly higher levels of antibodies not only to Aβ1-42 but also to AD-related molecules including AβpE3-42, Aβ oligomers and Aβ fibrils. Importantly, YM3711 significantly reduced these Aβ species in the brain of model mice. Binding and competition assays using translated YM3711 protein products clearly demonstrated that a large part of antibodies induced by YM3711 vaccination are directed at conformational epitopes of the Aβ complex and oligomers. Taken together, we demonstrate that YM3711 is a powerful DNA vaccine targeting a wide range of AD-related molecules and is worth examining in preclinical and clinical trials. PMID:24086465

  5. Aptamer-integrated DNA nanostructures for biosensing, bioimaging and cancer therapy.

    PubMed

    Meng, Hong-Min; Liu, Hui; Kuai, Hailan; Peng, Ruizi; Mo, Liuting; Zhang, Xiao-Bing

    2016-05-03

    The combination of nanostructures with biomolecules leading to the generation of functional nanosystems holds great promise for biotechnological and biomedical applications. As a naturally occurring biomacromolecule, DNA exhibits excellent biocompatibility and programmability. Also, scalable synthesis can be readily realized through automated instruments. Such unique properties, together with Watson-Crick base-pairing interactions, make DNA a particularly promising candidate to be used as a building block material for a wide variety of nanostructures. In the past few decades, various DNA nanostructures have been developed, including one-, two- and three-dimensional nanomaterials. Aptamers are single-stranded DNA or RNA molecules selected by Systematic Evolution of Ligands by Exponential Enrichment (SELEX), with specific recognition abilities to their targets. Therefore, integrating aptamers into DNA nanostructures results in powerful tools for biosensing and bioimaging applications. Furthermore, owing to their high loading capability, aptamer-modified DNA nanostructures have also been altered to play the role of drug nanocarriers for in vivo applications and targeted cancer therapy. In this review, we summarize recent progress in the design of aptamers and related DNA molecule-integrated DNA nanostructures as well as their applications in biosensing, bioimaging and cancer therapy. To begin with, we first introduce the SELEX technology. Subsequently, the methodologies for the preparation of aptamer-integrated DNA nanostructures are presented. Then, we highlight their applications in biosensing and bioimaging for various targets, as well as targeted cancer therapy applications. Finally, we discuss several challenges and further opportunities in this emerging field.

  6. Targeting DDX3 with a small molecule inhibitor for lung cancer therapy

    PubMed Central

    Bol, Guus M; Vesuna, Farhad; Xie, Min; Zeng, Jing; Aziz, Khaled; Gandhi, Nishant; Levine, Anne; Irving, Ashley; Korz, Dorian; Tantravedi, Saritha; Heerma van Voss, Marise R; Gabrielson, Kathleen; Bordt, Evan A; Polster, Brian M; Cope, Leslie; van der Groep, Petra; Kondaskar, Atul; Rudek, Michelle A; Hosmane, Ramachandra S; van der Wall, Elsken; van Diest, Paul J; Tran, Phuoc T; Raman, Venu

    2015-01-01

    Lung cancer is the most common malignancy worldwide and is a focus for developing targeted therapies due to its refractory nature to current treatment. We identified a RNA helicase, DDX3, which is overexpressed in many cancer types including lung cancer and is associated with lower survival in lung cancer patients. We designed a first-in-class small molecule inhibitor, RK-33, which binds to DDX3 and abrogates its activity. Inhibition of DDX3 by RK-33 caused G1 cell cycle arrest, induced apoptosis, and promoted radiation sensitization in DDX3-overexpressing cells. Importantly, RK-33 in combination with radiation induced tumor regression in multiple mouse models of lung cancer. Mechanistically, loss of DDX3 function either by shRNA or by RK-33 impaired Wnt signaling through disruption of the DDX3–β-catenin axis and inhibited non-homologous end joining—the major DNA repair pathway in mammalian somatic cells. Overall, inhibition of DDX3 by RK-33 promotes tumor regression, thus providing a compelling argument to develop DDX3 inhibitors for lung cancer therapy. PMID:25820276

  7. Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

    PubMed

    Schneider, Uffe Vest

    2012-01-01

    This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA

  8. Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions.

    PubMed

    Brown, Maxwell W; Kim, Yoori; Williams, Gregory M; Huck, John D; Surtees, Jennifer A; Finkelstein, Ilya J

    2016-02-03

    DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2-Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2-Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2-Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2-Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2-Msh3 and Msh2-Msh6 navigate on a crowded genome and suggest how Msh2-Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin.

  9. Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.

    PubMed

    Xue, J; Feng, Y

    2018-06-01

    Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.

  10. Single molecule analysis of Trypanosoma brucei DNA replication dynamics

    PubMed Central

    Calderano, Simone Guedes; Drosopoulos, William C.; Quaresma, Marina Mônaco; Marques, Catarina A.; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L.; Elias, Maria Carolina

    2015-01-01

    Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5′ extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. PMID:25690894

  11. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    PubMed Central

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  12. Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

    PubMed Central

    Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

    2013-01-01

    DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

  13. Inforna 2.0: A Platform for the Sequence-Based Design of Small Molecules Targeting Structured RNAs.

    PubMed

    Disney, Matthew D; Winkelsas, Audrey M; Velagapudi, Sai Pradeep; Southern, Mark; Fallahi, Mohammad; Childs-Disney, Jessica L

    2016-06-17

    The development of small molecules that target RNA is challenging yet, if successful, could advance the development of chemical probes to study RNA function or precision therapeutics to treat RNA-mediated disease. Previously, we described Inforna, an approach that can mine motifs (secondary structures) within target RNAs, which is deduced from the RNA sequence, and compare them to a database of known RNA motif-small molecule binding partners. Output generated by Inforna includes the motif found in both the database and the desired RNA target, lead small molecules for that target, and other related meta-data. Lead small molecules can then be tested for binding and affecting cellular (dys)function. Herein, we describe Inforna 2.0, which incorporates all known RNA motif-small molecule binding partners reported in the scientific literature, a chemical similarity searching feature, and an improved user interface and is freely available via an online web server. By incorporation of interactions identified by other laboratories, the database has been doubled, containing 1936 RNA motif-small molecule interactions, including 244 unique small molecules and 1331 motifs. Interestingly, chemotype analysis of the compounds that bind RNA in the database reveals features in small molecule chemotypes that are privileged for binding. Further, this updated database expanded the number of cellular RNAs to which lead compounds can be identified.

  14. PEGylation enhances tumor targeting of plasmid DNA by an artificial cationized protein with repeated RGD sequences, Pronectin.

    PubMed

    Hosseinkhani, Hossein; Tabata, Yasuhiko

    2004-05-31

    The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the

  15. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    PubMed

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Target DNA bending by the Mu transpososome promotes careful transposition and prevents its reversal

    PubMed Central

    Fuller, James R; Rice, Phoebe A

    2017-01-01

    The transposition of bacteriophage Mu serves as a model system for understanding DDE transposases and integrases. All available structures of these enzymes at the end of the transposition reaction, including Mu, exhibit significant bends in the transposition target site DNA. Here we use Mu to investigate the ramifications of target DNA bending on the transposition reaction. Enhancing the flexibility of the target DNA or prebending it increases its affinity for transpososomes by over an order of magnitude and increases the overall reaction rate. This and FRET confirm that flexibility is interrogated early during the interaction between the transposase and a potential target site, which may be how other DNA binding proteins can steer selection of advantageous target sites. We also find that the conformation of the target DNA after strand transfer is involved in preventing accidental catalysis of the reverse reaction, as conditions that destabilize this conformation also trigger reversal. DOI: http://dx.doi.org/10.7554/eLife.21777.001 PMID:28177285

  17. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    PubMed

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Determinants for DNA target structure selectivity of the human LINE-1 retrotransposon endonuclease.

    PubMed

    Repanas, Kostas; Zingler, Nora; Layer, Liliana E; Schumann, Gerald G; Perrakis, Anastassis; Weichenrieder, Oliver

    2007-01-01

    The human LINE-1 endonuclease (L1-EN) is the targeting endonuclease encoded by the human LINE-1 (L1) retrotransposon. L1-EN guides the genomic integration of new L1 and Alu elements that presently account for approximately 28% of the human genome. L1-EN bears considerable technological interest, because its target selectivity may ultimately be engineered to allow the site-specific integration of DNA into defined genomic locations. Based on the crystal structure, we generated L1-EN mutants to analyze and manipulate DNA target site recognition. Crystal structures and their dynamic and functional analysis show entire loop grafts to be feasible, resulting in altered specificity, while individual point mutations do not change the nicking pattern of L1-EN. Structural parameters of the DNA target seem more important for recognition than the nucleotide sequence, and nicking profiles on DNA oligonucleotides in vitro are less well defined than the respective integration site consensus in vivo. This suggests that additional factors other than the DNA nicking specificity of L1-EN contribute to the targeted integration of non-LTR retrotransposons.

  19. Accelerated Photobleaching of a Cyanine Dye in the Presence of a Ternary Target DNA, PNA Probe, Dye Catalytic Complex: A Molecular Diagnostic

    PubMed Central

    Wang, M.; Holmes-Davis, R.; Rafinski, Z.; Jedrzejewska, B.; Choi, K. Y.; Zwick, M.; Bupp, C.; Izmailov, A.; Paczkowski, J.; Warner, B.; Koshinsky, H.

    2009-01-01

    In many settings, molecular testing is needed but unavailable due to complexity and cost. Simple, rapid, and specific DNA detection technologies would provide important alternatives to existing detection methods. Here we report a novel, rapid nucleic acid detection method based on the accelerated photobleaching of the light-sensitive cyanine dye, 3,3′-diethylthiacarbocyanine iodide (DiSC2(3) I−), in the presence of a target genomic DNA and a complementary peptide nucleic acid (PNA) probe. On the basis of the UV–vis, circular dichroism, and fluorescence spectra of DiSC2(3) with PNA–DNA oligomer duplexes and on characterization of a product of photolysis of DiSC2(3) I−, a possible reaction mechanism is proposed. We propose that (1) a novel complex forms between dye, PNA, and DNA, (2) this complex functions as a photosensitizer producing 1O2, and (3) the 1O2 produced promotes photobleaching of dye molecules in the mixture. Similar cyanine dyes (DiSC3(3), DiSC4(3), DiSC5(3), and DiSCpy(3)) interact with preformed PNA–DNA oligomer duplexes but do not demonstrate an equivalent accelerated photobleaching effect in the presence of PNA and target genomic DNA. The feasibility of developing molecular diagnostic assays based on the accelerated photobleaching (the smartDNA assay) that results from the novel complex formed between DiSC2(3) and PNA–DNA is under way. PMID:19231844

  20. Targeting of adhesion molecules as a therapeutic strategy in multiple myeloma.

    PubMed

    Neri, Paola; Bahlis, Nizar J

    2012-09-01

    Multiple myeloma (MM) is a clonal disorder of plasma cells that remains, for the most part, incurable despite the advent of several novel therapeutic agents. Tumor cells in this disease are cradled within the bone marrow (BM) microenvironment by an array of adhesive interactions between the BM cellular residents, the surrounding extracellular matrix (ECM) components such as fibronectin (FN), laminin, vascular cell adhesion molecule-1 (VCAM-1), proteoglycans, collagens and hyaluronan, and a variety of adhesion molecules on the surface of MM cells including integrins, hyaluronan receptors (CD44 and RHAMM) and heparan sulfate proteoglycans. Several signaling responses are activated by these interactions, affecting the survival, proliferation and migration of MM cells. An important consequence of these direct adhesive interactions between the BM/ECM and MM cells is the development of drug resistance. This phenomenon is termed "cell adhesion-mediated drug resistance" (CAM-DR) and it is thought to be one of the major mechanisms by which MM cells escape the cytotoxic effects of therapeutic agents. This review will focus on the adhesion molecules involved in the cross-talk between MM cells and components of the BM microenvironment. The complex signaling networks downstream of these adhesive molecules mediated by direct ligand binding or inside-out soluble factors signaling will also be reviewed. Finally, novel therapeutic strategies targeting these molecules will be discussed. Identification of the mediators of MM-BM interaction is essential to understand MM biology and to elucidate novel therapeutic targets for this disease.

  1. Activity of foreign proteins targeted within the bacteriophage T4 head and prohead: implications for packaged DNA structure.

    PubMed

    Mullaney, J M; Black, L W

    1998-11-13

    The phage-derived expression, packaging, and processing (PEPP) system was used to target foreign proteins into the bacteriophage capsid to probe the intracapsid environment and the structure of packaged DNA. Small proteins with minimal requirements for activity were selected, staphylococcal nuclease (SN) and green fluorescent protein (GFP). These proteins were targeted into the T4 head by means of IPIII (internal protein III) fusions or CTS (capsid targeting sequence) fusions. Additional evidence is provided that foreign proteins are targeted into T4 by the N-terminal ten amino acid residue consensus CTS of IPIII identified in previous work. Fusion proteins were produced within host bacteria by expression from plasmids or by produc tion from recombinant phage carrying the fusion genes. Packaged fusion proteins CTS IPIII SN, CTS IPIII TSN, CTS IPIII GFP, CTS IPIII TGFP, and CTS GFP, where [symbol: see text] indicates a linkage peptide sequence Leu(Ile)-N-Glu cleaved by the T4 head morphogenetic proteinase gp21 during head maturation, are observed to exhibit intracapsid activity. SN activity within the head is demonstrated by loss of phage viability and by digested genomic DNA patterns visualized by gel electrophoresis when viable phage are incubated in Ca2+. Green fluorescent phage result immediately after packaging GFP produced at 30 degreesC and below, and continue to give green fluorescence under 470 nm light after CsCl purification. Non-fluorescent GFP-fusions are produced in bacteria at 37 degreesC, and phage packaged with these proteins achieve a fluorescent state after incubation for several months at 4 degreesC. GFP-packaged phage and proheads analyzed by fluorescence spectroscopy show that the mature head and the DNA-empty prohead package identical numbers of GFP-fusion proteins. Encapsidated GFP and SN can be injected into bacteria and rapidly exhibit intracellular activity. In vivo SN digestion of encapsidated DNA gives an intriguing pattern of DNA

  2. Modeling DNA methylation by analyzing the individual configurations of single molecules

    PubMed Central

    Affinito, Ornella; Scala, Giovanni; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Avvedimento, Vittorio Enrico; Usiello, Alessandro; Chiariotti, Lorenzo; Cocozza, Sergio

    2016-01-01

    ABSTRACT DNA methylation is often analyzed by reporting the average methylation degree of each cytosine. In this study, we used a single molecule methylation analysis in order to look at the methylation conformation of individual molecules. Using D-aspartate oxidase as a model gene, we performed an in-depth methylation analysis through the developmental stages of 3 different mouse tissues (brain, lung, and gut), where this gene undergoes opposite methylation destiny. This approach allowed us to track both methylation and demethylation processes at high resolution. The complexity of these dynamics was markedly simplified by introducing the concept of methylation classes (MCs), defined as the number of methylated cytosines per molecule, irrespective of their position. The MC concept smooths the stochasticity of the system, allowing a more deterministic description. In this framework, we also propose a mathematical model based on the Markov chain. This model aims to identify the transition probability of a molecule from one MC to another during methylation and demethylation processes. The results of our model suggest that: 1) both processes are ruled by a dominant class of phenomena, namely, the gain or loss of one methyl group at a time; and 2) the probability of a single CpG site becoming methylated or demethylated depends on the methylation status of the whole molecule at that time. PMID:27748645

  3. Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

    NASA Astrophysics Data System (ADS)

    Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

    2018-02-01

    Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

  4. Copper-redox cycling by coumarin-di(2-picolyl)amine hybrid molecule leads to ROS-mediated DNA damage and apoptosis: A mechanism for cancer chemoprevention.

    PubMed

    Khan, Saman; Zafar, Atif; Naseem, Imrana

    2018-06-25

    Coumarin is an important bioactive pharmacophore. It is found in plants as a secondary metabolite and exhibits diverse pharmacological properties including anticancer effects against different malignancies. Therapeutic efficacy of coumarin derivatives depends on the pattern of substitution and conjugation with different moieties. Cancer cells contain elevated copper as compared to normal cells that plays a role in angiogenesis. Thus, targeting copper in malignant cells via copper chelators can serve as an attractive targeted anticancer strategy. Our previous efforts led to the synthesis of di(2-picolyl)amine-3(bromoacetyl)coumarin hybrid molecule (ligand-L) endowed with DNA/Cu(II) binding properties, and ROS generation ability in the presence of copper ions. In the present study, we aimed to validate copper-dependent cytotoxic action of ligand-L against malignant cells. For this, we used a cellular model system of copper (Cu) overloaded lymphocytes (CuOLs) to simulate malignancy-like condition. In CuOLs, lipid peroxidation/protein carbonylation, ROS generation, DNA fragmentation and apoptosis were investigated in the presence of ligand-L. Results showed that ligand-L-Cu(II) interaction leads to ROS generation, lipid peroxidation/protein carbonylation (oxidative stress parameters), DNA damage, up-regulation of p53 and mitochondrial-mediated apoptosis in treated lymphocytes. Further, pre-incubation with neocuproine (membrane permeable copper chelator) and ROS scavengers attenuated the DNA damage and apoptosis. These results suggest that cellular copper acts as molecular target for ligand-L to propagate redox cycling and generation of ROS via Fenton-like reaction leading to DNA damage and apoptosis. Further, we showed that ligand-L targets elevated copper in breast cancer MCF-7 and colon cancer HCT116 cells leading to a pro-oxidant inhibition of proliferation of cancer cells. In conclusion, we propose copper-dependent ROS-mediated mechanism for the cytotoxic action

  5. Evolutionary transitions to new DNA methyltransferases through target site expansion and shrinkage.

    PubMed

    Rockah-Shmuel, Liat; Tawfik, Dan S

    2012-12-01

    DNA-binding and modifying proteins show high specificity but also exhibit a certain level of promiscuity. Such latent promiscuous activities comprise the starting points for new protein functions, but this hypothesis presents a paradox: a new activity can only evolve if it already exists. How then, do novel activities evolve? DNA methyltransferases, for example, are highly divergent in their target sites, but how transitions toward novel sites occur remains unknown. We performed laboratory evolution of the DNA methyltransferase M.HaeIII. We found that new target sites emerged primarily through expansion of the original site, GGCC, and the subsequent shrinkage of evolved expanded sites. Variants evolved for sites that are promiscuously methylated by M.HaeIII [GG((A)/(T))CC and GGCGCC] carried mutations in 'gate-keeper' residues. They could thereby methylate novel target sites such as GCGC and GGATCC that were neither selected for nor present in M.HaeIII. These 'generalist' intermediates were further evolved to obtain variants with novel target specificities. Our results demonstrate the ease by which new DNA-binding and modifying specificities evolve and the mechanism by which they occur at both the protein and DNA levels.

  6. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid.

    PubMed

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php. © The Author(s) 2016. Published by Oxford University Press.

  7. NALDB: nucleic acid ligand database for small molecules targeting nucleic acid

    PubMed Central

    Kumar Mishra, Subodh; Kumar, Amit

    2016-01-01

    Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php PMID:26896846

  8. Resolving DNA-ligand intercalation in the entropic stretching regime

    NASA Astrophysics Data System (ADS)

    Almaqwashi, Ali A.

    Single molecule studies of DNA intercalation are typically conducted by applying stretching forces to obtain force-dependent DNA elongation measurements. The zero-force properties of DNA intercalation are determined by equilibrium and kinetic force-analysis. However, the applied stretching forces that are above the entropic regime (>5 pN) prevent DNA-DNA contact which may eliminate competitive DNA-ligand interactions. In particular, it is noted that cationic mono-intercalators investigated by single molecule force spectroscopy are mostly found to intercalate DNA with single rate, while bulk studies reported additional slower rates. Here, a proposed framework quantifies DNA intercalation by cationic ligands in competition with relatively rapid kinetic DNA-ligand aggregation. At a constant applied force in the entropic stretching regime, the analysis illustrates that DNA intercalation would be measurably optimized only within a narrow range of low ligand concentrations. As DNA intercalators are considered for potential DNA-targeted therapeutics, this analysis provides insights in tuning ligand concertation to maximize therapeutics efficiency.

  9. Screening unlabeled DNA targets with randomly ordered fiber-optic gene arrays.

    PubMed

    Steemers, F J; Ferguson, J A; Walt, D R

    2000-01-01

    We have developed a randomly ordered fiber-optic gene array for rapid, parallel detection of unlabeled DNA targets with surface immobilized molecular beacons (MB) that undergo a conformational change accompanied by a fluorescence change in the presence of a complementary DNA target. Microarrays are prepared by randomly distributing MB-functionalized 3-microm diameter microspheres in an array of wells etched in a 500-microm diameter optical imaging fiber. Using several MBs, each designed to recognize a different target, we demonstrate the selective detection of genomic cystic fibrosis related targets. Positional registration and fluorescence response monitoring of the microspheres was performed using an optical encoding scheme and an imaging fluorescence microscope system.

  10. Topology simplification: Important biological phenomenon or evolutionary relic?. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Bates, Andrew D.; Maxwell, Anthony

    2016-09-01

    The review, Disentangling DNA molecules[1], gives an excellent technical description of the phenomenon of topology simplification (TS) by type IIA DNA topoisomerases (topos). In the 20 years since its discovery [2], this effect has attracted a good deal of attention, probably because of its apparently magical nature, and because it seemed to offer a solution to the conundrum that all type II topos rely on ATP hydrolysis, but only bacterial DNA gyrases were known to transduce the free energy of hydrolysis into torsion (supercoiling) in the DNA. It made good sense to think that the other enzymes are using the energy to reduce the level of supercoiling, knotting, and particularly decatenation (unlinking), below equilibrium, since the key activity of the non-supercoiling topos is the removal of links between daughter chromosomes [3]. As Vologodskii discusses [1], there have been a number of theoretical models developed to explain how the local effect of a type II topo can influence the global level of knotting and catenation in large DNA molecules, and he explains how features of two of the most successful models (bent G segment and hooked juxtapositions) may be combined to explain the magnitude of the effect and overcome a kinetic problem with the hooked juxtaposition model.

  11. Super-lncRNAs: identification of lncRNAs that target super-enhancers via RNA:DNA:DNA triplex formation.

    PubMed

    Soibam, Benjamin

    2017-11-01

    Super-enhancers are characterized by high levels of Mediator binding and are major contributors to the expression of their associated genes. They exhibit high levels of local chromatin interactions and a higher order of local chromatin organization. On the other hand, lncRNAs can localize to specific DNA sites by forming a RNA:DNA:DNA triplex, which in turn can contribute to local chromatin organization. In this paper, we characterize a new class of lncRNAs called super-lncRNAs that target super-enhancers and which can contribute to the local chromatin organization of the super-enhancers. Using a logistic regression model based on the number of RNA:DNA:DNA triplex sites a lncRNA forms within the super-enhancer, we identify 442 unique super-lncRNA transcripts in 27 different human cell and tissue types; 70% of these super-lncRNAs were tissue restricted. They primarily harbor a single triplex-forming repeat domain, which forms an RNA:DNA:DNA triplex with multiple anchor DNA sites (originating from transposable elements) within the super-enhancers. Super-lncRNAs can be grouped into 17 different clusters based on the tissue or cell lines they target. Super-lncRNAs in a particular cluster share common short structural motifs and their corresponding super-enhancer targets are associated with gene ontology terms pertaining to the tissue or cell line. Super-lncRNAs may use these structural motifs to recruit and transport necessary regulators (such as transcription factors and Mediator complexes) to super-enhancers, influence chromatin organization, and act as spatial amplifiers for key tissue-specific genes associated with super-enhancers. © 2017 Soibam; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Single molecule analysis of Trypanosoma brucei DNA replication dynamics.

    PubMed

    Calderano, Simone Guedes; Drosopoulos, William C; Quaresma, Marina Mônaco; Marques, Catarina A; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L; Elias, Maria Carolina

    2015-03-11

    Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5' extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Another expert system rule inference based on DNA molecule logic gates

    NASA Astrophysics Data System (ADS)

    WÄ siewicz, Piotr

    2013-10-01

    With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.

  14. DNA Duplex-Based Photodynamic Molecular Beacon for Targeted Killing of Retinoblastoma Cell.

    PubMed

    Wei, Yanchun; Lu, Cuixia; Chen, Qun; Xing, Da

    2016-11-01

    Retinoblastoma (RB) is the most common primary intraocular malignancy of infancy. An alternative RB treatment protocol is proposed and tested. It is based on a photodynamic therapy (PDT) with a designed molecular beacon that specifically targets the murine double minute x (MDMX) high-expressed RB cells. A MDMX mRNA triggered photodynamic molecular beacon is designed by binding a photosensitizer molecule (pyropheophorbide-a, or PPa) and a black hole quencher-3 (BHQ3) through a complementary oligonucleotide sequence. Cells with and without MDMX high-expression are incubated with the beacon and then irradiated with a laser. The fluorescence and reactive oxygen species are detected in solution to verify the specific activation of PPa by the perfectly matched DNA targets. The cell viabilities are evaluated with CCK-8 and flow cytometry assay. The fluorescence and photo-cytoxicity of PPa is recovered and significantly higher in the MDMX high-expressed Y79 and WERI-Rb1 cells, compared to that with the MDMX low-expressed cells. The synthesized beacon exhibits high PDT efficiency toward MDMX high-expressed RB cells. The data suggest that the designed beacon may provide a potential alternative for RB therapy and secures the ground for future investigation.

  15. Multiplexed Elimination of Wild-Type DNA and High-Resolution Melting Prior to Targeted Resequencing of Liquid Biopsies.

    PubMed

    Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Song, Chen; Adalsteinsson, Viktor A; Parsons, Heather A; Lin, Nancy U; Wagle, Nikhil; Makrigiorgos, G Mike

    2017-10-01

    The use of clinical samples and circulating cell-free DNA (cfDNA) collected from liquid biopsies for diagnostic and prognostic applications in cancer is burgeoning, and improved methods that reduce the influence of excess wild-type (WT) portion of the sample are desirable. Here we present enrichment of mutation-containing sequences using enzymatic degradation of WT DNA. Mutation enrichment is combined with high-resolution melting (HRM) performed in multiplexed closed-tube reactions as a rapid, cost-effective screening tool before targeted resequencing. We developed a homogeneous, closed-tube approach to use a double-stranded DNA-specific nuclease for degradation of WT DNA at multiple targets simultaneously. The No Denaturation Nuclease-assisted Minor Allele Enrichment with Probe Overlap (ND-NaME-PrO) uses WT oligonucleotides overlapping both strands on putative DNA targets. Under conditions of partial denaturation (DNA breathing), the oligonucleotide probes enhance double-stranded DNA-specific nuclease digestion at the selected targets, with high preference toward WT over mutant DNA. To validate ND-NaME-PrO, we used multiplexed HRM, digital PCR, and MiSeq targeted resequencing of mutated genomic DNA and cfDNA. Serial dilution of KRAS mutation-containing DNA shows mutation enrichment by 10- to 120-fold and detection of allelic fractions down to 0.01%. Multiplexed ND-NaME-PrO combined with multiplexed PCR-HRM showed mutation scanning of 10-20 DNA amplicons simultaneously. ND-NaME-PrO applied on cfDNA from clinical samples enables mutation enrichment and HRM scanning over 10 DNA targets. cfDNA mutations were enriched up to approximately 100-fold (average approximately 25-fold) and identified via targeted resequencing. Closed-tube homogeneous ND-NaME-PrO combined with multiplexed HRM is a convenient approach to efficiently enrich for mutations on multiple DNA targets and to enable prescreening before targeted resequencing. © 2017 American Association for Clinical

  16. Synthesis of galactosyl compounds for targeted gene delivery.

    PubMed

    Ren, T; Zhang, G; Liu, D

    2001-11-01

    Cell-specific DNA delivery offers a great potential for targeted gene therapy. Toward this end, we have synthesized a series of compounds carrying galactose residues as a targeting ligand for asialoglycoprotein receptors of hepatocytes and primary amine groups as a functional domain for DNA binding. Biological activity of these galactosyl compounds in DNA delivery was evaluated in HepG2 and BL-6 cells and compared with respect to the number of galactose residues as well as primary amine groups in each molecule. Transfection experiments using a firefly luciferase gene as a reporter revealed that compounds with multivalent binding properties were more active in DNA delivery. An optimal transfection activity in HepG2 cells requires seven primary amine groups and a minimum of two galactose residues in each molecule. The transfection activity of compounds carrying multi-galactose residues can be inhibited by asialofetuin, a natural substrate for asialoglycoprotein receptors of hepatocytes, suggesting that gene transfer by these galactosyl compounds is asialoglycoprotein receptor-mediated. These results provide direct evidence in support of our new strategy for the use of small and synthetic compounds for cell specific and targeted gene delivery.

  17. 'Petite' mutagenesis and mitotic crossing-over in yeast by DNA-targeted alkylating agents.

    PubMed

    Ferguson, L R; Turner, P M; Gourdie, T A; Valu, K K; Denny, W A

    1989-12-01

    Although the biological properties (cytotoxicity, mutagenicity and carcinogenicity) of alkylating agents result from their bonding interactions with DNA, such compounds generally do not show any special binding affinity for DNA. A series of acridine-linked aniline mustards of widely-varying alkylator reactivity have been designed as DNA-directed alkylating agents. We have considered whether such DNA targeting has an effect on mutagenic properties by evaluating this series of drugs in comparison with their untargeted counterparts for toxic, recombinogenic and mutagenic properties in Saccharomyces cerevisiae strain D5. The simple untargeted aniline mustards are effective inducers of mitotic crossing-over in this strain, but resemble other reported alkylators in being rather inefficient inducers of the "petite" or mitochondrial mutation in yeast. However, the majority of the DNA-targeted mustards were very efficient petite mutagens, while showing little evidence of mitotic crossing-over or other nuclear events. The 100% conversion of cells into petites and the lack of a differential between growing and non-growing cells are similar to the effects of the well characterised mitochondrial mutagen ethidium bromide. These data suggest very different modes of action between the DNA-targeted alkylators and their non-targeted counterparts.

  18. Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions

    PubMed Central

    Brown, Maxwell W.; Kim, Yoori; Williams, Gregory M.; Huck, John D.; Surtees, Jennifer A.; Finkelstein, Ilya J.

    2016-01-01

    DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2–Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2–Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2–Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2–Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2–Msh3 and Msh2–Msh6 navigate on a crowded genome and suggest how Msh2–Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705

  19. Sequence-based design of bioactive small molecules that target precursor microRNAs.

    PubMed

    Velagapudi, Sai Pradeep; Gallo, Steven M; Disney, Matthew D

    2014-04-01

    Oligonucleotides are designed to target RNA using base pairing rules, but they can be hampered by poor cellular delivery and nonspecific stimulation of the immune system. Small molecules are preferred as lead drugs or probes but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA hairpin precursors, and it identified bioactive small molecules that inhibit biogenesis by binding nuclease-processing sites (44% hit rate). Among 27 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Markedly, microRNA profiling shows that 1 only affects microRNA-96 biogenesis and is at least as selective as an oligonucleotide.

  20. Sequence-based design of bioactive small molecules that target precursor microRNAs

    PubMed Central

    Velagapudi, Sai Pradeep; Gallo, Steven M.; Disney, Matthew D.

    2014-01-01

    Oligonucleotides are designed to target RNA using base pairing rules, however, they are hampered by poor cellular delivery and non-specific stimulation of the immune system. Small molecules are preferred as lead drugs or probes, but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA precursors and identified bioactive small molecules that inhibit biogenesis by binding to nuclease processing sites (41% hit rate). Amongst 29 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Importantly, microRNA profiling shows that 1 only significantly effects microRNA-96 biogenesis and is more selective than an oligonucleotide. PMID:24509821

  1. Targeting of the MYCN Protein with Small Molecule c-MYC Inhibitors

    PubMed Central

    Müller, Inga; Larsson, Karin; Frenzel, Anna; Oliynyk, Ganna; Zirath, Hanna; Prochownik, Edward V.; Westwood, Nicholas J.; Henriksson, Marie Arsenian

    2014-01-01

    Members of the MYC family are the most frequently deregulated oncogenes in human cancer and are often correlated with aggressive disease and/or poorly differentiated tumors. Since patients with MYCN-amplified neuroblastoma have a poor prognosis, targeting MYCN using small molecule inhibitors could represent a promising therapeutic approach. We have previously demonstrated that the small molecule 10058-F4, known to bind to the c-MYC bHLHZip dimerization domain and inhibiting the c-MYC/MAX interaction, also interferes with the MYCN/MAX dimerization in vitro and imparts anti-tumorigenic effects in neuroblastoma tumor models with MYCN overexpression. Our previous work also revealed that MYCN-inhibition leads to mitochondrial dysfunction resulting in accumulation of lipid droplets in neuroblastoma cells. To expand our understanding of how small molecules interfere with MYCN, we have now analyzed the direct binding of 10058-F4, as well as three of its analogs; #474, #764 and 10058-F4(7RH), one metabolite C-m/z 232, and a structurally unrelated c-MYC inhibitor 10074-G5, to the bHLHZip domain of MYCN. We also assessed their ability to induce apoptosis, neurite outgrowth and lipid accumulation in neuroblastoma cells. Interestingly, all c-MYC binding molecules tested also bind MYCN as assayed by surface plasmon resonance. Using a proximity ligation assay, we found reduced interaction between MYCN and MAX after treatment with all molecules except for the 10058-F4 metabolite C-m/z 232 and the non-binder 10058-F4(7RH). Importantly, 10074-G5 and 10058-F4 were the most efficient in inducing neuronal differentiation and lipid accumulation in MYCN-amplified neuroblastoma cells. Together our data demonstrate MYCN-binding properties for a selection of small molecules, and provide functional information that could be of importance for future development of targeted therapies against MYCN-amplified neuroblastoma. PMID:24859015

  2. Quantification of DNA-associated proteins inside eukaryotic cells using single-molecule localization microscopy

    PubMed Central

    Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.

    2014-01-01

    Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872

  3. Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors

    NASA Astrophysics Data System (ADS)

    Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja

    2014-06-01

    The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.

  4. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    PubMed

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  5. Bio-recognitive photonics of a DNA-guided organic semiconductor.

    PubMed

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-04

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  6. Bio-recognitive photonics of a DNA-guided organic semiconductor

    NASA Astrophysics Data System (ADS)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-01

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  7. Modularly Constructed Synthetic Granzyme B Molecule Enables Interrogation of Intracellular Proteases for Targeted Cytotoxicity.

    PubMed

    Ho, Patrick; Ede, Christopher; Chen, Yvonne Y

    2017-08-18

    Targeted therapies promise to increase the safety and efficacy of treatments against diseases ranging from cancer to viral infections. However, the vast majority of targeted therapeutics relies on the recognition of extracellular biomarkers, which are rarely restricted to diseased cells and are thus prone to severe and sometimes-fatal off-target toxicities. In contrast, intracellular antigens present a diverse yet underutilized repertoire of disease markers. Here, we report a protein-based therapeutic platform-termed Cytoplasmic Oncoprotein VErifier and Response Trigger (COVERT)-which enables the interrogation of intracellular proteases to trigger targeted cytotoxicity. COVERT molecules consist of the cytotoxic protein granzyme B (GrB) fused to an inhibitory N-terminal peptide, which can be removed by researcher-specified proteases to activate GrB function. We demonstrate that fusion of a small ubiquitin-like modifier 1 (SUMO1) protein to GrB yields a SUMO-GrB molecule that is specifically activated by the cancer-associated sentrin-specific protease 1 (SENP1). SUMO-GrB selectively triggers apoptotic phenotypes in HEK293T cells that overexpress SENP1, and it is highly sensitive to different SENP1 levels across cell lines. We further demonstrate the rational design of additional COVERT molecules responsive to enterokinase (EK) and tobacco etch virus protease (TEVp), highlighting the COVERT platform's modularity and adaptability to diverse protease targets. As an initial step toward engineering COVERT-T cells for adoptive T-cell therapy, we verified that primary human T cells can express, package, traffic, and deliver engineered GrB molecules in response to antigen stimulation. Our findings set the foundation for future intracellular-antigen-responsive therapeutics that can complement surface-targeted therapies.

  8. Targeting DDX3 with a small molecule inhibitor for lung cancer therapy.

    PubMed

    Bol, Guus M; Vesuna, Farhad; Xie, Min; Zeng, Jing; Aziz, Khaled; Gandhi, Nishant; Levine, Anne; Irving, Ashley; Korz, Dorian; Tantravedi, Saritha; Heerma van Voss, Marise R; Gabrielson, Kathleen; Bordt, Evan A; Polster, Brian M; Cope, Leslie; van der Groep, Petra; Kondaskar, Atul; Rudek, Michelle A; Hosmane, Ramachandra S; van der Wall, Elsken; van Diest, Paul J; Tran, Phuoc T; Raman, Venu

    2015-05-01

    Lung cancer is the most common malignancy worldwide and is a focus for developing targeted therapies due to its refractory nature to current treatment. We identified a RNA helicase, DDX3, which is overexpressed in many cancer types including lung cancer and is associated with lower survival in lung cancer patients. We designed a first-in-class small molecule inhibitor, RK-33, which binds to DDX3 and abrogates its activity. Inhibition of DDX3 by RK-33 caused G1 cell cycle arrest, induced apoptosis, and promoted radiation sensitization in DDX3-overexpressing cells. Importantly, RK-33 in combination with radiation induced tumor regression in multiple mouse models of lung cancer. Mechanistically, loss of DDX3 function either by shRNA or by RK-33 impaired Wnt signaling through disruption of the DDX3-β-catenin axis and inhibited non-homologous end joining-the major DNA repair pathway in mammalian somatic cells. Overall, inhibition of DDX3 by RK-33 promotes tumor regression, thus providing a compelling argument to develop DDX3 inhibitors for lung cancer therapy. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.

  9. Observation of anisotropic interactions between metastable atoms and target molecules by two-dimensional collisional ionization electron spectroscopy

    NASA Astrophysics Data System (ADS)

    Kishimoto, Naoki; Ohno, Koichi

    Excited metastable atoms colliding with target molecules can sensitively probe outer properties of molecules by chemi-ionization (Penning ionization) from molecular orbitals in the outer region, since metastable atoms cannot penetrate into the repulsive interaction wall around the molecules. By means of two-dimensional measurements using kinetic energy analysis of electrons combined with a velocity-resolved metastable beam, one can obtain information on the anisotropic interaction between the colliding particles without any control of orientation or alignment of target molecules. We have developed a classical trajectory method to calculate the collision energy dependence of partial ionization cross-sections (CEDPICS) on the anisotropic interaction potential energy surface, which has enabled us to study stereodynamics between metastable atoms and target molecules as well as the spatial distribution of molecular orbitals and electron ejection functions which have a relation with entrance and exit channels of the reaction. Based on the individual CEDPICS, the electronic structure of molecules can also be elucidated.

  10. Computational optimisation of targeted DNA sequencing for cancer detection

    NASA Astrophysics Data System (ADS)

    Martinez, Pierre; McGranahan, Nicholas; Birkbak, Nicolai Juul; Gerlinger, Marco; Swanton, Charles

    2013-12-01

    Despite recent progress thanks to next-generation sequencing technologies, personalised cancer medicine is still hampered by intra-tumour heterogeneity and drug resistance. As most patients with advanced metastatic disease face poor survival, there is need to improve early diagnosis. Analysing circulating tumour DNA (ctDNA) might represent a non-invasive method to detect mutations in patients, facilitating early detection. In this article, we define reduced gene panels from publicly available datasets as a first step to assess and optimise the potential of targeted ctDNA scans for early tumour detection. Dividing 4,467 samples into one discovery and two independent validation cohorts, we show that up to 76% of 10 cancer types harbour at least one mutation in a panel of only 25 genes, with high sensitivity across most tumour types. Our analyses demonstrate that targeting ``hotspot'' regions would introduce biases towards in-frame mutations and would compromise the reproducibility of tumour detection.

  11. A type III-B CRISPR-Cas effector complex mediating massive target DNA destruction.

    PubMed

    Han, Wenyuan; Li, Yingjun; Deng, Ling; Feng, Mingxia; Peng, Wenfang; Hallstrøm, Søren; Zhang, Jing; Peng, Nan; Liang, Yun Xiang; White, Malcolm F; She, Qunxin

    2017-02-28

    The CRISPR (clustered regularly interspaced short palindromic repeats) system protects archaea and bacteria by eliminating nucleic acid invaders in a crRNA-guided manner. The Sulfolobus islandicus type III-B Cmr-α system targets invading nucleic acid at both RNA and DNA levels and DNA targeting relies on the directional transcription of the protospacer in vivo. To gain further insight into the involved mechanism, we purified a native effector complex of III-B Cmr-α from S. islandicus and characterized it in vitro. Cmr-α cleaved RNAs complementary to crRNA present in the complex and its ssDNA destruction activity was activated by target RNA. The ssDNA cleavage required mismatches between the 5΄-tag of crRNA and the 3΄-flanking region of target RNA. An invader plasmid assay showed that mutation either in the histidine-aspartate acid (HD) domain (a quadruple mutation) or in the GGDD motif of the Cmr-2α protein resulted in attenuation of the DNA interference in vivo. However, double mutation of the HD motif only abolished the DNase activity in vitro. Furthermore, the activated Cmr-α binary complex functioned as a highly active DNase to destroy a large excess DNA substrate, which could provide a powerful means to rapidly degrade replicating viral DNA. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Targeting the DNA damage response in oncology: past, present and future perspectives.

    PubMed

    Basu, Bristi; Yap, Timothy A; Molife, L Rhoda; de Bono, Johann S

    2012-05-01

    The success of poly(ADP-ribose) polymerase inhibition in BRCA1 or BRCA2 deficient tumors as an anticancer strategy provided proof-of-concept for a synthetic lethality approach in oncology. There is therefore now active interest in expanding this approach to include other agents targeting the DNA damage response (DDR). We review lessons learnt from the development of inhibitors against DNA damage response mechanisms and envision the future of DNA repair inhibition in oncology. Preclinical synthetic lethality screens may potentially identify the best combinations of DNA-damaging drugs with inhibitors of DNA repair and the DDR or two agents acting within the DDR. Efforts are currently being made to establish robust and cost-effective assays that may be implemented within appropriate time-scales in parallel with future clinical studies. Detection of relevant mutations in a high-throughput manner, such as with next-generation sequencing for genes implicated in homologous recombination, including BRCA1, BRCA2, and ataxia telangiectasia mutated is anticipated. Novel approaches targeting the DDR are currently being evaluated and inhibitors of ATM, RAD51 and DNA-dependent protein kinase are now in early drug discovery and development. There remains great enthusiasm in oncology practice for pursuing the strategy of synthetic lethality. The future development of antitumor agents targeting the DDR should include detailed correlative biomarker work within early phase clinical studies wherever possible, with clear attempts to identify doses at which robust target modulation is observed.

  13. Inactivation of Pol θ and C-NHEJ eliminates off-target integration of exogenous DNA.

    PubMed

    Zelensky, Alex N; Schimmel, Joost; Kool, Hanneke; Kanaar, Roland; Tijsterman, Marcel

    2017-07-07

    Off-target or random integration of exogenous DNA hampers precise genomic engineering and presents a safety risk in clinical gene therapy strategies. Genetic definition of random integration has been lacking for decades. Here, we show that the A-family DNA polymerase θ (Pol θ) promotes random integration, while canonical non-homologous DNA end joining plays a secondary role; cells double deficient for polymerase θ and canonical non-homologous DNA end joining are devoid of any integration events, demonstrating that these two mechanisms define random integration. In contrast, homologous recombination is not reduced in these cells and gene targeting is improved to 100% efficiency. Such complete reversal of integration outcome, from predominately random integration to exclusively gene targeting, provides a rational way forward to improve the efficacy and safety of DNA delivery and gene correction approaches.Random off-target integration events can impair precise gene targeting and poses a safety risk for gene therapy. Here the authors show that repression of polymerase θ and classical non-homologous recombination eliminates random integration.

  14. Simultaneous Single-Molecule Force and Fluorescence Sampling of DNA Nanostructure Conformations Using Magnetic Tweezers.

    PubMed

    Kemmerich, Felix E; Swoboda, Marko; Kauert, Dominik J; Grieb, M Svea; Hahn, Steffen; Schwarz, Friedrich W; Seidel, Ralf; Schlierf, Michael

    2016-01-13

    We present a hybrid single-molecule technique combining magnetic tweezers and Förster resonance energy transfer (FRET) measurements. Through applying external forces to a paramagnetic sphere, we induce conformational changes in DNA nanostructures, which are detected in two output channels simultaneously. First, by tracking a magnetic bead with high spatial and temporal resolution, we observe overall DNA length changes along the force axis. Second, the measured FRET efficiency between two fluorescent probes monitors local conformational changes. The synchronized orthogonal readout in different observation channels will facilitate deciphering the complex mechanisms of biomolecular machines.

  15. Targeted DNA Mutagenesis for the Cure of Chronic Viral Infections

    PubMed Central

    Schiffer, Joshua T.; Aubert, Martine; Weber, Nicholas D.; Mintzer, Esther; Stone, Daniel

    2012-01-01

    Human immunodeficiency virus type 1 (HIV-1), hepatitis B virus (HBV), and herpes simplex virus (HSV) have been incurable to date because effective antiviral therapies target only replicating viruses and do not eradicate latently integrated or nonreplicating episomal viral genomes. Endonucleases that can target and cleave critical regions within latent viral genomes are currently in development. These enzymes are being engineered with high specificity such that off-target binding of cellular DNA will be absent or minimal. Imprecise nonhomologous-end-joining (NHEJ) DNA repair following repeated cleavage at the same critical site may permanently disrupt translation of essential viral proteins. We discuss the benefits and drawbacks of three types of DNA cleavage enzymes (zinc finger endonucleases, transcription activator-like [TAL] effector nucleases [TALENs], and homing endonucleases [also called meganucleases]), the development of delivery vectors for these enzymes, and potential obstacles for successful treatment of chronic viral infections. We then review issues regarding persistence of HIV-1, HBV, and HSV that are relevant to eradication with genome-altering approaches. PMID:22718830

  16. In Vitro Selection for Small-Molecule-Triggered Strand Displacement and Riboswitch Activity.

    PubMed

    Martini, Laura; Meyer, Adam J; Ellefson, Jared W; Milligan, John N; Forlin, Michele; Ellington, Andrew D; Mansy, Sheref S

    2015-10-16

    An in vitro selection method for ligand-responsive RNA sensors was developed that exploited strand displacement reactions. The RNA library was based on the thiamine pyrophosphate (TPP) riboswitch, and RNA sequences capable of hybridizing to a target duplex DNA in a TPP regulated manner were identified. After three rounds of selection, RNA molecules that mediated a strand exchange reaction upon TPP binding were enriched. The enriched sequences also showed riboswitch activity. Our results demonstrated that small-molecule-responsive nucleic acid sensors can be selected to control the activity of target nucleic acid circuitry.

  17. A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners.

    PubMed

    Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang

    2013-11-15

    The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

    PubMed

    Rocha, M S

    2015-09-01

    In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

  19. An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.

    PubMed

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald

    2016-02-01

    Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and

  20. Telomere and ribosomal DNA repeats are chromosomal targets of the bloom syndrome DNA helicase

    PubMed Central

    Schawalder, James; Paric, Enesa; Neff, Norma F

    2003-01-01

    Background Bloom syndrome is one of the most cancer-predisposing disorders and is characterized by genomic instability and a high frequency of sister chromatid exchange. The disorder is caused by loss of function of a 3' to 5' RecQ DNA helicase, BLM. The exact role of BLM in maintaining genomic integrity is not known but the helicase has been found to associate with several DNA repair complexes and some DNA replication foci. Results Chromatin immunoprecipitation of BLM complexes recovered telomere and ribosomal DNA repeats. The N-terminus of BLM, required for NB localization, is the same as the telomere association domain of BLM. The C-terminus is required for ribosomal DNA localization. BLM localizes primarily to the non-transcribed spacer region of the ribosomal DNA repeat where replication forks initiate. Bloom syndrome cells expressing the deletion alleles lacking the ribosomal DNA and telomere association domains have altered cell cycle populations with increased S or G2/M cells relative to normal. Conclusion These results identify telomere and ribosomal DNA repeated sequence elements as chromosomal targets for the BLM DNA helicase during the S/G2 phase of the cell cycle. BLM is localized in nuclear bodies when it associates with telomeric repeats in both telomerase positive and negative cells. The BLM DNA helicase participates in genomic stability at ribosomal DNA repeats and telomeres. PMID:14577841

  1. Development of an optical biosensor based on surface-enhanced Raman scattering for DNA analysis

    NASA Astrophysics Data System (ADS)

    Yigit, Tugce; Akdogan, Ebru; Karagoz, Isık. Didem; Kahraman, Mehmet

    2016-03-01

    Rapid, accurate and sensitive DNA analysis is critically important for the diagnostic of genetic diseases. The most common method preferred in practice is fluorescence based microarrays to analyze the DNA. However, there exist some disadvantages related to the above-mentioned method such as the overlapping of the fluorescence emission wavelengths that can diminish in the performance of multiplexing, needed to obtain fluorescence spectra from each dye and photo degradation. In this study, a novel SERS based DNA analysis approach, which is Raman active dye-free and independent of SERS substrate properties, is developed. First, the single strand DNA probe is attached to the SERS substrate and half of the complimentary DNA is attached to gold nanoparticles, as well. We hypothesize that in the presence of target DNA, the complimentary DNA coupled colloids will bind to the SERS substrate surface via hybridization of single strand target DNA. To test this hypothesis, we used UV/Vis spectroscopy, atomic for microscopy (AFM) and dynamic light scattering (DLS). DNA analysis is demonstrated by a peak shift of the certain peak of the small molecules attached to the SERS substrate surface instead of SERS spectrum obtained in the presence of target DNA from the Raman reporter molecules. The degree of peak shifting will be used for the quantification of the target DNA in the sample. Plasmonic properties of SERS substrates and reproducibility issues will not be considerable due to the use of peak shifting instead of peak intensity for the qualitative analysis.

  2. Exploration of target molecules for molecular imaging of inflammatory bowel disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Higashikawa, Kei; Akada, Naoki; Yagi, Katsuharu

    2011-07-08

    Highlights: {sup {yields}18}F-FDG PET could discriminate each inflamed area of IBD model mice clearly. {sup {yields}18}F-FDG PET could not discriminate the difference of pathogenic mechanism. {yields} Cytokines and cytokine receptors expression was different by pathogenic mechanism. {yields} Cytokines and cytokine receptors would be new target molecules for IBD imaging. -- Abstract: Molecular imaging technology is a powerful tool for the diagnosis of inflammatory bowel disease (IBD) and the efficacy evaluation of various drug therapies for it. However, it is difficult to elucidate directly the relationships between the responsible molecules and IBD using existing probes. Therefore, the development of an alternativemore » probe that is able to elucidate the pathogenic mechanism and provide information on the appropriate guidelines for treatment is earnestly awaited. In this study, we investigated pathognomonic molecules in the intestines of model mice. The accumulation of fluorine-18 fluorodeoxyglucose ({sup 18}F-FDG) in the inflamed area of the intestines of dextran sulfate sodium (DSS)- or indomethacin (IND)-induced IBD model mice was measured by positron emission tomography (PET) and autoradiography to confirm the inflamed area. The results suggested that the inflammation was selectively induced in the colons of mice by the administration of DSS, whereas it was induced mainly in the ilea and the proximal colons of mice by the administration of IND. To explore attractive target molecules for the molecular imaging of IBD, we evaluated the gene expression levels of cytokines and cytokine receptors in the inflamed area of the intestines of both model mice. We found that the expression levels of cytokines and cytokine receptors were significantly increased during the progression of IBD, whereas the expression levels were decreased as the mucosa began to heal. In particular, the expression levels of these molecules had already changed before the symptoms of IBD

  3. Chemical genetics-based development of small molecules targeting hepatitis C virus.

    PubMed

    Jin, Guanghai; Lee, Jisu; Lee, Kyeong

    2017-09-01

    Hepatitis C virus (HCV) infection is a major worldwide problem that has emerged as one of the most significant diseases affecting humans. There are currently no vaccines or efficient therapies without side effects, despite today's advanced medical technology. Currently, the common therapy for most patients (i.e. genotype 1) is combination of HCV-specific direct-acting antivirals (DAAs). Up to 2011, the standard of care (SOC) was a combination of peg-IFNα with ribavirin (RBV). After approval of NS3/4A protease inhibitor, SOC was peg-IFNα and RBV with either the first-generation DAAs boceprevir or telaprevir. In the past several years, various novel small molecules have been discovered and some of them (i.e., HCV polymerase, protease, helicase and entry inhibitors) have undergone clinical trials. Between 2013 and 2016, the second-generation DAA drugs simeprevir, asunaprevir, daclatasvir, dasabuvir, sofosbuvir, and elbasvir were approved, as well as the combinational drugs Harvoni ® , Zepatier ® , Technivie ® , and Epclusa ® . A number of reviews have been recently published describing the structure-activity relationship (SAR) in the development of HCV inhibitors and outlining current therapeutic approaches to hepatitis C infection. Target identification involves studying a drug's mechanism of action (MOA), and a variety of target identification methods have been developed in the past few years. Chemical biology has emerged as a powerful tool for studying biological processes using small molecules. The use of chemical genetic methods is a valuable strategy for studying the molecular mechanisms of the viral lifecycle and screening for anti-viral agents. Two general screening approaches have been employed: forward and reverse chemical genetics. This review reveals information on the small molecules in HCV drug discovery by using chemical genetics for targeting the HCV protein and describes successful examples of targets identified with these methods.

  4. Aptamer Recognition of Multiplexed Small-Molecule-Functionalized Substrates.

    PubMed

    Nakatsuka, Nako; Cao, Huan H; Deshayes, Stephanie; Melkonian, Arin Lucy; Kasko, Andrea M; Weiss, Paul S; Andrews, Anne M

    2018-05-31

    Aptamers are chemically synthesized oligonucleotides or peptides with molecular recognition capabilities. We investigated recognition of substrate-tethered small-molecule targets, using neurotransmitters as examples, and fluorescently labeled DNA aptamers. Substrate regions patterned via microfluidic channels with dopamine or L-tryptophan were selectively recognized by previously identified dopamine or L-tryptophan aptamers, respectively. The on-substrate dissociation constant determined for the dopamine aptamer was comparable to, though slightly greater than the previously determined solution dissociation constant. Using pre-functionalized neurotransmitter-conjugated oligo(ethylene glycol) alkanethiols and microfluidics patterning, we produced multiplexed substrates to capture and to sort aptamers. Substrates patterned with L-DOPA, L-DOPS, and L-5-HTP enabled comparison of the selectivity of the dopamine aptamer for different targets via simultaneous determination of in situ binding constants. Thus, beyond our previous demonstrations of recognition by protein binding partners (i.e., antibodies and G-protein-coupled receptors), strategically optimized small-molecule-functionalized substrates show selective recognition of nucleic acid binding partners. These substrates are useful for side-by-side target comparisons, and future identification and characterization of novel aptamers targeting neurotransmitters or other important small-molecules.

  5. Dual Targeting Biomimetic Liposomes for Paclitaxel/DNA Combination Cancer Treatment

    PubMed Central

    Liu, Guo-Xia; Fang, Gui-Qing; Xu, Wei

    2014-01-01

    Combinations of chemotherapeutic drugs with nucleic acid has shown great promise in cancer therapy. In the present study, paclitaxel (PTX) and DNA were co-loaded in the hyaluronic acid (HA) and folate (FA)-modified liposomes (HA/FA/PPD), to obtain the dual targeting biomimetic nanovector. The prepared HA/FA/PPD exhibited nanosized structure and narrow size distributions (247.4 ± 4.2 nm) with appropriate negative charge of −25.40 ± 2.7 mV. HA/FA/PD (PTX free HA/FA/PPD) showed almost no toxicity on murine malignant melanoma cell line (B16) and human hepatocellular carcinoma cell line (HepG2) (higher than 80% cell viability), demonstrating the safety of the blank nanovector. In comparison with the FA-modified PTX/DNA co-loaded liposomes (FA/PPD), HA/FA/PPD showed significant superiority in protecting the nanoparticles from aggregation in the presence of plasma and degradation by DNase I. Moreover, HA/FA/PPD could also significantly improve the transfection efficiency and cellular internalization rates on B16 cells comparing to that of FA/PPD (p < 0.05) and PPD (p < 0.01), demonstrating the great advantages of dual targeting properties. Furthermore, fluorescence microscope and flow cytometry results showed that PTX and DNA could be effectively co-delivered into the same tumor cell via HA/FA/PPD, contributing to PTX/DNA combination cancer treatment. In conclusion, the obtained HA/FA/PPD in the study could effectively target tumor cells, enhance transfection efficiency and subsequently achieve the co-delivery of PTX and DNA, displaying great potential for optimal combination therapy. PMID:25177862

  6. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    PubMed Central

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  7. Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

    PubMed Central

    Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

    2008-01-01

    Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

  8. DNA methylation in CHO cells.

    PubMed

    Wippermann, Anna; Noll, Thomas

    2017-09-20

    Chinese hamster ovary (CHO) cells account for the production of the majority of biopharmaceutical molecules - however, the molecular basis for their versatile properties is not entirely understood yet and the underlying cellular processes need to be characterized in detail. One such process that is supposed to contribute significantly to CHO cell phenotype is methylation of DNA at cytosine residues. DNA methylation was shown to be involved in several central biological processes in humans and to contribute to diseases like cancer. Early studies of DNA methylation in CHO mostly focused on methylation of single recombinant genes and promoters and proved a correlation between DNA methylation status and recombinant gene expression or production stability. More recent publications utilized the CHO genomic and transcriptomic data available since 2011 and provided first insights into the CHO DNA methylation landscape and DNA methylation changes in response to effector molecules or culture conditions. Generally, further genome-wide studies of DNA methylation in CHO will be required to shed light on the relevance of this process regarding biopharmaceuticals production and might, e.g., address a potential link between CHO cell metabolism and DNA methylation or provide novel targets for rational cell line engineering. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.

    PubMed

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S

    2013-10-01

    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  10. Biosensors based on DNA-Functionalized Graphene

    NASA Astrophysics Data System (ADS)

    Vishnubhotla, Ramya; Ping, Jinglei; Vrudhula, Amey; Johnson, A. T. Charlie

    Since its discovery, graphene has been used for sensing applications due to its outstanding electrical properties and biocompatibility. Here, we demonstrate the capabilities of field effect transistors (FETs) based on CVD-grown graphene functionalized with commercially obtained DNA oligomers and aptamers for detection of various biomolecular targets (e.g., complementary DNA and small molecule drug targets). Graphene FETs were created with a scalable photolithography process that produces arrays consisting of 50-100 FETs with a layout suitable for multiplexed detection of four molecular targets. FETs were characterized via AFM to confirm the presence of the aptamer. From the measured electrical characteristics, it was determined that binding of molecular targets by the DNA chemical recognition element led to a reproducible, concentration-dependent shift in the Dirac voltage. This biosensor class is potentially suitable for applications in drug detection. This work is funded by NIH through the Center for AIDS Research at the University of Pennsylvania.

  11. Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives

    NASA Astrophysics Data System (ADS)

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-01

    The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.

  12. Target-triggering multiple-cycle signal amplification strategy for ultrasensitive detection of DNA based on QCM and SPR.

    PubMed

    Song, Weiling; Yin, Wenshuo; Sun, Wenbo; Guo, Xiaoyan; He, Peng; Yang, Xiaoyan; Zhang, Xiaoru

    2018-04-24

    Detection of ultralow concentrations of nucleic acid sequences is a central challenge in the early diagnosis of genetic diseases. Herein, we developed a target-triggering cascade multiple cycle amplification for ultrasensitive DNA detection using quartz crystal microbalance (QCM) and surface plasmon resonance (SPR). It was based on the exonuclease Ⅲ (Exo Ⅲ)-assisted signal amplification and the hybridization chain reaction (HCR). The streptavidin-coated Au-NPs (Au-NPs-SA) were assembled on the HCR products as recognition element. Upon sensing of target DNA, the duplex DNA probe triggered the Exo Ⅲ cleavage process, accompanied by generating a new secondary target DNA and releasing target DNA. The released target DNA and the secondary target DNA were recycled. Simultaneously, numerous single strands were liberated and acted as the trigger of HCR to generate further signal amplification, resulting in the immobilization of abundant Au-NPs-SA on the gold substrate. The QCM sensor results were found to be comparable to that achieved using a SPR sensor platform. This method exhibited a high sensitivity toward target DNA with a detection limit of 0.70 fM. The high sensitivity and specificity make this method a great potential for detecting DNA with trace amounts in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Differential targeting of Gbetagamma-subunit signaling with small molecules.

    PubMed

    Bonacci, Tabetha M; Mathews, Jennifer L; Yuan, Chujun; Lehmann, David M; Malik, Sundeep; Wu, Dianqing; Font, Jose L; Bidlack, Jean M; Smrcka, Alan V

    2006-04-21

    G protein betagamma subunits have potential as a target for therapeutic treatment of a number of diseases. We performed virtual docking of a small-molecule library to a site on Gbetagamma subunits that mediates protein interactions. We hypothesized that differential targeting of this surface could allow for selective modulation of Gbetagamma subunit functions. Several compounds bound to Gbetagamma subunits with affinities from 0.1 to 60 muM and selectively modulated functional Gbetagamma-protein-protein interactions in vitro, chemotactic peptide signaling pathways in HL-60 leukocytes, and opioid receptor-dependent analgesia in vivo. These data demonstrate an approach for modulation of G protein-coupled receptor signaling that may represent an important therapeutic strategy.

  14. Immunoglobulin class switch DNA recombination: induction, targeting and beyond

    PubMed Central

    Xu, Zhenming; Zan, Hong; Pone, Egest J.; Mai, Thach; Casali, Paolo

    2012-01-01

    Class switch DNA recombination (CSR) of the immunoglobulin heavy chain (IgH) locus is central to the maturation of the antibody response and critically requires the AID cytidine deaminase. CSR entails changes of the chromatin state and transcriptional activation of the IgH locus upstream and downstream switch (S) regions that are to undergo S-S DNA recombination, induction of AID, and targeting of CSR factors to S regions by 14-3-3 adaptors and as enabled by the transcription machinery and histone modifications. In this Review, we focus on recent advances in CSR induction and targeting. We also outline an integrated model of the assembly of macromolecular complexes that transduce critical epigenetic information to enzymatic effectors of the CSR machinery. PMID:22728528

  15. Autonomous generation and loading of DNA guides by bacterial Argonaute

    PubMed Central

    Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John

    2018-01-01

    Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506

  16. Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

    PubMed Central

    Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

    2011-01-01

    With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

  17. Influence of Ionic Liquids on Thermodynamics of Small Molecule-DNA Interaction: The Binding of Ethidium Bromide to Calf Thymus DNA.

    PubMed

    Mishra, Arpit; Ekka, Mary Krishna; Maiti, Souvik

    2016-03-17

    Ionic liquids (ILs) are salts with poor ionic coordination, resultantly remaining in liquid state below 100 °C and some may retain liquid state even at room temperature. ILs are known to provide a conducive environment for many biological enzymatic reactions, but their interaction with biomacromolecules are poorly understood. In the present study, we investigate the effect of various ionic liquids on DNA-small molecule interaction using calf thymus DNA (ctDNA)-ethidium bromide (EB) as a model system. The effect of various ionic liquids on these interactions is studied by an array of techniques such as circular dichroism (CD), UV melting, fluorescence exclusion and isothermal titration calorimetry. Interestingly, we observed that presence of IL increased the stability of ctDNA without altering its structure. The binding affinities Kbs for EB binding to ctDNA in the presence of 300 mM ILs are about half order of magnitude smaller than the Kbs in absence of ILs and correspond to a less favorable free energy. We noted that, when adjusted to corresponding buffer condition, the unfavorable shift in ΔG of ctDNA-EB interaction is attributed to decreased entropy in the case of ILs, whereas the same effect by NaCl was due to increased enthalpy.

  18. Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

    NASA Astrophysics Data System (ADS)

    Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

    2016-11-01

    The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

  19. A graphene-based biosensing platform based on the release of DNA probes and rolling circle amplification.

    PubMed

    Liu, Meng; Song, Jinping; Shuang, Shaomin; Dong, Chuan; Brennan, John D; Li, Yingfu

    2014-06-24

    We report a versatile biosensing platform capable of achieving ultrasensitive detection of both small-molecule and macromolecular targets. The system features three components: reduced graphene oxide for its ability to adsorb single-stranded DNA molecules nonspecifically, DNA aptamers for their ability to bind reduced graphene oxide but undergo target-induced conformational changes that facilitate their release from the reduced graphene oxide surface, and rolling circle amplification (RCA) for its ability to amplify a primer-template recognition event into repetitive sequence units that can be easily detected. The key to the design is the tagging of a short primer to an aptamer sequence, which results in a small DNA probe that allows for both effective probe adsorption onto the reduced graphene oxide surface to mask the primer domain in the absence of the target, as well as efficient probe release in the presence of the target to make the primer available for template binding and RCA. We also made an observation that the circular template, which on its own does not cause a detectable level of probe release from the reduced graphene oxide, augments target-induced probe release. The synergistic release of DNA probes is interpreted to be a contributing factor for the high detection sensitivity. The broad utility of the platform is illustrated though engineering three different sensors that are capable of achieving ultrasensitive detection of a protein target, a DNA sequence and a small-molecule analyte. We envision that the approach described herein will find useful applications in the biological, medical, and environmental fields.

  20. Mechanisms of autophagy and relevant small-molecule compounds for targeted cancer therapy.

    PubMed

    Zhang, Jin; Wang, Guan; Zhou, Yuxin; Chen, Yi; Ouyang, Liang; Liu, Bo

    2018-05-01

    Autophagy is an evolutionarily conserved, multi-step lysosomal degradation process for the clearance of damaged or superfluous proteins and organelles. Accumulating studies have recently revealed that autophagy is closely related to a variety of types of cancer; however, elucidation of its Janus role of either tumor-suppressive or tumor-promoting still remains to be discovered. In this review, we focus on summarizing the context-dependent role of autophagy and its complicated molecular mechanisms in different types of cancer. Moreover, we discuss a series of small-molecule compounds targeting autophagy-related proteins or the autophagic process for potential cancer therapy. Taken together, these findings would shed new light on exploiting the intricate mechanisms of autophagy and relevant small-molecule compounds as potential anti-cancer drugs to improve targeted cancer therapy.

  1. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    NASA Astrophysics Data System (ADS)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  2. Label-free in-flow detection of single DNA molecules using glass nanopipettes.

    PubMed

    Gong, Xiuqing; Patil, Amol V; Ivanov, Aleksandar P; Kong, Qingyuan; Gibb, Thomas; Dogan, Fatma; deMello, Andrew J; Edel, Joshua B

    2014-01-07

    With the view of enhancing the functionality of label-free single molecule nanopore-based detection, we have designed and developed a highly robust, mechanically stable, integrated nanopipette-microfluidic device which combines the recognized advantages of microfluidic systems and the unique properties/advantages of nanopipettes. Unlike more typical planar solid-state nanopores, which have inherent geometrical constraints, nanopipettes can be easily positioned at any point within a microfluidic channel. This is highly advantageous, especially when taking into account fluid flow properties. We show that we are able to detect and discriminate between DNA molecules of varying lengths when motivated through a microfluidic channel, upon the application of appropriate voltage bias across the nanopipette. The effects of applied voltage and volumetric flow rates have been studied to ascertain translocation event frequency and capture rate. Additionally, by exploiting the advantages associated with microfluidic systems (such as flow control and concomitant control over analyte concentration/presence), we show that the technology offers a new opportunity for single molecule detection and recognition in microfluidic devices.

  3. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  4. [Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].

    PubMed

    Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R

    2017-01-01

    Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.

  5. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    PubMed

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  6. Highly sensitive detection of target molecules using a new fluorescence-based bead assay

    NASA Astrophysics Data System (ADS)

    Scheffler, Silvia; Strauß, Denis; Sauer, Markus

    2007-07-01

    Development of immunoassays with improved sensitivity, specificity and reliability are of major interest in modern bioanalytical research. We describe the development of a new immunomagnetic fluorescence detection (IM-FD) assay based on specific antigen/antibody interactions and on accumulation of the fluorescence signal on superparamagnetic PE beads in combination with the use of extrinsic fluorescent labels. IM-FD can be easily modified by varying the order of coatings and assay conditions. Depending on the target molecule, antibodies (ABs), entire proteins, or small protein epitopes can be used as capture molecules. The presence of target molecules is detected by fluorescence microscopy using fluorescently labeled secondary or detection antibodies. Here, we demonstrate the potential of the new assay detecting the two tumor markers IGF-I and p53 antibodies in the clinically relevant concentration range. Our data show that the fluorescence-based bead assay exhibits a large dynamic range and a high sensitivity down to the subpicomolar level.

  7. In vitro DNA binding, pBR322 plasmid cleavage and molecular modeling study of chiral benzothiazole Schiff-base-valine Cu(II) and Zn(II) complexes to evaluate their enantiomeric biological disposition for molecular target DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Rahman; Afzal, Mohd; Arjmand, Farukh

    2014-10-01

    Bicyclic heterocyclic compounds viz. benzothiazoles are key components of deoxyribonucleic acid (DNA) molecules and participate directly in the encoding of genetic information. Benzothiazoles, therefore, represent a potent and selective class of antitumor compounds. The design and synthesis of chiral antitumor chemotherapeutic agents of Cu(II) and Zn(II), L- and -D benzothiazole Schiff base-valine complexes 1a &b and 2a &b, respectively were carried out and thoroughly characterized by spectroscopic and analytical techniques. Interaction of 1a and b and 2a and b with CT DNA by employing UV-vis, florescence, circular dichroic methods and cleavage studies of 1a with pBR322 plasmid, molecular docking were done in order to demonstrate their enantiomeric disposition toward the molecular drug target DNA. Interestingly, these studies unambiguously demonstrated the greater potency of L-enantiomer in comparison to D-enantiomer.

  8. A DNA vaccine targeting angiomotin inhibits angiogenesis and suppresses tumor growth

    NASA Astrophysics Data System (ADS)

    Holmgren, Lars; Ambrosino, Elena; Birot, Olivier; Tullus, Carl; Veitonmäki, Niina; Levchenko, Tetyana; Carlson, Lena-Maria; Musiani, Piero; Iezzi, Manuela; Curcio, Claudia; Forni, Guido; Cavallo, Federica; Kiessling, Rolf

    2006-06-01

    Endogenous angiogenesis inhibitors have shown promise in preclinical trials, but clinical use has been hindered by low half-life in circulation and high production costs. Here, we describe a strategy that targets the angiostatin receptor angiomotin (Amot) by DNA vaccination. The vaccination procedure generated antibodies that detected Amot on the endothelial cell surface. Purified Ig bound to the endothelial cell membrane and inhibited endothelial cell migration. In vivo, DNA vaccination blocked angiogenesis in the matrigel plug assay and prevented growth of transplanted tumors for up to 150 days. We further demonstrate that a combination of DNA vaccines encoding Amot and the extracellular and transmembrane domains of the human EGF receptor 2 (Her-2)/neu oncogene inhibited breast cancer progression and impaired tumor vascularization in Her-2/neu transgenic mice. No toxicity or impairment of normal blood vessels could be detected. This work shows that DNA vaccination targeting Amot may be used to mimic the effect of angiostatin. cancer vaccines | neoplasia | neovascularization | breast cancer | angiostatin

  9. Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

    PubMed Central

    Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

    2015-01-01

    Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

  10. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  11. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

    2015-12-02

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Exploiting bacterial DNA gyrase as a drug target: current state and perspectives.

    PubMed

    Collin, Frédéric; Karkare, Shantanu; Maxwell, Anthony

    2011-11-01

    DNA gyrase is a type II topoisomerase that can introduce negative supercoils into DNA at the expense of ATP hydrolysis. It is essential in all bacteria but absent from higher eukaryotes, making it an attractive target for antibacterials. The fluoroquinolones are examples of very successful gyrase-targeted drugs, but the rise in bacterial resistance to these agents means that we not only need to seek new compounds, but also new modes of inhibition of this enzyme. We review known gyrase-specific drugs and toxins and assess the prospects for developing new antibacterials targeted to this enzyme.

  13. Competition between B-Z and B-L transitions in a single DNA molecule: Computational studies

    NASA Astrophysics Data System (ADS)

    Kwon, Ah-Young; Nam, Gi-Moon; Johner, Albert; Kim, Seyong; Hong, Seok-Cheol; Lee, Nam-Kyung

    2016-02-01

    Under negative torsion, DNA adopts left-handed helical forms, such as Z-DNA and L-DNA. Using the random copolymer model developed for a wormlike chain, we represent a single DNA molecule with structural heterogeneity as a helical chain consisting of monomers which can be characterized by different helical senses and pitches. By Monte Carlo simulation, where we take into account bending and twist fluctuations explicitly, we study sequence dependence of B-Z transitions under torsional stress and tension focusing on the interaction with B-L transitions. We consider core sequences, (GC) n repeats or (TG) n repeats, which can interconvert between the right-handed B form and the left-handed Z form, imbedded in a random sequence, which can convert to left-handed L form with different (tension dependent) helical pitch. We show that Z-DNA formation from the (GC) n sequence is always supported by unwinding torsional stress but Z-DNA formation from the (TG) n sequence, which are more costly to convert but numerous, can be strongly influenced by the quenched disorder in the surrounding random sequence.

  14. Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.

    PubMed

    Cao, Chan; Long, Yi-Tao

    2018-02-20

    Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis

  15. The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures

    PubMed Central

    Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter

    2007-01-01

    Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862

  16. Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex.

    PubMed

    Guo, Tai Wei; Bartesaghi, Alberto; Yang, Hui; Falconieri, Veronica; Rao, Prashant; Merk, Alan; Eng, Edward T; Raczkowski, Ashleigh M; Fox, Tara; Earl, Lesley A; Patel, Dinshaw J; Subramaniam, Sriram

    2017-10-05

    Prokaryotic cells possess CRISPR-mediated adaptive immune systems that protect them from foreign genetic elements, such as invading viruses. A central element of this immune system is an RNA-guided surveillance complex capable of targeting non-self DNA or RNA for degradation in a sequence- and site-specific manner analogous to RNA interference. Although the complexes display considerable diversity in their composition and architecture, many basic mechanisms underlying target recognition and cleavage are highly conserved. Using cryoelectron microscopy (cryo-EM), we show that the binding of target double-stranded DNA (dsDNA) to a type I-F CRISPR system yersinia (Csy) surveillance complex leads to large quaternary and tertiary structural changes in the complex that are likely necessary in the pathway leading to target dsDNA degradation by a trans-acting helicase-nuclease. Comparison of the structure of the surveillance complex before and after dsDNA binding, or in complex with three virally encoded anti-CRISPR suppressors that inhibit dsDNA binding, reveals mechanistic details underlying target recognition and inhibition. Published by Elsevier Inc.

  17. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    PubMed Central

    2017-01-01

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 103 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale. PMID:29166033

  18. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    PubMed

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  19. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    NASA Astrophysics Data System (ADS)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  20. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  1. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics

    PubMed Central

    2012-01-01

    Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761

  2. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1991-01-01

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

  3. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Deepa; Gawel, Damian; Itsko, Mark

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  4. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE PAGES

    Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

    2015-02-18

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  5. Surface-enhanced Raman spectroscopy for the detection of pathogenic DNA and protein in foods

    NASA Astrophysics Data System (ADS)

    Chowdhury, Mustafa H.; Atkinson, Brad; Good, Theresa; Cote, Gerard L.

    2003-07-01

    Traditional Raman spectroscopy while extremely sensitive to structure and conformation, is an ineffective tool for the detection of bioanalytes at the sub milimolar level. Surface Enhanced Raman Spectroscopy (SERS) is a technique developed more recently that has been used with applaudable success to enhance the Raman cross-section of a molecule by factors of 106 to 1014. This technique can be exploited in a nanoscale biosensor for the detection of pathogenic proteins and DNA in foods by using a biorecognition molecule to bring a target analyte in close proximity to the mental surface. This is expected to produce a SERS signal of the target analyte, thus making it possible to easily discriminate between the target analyte and possible confounders. In order for the sensor to be effective, the Raman spectra of the target analyte would have to be distinct from that of the biorecognition molecule, as both would be in close proximity to the metal surface and thus be subjected to the SERS effect. In our preliminary studies we have successfully used citrate reduced silver colloidal particles to obtain unique SERS spectra of α-helical and β-sheet bovine serum albumin (BSA) that served as models of an α helical antiobiody (biorecognition element) and a β-sheet target protein (pathogenic prion). In addition, the unique SERS spectra of double stranded and single stranded DNA were also obtained where the single stranded DNA served as the model for the biorecognition element and the double stranded DNA served as themodel for the DNA probe/target hybrid. This provides a confirmation of the feasibility of the method which opens opportunities for potentially wide spread applications in the detection of food pathogens, biowarefare agents, andother bio-analytes.

  6. Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases

    PubMed Central

    Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

    2018-01-01

    Abstract Background Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. Findings We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with

  7. Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases.

    PubMed

    Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

    2018-03-01

    Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Our results prove that d

  8. Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

    PubMed

    Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

  9. The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

    PubMed

    Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

    2010-06-15

    Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

  10. Spy: a new group of eukaryotic DNA transposons without target site duplications.

    PubMed

    Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

    2014-06-24

    Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5'-AAA and TTT-3' host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Bio-recognitive photonics of a DNA-guided organic semiconductor

    PubMed Central

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-01

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA–DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an ‘inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA–DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition. PMID:26725969

  12. Triple Helix Formation in a Topologically Controlled DNA Nanosystem.

    PubMed

    Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki

    2016-04-11

    In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Design and Synthesis of Biaryl DNA-Encoded Libraries.

    PubMed

    Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana

    2016-10-10

    DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).

  14. Induced DNA demethylation by targeting Ten-Eleven Translocation 2 to the human ICAM-1 promoter

    PubMed Central

    Chen, Hui; Kazemier, Hinke G; de Groote, Marloes L.; Ruiters, Marcel H. J.; Xu, Guo-Liang; Rots, Marianne G.

    2014-01-01

    Increasing evidence indicates that active DNA demethylation is involved in several processes in mammals, resulting in developmental stage-specificity and cell lineage-specificity. The recently discovered Ten-Eleven Translocation (TET) dioxygenases are accepted to be involved in DNA demethylation by initiating 5-mC oxidation. Aberrant DNA methylation profiles are associated with many diseases. For example in cancer, hypermethylation results in silencing of tumor suppressor genes. Such silenced genes can be re-expressed by epigenetic drugs, but this approach has genome-wide effects. In this study, fusions of designer DNA binding domains to TET dioxygenase family members (TET1, -2 or -3) were engineered to target epigenetically silenced genes (ICAM-1, EpCAM). The effects on targeted CpGs’ methylation and on expression levels of the target genes were assessed. The results indicated demethylation of targeted CpG sites in both promoters for targeted TET2 and to a lesser extent for TET1, but not for TET3. Interestingly, we observed re-activation of transcription of ICAM-1. Thus, our work suggests that we provided a mechanism to induce targeted DNA demethylation, which facilitates re-activation of expression of the target genes. Furthermore, this Epigenetic Editing approach is a powerful tool to investigate functions of epigenetic writers and erasers and to elucidate consequences of epigenetic marks. PMID:24194590

  15. Functional transferred DNA within extracellular vesicles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cai, Jin; Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Jiangsu Province; Wu, Gengze

    Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmicmore » macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.« less

  16. Osmylated DNA, a novel concept for sequencing DNA using nanopores

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia

    2015-03-01

    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  17. Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives.

    PubMed

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-15

    The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  19. PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Hui; Gao, Pu; Rajashankar, Kanagalaghatta R.

    C2c1 is a newly identified guide RNA-mediated type V-B CRISPR-Cas endonuclease that site-specifically targets and cleaves both strands of target DNA. We have determined crystal structures of Alicyclobacillus acidoterrestris C2c1 (AacC2c1) bound to sgRNA as a binary complex and to target DNAs as ternary complexes, thereby capturing catalytically competent conformations of AacC2c1 with both target and non-target DNA strands independently positioned within a single RuvC catalytic pocket. Moreover, C2c1-mediated cleavage results in a staggered seven-nucleotide break of target DNA. crRNA adopts a pre-ordered five-nucleotide A-form seed sequence in the binary complex, with release of an inserted tryptophan, facilitating zippering upmore » of 20-bp guide RNA:target DNA heteroduplex on ternary complex formation. Notably, the PAM-interacting cleft adopts a “locked” conformation on ternary complex formation. Structural comparison of C2c1 ternary complexes with their Cas9 and Cpf1 counterparts highlights the diverse mechanisms adopted by these distinct CRISPR-Cas systems, thereby broadening and enhancing their applicability as genome editing tools.« less

  20. Exonuclease III-Assisted Upconversion Resonance Energy Transfer in a Wash-Free Suspension DNA Assay.

    PubMed

    Chen, Yinghui; Duong, Hien T T; Wen, Shihui; Mi, Chao; Zhou, Yingzhu; Shimoni, Olga; Valenzuela, Stella M; Jin, Dayong

    2018-01-02

    Sensitivity is the key in optical detection of low-abundant analytes, such as circulating RNA or DNA. The enzyme Exonuclease III (Exo III) is a useful tool in this regard; its ability to recycle target DNA molecules results in markedly improved detection sensitivity. Lower limits of detection may be further achieved if the detection background of autofluorescence can be removed. Here we report an ultrasensitive and specific method to quantify trace amounts of DNA analytes in a wash-free suspension assay. In the presence of target DNA, the Exo III recycles the target DNA by selectively digesting the dye-tagged sequence-matched probe DNA strand only, so that the amount of free dye removed from the probe DNA is proportional to the number of target DNAs. Remaining intact probe DNAs are then bound onto upconversion nanoparticles (energy donor), which allows for upconversion luminescence resonance energy transfer (LRET) that can be used to quantify the difference between the free dye and tagged dye (energy acceptor). This scheme simply avoids both autofluorescence under infrared excitation and many tedious washing steps, as the free dye molecules are physically located away from the nanoparticle surface, and as such they remain "dark" in suspension. Compared to alternative approaches requiring enzyme-assisted amplification on the nanoparticle surface, introduction of probe DNAs onto nanoparticles only after DNA hybridization and signal amplification steps effectively avoids steric hindrance. Via this approach, we have achieved a detection limit of 15 pM in LRET assays of human immunodeficiency viral DNA.

  1. Targeted Degradation of Proteins Localized in Subcellular Compartments by Hybrid Small Molecules.

    PubMed

    Okuhira, Keiichiro; Shoda, Takuji; Omura, Risa; Ohoka, Nobumichi; Hattori, Takayuki; Shibata, Norihito; Demizu, Yosuke; Sugihara, Ryo; Ichino, Asato; Kawahara, Haruka; Itoh, Yukihiro; Ishikawa, Minoru; Hashimoto, Yuichi; Kurihara, Masaaki; Itoh, Susumu; Saito, Hiroyuki; Naito, Mikihiko

    2017-03-01

    Development of novel small molecules that selectively degrade pathogenic proteins would provide an important advance in targeted therapy. Recently, we have devised a series of hybrid small molecules named SNIPER (specific and nongenetic IAP-dependent protein ERaser) that induces the degradation of target proteins via the ubiquitin-proteasome system. To understand the localization of proteins that can be targeted by this protein knockdown technology, we examined whether SNIPER molecules are able to induce degradation of cellular retinoic acid binding protein II (CRABP-II) proteins localized in subcellular compartments of cells. CRABP-II is genetically fused with subcellular localization signals, and they are expressed in the cells. SNIPER(CRABP) with different IAP-ligands, SNIPER(CRABP)-4 with bestatin and SNIPER(CRABP)-11 with MV1 compound, induce the proteasomal degradation of wild-type (WT), cytosolic, nuclear, and membrane-localized CRABP-II proteins, whereas only SNIPER(CRABP)-11 displayed degradation activity toward the mitochondrial CRABP-II protein. The small interfering RNA-mediated silencing of cIAP1 expression attenuated the knockdown activity of SNIPER(CRABP) against WT and cytosolic CRABP-II proteins, indicating that cIAP1 is the E3 ligase responsible for degradation of these proteins. Against membrane-localized CRABP-II protein, cIAP1 is also a primary E3 ligase in the cells, but another E3 ligase distinct from cIAP2 and X-linked inhibitor of apoptosis protein (XIAP) could also be involved in the SNIPER(CRABP)-11-induced degradation. However, for the degradation of nuclear and mitochondrial CRABP-II proteins, E3 ligases other than cIAP1, cIAP2, and XIAP play a role in the SNIPER-mediated protein knockdown. These results indicate that SNIPER can target cytosolic, nuclear, membrane-localized, and mitochondrial proteins for degradation, but the responsible E3 ligase is different, depending on the localization of the target protein. Copyright © 2017 by

  2. A Fragment-Based Method of Creating Small-Molecule Libraries to Target the Aggregation of Intrinsically Disordered Proteins.

    PubMed

    Joshi, Priyanka; Chia, Sean; Habchi, Johnny; Knowles, Tuomas P J; Dobson, Christopher M; Vendruscolo, Michele

    2016-03-14

    The aggregation process of intrinsically disordered proteins (IDPs) has been associated with a wide range of neurodegenerative disorders, including Alzheimer's and Parkinson's diseases. Currently, however, no drug in clinical use targets IDP aggregation. To facilitate drug discovery programs in this important and challenging area, we describe a fragment-based approach of generating small-molecule libraries that target specific IDPs. The method is based on the use of molecular fragments extracted from compounds reported in the literature to inhibit of the aggregation of IDPs. These fragments are used to screen existing large generic libraries of small molecules to form smaller libraries specific for given IDPs. We illustrate this approach by describing three distinct small-molecule libraries to target, Aβ, tau, and α-synuclein, which are three IDPs implicated in Alzheimer's and Parkinson's diseases. The strategy described here offers novel opportunities for the identification of effective molecular scaffolds for drug discovery for neurodegenerative disorders and to provide insights into the mechanism of small-molecule binding to IDPs.

  3. In vitro DNA binding, pBR322 plasmid cleavage and molecular modeling study of chiral benzothiazole Schiff-base-valine Cu(II) and Zn(II) complexes to evaluate their enantiomeric biological disposition for molecular target DNA.

    PubMed

    Alizadeh, Rahman; Afzal, Mohd; Arjmand, Farukh

    2014-10-15

    Bicyclic heterocyclic compounds viz. benzothiazoles are key components of deoxyribonucleic acid (DNA) molecules and participate directly in the encoding of genetic information. Benzothiazoles, therefore, represent a potent and selective class of antitumor compounds. The design and synthesis of chiral antitumor chemotherapeutic agents of Cu(II) and Zn(II), L- and -D benzothiazole Schiff base-valine complexes 1a &b and 2a &b, respectively were carried out and thoroughly characterized by spectroscopic and analytical techniques. Interaction of 1a and b and 2a and b with CT DNA by employing UV-vis, florescence, circular dichroic methods and cleavage studies of 1a with pBR322 plasmid, molecular docking were done in order to demonstrate their enantiomeric disposition toward the molecular drug target DNA. Interestingly, these studies unambiguously demonstrated the greater potency of L-enantiomer in comparison to D-enantiomer. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

    PubMed

    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

    2014-03-28

    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Direct cloning of isogenic murine DNA in yeast and relevance of isogenicity for targeting in embryonic stem cells.

    PubMed

    Andréasson, Claes; Schick, Anna J; Pfeiffer, Susanne M; Sarov, Mihail; Stewart, Francis; Wurst, Wolfgang; Schick, Joel A

    2013-01-01

    Efficient gene targeting in embryonic stem cells requires that modifying DNA sequences are identical to those in the targeted chromosomal locus. Yet, there is a paucity of isogenic genomic clones for human cell lines and PCR amplification cannot be used in many mutation-sensitive applications. Here, we describe a novel method for the direct cloning of genomic DNA into a targeting vector, pRTVIR, using oligonucleotide-directed homologous recombination in yeast. We demonstrate the applicability of the method by constructing functional targeting vectors for mammalian genes Uhrf1 and Gfap. Whereas the isogenic targeting of the gene Uhrf1 showed a substantial increase in targeting efficiency compared to non-isogenic DNA in mouse E14 cells, E14-derived DNA performed better than the isogenic DNA in JM8 cells for both Uhrf1 and Gfap. Analysis of 70 C57BL/6-derived targeting vectors electroporated in JM8 and E14 cell lines in parallel showed a clear dependence on isogenicity for targeting, but for three genes isogenic DNA was found to be inhibitory. In summary, this study provides a straightforward methodological approach for the direct generation of isogenic gene targeting vectors.

  6. A New Three-Dimensional Educational Model Kit for Building DNA and RNA Molecules: Development and Evaluation

    ERIC Educational Resources Information Center

    Beltramini, Leila Maria; Araujo, Ana Paula Ulian; de Oliveira, Tales Henrique Goncalves; dos Santos Abel, Luciano Douglas; da Silva, Aparecido Rodrigues; dos Santos, Neusa Fernandes

    2006-01-01

    International specialized literature focused on research in biology education is sadly scarce, especially regarding biochemical and molecular aspects. In this light, researchers from this Centre for Structural Molecular Biotechnology developed and evaluated a three-dimensional educational model named "Building Life Molecules DNA and RNA." The…

  7. Galactosylated DNA lipid nanocapsules for efficient hepatocyte targeting.

    PubMed

    Morille, M; Passirani, C; Letrou-Bonneval, E; Benoit, J-P; Pitard, B

    2009-09-11

    The main objective of gene therapy via a systemic pathway is the development of a stable and non-toxic gene vector that can encapsulate and deliver foreign genetic materials into specific cell types with the transfection efficiency of viral vectors. With this objective, DNA complexed with cationic lipids of DOTAP/DOPE was encapsulated into lipid nanocapsules (LNCs) forming nanocarriers (DNA LNCs) with a size suitable for systemic injection (109+/-6 nm). With the goal of increasing systemic delivery, LNCs were stabilised with long chains of poly(ethylene glycol) (PEG), either from a PEG lipid derivative (DSPE-mPEG(2000)) or from an amphiphilic block copolymer (F108). In order to overcome internalisation difficulties encountered with PEG shield, a specific ligand (galactose) was covalently added at the distal end of the PEG chains, in order to provide active targeting of the asialoglycoprotein-receptor present on hepatocytes. This study showed that DNA LNCs were as efficient as positively charged DOTAP/DOPE lipoplexes for transfection. In primary hepatocytes, when non-galactosylated, the two polymers significantly decreased the transfection, probably by creating a barrier around the DNA LNCs. Interestingly, galactosylated F108 coated DNA LNCs led to a 18-fold increase in luciferase expression compared to non-galactosylated ones.

  8. Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

    PubMed

    Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

    2014-04-01

    The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. When Maxwellian demon meets action at a distance. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Rybenkov, Valentin V.

    2016-09-01

    The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].

  10. Differential Targeting of Gβγ-Subunit Signaling with Small Molecules

    NASA Astrophysics Data System (ADS)

    Bonacci, Tabetha M.; Mathews, Jennifer L.; Yuan, Chujun; Lehmann, David M.; Malik, Sundeep; Wu, Dianqing; Font, Jose L.; Bidlack, Jean M.; Smrcka, Alan V.

    2006-04-01

    G protein βγ subunits have potential as a target for therapeutic treatment of a number of diseases. We performed virtual docking of a small-molecule library to a site on Gβγ subunits that mediates protein interactions. We hypothesized that differential targeting of this surface could allow for selective modulation of Gβγ subunit functions. Several compounds bound to Gβγ subunits with affinities from 0.1 to 60 μM and selectively modulated functional Gβγ-protein-protein interactions in vitro, chemotactic peptide signaling pathways in HL-60 leukocytes, and opioid receptor-dependent analgesia in vivo. These data demonstrate an approach for modulation of G protein-coupled receptor signaling that may represent an important therapeutic strategy.

  11. Strong DNA deformation required for extremely slow DNA threading intercalation by a binuclear ruthenium complex

    PubMed Central

    Almaqwashi, Ali A.; Paramanathan, Thayaparan; Lincoln, Per; Rouzina, Ioulia; Westerlund, Fredrik; Williams, Mark C.

    2014-01-01

    DNA intercalation by threading is expected to yield high affinity and slow dissociation, properties desirable for DNA-targeted therapeutics. To measure these properties, we utilize single molecule DNA stretching to quantify both the binding affinity and the force-dependent threading intercalation kinetics of the binuclear ruthenium complex Δ,Δ-[μ‐bidppz‐(phen)4Ru2]4+ (Δ,Δ-P). We measure the DNA elongation at a range of constant stretching forces using optical tweezers, allowing direct characterization of the intercalation kinetics as well as the amount intercalated at equilibrium. Higher forces exponentially facilitate the intercalative binding, leading to a profound decrease in the binding site size that results in one ligand intercalated at almost every DNA base stack. The zero force Δ,Δ-P intercalation Kd is 44 nM, 25-fold stronger than the analogous mono-nuclear ligand (Δ-P). The force-dependent kinetics analysis reveals a mechanism that requires DNA elongation of 0.33 nm for association, relaxation to an equilibrium elongation of 0.19 nm, and an additional elongation of 0.14 nm from the equilibrium state for dissociation. In cells, a molecule with binding properties similar to Δ,Δ-P may rapidly bind DNA destabilized by enzymes during replication or transcription, but upon enzyme dissociation it is predicted to remain intercalated for several hours, thereby interfering with essential biological processes. PMID:25245944

  12. A small-molecule-linked DNA-graphene oxide-based fluorescence-sensing system for detection of biotin.

    PubMed

    Zhang, Hao; Li, Yan; Su, Xingguang

    2013-11-15

    In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. A mathematical model for DNA

    NASA Astrophysics Data System (ADS)

    Sepehri, Alireza

    Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

  14. Mechanism of How Salt-Gradient-Induced Charges Affect the Translocation of DNA Molecules through a Nanopore

    PubMed Central

    He, Yuhui; Tsutsui, Makusu; Scheicher, Ralph H.; Fan, Chun; Taniguchi, Masateru; Kawai, Tomoji

    2013-01-01

    Experiments using nanopores demonstrated that a salt gradient enhances the capture rate of DNA and reduces its translocation speed. These two effects can help to enable electrical DNA sequencing with nanopores. Here, we provide a quantitative theoretical evaluation that shows the positive net charges, which accumulate around the pore entrance due to the salt gradient, are responsible for the two observed effects: they reinforce the electric capture field, resulting in promoted molecule capture rate; and they induce cationic electroosmotic flow through the nanopore, thus significantly retarding the motion of the anionic DNA through the nanopore. Our multiphysical simulation results show that, during the polymer trapping stage, the former effect plays the major role, thus resulting in promoted DNA capture rate, while during the nanopore-penetrating stage the latter effect dominates and consequently reduces the DNA translocation speed significantly. Quantitative agreement with experimental results has been reached by further taking nanopore wall surface charges into account. PMID:23931325

  15. Depth of focus extended microscope configuration for imaging of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells

    NASA Astrophysics Data System (ADS)

    Fessl, Tomas; Ben-Yaish, Shai; Vacha, Frantisek; Adamec, Frantisek; Zalevsky, Zeev

    2009-07-01

    Imaging of small objects such as single molecules, DNA clusters and single bacterial cells is problematic not only due to the lateral resolution that is obtainable in currently existing microscopy but also, and as much fundamentally limiting, due to the lack of sufficient axial depth of focus to have the full object focused simultaneously. Extension in depth of focus is helpful also for single molecule steady state FRET measurements. In this technique it is crucial to obtain data from many well focused molecules, which are often located in different axial depths. In this paper we present the implementation of an all-optical and a real time technique of extension in the depth of focus that may be incorporated in any high NA microscope system and to be used for the above mentioned applications. We demonstrate experimentally how after the integration of special optical element in high NA 100× objective lens of a single molecule imaging microscope system, the depth of focus is significantly improved while maintaining the same lateral resolution in imaging applications of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells.

  16. Isolation of a small molecule inhibitor of DNA base excision repair

    PubMed Central

    Madhusudan, Srinivasan; Smart, Fiona; Shrimpton, Paul; Parsons, Jason L.; Gardiner, Laurence; Houlbrook, Sue; Talbot, Denis C.; Hammonds, Timothy; Freemont, Paul A.; Sternberg, Michael J. E.; Dianov, Grigory L.; Hickson, Ian D.

    2005-01-01

    The base excision repair (BER) pathway is essential for the removal of DNA bases damaged by alkylation or oxidation. A key step in BER is the processing of an apurinic/apyrimidinic (AP) site intermediate by an AP endonuclease. The major AP endonuclease in human cells (APE1, also termed HAP1 and Ref-1) accounts for >95% of the total AP endonuclease activity, and is essential for the protection of cells against the toxic effects of several classes of DNA damaging agents. Moreover, APE1 overexpression has been linked to radio- and chemo-resistance in human tumors. Using a newly developed high-throughput screen, several chemical inhibitors of APE1 have been isolated. Amongst these, CRT0044876 was identified as a potent and selective APE1 inhibitor. CRT0044876 inhibits the AP endonuclease, 3′-phosphodiesterase and 3′-phosphatase activities of APE1 at low micromolar concentrations, and is a specific inhibitor of the exonuclease III family of enzymes to which APE1 belongs. At non-cytotoxic concentrations, CRT0044876 potentiates the cytotoxicity of several DNA base-targeting compounds. This enhancement of cytotoxicity is associated with an accumulation of unrepaired AP sites. In silico modeling studies suggest that CRT0044876 binds to the active site of APE1. These studies provide both a novel reagent for probing APE1 function in human cells, and a rational basis for the development of APE1-targeting drugs for antitumor therapy. PMID:16113242

  17. Targeted drug delivery to the brain using magnetic nanoparticles.

    PubMed

    Thomsen, Louiza Bohn; Thomsen, Maj Schneider; Moos, Torben

    2015-01-01

    Brain capillary endothelial cells denote the blood-brain barrier (BBB), and conjugation of nanoparticles with antibodies that target molecules expressed by these endothelial cells may facilitate their uptake and transport into the brain. Magnetic nanoparticles can be encapsulated in liposomes and carry large molecules with therapeutic potential, for example, siRNA, cDNA and polypeptides. An additional approach to enhance the transport of magnetic nanoparticles across the BBB is the application of extracranially applied magnetic force. Stepwise targeting of magnetic nanoparticles to brain capillary endothelial cells followed by transport through the BBB using magnetic force may prove a novel mechanism for targeted therapy of macromolecules to the brain.

  18. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less

  19. Endothelial targeting of high-affinity multivalent polymer nanocarriers directed to intercellular adhesion molecule 1.

    PubMed

    Muro, Silvia; Dziubla, Thomas; Qiu, Weining; Leferovich, John; Cui, Xiumin; Berk, Erik; Muzykantov, Vladimir R

    2006-06-01

    Targeting of diagnostic and therapeutic agents to endothelial cells (ECs) provides an avenue to improve treatment of many maladies. For example, intercellular adhesion molecule 1 (ICAM-1), a constitutive endothelial cell adhesion molecule up-regulated in many diseases, is a good determinant for endothelial targeting of therapeutic enzymes and polymer nanocarriers (PNCs) conjugated with anti-ICAM (anti-ICAM/PNCs). However, intrinsic and extrinsic factors that control targeting of anti-ICAM/PNCs to ECs (e.g., anti-ICAM affinity and PNC valency and flow) have not been defined. In this study we tested in vitro and in vivo parameters of targeting to ECs of anti-ICAM/PNCs consisting of either prototype polystyrene or biodegradable poly(lactic-coglycolic) acid polymers (approximately 200 nm diameter spheres carrying approximately 200 anti-ICAM molecules). Anti-ICAM/PNCs, but not control IgG/PNCs 1) rapidly (t1/2 approximately 5 min) and specifically bound to tumor necrosis factor-activated ECs in a dose-dependent manner (Bmax approximately 350 PNC/cell) at both static and physiological shear stress conditions and 2) bound to ECs and accumulated in the pulmonary vasculature after i.v. injection in mice. Anti-ICAM/PNCs displayed markedly higher EC affinity versus naked anti-ICAM (Kd approximately 80 pM versus approximately 8 nM) in cell culture and, probably because of this factor, higher value (185.3 +/- 24.2 versus 50.5 +/- 1.5% injected dose/g) and selectivity (lung/blood ratio 81.0 +/- 10.9 versus 2.1 +/- 0.02, in part due to faster blood clearance) of pulmonary targeting. These results 1) show that reformatting monomolecular anti-ICAM into high-affinity multivalent PNCs boosts their vascular immuno-targeting, which withstands physiological hydrodynamics and 2) support potential anti-ICAM/PNCs utility for medical applications.

  20. Nanosecond to submillisecond dynamics in dye-labeled single-stranded DNA, as revealed by ensemble measurements and photon statistics at single-molecule level.

    PubMed

    Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi

    2009-10-22

    Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.

  1. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    PubMed

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

    2017-01-01

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  2. Dendritic cell targeted chitosan nanoparticles for nasal DNA immunization against SARS CoV nucleocapsid protein.

    PubMed

    Raghuwanshi, Dharmendra; Mishra, Vivek; Das, Dipankar; Kaur, Kamaljit; Suresh, Mavanur R

    2012-04-02

    This work investigates the formulation and in vivo efficacy of dendritic cell (DC) targeted plasmid DNA loaded biotinylated chitosan nanoparticles for nasal immunization against nucleocapsid (N) protein of severe acute respiratory syndrome coronavirus (SARS-CoV) as antigen. The induction of antigen-specific mucosal and systemic immune response at the site of virus entry is a major challenge for vaccine design. Here, we designed a strategy for noninvasive receptor mediated gene delivery to nasal resident DCs. The pDNA loaded biotinylated chitosan nanoparticles were prepared using a complex coacervation process and characterized for size, shape, surface charge, plasmid DNA loading and protection against nuclease digestion. The pDNA loaded biotinylated chitosan nanoparticles were targeted with bifunctional fusion protein (bfFp) vector for achieving DC selective targeting. The bfFp is a recombinant fusion protein consisting of truncated core-streptavidin fused with anti-DEC-205 single chain antibody (scFv). The core-streptavidin arm of fusion protein binds with biotinylated nanoparticles, while anti-DEC-205 scFv imparts targeting specificity to DC DEC-205 receptor. We demonstrate that intranasal administration of bfFp targeted formulations along with anti-CD40 DC maturation stimuli enhanced magnitude of mucosal IgA as well as systemic IgG against N protein. The strategy led to the detection of augmented levels of N protein specific systemic IgG and nasal IgA antibodies. However, following intranasal delivery of naked pDNA no mucosal and systemic immune responses were detected. A parallel comparison of targeted formulations using intramuscular and intranasal routes showed that the intramuscular route is superior for induction of systemic IgG responses compared with the intranasal route. Our results suggest that targeted pDNA delivery through a noninvasive intranasal route can be a strategy for designing low-dose vaccines.

  3. 3,4-Dimethoxyphenyl bis-benzimidazole, a novel DNA topoisomerase inhibitor that preferentially targets Escherichia coli topoisomerase I

    PubMed Central

    Bansal, Sandhya; Sinha, Devapriya; Singh, Manish; Cheng, Bokun; Tse-Dinh, Yuk-Ching; Tandon, Vibha

    2012-01-01

    Objectives Antibiotic resistance in bacterial pathogens is a serious clinical problem. Novel targets are needed to combat increasing drug resistance in Escherichia coli. Our objective is to demonstrate that 2-(3,4-dimethoxyphenyl)-5-[5-(4-methylpiperazin-1-yl)-1H-benzimidazol-2yl]-1H-benzimidazole (DMA) inhibits E. coli DNA topoisomerase I more strongly than human topoisomerase I. In addition, DMA is non-toxic to mammalian cells at antibiotic dosage level. Methods In the present study, we have established DMA as an antibacterial compound by determining MICs, post-antibiotic effects (PAEs) and MBCs for different standard as well as clinical strains of E. coli. We have described the differential catalytic inhibitory mechanism of bis-benzimidazole, DMA, for human and E. coli topoisomerase I and topoisomerase II by performing different assays, including relaxation assays, cleavage–religation assays, DNA unwinding assays, ethidium bromide displacement assays, decatenation assays and DNA gyrase supercoiling assays. Results DMA significantly inhibited bacterial growth at a very low concentration, but did not affect human cell viability at higher concentrations. Activity assays showed that it preferentially targeted E. coli topoisomerase I over human topoisomerase I, topoisomerase II and gyrase. Cleavage–religation assays confirmed DMA as a poison inhibitor of E. coli topoisomerase I. This study illuminates new properties of DMA, which may be further modified to develop an efficient topoisomerase inhibitor that is selective towards bacterial topoisomerase I. Conclusions This is the first report of a bis-benzimidazole acting as an E. coli topoisomerase I inhibitor. DMA is a safe, non-cytotoxic molecule to human cells at concentrations that are needed for antibacterial activity. PMID:22945915

  4. Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

    PubMed

    Gopinath, Ashwin; Rothemund, Paul W K

    2014-12-23

    Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

  5. Optimization of a reusable, DNA pseudoknot-based electrochemical sensor for sequence-specific DNA detection in blood serum.

    PubMed

    Cash, Kevin J; Heeger, Alan J; Plaxco, Kevin W; Xiao, Yi

    2009-01-15

    We describe in detail a new electrochemical DNA (E-DNA) sensing platform based on target-induced conformation changes in an electrode-bound DNA pseudoknot. The pseudoknot, a DNA structure containing two stem-loops in which the first stem's loop forms part of the second stem, is modified with a methylene blue redox tag at its 3' terminus and covalently attached to a gold electrode via the 5' terminus. In the absence of a target, the structure of the pseudoknot probe minimizes collisions between the redox tag and the electrode, thus reducing faradaic current. Target binding disrupts the pseudoknot structure, liberating a flexible, single-stranded element that can strike the electrode and efficiently transfer electrons. In this article we report further characterization and optimization of this new E-DNA architecture. We find that optimal signaling is obtained at an intermediate probe density ( approximately 1.8 x 10(13) molecules/cm(2) apparent density), which presumably represents a balance between steric and electrostatic blocking at high probe densities and increased background currents arising from transfer from the pseudoknot probe at lower densities. We also find that optimal 3' stem length, which appears to be 7 base pairs, represents a balance between pseudoknot structural stability and target affinity. Finally, a 3' loop comprised of poly(A) exhibits better mismatch discrimination than the equivalent poly(T) loop, but at the cost of decreased gain. Optimization over this parameter space significantly improves the signaling of the pseudoknot-based E-DNA architecture, leading to the ability to sensitively and specifically detect DNA targets even when challenged in complex, multicomponent samples such as blood serum.

  6. Optimization of a Reusable, DNA Pseudoknot-Based Electrochemical Sensor for Sequence-Specific DNA Detection in Blood Serum

    PubMed Central

    Cash, Kevin J.; Heeger, Alan J.; Plaxco, Kevin W.; Xiao, Yi

    2010-01-01

    We describe in detail a new electrochemical DNA (E-DNA) sensing platform based on target-induced conformation changes in an electrode-bound DNA pseudoknot. The pseudoknot, a DNA structure containing two stem-loops in which the first stem’s loop forms part of the second stem, is modified with a methylene blue redox tag at its 3′ terminus and covalently attached to a gold electrode via the 5′ terminus. In the absence of a target, the structure of the pseudoknot probe minimizes collisions between the redox tag and the electrode, thus reducing faradaic current. Target binding disrupts the pseudoknot structure, liberating a flexible, single-stranded element that can strike the electrode and efficiently transfer electrons. In this article we report further characterization and optimization of this new E-DNA architecture. We find that optimal signaling is obtained at an intermediate probe density (~1.8 × 1013 molecules/cm2 apparent density), which presumably represents a balance between steric and electrostatic blocking at high probe densities and increased background currents arising from transfer from the pseudoknot probe at lower densities. We also find that optimal 3′ stem length, which appears to be 7 base pairs, represents a balance between pseudoknot structural stability and target affinity. Finally, a 3′ loop comprised of poly(A) exhibits better mismatch discrimination than the equivalent poly(T) loop, but at the cost of decreased gain. Optimization over this parameter space significantly improves the signaling of the pseudoknot-based E-DNA architecture, leading to the ability to sensitively and specifically detect DNA targets even when challenged in complex, multicomponent samples such as blood serum. PMID:19093760

  7. Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

    PubMed

    Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

    2017-08-01

    Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

  8. Open-target sparse sensing of biological agents using DNA microarray

    PubMed Central

    2011-01-01

    Background Current biosensors are designed to target and react to specific nucleic acid sequences or structural epitopes. These 'target-specific' platforms require creation of new physical capture reagents when new organisms are targeted. An 'open-target' approach to DNA microarray biosensing is proposed and substantiated using laboratory generated data. The microarray consisted of 12,900 25 bp oligonucleotide capture probes derived from a statistical model trained on randomly selected genomic segments of pathogenic prokaryotic organisms. Open-target detection of organisms was accomplished using a reference library of hybridization patterns for three test organisms whose DNA sequences were not included in the design of the microarray probes. Results A multivariate mathematical model based on the partial least squares regression (PLSR) was developed to detect the presence of three test organisms in mixed samples. When all 12,900 probes were used, the model correctly detected the signature of three test organisms in all mixed samples (mean(R2)) = 0.76, CI = 0.95), with a 6% false positive rate. A sampling algorithm was then developed to sparsely sample the probe space for a minimal number of probes required to capture the hybridization imprints of the test organisms. The PLSR detection model was capable of correctly identifying the presence of the three test organisms in all mixed samples using only 47 probes (mean(R2)) = 0.77, CI = 0.95) with nearly 100% specificity. Conclusions We conceived an 'open-target' approach to biosensing, and hypothesized that a relatively small, non-specifically designed, DNA microarray is capable of identifying the presence of multiple organisms in mixed samples. Coupled with a mathematical model applied to laboratory generated data, and sparse sampling of capture probes, the prototype microarray platform was able to capture the signature of each organism in all mixed samples with high sensitivity and specificity. It was demonstrated

  9. Transposon facilitated DNA sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berg, D.E.; Berg, C.M.; Huang, H.V.

    1990-01-01

    The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

  10. Bipartite recognition of target RNAs activates DNA cleavage by the Type III-B CRISPR–Cas system

    PubMed Central

    Elmore, Joshua R.; Sheppard, Nolan F.; Ramia, Nancy; Deighan, Trace; Li, Hong; Terns, Rebecca M.; Terns, Michael P.

    2016-01-01

    CRISPR–Cas systems eliminate nucleic acid invaders in bacteria and archaea. The effector complex of the Type III-B Cmr system cleaves invader RNAs recognized by the CRISPR RNA (crRNA ) of the complex. Here we show that invader RNAs also activate the Cmr complex to cleave DNA. As has been observed for other Type III systems, Cmr eliminates plasmid invaders in Pyrococcus furiosus by a mechanism that depends on transcription of the crRNA target sequence within the plasmid. Notably, we found that the target RNA per se induces DNA cleavage by the Cmr complex in vitro. DNA cleavage activity does not depend on cleavage of the target RNA but notably does require the presence of a short sequence adjacent to the target sequence within the activating target RNA (rPAM [RNA protospacer-adjacent motif]). The activated complex does not require a target sequence (or a PAM) in the DNA substrate. Plasmid elimination by the P. furiosus Cmr system also does not require the Csx1 (CRISPR-associated Rossman fold [CARF] superfamily) protein. Plasmid silencing depends on the HD nuclease and Palm domains of the Cmr2 (Cas10 superfamily) protein. The results establish the Cmr complex as a novel DNA nuclease activated by invader RNAs containing a crRNA target sequence and a rPAM. PMID:26848045

  11. Single-molecule localization microscopy reveals molecular transactions during RAD51 filament assembly at cellular DNA damage sites

    PubMed Central

    Haas, Kalina T; Lee, MiYoung; Esposito, Alessandro; Venkitaraman, Ashok R

    2018-01-01

    Abstract RAD51 recombinase assembles on single-stranded (ss)DNA substrates exposed by DNA end-resection to initiate homologous recombination (HR), a process fundamental to genome integrity. RAD51 assembly has been characterized using purified proteins, but its ultrastructural topography in the cell nucleus is unexplored. Here, we combine cell genetics with single-molecule localization microscopy and a palette of bespoke analytical tools, to visualize molecular transactions during RAD51 assembly in the cellular milieu at resolutions approaching 30–40 nm. In several human cell types, RAD51 focalizes in clusters that progressively extend into long filaments, which abut—but do not overlap—with globular bundles of replication protein A (RPA). Extended filaments alter topographically over time, suggestive of succeeding steps in HR. In cells depleted of the tumor suppressor protein BRCA2, or overexpressing its RAD51-binding BRC repeats, RAD51 fails to assemble at damage sites, although RPA accumulates unhindered. By contrast, in cells lacking a BRCA2 carboxyl (C)-terminal region targeted by cancer-causing mutations, damage-induced RAD51 assemblies initiate but do not extend into filaments. We suggest a model wherein RAD51 assembly proceeds concurrently with end-resection at adjacent sites, via an initiation step dependent on the BRC repeats, followed by filament extension through the C-terminal region of BRCA2. PMID:29309696

  12. Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute.

    PubMed

    Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio

    2016-06-21

    Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson-Crick base-pairing even in the 3'-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5' base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region.

  13. Using the QCM Biosensor-Based T7 Phage Display Combined with Bioinformatics Analysis for Target Identification of Bioactive Small Molecule.

    PubMed

    Takakusagi, Yoichi; Takakusagi, Kaori; Sugawara, Fumio; Sakaguchi, Kengo

    2018-01-01

    Identification of target proteins that directly bind to bioactive small molecule is of great interest in terms of clarifying the mode of action of the small molecule as well as elucidating the biological phenomena at the molecular level. Of the experimental technologies available, T7 phage display allows comprehensive screening of small molecule-recognizing amino acid sequence from the peptide libraries displayed on the T7 phage capsid. Here, we describe the T7 phage display strategy that is combined with quartz-crystal microbalance (QCM) biosensor for affinity selection platform and bioinformatics analysis for small molecule-recognizing short peptides. This method dramatically enhances efficacy and throughput of the screening for small molecule-recognizing amino acid sequences without repeated rounds of selection. Subsequent execution of bioinformatics programs allows combinatorial and comprehensive target protein discovery of small molecules with its binding site, regardless of protein sample insolubility, instability, or inaccessibility of the fixed small molecules to internally located binding site on larger target proteins when conventional proteomics approaches are used.

  14. Direct Interaction between the WD40 Repeat Protein WDR-23 and SKN-1/Nrf Inhibits Binding to Target DNA

    PubMed Central

    Leung, Chi K.; Hasegawa, Koichi; Wang, Ying; Deonarine, Andrew; Tang, Lanlan; Miwa, Johji

    2014-01-01

    SKN-1/Nrf transcription factors activate cytoprotective genes in response to reactive small molecules and strongly influence stress resistance, longevity, and development. The molecular mechanisms of SKN-1/Nrf regulation are poorly defined. We previously identified the WD40 repeat protein WDR-23 as a repressor of Caenorhabditis elegans SKN-1 that functions with a ubiquitin ligase to presumably target the factor for degradation. However, SKN-1 activity and nuclear accumulation are not always correlated, suggesting that there could be additional regulatory mechanisms. Here, we integrate forward genetics and biochemistry to gain insights into how WDR-23 interacts with and regulates SKN-1. We provide evidence that WDR-23 preferentially regulates one of three SKN-1 variants through a direct interaction that is required for normal stress resistance and development. Homology modeling predicts that WDR-23 folds into a β-propeller, and we identify the top of this structure and four motifs at the termini of SKN-1c as essential for the interaction. Two of these SKN-1 motifs are highly conserved in human Nrf1 and Nrf2 and two directly interact with target DNA. Lastly, we demonstrate that WDR-23 can block the ability of SKN-1c to interact with DNA sequences of target promoters identifying a new mechanism of regulation that is independent of the ubiquitin proteasome system, which can become occupied with damaged proteins during stress. PMID:24912676

  15. STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

    PubMed Central

    Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

    2013-01-01

    The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

  16. A universal molecular translator for non-nucleic acid targets that enables dynamic DNA assemblies and logic operations.

    PubMed

    Tang, Wei; Hu, Shichao; Wang, Huaming; Zhao, Yan; Li, Na; Liu, Feng

    2014-11-28

    A universal molecular translator based on the target-triggered DNA strand displacement was developed, which was able to convert various kinds of non-nucleic acid targets into a unique output DNA. This translation strategy was successfully applied in directing dynamic DNA assemblies and in realizing three-input logic gate operations.

  17. Engineering self-contained DNA circuit for proximity recognition and localized signal amplification of target biomolecules

    PubMed Central

    Ang, Yan Shan; Yung, Lin-Yue Lanry

    2014-01-01

    Biomolecular interactions have important cellular implications, however, a simple method for the sensing of such proximal events is lacking in the current molecular toolbox. We designed a dynamic DNA circuit capable of recognizing targets in close proximity to initiate a pre-programmed signal transduction process resulting in localized signal amplification. The entire circuit was engineered to be self-contained, i.e. it can self-assemble onto individual target molecules autonomously and form localized signal with minimal cross-talk. α-thrombin was used as a model protein to evaluate the performance of the individual modules and the overall circuit for proximity interaction under physiologically relevant buffer condition. The circuit achieved good selectivity in presence of non-specific protein and interfering serum matrix and successfully detected for physiologically relevant α-thrombin concentration (50 nM–5 μM) in a single mixing step without any further washing. The formation of localized signal at the interaction site can be enhanced kinetically through the control of temperature and probe concentration. This work provides a basic general framework from which other circuit modules can be adapted for the sensing of other biomolecular or cellular interaction of interest. PMID:25056307

  18. Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

    NASA Astrophysics Data System (ADS)

    Huschka, Ryan

    demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

  19. How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

    PubMed Central

    2017-01-01

    Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

  20. DNA Nanotechnology-Enabled Drug Delivery Systems.

    PubMed

    Hu, Qinqin; Li, Hua; Wang, Lihua; Gu, Hongzhou; Fan, Chunhai

    2018-02-21

    Over the past decade, we have seen rapid advances in applying nanotechnology in biomedical areas including bioimaging, biodetection, and drug delivery. As an emerging field, DNA nanotechnology offers simple yet powerful design techniques for self-assembly of nanostructures with unique advantages and high potential in enhancing drug targeting and reducing drug toxicity. Various sequence programming and optimization approaches have been developed to design DNA nanostructures with precisely engineered, controllable size, shape, surface chemistry, and function. Potent anticancer drug molecules, including Doxorubicin and CpG oligonucleotides, have been successfully loaded on DNA nanostructures to increase their cell uptake efficiency. These advances have implicated the bright future of DNA nanotechnology-enabled nanomedicine. In this review, we begin with the origin of DNA nanotechnology, followed by summarizing state-of-the-art strategies for the construction of DNA nanostructures and drug payloads delivered by DNA nanovehicles. Further, we discuss the cellular fates of DNA nanostructures as well as challenges and opportunities for DNA nanostructure-based drug delivery.