Sample records for target physics driven

  1. Temporally resolved proton radiography of rapidly varying electric and magnetic fields in laser-driven capacitor coil targets

    NASA Astrophysics Data System (ADS)

    Morace, A.; Santos, J. J.; Bailly-Grandvaux, M.; Ehret, M.; Alpinaniz, J.; Brabetz, C.; Schaumann, G.; Volpe, L.

    2017-02-01

    Understanding the dynamics of rapidly varying electromagnetic fields in intense short pulse laser plasma interactions is of key importance to understand the mechanisms at the basis of a wide variety of physical processes, from high energy density physics and fusion science to the development of ultrafast laser plasma devices to control laser-generated particle beams. Target normal sheath accelerated (TNSA) proton radiography represents an ideal tool to diagnose ultrafast electromagnetic phenomena, providing 2D spatially and temporally resolved radiographs with temporal resolution varying from 2-3 ps to few tens of ps. In this work we introduce the proton radiography technique and its application to diagnose the spatial and temporal evolution of electromagnetic fields in laser-driven capacitor coil targets.

  2. Kilotesla Magnetic Field due to a Capacitor-Coil Target Driven by High Power Laser

    PubMed Central

    Fujioka, Shinsuke; Zhang, Zhe; Ishihara, Kazuhiro; Shigemori, Keisuke; Hironaka, Youichiro; Johzaki, Tomoyuki; Sunahara, Atsushi; Yamamoto, Naoji; Nakashima, Hideki; Watanabe, Tsuguhiro; Shiraga, Hiroyuki; Nishimura, Hiroaki; Azechi, Hiroshi

    2013-01-01

    Laboratory generation of strong magnetic fields opens new frontiers in plasma and beam physics, astro- and solar-physics, materials science, and atomic and molecular physics. Although kilotesla magnetic fields have already been produced by magnetic flux compression using an imploding metal tube or plasma shell, accessibility at multiple points and better controlled shapes of the field are desirable. Here we have generated kilotesla magnetic fields using a capacitor-coil target, in which two nickel disks are connected by a U-turn coil. A magnetic flux density of 1.5 kT was measured using the Faraday effect 650 μm away from the coil, when the capacitor was driven by two beams from the GEKKO-XII laser (at 1 kJ (total), 1.3 ns, 0.53 or 1 μm, and 5 × 1016 W/cm2). PMID:23378905

  3. The Role of Emotion-Driven Impulse Control Difficulties in the Relation Between Social Anxiety and Aggression.

    PubMed

    Dixon, Laura J; Tull, Matthew T; Lee, Aaron A; Kimbrel, Nathan A; Gratz, Kim L

    2017-06-01

    To enhance our understanding of the factors that may account for increased aggression in socially anxious individuals, this study examined associations among emotion-driven impulse control difficulties, social anxiety, and dimensions of aggression (i.e., hostility, anger, physical aggression, verbal aggression). Individuals (N = 107; 73.8% male; M age = 40.8 years) receiving residential substance abuse treatment participated in this cross-sectional study. Social anxiety symptoms were significantly positively correlated with emotion-driven impulse control difficulties, anger, and hostility, but not verbal or physical aggression. Separate models for each aggression facet were examined to test the direct and indirect paths. Bootstrapped mediation analyses indicated a significant indirect path from social anxiety symptoms to each facet of aggression through emotion-driven impulse control difficulties (ps < .05). Results highlight the potential utility of targeting emotion-driven impulse control difficulties to decrease aggression among socially anxious individuals. © 2016 Wiley Periodicals, Inc.

  4. Implosion of multilayered cylindrical targets driven by intense heavy ion beams.

    PubMed

    Piriz, A R; Portugues, R F; Tahir, N A; Hoffmann, D H H

    2002-11-01

    An analytical model for the implosion of a multilayered cylindrical target driven by an intense heavy ion beam has been developed. The target is composed of a cylinder of frozen hydrogen or deuterium, which is enclosed in a thick shell of solid lead. This target has been designed for future high-energy-density matter experiments to be carried out at the Gesellschaft für Schwerionenforschung, Darmstadt. The model describes the implosion dynamics including the motion of the incident shock and the first reflected shock and allows for calculation of the physical conditions of the hydrogen at stagnation. The model predicts that the conditions of the compressed hydrogen are not sensitive to significant variations in target and beam parameters. These predictions are confirmed by one-dimensional numerical simulations and thus allow for a robust target design.

  5. Double shell planar experiments on OMEGA

    NASA Astrophysics Data System (ADS)

    Dodd, E. S.; Merritt, E. C.; Palaniyappan, S.; Montgomery, D. S.; Daughton, W. S.; Schmidt, D. W.; Cardenas, T.; Wilson, D. C.; Loomis, E. N.; Batha, S. H.; Ping, Y.; Smalyuk, V. A.; Amendt, P. A.

    2017-10-01

    The double shell project is aimed at fielding neutron-producing capsules at the National Ignition Facility (NIF), in which an outer low-Z ablator collides with an inner high-Z shell to compress the fuel. However, understanding these targets experimentally can be challenging when compared with conventional single shell targets. Halfraum-driven planar targets at OMEGA are being used to study physics issues important to double shell implosions outside of a convergent geometry. Both VISAR and radiography through a tube have advantages over imaging through the hohlraum and double-shell capsule at NIF. A number physics issues are being studied with this platform that include 1-d and higher dimensional effects such as defect-driven hydrodynamic instabilities from engineering features. Additionally, the use of novel materials with controlled density gradients require study in easily diagnosed 1-d systems. This work ultimately feeds back into the NIF capsule platform through manufacturing tolerances set using data from OMEGA. Supported under the US DOE by the LANS, LLC under contract DE-AC52-06NA25396. LA-UR-17-25386.

  6. Energy research: accelerator builders eager to aid fusion work.

    PubMed

    Metz, W D

    1976-10-15

    Useful fusion energy may be generated by means of heavy ion accelerator driven implosions if the contraints dictated by the physics and economics of thermonuclear targets and reactors can be satisfied.

  7. Radiological Aspects of Heavy Metal Liquid Targets for Accelerator-Driven Systems as Intense Neutron Sources

    NASA Astrophysics Data System (ADS)

    Gai, E. V.; Ignatyuk, A. V.; Lunev, V. P.; Shubin, Yu. N.

    2001-11-01

    General problems arising in development of intense neutron sources as a part of accelerator-driven systems and first experience accumulated in IPPE during last several years are briefly discussed. The calculation and analysis of nuclear-physical properties of the targets, such as the accumulation of spallation reaction products, activity and heat release for various versions of heavy liquid metal targets were performed in IPPE. The sensitivity of the results of calculations to the various sets of nuclear data was considered. The main radiology characteristics of the lead-bismuth target, which is now under construction in the frame of ISTC Project # 559, are briefly described. The production of short-lived nuclides was estimated, the total activity and volatile nuclide accumulation, residual heat release, the energies of various decay modes were analysed.

  8. Isochoric heating and strong blast wave formation driven by fast electrons in solid-density targets

    NASA Astrophysics Data System (ADS)

    Santos, J. J.; Vauzour, B.; Touati, M.; Gremillet, L.; Feugeas, J.-L.; Ceccotti, T.; Bouillaud, R.; Deneuville, F.; Floquet, V.; Fourment, C.; Hadj-Bachir, M.; Hulin, S.; Morace, A.; Nicolaï, Ph; d'Oliveira, P.; Reau, F.; Samaké, A.; Tcherbakoff, O.; Tikhonchuk, V. T.; Veltcheva, M.; Batani, D.

    2017-10-01

    We experimentally investigate the fast (< 1 {ps}) isochoric heating of multi-layer metallic foils and subsequent high-pressure hydrodynamics induced by energetic electrons driven by high-intensity, high-contrast laser pulses. The early-time temperature profile inside the target is measured from the streaked optical pyrometry of the target rear side. This is further characterized from benchmarked simulations of the laser-target interaction and the fast electron transport. Despite a modest laser energy (< 1 {{J}}), the early-time high pressures and associated gradients launch inwards a strong compression wave developing over ≳ 10 ps into a ≈ 140 {Mbar} blast wave, according to hydrodynamic simulations, consistent with our measurements. These experimental and numerical findings pave the way to a short-pulse-laser-based platform dedicated to high-energy-density physics studies.

  9. Irrelevant learned reward associations disrupt voluntary spatial attention.

    PubMed

    MacLean, Mary H; Diaz, Gisella K; Giesbrecht, Barry

    2016-10-01

    Attention can be guided involuntarily by physical salience and by non-salient, previously learned reward associations that are currently task-irrelevant. Attention can be guided voluntarily by current goals and expectations. The current study examined, in two experiments, whether irrelevant reward associations could disrupt current, goal-driven, voluntary attention. In a letter-search task, attention was directed voluntarily (i.e., cued) on half the trials by a cue stimulus indicating the hemifield in which the target letter would appear with 100 % accuracy. On the other half of the trials, a cue stimulus was presented, but it did not provide information about the target hemifield (i.e., uncued). On both cued and uncued trials, attention could be involuntarily captured by the presence of a task-irrelevant, and physically non-salient, color, either within the cued or the uncued hemifield. Importantly, one week prior to the letter search task, the irrelevant color had served as a target feature that was predictive of reward in a separate training task. Target identification accuracy was better on cued compared to uncued trials. However, this effect was reduced when the irrelevant, and physically non-salient, reward-associated feature was present in the uncued hemifield. This effect was not observed in a second, control experiment in which the irrelevant color was not predictive of reward during training. Our results indicate that involuntary, value-driven capture can disrupt the voluntary control of spatial attention.

  10. Study of Plasma Liner Driven Magnetized Target Fusion Via Advanced Simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samulyak, Roman V.; Brookhaven National Lab.; Parks, Paul

    The feasibility of the plasma liner driven Magnetized Target Fusion (MTF) via terascale numerical simulations will be assessed. In the MTF concept, a plasma liner, formed by merging of a number (60 or more) of radial, highly supersonic plasma jets, implodes on the target in the form of two compact plasma toroids, and compresses it to conditions of the fusion ignition. By avoiding major difficulties associated with both the traditional laser driven inertial confinement fusion and solid liner driven MTF, the plasma liner driven MTF potentially provides a low-cost and fast R&D path towards the demonstration of practical fusion energy.more » High fidelity numerical simulations of full nonlinear models associated with the plasma liner MTF using state-of-art numerical algorithms and terascale computing are necessary in order to resolve uncertainties and provide guidance for future experiments. At Stony Brook University, we have developed unique computational capabilities that ideally suite the MTF problem. The FronTier code, developed in collaboration with BNL and LANL under DOE funding including SciDAC for the simulation of 3D multi-material hydro and MHD flows, has beenbenchmarked and used for fundamental and engineering problems in energy science applications. We have performed 3D simulations of converging supersonic plasma jets, their merger and the formation of the plasma liner, and a study of the corresponding oblique shock problem. We have studied the implosion of the plasma liner on the magnetized plasma target by resolving Rayleigh-Taylor instabilities in 2D and 3D and other relevant physics and estimate thermodynamic conditions of the target at the moment of maximum compression and the hydrodynamic efficiency of the method.« less

  11. Improvement or selection? A longitudinal analysis of students' views about experimental physics in their lab courses

    NASA Astrophysics Data System (ADS)

    Wilcox, Bethany R.; Lewandowski, H. J.

    2017-12-01

    Laboratory courses represent a unique and potentially important component of the undergraduate physics curriculum, which can be designed to allow students to authentically engage with the process of experimental physics. Among other possible benefits, participation in these courses throughout the undergraduate physics curriculum presents an opportunity to develop students' understanding of the nature and importance of experimental physics within the discipline as a whole. Here, we present and compare both a longitudinal and pseudolongitudinal analysis of students' responses to a research-based assessment targeting students' views about experimental physics—the Colorado Learning Attitudes about Science Survey for Experimental Physics (E-CLASS)—across multiple, required lab courses at a single institution. We find that, while pseudolongitudinal averages showed increases in students' E-CLASS scores in each consecutive course, analysis of longitudinal data indicates that this increase was not driven by a cumulative impact of laboratory instruction. Rather, the increase was driven by a selection effect in which students who persisted into higher-level lab courses already had more expertlike beliefs, attitudes, and expectations than their peers when they started the lower-level courses.

  12. Generation of quasi-monoenergetic protons from a double-species target driven by the radiation pressure of an ultraintense laser pulse

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pae, Ki Hong; Kim, Chul Min, E-mail: chulmin@gist.ac.kr; Advanced Photonics Research Institute, Gwangju Institute of Science and Technology, Gwangju 61005

    In laser-driven proton acceleration, generation of quasi-monoenergetic proton beams has been considered a crucial feature of the radiation pressure acceleration (RPA) scheme, but the required difficult physical conditions have hampered its experimental realization. As a method to generate quasi-monoenergetic protons under experimentally viable conditions, we investigated using double-species targets of controlled composition ratio in order to make protons bunched in the phase space in the RPA scheme. From a modified optimum condition and three-dimensional particle-in-cell simulations, we showed by varying the ion composition ratio of proton and carbon that quasi-monoenergetic protons could be generated from ultrathin plane targets irradiated withmore » a circularly polarized Gaussian laser pulse. The proposed scheme should facilitate the experimental realization of ultrashort quasi-monoenergetic proton beams for unique applications in high field science.« less

  13. Semi-analytic model of plasma-jet-driven magneto-inertial fusion

    DOE PAGES

    Langendorf, Samuel J.; Hsu, Scott C.

    2017-03-01

    A semi-analytic model for plasma-jet-driven magneto-inertial fusion is presented here. Compressions of a magnetized plasma target by a spherically imploding plasma liner are calculated in one dimension (1D), accounting for compressible hydrodynamics and ionization of the liner material, energy losses due to conduction and radiation, fusion burn and alpha deposition, separate ion and electron temperatures in the target, magnetic pressure, and fuel burn-up. Results show 1D gains of 3–30 at spherical convergence ratio <15 and 20–40 MJ of liner energy, for cases in which the liner thickness is 1 cm and the initial radius of a preheated magnetized target ismore » 4 cm. Some exploration of parameter space and physics settings is presented. The yields observed suggest that there is a possibility of igniting additional dense fuel layers to reach high gain.« less

  14. The unique contributions of perceiver and target characteristics in person perception.

    PubMed

    Hehman, Eric; Sutherland, Clare A M; Flake, Jessica K; Slepian, Michael L

    2017-10-01

    Models of person perception have long asserted that our impressions of others are guided by characteristics of both the target and perceiver. However, research has not yet quantified to what extent perceivers and targets contribute to different impressions. This quantification is theoretically critical, as it addresses how much an impression arises from "our minds" versus "others' faces." Here, we apply cross-classified random effects models to address this fundamental question in social cognition, using approximately 700,000 ratings of faces. With this approach, we demonstrate that (a) different trait impressions have unique causal processes, meaning that some impressions are largely informed by perceiver-level characteristics whereas others are driven more by physical target-level characteristics; (b) modeling of perceiver- and target-variance in impressions informs fundamental models of social perception; (c) Perceiver × Target interactions explain a substantial portion of variance in impressions; (d) greater emotional intensity in stimuli decreases the influence of the perceiver; and (e) more variable, naturalistic stimuli increases variation across perceivers. Important overarching patterns emerged. Broadly, traits and dimensions representing inferences of character (e.g., dominance) are driven more by perceiver characteristics than those representing appearance-based appraisals (e.g., youthful-attractiveness). Moreover, inferences made of more ambiguous traits (e.g., creative) or displays (e.g., faces with less extreme emotions, less-controlled stimuli) are similarly driven more by perceiver than target characteristics. Together, results highlight the large role that perceiver and target variability play in trait impressions, and develop a new topography of trait impressions that considers the source of the impression. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  15. The Healthy Children, Strong Families Intervention: Design and Community Participation

    ERIC Educational Resources Information Center

    Adams, Alexandra K.; LaRowe, Tara L.; Cronin, Kate A.; Prince, Ronald J.; Wubben, Deborah P.; Parker, Tassy; Jobe, Jared B.

    2012-01-01

    Healthy Children, Strong Families (HCSF) is a 2-year, community-driven, family-based randomized controlled trial of a healthy lifestyles intervention conducted in partnership with four Wisconsin American Indian tribes. HCSF is composed of 1 year of targeted home visits to deliver nutritional and physical activity curricula. During Year 1, trained…

  16. Diagnostic Opportunities Using Rasch Measurement in the Context of a Misconceptions-Based Physical Science Assessment

    ERIC Educational Resources Information Center

    Wind, Stefanie A.; Gale, Jessica D.

    2015-01-01

    Multiple-choice (MC) items that are constructed such that distractors target known misconceptions for a particular domain provide useful diagnostic information about student misconceptions (Herrmann-Abell & DeBoer, 2011, 2014; Sadler, 1998). Item response theory models can be used to examine misconceptions distractor-driven multiple-choice…

  17. Modeling dynamic plasmas driven by ultraintense nano-focused x-ray laser pulses in solid iron targets

    NASA Astrophysics Data System (ADS)

    Royle, Ryan; Sentoku, Yasuhiko; Mancini, Roberto

    2017-10-01

    The hard x-ray free electron laser has proven to be a valuable tool for high energy density (HED) physics as it is able to produce well-characterized samples of HED matter at exactly solid density and homogeneous temperatures. However, if the x-ray pulses are focused to sub-micron spot sizes, where peak intensities can exceed 1020 W/cm2, the plasmas driven by sources of non-thermal photoelectrons and Auger electrons can be highly dynamic and so cannot be modeled by atomic kinetics or fluid codes. We apply the 2D/3D particle-in-cell code, PICLS-which has been extended with numerous physics models to enable the simulation of XFEL-driven plasmas-to the modeling of such dynamic plasmas driven by nano-focused XFEL pulses in solid iron targets. In the case of the smallest focal spot investigated of just 100 nm in diameter, keV plasmas induce strong radial E-fields that accelerate keV ions radially as well as sheath fields that accelerate surface ions to hundreds of keV. The heated spot, which is initially larger than the laser spot due to the kinetic nature of the fast Auger electrons, expands as ion and electron waves propagate radially, leaving a low density region along the laser axis. This research was supported by the US DOE-OFES under Grant No. DE-SC0008827, the DOE-NNSA under Grant No. DE-NA0002075, and the JSPS KAKENHI under Grant No. JP15K21767.

  18. Assessment of Laser-Driven Pulsed Neutron Sources for Poolside Neutron-based Advanced NDE – A Pathway to LANSCE-like Characterization at INL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roth, Markus; Vogel, Sven C.; Bourke, Mark Andrew M.

    A variety of opportunities for characterization of fresh nuclear fuels using thermal (~25meV) and epithermal (~10eV) neutrons have been documented at Los Alamos National Laboratory. They include spatially resolved non-destructive characterization of features, isotopic enrichment, chemical heterogeneity and stoichiometry. The LANSCE spallation neutron source is well suited in neutron fluence and temporal characteristics for studies of fuels. However, recent advances in high power short pulse lasers suggest that compact neutron sources might, over the next decade, become viable at a price point that would permit their consideration for poolside characterization on site at irradiation facilities. In a laser-driven neutron sourcemore » the laser is used to accelerate deuterium ions into a beryllium target where neutrons are produced. At this time, the technology is new and their total neutron production is approximately four orders of magnitude less than a facility like LANSCE. However, recent measurements on a sub-optimized system demonstrated >10 10 neutrons in sub-nanosecond pulses in predominantly forward direction. The compactness of the target system compared to a spallation target may allow exchanging the target during a measurement to e.g. characterize a highly radioactive sample with thermal, epithermal, and fast neutrons as well as hard X-rays, thus avoiding sample handling. At this time several groups are working on laser-driven neutron production and are advancing concepts for lasers, laser targets, and optimized neutron target/moderator systems. Advances in performance sufficient to enable poolside fuels characterization with LANSCE-like fluence on sample within a decade may be possible. This report describes the underlying physics and state-of-the-art of the laser-driven neutron production process from the perspective of the DOE/NE mission. It also discusses the development and understanding that will be necessary to provide customized capability for characterization of irradiated fuels. Potential operational advantages compared to a spallation neutron source include reduced shielding complexity, reduced energy requirements, and a production target free of fission products. Contributors to this report include experts in laser-driven neutron production (Roth, Fernandez), laser design (Haefner, Siders, Leemans), laser target design (Glenzer), spallation target/moderator design (Mocko), neutron instrumentation and characterization applications (Vogel, Bourke).« less

  19. Contexts, Mechanisms, and Outcomes That Matter in Dutch Community-Based Physical Activity Programs Targeting Socially Vulnerable Groups.

    PubMed

    Herens, Marion; Wagemakers, Annemarie; Vaandrager, Lenneke; van Ophem, Johan; Koelen, Maria

    2017-09-01

    This article presents a practitioner-based approach to identify key combinations of contextual factors (C) and mechanisms (M) that trigger outcomes (O) in Dutch community-based health-enhancing physical activity (CBHEPA) programs targeting socially vulnerable groups. Data were collected in six programs using semi-structured interviews and focus groups using a timeline technique. Sessions were recorded, anonymized, and transcribed. A realist synthesis protocol was used for data-driven and thematic analysis of CMO configurations. CMO configurations related to community outreach, program sustainability, intersectoral collaboration, and enhancing participants' active lifestyles. We have refined the CBHEPA program theory by showing that actors' passion for, and past experiences with, physical activity programs trigger outcomes, alongside their commitment to socially vulnerable target groups. Project discontinuity, limited access to resources, and a trainer's stand-alone position were negative configurations. The authors conclude that local governance structures appear often to lack adaptive capacity to accommodate multilevel processes to sustain programs.

  20. Critical mingling and universal correlations in model binary active liquids

    NASA Astrophysics Data System (ADS)

    Bain, Nicolas; Bartolo, Denis

    2017-06-01

    Ensembles of driven or motile bodies moving along opposite directions are generically reported to self-organize into strongly anisotropic lanes. Here, building on a minimal model of self-propelled bodies targeting opposite directions, we first evidence a critical phase transition between a mingled state and a phase-separated lane state specific to active particles. We then demonstrate that the mingled state displays algebraic structural correlations also found in driven binary mixtures. Finally, constructing a hydrodynamic theory, we single out the physical mechanisms responsible for these universal long-range correlations typical of ensembles of oppositely moving bodies.

  1. Initial Results from an Energy-Aware Airborne Dynamic, Data-Driven Application System Performing Sampling in Coherent Boundary-Layer Structures

    NASA Astrophysics Data System (ADS)

    Frew, E.; Argrow, B. M.; Houston, A. L.; Weiss, C.

    2014-12-01

    The energy-aware airborne dynamic, data-driven application system (EA-DDDAS) performs persistent sampling in complex atmospheric conditions by exploiting wind energy using the dynamic data-driven application system paradigm. The main challenge for future airborne sampling missions is operation with tight integration of physical and computational resources over wireless communication networks, in complex atmospheric conditions. The physical resources considered here include sensor platforms, particularly mobile Doppler radar and unmanned aircraft, the complex conditions in which they operate, and the region of interest. Autonomous operation requires distributed computational effort connected by layered wireless communication. Onboard decision-making and coordination algorithms can be enhanced by atmospheric models that assimilate input from physics-based models and wind fields derived from multiple sources. These models are generally too complex to be run onboard the aircraft, so they need to be executed in ground vehicles in the field, and connected over broadband or other wireless links back to the field. Finally, the wind field environment drives strong interaction between the computational and physical systems, both as a challenge to autonomous path planning algorithms and as a novel energy source that can be exploited to improve system range and endurance. Implementation details of a complete EA-DDDAS will be provided, along with preliminary flight test results targeting coherent boundary-layer structures.

  2. Science Goal Driven Observing and Spacecraft Autonomy

    NASA Technical Reports Server (NTRS)

    Koratkar, Amuradha; Grosvenor, Sandy; Jones, Jeremy; Wolf, Karl

    2002-01-01

    Spacecraft autonomy will be an integral part of mission operations in the coming decade. While recent missions have made great strides in the ability to autonomously monitor and react to changing health and physical status of spacecraft, little progress has been made in responding quickly to science driven events. For observations of inherently variable targets and targets of opportunity, the ability to recognize early if an observation will meet the science goals of a program, and react accordingly, can have a major positive impact on the overall scientific returns of an observatory and on its operational costs. If the onboard software can reprioritize the schedule to focus on alternate targets, discard uninteresting observations prior to downloading, or download a subset of observations at a reduced resolution, the spacecraft's overall efficiency will be dramatically increased. The science goal monitoring (SGM) system is a proof-of-concept effort to address the above challenge. The SGM will have an interface to help capture higher level science goals from the scientists and translate them into a flexible observing strategy that SGM can execute and monitor. We are developing an interactive distributed system that will use on-board processing and storage combined with event-driven interfaces with ground-based processing and operations, to enable fast re-prioritization of observing schedules, and to minimize time spent on non-optimized observations.

  3. Enhanced reproducibility of L-mode plasma discharges via physics-model-based q-profile feedback control in DIII-D

    NASA Astrophysics Data System (ADS)

    Schuster, E.; Wehner, W. P.; Barton, J. E.; Boyer, M. D.; Luce, T. C.; Ferron, J. R.; Holcomb, C. T.; Walker, M. L.; Humphreys, D. A.; Solomon, W. M.; Penaflor, B. G.; Johnson, R. D.

    2017-11-01

    Recent experiments on DIII-D demonstrate the potential of physics-model-based q-profile control to improve reproducibility of plasma discharges. A combined feedforward  +  feedback control scheme is employed to optimize the current ramp-up phase by consistently achieving target q profiles (Target 1: q_min=1.3, q95=4.4 ; Target 2: q_min=1.65, q95=5.0 ; Target 3: q_min=2.1, q95=6.2 ) at prescribed times during the plasma formation phase (Target 1: t=1.5 s; Target 2: t=1.3 s; Target 3: t=1.0 s). At the core of the control scheme is a nonlinear, first-principles-driven, physics-based, control-oriented model of the plasma dynamics valid for low confinement (L-mode) scenarios. To prevent undesired L-H transitions, a constraint on the maximum allowable total auxiliary power is imposed in addition to the maximum powers for the individual heating and current-drive sources. Experimental results are presented to demonstrate the effectiveness of the combined feedforward  +  feedback control scheme to consistently achieve the desired target profiles at the predefined times. These results also show how the addition of feedback control significantly improves upon the feedforward-only control solution by reducing the matching error and also how the feedback controller is able to reduce the matching error as the constraint on the maximum allowable total auxiliary power is relaxed while keeping the plasma in L-mode.

  4. Solid hydrogen target for laser driven proton acceleration

    NASA Astrophysics Data System (ADS)

    Perin, J. P.; Garcia, S.; Chatain, D.; Margarone, D.

    2015-05-01

    The development of very high power lasers opens up new horizons in various fields, such as laser plasma acceleration in Physics and innovative approaches for proton therapy in Medicine. Laser driven proton acceleration is commonly based on the so-called Target Normal Sheath Acceleration (TNSA) mechanisms: a high power laser is focused onto a solid target (thin metallic or plastic foil) and interact with matter at very high intensity, thus generating a plasma; as a consequence "hot" electrons are produced and move into the forward direction through the target. Protons are generated at the target rear side, electrons try to escape from the target and an ultra-strong quasi-electrostatic field (~1TV/m) is generated. Such a field can accelerate protons with a wide energy spectrum (1-200 MeV) in a few tens of micrometers. The proton beam characteristics depend on the laser parameters and on the target geometry and nature. This technique has been validated experimentally in several high power laser facilities by accelerating protons coming from hydrogenated contaminant (mainly water) at the rear of metallic target, however, several research groups are investigating the possibility to perform experiments by using "pure" hydrogen targets. In this context, the low temperature laboratory at CEA-Grenoble has developed a cryostat able to continuously produce a thin hydrogen ribbon (from 40 to 100 microns thick). A new extrusion concept, without any moving part has been carried out, using only the thermodynamic properties of the fluid. First results and perspectives are presented in this paper.

  5. Transmutation of uranium and thorium in the particle field of the Quinta sub-critical assembly

    NASA Astrophysics Data System (ADS)

    Hashemi-Nezhad, S. R.; Asquith, N. L.; Voronko, V. A.; Sotnikov, V. V.; Zhadan, Alina; Zhuk, I. V.; Potapenko, A.; Husak, Krystsina; Chilap, V.; Adam, J.; Baldin, A.; Berlev, A.; Furman, W.; Kadykov, M.; Khushvaktov, J.; Kudashkin, I.; Mar'in, I.; Paraipan, M.; Pronskih, V.; Solnyshkin, A.; Tyutyunnikov, S.

    2018-03-01

    The fission rates of natural uranium and thorium were measured in the particle field of Quinta, a 512 kg natural uranium target-blanket sub-critical assembly. The Quinta assembly was irradiated with deuterons of energy 4 GeV from the Nuclotron accelerator of the Joint Institute for Nuclear Research (JINR), Dubna, Russia. Fission rates of uranium and thorium were measured using Gamma spectroscopy and fission track techniques. The production rate of 239Np was also measured. The obtained experimental results were compared with Monte Carlo predictions using the MCNPX 2.7 code employing the physics and fission-evaporation models of INCL4-ABLA, CEM03.03 and LAQGSM03.03. Some of the neutronic characteristics of the Quinta are compared with the "Energy plus Transmutation (EpT)" subcritical assembly, which is composed of a lead target and natU blanket. This comparison clearly demonstrates the importance of target material, neutron moderator and reflector types on the performance of a spallation neutron driven subcritical system. As the dimensions of the Quinta are very close to those of an optimal multi-rod-uranium target, the experimental and Monte Carlo calculation results presented in this paper provide insights on the particle field within a uranium target as well as in Accelerator Driven Systems in general.

  6. Deuteron Beam Driven Fast Ignition of a Pre-Compressed Inertial Confinement Fusion (ICF) Fuel Capsule

    NASA Astrophysics Data System (ADS)

    Yang, Xiaoling; Miley, George; Flippo, Kirk; Hora, Heinrich; Gaillard, Sandrine; Offermann, Dustin

    2012-10-01

    We proposed to utilize a new ``Deuterium Cluster'' type structure for the laser interaction foil to generate an energetic deuteron beam as the fast igniter to ignite inertial confinement fusion fuel capsule. The benefit of deuteron beam driven fast ignition is that its deposition in the target fuel will not only provide heating but also fuse with fuel as they slow down in the target. The preliminary results from recent laser-deuteron acceleration experiment at LANL were encouraging. Also, in most recent calculations, we found that a 12.73% extra energy gain from deuteron beam-target fusion could be achieved when quasi-Maxwellian deuteron beam was assumed, and when a ρrb = 4.5 g/cm2 was considered, where ρ is the fuel density, and rb is the ion beam focusing radius on the target. These results provide some insight into the contribution of the extra heat produced by deuteron beam-target fusion to the hot spot ignition process. If the physics works as anticipated, this novel type of interaction foil can efficiently generate energetic deuterons during intense laser pulses. The massive yield of deuterons should turn out to be the most efficient way of igniting the DT fuel, making the dream of near-term commercialization of FI fusion more achievable.

  7. Shock-driven Rayleigh-Taylor / Richtmyer-Meshkov 2D multimode ripple evolution before and after re-shock

    NASA Astrophysics Data System (ADS)

    Nagel, Sabrina; Huntington, Channing; Bender, Jason; Raman, Kumar; Baumann, Ted; MacLaren, Stephan; Prisbrey, Shon; Zhou, Ye

    2017-10-01

    Laser-driven hydrodynamic experiments allow for the precise control over several important experimental parameters, including the timing of the laser irradiation delivered and the initial conditions of the laser-driven target. Our experimental platform at the National Ignition Facility enables the investigation of the physics of instability growth after the passage of a second shock (``reshock''). This is done by varying the laser to change the strength and timing of the secondary shock. Here we present x-ray images capturing the rapid post-reshock instability growth for a set of reshock strengths. The radiation hydrodynamics simulations used to design these experiments are also introduced. This work was performed under the auspices of the Lawrence Livermore National Security, LLC, (LLNS) under Contract No. DE-AC52-07NA27344. LLNL-ABS-734509.

  8. Using phase for radar scatterer classification

    NASA Astrophysics Data System (ADS)

    Moore, Linda J.; Rigling, Brian D.; Penno, Robert P.; Zelnio, Edmund G.

    2017-04-01

    Traditional synthetic aperture radar (SAR) systems tend to discard phase information of formed complex radar imagery prior to automatic target recognition (ATR). This practice has historically been driven by available hardware storage, processing capabilities, and data link capacity. Recent advances in high performance computing (HPC) have enabled extremely dense storage and processing solutions. Therefore, previous motives for discarding radar phase information in ATR applications have been mitigated. First, we characterize the value of phase in one-dimensional (1-D) radar range profiles with respect to the ability to correctly estimate target features, which are currently employed in ATR algorithms for target discrimination. These features correspond to physical characteristics of targets through radio frequency (RF) scattering phenomenology. Physics-based electromagnetic scattering models developed from the geometrical theory of diffraction are utilized for the information analysis presented here. Information is quantified by the error of target parameter estimates from noisy radar signals when phase is either retained or discarded. Operating conditions (OCs) of signal-tonoise ratio (SNR) and bandwidth are considered. Second, we investigate the value of phase in 1-D radar returns with respect to the ability to correctly classify canonical targets. Classification performance is evaluated via logistic regression for three targets (sphere, plate, tophat). Phase information is demonstrated to improve radar target classification rates, particularly at low SNRs and low bandwidths.

  9. MTF Driven by Plasma Liner Dynamically Formed by the Merging of Plasma Jets: An Overview

    NASA Technical Reports Server (NTRS)

    Thio, Y. C. Francis; Eskridge, Richard; Martin, Adam; Smith, James; Lee, Michael; Rodgers, Stephen L. (Technical Monitor)

    2001-01-01

    One approach for standoff delivery of the momentum flux for compressing the target in MTF consists of using a spherical array of plasma jets to form a spherical plasma shell imploding towards the center of a magnetized plasma, a compact toroid (Figure 1). A 3-year experiment (PLX-1) to explore the physics of forming a 2-D plasma liner (shell) by merging plasma jets is described. An overview showing how this 3-year project (PLX-1) fits into the program plan at the national and international level for realizing MTF for energy and propulsion is discussed. Assuming that there will be a parallel program in demonstrating and establishing the underlying physics principles of MTF using whatever liner is appropriate (e.g. a solid liner) with a goal of demonstrating breakeven by 2010, the current research effort at NASA MSFC attempts to complement such a program by addressing the issues of practical embodiment of MTF for propulsion. Successful conclusion of PLX-1 will be followed by a Physics Feasibility Experiment (PLX-2) for the Plasma Liner Driven MTF.

  10. Enhanced laser-energy coupling to dense plasmas driven by recirculating electron currents

    NASA Astrophysics Data System (ADS)

    Gray, R. J.; Wilson, R.; King, M.; Williamson, S. D. R.; Dance, R. J.; Armstrong, C.; Brabetz, C.; Wagner, F.; Zielbauer, B.; Bagnoud, V.; Neely, D.; McKenna, P.

    2018-03-01

    The absorption of laser energy and dynamics of energetic electrons in dense plasma is fundamental to a range of intense laser-driven particle and radiation generation mechanisms. We measure the total reflected and scattered laser energy as a function of intensity, distinguishing between the influence of pulse energy and focal spot size on total energy absorption, in the interaction with thin foils. We confirm a previously published scaling of absorption with intensity by variation of laser pulse energy, but find a slower scaling when changing the focal spot size. 2D particle-in-cell simulations show that the measured differences arise due to energetic electrons recirculating within the target and undergoing multiple interactions with the laser pulse, which enhances absorption in the case of large focal spots. This effect is also shown to be dependent on the laser pulse duration, the target thickness and the electron beam divergence. The parameter space over which this absorption enhancement occurs is explored via an analytical model. The results impact our understanding of the fundamental physics of laser energy absorption in solids and thus the development of particle and radiation sources driven by intense laser–solid interactions.

  11. Conceptual achievement of 1GBq activity in a Plasma Focus driven system.

    PubMed

    Tabbakh, Farshid; Sadat Kiai, Seyed Mahmood; Pashaei, Mohammad

    2017-11-01

    This is an approach to evaluate the radioisotope production by means of typical dense plasma focus devices. The production rate of the appropriate positron emitters, F-18, N-13 and O-15 has been studied. The beam-target mechanism was simulated by GEANT4 Monte Carlo tool using QGSP_BIC and QGSP_INCLXX physic models as comparison. The results for positron emitters have been evaluated by reported experimental data and found conformity between simulations and experimental reports that leads to using this code as a reliable tool in optimizing the DPF driven systems for achieving to 1GBq activity of produced radioisotope. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Recruitment rates in workplace physical activity interventions: characteristics for success.

    PubMed

    Ryde, Gemma C; Gilson, Nicholas D; Burton, Nicola W; Brown, Wendy J

    2013-01-01

    To conduct a systematic review to assess recruitment rates in workplace physical activity (PA) intervention studies and describe characteristics of studies with high recruitment rates. Data Source. Electronic and manual searches were conducted. Workplace PA intervention studies that reported the number of employees invited to participate and the number who responded were included. Studies with recruitment rates of ≥70% were categorized as high with the remaining studies (<70%) used as comparison. Key study characteristics were assessed. An approach called positive deviance was used to identify the extent to which study characteristics were unique to high recruitment rate. Seventy-six percent of studies failed to report recruitment rates (n = 30 included for review). Studies with high recruitment rates (n = 8) tended to have longer study duration (mean 1.6 years) and target smaller cohorts of employees (mean n = 199) than comparison studies (3.9 months; n = 1241). For recruitment strategies and intervention components of high studies, involvement of employees was driven by the organization, with PA interventions provided as part of the working day in paid time. These findings suggest a potential to improve recruitment through targeting small cohorts of employees, incorporating PA as a long-term strategy, facilitating organizationally driven employee involvement, and providing PA interventions during paid time.

  13. Computational modeling of joint U.S.-Russian experiments relevant to magnetic compression/magnetized target fusion (MAGO/MTF)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheehey, P.T.; Faehl, R.J.; Kirkpatrick, R.C.

    1997-12-31

    Magnetized Target Fusion (MTF) experiments, in which a preheated and magnetized target plasma is hydrodynamically compressed to fusion conditions, present some challenging computational modeling problems. Recently, joint experiments relevant to MTF (Russian acronym MAGO, for Magnitnoye Obzhatiye, or magnetic compression) have been performed by Los Alamos National Laboratory and the All-Russian Scientific Research Institute of Experimental Physics (VNIIEF). Modeling of target plasmas must accurately predict plasma densities, temperatures, fields, and lifetime; dense plasma interactions with wall materials must be characterized. Modeling of magnetically driven imploding solid liners, for compression of target plasmas, must address issues such as Rayleigh-Taylor instability growthmore » in the presence of material strength, and glide plane-liner interactions. Proposed experiments involving liner-on-plasma compressions to fusion conditions will require integrated target plasma and liner calculations. Detailed comparison of the modeling results with experiment will be presented.« less

  14. Enhanced reproducibility of L-mode plasma discharges via physics-model-based q-profile feedback control in DIII-D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schuster, Eugenio J.; Wehner, William P.; Barton, Joseph E.

    Recent experiments on DIII-D demonstrate the potential of physics-model-based q-profile control to improve reproducibility of plasma discharges. A combined feed forward + feedback control scheme is employed to optimize the current ramp-up phase by consistently achieving target q profiles (Target 1: q min = 1.3,q 95 = 4:4; Target 2: q min = 1.65,q 95 = 5.0; Target 3: q min = 2.1,q 95 = 6:2) at prescribed times during the plasma formation phase (Target 1: t = 1.5 s; Target 2: t = 1:3 s; Target 3: t = 1.0 s). At the core of the control scheme ismore » a nonlinear, first-principles-driven, physics-based, control-oriented model of the plasma dynamics valid for low confinement (L-mode) scenarios. To prevent undesired L-H transitions, a constraint on the maximum allowable total auxiliary power is imposed in addition to the maximum powers for the individual heating and current-drive sources. Experimental results are presented to demonstrate the effectiveness of the combined feed forward + feedback control scheme to consistently achieve the desired target profiles at the predefined times. Here, these results also show how the addition of feedback control significantly improves upon the feed forward only control solution by reducing the matching error and also how the feedback controller is able to reduce the matching error as the constraint on the maximum allowable total auxiliary power is relaxed while keeping the plasma in L-mode.« less

  15. Enhanced reproducibility of L-mode plasma discharges via physics-model-based q-profile feedback control in DIII-D

    DOE PAGES

    Schuster, Eugenio J.; Wehner, William P.; Barton, Joseph E.; ...

    2017-08-09

    Recent experiments on DIII-D demonstrate the potential of physics-model-based q-profile control to improve reproducibility of plasma discharges. A combined feed forward + feedback control scheme is employed to optimize the current ramp-up phase by consistently achieving target q profiles (Target 1: q min = 1.3,q 95 = 4:4; Target 2: q min = 1.65,q 95 = 5.0; Target 3: q min = 2.1,q 95 = 6:2) at prescribed times during the plasma formation phase (Target 1: t = 1.5 s; Target 2: t = 1:3 s; Target 3: t = 1.0 s). At the core of the control scheme ismore » a nonlinear, first-principles-driven, physics-based, control-oriented model of the plasma dynamics valid for low confinement (L-mode) scenarios. To prevent undesired L-H transitions, a constraint on the maximum allowable total auxiliary power is imposed in addition to the maximum powers for the individual heating and current-drive sources. Experimental results are presented to demonstrate the effectiveness of the combined feed forward + feedback control scheme to consistently achieve the desired target profiles at the predefined times. Here, these results also show how the addition of feedback control significantly improves upon the feed forward only control solution by reducing the matching error and also how the feedback controller is able to reduce the matching error as the constraint on the maximum allowable total auxiliary power is relaxed while keeping the plasma in L-mode.« less

  16. Flexible cue combination in the guidance of attention in visual search

    PubMed Central

    Brand, John; Oriet, Chris; Johnson, Aaron P.; Wolfe, Jeremy M.

    2014-01-01

    Hodsoll and Humphreys (2001) have assessed the relative contributions of stimulus-driven and user-driven knowledge on linearly- and nonlinearly separable search. However, the target feature used to determine linear separability in their task (i.e., target size) was required to locate the target. In the present work, we investigated the contributions of stimulus-driven and user-driven knowledge when a linearly- or nonlinearly-separable feature is available but not required for target identification. We asked observers to complete a series of standard color X orientation conjunction searches in which target size was either linearly- or nonlinearly separable from the size of the distractors. When guidance by color X orientation and by size information are both available, observers rely on whichever information results in the best search efficiency. This is the case irrespective of whether we provide target foreknowledge by blocking stimulus conditions, suggesting that feature information is used in both a stimulus-driven and user-driven fashion. PMID:25463553

  17. Electron dynamics in high energy density plasma bunch generation driven by intense picosecond laser pulse

    NASA Astrophysics Data System (ADS)

    Li, M.; Yuan, T.; Xu, Y. X.; Luo, S. N.

    2018-05-01

    When an intense picosecond laser pulse is loaded upon a dense plasma, a high energy density plasma bunch, including electron bunch and ion bunch, can be generated in the target. We simulate this process through one-dimensional particle-in-cell simulation and find that the electron bunch generation is mainly due to a local high energy density electron sphere originated in the plasma skin layer. Once generated the sphere rapidly expands to compress the surrounding electrons and induce high density electron layer, coupled with that, hot electrons are efficiently triggered in the local sphere and traveling in the whole target. Under the compressions of light pressure, forward-running and backward-running hot electrons, a high energy density electron bunch generates. The bunch energy density is as high as TJ/m3 order of magnitude in our conditions, which is significant in laser driven dynamic high pressure generation and may find applications in high energy density physics.

  18. Physics at the SPS.

    PubMed

    Gatignon, L

    2018-05-01

    The CERN Super Proton Synchrotron (SPS) has delivered a variety of beams to a vigorous fixed target physics program since 1978. In this paper, we restrict ourselves to the description of a few illustrative examples in the ongoing physics program at the SPS. We will outline the physics aims of the COmmon Muon Proton Apparatus for Structure and Spectroscopy (COMPASS), north area 64 (NA64), north area 62 (NA62), north area 61 (NA61), and advanced proton driven plasma wakefield acceleration experiment (AWAKE). COMPASS studies the structure of the proton and more specifically of its spin. NA64 searches for the dark photon A', which is the messenger for interactions between normal and dark matter. The NA62 experiment aims at a 10% precision measurement of the very rare decay K + → π + νν. As this decay mode can be calculated very precisely in the Standard Model, it offers a very good opportunity to look for new physics beyond the Standard Model. The NA61/SHINE experiment studies the phase transition to Quark Gluon Plasma, a state in which the quarks and gluons that form the proton and the neutron are de-confined. Finally, AWAKE investigates proton-driven wake field acceleration: a promising technique to accelerate electrons with very high accelerating gradients. The Physics Beyond Colliders study at CERN is paving the way for a significant and diversified continuation of this already rich and compelling physics program that is complementary to the one at the big colliders like the Large Hadron Collider.

  19. Physics at the SPS

    NASA Astrophysics Data System (ADS)

    Gatignon, L.

    2018-05-01

    The CERN Super Proton Synchrotron (SPS) has delivered a variety of beams to a vigorous fixed target physics program since 1978. In this paper, we restrict ourselves to the description of a few illustrative examples in the ongoing physics program at the SPS. We will outline the physics aims of the COmmon Muon Proton Apparatus for Structure and Spectroscopy (COMPASS), north area 64 (NA64), north area 62 (NA62), north area 61 (NA61), and advanced proton driven plasma wakefield acceleration experiment (AWAKE). COMPASS studies the structure of the proton and more specifically of its spin. NA64 searches for the dark photon A', which is the messenger for interactions between normal and dark matter. The NA62 experiment aims at a 10% precision measurement of the very rare decay K+ → π+νν. As this decay mode can be calculated very precisely in the Standard Model, it offers a very good opportunity to look for new physics beyond the Standard Model. The NA61/SHINE experiment studies the phase transition to Quark Gluon Plasma, a state in which the quarks and gluons that form the proton and the neutron are de-confined. Finally, AWAKE investigates proton-driven wake field acceleration: a promising technique to accelerate electrons with very high accelerating gradients. The Physics Beyond Colliders study at CERN is paving the way for a significant and diversified continuation of this already rich and compelling physics program that is complementary to the one at the big colliders like the Large Hadron Collider.

  20. Optical, x-ray and microwave diagnostics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tudisco, S.; Mascali, D.; Altana, C.

    2013-07-26

    Laser-driven ion acceleration is a new approach for the particles acceleration, which allows obtaining ion beams with unique properties, such as short burst duration, large particle number, small size source size, low transverse emittance. Currently, two main acceleration mechanisms have been identified and investigated: target normal sheath acceleration (TNSA) and radiation pressure acceleration (RPA). Electrons dynamics and energies are strongly coupled to these acceleration mechanisms and they can be investigated with optical and X-ray techniques. The main aim of these studies are the identification of few physical observables that can be directly correlated to the proton emission obtained (in termsmore » of reproducibility and intensity) in operations with different target material and structure and laser-target interaction parameters.« less

  1. Coupling physically based and data-driven models for assessing freshwater inflow into the Small Aral Sea

    NASA Astrophysics Data System (ADS)

    Ayzel, Georgy; Izhitskiy, Alexander

    2018-06-01

    The Aral Sea desiccation and related changes in hydroclimatic conditions on a regional level is a hot topic for past decades. The key problem of scientific research projects devoted to an investigation of modern Aral Sea basin hydrological regime is its discontinuous nature - the only limited amount of papers takes into account the complex runoff formation system entirely. Addressing this challenge we have developed a continuous prediction system for assessing freshwater inflow into the Small Aral Sea based on coupling stack of hydrological and data-driven models. Results show a good prediction skill and approve the possibility to develop a valuable water assessment tool which utilizes the power of classical physically based and modern machine learning models both for territories with complex water management system and strong water-related data scarcity. The source code and data of the proposed system is available on a Github page (https://github.com/SMASHIproject/IWRM2018).

  2. Review and Study of Physics Driven Pitting Corrosion Modeling in 2024-T3 Aluminum Alloys (Postprint)

    DTIC Science & Technology

    2015-05-01

    AFRL-RX-WP-JA-2015-0218 REVIEW AND STUDY OF PHYSICS DRIVEN PITTING CORROSION MODELING IN 2024-T3 ALUMINUM ALLOYS (POSTPRINT) Lingyu...2014 – 1 April 2015 4. TITLE AND SUBTITLE REVIEW AND STUDY OF PHYSICS DRIVEN PITTING CORROSION MODELING IN 2024-T3 ALUMINUM ALLOYS (POSTPRINT) 5a...18 Review and Study of Physics Driven Pitting Corrosion Modeling in 2024-T3 Aluminum Alloys Lingyu Yu 1*, Kumar V. Jata2 1Mechanical Engineering

  3. An off-line method to characterize the fission product release from uranium carbide-target prototypes developed for SPIRAL2 project

    NASA Astrophysics Data System (ADS)

    Hy, B.; Barré-Boscher, N.; Özgümüs, A.; Roussière, B.; Tusseau-Nenez, S.; Lau, C.; Cheikh Mhamed, M.; Raynaud, M.; Said, A.; Kolos, K.; Cottereau, E.; Essabaa, S.; Tougait, O.; Pasturel, M.

    2012-10-01

    In the context of radioactive ion beams, fission targets, often based on uranium compounds, have been used for more than 50 years at isotope separator on line facilities. The development of several projects of second generation facilities aiming at intensities two or three orders of magnitude higher than today puts an emphasis on the properties of the uranium fission targets. A study, driven by Institut de Physique Nucléaire d'Orsay (IPNO), has been started within the SPIRAL2 project to try and fully understand the behavior of these targets. In this paper, we have focused on five uranium carbide based targets. We present an off-line method to characterize their fission product release and the results are examined in conjunction with physical characteristics of each material such as the microstructure, the porosity and the chemical composition.

  4. On the utility of antiprotons as drivers for inertial confinement fusion

    NASA Astrophysics Data System (ADS)

    Perkins, L. John; Orth, Charles D.; Tabak, Max

    2004-10-01

    In contrast to the large mass, complexity and recirculating power of conventional drivers for inertial confinement fusion (ICF), antiproton annihilation offers a specific energy of 90 MJ µg-1 and thus a unique form of energy packaging and delivery. In principle, antiproton drivers could provide a profound reduction in system mass for advanced space propulsion by ICF. We examine the physics underlying the use of antiprotons ( \\bar{p} ) to drive various classes of high-yield ICF targets by the methods of volumetric ignition, hotspot ignition and fast ignition. The useable fraction of annihilation deposition energy is determined for both \\bar{p} -driven ablative compression and \\bar{p} -driven fast ignition, in association with zero- and one-dimensional target burn models. Thereby, we deduce scaling laws for the number of injected antiprotons required per capsule, together with timing and focal spot requirements. The kinetic energy of the injected antiproton beam required to penetrate to the desired annihilation point is always small relative to the deposited annihilation energy. We show that heavy metal seeding of the fuel and/or ablator is required to optimize local deposition of annihilation energy and determine that a minimum of ~3 × 1015 injected antiprotons will be required to achieve high yield (several hundred megajoules) in any target configuration. Target gains—i.e. fusion yields divided by the available p- \\bar{p} annihilation energy from the injected antiprotons ( 1.88\\,GeV/\\bar{p} )—range from ~3 for volumetric ignition targets to ~600 for fast ignition targets. Antiproton-driven ICF is a speculative concept, and the handling of antiprotons and their required injection precision—temporally and spatially—will present significant technical challenges. The storage and manipulation of low-energy antiprotons, particularly in the form of antihydrogen, is a science in its infancy and a large scale-up of antiproton production over present supply methods would be required to embark on a serious R&D programme for this application.

  5. Stimulus-driven and knowledge-driven processes in attention to warbles

    NASA Astrophysics Data System (ADS)

    Dowling, W. Jay; Tillmann, Barbara

    2003-10-01

    Listeners identified warbles differing in amplitude-modulation rate (3-10 Hz). And measured RT while listeners maintained above 90% correct responses. After a practice session listeners identified target warbles following stimulus-driven or knowledge-driven cues. The stimulus-driven cue was a 250-ms ``beep'' at the target pitch (valid) or another pitch (invalid); the knowledge-driven cue was a midrange ``melody'' pointing to the target pitch (always valid). A 500-ms target warble followed the cue after delays of 0-500 ms (250-750 ms SOA). The listener pressed a key to indicate ``slow'' or ``fast.'' RTs were shortest at the briefest delay. In contrast to results from a memory task, RTs here were much shorter, and we found no evidence for IOR or attentional blink. Listeners began generating responses while the target was still sounding. Invalid ``beeps'' slowed responses at the briefest (but not the longer) delays; adding a valid ``beep'' to the valid ``melody'' did not speed responses.

  6. Records for conversion of laser energy to nuclear energy in exploding nanostructures

    NASA Astrophysics Data System (ADS)

    Jortner, Joshua; Last, Isidore

    2017-09-01

    Table-top nuclear fusion reactions in the chemical physics laboratory can be driven by high-energy dynamics of Coulomb exploding, multicharged, deuterium containing nanostructures generated by ultraintense, femtosecond, near-infrared laser pulses. Theoretical-computational studies of table-top laser-driven nuclear fusion of high-energy (up to 15 MeV) deuterons with 7Li, 6Li and D nuclei demonstrate the attainment of high fusion yields within a source-target reaction design, which constitutes the highest table-top fusion efficiencies obtained up to date. The conversion efficiency of laser energy to nuclear energy (0.1-1.0%) for table-top fusion is comparable to that for DT fusion currently accomplished for 'big science' inertial fusion setups.

  7. Defect Implosion Experiments (DIME) at OMEGA

    NASA Astrophysics Data System (ADS)

    Cobble, J. A.; Schmitt, M. J.; Tregillis, I. L.; Obrey, K. D.; Magelssen, G. R.; Wilke, M. D.; Glebov, V.; Marshall, F. J.; Kim, Y. H.; Bradley, P. A.; Batha, S. H.

    2010-11-01

    The Los Alamos DIME campaign involves perturbed spherical implosions, driven by 60 OMEGA beams with uniform, symmetrical illumination. D-T-filled CH-shell targets with equatorial-plane defects are designed to produce a non-spherical neutron burn region. The objectives of the DIME series are to observe the non-spherical burn with the neutron imaging system (NIS) and to simulate the physics of the neutron and x-ray production. We have demonstrated adequate neutron yield for NIS imaging with targets of diameter 860 μm. All targets are filled with 5 atm of DT. We used two separate shell thicknesses: 8 μm and 15 μm, thus testing both exploding pusher and ablative designs. Defect channel depth ranges from 0 -- 8 μm. Width is 20 -- 40 μm. Perfect targets have no defect. Numerical simulations predict enhanced x-ray emission, that is suggested by experiment. Results from a recent DIME campaign will be discussed.

  8. Bacterial cells enhance laser driven ion acceleration

    PubMed Central

    Dalui, Malay; Kundu, M.; Trivikram, T. Madhu; Rajeev, R.; Ray, Krishanu; Krishnamurthy, M.

    2014-01-01

    Intense laser produced plasmas generate hot electrons which in turn leads to ion acceleration. Ability to generate faster ions or hotter electrons using the same laser parameters is one of the main outstanding paradigms in the intense laser-plasma physics. Here, we present a simple, albeit, unconventional target that succeeds in generating 700 keV carbon ions where conventional targets for the same laser parameters generate at most 40 keV. A few layers of micron sized bacteria coating on a polished surface increases the laser energy coupling and generates a hotter plasma which is more effective for the ion acceleration compared to the conventional polished targets. Particle-in-cell simulations show that micro-particle coated target are much more effective in ion acceleration as seen in the experiment. We envisage that the accelerated, high-energy carbon ions can be used as a source for multiple applications. PMID:25102948

  9. Working memory-driven attention improves spatial resolution: Support for perceptual enhancement.

    PubMed

    Pan, Yi; Luo, Qianying; Cheng, Min

    2016-08-01

    Previous research has indicated that attention can be biased toward those stimuli matching the contents of working memory and thereby facilitates visual processing at the location of the memory-matching stimuli. However, whether this working memory-driven attentional modulation takes place on early perceptual processes remains unclear. Our present results showed that working memory-driven attention improved identification of a brief Landolt target presented alone in the visual field. Because the suprathreshold target appeared without any external noise added (i.e., no distractors or masks), the results suggest that working memory-driven attention enhances the target signal at early perceptual stages of visual processing. Furthermore, given that performance in the Landolt target identification task indexes spatial resolution, this attentional facilitation indicates that working memory-driven attention can boost early perceptual processing via enhancement of spatial resolution at the attended location.

  10. Laser-driven ion acceleration at BELLA

    NASA Astrophysics Data System (ADS)

    Bin, Jianhui; Steinke, Sven; Ji, Qing; Nakamura, Kei; Treffert, Franziska; Bulanov, Stepan; Roth, Markus; Toth, Csaba; Schroeder, Carl; Esarey, Eric; Schenkel, Thomas; Leemans, Wim

    2017-10-01

    BELLA is a high repetiton rate PW laser and we used it for high intensity laser plasma acceleration experiments. The BELLA-i program is focused on relativistic laser plasma interaction such as laser driven ion acceleration, aiming at establishing an unique collaborative research facility providing beam time to selected external groups for fundamental physics and advanced applications. Here we present our first parameter study of ion acceleration driven by the BELLA-PW laser with truly high repetition rate. The laser repetition rate of 1Hz allows for scanning the laser pulse duration, relative focus location and target thickness for the first time at laser peak powers of above 1 PW. Furthermore, the long focal length geometry of the experiment (f ∖65) and hence, large focus size provided ion beams of reduced divergence and unprecedented charge density. This work was supported by the Director, Office of Science, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

  11. Novel characterization of capsule x-ray drive at the National Ignition Facility.

    PubMed

    MacLaren, S A; Schneider, M B; Widmann, K; Hammer, J H; Yoxall, B E; Moody, J D; Bell, P M; Benedetti, L R; Bradley, D K; Edwards, M J; Guymer, T M; Hinkel, D E; Hsing, W W; Kervin, M L; Meezan, N B; Moore, A S; Ralph, J E

    2014-03-14

    Indirect drive experiments at the National Ignition Facility are designed to achieve fusion by imploding a fuel capsule with x rays from a laser-driven hohlraum. Previous experiments have been unable to determine whether a deficit in measured ablator implosion velocity relative to simulations is due to inadequate models of the hohlraum or ablator physics. ViewFactor experiments allow for the first time a direct measure of the x-ray drive from the capsule point of view. The experiments show a 15%-25% deficit relative to simulations and thus explain nearly all of the disagreement with the velocity data. In addition, the data from this open geometry provide much greater constraints on a predictive model of laser-driven hohlraum performance than the nominal ignition target.

  12. Nuclear Methods for Transmutation of Nuclear Waste: Problems, Perspextives, Cooperative Research - Proceedings of the International Workshop

    NASA Astrophysics Data System (ADS)

    Khankhasayev, Zhanat B.; Kurmanov, Hans; Plendl, Mikhail Kh.

    1996-12-01

    The Table of Contents for the full book PDF is as follows: * Preface * I. Review of Current Status of Nuclear Transmutation Projects * Accelerator-Driven Systems — Survey of the Research Programs in the World * The Los Alamos Accelerator-Driven Transmutation of Nuclear Waste Concept * Nuclear Waste Transmutation Program in the Czech Republic * Tentative Results of the ISTC Supported Study of the ADTT Plutonium Disposition * Recent Neutron Physics Investigations for the Back End of the Nuclear Fuel Cycle * Optimisation of Accelerator Systems for Transmutation of Nuclear Waste * Proton Linac of the Moscow Meson Factory for the ADTT Experiments * II. Computer Modeling of Nuclear Waste Transmutation Methods and Systems * Transmutation of Minor Actinides in Different Nuclear Facilities * Monte Carlo Modeling of Electro-nuclear Processes with Nonlinear Effects * Simulation of Hybrid Systems with a GEANT Based Program * Computer Study of 90Sr and 137Cs Transmutation by Proton Beam * Methods and Computer Codes for Burn-Up and Fast Transients Calculations in Subcritical Systems with External Sources * New Model of Calculation of Fission Product Yields for the ADTT Problem * Monte Carlo Simulation of Accelerator-Reactor Systems * III. Data Basis for Transmutation of Actinides and Fission Products * Nuclear Data in the Accelerator Driven Transmutation Problem * Nuclear Data to Study Radiation Damage, Activation, and Transmutation of Materials Irradiated by Particles of Intermediate and High Energies * Radium Institute Investigations on the Intermediate Energy Nuclear Data on Hybrid Nuclear Technologies * Nuclear Data Requirements in Intermediate Energy Range for Improvement of Calculations of ADTT Target Processes * IV. Experimental Studies and Projects * ADTT Experiments at the Los Alamos Neutron Science Center * Neutron Multiplicity Distributions for GeV Proton Induced Spallation Reactions on Thin and Thick Targets of Pb and U * Solid State Nuclear Track Detector and Radiochemical Studies on the Transmutation of Nuclei Using Relativistic Heavy Ions * Experimental and Theoretical Study of Radionuclide Production on the Electronuclear Plant Target and Construction Materials Irradiated by 1.5 GeV and 130 MeV Protons * Neutronics and Power Deposition Parameters of the Targets Proposed in the ISTC Project 17 * Multicycle Irradiation of Plutonium in Solid Fuel Heavy-Water Blanket of ADS * Compound Neutron Valve of Accelerator-Driven System Sectioned Blanket * Subcritical Channel-Type Reactor for Weapon Plutonium Utilization * Accelerator Driven Molten-Fluoride Reactor with Modular Heat Exchangers on PB-BI Eutectic * A New Conception of High Power Ion Linac for ADTT * Pions and Accelerator-Driven Transmutation of Nuclear Waste? * V. Problems and Perspectives * Accelerator-Driven Transmutation Technologies for Resolution of Long-Term Nuclear Waste Concerns * Closing the Nuclear Fuel-Cycle and Moving Toward a Sustainable Energy Development * Workshop Summary * List of Participants

  13. Shockwave compression of Ar gas at several initial densities

    NASA Astrophysics Data System (ADS)

    Dattelbaum, Dana M.; Goodwin, Peter M.; Garcia, Daniel B.; Gustavsen, Richard L.; Lang, John M.; Aslam, Tariq D.; Sheffield, Stephen A.; Gibson, Lloyd L.; Morris, John S.

    2017-01-01

    Experimental data of the principal Hugoniot locus of variable density gas-phase noble and molecular gases are rare. The majority of shock Hugoniot data is either from shock tube experiments on low-pressure gases or from plate impact experiments on cryogenic, liquefied gases. In both cases, physics regarding shock compressibility, thresholds for the on-set of shock-driven ionization, and even dissociation chemistry are difficult to infer for gases at intermediate densities. We have developed an experimental target design for gas gun-driven plate impact experiments on noble gases at initial pressures between 200-1000 psi. Using optical velocimetry, we are able to directly determine both the shock and particle velocities of the gas on the principal Hugoniot locus, as well as clearly differentiate ionization thresholds. The target design also results in multiply shocking the gas in a quasi-isentropic fashion yielding off-Hugoniot compression data. We describe the results of a series of plate impact experiments on Ar with starting densities between 0.02-0.05 g/cm3 at room temperature. Furthermore, by coupling optical fibers to the targets, we have measured the time-resolved optical emission from the shocked gas using a spectrometer coupled to an optical streak camera to spectrally-resolve the emission, and with a 5-color optical pyrometer for temperature determination.

  14. Novel high-energy physics studies using intense lasers and plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leemans, Wim P.; Bulanov, Stepan; Esarey, Eric

    2015-06-29

    In the framework of the project “Novel high-energy physics studies using intense lasers and plasmas” we conducted the study of ion acceleration and “flying mirrors” with high intensity lasers in order to develop sources of ion beams and high frequency radiation for different applications. Since some schemes of laser ion acceleration are also considered a good source of “flying mirrors”, we proposed to investigate the mechanisms of “mirror” formation. As a result we were able to study the laser ion acceleration from thin foils and near critical density targets. We identified several fundamental factors limiting the acceleration in the RPAmore » regime and proposed the target design to compensate these limitations. In the case of near critical density targets, we developed a concept for the laser driven ion source for the hadron therapy. Also we studied the mechanism of “flying mirror” generation during the intense laser interaction with thin solid density targets. As for the laser-based positron creation and capture we initially proposed to study different regimes of positron beam generation and positron beam cooling. Since the for some of these schemes a good quality electron beam is required, we studied the generation of ultra-low emittance electron beams. In order to understand the fundamental physics of high energy electron beam interaction with high intensity laser pulses, which may affect the efficient generation of positron beams, we studied the radiation reaction effects.« less

  15. A data-driven approach for evaluating multi-modal therapy in traumatic brain injury

    PubMed Central

    Haefeli, Jenny; Ferguson, Adam R.; Bingham, Deborah; Orr, Adrienne; Won, Seok Joon; Lam, Tina I.; Shi, Jian; Hawley, Sarah; Liu, Jialing; Swanson, Raymond A.; Massa, Stephen M.

    2017-01-01

    Combination therapies targeting multiple recovery mechanisms have the potential for additive or synergistic effects, but experimental design and analyses of multimodal therapeutic trials are challenging. To address this problem, we developed a data-driven approach to integrate and analyze raw source data from separate pre-clinical studies and evaluated interactions between four treatments following traumatic brain injury. Histologic and behavioral outcomes were measured in 202 rats treated with combinations of an anti-inflammatory agent (minocycline), a neurotrophic agent (LM11A-31), and physical therapy consisting of assisted exercise with or without botulinum toxin-induced limb constraint. Data was curated and analyzed in a linked workflow involving non-linear principal component analysis followed by hypothesis testing with a linear mixed model. Results revealed significant benefits of the neurotrophic agent LM11A-31 on learning and memory outcomes after traumatic brain injury. In addition, modulations of LM11A-31 effects by co-administration of minocycline and by the type of physical therapy applied reached statistical significance. These results suggest a combinatorial effect of drug and physical therapy interventions that was not evident by univariate analysis. The study designs and analytic techniques applied here form a structured, unbiased, internally validated workflow that may be applied to other combinatorial studies, both in animals and humans. PMID:28205533

  16. A data-driven approach for evaluating multi-modal therapy in traumatic brain injury.

    PubMed

    Haefeli, Jenny; Ferguson, Adam R; Bingham, Deborah; Orr, Adrienne; Won, Seok Joon; Lam, Tina I; Shi, Jian; Hawley, Sarah; Liu, Jialing; Swanson, Raymond A; Massa, Stephen M

    2017-02-16

    Combination therapies targeting multiple recovery mechanisms have the potential for additive or synergistic effects, but experimental design and analyses of multimodal therapeutic trials are challenging. To address this problem, we developed a data-driven approach to integrate and analyze raw source data from separate pre-clinical studies and evaluated interactions between four treatments following traumatic brain injury. Histologic and behavioral outcomes were measured in 202 rats treated with combinations of an anti-inflammatory agent (minocycline), a neurotrophic agent (LM11A-31), and physical therapy consisting of assisted exercise with or without botulinum toxin-induced limb constraint. Data was curated and analyzed in a linked workflow involving non-linear principal component analysis followed by hypothesis testing with a linear mixed model. Results revealed significant benefits of the neurotrophic agent LM11A-31 on learning and memory outcomes after traumatic brain injury. In addition, modulations of LM11A-31 effects by co-administration of minocycline and by the type of physical therapy applied reached statistical significance. These results suggest a combinatorial effect of drug and physical therapy interventions that was not evident by univariate analysis. The study designs and analytic techniques applied here form a structured, unbiased, internally validated workflow that may be applied to other combinatorial studies, both in animals and humans.

  17. Physics considerations in targeted anticancer drug delivery by magnetoelectric nanoparticles

    NASA Astrophysics Data System (ADS)

    Stimphil, Emmanuel; Nagesetti, Abhignyan; Guduru, Rakesh; Stewart, Tiffanie; Rodzinski, Alexandra; Liang, Ping; Khizroev, Sakhrat

    2017-06-01

    In regard to cancer therapy, magnetoelectric nanoparticles (MENs) have proven to be in a class of its own when compared to any other nanoparticle type. Like conventional magnetic nanoparticles, they can be used for externally controlled drug delivery via application of a magnetic field gradient and image-guided delivery. However, unlike conventional nanoparticles, due to the presence of a non-zero magnetoelectric effect, MENs provide a unique mix of important properties to address key challenges in modern cancer therapy: (i) a targeting mechanism driven by a physical force rather than antibody matching, (ii) a high-specificity delivery to enhance the cellular uptake of therapeutic drugs across the cancer cell membranes only, while sparing normal cells, (iii) an externally controlled mechanism to release drugs on demand, and (iv) a capability for image guided precision medicine. These properties separate MEN-based targeted delivery from traditional biotechnology approaches and lay a foundation for the complementary approach of technobiology. The biotechnology approach stems from the underlying biology and exploits bioinformatics to find the right therapy. In contrast, the technobiology approach is geared towards using the physics of molecular-level interactions between cells and nanoparticles to treat cancer at the most fundamental level and thus can be extended to all the cancers. This paper gives an overview of the current state of the art and presents an ab initio model to describe the underlying mechanisms of cancer treatment with MENs from the perspective of basic physics.

  18. The Hypothesis-Driven Physical Examination.

    PubMed

    Garibaldi, Brian T; Olson, Andrew P J

    2018-05-01

    The physical examination remains a vital part of the clinical encounter. However, physical examination skills have declined in recent years, in part because of decreased time at the bedside. Many clinicians question the relevance of physical examinations in the age of technology. A hypothesis-driven approach to teaching and practicing the physical examination emphasizes the performance of maneuvers that can alter the likelihood of disease. Likelihood ratios are diagnostic weights that allow clinicians to estimate the post-probability of disease. This hypothesis-driven approach to the physical examination increases its value and efficiency, while preserving its cultural role in the patient-physician relationship. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Mental health starts with physical health: current status and future directions of non-pharmacological interventions to improve physical health in first-episode psychosis.

    PubMed

    Gates, Jesse; Killackey, Eóin; Phillips, Lisa; Álvarez-Jiménez, Mario

    2015-08-01

    People with psychotic disorders have reduced life expectancy compared with the general population. This difference is primarily due to increased prevalence of cardiovascular disease associated with antipsychotic drugs and with modifiable risk factors, including weight gain, low exercise, poor diet, and high prevalence of cigarette smoking. We review non-pharmacological interventions for physical health behaviour in patients with chronic and first-episode psychosis. Our findings suggest that weight loss and attenuation of weight gain are achievable but limited and might not persist beyond the end of an intervention. Evidence for smoking cessation interventions is scarce. The case for early intervention to prevent deterioration of physical health is strong. We propose a framework for development of interventions, which addresses three main factors largely absent in previous research: (1) examination of aetiological factors related to poor physical health, (2) theory-driven interventions that target aetiological factors, and (3) assessment of feasibility. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Physics-model-based nonlinear actuator trajectory optimization and safety factor profile feedback control for advanced scenario development in DIII-D

    DOE PAGES

    Barton, Justin E.; Boyer, Mark D.; Shi, Wenyu; ...

    2015-07-30

    DIII-D experimental results are reported to demonstrate the potential of physics-model-based safety factor profile control for robust and reproducible sustainment of advanced scenarios. In the absence of feedback control, variability in wall conditions and plasma impurities, as well as drifts due to external disturbances, can limit the reproducibility of discharges with simple pre-programmed scenario trajectories. The control architecture utilized is a feedforward + feedback scheme where the feedforward commands are computed off-line and the feedback commands are computed on-line. In this work, firstly a first-principles-driven (FPD), physics-based model of the q profile and normalized beta (β N) dynamics is embeddedmore » into a numerical optimization algorithm to design feedforward actuator trajectories that sheer the plasma through the tokamak operating space to reach a desired stationary target state that is characterized by the achieved q profile and β N. Good agreement between experimental results and simulations demonstrates the accuracy of the models employed for physics-model-based control design. Secondly, a feedback algorithm for q profile control is designed following a FPD approach, and the ability of the controller to achieve and maintain a target q profile evolution is tested in DIII-D high confinement (H-mode) experiments. The controller is shown to be able to effectively control the q profile when β N is relatively close to the target, indicating the need for integrated q profile and β N control to further enhance the ability to achieve robust scenario execution. Furthermore, the ability of an integrated q profile + β N feedback controller to track a desired target is demonstrated through simulation.« less

  1. Block Ignition Inertial Confinement Fusion (ICF) with Condensed Matter Cluster Type Targets for p-B11 Powered Space Propulsion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miley, George H.; Hora, H.; Badziak, J.

    The use of laser-driven Inertial Confinement Fusion (ICF) for space propulsion has been the subject of several earlier conceptual design studies, (see: Orth, 1998; and other references therein). However, these studies were based on older ICF technology using either 'direct' or 'in-direct x-ray driven' type target irradiation. Important new directions have opened for laser ICF in recent years following the development of 'chirped' lasers capable of ultra short pulses with powers of TW up to few PW which leads to the concept of 'fast ignition (FI)' to achieve higher energy gains from target implosions. In a recent publication the authorsmore » showed that use of a modified type of FI, termed 'block ignition' (Miley et al., 2008), could meet many of the requirements anticipated (but not then available) by the designs of the Vehicle for Interplanetary Space Transport Applications (VISTA) ICF fusion propulsion ship (Orth, 2008) for deep space missions. Subsequently the first author devised and presented concepts for imbedding high density condensed matter 'clusters' of deuterium into the target to obtain ultra high local fusion reaction rates (Miley, 2008). Such rates are possible due to the high density of the clusters (over an order of magnitude above cryogenic deuterium). Once compressed by the implosion, the yet higher density gives an ultra high reaction rate over the cluster volume since the fusion rate is proportional to the square of the fuel density. Most recently, a new discovery discussed here indicates that the target matrix could be composed of B{sup 11} with proton clusters imbedded. This then makes p-B{sup 11} fusion practical, assuming all of the physics issues such as stability of the clusters during compression are resolved. Indeed, p-B{sup 11} power is ideal for fusion propulsion since it has a minimum of unwanted side products while giving most of the reaction energy to energetic alpha particles which can be directed into an exhaust (propulsion) nozzle. Power plants using p-B{sup 11} have been discussed for such applications before, but prior designs face formidable physics/technology issues, largely overcome with the present approach.« less

  2. Redox-responsive mesoporous selenium delivery of doxorubicin targets MCF-7 cells and synergistically enhances its anti-tumor activity.

    PubMed

    Zhao, Shuang; Yu, Qianqian; Pan, Jiali; Zhou, Yanhui; Cao, Chengwen; Ouyang, Jian-Ming; Liu, Jie

    2017-05-01

    To reduce the side effects and enhance the anti-tumor activities of anticancer drugs in the clinic, the use of nano mesoporous materials, with mesoporous silica (MSN) being the best-studied, has become an effective method of drug delivery. In this study, we successfully synthesized mesoporous selenium (MSe) nanoparticles and first introduced them to the field of drug delivery. Loading MSe with doxorubicin (DOX) is mainly driven by the physical adsorption mechanism of the mesopores, and our results demonstrated that MSe could synergistically enhance the antitumor activity of DOX. Coating the surface of MSe@DOX with Human serum albumin (HSA) generated a unique redox-responsive nanoparticle (HSA-MSe@DOX) that demonstrated glutathione-dependent drug release, increased tumor-targeting effects and enhanced cellular uptake throug nanoparticle interact with SPARC in MCF-7 cells. In vitro, HSA-MSe@DOX prominently induced cancer cell toxicity by synergistically enhancing the effects of MSe and DOX. Moreover, HSA-MSe@DOX possessed tumor-targeting abilities in tumor-bearing nude mice and not only decreased the side effects associated with DOX, but also enhanced its antitumor activity. Therefore, HSA-MSe@DOX is a promising new drug that warrants further evaluation in the treatments of tumors. To reduce the side effects and enhance the anti-tumor activities of anticancer drugs, we successfully synthesized mesoporous selenium (MSe) nanoparticles and first introduced them to the field of drug delivery. Loading MSe with doxorubicin (DOX) is mainly driven by the physical adsorption mechanism of the mesopores. Coating the surface of MSe@DOX with Human serum albumin (HSA) generated a unique redox-responsive nanoparticle (HSA-MSe@DOX) that demonstrated glutathione-dependent drug release, increased tumor-targeting effects and enhanced cellular uptake throug nanoparticle interact with SPARC in MCF-7 cells. In vitro and in vivo, HSA-MSe@DOX possessed tumor-targeting abilities and not only decreased the side effects associated with DOX, but also enhanced its antitumor activity. Therefore, HSA-MSe@DOX is a promising new drug that warrants further evaluation in the treatments of tumors. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  3. Laser-driven strong magnetostatic fields with applications to charged beam transport and magnetized high energy-density physics

    NASA Astrophysics Data System (ADS)

    Santos, J. J.; Bailly-Grandvaux, M.; Ehret, M.; Arefiev, A. V.; Batani, D.; Beg, F. N.; Calisti, A.; Ferri, S.; Florido, R.; Forestier-Colleoni, P.; Fujioka, S.; Gigosos, M. A.; Giuffrida, L.; Gremillet, L.; Honrubia, J. J.; Kojima, S.; Korneev, Ph.; Law, K. F. F.; Marquès, J.-R.; Morace, A.; Mossé, C.; Peyrusse, O.; Rose, S.; Roth, M.; Sakata, S.; Schaumann, G.; Suzuki-Vidal, F.; Tikhonchuk, V. T.; Toncian, T.; Woolsey, N.; Zhang, Z.

    2018-05-01

    Powerful nanosecond laser-plasma processes are explored to generate discharge currents of a few 100 kA in coil targets, yielding magnetostatic fields (B-fields) in excess of 0.5 kT. The quasi-static currents are provided from hot electron ejection from the laser-irradiated surface. According to our model, which describes the evolution of the discharge current, the major control parameter is the laser irradiance Ilasλlas2 . The space-time evolution of the B-fields is experimentally characterized by high-frequency bandwidth B-dot probes and proton-deflectometry measurements. The magnetic pulses, of ns-scale, are long enough to magnetize secondary targets through resistive diffusion. We applied it in experiments of laser-generated relativistic electron transport through solid dielectric targets, yielding an unprecedented 5-fold enhancement of the energy-density flux at 60 μm depth, compared to unmagnetized transport conditions. These studies pave the ground for magnetized high-energy density physics investigations, related to laser-generated secondary sources of radiation and/or high-energy particles and their transport, to high-gain fusion energy schemes, and to laboratory astrophysics.

  4. Nuclear Physics with 10 PW laser beams at Extreme Light Infrastructure - Nuclear Physics (ELI-NP)

    NASA Astrophysics Data System (ADS)

    Zamfir, N. V.

    2014-05-01

    The field of the uncharted territory of high-intensity laser interaction with matter is confronted with new exotic phenomena and, consequently, opens new research perspectives. The intense laser beams interacting with a gas or solid target generate beams of electrons, protons and ions. These beams can induce nuclear reactions. Electrons also generate ions high-energy photons via bremsstrahlung processes which can also induce nuclear reactions. In this context a new research domain began to form in the last decade or so, namely nuclear physics with high power lasers. The observation of high brilliance proton beams of tens of MeV energy from solid targets has stimulated an intense research activity. The laser-driven particle beams have to compete with conventional nuclear accelerator-generated beams. The ultimate goal is aiming at applications of the laser produced beams in research, technology and medicine. The mechanism responsible for ion acceleration are currently subject of intensive research in many laboratories in the world. The existing results, experimental and theoretical, and their perspectives are reviewed in this article in the context of IZEST and the scientific program of ELI-NP.

  5. Design of the LBNF Beamline Target Station

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tariq, S.; Ammigan, K.; Anderson, K.

    2016-10-01

    The Long Baseline Neutrino Facility (LBNF) project will build a beamline located at Fermilab to create and aim an intense neutrino beam of appropriate energy range toward the DUNE detectors at the SURF facility in Lead, South Dakota. Neutrino production starts in the Target Station, which consists of a solid target, magnetic focusing horns, and the associated sub-systems and shielding infrastructure. Protons hit the target producing mesons which are then focused by the horns into a helium-filled decay pipe where they decay into muons and neutrinos. The target and horns are encased in actively cooled steel and concrete shielding inmore » a chamber called the target chase. The reference design chase is filled with air, but nitrogen and helium are being evaluated as alternatives. A replaceable beam window separates the decay pipe from the target chase. The facility is designed for initial operation at 1.2 MW, with the ability to upgrade to 2.4 MW, and is taking advantage of the experience gained by operating Fermilab’s NuMI facility. We discuss here the design status, associated challenges, and ongoing R&D and physics-driven component optimization of the Target Station.« less

  6. Hydrodynamics of laser-driven double-foil collisions studied by orthogonal x-ray imaging

    NASA Astrophysics Data System (ADS)

    Aglitskiy, Y.; Metzler, N.; Karasik, M.; Serlin, V.; Obenschain, S. P.; Schmitt, A. J.; Velikovich, A. L.; Gardner, J. H.; Weaver, J.; Oh, J.

    2006-10-01

    With this experiment we start the study of the physics of hydrodynamic instability seeding and growth during the deceleration and stagnation phases. Our first targets consisted of two separated parallel plastic foils -- flat and rippled. The flat foil was irradiated by the 4 ns Nike KrF laser pulses at 50 TW/cm^2 and accelerated towards the rippled one. Orthogonal imaging, i. e., a simultaneous side-on and face-on radiography of the targets has been used in these experiments. Side-on x-ray radiography and VISAR data yield shock and target velocities before and after the collision. Face-on streaks revealed well-pronounced oscillatory behavior of the single-mode mass perturbations. Both sets of synchronized data were compared with 1D and 2D simulations. Observed velocities, timing and the peak value of areal mass variation are in good agreement with the simulated ones.

  7. Reward and attentional control in visual search.

    PubMed

    Yantis, Steven; Anderson, Brian A; Wampler, Emma K; Laurent, Patryk A

    2012-01-01

    It has long been known that the control of attention in visual search depends both on voluntary, top-down deployment according to context-specific goals, and on involuntary, stimulus-driven capture based on the physical conspicuity of perceptual objects. Recent evidence suggests that pairing target stimuli with reward can modulate the voluntary deployment of attention, but there is little evidence that reward modulates the involuntary deployment of attention to task-irrelevant distractors. We report several experiments that investigate the role of reward learning on attentional control. Each experiment involved a training phase and a test phase. In the training phase, different colors were associated with different amounts of monetary reward. In the test phase, color was not task-relevant and participants searched for a shape singleton; in most experiments no reward was delivered in the test phase. We first show that attentional capture by physically salient distractors is magnified by a previous association with reward. In subsequent experiments we demonstrate that physically inconspicuous stimuli previously associated with reward capture attention persistently during extinction--even several days after training. Furthermore, vulnerability to attentional capture by high-value stimuli is negatively correlated across individuals with working memory capacity and positively correlated with trait impulsivity. An analysis of intertrial effects reveals that value-driven attentional capture is spatially specific. Finally, when reward is delivered at test contingent on the task-relevant shape feature, recent reward history modulates value-driven attentional capture by the irrelevant color feature. The influence of learned value on attention may provide a useful model of clinical syndromes characterized by similar failures of cognitive control, including addiction, attention-deficit/hyperactivity disorder, and obesity.

  8. PREVIEW Behavior Modification Intervention Toolbox (PREMIT): A Study Protocol for a Psychological Element of a Multicenter Project.

    PubMed

    Kahlert, Daniela; Unyi-Reicherz, Annelie; Stratton, Gareth; Meinert Larsen, Thomas; Fogelholm, Mikael; Raben, Anne; Schlicht, Wolfgang

    2016-01-01

    Losing excess body weight and preventing weight regain by changing lifestyle is a challenging but promising task to prevent the incidence of type-2 diabetes. To be successful, it is necessary to use evidence-based and theory-driven interventions, which also contribute to the science of behavior modification by providing a deeper understanding of successful intervention components. To develop a physical activity and dietary behavior modification intervention toolbox (PREMIT) that fulfills current requirements of being theory-driven and evidence-based, comprehensively described and feasible to evaluate. PREMIT is part of an intervention trial, which aims to prevent the onset of type-2 diabetes in pre-diabetics in eight clinical centers across the world by guiding them in changing their physical activity and dietary behavior through a group counseling approach. The program development took five progressive steps, in line with the Public Health Action Cycle: (1) Summing-up the intervention goal(s), target group and the setting, (2) uncovering the generative psychological mechanisms, (3) identifying behavior change techniques and tools, (4) preparing for evaluation and (5) implementing the intervention and assuring quality. PREMIT is based on a trans-theoretical approach referring to valid behavior modification theories, models and approaches. A major "product" of PREMIT is a matrix, constructed for use by onsite-instructors. The matrix includes objectives, tasks and activities ordered by periods. PREMIT is constructed to help instructors guide participants' behavior change. To ensure high fidelity and adherence of program-implementation across the eight intervention centers standardized operational procedures were defined and "train-the-trainer" workshops were held. In summary PREMIT is a theory-driven, evidence-based program carefully developed to change physical activity and dietary behaviors in pre-diabetic people.

  9. PREVIEW Behavior Modification Intervention Toolbox (PREMIT): A Study Protocol for a Psychological Element of a Multicenter Project

    PubMed Central

    Kahlert, Daniela; Unyi-Reicherz, Annelie; Stratton, Gareth; Meinert Larsen, Thomas; Fogelholm, Mikael; Raben, Anne; Schlicht, Wolfgang

    2016-01-01

    Background: Losing excess body weight and preventing weight regain by changing lifestyle is a challenging but promising task to prevent the incidence of type-2 diabetes. To be successful, it is necessary to use evidence-based and theory-driven interventions, which also contribute to the science of behavior modification by providing a deeper understanding of successful intervention components. Objective: To develop a physical activity and dietary behavior modification intervention toolbox (PREMIT) that fulfills current requirements of being theory-driven and evidence-based, comprehensively described and feasible to evaluate. PREMIT is part of an intervention trial, which aims to prevent the onset of type-2 diabetes in pre-diabetics in eight clinical centers across the world by guiding them in changing their physical activity and dietary behavior through a group counseling approach. Methods: The program development took five progressive steps, in line with the Public Health Action Cycle: (1) Summing-up the intervention goal(s), target group and the setting, (2) uncovering the generative psychological mechanisms, (3) identifying behavior change techniques and tools, (4) preparing for evaluation and (5) implementing the intervention and assuring quality. Results: PREMIT is based on a trans-theoretical approach referring to valid behavior modification theories, models and approaches. A major “product” of PREMIT is a matrix, constructed for use by onsite-instructors. The matrix includes objectives, tasks and activities ordered by periods. PREMIT is constructed to help instructors guide participants' behavior change. To ensure high fidelity and adherence of program-implementation across the eight intervention centers standardized operational procedures were defined and “train-the-trainer” workshops were held. In summary PREMIT is a theory-driven, evidence-based program carefully developed to change physical activity and dietary behaviors in pre-diabetic people. PMID:27559319

  10. Reward and Attentional Control in Visual Search

    PubMed Central

    Anderson, Brian A.; Wampler, Emma K.; Laurent, Patryk A.

    2015-01-01

    It has long been known that the control of attention in visual search depends both on voluntary, top-down deployment according to context-specific goals, and on involuntary, stimulus-driven capture based on the physical conspicuity of perceptual objects. Recent evidence suggests that pairing target stimuli with reward can modulate the voluntary deployment of attention, but there is little evidence that reward modulates the involuntary deployment of attention to task-irrelevant distractors. We report several experiments that investigate the role of reward learning on attentional control. Each experiment involved a training phase and a test phase. In the training phase, different colors were associated with different amounts of monetary reward. In the test phase, color was not task-relevant and participants searched for a shape singleton; in most experiments no reward was delivered in the test phase. We first show that attentional capture by physically salient distractors is magnified by a previous association with reward. In subsequent experiments we demonstrate that physically inconspicuous stimuli previously associated with reward capture attention persistently during extinction—even several days after training. Furthermore, vulnerability to attentional capture by high-value stimuli is negatively correlated across individuals with working memory capacity and positively correlated with trait impulsivity. An analysis of intertrial effects reveals that value-driven attentional capture is spatially specific. Finally, when reward is delivered at test contingent on the task-relevant shape feature, recent reward history modulates value-driven attentional capture by the irrelevant color feature. The influence of learned value on attention may provide a useful model of clinical syndromes characterized by similar failures of cognitive control, including addiction, attention-deficit/hyperactivity disorder, and obesity. PMID:23437631

  11. Target materials for exotic ISOL beams

    NASA Astrophysics Data System (ADS)

    Gottberg, A.

    2016-06-01

    The demand for intensity, purity, reliability and availability of short-lived isotopes far from stability is steadily high, and considerably exceeding the supply. In many cases the ISOL (Isotope Separation On-Line) method can provide beams of high intensity and purity. Limitations in terms of accessible chemical species and minimum half-life are driven mainly by chemical reactions and physical processes inside of the thick target. A wide range of materials are in use, ranging from thin metallic foils and liquids to refractory ceramics, while poly-phasic mixed uranium carbides have become the reference target material for most ISOL facilities world-wide. Target material research and development is often complex and especially important post-irradiation analyses are hindered by the high intrinsic radiotoxicity of these materials. However, recent achievements have proven that these investigations are possible if the effort of different facilities is combined, leading to the development of new material matrices that can supply new beams of unprecedented intensity and beam current stability.

  12. Radioactive ion beams at ISOLDE/CERN recent developments and perspectives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Georg, U.; Catherall, R.; Giles, T.

    1999-11-16

    Since the move of ISOLDE from CERN's synchrocyclotron (SC) to the Proton Synchrotron Booster (PSB) in 1992 extensive work has been devoted to the development of new beams, i.e. the production of new isotopes, beams of higher intensity and the ionization of further elements. Most of these developments were driven by the particular needs of the physics community proposing new experiments. The main achievements were the adaption of liquid metal targets to the pulsed proton beam to prevent shockwaves and splashing inside the target container and systematic studies on the time structure of the release of the isotopes from themore » target. Furthermore the work on laser ion-sources already started at ISOLDE-2 was continued, the so-called RIST target was developed, and most recently first tests on the isotope production while increasing the proton energy from 1 GeV to 1.4 GeV were done. The latter topics are discussed in this paper.« less

  13. Radioactive Ion Beams at ISOLDE/CERN Recent Developments and Perspectives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    U. Georg; J.R.J. Bennett; U.C. Bergmann

    1999-12-31

    Since the move of ISOLDE from CERN's synchrocyclotron (SC) to the Proton Synchrotron Booster (PSB) in 1992 extensive work has been devoted to the development of new beams, i.e. the production of new isotopes, beams of higher intensity and the ionization of further elements. Most of these developments were driven by the particular needs of the physics community proposing new experiments. The main achievements were the adaption of liquid metal targets to the pulsed proton beam to prevent shockwaves and splashing inside the target container and systematic studies on the time structure of the release of the isotopes from themore » target. Furthermore the work on laser ion-sources already started at ISOLDE-2 was continued, the so-called RIST target was developed, and most recently first tests on the isotope production while increasing the proton energy from 1 GeV to 1.4 GeV were done. The latter topics are discussed in this paper.« less

  14. Teaching a Hypothesis-driven Physical Diagnosis Curriculum to Pulmonary Fellows Improves Performance of First-Year Medical Students.

    PubMed

    Staitieh, Bashar S; Saghafi, Ramin; Kempker, Jordan A; Schulman, David A

    2016-04-01

    Hypothesis-driven physical examination emphasizes the role of bedside examination in the refinement of differential diagnoses and improves diagnostic acumen. This approach has not yet been investigated as a tool to improve the ability of higher-level trainees to teach medical students. To assess the effect of teaching hypothesis-driven physical diagnosis to pulmonary fellows on their ability to improve the pulmonary examination skills of first-year medical students. Fellows and students were assessed on teaching and diagnostic skills by self-rating on a Likert scale. One group of fellows received the hypothesis-driven teaching curriculum (the "intervention" group) and another received instruction on head-to-toe examination. Both groups subsequently taught physical diagnosis to a group of first-year medical students. An oral examination was administered to all students after completion of the course. Fellows were comfortable teaching physical diagnosis to students. Students in both groups reported a lack of comfort with the pulmonary examination at the beginning of the course and improvement in their comfort by the end. Students trained by intervention group fellows outperformed students trained by control group fellows in the interpretation of physical findings (P < 0.05). Teaching hypothesis-driven physical examination to higher-level trainees who teach medical students improves the ability of students to interpret physical findings. This benefit should be confirmed using validated testing tools.

  15. The physics of sub-critical lattices in accelerator driven hybrid systems: The MUSE experiments in the MASURCA facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chauvin, J. P.; Lebrat, J. F.; Soule, R.

    Since 1991, the CEA has studied the physics of hybrid systems, involving a sub-critical reactor coupled with an accelerator. These studies have provided information on the potential of hybrid systems to transmute actinides and, long lived fission products. The potential of such a system remains to be proven, specifically in terms of the physical understanding of the different phenomena involved and their modelling, as well as in terms of experimental validation of coupled systems, sub-critical environment/accelerator. This validation must be achieved through mock-up studies of the sub-critical environments coupled to a source of external neutrons. The MUSE-4 mock-up experiment ismore » planed at the MASURCA facility and will use an accelerator coupled to a tritium target. The great step between the generator used in the past and the accelerator will allow to increase the knowledge in hybrid physic and to decrease the experimental biases and the measurement uncertainties.« less

  16. Developing Large Scale Explosively Driven Flyer Experiments on Sand

    NASA Astrophysics Data System (ADS)

    Rehagen, Thomas; Kraus, Richard

    2017-06-01

    Measurements of the dynamic behavior of granular materials are of great importance to a variety of scientific and engineering applications, including planetary science, seismology, and construction and destruction. In addition, high quality data are needed to enhance our understanding of granular physics and improve the computational models used to simulate related physical processes. However, since there is a non-negligible grain size associated with these materials, experiments must be of a relatively large scale in order to capture the continuum response of the material and reduce errors associated with the finite grain size. We will present designs for explosively driven flyer experiments to make high accuracy measurements of the Hugoniot of sand (with a grain size of hundreds of microns). To achieve an accuracy of better than a few percent in density, we are developing a platform to measure the Hugoniot of samples several centimeters in thickness. We will present the target designs as well as coupled designs for the explosively launched flyer system. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344.

  17. Hormesis does not make sense except in the light of TOR-driven aging

    PubMed Central

    Blagosklonny, Mikhail V.

    2011-01-01

    Weak stresses (including weak oxidative stress, cytostatic agents, heat shock, hypoxia, calorie restriction) may extend lifespan. Known as hormesis, this is the most controversial notion in gerontology. For one, it is believed that aging is caused by accumulation of molecular damage. If so, hormetic stresses (by causing damage) must shorten lifespan. To solve the paradox, it was suggested that, by activating repair, hormetic stresses eventually decrease damage. Similarly, Baron Munchausen escaped from a swamp by pulling himself up by his own hair. Instead, I discuss that aging is not caused by accumulation of molecular damage. Although molecular damage accumulates, organisms do not live long enough to age from this accumulation. Instead, aging is driven by overactivated signal-transduction pathways including the TOR (Target of Rapamycin) pathway. A diverse group of hormetic conditions can be divided into two groups. “Hormesis A” inhibits the TOR pathway. “Hormesis B” increases aging-tolerance, defined as the ability to survive catastrophic complications of aging. Hormesis A includes calorie restriction, resveratrol, rapamycin, p53-inducing agents and, in part, physical exercise, heat shock and hypoxia. Hormesis B includes ischemic preconditioning and, in part, physical exercise, heat shock, hypoxia and medical interventions. PMID:22166724

  18. NDCX-II target experiments and simulations

    DOE PAGES

    Barnard, J. J.; More, R. M.; Terry, M.; ...

    2013-06-13

    The ion accelerator NDCX-II is undergoing commissioning at Lawrence Berkeley National Laboratory (LBNL). Its principal mission is to explore ion-driven High Energy Density Physics (HEDP) relevant to Inertial Fusion Energy (IFE) especially in the Warm Dense Matter (WDM) regime. We have carried out hydrodynamic simulations of beam-heated targets for parameters expected for the initial configuration of NDCX-II. For metal foils of order one micron thick (thin targets), the beam is predicted to heat the target in a timescale comparable to the hydrodynamic expansion time for experiments that infer material properties from measurements of the resulting rarefaction wave. We have alsomore » carried out hydrodynamic simulations of beam heating of metallic foam targets several tens of microns thick (thick targets) in which the ion range is shorter than the areal density of the material. In this case shock waves will form and we derive simple scaling laws for the efficiency of conversion of ion energy into kinetic energy of fluid flow. Geometries with a tamping layer may also be used to study the merging of a tamper shock with the end-of-range shock. As a result, this process can occur in tamped, direct drive IFE targets.« less

  19. Research opportunities with compact accelerator-driven neutron sources

    NASA Astrophysics Data System (ADS)

    Anderson, I. S.; Andreani, C.; Carpenter, J. M.; Festa, G.; Gorini, G.; Loong, C.-K.; Senesi, R.

    2016-10-01

    Since the discovery of the neutron in 1932 neutron beams have been used in a very broad range of applications, As an aging fleet of nuclear reactor sources is retired the use of compact accelerator-driven neutron sources (CANS) is becoming more prevalent. CANS are playing a significant and expanding role in research and development in science and engineering, as well as in education and training. In the realm of multidisciplinary applications, CANS offer opportunities over a wide range of technical utilization, from interrogation of civil structures to medical therapy to cultural heritage study. This paper aims to provide the first comprehensive overview of the history, current status of operation, and ongoing development of CANS worldwide. The basic physics and engineering regarding neutron production by accelerators, target-moderator systems, and beam line instrumentation are introduced, followed by an extensive discussion of various evolving applications currently exploited at CANS.

  20. Data-based adjoint and H2 optimal control of the Ginzburg-Landau equation

    NASA Astrophysics Data System (ADS)

    Banks, Michael; Bodony, Daniel

    2017-11-01

    Equation-free, reduced-order methods of control are desirable when the governing system of interest is of very high dimension or the control is to be applied to a physical experiment. Two-phase flow optimal control problems, our target application, fit these criteria. Dynamic Mode Decomposition (DMD) is a data-driven method for model reduction that can be used to resolve the dynamics of very high dimensional systems and project the dynamics onto a smaller, more manageable basis. We evaluate the effectiveness of DMD-based forward and adjoint operator estimation when applied to H2 optimal control approaches applied to the linear and nonlinear Ginzburg-Landau equation. Perspectives on applying the data-driven adjoint to two phase flow control will be given. Office of Naval Research (ONR) as part of the Multidisciplinary University Research Initiatives (MURI) Program, under Grant Number N00014-16-1-2617.

  1. Data-driven, Interpretable Photometric Redshifts Trained on Heterogeneous and Unrepresentative Data

    NASA Astrophysics Data System (ADS)

    Leistedt, Boris; Hogg, David W.

    2017-03-01

    We present a new method for inferring photometric redshifts in deep galaxy and quasar surveys, based on a data-driven model of latent spectral energy distributions (SEDs) and a physical model of photometric fluxes as a function of redshift. This conceptually novel approach combines the advantages of both machine learning methods and template fitting methods by building template SEDs directly from the spectroscopic training data. This is made computationally tractable with Gaussian processes operating in flux-redshift space, encoding the physics of redshifts and the projection of galaxy SEDs onto photometric bandpasses. This method alleviates the need to acquire representative training data or to construct detailed galaxy SED models; it requires only that the photometric bandpasses and calibrations be known or have parameterized unknowns. The training data can consist of a combination of spectroscopic and deep many-band photometric data with reliable redshifts, which do not need to entirely spatially overlap with the target survey of interest or even involve the same photometric bands. We showcase the method on the I-magnitude-selected, spectroscopically confirmed galaxies in the COSMOS field. The model is trained on the deepest bands (from SUBARU and HST) and photometric redshifts are derived using the shallower SDSS optical bands only. We demonstrate that we obtain accurate redshift point estimates and probability distributions despite the training and target sets having very different redshift distributions, noise properties, and even photometric bands. Our model can also be used to predict missing photometric fluxes or to simulate populations of galaxies with realistic fluxes and redshifts, for example.

  2. Teaching a Hypothesis-driven Physical Diagnosis Curriculum to Pulmonary Fellows Improves Performance of First-Year Medical Students

    PubMed Central

    Saghafi, Ramin; Kempker, Jordan A.; Schulman, David A.

    2016-01-01

    Rationale: Hypothesis-driven physical examination emphasizes the role of bedside examination in the refinement of differential diagnoses and improves diagnostic acumen. This approach has not yet been investigated as a tool to improve the ability of higher-level trainees to teach medical students. Objectives: To assess the effect of teaching hypothesis-driven physical diagnosis to pulmonary fellows on their ability to improve the pulmonary examination skills of first-year medical students. Methods: Fellows and students were assessed on teaching and diagnostic skills by self-rating on a Likert scale. One group of fellows received the hypothesis-driven teaching curriculum (the “intervention” group) and another received instruction on head-to-toe examination. Both groups subsequently taught physical diagnosis to a group of first-year medical students. An oral examination was administered to all students after completion of the course. Measurements and Main Results: Fellows were comfortable teaching physical diagnosis to students. Students in both groups reported a lack of comfort with the pulmonary examination at the beginning of the course and improvement in their comfort by the end. Students trained by intervention group fellows outperformed students trained by control group fellows in the interpretation of physical findings (P < 0.05). Conclusions: Teaching hypothesis-driven physical examination to higher-level trainees who teach medical students improves the ability of students to interpret physical findings. This benefit should be confirmed using validated testing tools. PMID:26730644

  3. Arc-based smoothing of ion beam intensity on targets

    DOE PAGES

    Friedman, Alex

    2012-06-20

    Manipulating a set of ion beams upstream of a target, makes it possible to arrange a smoother deposition pattern, so as to achieve more uniform illumination of the target. A uniform energy deposition pattern is important for applications including ion-beam-driven high energy density physics and heavy-ion beam-driven inertial fusion energy (“heavy-ion fusion”). Here, we consider an approach to such smoothing that is based on rapidly “wobbling” each of the beams back and forth along a short arc-shaped path, via oscillating fields applied upstream of the final pulse compression. In this technique, uniformity is achieved in the time-averaged sense; this ismore » sufficient provided the beam oscillation timescale is short relative to the hydrodynamic timescale of the target implosion. This work builds on two earlier concepts: elliptical beams applied to a distributed-radiator target [D. A. Callahan and M. Tabak, Phys. Plasmas 7, 2083 (2000)] and beams that are wobbled so as to trace a number of full rotations around a circular or elliptical path [R. C. Arnold et al., Nucl. Instrum. Methods 199, 557 (1982)]. Here, we describe the arc-based smoothing approach and compare it to results obtainable using an elliptical-beam prescription. In particular, we assess the potential of these approaches for minimization of azimuthal asymmetry, for the case of a ring of beams arranged on a cone. We also found that, for small numbers of beams on the ring, the arc-based smoothing approach offers superior uniformity. In contrast with the full-rotation approach, arc-based smoothing remains usable when the geometry precludes wobbling the beams around a full circle, e.g., for the X-target [E. Henestroza, B. G. Logan, and L. J. Perkins, Phys. Plasmas 18, 032702 (2011)] and some classes of distributed-radiator targets.« less

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedman, A.; Barnard, J. J.; Cohen, R. H.

    The Heavy Ion Fusion Science Virtual National Laboratory(a collaboration of LBNL, LLNL, and PPPL) is using intense ion beams to heat thin foils to the"warm dense matter" regime at<~;; 1 eV, and is developing capabilities for studying target physics relevant to ion-driven inertial fusion energy. The need for rapid target heating led to the development of plasma-neutralized pulse compression, with current amplification factors exceeding 50 now routine on the Neutralized Drift Compression Experiment (NDCX). Construction of an improved platform, NDCX-II, has begun at LBNL with planned completion in 2012. Using refurbished induction cells from the Advanced Test Accelerator at LLNL,more » NDCX-II will compress a ~;;500 ns pulse of Li+ ions to ~;;1 ns while accelerating it to 3-4 MeV over ~;;15 m. Strong space charge forces are incorporated into the machine design at a fundamental level. We are using analysis, an interactive 1D PIC code (ASP) with optimizing capabilities and centroid tracking, and multi-dimensional Warpcode PIC simulations, to develop the NDCX-II accelerator. This paper describes the computational models employed, and the resulting physics design for the accelerator.« less

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedman, A; Barnard, J J; Cohen, R H

    The Heavy Ion Fusion Science Virtual National Laboratory (a collaboration of LBNL, LLNL, and PPPL) is using intense ion beams to heat thin foils to the 'warm dense matter' regime at {approx}< 1 eV, and is developing capabilities for studying target physics relevant to ion-driven inertial fusion energy. The need for rapid target heating led to the development of plasma-neutralized pulse compression, with current amplification factors exceeding 50 now routine on the Neutralized Drift Compression Experiment (NDCX). Construction of an improved platform, NDCX-II, has begun at LBNL with planned completion in 2012. Using refurbished induction cells from the Advanced Testmore » Accelerator at LLNL, NDCX-II will compress a {approx}500 ns pulse of Li{sup +} ions to {approx} 1 ns while accelerating it to 3-4 MeV over {approx} 15 m. Strong space charge forces are incorporated into the machine design at a fundamental level. We are using analysis, an interactive 1D PIC code (ASP) with optimizing capabilities and centroid tracking, and multi-dimensional Warpcode PIC simulations, to develop the NDCX-II accelerator. This paper describes the computational models employed, and the resulting physics design for the accelerator.« less

  6. X-ray Thomson scattering measurements from hohlraum-driven spheres on the OMEGA laser [X-ray Thomson scattering measurements from hohlraum targets on the OMEGA laser

    DOE PAGES

    Saunders, A. M.; Jenei, A.; Doppner, T.; ...

    2016-08-30

    X-ray Thomson scattering (XRTS) is a powerful diagnostic for probing warm and hot dense matter. We present the design and results of the first XRTS experiments with hohlraum-driven CH 2 targets on the OMEGA laser. X-rays seen directly from the XRTS x-ray source overshadow the elastic scattering signal from the target capsule, but can be controlled in future experiments. From the inelastic scattering signal, an average plasma temperature is inferred that is in reasonable agreement with the temperatures predicted by simulations. Here, knowledge gained in this experiment show a promising future for further XRTS measurements on indirectly driven OMEGA targets.

  7. X-ray Thomson scattering measurements from hohlraum-driven spheres on the OMEGA laser [X-ray Thomson scattering measurements from hohlraum targets on the OMEGA laser

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saunders, A. M.; Jenei, A.; Doppner, T.

    X-ray Thomson scattering (XRTS) is a powerful diagnostic for probing warm and hot dense matter. We present the design and results of the first XRTS experiments with hohlraum-driven CH 2 targets on the OMEGA laser. X-rays seen directly from the XRTS x-ray source overshadow the elastic scattering signal from the target capsule, but can be controlled in future experiments. From the inelastic scattering signal, an average plasma temperature is inferred that is in reasonable agreement with the temperatures predicted by simulations. Here, knowledge gained in this experiment show a promising future for further XRTS measurements on indirectly driven OMEGA targets.

  8. Development and evaluation of a structured programme for promoting physical activity among seniors with intellectual disabilities: a study protocol for a cluster randomized trial

    PubMed Central

    2013-01-01

    Background Older people with intellectual disabilities have very low physical activity levels. Well designed, theory-driven and evidence-based health promotion programmes for the target population are lacking. This paper describes the design of a cluster-randomised trial for a systematically developed health promotion programme aimed at improving physical activity and increasing fitness among seniors with intellectual disabilities. Methods and design The Intervention Mapping protocol was used for programme development. After defining the programme’s objectives, the following behavioural techniques were selected to achieve them: Tailoring, Education, Modelling, Mirroring, Feedback, Reinforcement and Grading. With professionals and managers of provider services for people with intellectual disabilities, we translated these strategies into a structured day-activity programme, that consisted of a physical activity and an education programme. The programme will be executed in five day-activity centres in groups of eight to ten seniors during eight months, whereas seniors in five other centres receive care as usual. The physical activity level, as measured in number of steps a day, will be used as primary outcome measurement. Secondary outcome measurements include motor fitness, cardio respiratory fitness, morphological and metabolic fitness, ADL, functional deterioration and depressive symptoms. Differences in the primary and secondary outcome measures between participants and controls will be analysed using generalized estimation equations, correcting for day-activity center as cluster. Discussion This paper provides insight into the development and content of a theory-driven intervention aimed at behavioural change in a population with a low intellectual level. Its evaluation design is described. The programme’s applicability to other populations is discussed. Trial registration Trial number: ISRCTN82341588 PMID:23938154

  9. A Physics Exploratory Experiment on Plasma Liner Formation

    NASA Technical Reports Server (NTRS)

    Thio, Y. C. Francis; Knapp, Charles E.; Kirkpatrick, Ronald C.; Siemon, Richard E.; Turchi, Peter

    2002-01-01

    Momentum flux for imploding a target plasma in magnetized target fusion (MTF) may be delivered by an array of plasma guns launching plasma jets that would merge to form an imploding plasma shell (liner). In this paper, we examine what would be a worthwhile experiment to do in order to explore the dynamics of merging plasma jets to form a plasma liner as a first step in establishing an experimental database for plasma-jets driven magnetized target fusion (PJETS-MTF). Using past experience in fusion energy research as a model, we envisage a four-phase program to advance the art of PJETS-MTF to fusion breakeven Q is approximately 1). The experiment (PLX (Plasma Liner Physics Exploratory Experiment)) described in this paper serves as Phase I of this four-phase program. The logic underlying the selection of the experimental parameters is presented. The experiment consists of using twelve plasma guns arranged in a circle, launching plasma jets towards the center of a vacuum chamber. The velocity of the plasma jets chosen is 200 km/s, and each jet is to carry a mass of 0.2 mg - 0.4 mg. A candidate plasma accelerator for launching these jets consists of a coaxial plasma gun of the Marshall type.

  10. Laser-driven strong magnetostatic fields with applications to charged beam transport and magnetized high energy-density physics

    NASA Astrophysics Data System (ADS)

    Santos, Joao

    2017-10-01

    Powerful laser-plasma processes are explored to generate discharge currents of a few 100 kA in coil targets, yielding magnetostatic fields (B-fields) in the kTesla range. The B-fields are measured by proton-deflectometry and high-frequency bandwidth B-dot probes. According to our modeling, the quasi-static currents are provided from hot electron ejection from the laser-irradiated surface, accounting for the space charge neutralization and the plasma magnetization. The major control parameter is the laser irradiance Iλ2 . The B-fields ns-scale is long enough to magnetize secondary targets through resistive diffusion. We applied it in experiments of laser-generated relativistic electron transport into solid dielectric targets, yielding an unprecedented enhancement of a factor 5 on the energy-density flux at 60 µm depth, compared to unmagnetized transport conditions. These studies pave the ground for magnetized high-energy density physics investigations, related to laser-generated secondary sources of radiation and/or high-energy particles and their transport, to high-gain fusion energy schemes and to laboratory astrophysics. We acknowledge funding from French National Agency for Research (ANR), Grant TERRE ANR-2011-BS04-014, and from EUROfusion Consortium, European Union's Horizon 2020 research and innovation programme, Grant 633053.

  11. Physics design of a 10 MeV injector test stand for an accelerator-driven subcritical system

    NASA Astrophysics Data System (ADS)

    Yan, Fang; Pei, Shilun; Geng, Huiping; Meng, Cai; Zhao, Yaliang; Sun, Biao; Cheng, Peng; Yang, Zheng; Ouyang, Huafu; Li, Zhihui; Tang, Jingyu; Wang, Jianli; Sui, Yefeng; Dai, Jianping; Sha, Peng; Ge, Rui

    2015-05-01

    The 10 MeV accelerator-driven subcritical system (ADS) Injector I test stand at Institute of High Energy Physics (IHEP) is a testing facility dedicated to demonstrate one of the two injector design schemes [Injector Scheme-I, which works at 325 MHz], for the ADS project in China. The injector is composed of two parts, the linac part and the beam dump line. The former is designed on the basis of 325 MHz four-vane type copper structure radio frequency quadrupole and superconducting (SC) spoke cavities with β =0.12 . The latter is designed to transport the beam coming out of the SC section of the linac to the beam dump, where the beam transverse profile is fairly enlarged and unformed to simplify the beam target design. The SC section consists of two cryomodules with 14 β =0.12 Spoke cavities, 14 solenoid and 14 BPMs in total. The first challenge in the physics design comes from the necessary space required for the cryomodule separation where the periodical lattice is destroyed at a relatively lower energy of ˜5 MeV . Another challenge is the beam dump line design, as it will be the first beam dump line being built by using a step field magnet for the transverse beam expansion and uniformity in the world. This paper gives an overview of the physics design study together with the design principles and machine construction considerations. The results of an optimized design, fabrication status and end to end simulations including machine errors are presented.

  12. Guiding of relativistic electron beams in dense matter by laser-driven magnetostatic fields.

    PubMed

    Bailly-Grandvaux, M; Santos, J J; Bellei, C; Forestier-Colleoni, P; Fujioka, S; Giuffrida, L; Honrubia, J J; Batani, D; Bouillaud, R; Chevrot, M; Cross, J E; Crowston, R; Dorard, S; Dubois, J-L; Ehret, M; Gregori, G; Hulin, S; Kojima, S; Loyez, E; Marquès, J-R; Morace, A; Nicolaï, Ph; Roth, M; Sakata, S; Schaumann, G; Serres, F; Servel, J; Tikhonchuk, V T; Woolsey, N; Zhang, Z

    2018-01-09

    Intense lasers interacting with dense targets accelerate relativistic electron beams, which transport part of the laser energy into the target depth. However, the overall laser-to-target energy coupling efficiency is impaired by the large divergence of the electron beam, intrinsic to the laser-plasma interaction. Here we demonstrate that an efficient guiding of MeV electrons with about 30 MA current in solid matter is obtained by imposing a laser-driven longitudinal magnetostatic field of 600 T. In the magnetized conditions the transported energy density and the peak background electron temperature at the 60-μm-thick target's rear surface rise by about a factor of five, as unfolded from benchmarked simulations. Such an improvement of energy-density flux through dense matter paves the ground for advances in laser-driven intense sources of energetic particles and radiation, driving matter to extreme temperatures, reaching states relevant for planetary or stellar science as yet inaccessible at the laboratory scale and achieving high-gain laser-driven thermonuclear fusion.

  13. Statistical and engineering methods for model enhancement

    NASA Astrophysics Data System (ADS)

    Chang, Chia-Jung

    Models which describe the performance of physical process are essential for quality prediction, experimental planning, process control and optimization. Engineering models developed based on the underlying physics/mechanics of the process such as analytic models or finite element models are widely used to capture the deterministic trend of the process. However, there usually exists stochastic randomness in the system which may introduce the discrepancy between physics-based model predictions and observations in reality. Alternatively, statistical models can be used to develop models to obtain predictions purely based on the data generated from the process. However, such models tend to perform poorly when predictions are made away from the observed data points. This dissertation contributes to model enhancement research by integrating physics-based model and statistical model to mitigate the individual drawbacks and provide models with better accuracy by combining the strengths of both models. The proposed model enhancement methodologies including the following two streams: (1) data-driven enhancement approach and (2) engineering-driven enhancement approach. Through these efforts, more adequate models are obtained, which leads to better performance in system forecasting, process monitoring and decision optimization. Among different data-driven enhancement approaches, Gaussian Process (GP) model provides a powerful methodology for calibrating a physical model in the presence of model uncertainties. However, if the data contain systematic experimental errors, the GP model can lead to an unnecessarily complex adjustment of the physical model. In Chapter 2, we proposed a novel enhancement procedure, named as “Minimal Adjustment”, which brings the physical model closer to the data by making minimal changes to it. This is achieved by approximating the GP model by a linear regression model and then applying a simultaneous variable selection of the model and experimental bias terms. Two real examples and simulations are presented to demonstrate the advantages of the proposed approach. Different from enhancing the model based on data-driven perspective, an alternative approach is to focus on adjusting the model by incorporating the additional domain or engineering knowledge when available. This often leads to models that are very simple and easy to interpret. The concepts of engineering-driven enhancement are carried out through two applications to demonstrate the proposed methodologies. In the first application where polymer composite quality is focused, nanoparticle dispersion has been identified as a crucial factor affecting the mechanical properties. Transmission Electron Microscopy (TEM) images are commonly used to represent nanoparticle dispersion without further quantifications on its characteristics. In Chapter 3, we developed the engineering-driven nonhomogeneous Poisson random field modeling strategy to characterize nanoparticle dispersion status of nanocomposite polymer, which quantitatively represents the nanomaterial quality presented through image data. The model parameters are estimated through the Bayesian MCMC technique to overcome the challenge of limited amount of accessible data due to the time consuming sampling schemes. The second application is to calibrate the engineering-driven force models of laser-assisted micro milling (LAMM) process statistically, which facilitates a systematic understanding and optimization of targeted processes. In Chapter 4, the force prediction interval has been derived by incorporating the variability in the runout parameters as well as the variability in the measured cutting forces. The experimental results indicate that the model predicts the cutting force profile with good accuracy using a 95% confidence interval. To conclude, this dissertation is the research drawing attention to model enhancement, which has considerable impacts on modeling, design, and optimization of various processes and systems. The fundamental methodologies of model enhancement are developed and further applied to various applications. These research activities developed engineering compliant models for adequate system predictions based on observational data with complex variable relationships and uncertainty, which facilitate process planning, monitoring, and real-time control.

  14. Mixed signals: The effect of conflicting reward- and goal-driven biases on selective attention.

    PubMed

    Preciado, Daniel; Munneke, Jaap; Theeuwes, Jan

    2017-07-01

    Attentional selection depends on the interaction between exogenous (stimulus-driven), endogenous (goal-driven), and selection history (experience-driven) factors. While endogenous and exogenous biases have been widely investigated, less is known about their interplay with value-driven attention. The present study investigated the interaction between reward-history and goal-driven biases on perceptual sensitivity (d') and response time (RT) in a modified cueing paradigm presenting two coloured cues, followed by sinusoidal gratings. Participants responded to the orientation of one of these gratings. In Experiment 1, one cue signalled reward availability but was otherwise task irrelevant. In Experiment 2, the same cue signalled reward, and indicated the target's most likely location at the opposite side of the display. This design introduced a conflict between reward-driven biases attracting attention and goal-driven biases directing it away. Attentional effects were examined comparing trials in which cue and target appeared at the same versus opposite locations. Two interstimulus interval (ISI) levels were used to probe the time course of attentional effects. Experiment 1 showed performance benefits at the location of the reward-signalling cue and costs at the opposite for both ISIs, indicating value-driven capture. Experiment 2 showed performance benefits only for the long ISI when the target was at the opposite to the reward-associated cue. At the short ISI, only performance costs were observed. These results reveal the time course of these biases, indicating that reward-driven effects influence attention early but can be overcome later by goal-driven control. This suggests that reward-driven biases are integrated as attentional priorities, just as exogenous and endogenous factors.

  15. Improved Quantitative Plant Proteomics via the Combination of Targeted and Untargeted Data Acquisition

    PubMed Central

    Hart-Smith, Gene; Reis, Rodrigo S.; Waterhouse, Peter M.; Wilkins, Marc R.

    2017-01-01

    Quantitative proteomics strategies – which are playing important roles in the expanding field of plant molecular systems biology – are traditionally designated as either hypothesis driven or non-hypothesis driven. Many of these strategies aim to select individual peptide ions for tandem mass spectrometry (MS/MS), and to do this mixed hypothesis driven and non-hypothesis driven approaches are theoretically simple to implement. In-depth investigations into the efficacies of such approaches have, however, yet to be described. In this study, using combined samples of unlabeled and metabolically 15N-labeled Arabidopsis thaliana proteins, we investigate the mixed use of targeted data acquisition (TDA) and data dependent acquisition (DDA) – referred to as TDA/DDA – to facilitate both hypothesis driven and non-hypothesis driven quantitative data collection in individual LC-MS/MS experiments. To investigate TDA/DDA for hypothesis driven data collection, 7 miRNA target proteins of differing size and abundance were targeted using inclusion lists comprised of 1558 m/z values, using 3 different TDA/DDA experimental designs. In samples in which targeted peptide ions were of particularly low abundance (i.e., predominantly only marginally above mass analyser detection limits), TDA/DDA produced statistically significant increases in the number of targeted peptides identified (230 ± 8 versus 80 ± 3 for DDA; p = 1.1 × 10-3) and quantified (35 ± 3 versus 21 ± 2 for DDA; p = 0.038) per experiment relative to the use of DDA only. These expected improvements in hypothesis driven data collection were observed alongside unexpected improvements in non-hypothesis driven data collection. Untargeted peptide ions with m/z values matching those in inclusion lists were repeatedly identified and quantified across technical replicate TDA/DDA experiments, resulting in significant increases in the percentages of proteins repeatedly quantified in TDA/DDA experiments only relative to DDA experiments only (33.0 ± 2.6% versus 8.0 ± 2.7%, respectively; p = 0.011). These results were observed together with uncompromised broad-scale MS/MS data collection in TDA/DDA experiments relative to DDA experiments. Using our observations we provide guidelines for TDA/DDA method design for quantitative plant proteomics studies, and suggest that TDA/DDA is a broadly underutilized proteomics data acquisition strategy. PMID:29021799

  16. Influence of field ionization effect on the divergence of laser-driven fast electrons

    NASA Astrophysics Data System (ADS)

    Lang, Y.; Yang, X. H.; Xu, H.; Jin, Z.; Zhuo, H. B.

    2018-07-01

    The effect of field ionization on the divergence of fast electrons (E k ≥ 50 keV), driven by ultrashort-ultraintense laser pulse interaction with plasma, is studied by using 2D3V particle-in-cell simulations. It is found that, due to temperature anisotropy of the fast electrons in the ionizing target, strong fluctuant magnetic fields in the preplasma region is generated through Weibel instability. In turn, the field induces an enhancement of the hot electron divergence for the target with ionization process. Meanwhile, compared with the target without an ionization process, larger divergence of hot electrons can also be seen in the ionizing target with laser intensity varying from 5 × 1019 W/cm2 to 5 × 1020 W/cm2 and the divergence is weakly dependent on target materials for a fixed profile of preplasma. The results here are useful for the application of laser-driven fast electron beams.

  17. Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer

    DTIC Science & Technology

    2013-07-01

    to aid future studies. Identification is a highly significant finding with regard to the potential for future therapeutic development targeted at...Met trafficking, stability, and ultimately oncogenic potential . Palmitoylation defective mutants will be used in animal models of c-Met driven tumor...growth (Aim 2). In addition, future work toward identifying the enzyme responsible for palmitoylation of c- Met will provide a new specific target

  18. Laser Hole Boring into Overdense Plasma and Relativistic Electron Currents for Fast Ignition of ICF Targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pukhov, A.; Meyer-ter-Vehn, J.

    Laser hole boring and relativistic electron transport into plasma of 10 times critical density is studied by means of 2D particle-in-cell simulation. At intensities of I{sub 0}{lambda}{sup 2}=10{sup 20} W(cm){sup {minus}2} {mu}m{sup 2}, a channel 12{lambda} deep and 3{lambda} in diameter has formed after 200 laser cycles. The laser driven electron current carries up to 40{percent} of the incident laser power. When penetrating the overdense region, it breaks up into several filaments at early times, but is channeled into a single magnetized jet later on. These features are essential for fast ignition of targets for inertial confinement fusion (ICF). {copyright}more » {ital 1997} {ital The American Physical Society}« less

  19. Targeting MYCN-Driven Transcription By BET-Bromodomain Inhibition.

    PubMed

    Henssen, Anton; Althoff, Kristina; Odersky, Andrea; Beckers, Anneleen; Koche, Richard; Speleman, Frank; Schäfers, Simon; Bell, Emma; Nortmeyer, Maike; Westermann, Frank; De Preter, Katleen; Florin, Alexandra; Heukamp, Lukas; Spruessel, Annika; Astrahanseff, Kathy; Lindner, Sven; Sadowski, Natalie; Schramm, Alexander; Astorgues-Xerri, Lucile; Riveiro, Maria E; Eggert, Angelika; Cvitkovic, Esteban; Schulte, Johannes H

    2016-05-15

    Targeting BET proteins was previously shown to have specific antitumoral efficacy against MYCN-amplified neuroblastoma. We here assess the therapeutic efficacy of the BET inhibitor, OTX015, in preclinical neuroblastoma models and extend the knowledge on the role of BRD4 in MYCN-driven neuroblastoma. The efficacy of OTX015 was assessed in in vitro and in vivo models of human and murine MYCN-driven neuroblastoma. To study the effects of BET inhibition in the context of high MYCN levels, MYCN was ectopically expressed in human and murine cells. The effect of OTX015 on BRD4-regulated transcriptional pause release was analyzed using BRD4 and H3K27Ac chromatin immunoprecipitation coupled with DNA sequencing (ChIP-Seq) and gene expression analysis in neuroblastoma cells treated with OTX015 compared with vehicle control. OTX015 showed therapeutic efficacy against preclinical MYCN-driven neuroblastoma models. Similar to previously described BET inhibitors, concurrent MYCN repression was observed in OTX015-treated samples. Ectopic MYCN expression, however, did not abrogate effects of OTX015, indicating that MYCN repression is not the only target of BET proteins in neuroblastoma. When MYCN was ectopically expressed, BET inhibition still disrupted MYCN target gene transcription without affecting MYCN expression. We found that BRD4 binds to super-enhancers and MYCN target genes, and that OTX015 specifically disrupts BRD4 binding and transcription of these genes. We show that OTX015 is effective against mouse and human MYCN-driven tumor models and that BRD4 not only targets MYCN, but specifically occupies MYCN target gene enhancers as well as other genes associated with super-enhancers. Clin Cancer Res; 22(10); 2470-81. ©2015 AACR. ©2015 American Association for Cancer Research.

  20. Preliminary research on flow rate and free surface of the accelerator driven subcritical system gravity-driven dense granular-flow target

    PubMed Central

    Li, Xiaodong; Wan, Jiangfeng; Zhang, Sheng; Lin, Ping; Zhang, Yanshi; Yang, Guanghui; Wang, Mengke; Duan, Wenshan; Sun, Jian’an

    2017-01-01

    A spallation target is one of the three core parts of the accelerator driven subcritical system (ADS), which has already been investigated for decades. Recently, a gravity-driven Dense Granular-flow Target (DGT) is proposed, which consists of a cylindrical hopper and an internal coaxial cylindrical beam pipe. The research on the flow rate and free surface are important for the design of the target whether in Heavy Liquid Metal (HLM) targets or the DGT. In this paper, the relations of flow rate and the geometry of the DGT are investigated. Simulations based on the discrete element method (DEM) implementing on Graphics Processing Units (GPUs) and experiments are both performed. It is found that the existence of an internal pipe doesn’t influence the flow rate when the distance from the bottom of the pipe to orifice is large enough even in a larger system. Meanwhile, snapshots of the free surface formed just below the beam pipe are given. It is observed that the free surface is stable over time. The entire research is meaningful for the design of DGT. PMID:29095910

  1. Preliminary research on flow rate and free surface of the accelerator driven subcritical system gravity-driven dense granular-flow target.

    PubMed

    Li, Xiaodong; Wan, Jiangfeng; Zhang, Sheng; Lin, Ping; Zhang, Yanshi; Yang, Guanghui; Wang, Mengke; Duan, Wenshan; Sun, Jian'an; Yang, Lei

    2017-01-01

    A spallation target is one of the three core parts of the accelerator driven subcritical system (ADS), which has already been investigated for decades. Recently, a gravity-driven Dense Granular-flow Target (DGT) is proposed, which consists of a cylindrical hopper and an internal coaxial cylindrical beam pipe. The research on the flow rate and free surface are important for the design of the target whether in Heavy Liquid Metal (HLM) targets or the DGT. In this paper, the relations of flow rate and the geometry of the DGT are investigated. Simulations based on the discrete element method (DEM) implementing on Graphics Processing Units (GPUs) and experiments are both performed. It is found that the existence of an internal pipe doesn't influence the flow rate when the distance from the bottom of the pipe to orifice is large enough even in a larger system. Meanwhile, snapshots of the free surface formed just below the beam pipe are given. It is observed that the free surface is stable over time. The entire research is meaningful for the design of DGT.

  2. Top-down dimensional weight set determines the capture of visual attention: evidence from the PCN component.

    PubMed

    Töllner, Thomas; Müller, Hermann J; Zehetleitner, Michael

    2012-07-01

    Visual search for feature singletons is slowed when a task-irrelevant, but more salient distracter singleton is concurrently presented. While there is a consensus that this distracter interference effect can be influenced by internal system settings, it remains controversial at what stage of processing this influence starts to affect visual coding. Advocates of the "stimulus-driven" view maintain that the initial sweep of visual processing is entirely driven by physical stimulus attributes and that top-down settings can bias visual processing only after selection of the most salient item. By contrast, opponents argue that top-down expectancies can alter the initial selection priority, so that focal attention is "not automatically" shifted to the location exhibiting the highest feature contrast. To precisely trace the allocation of focal attention, we analyzed the Posterior-Contralateral-Negativity (PCN) in a task in which the likelihood (expectancy) with which a distracter occurred was systematically varied. Our results show that both high (vs. low) distracter expectancy and experiencing a distracter on the previous trial speed up the timing of the target-elicited PCN. Importantly, there was no distracter-elicited PCN, indicating that participants did not shift attention to the distracter before selecting the target. This pattern unambiguously demonstrates that preattentive vision is top-down modifiable.

  3. Interaction of laser beams with magnetized substance in a strong magnetic field

    NASA Astrophysics Data System (ADS)

    Kuzenov, V. V.

    2018-03-01

    Laser-driven magneto-inertial fusion assumed plasma and magnetic flux compression by quasisymmetric laser-driven implosion of magnetized target. We develop a 2D radiation magnetohydrodynamic code and a formulation for the one-fluid two-temperature equations for simulating compressible non-equilibrium magnetized target plasma. Laser system with pulse radiation with 10 ns duration is considered for numerical experiments. A numerical study of a scheme of magnetized laser-driven implosion in the external magnetic field is carried out.

  4. The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements

    PubMed Central

    2010-01-01

    Background Individuals with severe physical disabilities and minimal motor behaviour may be unable to use conventional mechanical switches for access. These persons may benefit from access technologies that harness the volitional activity of muscles. In this study, we describe the design and demonstrate the performance of a binary switch controlled by mechanomyogram (MMG) signals recorded from the frontalis muscle during eyebrow movements. Methods Muscle contractions, detected in real-time with a continuous wavelet transform algorithm, were used to control a binary switch for computer access. The automatic selection of scale-specific thresholds reduced the effect of artefact, such as eye blinks and head movement, on the performance of the switch. Switch performance was estimated by cued response-tests performed by eleven participants (one with severe physical disabilities). Results The average sensitivity and specificity of the switch was 99.7 ± 0.4% and 99.9 ± 0.1%, respectively. The algorithm performance was robust against typical participant movement. Conclusions The results suggest that the frontalis muscle is a suitable site for controlling the MMG-driven switch. The high accuracies combined with the minimal requisite effort and training show that MMG is a promising binary control signal. Further investigation of the potential benefits of MMG-control for the target population is warranted. PMID:20492680

  5. The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements.

    PubMed

    Alves, Natasha; Chau, Tom

    2010-05-21

    Individuals with severe physical disabilities and minimal motor behaviour may be unable to use conventional mechanical switches for access. These persons may benefit from access technologies that harness the volitional activity of muscles. In this study, we describe the design and demonstrate the performance of a binary switch controlled by mechanomyogram (MMG) signals recorded from the frontalis muscle during eyebrow movements. Muscle contractions, detected in real-time with a continuous wavelet transform algorithm, were used to control a binary switch for computer access. The automatic selection of scale-specific thresholds reduced the effect of artefact, such as eye blinks and head movement, on the performance of the switch. Switch performance was estimated by cued response-tests performed by eleven participants (one with severe physical disabilities). The average sensitivity and specificity of the switch was 99.7 +/- 0.4% and 99.9 +/- 0.1%, respectively. The algorithm performance was robust against typical participant movement. The results suggest that the frontalis muscle is a suitable site for controlling the MMG-driven switch. The high accuracies combined with the minimal requisite effort and training show that MMG is a promising binary control signal. Further investigation of the potential benefits of MMG-control for the target population is warranted.

  6. Is "Market-Driven" Good Enough?

    ERIC Educational Resources Information Center

    Kaufman, Roger

    1995-01-01

    Discusses marketing and management strategies and evaluates the path most traveled; going beyond market-driven; proactive and reactive organizational positioning; ways to manage human and physical resources to make both market-driven and market-making contributions; and values necessary for an organization to move from market-driven to…

  7. Top-Down Prioritization of Salient Items May Produce the So-Called Stimulus-Driven Capture

    PubMed Central

    Benoni, Hanna

    2018-01-01

    The current study proposes that top-down attentional prioritization of salient items may produce the so-called stimulus-driven capture. To test this proposal, the “expectation-based paradigm” was designed on the basis of a visual search task. In Experiment 1, a task-irrelevant singleton frame was presented at the same location in 70% of the trials. The target was either presented at chance level within the singleton location, or away from it. In line with the singleton capture phenomenon, participants were faster in identifying the target when it appeared in the singleton location compared to non-singleton locations. However, leaving out the singleton frame in 30% of the trials led to a similar effect; participants were faster in identifying the target when it appeared in the expected singleton location compared to expected non-singletons locations (a “quasi-capture” effect). These results suggest that the participants allocated their attention to the expected singleton location, rather than that the singleton itself captured attention. In Experiment 2, the same task-irrelevant color singleton was presented in a random position in 70% of the trials. This color frame was shown as a non-singleton in all of the 30% singleton-absent multicolored trials. A similar facilitation effect was obtained when the target appeared in the expected singleton color frame compared to other frames, in singleton-absent trials as in singleton-present trials. These results further support the idea that instances of singleton capture can be explained by top-down attentional shifts toward singleton items. Theoretical implications of these results are discussed. Mostly, the study calls to consider the possibility that all sources of attentional control may be represented by a continuous variable of top-down control, including the category of “physical salience.” PMID:29599731

  8. Special issue on compact x-ray sources

    NASA Astrophysics Data System (ADS)

    Hooker, Simon; Midorikawa, Katsumi; Rosenzweig, James

    2014-04-01

    Journal of Physics B: Atomic, Molecular and Optical Physics is delighted to announce a forthcoming special issue on compact x-ray sources, to appear in the winter of 2014, and invites you to submit a paper. The potential for high-brilliance x- and gamma-ray sources driven by advanced, compact accelerators has gained increasing attention in recent years. These novel sources—sometimes dubbed 'fifth generation sources'—will build on the revolutionary advance of the x-ray free-electron laser (FEL). New radiation sources of this type have widespread applications, including in ultra-fast imaging, diagnostic and therapeutic medicine, and studies of matter under extreme conditions. Rapid advances in compact accelerators and in FEL techniques make this an opportune moment to consider the opportunities which could be realized by bringing these two fields together. Further, the successful development of compact radiation sources driven by compact accelerators will be a significant milestone on the road to the development of high-gradient colliders able to operate at the frontiers of particle physics. Thus the time is right to publish a peer-reviewed collection of contributions concerning the state-of-the-art in: advanced and novel acceleration techniques; sophisticated physics at the frontier of FELs; and the underlying and enabling techniques of high brightness electron beam physics. Interdisciplinary research connecting two or more of these fields is also increasingly represented, as exemplified by entirely new concepts such as plasma based electron beam sources, and coherent imaging with fs-class electron beams. We hope that in producing this special edition of Journal of Physics B: Atomic, Molecular and Optical Physics (iopscience.iop.org/0953-4075/) we may help further a challenging mission and ongoing intellectual adventure: the harnessing of newly emergent, compact advanced accelerators to the creation of new, agile light sources with unprecedented capabilities. New schemes for compact accelerators: laser- and beam-driven plasma accelerators; dielectric laser accelerators; THz accelerators. Latest results for compact accelerators. Target design and staging of advanced accelerators. Advanced injection and phase space manipulation techniques. Novel diagnostics: single-shot measurement of sub-fs bunch duration; measurement of ultra-low emittance. Generation and characterization of incoherent radiation: betatron and undulator radiation; Thomson/Compton scattering sources, novel THz sources. Generation and characterization of coherent radiation. Novel FEL simulation techniques. Advances in simulations of novel accelerators: simulations of injection and acceleration processes; simulations of coherent and incoherent radiation sources; start-to-end simulations of fifth generation light sources. Novel undulator schemes. Novel laser drivers for laser-driven accelerators: high-repetition rate laser systems; high wall-plug efficiency systems. Applications of compact accelerators: imaging; radiography; medical applications; electron diffraction and microscopy. Please submit your article by 15 May 2014 (expected web publication: winter 2014); submissions received after this date will be considered for the journal, but may not be included in the special issue.

  9. Relationship between risk factor control and vascular events in the SAMMPRIS trial.

    PubMed

    Turan, Tanya N; Nizam, Azhar; Lynn, Michael J; Egan, Brent M; Le, Ngoc-Anh; Lopes-Virella, Maria F; Hermayer, Kathie L; Harrell, Jamie; Derdeyn, Colin P; Fiorella, David; Janis, L Scott; Lane, Bethany; Montgomery, Jean; Chimowitz, Marc I

    2017-01-24

    The Stenting and Aggressive Medical Management for Preventing Recurrent Stroke in Intracranial Stenosis (SAMMPRIS) study is the first stroke prevention trial to include protocol-driven intensive management of multiple risk factors. In this prespecified analysis, we aimed to investigate the relationship between risk factor control during follow-up and outcome of patients in the medical arm of SAMMPRIS. Data from SAMMPRIS participants in the medical arm (n = 227) were analyzed. Risk factors were recorded at baseline, 30 days, 4 months, and then every 4 months for a mean follow-up of 32 months. For each patient, values for all risk factor measures were averaged and dichotomized as in or out of target. Participants who were out of target for systolic blood pressure and physical activity, as well as those with higher mean low-density lipoprotein cholesterol and non-high-density lipoprotein, were more likely to have a recurrent vascular event (stroke, myocardial infarction, or vascular death) at 3 years compared to those who had good risk factor control. In the multivariable analysis, greater physical activity decreased the likelihood of a recurrent stroke, myocardial infarction, or vascular death (odds ratio 0.6, confidence interval 0.4-0.8). Raised blood pressure, cholesterol, and physical inactivity should be aggressively treated in patients with intracranial atherosclerosis to prevent future vascular events. Physical activity, which has not received attention in stroke prevention trials, was the strongest predictor of a good outcome in the medical arm in SAMMPRIS. NCT00576693. © 2016 American Academy of Neurology.

  10. Variability in physical and biological exchange among coastal wetlands and their adjacent Great Lakes

    EPA Science Inventory

    Hydrology is a major governor of physically-driven exchange among coastal wetlands and the adjacent Great Lake, whereas fish movement is a major governor of biologically-driven exchange. We use data describing coastal wetland morphology, hydrology, water quality, and fish tissue...

  11. mTORC1-Mediated Inhibition of 4EBP1 Is Essential for Hedgehog Signaling-Driven Translation and Medulloblastoma.

    PubMed

    Wu, Chang-Chih; Hou, Shirui; Orr, Brent A; Kuo, Bryan R; Youn, Yong Ha; Ong, Taren; Roth, Fanny; Eberhart, Charles G; Robinson, Giles W; Solecki, David J; Taketo, Makoto M; Gilbertson, Richard J; Roussel, Martine F; Han, Young-Goo

    2017-12-18

    Mechanistic target of rapamycin (MTOR) cooperates with Hedgehog (HH) signaling, but the underlying mechanisms are incompletely understood. Here we provide genetic, biochemical, and pharmacologic evidence that MTOR complex 1 (mTORC1)-dependent translation is a prerequisite for HH signaling. The genetic loss of mTORC1 function inhibited HH signaling-driven growth of the cerebellum and medulloblastoma. Inhibiting translation or mTORC1 blocked HH signaling. Depleting 4EBP1, an mTORC1 target that inhibits translation, alleviated the dependence of HH signaling on mTORC1. Consistent with this, phosphorylated 4EBP1 levels were elevated in HH signaling-driven medulloblastomas in mice and humans. In mice, an mTORC1 inhibitor suppressed medulloblastoma driven by a mutant SMO that is inherently resistant to existing SMO inhibitors, prolonging the survival of the mice. Our study reveals that mTORC1-mediated translation is a key component of HH signaling and an important target for treating medulloblastoma and other cancers driven by HH signaling. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Novel Characterization of Capsule X-Ray Drive at the National Ignition Facility [Using ViewFactor Experiments to Measure Hohlraum X-Radiation Drive from the Capsule Point-of-View in Ignition Experiments on the National Ignition Facility

    DOE PAGES

    MacLaren, S. A.; Schneider, M. B.; Widmann, K.; ...

    2014-03-13

    Here, indirect drive experiments at the National Ignition Facility are designed to achieve fusion by imploding a fuel capsule with x rays from a laser-driven hohlraum. Previous experiments have been unable to determine whether a deficit in measured ablator implosion velocity relative to simulations is due to inadequate models of the hohlraum or ablator physics. ViewFactor experiments allow for the first time a direct measure of the x-ray drive from the capsule point of view. The experiments show a 15%–25% deficit relative to simulations and thus explain nearly all of the disagreement with the velocity data. In addition, the datamore » from this open geometry provide much greater constraints on a predictive model of laser-driven hohlraum performance than the nominal ignition target.« less

  13. Contraction driven flow in the extended vein networks of Physarum polycephalum

    NASA Astrophysics Data System (ADS)

    Alim, Karen; Amselem, Gabriel; Peaudecerf, Francois; Pringle, Anne; Brenner, Michael P.

    2011-11-01

    The true slime mold Physarum polycephalum is a basal organism that forms an extended network of veins to forage for food. P. polycephalum is renown for its adaptive changes of vein structure and morphology in response to food sources. These rearrangements presumably occur to establish an efficient transport and mixing of resources throughout the networks thus presenting a prototype to design transport networks under the constraints of laminar flow. The physical flows of cytoplasmic fluid enclosed by the veins exhibit an oscillatory flow termed ``shuttle streaming.'' The flow exceed by far the volume required for growth at the margins suggesting that the additional energy cost for generating the flow is spent for efficient and/or targeted redistribution of resources. We show that the viscous shuttle flow is driven by the radial contractions of the veins that accompany the streaming. We present a model for the fluid flow and resource dispersion arising due to radial contractions. The transport and mixing properties of the flow are discussed.

  14. The NDCX-II engineering design

    NASA Astrophysics Data System (ADS)

    Waldron, W. L.; Abraham, W. J.; Arbelaez, D.; Friedman, A.; Galvin, J. E.; Gilson, E. P.; Greenway, W. G.; Grote, D. P.; Jung, J.-Y.; Kwan, J. W.; Leitner, M.; Lidia, S. M.; Lipton, T. M.; Reginato, L. L.; Regis, M. J.; Roy, P. K.; Sharp, W. M.; Stettler, M. W.; Takakuwa, J. H.; Volmering, J.; Vytla, V. K.

    2014-01-01

    The Neutralized Drift Compression Experiment (NDCX-II) is a user facility located at Lawrence Berkeley National Laboratory which is uniquely designed for ion-beam-driven high energy density laboratory physics and heavy ion fusion research. Construction was completed in March 2012 and the facility is now in the commissioning phase. A significant amount of engineering was carried out in order to meet the performance parameters required for a wide range of target heating experiments while making the most cost-effective use of high-value hardware available from a decommissioned high current electron induction accelerator. The technical challenges and design of this new ion induction accelerator facility are described.

  15. Interaction physics of multipicosecond Petawatt laser pulses with overdense plasma.

    PubMed

    Kemp, A J; Divol, L

    2012-11-09

    We study the interaction of intense petawatt laser pulses with overdense plasma over several picoseconds, using two- and three-dimensional kinetic particle simulations. Sustained irradiation with non-diffraction-limited pulses at relativistic intensities yields conditions that differ qualitatively from what is experimentally available today. Nonlinear saturation of laser-driven density perturbations at the target surface causes recurrent emissions of plasma, which stabilize the surface and keep absorption continuously high. This dynamics leads to the acceleration of three distinct groups of electrons up to energies many times the laser ponderomotive potential. We discuss their energy distribution for applications like the fast-ignition approach to inertial confinement fusion.

  16. Neutronics performance and activation calculation of dense tungsten granular target for China-ADS

    NASA Astrophysics Data System (ADS)

    Zhang, Yaling; Li, Jianyang; Zhang, Xunchao; Cai, Hanjie; Yan, Xuesong; Yu, Lin; Fu, Fen; Lin, Ping; Gao, Xiaofei; Zhang, Zhilei; Zhang, Yanshi; Yang, Lei

    2017-11-01

    Spallation target, which constitutes the physical and functional interface between the high power accelerator and the subcritical core, is one of the most important components in Accelerator Driven Subcritical System (ADS). In this paper, we investigated the neutronics performance, the radiation damage and the activation of dense tungsten granular flow spallation target by using the Monte Carlo programs GMT and FLUKA at the proton energy of 250 MeV with a beam current of 10 mA . First, the leaking neutron yield, leaking neutron energy spectrum and laterally leaking neutron distribution at several time nodes and with different target parameters are explored. After that, the displacement per atom (DPA) and the helium/hydrogen production for tungsten grains and structural materials with stainless steel 316L are estimated. Finally, the radioactivity, residual dose rate and afterheat of granular target are presented. Results indicate that granule diameter below 1 cm and the beam profile diameter have negligible impact on neutronics performance, while the target diameter and volume fraction of grain have notable influence. The maximum DPA for target vessel (beam tube) is about 1.0 (1.6) DPA/year in bare target, and increased to 2.6 (2.8) DPA/year in fission environment. Average DPA for tungsten grains is relatively low. The decline rate of radioactivity and afterheat with cooling time grows with the decrease of the irradiation time.

  17. Polar-direct-drive experiments with contoured-shell targets on OMEGA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marshall, F. J.; Radha, P. B.; Bonino, M. J.

    Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. As a result, fusion yields were increased by more than a factor of ~2 without increasing the energy of the laser by the use of contoured shells.

  18. Polar-direct-drive experiments with contoured-shell targets on OMEGA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marshall, F. J.; Radha, P. B.; Bonino, M. J.

    Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. Fusion yields were increased by more than a factor of ∼2 without increasing the energy of the laser by the use of contoured shells.

  19. Polar-direct-drive experiments with contoured-shell targets on OMEGA

    DOE PAGES

    Marshall, F. J.; Radha, P. B.; Bonino, M. J.; ...

    2016-01-28

    Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. As a result, fusion yields were increased by more than a factor of ~2 without increasing the energy of the laser by the use of contoured shells.

  20. A systematic review of fantasy driven vs. contact driven internet-initiated sexual offences: Discrete or overlapping typologies?

    PubMed

    Broome, Laura Jayne; Izura, Cristina; Lorenzo-Dus, Nuria

    2018-05-01

    Within the literature individuals who use the internet to facilitate the sexual abuse of a minor are generally classified as being fantasy or contact driven. Classification is based upon the intended location for sexual climax: fantasy driven individuals aim to reach sexual climax online, whereas contact driven individuals target minors to achieve physical sex offline. This review systematically investigates whether there is an empirical basis for the distinction between these two proposed discrete types. Comparison of tactics and behaviour are considered to examine whether the contact vs. fantasy distinction is useful. A two-stage literature selection process, considered against pre-determined inclusion criteria, identified a total of twenty-two studies. As methodological heterogeneity limited the ability to conduct pooled analysis, a narrative synthesis of data employing an interpretive approach was conducted. This showed that the contact and fantasy distinction is ambiguous, given that both groups engage in online behaviours that provide them with online sexual gratification that can also lead to offline contact. Furthermore, no clear pattern of behaviour was found to define contact and fantasy individuals idiosyncratically. The European Online Grooming Project typology is thus proposed as a better representation of this behaviour; intimacy seeking, adaptable and hypersexualized groups. The distinction between these groups focuses primarily on the intensity of the relationship, acknowledging that sexual abuse can occur with or without offline contact. This review also highlights the need for larger, methodologically robust studies that examine the behaviour of online child sexual offenders. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. ICF Implosions, Space-Charge Electric Fields, and Their Impact on Mix and Compression

    NASA Astrophysics Data System (ADS)

    Knoll, Dana; Chacon, Luis; Simakov, Andrei

    2013-10-01

    The single-fluid, quasi-neutral, radiation hydrodynamics codes, used to design the NIF targets, predict thermonuclear ignition for the conditions that have been achieved experimentally. A logical conclusion is that the physics model used in these codes is missing one, or more, key phenomena. Two key model-experiment inconsistencies on NIF are: 1) a lower implosion velocity than predicted by the design codes, and 2) transport of pusher material deep into the hot spot. We hypothesize that both of these model-experiment inconsistencies may be a result of a large, space-charge, electric field residing on the distinct interfaces in a NIF target. Large space-charge fields have been experimentally observed in Omega experiments. Given our hypothesis, this presentation will: 1) Develop a more complete physics picture of initiation, sustainment, and dissipation of a current-driven plasma sheath / double-layer at the Fuel-Pusher interface of an ablating plastic shell implosion on Omega, 2) Characterize the mix that can result from a double-layer field at the Fuel-Pusher interface, prior to the onset of fluid instabilities, and 3) Quantify the impact of the double-layer induced surface tension at the Fuel-Pusher interface on the peak observed implosion velocity in Omega.

  2. Active machine learning-driven experimentation to determine compound effects on protein patterns.

    PubMed

    Naik, Armaghan W; Kangas, Joshua D; Sullivan, Devin P; Murphy, Robert F

    2016-02-03

    High throughput screening determines the effects of many conditions on a given biological target. Currently, to estimate the effects of those conditions on other targets requires either strong modeling assumptions (e.g. similarities among targets) or separate screens. Ideally, data-driven experimentation could be used to learn accurate models for many conditions and targets without doing all possible experiments. We have previously described an active machine learning algorithm that can iteratively choose small sets of experiments to learn models of multiple effects. We now show that, with no prior knowledge and with liquid handling robotics and automated microscopy under its control, this learner accurately learned the effects of 48 chemical compounds on the subcellular localization of 48 proteins while performing only 29% of all possible experiments. The results represent the first practical demonstration of the utility of active learning-driven biological experimentation in which the set of possible phenotypes is unknown in advance.

  3. Generation of sub-gigabar-pressure shocks by a hyper-velocity impact in the collider driven by laser-induced cavity pressure

    NASA Astrophysics Data System (ADS)

    Badziak, J.; Kucharik, M.; Liska, R.

    2018-02-01

    The generation of high-pressure shocks in the newly proposed collider in which the projectile impacting a solid target is driven by the laser-induced cavity pressure acceleration (LICPA) mechanism is investigated using two-dimensional hydrodynamic simulations. The dependence of parameters of the shock generated in the target by the impact of a gold projectile on the impacted target material and the laser driver energy is examined. It is found that both in case of low-density (CH, Al) and high-density (Au, Cu) solid targets the shock pressures in the sub-Gbar range can be produced in the LICPA-driven collider with the laser energy of only a few hundreds of joules, and the laser-to-shock energy conversion efficiency can reach values of 10 - 20 %, by an order of magnitude higher than the conversion efficiencies achieved with other laser-based methods used so far.

  4. The impact of nurse-driven targeted HIV screening in 8 emergency departments: study protocol for the DICI-VIH cluster-randomized two-period crossover trial.

    PubMed

    Leblanc, Judith; Rousseau, Alexandra; Hejblum, Gilles; Durand-Zaleski, Isabelle; de Truchis, Pierre; Lert, France; Costagliola, Dominique; Simon, Tabassome; Crémieux, Anne-Claude

    2016-02-01

    In 2010, to reduce late HIV diagnosis, the French national health agency endorsed non-targeted HIV screening in health care settings. Despite these recommendations, non-targeted screening has not been implemented and only physician-directed diagnostic testing is currently performed. A survey conducted in 2010 in 29 French Emergency Departments (EDs) showed that non-targeted nurse-driven screening was feasible though only a few new HIV diagnoses were identified, predominantly among high-risk groups. A strategy targeting high-risk groups combined with current practice could be shown to be feasible, more efficient and cost-effective than current practice alone. DICI-VIH (acronym for nurse-driven targeted HIV screening) is a multicentre, cluster-randomized, two-period crossover trial. The primary objective is to compare the effectiveness of 2 strategies for diagnosing HIV among adult patients visiting EDs: nurse-driven targeted HIV screening combined with current practice (physician-directed diagnostic testing) versus current practice alone. Main secondary objectives are to compare access to specialist consultation and how early HIV diagnosis occurs in the course of the disease between the 2 groups, and to evaluate the implementation, acceptability and cost-effectiveness of nurse-driven targeted screening. The 2 strategies take place during 2 randomly assigned periods in 8 EDs of metropolitan Paris, where 42 % of France's new HIV patients are diagnosed every year. All patients aged 18 to 64, not presenting secondary to HIV exposure are included. During the intervention period, patients are invited to fill a 7-item questionnaire (country of birth, sexual partners and injection drug use) in order to select individuals who are offered a rapid test. If the rapid test is reactive, a follow-up visit with an infectious disease specialist is scheduled within 72 h. Assuming an 80 % statistical power and a 5 % type 1 error, with 1.04 and 3.38 new diagnoses per 10,000 patients in the control and targeted groups respectively, a sample size of 140,000 patients was estimated corresponding to 8,750 patients per ED and per period. Inclusions started in June 2014. Results are expected by mid-2016. The DICI-VIH study is the first large randomized controlled trial designed to assess nurse-driven targeted HIV screening. This study can provide valuable information on HIV screening in health care settings. ClinicalTrials.gov: NCT02127424 (29 April 2014).

  5. College Ready: A 7M NSF MSP project to prepare pre- and in-service teachers

    NASA Astrophysics Data System (ADS)

    Stewart, Gay; Stewart, John

    2009-05-01

    The College Ready in Mathematics and Physics Partnership is comprised of 38 school districts, UA Fort Smith, and UA, Fayetteville, which will serve as the lead among these core partners, with supporting partners AAPT, APS, College Board, Mathematical Association of America, Maplesoft, and Northwest Arkansas Community College. College Ready will build vertical and horizontal learning communities among school and college faculty in order to improve major articulation issues that impact the successful transition of students from high school to college, targeting physics. College Ready will achieve these ends through a series of interconnected activities including vertical alignment of high school and college expectations, intensive content driven workshops, articulation conferences, university course revisions, the creation of professional learning communities, and the opportunity for teachers to earn advanced degrees and endorsements. It builds on and looks to establish synergy between established efforts of PhysTEC and PMET.

  6. Nuclear physics in particle therapy: a review

    NASA Astrophysics Data System (ADS)

    Durante, Marco; Paganetti, Harald

    2016-09-01

    Charged particle therapy has been largely driven and influenced by nuclear physics. The increase in energy deposition density along the ion path in the body allows reducing the dose to normal tissues during radiotherapy compared to photons. Clinical results of particle therapy support the physical rationale for this treatment, but the method remains controversial because of the high cost and of the lack of comparative clinical trials proving the benefit compared to x-rays. Research in applied nuclear physics, including nuclear interactions, dosimetry, image guidance, range verification, novel accelerators and beam delivery technologies, can significantly improve the clinical outcome in particle therapy. Measurements of fragmentation cross-sections, including those for the production of positron-emitting fragments, and attenuation curves are needed for tuning Monte Carlo codes, whose use in clinical environments is rapidly increasing thanks to fast calculation methods. Existing cross sections and codes are indeed not very accurate in the energy and target regions of interest for particle therapy. These measurements are especially urgent for new ions to be used in therapy, such as helium. Furthermore, nuclear physics hardware developments are frequently finding applications in ion therapy due to similar requirements concerning sensors and real-time data processing. In this review we will briefly describe the physics bases, and concentrate on the open issues.

  7. Nuclear physics in particle therapy: a review.

    PubMed

    Durante, Marco; Paganetti, Harald

    2016-09-01

    Charged particle therapy has been largely driven and influenced by nuclear physics. The increase in energy deposition density along the ion path in the body allows reducing the dose to normal tissues during radiotherapy compared to photons. Clinical results of particle therapy support the physical rationale for this treatment, but the method remains controversial because of the high cost and of the lack of comparative clinical trials proving the benefit compared to x-rays. Research in applied nuclear physics, including nuclear interactions, dosimetry, image guidance, range verification, novel accelerators and beam delivery technologies, can significantly improve the clinical outcome in particle therapy. Measurements of fragmentation cross-sections, including those for the production of positron-emitting fragments, and attenuation curves are needed for tuning Monte Carlo codes, whose use in clinical environments is rapidly increasing thanks to fast calculation methods. Existing cross sections and codes are indeed not very accurate in the energy and target regions of interest for particle therapy. These measurements are especially urgent for new ions to be used in therapy, such as helium. Furthermore, nuclear physics hardware developments are frequently finding applications in ion therapy due to similar requirements concerning sensors and real-time data processing. In this review we will briefly describe the physics bases, and concentrate on the open issues.

  8. Target volume and artifact evaluation of a new data-driven 4D CT.

    PubMed

    Martin, Rachael; Pan, Tinsu

    Four-dimensional computed tomography (4D CT) is often used to define the internal gross target volume (IGTV) for radiation therapy of lung cancer. Traditionally, this technique requires the use of an external motion surrogate; however, a new image, data-driven 4D CT, has become available. This study aims to describe this data-driven 4D CT and compare target contours created with it to those created using standard 4D CT. Cine CT data of 35 patients undergoing stereotactic body radiation therapy were collected and sorted into phases using standard and data-driven 4D CT. IGTV contours were drawn using a semiautomated method on maximum intensity projection images of both 4D CT methods. Errors resulting from reproducibility of the method were characterized. A comparison of phase image artifacts was made using a normalized cross-correlation method that assigned a score from +1 (data-driven "better") to -1 (standard "better"). The volume difference between the data-driven and standard IGTVs was not significant (data driven was 2.1 ± 1.0% smaller, P = .08). The Dice similarity coefficient showed good similarity between the contours (0.949 ± 0.006). The mean surface separation was 0.4 ± 0.1 mm and the Hausdorff distance was 3.1 ± 0.4 mm. An average artifact score of +0.37 indicated that the data-driven method had significantly fewer and/or less severe artifacts than the standard method (P = 1.5 × 10 -5 for difference from 0). On average, the difference between IGTVs derived from data-driven and standard 4D CT was not clinically relevant or statistically significant, suggesting data-driven 4D CT can be used in place of standard 4D CT without adjustments to IGTVs. The relatively large differences in some patients were usually attributed to limitations in automatic contouring or differences in artifacts. Artifact reduction and setup simplicity suggest a clinical advantage to data-driven 4D CT. Published by Elsevier Inc.

  9. Attentional capture by alcohol-related stimuli may be activated involuntarily by top-down search goals.

    PubMed

    Brown, Chris R H; Duka, Theodora; Forster, Sophie

    2018-04-25

    Previous research has found that the attention of social drinkers is preferentially oriented towards alcohol-related stimuli (attentional capture). This is argued to play a role in escalating craving for alcohol that can result in hazardous drinking. According to incentive theories of drug addiction, the stimuli associated with the drug reward acquire learned incentive salience and grab attention. However, it is not clear whether the mechanism by which this bias is created is a voluntary or an automatic one, although some evidence suggests a stimulus-driven mechanism. Here, we test for the first time whether this attentional capture could reflect an involuntary consequence of a goal-driven mechanism. Across three experiments, participants were given search goals to detect either an alcoholic or a non-alcoholic object (target) in a stream of briefly presented objects unrelated to the target. Prior to the target, a task-irrelevant parafoveal distractor appeared. This could either be congruent or incongruent with the current search goal. Applying a meta-analysis, we combined the results across the three experiments and found consistent evidence of goal-driven attentional capture, whereby alcohol distractors impeded target detection when the search goal was for alcohol. By contrast, alcohol distractors did not interfere with target detection, whilst participants were searching for a non-alcoholic category. A separate experiment revealed that the goal-driven capture effect was not found when participants held alcohol features active in memory but did not intentionally search for them. These findings suggest a strong goal-driven account of attentional capture by alcohol cues in social drinkers.

  10. Accommodation Responds to Optical Vergence and Not Defocus Blur Alone.

    PubMed

    Del Águila-Carrasco, Antonio J; Marín-Franch, Iván; Bernal-Molina, Paula; Esteve-Taboada, José J; Kruger, Philip B; Montés-Micó, Robert; López-Gil, Norberto

    2017-03-01

    To determine whether changes in wavefront spherical curvature (optical vergence) are a directional cue for accommodation. Nine subjects participated in this experiment. The accommodation response to a monochromatic target was measured continuously with a custom-made adaptive optics system while astigmatism and higher-order aberrations were corrected in real time. There were two experimental open-loop conditions: vergence-driven condition, where the deformable mirror provided sinusoidal changes in defocus at the retina between -1 and +1 diopters (D) at 0.2 Hz; and blur-driven condition, in which the level of defocus at the retina was always 0 D, but a sinusoidal defocus blur between -1 and +1 D at 0.2 Hz was simulated in the target. Right before the beginning of each trial, the target was moved to an accommodative demand of 2 D. Eight out of nine subjects showed sinusoidal responses for the vergence-driven condition but not for the blur-driven condition. Their average (±SD) gain for the vergence-driven condition was 0.50 (±0.28). For the blur-driven condition, average gain was much smaller at 0.07 (±0.03). The ninth subject showed little to no response for both conditions, with average gain <0.08. Vergence-driven condition gain was significantly different from blur-driven condition gain (P = 0.004). Accommodation responds to optical vergence, even without feedback, and not to changes in defocus blur alone. These results suggest the presence of a retinal mechanism that provides a directional cue for accommodation from optical vergence.

  11. Guided goal setting: effectiveness in a dietary and physical activity intervention with low-income adolescents.

    PubMed

    Shilts, Mical Kay; Horowitz, Marcel; Townsend, Marilyn S

    2009-01-01

    Determining the effectiveness of the guided goal setting strategy on changing adolescents' dietary and physical activity self-efficacy and behaviors. Adolescents were individually assigned to treatment (intervention with guided goal setting) or control conditions (intervention without guided goal setting) with data collected before and after the education intervention. Urban middle school in a low-income community in Central California. Ethnically diverse middle school students (n = 94, 55% male) who were participants of a USDA nutrition education program. Driven by the Social Cognitive Theory, the intervention targeted dietary and physical activity behaviors of adolescents. Dietary self-efficacy and behavior; physical activity self-efficacy and behavior; goal effort and spontaneous goal setting. ANCOVA and path analysis were performed using the full sample and a sub-sample informed by Locke's recommendations (accounting for goal effort and spontaneous goal setting). No significant differences were found between groups using the full sample. Using the sub-sample, greater gains in dietary behavior (p < .05), physical activity behavior (p < .05), and physical activity self-efficacy (p < .05) were made by treatment participants compared to control participants. Change in physical activity behaviors was mediated by self-efficacy. Accounting for goal effort and spontaneous goal setting, this study provides some evidence that the use of guided goal setting with adolescents may be a viable strategy to promote dietary and physical activity behavior change.

  12. Capturing attention is not that simple: different mechanisms for stimulus-driven and contingent capture.

    PubMed

    Liao, Hsin-I; Yeh, Su-Ling

    2013-11-01

    Attentional orienting can be involuntarily directed to task-irrelevant stimuli, but it remains unsolved whether such attentional capture is contingent on top-down settings or could be purely stimulus-driven. We propose that attentional capture depends on the stimulus property because transient and static features are processed differently; thus, they might be modulated differently by top-down controls. To test this hybrid account, we adopted a spatial cuing paradigm in which a noninformative onset or color cue preceded an onset or color target with various stimulus onset asynchronies (SOAs). Results showed that the onset cue captured attention regardless of target type at short-but not long-SOAs. In contrast, the color cue captured attention at short and long SOAs, but only with a color target. The overall pattern of results corroborates our hypothesis, suggesting that different mechanisms are at work for stimulus-driven capture (by onset) and contingent capture (by color). Stimulus-driven capture elicits reflexive involuntary orienting, and contingent capture elicits voluntary feature-based enhancement.

  13. Deformable registration of the inflated and deflated lung in cone-beam CT-guided thoracic surgery: Initial investigation of a combined model- and image-driven approach

    PubMed Central

    Uneri, Ali; Nithiananthan, Sajendra; Schafer, Sebastian; Otake, Yoshito; Stayman, J. Webster; Kleinszig, Gerhard; Sussman, Marc S.; Prince, Jerry L.; Siewerdsen, Jeffrey H.

    2013-01-01

    Purpose: Surgical resection is the preferred modality for curative treatment of early stage lung cancer, but localization of small tumors (<10 mm diameter) during surgery presents a major challenge that is likely to increase as more early-stage disease is detected incidentally and in low-dose CT screening. To overcome the difficulty of manual localization (fingers inserted through intercostal ports) and the cost, logistics, and morbidity of preoperative tagging (coil or dye placement under CT-fluoroscopy), the authors propose the use of intraoperative cone-beam CT (CBCT) and deformable image registration to guide targeting of small tumors in video-assisted thoracic surgery (VATS). A novel algorithm is reported for registration of the lung from its inflated state (prior to pleural breach) to the deflated state (during resection) to localize surgical targets and adjacent critical anatomy. Methods: The registration approach geometrically resolves images of the inflated and deflated lung using a coarse model-driven stage followed by a finer image-driven stage. The model-driven stage uses image features derived from the lung surfaces and airways: triangular surface meshes are morphed to capture bulk motion; concurrently, the airways generate graph structures from which corresponding nodes are identified. Interpolation of the sparse motion fields computed from the bounding surface and interior airways provides a 3D motion field that coarsely registers the lung and initializes the subsequent image-driven stage. The image-driven stage employs an intensity-corrected, symmetric form of the Demons method. The algorithm was validated over 12 datasets, obtained from porcine specimen experiments emulating CBCT-guided VATS. Geometric accuracy was quantified in terms of target registration error (TRE) in anatomical targets throughout the lung, and normalized cross-correlation. Variations of the algorithm were investigated to study the behavior of the model- and image-driven stages by modifying individual algorithmic steps and examining the effect in comparison to the nominal process. Results: The combined model- and image-driven registration process demonstrated accuracy consistent with the requirements of minimally invasive VATS in both target localization (∼3–5 mm within the target wedge) and critical structure avoidance (∼1–2 mm). The model-driven stage initialized the registration to within a median TRE of 1.9 mm (95% confidence interval (CI) maximum = 5.0 mm), while the subsequent image-driven stage yielded higher accuracy localization with 0.6 mm median TRE (95% CI maximum = 4.1 mm). The variations assessing the individual algorithmic steps elucidated the role of each step and in some cases identified opportunities for further simplification and improvement in computational speed. Conclusions: The initial studies show the proposed registration method to successfully register CBCT images of the inflated and deflated lung. Accuracy appears sufficient to localize the target and adjacent critical anatomy within ∼1–2 mm and guide localization under conditions in which the target cannot be discerned directly in CBCT (e.g., subtle, nonsolid tumors). The ability to directly localize tumors in the operating room could provide a valuable addition to the VATS arsenal, obviate the cost, logistics, and morbidity of preoperative tagging, and improve patient safety. Future work includes in vivo testing, optimization of workflow, and integration with a CBCT image guidance system. PMID:23298134

  14. Deformable registration of the inflated and deflated lung in cone-beam CT-guided thoracic surgery: initial investigation of a combined model- and image-driven approach.

    PubMed

    Uneri, Ali; Nithiananthan, Sajendra; Schafer, Sebastian; Otake, Yoshito; Stayman, J Webster; Kleinszig, Gerhard; Sussman, Marc S; Prince, Jerry L; Siewerdsen, Jeffrey H

    2013-01-01

    Surgical resection is the preferred modality for curative treatment of early stage lung cancer, but localization of small tumors (<10 mm diameter) during surgery presents a major challenge that is likely to increase as more early-stage disease is detected incidentally and in low-dose CT screening. To overcome the difficulty of manual localization (fingers inserted through intercostal ports) and the cost, logistics, and morbidity of preoperative tagging (coil or dye placement under CT-fluoroscopy), the authors propose the use of intraoperative cone-beam CT (CBCT) and deformable image registration to guide targeting of small tumors in video-assisted thoracic surgery (VATS). A novel algorithm is reported for registration of the lung from its inflated state (prior to pleural breach) to the deflated state (during resection) to localize surgical targets and adjacent critical anatomy. The registration approach geometrically resolves images of the inflated and deflated lung using a coarse model-driven stage followed by a finer image-driven stage. The model-driven stage uses image features derived from the lung surfaces and airways: triangular surface meshes are morphed to capture bulk motion; concurrently, the airways generate graph structures from which corresponding nodes are identified. Interpolation of the sparse motion fields computed from the bounding surface and interior airways provides a 3D motion field that coarsely registers the lung and initializes the subsequent image-driven stage. The image-driven stage employs an intensity-corrected, symmetric form of the Demons method. The algorithm was validated over 12 datasets, obtained from porcine specimen experiments emulating CBCT-guided VATS. Geometric accuracy was quantified in terms of target registration error (TRE) in anatomical targets throughout the lung, and normalized cross-correlation. Variations of the algorithm were investigated to study the behavior of the model- and image-driven stages by modifying individual algorithmic steps and examining the effect in comparison to the nominal process. The combined model- and image-driven registration process demonstrated accuracy consistent with the requirements of minimally invasive VATS in both target localization (∼3-5 mm within the target wedge) and critical structure avoidance (∼1-2 mm). The model-driven stage initialized the registration to within a median TRE of 1.9 mm (95% confidence interval (CI) maximum = 5.0 mm), while the subsequent image-driven stage yielded higher accuracy localization with 0.6 mm median TRE (95% CI maximum = 4.1 mm). The variations assessing the individual algorithmic steps elucidated the role of each step and in some cases identified opportunities for further simplification and improvement in computational speed. The initial studies show the proposed registration method to successfully register CBCT images of the inflated and deflated lung. Accuracy appears sufficient to localize the target and adjacent critical anatomy within ∼1-2 mm and guide localization under conditions in which the target cannot be discerned directly in CBCT (e.g., subtle, nonsolid tumors). The ability to directly localize tumors in the operating room could provide a valuable addition to the VATS arsenal, obviate the cost, logistics, and morbidity of preoperative tagging, and improve patient safety. Future work includes in vivo testing, optimization of workflow, and integration with a CBCT image guidance system.

  15. Electrophysiological correlates of stimulus-driven reorienting deficits after interference with right parietal cortex during a spatial attention task: a TMS-EEG study

    PubMed Central

    Capotosto, Paolo; Corbetta, Maurizio; Romani, Gian Luca; Babiloni, Claudio

    2013-01-01

    Transcranial magnetic stimulation (TMS) interference over right intraparietal sulcus (IPS) causally disrupts behaviorally and electroencephalographic (EEG) rhythmic correlates of endogenous spatial orienting prior to visual target presentation (Capotosto et al. 2009; 2011). Here we combine data from our previous studies to examine whether right parietal TMS during spatial orienting also impairs stimulus-driven re-orienting or the ability to efficiently process unattended stimuli, i.e. stimuli outside the current focus of attention. Healthy subjects (N=24) performed a Posner spatial cueing task while their EEG activity was being monitored. Repetitive TMS (rTMS) was applied for 150 milliseconds (ms) simultaneously to the presentation of a central arrow directing spatial attention to the location of an upcoming visual target. Right IPS-rTMS impaired target detection, especially for stimuli presented at unattended locations; it also caused a modulation of the amplitude of parieto-occipital positive ERPs peaking at about 480 ms (P3) post-target. The P3 significantly decreased for unattended targets, and significantly increased for attended targets after right IPS-rTMS as compared to Sham stimulation. Similar effects were obtained for left IPS stimulation albeit in a smaller group of subjects. We conclude that disruption of anticipatory processes in right IPS has prolonged effects that persist during target processing. The P3 decrement may reflect interference with post-decision processes that are part of stimulus-driven re-orienting. Right IPS is a node of functional interaction between endogenous spatial orienting and stimulus-driven re-orienting processes in human vision. PMID:22905824

  16. Stimulus-driven attentional capture by subliminal onset cues.

    PubMed

    Schoeberl, Tobias; Fuchs, Isabella; Theeuwes, Jan; Ansorge, Ulrich

    2015-04-01

    In two experiments, we tested whether subliminal abrupt onset cues capture attention in a stimulus-driven way. An onset cue was presented 16 ms prior to the stimulus display that consisted of clearly visible color targets. The onset cue was presented either at the same side as the target (the valid cue condition) or on the opposite side of the target (the invalid cue condition). Because the onset cue was presented 16 ms before other placeholders were presented, the cue was subliminal to the participant. To ensure that this subliminal cue captured attention in a stimulus-driven way, the cue's features did not match the top-down attentional control settings of the participants: (1) The color of the cue was always different than the color of the non-singleton targets ensuring that a top-down set for a specific color or for a singleton would not match the cue, and (2) colored targets and distractors had the same objective luminance (measured by the colorimeter) and subjective lightness (measured by flicker photometry), preventing a match between the top-down set for target and cue contrast. Even though a match between the cues and top-down settings was prevented, in both experiments, the cues captured attention, with faster response times in valid than invalid cue conditions (Experiments 1 and 2) and faster response times in valid than the neutral conditions (Experiment 2). The results support the conclusion that subliminal cues capture attention in a stimulus-driven way.

  17. Goal-driven modulation of stimulus-driven attentional capture in multiple-cue displays.

    PubMed

    Richard, Christian M; Wright, Richard D; Ward, Lawrence M

    2003-08-01

    Six location-cuing experiments were conducted to examine the goal-driven control of attentional capture in multiple-cue displays. In most of the experiments, the cue display consisted of the simultaneous presentation of a red direct cue that was highly predictive of the target location (the unique cue) and three gray direct cues (the standard cues) that were not predictive of the location. The results indicated that although target responses were faster at all cued locations relative to uncued locations, they were significantly faster at the unique-cue location than at the standard-cue locations. Other results suggest that the faster responses produced by direct cues may be associated with two different components: an attention-related component that can be modulated by goal-driven factors and a nonattentional component that occurs in parallel at multiple direct-cue locations and is minimally affected by the same goal-driven factors.

  18. A flexible data fusion architecture for persistent surveillance using ultra-low-power wireless sensor networks

    NASA Astrophysics Data System (ADS)

    Hanson, Jeffrey A.; McLaughlin, Keith L.; Sereno, Thomas J.

    2011-06-01

    We have developed a flexible, target-driven, multi-modal, physics-based fusion architecture that efficiently searches sensor detections for targets and rejects clutter while controlling the combinatoric problems that commonly arise in datadriven fusion systems. The informational constraints imposed by long lifetime requirements make systems vulnerable to false alarms. We demonstrate that our data fusion system significantly reduces false alarms while maintaining high sensitivity to threats. In addition, mission goals can vary substantially in terms of targets-of-interest, required characterization, acceptable latency, and false alarm rates. Our fusion architecture provides the flexibility to match these trade-offs with mission requirements unlike many conventional systems that require significant modifications for each new mission. We illustrate our data fusion performance with case studies that span many of the potential mission scenarios including border surveillance, base security, and infrastructure protection. In these studies, we deployed multi-modal sensor nodes - including geophones, magnetometers, accelerometers and PIR sensors - with low-power processing algorithms and low-bandwidth wireless mesh networking to create networks capable of multi-year operation. The results show our data fusion architecture maintains high sensitivities while suppressing most false alarms for a variety of environments and targets.

  19. Relationship between risk factor control and vascular events in the SAMMPRIS trial

    PubMed Central

    Nizam, Azhar; Lynn, Michael J.; Egan, Brent M.; Le, Ngoc-Anh; Lopes-Virella, Maria F.; Hermayer, Kathie L.; Harrell, Jamie; Derdeyn, Colin P.; Fiorella, David; Janis, L. Scott; Lane, Bethany; Montgomery, Jean; Chimowitz, Marc I.

    2017-01-01

    Objective: The Stenting and Aggressive Medical Management for Preventing Recurrent Stroke in Intracranial Stenosis (SAMMPRIS) study is the first stroke prevention trial to include protocol-driven intensive management of multiple risk factors. In this prespecified analysis, we aimed to investigate the relationship between risk factor control during follow-up and outcome of patients in the medical arm of SAMMPRIS. Methods: Data from SAMMPRIS participants in the medical arm (n = 227) were analyzed. Risk factors were recorded at baseline, 30 days, 4 months, and then every 4 months for a mean follow-up of 32 months. For each patient, values for all risk factor measures were averaged and dichotomized as in or out of target. Results: Participants who were out of target for systolic blood pressure and physical activity, as well as those with higher mean low-density lipoprotein cholesterol and non–high-density lipoprotein, were more likely to have a recurrent vascular event (stroke, myocardial infarction, or vascular death) at 3 years compared to those who had good risk factor control. In the multivariable analysis, greater physical activity decreased the likelihood of a recurrent stroke, myocardial infarction, or vascular death (odds ratio 0.6, confidence interval 0.4–0.8). Conclusions: Raised blood pressure, cholesterol, and physical inactivity should be aggressively treated in patients with intracranial atherosclerosis to prevent future vascular events. Physical activity, which has not received attention in stroke prevention trials, was the strongest predictor of a good outcome in the medical arm in SAMMPRIS. ClinicalTrials.gov identifier: NCT00576693. PMID:28003500

  20. Actinide targets for fundamental research in nuclear physics

    NASA Astrophysics Data System (ADS)

    Eberhardt, K.; Düllmann, Ch. E.; Haas, R.; Mokry, Ch.; Runke, J.; Thörle-Pospiech, P.; Trautmann, N.

    2018-05-01

    Thin actinide layers deposited on various substrates are widely used as calibration sources in nuclear spectroscopy. Other applications include fundamental research in nuclear chemistry and -physics, e.g., the chemical and physical properties of super-heavy elements (SHE, Z > 103) or nuclear reaction studies with heavy ions. For the design of future nuclear reactors like fast-fission reactors and accelerator-driven systems for transmutation of nuclear waste, precise data for neutron absorption as well as neutron-induced fission cross section data for 242Pu with neutrons of different energies are of particular importance, requiring suitable Pu-targets. Another application includes studies of nuclear transitions in 229Th harvested as α-decay recoil product from a thin layer of its 233U precursor. For this, a thin and very smooth layer of 233U is used. We report here on the production of actinide layers mostly obtained by Molecular Plating (MP). MP is currently the only fabrication method in cases where the desired actinide material is available only in very limited amounts or possesses a high specific activity. Here, deposition is performed from organic solution applying a current density of 1-2 mA/cm2. Under these conditions target thicknesses of 500-1000 μg/cm2 are possible applying a single deposition step with deposition yields approaching 100 %. For yield determination α-particle spectroscopy, γ-spectroscopy and Neutron Activation Analysis is routinely used. Layer homogeneity is checked with Radiographic Imaging. As an alternative technique to MP the production of thin lanthanide and actinide layers by the so-called "Drop on Demand"-technique applied e.g., in ink-jet printing is currently under investigation.

  1. Method and apparatus for plasma source ion implantation

    DOEpatents

    Conrad, J.R.

    1988-08-16

    Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner. 7 figs.

  2. Method and apparatus for plasma source ion implantation

    DOEpatents

    Conrad, John R.

    1988-01-01

    Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner.

  3. A Model-Driven Co-Design Framework for Fusing Control and Scheduling Viewpoints.

    PubMed

    Sundharam, Sakthivel Manikandan; Navet, Nicolas; Altmeyer, Sebastian; Havet, Lionel

    2018-02-20

    Model-Driven Engineering (MDE) is widely applied in the industry to develop new software functions and integrate them into the existing run-time environment of a Cyber-Physical System (CPS). The design of a software component involves designers from various viewpoints such as control theory, software engineering, safety, etc. In practice, while a designer from one discipline focuses on the core aspects of his field (for instance, a control engineer concentrates on designing a stable controller), he neglects or considers less importantly the other engineering aspects (for instance, real-time software engineering or energy efficiency). This may cause some of the functional and non-functional requirements not to be met satisfactorily. In this work, we present a co-design framework based on timing tolerance contract to address such design gaps between control and real-time software engineering. The framework consists of three steps: controller design, verified by jitter margin analysis along with co-simulation, software design verified by a novel schedulability analysis, and the run-time verification by monitoring the execution of the models on target. This framework builds on CPAL (Cyber-Physical Action Language), an MDE design environment based on model-interpretation, which enforces a timing-realistic behavior in simulation through timing and scheduling annotations. The application of our framework is exemplified in the design of an automotive cruise control system.

  4. A Model-Driven Co-Design Framework for Fusing Control and Scheduling Viewpoints

    PubMed Central

    Navet, Nicolas; Havet, Lionel

    2018-01-01

    Model-Driven Engineering (MDE) is widely applied in the industry to develop new software functions and integrate them into the existing run-time environment of a Cyber-Physical System (CPS). The design of a software component involves designers from various viewpoints such as control theory, software engineering, safety, etc. In practice, while a designer from one discipline focuses on the core aspects of his field (for instance, a control engineer concentrates on designing a stable controller), he neglects or considers less importantly the other engineering aspects (for instance, real-time software engineering or energy efficiency). This may cause some of the functional and non-functional requirements not to be met satisfactorily. In this work, we present a co-design framework based on timing tolerance contract to address such design gaps between control and real-time software engineering. The framework consists of three steps: controller design, verified by jitter margin analysis along with co-simulation, software design verified by a novel schedulability analysis, and the run-time verification by monitoring the execution of the models on target. This framework builds on CPAL (Cyber-Physical Action Language), an MDE design environment based on model-interpretation, which enforces a timing-realistic behavior in simulation through timing and scheduling annotations. The application of our framework is exemplified in the design of an automotive cruise control system. PMID:29461489

  5. Experimental Proof for the Role of Nonlinear Photoionization in Plasmonic Phototherapy.

    PubMed

    Minai, Limor; Zeidan, Adel; Yeheskely-Hayon, Daniella; Yudovich, Shimon; Kviatkovsky, Inna; Yelin, Dvir

    2016-07-13

    Targeting individual cells within a heterogeneous tissue is a key challenge in cancer therapy, encouraging new approaches for cancer treatment that complement the shortcomings of conventional therapies. The highly localized interactions triggered by focused laser beams promise great potential for targeting single cells or small cell clusters; however, most laser-tissue interactions often involve macroscopic processes that may harm healthy nearby tissue and reduce specificity. Specific targeting of living cells using femtosecond pulses and nanoparticles has been demonstrated promising for various potential therapeutic applications including drug delivery via optoporation, drug release, and selective cell death. Here, using an intense resonant femtosecond pulse and cell-specific gold nanorods, we show that at certain irradiation parameters cell death is triggered by nonlinear plasmonic photoionization and not by thermally driven processes. The experimental results are supported by a physical model for the pulse-particle-medium interactions. A good correlation is found between the calculated total number and energy of the generated free electrons and the observed cell death, suggesting that femtosecond photoionization plays the dominant role in cell death.

  6. Two-Plasmon Decay Mitigation in Direct-Drive Inertial-Confinement-Fusion Experiments Using Multilayer Targets.

    PubMed

    Follett, R K; Delettrez, J A; Edgell, D H; Goncharov, V N; Henchen, R J; Katz, J; Michel, D T; Myatt, J F; Shaw, J; Solodov, A A; Stoeckl, C; Yaakobi, B; Froula, D H

    2016-04-15

    Multilayer direct-drive inertial-confinement-fusion targets are shown to significantly reduce two-plasmon decay (TPD) driven hot-electron production while maintaining high hydrodynamic efficiency. Implosion experiments on the OMEGA laser used targets with silicon layered between an inner beryllium and outer silicon-doped plastic ablator. A factor-of-5 reduction in hot-electron generation (>50  keV) was observed in the multilayer targets relative to pure CH targets. Three-dimensional simulations of the TPD-driven hot-electron production using a laser-plasma interaction code (lpse) that includes nonlinear and kinetic effects show good agreement with the measurements. The simulations suggest that the reduction in hot-electron production observed in the multilayer targets is primarily caused by increased electron-ion collisional damping.

  7. Identity negotiation in roommate relationships: the self as architect and consequence of social reality.

    PubMed

    McNulty, S E; Swann, W B

    1994-12-01

    The authors report two longitudinal studies of new college roommates (Ns = 69 and 95 pairs). In both studies, targets' initial self-views predicted changes in perceivers' appraisals of them, and perceivers' initial appraisals predicted changes in targets' self-views, although few dyads displayed both effects. The perceiver-driven and target-driven effects occurred when appraisals and self-views were negative as well as positive. Implications for self-verification theory and symbolic interactionism are discussed, and a less restrictive model of how appraisals influence self-views is proposed.

  8. Active machine learning-driven experimentation to determine compound effects on protein patterns

    PubMed Central

    Naik, Armaghan W; Kangas, Joshua D; Sullivan, Devin P; Murphy, Robert F

    2016-01-01

    High throughput screening determines the effects of many conditions on a given biological target. Currently, to estimate the effects of those conditions on other targets requires either strong modeling assumptions (e.g. similarities among targets) or separate screens. Ideally, data-driven experimentation could be used to learn accurate models for many conditions and targets without doing all possible experiments. We have previously described an active machine learning algorithm that can iteratively choose small sets of experiments to learn models of multiple effects. We now show that, with no prior knowledge and with liquid handling robotics and automated microscopy under its control, this learner accurately learned the effects of 48 chemical compounds on the subcellular localization of 48 proteins while performing only 29% of all possible experiments. The results represent the first practical demonstration of the utility of active learning-driven biological experimentation in which the set of possible phenotypes is unknown in advance. DOI: http://dx.doi.org/10.7554/eLife.10047.001 PMID:26840049

  9. Solar research with stratospheric balloons

    NASA Astrophysics Data System (ADS)

    Vázquez, Manuel; Wittmann, Axel D.

    Balloons, driven by hot air or some gas lighter than air, were the first artificial machines able to lift payloads (including humans) from the ground. After some pioneering flights the study of the physical properties of the terrestrial atmosphere constituted the first scientific target. A bit later astronomers realized that the turbulence of the atmospheric layers above their ground-based telescopes deteriorated the image quality, and that balloons were an appropriate means to overcome, total or partially, this problem. Some of the most highly-resolved photographs and spectrograms of the sun during the 20th century were actually obtained by balloon-borne telescopes from the stratosphere. Some more recent projects of solar balloon astronomy will also be described.

  10. Simulations of inertial confinement fusion driven by a novel synchrotron-radiation-based x-ray igniter

    NASA Astrophysics Data System (ADS)

    Shlyaptsev, Vyacheslav N.; Tatchyn, Roman O.

    2004-01-01

    The advantages and challenges of using a powerful x-ray source for the fast ignition of compressed Inertial Confinement Fusion (ICF) targets have been considered. The requirements for such a source together with the optics to focus the x-rays onto compressed DT cores lead to a conceptual design based on Energy Recovery Linacs (ERLs) and long wigglers to produce x-ray pulses with the appropriate phase space properties. A comparative assessment of the parameters of the igniter system indicates that the technologies for building it, although expensive, are physically achievable. Our x-ray fast ignition (XFI) scheme requires substantially smaller energy for the initiation of nuclear fusion reactions than other methods.

  11. EDITORIAL: Inertial Fusion State of the Art---A Collection of Overview and Technical Papers from IFSA2003

    NASA Astrophysics Data System (ADS)

    Hogan, W. J.

    2004-12-01

    The Third International Conference on Inertial Fusion Sciences and Applications (IFSA2003) was held in Monterey, CA, USA, on 7--12 September 2003. The goal of IFSA2003 was to bring together scientists and engineers in the fields of inertial fusion sciences, high energy density physics, inertial fusion energy (IFE) and other related research and applications. By all measures IFSA2003 was a resounding success. IFSA2003 was hosted by the University of California, which was supported in organizing the conference by seven institutions: General Atomics, Lawrence Berkeley National Laboratory, Lawrence Livermore National Laboratory, Los Alamos National Laboratory, Naval Research Laboratory, Sandia National Laboratory and the University of Rochester, Laboratory for Laser Energetics. IFSA2003 was the largest IFSA conference yet with 405 participants from 17 countries. Approximately 430 papers were presented and 236 appeared in the Proceedings, published in July 2004 by the American Nuclear Society [1]. A subset of the Nuclear Fusion Board of Editors, those who work on inertial confinement fusion (ICF), recommended creating this special issue of Nuclear Fusion by selecting a representative cross-section of the papers presented at IFSA2003. Authors of the selected papers were asked to expand their papers and make them suitable for publication in it Nuclear Fusion. Nineteen papers are presented in this special issue. They represent a cross-section of the papers presented at IFSA2003. However, there was no attempt to represent the `feel' of the conference by having the same fraction of papers on each topic as existed at IFSA. There were far more detailed scientific papers at IFSA than are presented in this special issue. However, in the interest of giving the reader a cross-section of the papers and showing the entire breadth of ICF research going on, we have biased the selection process toward review papers. The first three papers here are based upon the keynote talks at IFSA2003 and are, therefore, overviews of all ICF research being done in the Americas, Asia, and Europe. The next two papers are also reviews but of a different sort. The Teller Medal is awarded at the IFSA conferences for pioneering work and leadership in inertial fusion and high energy density science. The two recipients for 2003 were H. Takabe of the Institute of Laser Engineering at Osaka University and L. Suter of Lawrence Livermore National Laboratory. These awardees were asked to deliver the two Teller Lectures at IFSA based upon the work for which they were being honoured. The papers presented here are expansions of those two review talks. Suter chose to focus his review on his recent work on ignition physics for targets driven by 0.54 m light. This is of interest because large facilities like the National Ignition Facility (NIF) will deliver much more energy in the frequency doubled wavelength than in the frequency tripled one. Takabe, on the other hand chose to give a historical perspective of his lifelong work. The other 14 papers were selected to represent a cross-section of the research being conducted in the science and engineering of inertial fusion. The papers by Haan et al and Holstein et al represent some of the recent progress in target design calculations for the ignition first experiments. Haan presents his team's work on indirect drive ignition targets (driven by 0.35 m) intended for the National Ignition Facility (NIF) when all the beamlines are activated. Holstein does the same for targets being design for the Laser MegaJoule (LMJ). Suter's paper, presented earlier as a Teller Lecture also falls into this ignition target physics category. The next four papers look at some of the exciting high energy density physics being studied in ICF facilities around the world. Glenzer et al looks at stimulated light scattering processes in hot dense plasmas. Pukhov et al look at relativistic laser-plasma interactions that produce energetic particles and x-rays. Peyrusse et al examine atomic physics and radiative processes in hot dense plasmas. Koenig et al examine ways to simulate planetary physics processes using high pressures generated in laser driven shocks. Non-laser approaches to inertial fusion were also fully represented at IFSA2003. The paper by Lebedev et al shows important physics developments in Z-pinch plasmas. Sharp et al present chamber transport modelling for heavy ion fusion drivers. Technology development studies were also well represented at IFSA2003. There was a special session on facility and driver developments that contained several papers. Presented here are the papers by Miller et al on the NIF, Danson et al on the Vulcan petawatt facility, and Myers et al on KrF lasers for IFE. A paper by Goodin et al shows progress in finding cost effective target manufacturing methods for IFE. Finally, there were many papers at IFSA2003 that focused upon the very promising but more immature field of fast ignition. Barty et al give an overview of the development issues for short pulse lasers that will be essential if fast ignition is to become mainstream. A paper by Kodama et al looks at target physics using cone focus targets. Fast ignition lasers and innovative target physics within this concept were a `hot topic' at IFSA2003. The IFSA conferences have become the principal forum for the exchange of research results in inertial fusion and high energy and density science. There is a unique blend of science and technology. All fields of inertial fusion are represented. This special issue is a snapshot and a cross-section of the field at this time. We hope the reader is encouraged to look into more of the papers in areas that interest them. References [1] Inertial Fusion Sciences and Applications: State of the Art 2003 ed B. Hammel, D. Meyerhofer, J. Meyer-ter-Vehn and H. Azechi American Nuclear Society (July 2004) These IFSA2003 proceedings may be purchased on-line at http://www.ans.org.

  12. Two-plasmon decay mitigation in direct-drive inertial-confinement-fusion experiments using multilayer targets

    DOE PAGES

    Follett, R. K.; Delettrez, J. A.; Edgell, D. H.; ...

    2016-04-15

    Multilayer direct-drive inertial-confinement-fusion (ICF) targets are shown to significantly reduce two-plasmon-decay (TPD) driven hot-electron production while maintaining high hydrodynamic efficiency. Implosion experiments on the OMEGA Laser used targets with silicon layered between an inner beryllium and outer silicon-doped plastic ablator. A factor of five reduction in hot-electron generation (> 50 keV) was observed in the multilayer targets relative to pure CH targets. Three-dimensional simulations of the TPD driven hot-electron production using a laser-plasma interaction code (LPSE) that includes nonlinear and kinetic effects show excellent agreement with the measurements. As a result, the simulations suggest that the reduction in hot-electron productionmore » observed in the multilayer targets is primarily due to increased electron-ion collisional damping.« less

  13. Visuospatial working memory mediates inhibitory and facilitatory guidance in preview search.

    PubMed

    Barrett, Doug J K; Shimozaki, Steven S; Jensen, Silke; Zobay, Oliver

    2016-10-01

    Visual search is faster and more accurate when a subset of distractors is presented before the display containing the target. This "preview benefit" has been attributed to separate inhibitory and facilitatory guidance mechanisms during search. In the preview task the temporal cues thought to elicit inhibition and facilitation provide complementary sources of information about the likely location of the target. In this study, we use a Bayesian observer model to compare sensitivity when the temporal cues eliciting inhibition and facilitation produce complementary, and competing, sources of information. Observers searched for T-shaped targets among L-shaped distractors in 2 standard and 2 preview conditions. In the standard conditions, all the objects in the display appeared at the same time. In the preview conditions, the initial subset of distractors either stayed on the screen or disappeared before the onset of the search display, which contained the target when present. In the latter, the synchronous onset of old and new objects negates the predictive utility of stimulus-driven capture during search. The results indicate observers combine memory-driven inhibition and sensory-driven capture to reduce spatial uncertainty about the target's likely location during search. In the absence of spatially predictive onsets, memory-driven inhibition at old locations persists despite irrelevant sensory change at previewed locations. This result is consistent with a bias toward unattended objects during search via the active suppression of irrelevant capture at previously attended locations. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  14. On the Value-Dependence of Value-Driven Attentional Capture

    PubMed Central

    Anderson, Brian A.; Halpern, Madeline

    2017-01-01

    Findings from an increasingly large number of studies have been used to argue that attentional capture can be dependent on the learned value of a stimulus, or value-driven. However, under certain circumstances attention can be biased to select stimuli that previously served as targets, independent of reward history. Value-driven attentional capture, as studied using the training phase-test phase design introduced by Anderson and colleagues, is widely presumed to reflect the combined influence of learned value and selection history. However, the degree to which attentional capture is at all dependent on value learning in this paradigm has recently been questioned. Support for value-dependence can be provided through one of two means: (1) greater attentional capture by prior targets following rewarded training than following unrewarded training, and (2) greater attentional capture by prior targets previously associated with high compared to low value. Using a variant of the original value-driven attentional capture paradigm, Sha and Jiang (2016) failed to find evidence of either, and raised criticisms regarding the adequacy of evidence provided by prior studies using this particular paradigm. To address this disparity, here we provided a stringent test of the value-dependence hypothesis using the traditional value-driven attentional capture paradigm. With a sufficiently large sample size, value-dependence was observed based on both criteria, with no evidence of attentional capture without rewards during training. Our findings support the validity of the traditional value-driven attentional capture paradigm in measuring what its name purports to measure. PMID:28176215

  15. A beamline systems model for Accelerator-Driven Transmutation Technology (ADTT) facilities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Todd, A.M.M.; Paulson, C.C.; Peacock, M.A.

    1995-10-01

    A beamline systems code, that is being developed for Accelerator-Driven Transmutation Technology (ADTT) facility trade studies, is described. The overall program is a joint Grumman, G.H. Gillespie Associates (GHGA) and Los Alamos National Laboratory effort. The GHGA Accelerator Systems Model (ASM) has been adopted as the framework on which this effort is based. Relevant accelerator and beam transport models from earlier Grumman systems codes are being adapted to this framework. Preliminary physics and engineering models for each ADTT beamline component have been constructed. Examples noted include a Bridge Coupled Drift Tube Linac (BCDTL) and the accelerator thermal system. A decisionmore » has been made to confine the ASM framework principally to beamline modeling, while detailed target/blanket, balance-of-plant and facility costing analysis will be performed externally. An interfacing external balance-of-plant and facility costing model, which will permit the performance of iterative facility trade studies, is under separate development. An ABC (Accelerator Based Conversion) example is used to highlight the present models and capabilities.« less

  16. A beamline systems model for Accelerator-Driven Transmutation Technology (ADTT) facilities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Todd, Alan M. M.; Paulson, C. C.; Peacock, M. A.

    1995-09-15

    A beamline systems code, that is being developed for Accelerator-Driven Transmutation Technology (ADTT) facility trade studies, is described. The overall program is a joint Grumman, G. H. Gillespie Associates (GHGA) and Los Alamos National Laboratory effort. The GHGA Accelerator Systems Model (ASM) has been adopted as the framework on which this effort is based. Relevant accelerator and beam transport models from earlier Grumman systems codes are being adapted to this framework. Preliminary physics and engineering models for each ADTT beamline component have been constructed. Examples noted include a Bridge Coupled Drift Tube Linac (BCDTL) and the accelerator thermal system. Amore » decision has been made to confine the ASM framework principally to beamline modeling, while detailed target/blanket, balance-of-plant and facility costing analysis will be performed externally. An interfacing external balance-of-plant and facility costing model, which will permit the performance of iterative facility trade studies, is under separate development. An ABC (Accelerator Based Conversion) example is used to highlight the present models and capabilities.« less

  17. Wind Extraction for Natural Ventilation

    NASA Astrophysics Data System (ADS)

    Fagundes, Tadeu; Yaghoobian, Neda; Kumar, Rajan; Ordonez, Juan

    2017-11-01

    Due to the depletion of energy resources and the environmental impact of pollution and unsustainable energy resources, energy consumption has become one of the main concerns in our rapidly growing world. Natural ventilation, a traditional method to remove anthropogenic and solar heat gains, proved to be a cost-effective, alternative method to mechanical ventilation. However, while natural ventilation is simple in theory, its detailed design can be a challenge, particularly for wind-driven ventilation, which its performance highly involves the buildings' form, surrounding topography, turbulent flow characteristics, and climate. One of the main challenges with wind-driven natural ventilation schemes is due to the turbulent and unpredictable nature of the wind around the building that impose complex pressure loads on the structure. In practice, these challenges have resulted in founding the natural ventilation mainly on buoyancy (rather than the wind), as the primary force. This study is the initial step for investigating the physical principals of wind extraction over building walls and investigating strategies to reduce the dependence of the wind extraction on the incoming flow characteristics and the target building form.

  18. The ideal neutrino beams

    NASA Astrophysics Data System (ADS)

    Lindroos, Mats

    2009-06-01

    The advance in neutrino oscillation physics is driven by the availability of well characterized and high flux neutrino beams. The three present options for the next generation neutrino oscillation facility are super beams, neutrino factories and beta-beams. A super-beam is a very high intensity classical neutrino beam generated by protons impinging on a target where the neutrinos are generated by the secondary particles decaying in a tunnel down streams of the target. In a neutrino factory the neutrinos are generated from muons decaying in a storage ring with long straight sections pointing towards the detectors. In a beta-beam the neutrinos are also originating from decay in a storage ring but the decaying particles are radioactive ions rather than muons. I will in this presentation review the three options and discuss the pros and cons of each. The present joint design effort for a future high intensity neutrino oscillation in Europe within a common EU supported design study, EURONU, will also be presented. The design study will explore the physics reach, the detectors, the feasibility, the safety issues and the cost for each of the options so that the the community can take a decision on what to build when the facilities presently under exploitation and construction have to be replaced.

  19. Implementing Genome-Driven Oncology

    PubMed Central

    Hyman, David M.; Taylor, Barry S.; Baselga, José

    2017-01-01

    Early successes in identifying and targeting individual oncogenic drivers, together with the increasing feasibility of sequencing tumor genomes, have brought forth the promise of genome-driven oncology care. As we expand the breadth and depth of genomic analyses, the biological and clinical complexity of its implementation will be unparalleled. Challenges include target credentialing and validation, implementing drug combinations, clinical trial designs, targeting tumor heterogeneity, and deploying technologies beyond DNA sequencing, among others. We review how contemporary approaches are tackling these challenges and will ultimately serve as an engine for biological discovery and increase our insight into cancer and its treatment. PMID:28187282

  20. Laser-driven proton and deuteron acceleration from a pure solid-density H2/D2 cryogenic jet

    NASA Astrophysics Data System (ADS)

    Kim, Jongjin; Gauthier, Maxence; Aurand, Bastian; Curry, Chandra; Goede, Sebastian; Goyon, Clement; Williams, Jackson; Kerr, Shaun; Ruby, John; Propp, Adrienne; Ramakrishna, Bhuvanesh; Pak, Art; Hazi, Andy; Glenzer, Siegfried; Roedel, Christian

    2015-11-01

    Laser-driven proton acceleration has become of tremendous interest for the fundamental science and the potential applications in tumor therapy and proton radiography. We have developed a cryogenic liquid hydrogen jet, which can deliver a self-replenishing target of pure solid-density hydrogen or deuterium. This allows for a target compatible with high-repetition-rate experiments and results in a pure hydrogen plasma, facilitating comparison with simulations. A new modification has allowed for the formation of jets with rectangular profiles, facilitating comparison with foil targets. This jet was installed at the Titan laser and driven by laser pulses of 40-60 J of 527 nm laser light in 1 ps. The resulting proton and deuteron spectra were measured in multiple directions with Thomson parabola spectrometers and RCF stacks. The spectral and angular information suggest contribution from both the TNSA and RPA acceleration mechanisms.

  1. Sensor modeling and demonstration of a multi-object spectrometer for performance-driven sensing

    NASA Astrophysics Data System (ADS)

    Kerekes, John P.; Presnar, Michael D.; Fourspring, Kenneth D.; Ninkov, Zoran; Pogorzala, David R.; Raisanen, Alan D.; Rice, Andrew C.; Vasquez, Juan R.; Patel, Jeffrey P.; MacIntyre, Robert T.; Brown, Scott D.

    2009-05-01

    A novel multi-object spectrometer (MOS) is being explored for use as an adaptive performance-driven sensor that tracks moving targets. Developed originally for astronomical applications, the instrument utilizes an array of micromirrors to reflect light to a panchromatic imaging array. When an object of interest is detected the individual micromirrors imaging the object are tilted to reflect the light to a spectrometer to collect a full spectrum. This paper will present example sensor performance from empirical data collected in laboratory experiments, as well as our approach in designing optical and radiometric models of the MOS channels and the micromirror array. Simulation of moving vehicles in a highfidelity, hyperspectral scene is used to generate a dynamic video input for the adaptive sensor. Performance-driven algorithms for feature-aided target tracking and modality selection exploit multiple electromagnetic observables to track moving vehicle targets.

  2. A Hybrid Physics-Based Data-Driven Approach for Point-Particle Force Modeling

    NASA Astrophysics Data System (ADS)

    Moore, Chandler; Akiki, Georges; Balachandar, S.

    2017-11-01

    This study improves upon the physics-based pairwise interaction extended point-particle (PIEP) model. The PIEP model leverages a physical framework to predict fluid mediated interactions between solid particles. While the PIEP model is a powerful tool, its pairwise assumption leads to increased error in flows with high particle volume fractions. To reduce this error, a regression algorithm is used to model the differences between the current PIEP model's predictions and the results of direct numerical simulations (DNS) for an array of monodisperse solid particles subjected to various flow conditions. The resulting statistical model and the physical PIEP model are superimposed to construct a hybrid, physics-based data-driven PIEP model. It must be noted that the performance of a pure data-driven approach without the model-form provided by the physical PIEP model is substantially inferior. The hybrid model's predictive capabilities are analyzed using more DNS. In every case tested, the hybrid PIEP model's prediction are more accurate than those of physical PIEP model. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship Program under Grant No. DGE-1315138 and the U.S. DOE, NNSA, ASC Program, as a Cooperative Agreement under Contract No. DE-NA0002378.

  3. Reprint of: Reaction measurements with the Jet Experiments in Nuclear Structure and Astrophysics (JENSA) gas jet target

    NASA Astrophysics Data System (ADS)

    Chipps, K. A.

    2018-01-01

    Explosive stellar environments are sometimes driven by nuclear reactions on short-lived, radioactive nuclei. These reactions often drive the stellar explosion, alter the observable light curves produced, and dictate the final abundances of the isotopes created. Unfortunately, many reaction rates at stellar temperatures cannot be directly measured in the laboratory, due to the physical limitations of ultra-low cross sections and high background rates. An additional complication arises because many of the important reactions involve radioactive nuclei which have lifetimes too short to be made into a target. As such, direct reactions require very intense and pure beams of exotic nuclei. Indirect approaches with both stable and radioactive beams can, however, provide crucial information on the nuclei involved in these astrophysical reactions. A major development toward both direct and indirect studies of nuclear reactions rates is the commissioning of the Jet Experiments in Nuclear Structure and Astrophysics (JENSA) supersonic gas jet target. The JENSA system provides a pure, homogeneous, highly localized, dense, and robust gaseous target for radioactive ion beam studies. Charged-particle reactions measurements made with gas jet targets can be cleaner and display better resolution than with traditional targets. With the availability of pure and localized gas jet targets in combination with developments in exotic radioactive ion beams and next-generation detector systems, the range of reaction studies that are experimentally possible is vastly expanded. Various representative cases will be discussed.

  4. INTER-ACT: prevention of pregnancy complications through an e-health driven interpregnancy lifestyle intervention - study protocol of a multicentre randomised controlled trial.

    PubMed

    Bogaerts, Annick; Ameye, Lieveke; Bijlholt, Margriet; Amuli, Kelly; Heynickx, Dorine; Devlieger, Roland

    2017-05-26

    Excessive maternal pre-pregnancy and gestational weight gain are related to pregnancy- and birth outcomes. The interpregnancy time window offers a unique opportunity to intervene in order to acquire a healthy lifestyle before the start of a new pregnancy. INTER-ACT is an e-health driven multicentre randomised controlled intervention trial targeting women at high risk of pregnancy- and birth related complications. Eligible women are recruited for the study at day 2 or 3 postpartum. At week 6 postpartum, participants are randomised into the intervention or control arm of the study. The intervention focuses on weight, diet, physical activity and mental well-being, and comprises face-to-face coaching, in which behavioural change techniques are central, and use of a mobile application, which is Bluetooth-connected to a weighing scale and activity tracker. The intervention is rolled out postpartum (4 coaching sessions between week 6 and month 6) and in a new pregnancy (3 coaching sessions, one in each trimester of pregnancy); the mobile app is used throughout the two intervention phases. Data collection includes data from the medical record of the participants (pregnancy outcomes and medical history), anthropometric data (height, weight, waist- and hip circumferences, skinfold thickness and body composition by bio-electrical impedance analysis), data from the mobile app (physical activity and weight; intervention group only) and questionnaires (socio-demographics, breastfeeding, food intake, physical activity, lifestyle, psychosocial factors and process evaluation). Medical record data are collected at inclusion and at delivery of the subsequent pregnancy. All other data are collected at week 6 and month 6 postpartum and every subsequent 6 months until a new pregnancy, and in every trimester in the new pregnancy. Primary outcome is the composite endpoint score of pregnancy-induced hypertension, gestational diabetes mellitus, caesarean section, and large-for-gestational-age infant in the subsequent pregnancy. INTER-ACT is a unique randomised controlled lifestyle intervention trial in its implementation between pregnancies and during the subsequent pregnancy, with an e-health driven approach. ClinicalTrials.gov Identifier: NCT02989142 . Registered August 2016.

  5. Onset of turbulence in accelerated high-Reynolds-number flow

    NASA Astrophysics Data System (ADS)

    Zhou, Ye; Robey, Harry F.; Buckingham, Alfred C.

    2003-05-01

    A new criterion, flow drive time, is identified here as a necessary condition for transition to turbulence in accelerated, unsteady flows. Compressible, high-Reynolds-number flows initiated, for example, in shock tubes, supersonic wind tunnels with practical limitations on dimensions or reservoir capacity, and high energy density pulsed laser target vaporization experimental facilities may not provide flow duration adequate for turbulence development. In addition, for critical periods of the overall flow development, the driving background flow is often unsteady in the experiments as well as in the physical flow situations they are designed to mimic. In these situations transition to fully developed turbulence may not be realized despite achievement of flow Reynolds numbers associated with or exceeding stationary flow transitional criteria. Basically our transitional criterion and prediction procedure extends to accelerated, unsteady background flow situations the remarkably universal mixing transition criterion proposed by Dimotakis [P. E. Dimotakis, J. Fluid Mech. 409, 69 (2000)] for stationary flows. This provides a basis for the requisite space and time scaling. The emphasis here is placed on variable density flow instabilities initiated by constant acceleration Rayleigh-Taylor instability (RTI) or impulsive (shock) acceleration Richtmyer-Meshkov instability (RMI) or combinations of both. The significant influences of compressibility on these developing transitional flows are discussed with their implications on the procedural model development. A fresh perspective for predictive modeling and design of experiments for the instability growth and turbulent mixing transitional interval is provided using an analogy between the well-established buoyancy-drag model with applications of a hierarchy of single point turbulent transport closure models. Experimental comparisons with the procedural results are presented where use is made of three distinctly different types of acceleration driven instability experiments: (1) classical, relatively low speed, constant acceleration RTI experiments; (2) shock tube, shockwave driven RMI flow mixing experiments; (3) laser target vaporization RTI and RMI mixing experiments driven at very high energy density. These last named experiments are of special interest as they provide scaleable flow conditions simulating those of astrophysical magnitude such as shock-driven hydrodynamic mixing in supernova evolution research.

  6. The importance of physical function to people with osteoporosis.

    PubMed

    Kerr, C; Bottomley, C; Shingler, S; Giangregorio, L; de Freitas, H M; Patel, C; Randall, S; Gold, D T

    2017-05-01

    There is increasing need to understand patient outcomes in osteoporosis. This article discusses that fracture in osteoporosis can lead to a cycle of impairment, driven by complex psychosocial factors, having a profound impact on physical function/activity which accumulates over time. More information is required on how treatments impact physical function. There is increasing need to understand patient-centred outcomes in osteoporosis (OP) clinical research and management. This multi-method paper provides insight on the effect of OP on patients' physical function and everyday activity. Data were collected from three sources: (1) targeted literature review on OP and physical function, conducted in MEDLINE, Embase and PsycINFO; (2) secondary thematic analysis of transcripts from patient interviews, conducted to develop a patient-reported outcome instrument. Transcripts were re-coded to focus on OP impact on daily activities and physical function for those with and without fracture history; and (3) discussions of the literature review and secondary qualitative analysis results with three clinical experts to review and interpret the importance and implications of the findings. Results suggest that OP, particularly with fracture, can have profound impacts on physical function/activity. These impacts accumulate over time through a cycle of impairment, as fracture leads to longer term detriments in physical function, including loss of muscle, activity avoidance and reduced physical capacity, which in turn leads to greater risk of fracture and potential for further physical restrictions. The cycle of impairment is complex, as other physical, psychosocial and treatment-related factors, such as comorbidities, fears and beliefs about physical activity and fracture risk influence physical function and everyday activity. More information on how treatments impact physical function would benefit healthcare professionals and persons with OP in making treatment decisions and improving treatment compliance/persistence, as these impacts may be more salient to patients than fracture incidence.

  7. The impact of temporal contingencies between cue and target onset on spatial attentional capture by subliminal onset cues.

    PubMed

    Schoeberl, Tobias; Ansorge, Ulrich

    2018-05-15

    Prior research suggested that attentional capture by subliminal abrupt onset cues is stimulus driven. In these studies, reacting was faster when a searched-for target appeared at the location of a preceding abrupt onset cue compared to when the same target appeared at a location away from the cue (cueing effect), although the earlier onset of the cue was subliminal, because it appeared as one out of three horizontally aligned placeholders with a lead time that was too short to be noticed by the participants. Because the cueing effects seemed to be independent of top-down search settings for target features, the effect was attributed to stimulus-driven attentional capture. However, prior studies did not investigate if participants experienced the cues as useful temporal warning signals and, therefore, attended to the cues in a top-down way. Here, we tested to which extent search settings based on temporal contingencies between cue and target onset could be responsible for spatial cueing effects. Cueing effects were replicated, and we showed that removing temporal contingencies between cue and target onset did not diminish the cueing effects (Experiments 1 and 2). Neither presenting the cues in the majority of trials after target onset (Experiment 1) nor presenting cue and target unrelated to one another (Experiment 2) led to a significant reduction of the spatial cueing effects. Results thus support the hypothesis that the subliminal cues captured attention in a stimulus-driven way.

  8. An RCT Investigating Patient-Driven Versus Physician-Driven Titration of BIAsp 30 in Patients with Type 2 Diabetes Uncontrolled Using NPH Insulin.

    PubMed

    Chraibi, Abdelmjid; Al-Herz, Shoorook; Nguyen, Bich Dao; Soeatmadji, Djoko W; Shinde, Anil; Lakshmivenkataraman, Balasubramanian; Assaad-Khalil, Samir H

    2017-08-01

    The aim of this study was to confirm the efficacy of patient-driven titration of BIAsp 30 in terms of glycemic control, by comparing it to physician-driven titration of BIAsp 30, in patients with type 2 diabetes in North Africa, the Middle East, and Asia. A 20-week, open-label, randomized, two-armed, parallel-group, multicenter study in Egypt, Indonesia, Morocco, Saudi Arabia, and Vietnam. Patients (n = 155) with type 2 diabetes inadequately controlled using neutral protamine Hagedorn (NPH) insulin were randomized to either patient-driven or physician-driven BIAsp 30 titration. The noninferiority of patient-driven compared to physician-driven titration with respect to the reduction in HbA1c was confirmed. The estimated mean change in HbA1c from baseline to week 20 was -1.27% in the patient-driven arm and -1.04% in the physician-driven arm, with an estimated treatment difference of -0.23% (95% confidence interval: -0.54; 0.08). After 20 weeks of treatment, the proportions of patients achieving the target of HbA1c <7.5% were similar between titration arms; the proportions of patients achieving the target of ≤6.5% were also similar. Both titration algorithms were well tolerated, and hypoglycemic episode rates were similar in both arms. Patient-driven titration of BIAsp 30 can be as effective and safe as physician-driven titration in non-Western populations. Overall, the switch from NPH insulin to BIAsp 30 was well tolerated in both titration arms and led to improved glycemic control. A limitation of the study was the relatively small number of patients recruited in each country. ClinicalTrials.gov NCT01589653. Novo Nordisk A/S, Denmark.

  9. About probabilistic integration of ill-posed geophysical tomography and logging data: A knowledge discovery approach versus petrophysical transfer function concepts illustrated using cross-borehole radar-, P- and S-wave traveltime tomography in combination with cone penetration and dielectric logging data

    NASA Astrophysics Data System (ADS)

    Paasche, Hendrik

    2018-01-01

    Site characterization requires detailed and ideally spatially continuous information about the subsurface. Geophysical tomographic experiments allow for spatially continuous imaging of physical parameter variations, e.g., seismic wave propagation velocities. Such physical parameters are often related to typical geotechnical or hydrological target parameters, e.g. as achieved from 1D direct push or borehole logging. Here, the probabilistic inference of 2D tip resistance, sleeve friction, and relative dielectric permittivity distributions in near-surface sediments is constrained by ill-posed cross-borehole seismic P- and S-wave and radar wave traveltime tomography. In doing so, we follow a discovery science strategy employing a fully data-driven approach capable of accounting for tomographic ambiguity and differences in spatial resolution between the geophysical tomograms and the geotechnical logging data used for calibration. We compare the outcome to results achieved employing classical hypothesis-driven approaches, i.e., deterministic transfer functions derived empirically for the inference of 2D sleeve friction from S-wave velocity tomograms and theoretically for the inference of 2D dielectric permittivity from radar wave velocity tomograms. The data-driven approach offers maximal flexibility in combination with very relaxed considerations about the character of the expected links. This makes it a versatile tool applicable to almost any combination of data sets. However, error propagation may be critical and justify thinking about a hypothesis-driven pre-selection of an optimal database going along with the risk of excluding relevant information from the analyses. Results achieved by transfer function rely on information about the nature of the link and optimal calibration settings drawn as retrospective hypothesis by other authors. Applying such transfer functions at other sites turns them into a priori valid hypothesis, which can, particularly for empirically derived transfer functions, result in poor predictions. However, a mindful utilization and critical evaluation of the consequences of turning a retrospectively drawn hypothesis into an a priori valid hypothesis can also result in good results for inference and prediction problems when using classical transfer function concepts.

  10. Observational and Dynamical Wave Climatologies. VOS vs Satellite Data

    NASA Astrophysics Data System (ADS)

    Grigorieva, Victoria; Badulin, Sergei; Chernyshova, Anna

    2013-04-01

    The understanding physics of wind-driven waves is crucially important for fundamental science and practical applications. This is why experimental efforts are targeted at both getting reliable information on sea state and elaborating effective tools of the sea wave forecasting. The global Visual Wave Observations and satellite data from the GLOBWAVE project of the European Space Agency are analyzed in the context of these two viewpoints. Within the first "observational" aspect we re-analyze conventional climatologies of all basic wave parameters for the last decades [5]. An alternative "dynamical" climatology is introduced as a tool of prediction of dynamical features of sea waves on global scales. The features of wave dynamics are studied in terms of one-parametric dependencies of wave heights on wave periods following the theoretical concept of self-similar wind-driven seas [3, 1, 4] and recently proposed approach to analysis of Voluntary Observing Ship (VOS) data [2]. Traditional "observational" climatologies based on VOS and satellite data collections demonstrate extremely consistent pictures for significant wave heights and dominant periods. On the other hand, collocated satellite and VOS data show significant differences in wave heights, wind speeds and, especially, in wave periods. Uncertainties of visual wave observations can explain these differences only partially. We see the key reason of this inconsistency in the methods of satellite data processing which are based on formal application of data interpolation methods rather than on up-to-date physics of wind-driven waves. The problem is considered within the alternative climatology approach where dynamical criteria of wave height-to-period linkage are used for retrieving wave periods and constructing physically consistent dynamical climatology. The key dynamical parameter - exponent R of one-parametric dependence Hs ~ TR shows dramatically less pronounced latitudinal dependence as compared to observed Hs and T of conventional climatology in both satellite and VOS data collections. It can be treated as an effect of interaction of wind-driven seas and swell on global scales as it was stated in [2]. Further study combining the alternative and conventional climatologies can help to detail this important dynamical effect of global wave dynamics. The progress in satellite data processing and their physical interpretation is of great value for such study. The work was supported by Russian Foundation for Basic Research grant 11-05-01114-a and the Russian government contracts No.11.G34.31.0035, No.11.G34.31.0078. References [1] S. I. Badulin, A. V. Babanin, D. Resio, and V. Zakharov. Weakly turbulent laws of wind-wave growth. J. Fluid Mech., 591:339-378, 2007. [2] S. I. Badulin and Grigorieva V. G. On discriminating swell and wind-driven seas in voluntary observing ship data. J. Geophys. Res., 117(C00J29), 2012. [3] S. I. Badulin, A. N. Pushkarev, D. Resio, and V. E. Zakharov. Self-similarity of wind-driven seas. Nonl. Proc. Geophys., 12:891-946, 2005. [4] E. Gagnaire-Renou, M. Benoit, and S. I. Badulin. On weakly turbulent scaling of wind sea in simulations of fetch-limited growth. J. Fluid Mech., 669:178-213, 2011. [5] S. K. Gulev, V. Grigorieva, A. Sterl, and D. Woolf. Assessment for the reliability of wave observations from voluntary observing ships: insights from the validation of a global wind wave climatology based on voluntary observing ship data. J. Geophys. Res. - Oceans, 108(C7):3236, doi:10,1029/2002JC001437, 2003.

  11. The first target experiments on the National Ignition Facility

    NASA Astrophysics Data System (ADS)

    Landen, O. L.; Glenzer, S. H.; Froula, D. H.; Dewald, E. L.; Suter, L. J.; Schneider, M. B.; Hinkel, D. E.; Fernandez, J. C.; Kline, J. L.; Goldman, S. R.; Braun, D. G.; Celliers, P. M.; Moon, S. J.; Robey, H. S.; Lanier, N. E.; Glendinning, S. G.; Blue, B. E.; Wilde, B. H.; Jones, O. S.; Schein, J.; Divol, L.; Kalantar, D. H.; Campbell, K. M.; Holder, J. P.; McDonald, J. W.; Niemann, C.; MacKinnon, A. J.; Collins, G. W.; Bradley, D. K.; Eggert, J. H.; Hicks, D. G.; Gregori, G.; Kirkwood, R. K.; Young, B. K.; Foster, J. M.; Hansen, J. F.; Perry, T. S.; Munro, D. H.; Baldis, H. A.; Grim, G. P.; Heeter, R. F.; Hegelich, M. B.; Montgomery, D. S.; Rochau, G. A.; Olson, R. E.; Turner, R. E.; Workman, J. B.; Berger, R. L.; Cohen, B. I.; Kruer, W. L.; Langdon, A. B.; Langer, S. H.; Meezan, N. B.; Rose, H. A.; Still, C. H.; Williams, E. A.; Dodd, E. S.; Edwards, M. J.; Monteil, M.-C.; Stevenson, R. M.; Thomas, B. R.; Coker, R. F.; Magelssen, G. R.; Rosen, P. A.; Stry, P. E.; Woods, D.; Weber, S. V.; Young, P. E.; Alvarez, S.; Armstrong, G.; Bahr, R.; Bourgade, J.-L.; Bower, D.; Celeste, J.; Chrisp, M.; Compton, S.; Cox, J.; Constantin, C.; Costa, R.; Duncan, J.; Ellis, A.; Emig, J.; Gautier, C.; Greenwood, A.; Griffith, R.; Holdner, F.; Holtmeier, G.; Hargrove, D.; James, T.; Kamperschroer, J.; Kimbrough, J.; Landon, M.; Lee, F. D.; Malone, R.; May, M.; Montelongo, S.; Moody, J.; Ng, E.; Nikitin, A.; Pellinen, D.; Piston, K.; Poole, M.; Rekow, V.; Rhodes, M.; Shepherd, R.; Shiromizu, S.; Voloshin, D.; Warrick, A.; Watts, P.; Weber, F.; Young, P.; Arnold, P.; Atherton, L.; Bardsley, G.; Bonanno, R.; Borger, T.; Bowers, M.; Bryant, R.; Buckman, S.; Burkhart, S.; Cooper, F.; Dixit, S. N.; Erbert, G.; Eder, D. C.; Ehrlich, R. E.; Felker, B.; Fornes, J.; Frieders, G.; Gardner, S.; Gates, C.; Gonzalez, M.; Grace, S.; Hall, T.; Haynam, C. A.; Heestand, G.; Henesian, M. A.; Hermann, M.; Hermes, G.; Huber, S.; Jancaitis, K.; Johnson, S.; Kauffman, B.; Kelleher, T.; Kohut, T.; Koniges, A. E.; Labiak, T.; Latray, D.; Lee, A.; Lund, D.; Mahavandi, S.; Manes, K. R.; Marshall, C.; McBride, J.; McCarville, T.; McGrew, L.; Menapace, J.; Mertens, E.; Murray, J.; Neumann, J.; Newton, M.; Opsahl, P.; Padilla, E.; Parham, T.; Parrish, G.; Petty, C.; Polk, M.; Powell, C.; Reinbachs, I.; Rinnert, R.; Riordan, B.; Ross, G.; Robert, V.; Tobin, M.; Sailors, S.; Saunders, R.; Schmitt, M.; Shaw, M.; Singh, M.; Spaeth, M.; Stephens, A.; Tietbohl, G.; Tuck, J.; van Wonterghem, B. M.; Vidal, R.; Wegner, P. J.; Whitman, P.; Williams, K.; Winward, K.; Work, K.; Wallace, R.; Nobile, A.; Bono, M.; Day, B.; Elliott, J.; Hatch, D.; Louis, H.; Manzenares, R.; O'Brien, D.; Papin, P.; Pierce, T.; Rivera, G.; Ruppe, J.; Sandoval, D.; Schmidt, D.; Valdez, L.; Zapata, K.; MacGowan, B. J.; Eckart, M. J.; Hsing, W. W.; Springer, P. T.; Hammel, B. A.; Moses, E. I.; Miller, G. H.

    2007-08-01

    A first set of shock timing, laser-plasma interaction, hohlraum energetics and hydrodynamic experiments have been performed using the first 4 beams of the National Ignition Facility (NIF), in support of indirect drive Inertial Confinement Fusion (ICF) and High Energy Density Physics (HEDP). In parallel, a robust set of optical and X-ray spectrometers, interferometer, calorimeters and imagers have been activated. The experiments have been undertaken with laser powers and energies of up to 8 TW and 17 kJ in flattop and shaped 1 9 ns pulses focused with various beam smoothing options. The experiments have demonstrated excellent agreement between measured and predicted laser-target coupling in foils and hohlraums, even when extended to a longer pulse regime unattainable at previous laser facilities, validated the predicted effects of beam smoothing on intense laser beam propagation in long scale-length plasmas and begun to test 3D codes by extending the study of laser driven hydrodynamic jets to 3D geometries.

  12. Numerical simulation of exploding pusher targets

    NASA Astrophysics Data System (ADS)

    Atzeni, S.; Rosenberg, M. J.; Gatu Johnson, M.; Petrasso, R. D.

    2017-10-01

    Exploding pusher targets, i.e. gas-filled large aspect-ratio glass or plastic shells, driven by a strong laser-generated shock, are widely used as pulsed sources of neutrons and fast charged particles. Recent experiments on exploding pushers provided evidence for the transition from a purely fluid behavior to a kinetic one. Indeed, fluid models largely overpredict yield and temperature as the Knudsen number Kn (ratio of ion mean-free path to compressed gas radius) is comparable or larger than one. At Kn = 0.3 - 1, fluid codes reasonably estimate integral quantities as yield and neutron-averaged temperatures, but do not reproduce burn radii, burn profiles and DD/DHe3 yield ratio. This motivated a detailed simulation study of intermediate-Kn exploding pushers. We will show how simulation results depend on models for laser-interaction, electron conductivity (flux-limited local vs nonlocal), viscosity (physical vs artificial), and ion mixing. Work partially supported by Sapienza Project C26A15YTMA, Sapienza 2016 (n. 257584), and Eurofusion Project AWP17-ENR-IFE-CEA-01.

  13. Progress of LMJ-relevant implosions experiments on OMEGA

    NASA Astrophysics Data System (ADS)

    Casner, A.; Philippe, F.; Tassin, V.; Seytor, P.; Monteil, M.-C.; Gauthier, P.; Park, H. S.; Robey, H.; Ross, J.; Amendt, P.; Girard, F.; Villette, B.; Reverdin, C.; Loiseau, P.; Caillaud, T.; Landoas, O.; Li, C. K.; Petrasso, R.; Seguin, F.; Rosenberg, M.; Renaudin, P.

    2013-11-01

    In preparation of the first ignition attempts on the Laser Mégajoule (LMJ), an experimental program is being pursued on OMEGA to investigate LMJ-relevant hohlraums. First, radiation temperature levels close to 300 eV were recently achieved in reduced-scale hohlraums with modest backscatter losses. Regarding the baseline target design for fusion experiments on LMJ, an extensive experimental database has also been collected for scaled implosions experiments in both empty and gas-filled rugby-shaped hohlraums. We acquired a full picture of hohlraum energetics and implosion dynamics. Not only did the rugby hohlraums show significantly higher x-ray drive energy over the cylindrical hohlraums, but symmetry control by power balance was demonstrated, as well as high-performance D2 implosions enabling the use of a complete suite of neutrons diagnostics. Charged particle diagnostics provide complementary insights into the physics of these x-ray driven implosions. An overview of these results demonstrates our ability to control the key parameters driving the implosion, lending more confidence in extrapolations to ignition-scale targets.

  14. Design of a universal logic block for fault-tolerant realization of any logic operation in trapped-ion quantum circuits

    NASA Astrophysics Data System (ADS)

    Goudarzi, H.; Dousti, M. J.; Shafaei, A.; Pedram, M.

    2014-05-01

    This paper presents a physical mapping tool for quantum circuits, which generates the optimal universal logic block (ULB) that can, on average, perform any logical fault-tolerant (FT) quantum operations with the minimum latency. The operation scheduling, placement, and qubit routing problems tackled by the quantum physical mapper are highly dependent on one another. More precisely, the scheduling solution affects the quality of the achievable placement solution due to resource pressures that may be created as a result of operation scheduling, whereas the operation placement and qubit routing solutions influence the scheduling solution due to resulting distances between predecessor and current operations, which in turn determines routing latencies. The proposed flow for the quantum physical mapper captures these dependencies by applying (1) a loose scheduling step, which transforms an initial quantum data flow graph into one that explicitly captures the no-cloning theorem of the quantum computing and then performs instruction scheduling based on a modified force-directed scheduling approach to minimize the resource contention and quantum circuit latency, (2) a placement step, which uses timing-driven instruction placement to minimize the approximate routing latencies while making iterative calls to the aforesaid force-directed scheduler to correct scheduling levels of quantum operations as needed, and (3) a routing step that finds dynamic values of routing latencies for the qubits. In addition to the quantum physical mapper, an approach is presented to determine the single best ULB size for a target quantum circuit by examining the latency of different FT quantum operations mapped onto different ULB sizes and using information about the occurrence frequency of operations on critical paths of the target quantum algorithm to weigh these latencies. Experimental results show an average latency reduction of about 40 % compared to previous work.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saunders, Will; Smedley, Scott; Gillingham, Peter

    We present Simulated Annealing fiber-to-target allocation simulations for the proposed DESI and 4MOST massively multiplexed spectroscopic surveys, and for both Poisson and realistically clustered mock target samples. We simulate both Echidna and theta-phi actuator designs, including the restrictions caused by the physical actuator characteristics during repositioning. For DESI, with theta-phi actuators, used in 5 passes over the sky for a mock ELG/LRG/QSO sample, with matched fiber and target densities, a total target allocation yield of 89.3% was achieved, but only 83.7% for the high-priority Ly-alpha QSOs. If Echidna actuators are used with the same pitch and number of passes, themore » yield increases by 5.7% and 16% respectively. Echidna also allows a factor-of-two increase in the number of close Ly-alpha QSO pairs that can be observed. Echidna spine tilt causes a variable loss of throughput, with average loss being the same as the loss at the rms tilt. With a natural tilt minimization scheme, we find an rms tilt always close to 0.58 x maximum. There is an additional but much smaller defocus loss, equivalent to an average defocus of 30microns. These tilt losses offset the gains in yield for Echidna, but because the survey strategy is driven by the higher priority targets, a clear survey speed advantage remains. For 4MOST, high and low latitude sample mock catalogs were supplied by the 4MOST team, and allocations were carried out with the proposed Echidna-based positioner geometry. At high latitudes, the resulting target completeness was 85.3% for LR targets and 78.9% for HR targets. At low latitude, the target completeness was 93.9% for LR targets and 71.2% for HR targets.« less

  16. Underlying role of mechanical rigidity and topological constraints in physical sputtering and reactive ion etching of amorphous materials

    NASA Astrophysics Data System (ADS)

    Bhattarai, Gyanendra; Dhungana, Shailesh; Nordell, Bradley J.; Caruso, Anthony N.; Paquette, Michelle M.; Lanford, William A.; King, Sean W.

    2018-05-01

    Analytical expressions describing ion-induced sputter or etch processes generally relate the sputter yield to the surface atomic binding energy (Usb) for the target material. While straightforward to measure for the crystalline elemental solids, Usb is more complicated to establish for amorphous and multielement materials due to composition-driven variations and incongruent sublimation. In this regard, we show that for amorphous multielement materials, the ion-driven yield can instead be better understood via a consideration of mechanical rigidity and network topology. We first demonstrate a direct relationship between Usb, bulk modulus, and ion sputter yield for the elements, and then subsequently prove our hypothesis for amorphous multielement compounds by demonstrating that the same relationships exist between the reactive ion etch (RIE) rate and nanoindentation Young's modulus for a series of a -Si Nx :H and a -Si OxCy :H thin films. The impact of network topology is further revealed via application of the Phillips-Thorpe theory of topological constraints, which directly relates the Young's modulus to the mean atomic coordination () for an amorphous solid. The combined analysis allows the trends and plateaus in the RIE rate to be ultimately reinterpreted in terms of the atomic structure of the target material through a consideration of . These findings establish the important underlying role of mechanical rigidity and network topology in ion-solid interactions and provide additional considerations for the design and optimization of radiation-hard materials in nuclear and outer space environments.

  17. Uniform heating of materials into the warm dense matter regime with laser-driven quasimonoenergetic ion beams

    DOE PAGES

    Bang, W.; Albright, B. J.; Bradley, P. A.; ...

    2015-12-01

    In a recent experiment at the Trident laser facility, a laser-driven beam of quasimonoenergetic aluminum ions was used to heat solid gold and diamond foils isochorically to 5.5 and 1.7 eV, respectively. Here theoretical calculations are presented that suggest the gold and diamond were heated uniformly by these laser-driven ion beams. According to calculations and SESAME equation-of-state tables, laser-driven aluminum ion beams achievable at Trident, with a finite energy spread of ΔE/E~20%, are expected to heat the targets more uniformly than a beam of 140-MeV aluminum ions with zero energy spread. As a result, the robustness of the expected heatingmore » uniformity relative to the changes in the incident ion energy spectra is evaluated, and expected plasma temperatures of various target materials achievable with the current experimental platform are presented.« less

  18. Uniform heating of materials into the warm dense matter regime with laser-driven quasimonoenergetic ion beams

    NASA Astrophysics Data System (ADS)

    Bang, W.; Albright, B. J.; Bradley, P. A.; Vold, E. L.; Boettger, J. C.; Fernández, J. C.

    2015-12-01

    In a recent experiment at the Trident laser facility, a laser-driven beam of quasimonoenergetic aluminum ions was used to heat solid gold and diamond foils isochorically to 5.5 and 1.7 eV, respectively. Here theoretical calculations are presented that suggest the gold and diamond were heated uniformly by these laser-driven ion beams. According to calculations and SESAME equation-of-state tables, laser-driven aluminum ion beams achievable at Trident, with a finite energy spread of ΔE /E ˜20 %, are expected to heat the targets more uniformly than a beam of 140-MeV aluminum ions with zero energy spread. The robustness of the expected heating uniformity relative to the changes in the incident ion energy spectra is evaluated, and expected plasma temperatures of various target materials achievable with the current experimental platform are presented.

  19. Enhancement of cognitive and neural functions through complex reasoning training: evidence from normal and clinical populations

    PubMed Central

    Chapman, Sandra B.; Mudar, Raksha A.

    2014-01-01

    Public awareness of cognitive health is fairly recent compared to physical health. Growing evidence suggests that cognitive training offers promise in augmenting cognitive brain performance in normal and clinical populations. Targeting higher-order cognitive functions, such as reasoning in particular, may promote generalized cognitive changes necessary for supporting the complexities of daily life. This data-driven perspective highlights cognitive and brain changes measured in randomized clinical trials that trained gist reasoning strategies in populations ranging from teenagers to healthy older adults, individuals with brain injury to those at-risk for Alzheimer's disease. The evidence presented across studies support the potential for Gist reasoning training to strengthen cognitive performance in trained and untrained domains and to engage more efficient communication across widespread neural networks that support higher-order cognition. The meaningful benefits of Gist training provide compelling motivation to examine optimal dose for sustained benefits as well as to explore additive benefits of meditation, physical exercise, and/or improved sleep in future studies. PMID:24808834

  20. Shock wave driven microparticles for pharmaceutical applications

    NASA Astrophysics Data System (ADS)

    Menezes, V.; Takayama, K.; Gojani, A.; Hosseini, S. H. R.

    2008-10-01

    Ablation created by a Q-switched Nd:Yttrium Aluminum Garnet (Nd:YAG) laser beam focusing on a thin aluminum foil surface spontaneously generates a shock wave that propagates through the foil and deforms it at a high speed. This high-speed foil deformation can project dry micro- particles deposited on the anterior surface of the foil at high speeds such that the particles have sufficient momentum to penetrate soft targets. We used this method of particle acceleration to develop a drug delivery device to deliver DNA/drug coated microparticles into soft human-body targets for pharmaceutical applications. The device physics has been studied by observing the process of particle acceleration using a high-speed video camera in a shadowgraph system. Though the initial rate of foil deformation is over 5 km/s, the observed particle velocities are in the range of 900-400 m/s over a distance of 1.5-10 mm from the launch pad. The device has been tested by delivering microparticles into liver tissues of experimental rats and artificial soft human-body targets, modeled using gelatin. The penetration depths observed in the experimental targets are quite encouraging to develop a future clinical therapeutic device for treatments such as gene therapy, treatment of cancer and tumor cells, epidermal and mucosal immunizations etc.

  1. Combustion mode switching with a turbocharged/supercharged engine

    DOEpatents

    Mond, Alan; Jiang, Li

    2015-09-22

    A method for switching between low- and high-dilution combustion modes in an internal combustion engine having an intake passage with an exhaust-driven turbocharger, a crankshaft-driven positive displacement supercharger downstream of the turbocharger and having variable boost controllable with a supercharger bypass valve, and a throttle valve downstream of the supercharger. The current combustion mode and mass air flow are determined. A switch to the target combustion mode is commanded when an operating condition falls within a range of predetermined operating conditions. A target mass air flow to achieve a target air-fuel ratio corresponding to the current operating condition and the target combustion mode is determined. The degree of opening of the supercharger bypass valve and the throttle valve are controlled to achieve the target mass air flow. The amount of residual exhaust gas is manipulated.

  2. Event-driven simulation in SELMON: An overview of EDSE

    NASA Technical Reports Server (NTRS)

    Rouquette, Nicolas F.; Chien, Steve A.; Charest, Leonard, Jr.

    1992-01-01

    EDSE (event-driven simulation engine), a model-based event-driven simulator implemented for SELMON, a tool for sensor selection and anomaly detection in real-time monitoring is described. The simulator is used in conjunction with a causal model to predict future behavior of the model from observed data. The behavior of the causal model is interpreted as equivalent to the behavior of the physical system being modeled. An overview of the functionality of the simulator and the model-based event-driven simulation paradigm on which it is based is provided. Included are high-level descriptions of the following key properties: event consumption and event creation, iterative simulation, synchronization and filtering of monitoring data from the physical system. Finally, how EDSE stands with respect to the relevant open issues of discrete-event and model-based simulation is discussed.

  3. Knowledge-based fragment binding prediction.

    PubMed

    Tang, Grace W; Altman, Russ B

    2014-04-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening.

  4. Knowledge-based Fragment Binding Prediction

    PubMed Central

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  5. Random intermittent search and the tug-of-war model of motor-driven transport

    NASA Astrophysics Data System (ADS)

    Newby, Jay; Bressloff, Paul C.

    2010-04-01

    We formulate the 'tug-of-war' model of microtubule cargo transport by multiple molecular motors as an intermittent random search for a hidden target. A motor complex consisting of multiple molecular motors with opposing directional preference is modeled using a discrete Markov process. The motors randomly pull each other off of the microtubule so that the state of the motor complex is determined by the number of bound motors. The tug-of-war model prescribes the state transition rates and corresponding cargo velocities in terms of experimentally measured physical parameters. We add space to the resulting Chapman-Kolmogorov (CK) equation so that we can consider delivery of the cargo to a hidden target at an unknown location along the microtubule track. The target represents some subcellular compartment such as a synapse in a neuron's dendrites, and target delivery is modeled as a simple absorption process. Using a quasi-steady-state (QSS) reduction technique we calculate analytical approximations of the mean first passage time (MFPT) to find the target. We show that there exists an optimal adenosine triphosphate (ATP) concentration that minimizes the MFPT for two different cases: (i) the motor complex is composed of equal numbers of kinesin motors bound to two different microtubules (symmetric tug-of-war model) and (ii) the motor complex is composed of different numbers of kinesin and dynein motors bound to a single microtubule (asymmetric tug-of-war model).

  6. Anaemia management protocols in the care of haemodialysis patients: examining patient outcomes.

    PubMed

    Saunders, Sushila; MacLeod, Martha L P; Salyers, Vince; MacMillan, Peter D; Ogborn, Malcolm R

    2013-08-01

    To determine whether the use of a nurse-driven protocol in the haemodialysis setting is as safe and effective as traditional physician-driven approaches to anaemia management. The role of haemodialysis nurses in renal anaemia management has evolved through the implementation of nurse-driven protocols, addressing the trend of exceeding haemoglobin targets and rising costs of erythropoietin-stimulating agents. Retrospective, non-equivalent case control group design. The sample was from three haemodialysis units in a control group (n = 64) and three haemodialysis units in a protocol group (n = 43). The protocol group used a nurse-driven renal anaemia management protocol, while the control group used a traditional physician-driven approach to renal anaemia management. All retrospective data were obtained from a provincial renal database. Data were analysed using chi-square tests and t-tests. Patient outcomes examined were haemoglobin levels, transferrin saturation levels, erythropoietin-stimulating agents use and intravenous iron use. Cost comparisons were determined using average use of erythropoietin-stimulating agents and intravenous iron. Control and protocol groups reached haemoglobin target levels. In the protocol group, 75% reached transferrin saturation target levels in comparison with 25% of the control group. Use and costs for iron was higher in the control group, while use and costs for erythropoietin was higher in the protocol group. The higher usage of erythropoietin-stimulating agents was potentially related to comorbid conditions amongst the protocol group. A nurse-driven protocol approach to renal anaemia management was as effective as the physician-driven approach in reaching haemoglobin and transferrin saturation levels. Further examination of the use and dosing of erythropoietin-stimulating agents and intravenous iron, their impact on haemoglobin levels related to patient comorbidities and subsequent cost effectiveness of protocols is required. Using a nurse-driven protocol in practice supports the independent nursing role while contributing to safe patient outcomes. © 2013 Blackwell Publishing Ltd.

  7. Enhanced Laser-Driven Ion Acceleration by Superponderomotive Electrons Generated from Near-Critical-Density Plasma

    NASA Astrophysics Data System (ADS)

    Bin, J. H.; Yeung, M.; Gong, Z.; Wang, H. Y.; Kreuzer, C.; Zhou, M. L.; Streeter, M. J. V.; Foster, P. S.; Cousens, S.; Dromey, B.; Meyer-ter-Vehn, J.; Zepf, M.; Schreiber, J.

    2018-02-01

    We report on the experimental studies of laser driven ion acceleration from a double-layer target where a near-critical density target with a few-micron thickness is coated in front of a nanometer-thin diamondlike carbon foil. A significant enhancement of proton maximum energies from 12 to ˜30 MeV is observed when a relativistic laser pulse impinges on the double-layer target under linear polarization. We attributed the enhanced acceleration to superponderomotive electrons that were simultaneously measured in the experiments with energies far beyond the free-electron ponderomotive limit. Our interpretation is supported by two-dimensional simulation results.

  8. Decision Manifold Approximation for Physics-Based Simulations

    NASA Technical Reports Server (NTRS)

    Wong, Jay Ming; Samareh, Jamshid A.

    2016-01-01

    With the recent surge of success in big-data driven deep learning problems, many of these frameworks focus on the notion of architecture design and utilizing massive databases. However, in some scenarios massive sets of data may be difficult, and in some cases infeasible, to acquire. In this paper we discuss a trajectory-based framework that quickly learns the underlying decision manifold of binary simulation classifications while judiciously selecting exploratory target states to minimize the number of required simulations. Furthermore, we draw particular attention to the simulation prediction application idealized to the case where failures in simulations can be predicted and avoided, providing machine intelligence to novice analysts. We demonstrate this framework in various forms of simulations and discuss its efficacy.

  9. On the value-dependence of value-driven attentional capture.

    PubMed

    Anderson, Brian A; Halpern, Madeline

    2017-05-01

    Findings from an increasingly large number of studies have been used to argue that attentional capture can be dependent on the learned value of a stimulus, or value-driven. However, under certain circumstances attention can be biased to select stimuli that previously served as targets, independent of reward history. Value-driven attentional capture, as studied using the training phase-test phase design introduced by Anderson and colleagues, is widely presumed to reflect the combined influence of learned value and selection history. However, the degree to which attentional capture is at all dependent on value learning in this paradigm has recently been questioned. Support for value-dependence can be provided through one of two means: (1) greater attentional capture by prior targets following rewarded training than following unrewarded training, and (2) greater attentional capture by prior targets previously associated with high compared to low value. Using a variant of the original value-driven attentional capture paradigm, Sha and Jiang (Attention, Perception, and Psychophysics, 78, 403-414, 2016) failed to find evidence of either, and raised criticisms regarding the adequacy of evidence provided by prior studies using this particular paradigm. To address this disparity, here we provided a stringent test of the value-dependence hypothesis using the traditional value-driven attentional capture paradigm. With a sufficiently large sample size, value-dependence was observed based on both criteria, with no evidence of attentional capture without rewards during training. Our findings support the validity of the traditional value-driven attentional capture paradigm in measuring what its name purports to measure.

  10. Simulation of high-energy radiation belt electron fluxes using NARMAX-VERB coupled codes

    PubMed Central

    Pakhotin, I P; Drozdov, A Y; Shprits, Y Y; Boynton, R J; Subbotin, D A; Balikhin, M A

    2014-01-01

    This study presents a fusion of data-driven and physics-driven methodologies of energetic electron flux forecasting in the outer radiation belt. Data-driven NARMAX (Nonlinear AutoRegressive Moving Averages with eXogenous inputs) model predictions for geosynchronous orbit fluxes have been used as an outer boundary condition to drive the physics-based Versatile Electron Radiation Belt (VERB) code, to simulate energetic electron fluxes in the outer radiation belt environment. The coupled system has been tested for three extended time periods totalling several weeks of observations. The time periods involved periods of quiet, moderate, and strong geomagnetic activity and captured a range of dynamics typical of the radiation belts. The model has successfully simulated energetic electron fluxes for various magnetospheric conditions. Physical mechanisms that may be responsible for the discrepancies between the model results and observations are discussed. PMID:26167432

  11. Comparison of bulk and pitcher-catcher targets for laser-driven neutron production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Willingale, L.; Maksimchuk, A.; Joglekar, A. S.

    2011-08-15

    Laser-driven d(d, n)-{sup 3}He beam-target fusion neutron production from bulk deuterated plastic (CD) targets is compared with a pitcher-catcher target scheme using an identical laser and detector arrangement. For laser intensities in the range of (1-3) x 10{sup 19} W cm{sup -2}, it was found that the bulk targets produced a high yield (5 x 10{sup 4} neutrons per steradian) beamed preferentially in the laser propagation direction. Numerical modeling shows the importance of considering the temperature adjusted stopping powers to correctly model the neutron production. The bulk CD targets have a high background target temperature leading to a reduced stoppingmore » power for the deuterons, which increases the probability of generating neutrons by fusion. Neutron production from the pitcher-catcher targets was not as efficient since it does not benefit from the reduced stopping power in the cold catcher target. Also, the inhibition of the deuteron acceleration by a proton rich contamination layer significantly reduces the pitcher-catcher neutron production.« less

  12. Power Transfer in Physical Systems.

    ERIC Educational Resources Information Center

    Kaeck, Jack A.

    1990-01-01

    Explores the power transfer using (1) a simple electric circuit consisting of a power source with internal resistance; (2) two different mechanical systems (gravity driven and constant force driven); (3) ecological examples; and (4) a linear motor. (YP)

  13. Staging and laser acceleration of ions in underdense plasma

    NASA Astrophysics Data System (ADS)

    Ting, Antonio; Hafizi, Bahman; Helle, Michael; Chen, Yu-Hsin; Gordon, Daniel; Kaganovich, Dmitri; Polyanskiy, Mikhail; Pogorelsky, Igor; Babzien, Markus; Miao, Chenlong; Dover, Nicholas; Najmudin, Zulfikar; Ettlinger, Oliver

    2017-03-01

    Accelerating ions from rest in a plasma requires extra considerations because of their heavy mass. Low phase velocity fields or quasi-electrostatic fields are often necessary, either by operating above or near the critical density or by applying other slow wave generating mechanisms. Solid targets have been a favorite and have generated many good results. High density gas targets have also been reported to produce energetic ions. It is interesting to consider acceleration of ions in laser-driven plasma configurations that will potentially allow continuous acceleration in multiple consecutive stages. The plasma will be derived from gaseous targets, producing plasma densities slightly below the critical plasma density (underdense) for the driving laser. Such a plasma is experimentally robust, being repeatable and relatively transparent to externally injected ions from a previous stage. When optimized, multiple stages of this underdense laser plasma acceleration mechanism can progressively accelerate the ions to a high final energy. For a light mass ion such as the proton, relativistic velocities could be reached, making it suitable for further acceleration by high phase velocity plasma accelerators to energies appropriate for High Energy Physics applications. Negatively charged ions such as antiprotons could be similarly accelerated in this multi-staged ion acceleration scheme.

  14. Laser imprint reduction for the critical-density foam buffered target driven by a relatively strong foot pulse at early stage of laser implosions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, J. W., E-mail: li-jiwei@iapcm.ac.cn; He, X. T.; Institute of Applied Physics and Computational Mathematics, P. O. Box 8009, Beijing 100094

    In order to reduce the effect of laser imprint in direct-drive ignition scheme a low-density foam buffered target has been proposed. This target is driven by a laser pulse with a low-intensity foot at the early stage of implosion, which heats the foam and elongates the thermal conduction zone between the laser absorption region and ablation front, increasing the thermal smoothing effect. In this paper, a relatively strong foot pulse is adopted to irradiate the critical-density foam buffered target. The stronger foot, near 1 × 10{sup 14 }W/cm{sup 2}, is able to drive a radiative shock in the low-density foam, which helps smoothmore » the shock and further reduce the effect of laser imprint. The radiative shock also forms a double ablation front structure between the two ablation fronts to further stabilize the hydrodynamics, achieving the similar results to a target with a high-Z dopant in the ablator. 2D analysis shows that for the critical-density foam buffered target irradiated by the strong foot pulse, the laser imprint can be reduced due to the radiative shock in the foam and an increased thermal smoothing effect. It seems viable for the critical-density foam buffered target to be driven by a relatively strong foot pulse with the goal of reducing the laser imprint and achieving better implosion symmetry in the direct-drive laser fusion.« less

  15. Radiological Protection and Nuclear Engineering Studies in Multi-MW Target Systems

    NASA Astrophysics Data System (ADS)

    Luis, Raul Fernandes

    Several innovative projects involving nuclear technology have emerged around the world in recent years, for applications such as spallation neutron sources, accelerator-driven systems for the transmutation of nuclear waste and radioactive ion beam (RIB) production. While the available neutron Wuxes from nuclear reactors did not increase substantially in intensity over the past three decades, the intensities of neutron sources produced in spallation targets have increased steadily, and should continue to do so during the 21st century. Innovative projects like ESS, MYRRHA and EURISOL lie at the forefront of the ongoing pursuit for increasingly bright neutron sources; driven by proton beams with energies up to 2 GeV and intensities up to several mA, the construction of their proposed facilities involves complex Nuclear Technology and Radiological Protection design studies executed by multidisciplinary teams of scientists and engineers from diUerent branches of Science. The intense neutron Wuxes foreseen for those facilities can be used in several scientiVc research Velds, such as Nuclear Physics and Astrophysics, Medicine and Materials Science. In this work, the target systems of two facilitites for the production of RIBs using the Isotope Separation On-Line (ISOL) method were studied in detail: ISOLDE, operating at CERN since 1967, and EURISOL, the next-generation ISOL facility to be built in Europe. For the EURISOL multi-MW target station, a detailed study of Radiological Protection was carried out using the Monte Carlo code FLUKA. Simulations were done to assess neutron Wuences, Vssion rates, ambient dose equivalent rates during operation and after shutdown and the production of radioactive nuclei in the targets and surrounding materials. DiUerent materials were discussed for diUerent components of the target system, aiming at improving its neutronics performance while keeping the residual activities resulting from material activation as low as possible. The second goal of this work was to perform an optimisation study for the ISOLDE neutron converter and Vssion target system. The target system was simulated using FLUKA and the cross section codes TALYS and ABRABLA, with the objective of maximising the performance of the system for the production of pure beams of neutron-rich isotopes, suppressing the contaminations by undesired neutron-deficient isobars. Two alternative target systems were proposed in the optimisation studies; the simplest of the two, with some modiVcations, was built as a prototype and tested at ISOLDE. The experimental results clearly show that it is possible, with simple changes in the layouts of the target systems, to produce purer beams of neutron-rich isotopes around the doubly magic nuclei 78Ni and 132Sn. A study of Radiological Protection was also performed, comparing the performances of the prototype target system and the standard ISOLDE target system. None

  16. Magnetic reconnection driven by Gekko XII lasers with a Helmholtz capacitor-coil target

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pei, X. X.; University of Chinese Academy of Sciences, Beijing 100049; Zhong, J. Y., E-mail: jyzhong@bnu.edu.cn, E-mail: gzhao@bao.ac.cn

    2016-03-15

    We demonstrate a novel plasma device for magnetic reconnection, driven by Gekko XII lasers irradiating a double-turn Helmholtz capacitor-coil target. Optical probing revealed an accumulated plasma plume near the magnetic reconnection outflow. The background electron density and magnetic field were measured to be approximately 10{sup 18 }cm{sup −3} and 60 T by using Nomarski interferometry and the Faraday effect, respectively. In contrast with experiments on magnetic reconnection constructed by the Biermann battery effect, which produced high beta values, our beta value was much lower than one, which greatly extends the parameter regime of laser-driven magnetic reconnection and reveals its potential in astrophysicalmore » plasma applications.« less

  17. Seeding magnetic fields for laser-driven flux compression in high-energy-density plasmas.

    PubMed

    Gotchev, O V; Knauer, J P; Chang, P Y; Jang, N W; Shoup, M J; Meyerhofer, D D; Betti, R

    2009-04-01

    A compact, self-contained magnetic-seed-field generator (5 to 16 T) is the enabling technology for a novel laser-driven flux-compression scheme in laser-driven targets. A magnetized target is directly irradiated by a kilojoule or megajoule laser to compress the preseeded magnetic field to thousands of teslas. A fast (300 ns), 80 kA current pulse delivered by a portable pulsed-power system is discharged into a low-mass coil that surrounds the laser target. A >15 T target field has been demonstrated using a <100 J capacitor bank, a laser-triggered switch, and a low-impedance (<1 Omega) strip line. The device has been integrated into a series of magnetic-flux-compression experiments on the 60 beam, 30 kJ OMEGA laser [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)]. The initial application is a novel magneto-inertial fusion approach [O. V. Gotchev et al., J. Fusion Energy 27, 25 (2008)] to inertial confinement fusion (ICF), where the amplified magnetic field can inhibit thermal conduction losses from the hot spot of a compressed target. This can lead to the ignition of massive shells imploded with low velocity-a way of reaching higher gains than is possible with conventional ICF.

  18. Schematic driven silicon photonics design

    NASA Astrophysics Data System (ADS)

    Chrostowski, Lukas; Lu, Zeqin; Flückiger, Jonas; Pond, James; Klein, Jackson; Wang, Xu; Li, Sarah; Tai, Wei; Hsu, En Yao; Kim, Chan; Ferguson, John; Cone, Chris

    2016-03-01

    Electronic circuit designers commonly start their design process with a schematic, namely an abstract representation of the physical circuit. In integrated photonics on the other hand, it is very common for the design to begin at the physical component level. In order to build large integrated photonic systems, it is crucial to design using a schematic-driven approach. This includes simulations based on schematics, schematic-driven layout, layout versus schematic verification, and post-layout simulations. This paper describes such a design framework implemented using Mentor Graphics and Lumerical Solutions design tools. In addition, we describe challenges in silicon photonics related to manufacturing, and how these can be taken into account in simulations and how these impact circuit performance.

  19. Novel target design for enhanced laser driven proton acceleration

    NASA Astrophysics Data System (ADS)

    Dalui, Malay; Kundu, M.; Tata, Sheroy; Lad, Amit D.; Jha, J.; Ray, Krishanu; Krishnamurthy, M.

    2017-09-01

    We demonstrate a simple method of preparing structured target for enhanced laser-driven proton acceleration under target-normal-sheath-acceleration scheme. A few layers of genetically modified, clinically grown micron sized E. Coli bacteria cell coated on a thin metal foil has resulted in an increase in the maximum proton energy by about 1.5 times and the total proton yield is enhanced by approximately 25 times compared to an unstructured reference foil at a laser intensity of 1019 W/cm2. Particle-in-cell simulations on the system shows that the structures on the target-foil facilitates anharmonic resonance, contributing to enhanced hot electron production which leads to stronger accelerating field. The effect is observed to grow as the number of structures is increased in the focal area of the laser pulse.

  20. Data-driven risk models could help target pipeline safety inspections

    DOT National Transportation Integrated Search

    2008-07-01

    Federal safety agencies share a common problemthe : need to target resources effectively to reduce risk. One : way this targeting is commonly done is with a risk model : that uses safety data along with expert judgment to identify : and weight ris...

  1. Thermally driven advection for radioxenon transport from an underground nuclear explosion

    NASA Astrophysics Data System (ADS)

    Sun, Yunwei; Carrigan, Charles R.

    2016-05-01

    Barometric pumping is a ubiquitous process resulting in migration of gases in the subsurface that has been studied as the primary mechanism for noble gas transport from an underground nuclear explosion (UNE). However, at early times following a UNE, advection driven by explosion residual heat is relevant to noble gas transport. A rigorous measure is needed for demonstrating how, when, and where advection is important. In this paper three physical processes of uncertain magnitude (oscillatory advection, matrix diffusion, and thermally driven advection) are parameterized by using boundary conditions, system properties, and source term strength. Sobol' sensitivity analysis is conducted to evaluate the importance of all physical processes influencing the xenon signals. This study indicates that thermally driven advection plays a more important role in producing xenon signals than oscillatory advection and matrix diffusion at early times following a UNE, and xenon isotopic ratios are observed to have both time and spatial dependence.

  2. A review of the nutritional challenges experienced by people living with severe mental illness: a role for dietitians in addressing physical health gaps.

    PubMed

    Teasdale, S B; Samaras, K; Wade, T; Jarman, R; Ward, P B

    2017-10-01

    People experiencing a severe mental illness (SMI), such as schizophrenia, schizoaffective disorder, bipolar affective disorder or depression with psychotic features, have a 20-year mortality gap compared to the general population. This 'scandal of premature mortality' is primarily driven by preventable cardiometabolic disease, and recent research suggests that the mortality gap is widening. Multidisciplinary mental health teams often include psychiatrists, clinical psychologists, specialist mental health nurses, social workers and occupational therapists, offering a range of pharmacological and nonpharmacological treatments to enhance the recovery of clients who have experienced, or are experiencing a SMI. Until recently, lifestyle and life skills interventions targeting the poor physical health experienced by people living with SMI have not been offered in most routine clinical settings. Furthermore, there are calls to include dietary intervention as mainstream in psychiatry to enhance mental health recovery. With the integration of dietitians being a relatively new approach, it is important to review and assess the literature to inform practice. This review assesses the dietary challenges experienced by people with a SMI and discusses potential strategies for improving mental and physical health. © 2017 The British Dietetic Association Ltd.

  3. Repetition rates in heavy ion beam driven fusion reactors

    NASA Astrophysics Data System (ADS)

    Peterson, Robert R.

    1986-01-01

    The limits on the cavity gas density required for beam propagation and condensation times for material vaporized by target explosions can determine the maximum repetition rate of Heavy Ion Beam (HIB) driven fusion reactors. If the ions are ballistically focused onto the target, the cavity gas must have a density below roughly 10-4 torr (3×1012 cm-3) at the time of propagation; other propagation schemes may allow densities as high as 1 torr or more. In some reactor designs, several kilograms of material may be vaporized off of the target chamber walls by the target generated x-rays, raising the average density in the cavity to 100 tor or more. A one-dimensional combined radiation hydrodynamics and vaporization and condensation computer code has been used to simulate the behavior of the vaporized material in the target chambers of HIB fusion reactors.

  4. Dynamics of Laser-Driven Shock Waves in Solid Targets

    NASA Astrophysics Data System (ADS)

    Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J.; Schmitt, A. J.; Obenschain, S. P.; Grun, J.; Metzler, N.; Zalesak, S. T.; Gardner, J. H.; Oh, J.; Harding, E. C.

    2009-11-01

    Accurate shock timing is a key issue of both indirect- and direct-drive laser fusions. The experiments on the Nike laser at NRL presented here were made possible by improvements in the imaging capability of our monochromatic x-ray diagnostics based on Bragg reflection from spherically curved crystals. Side-on imaging implemented on Nike makes it possible to observe dynamics of the shock wave and ablation front in laser-driven solid targets. We can choose to observe a sequence of 2D images or a continuous time evolution of an image resolved in one spatial dimension. A sequence of 300 ps snapshots taken using vanadium backlighter at 5.2 keV reveals propagation of a shock wave in a solid plastic target. The shape of the shock wave reflects the intensity distribution in the Nike beam. The streak records with continuous time resolution show the x-t trajectory of a laser-driven shock wave in a 10% solid density DVB foam.

  5. A paradigm shift toward a consistent modeling framework to assess climate impacts

    NASA Astrophysics Data System (ADS)

    Monier, E.; Paltsev, S.; Sokolov, A. P.; Fant, C.; Chen, H.; Gao, X.; Schlosser, C. A.; Scott, J. R.; Dutkiewicz, S.; Ejaz, Q.; Couzo, E. A.; Prinn, R. G.; Haigh, M.

    2017-12-01

    Estimates of physical and economic impacts of future climate change are subject to substantial challenges. To enrich the currently popular approaches of assessing climate impacts by evaluating a damage function or by multi-model comparisons based on the Representative Concentration Pathways (RCPs), we focus here on integrating impacts into a self-consistent coupled human and Earth system modeling framework that includes modules that represent multiple physical impacts. In a sample application we show that this framework is capable of investigating the physical impacts of climate change and socio-economic stressors. The projected climate impacts vary dramatically across the globe in a set of scenarios with global mean warming ranging between 2.4°C and 3.6°C above pre-industrial by 2100. Unabated emissions lead to substantial sea level rise, acidification that impacts the base of the oceanic food chain, air pollution that exceeds health standards by tenfold, water stress that impacts an additional 1 to 2 billion people globally and agricultural productivity that decreases substantially in many parts of the world. We compare the outcomes from these forward-looking scenarios against the common goal described by the target-driven scenario of 2°C, which results in much smaller impacts. It is challenging for large internationally coordinated exercises to respond quickly to new policy targets. We propose that a paradigm shift toward a self-consistent modeling framework to assess climate impacts is needed to produce information relevant to evolving global climate policy and mitigation strategies in a timely way.

  6. Hybrid-drive implosion system for ICF targets

    DOEpatents

    Mark, James W.

    1988-08-02

    Hybrid-drive implosion systems (20,40) for ICF targets (10,22,42) are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator (12) surroundingly disposed around fusion fuel (14). The ablator is first compressed to higher density by a laser system (24), or by an ion beam system (44), that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system (30,48) that is optimized for this second phase of operation of the target. The fusion fuel (14) is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion.

  7. Hybrid-drive implosion system for ICF targets

    DOEpatents

    Mark, James W.

    1988-01-01

    Hybrid-drive implosion systems (20,40) for ICF targets (10,22,42) are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator (12) surroundingly disposed around fusion fuel (14). The ablator is first compressed to higher density by a laser system (24), or by an ion beam system (44), that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system (30,48) that is optimized for this second phase of operation of the target. The fusion fuel (14) is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion.

  8. Hybrid-drive implosion system for ICF targets

    DOEpatents

    Mark, J.W.K.

    1987-10-14

    Hybrid-drive implosion systems for ICF targets are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator surroundingly disposed around fusion fuel. The ablator is first compressed to higher density by a laser system, or by an ion beam system, that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system that is optimized for this second phase of operation of the target. The fusion fuel is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion. 3 figs.

  9. Superconductivity driven by pairing of the coherent parts of the physical electrons

    NASA Astrophysics Data System (ADS)

    Su, Yuehua; Zhang, Chao

    2018-03-01

    How the superconductivity in unconventional superconductors emerges from the diverse mother normal states is still a big puzzle. Whatever the mother normal states are the superconductivity is normal with BCS-like behaviours of the paired quasiparticles in condensation. To reconcile the diverse mother normal states and the normal superconductivity in unconventional superconductors, we revisit a proposal that the emergence of the low-energy coherent parts of the physical electrons, which survive from the interaction correlations, is an essential prerequisite for superconductivity. The superconductivity is driven by the pair condensation of these coherent parts of the physical electrons. Moreover the incoherent parts of the physical electrons can enhance the superconducting transition temperature Tc although they are not in driving role in the emergence of the superconductivity. Some experimental responses of the coherent parts of the physical electrons are predicted.

  10. Retinotopy and attention to the face and house images in the human visual cortex.

    PubMed

    Wang, Bin; Yan, Tianyi; Ohno, Seiichiro; Kanazawa, Susumu; Wu, Jinglong

    2016-06-01

    Attentional modulation of the neural activities in human visual areas has been well demonstrated. However, the retinotopic activities that are driven by face and house images and attention to face and house images remain unknown. In the present study, we used images of faces and houses to estimate the retinotopic activities that were driven by both the images and attention to the images, driven by attention to the images, and driven by the images. Generally, our results show that both face and house images produced similar retinotopic activities in visual areas, which were only observed in the attention + stimulus and the attention conditions, but not in the stimulus condition. The fusiform face area (FFA) responded to faces that were presented on the horizontal meridian, whereas parahippocampal place area (PPA) rarely responded to house at any visual field. We further analyzed the amplitudes of the neural responses to the target wedge. In V1, V2, V3, V3A, lateral occipital area 1 (LO-1), and hV4, the neural responses to the attended target wedge were significantly greater than those to the unattended target wedge. However, in LO-2, ventral occipital areas 1 and 2 (VO-1 and VO-2) and FFA and PPA, the differences were not significant. We proposed that these areas likely have large fields of attentional modulation for face and house images and exhibit responses to both the target wedge and the background stimuli. In addition, we proposed that the absence of retinotopic activity in the stimulus condition might imply no perceived difference between the target wedge and the background stimuli.

  11. Does the cerebellum initiate movement?

    PubMed

    Thach, W T

    2014-02-01

    Opinion is divided on what the exact function of the cerebellum is. Experiments are summarized that support the following views: (1) the cerebellum is a combiner of multiple movement factors; (2) it contains anatomically fixed permanent focal representation of individual body parts (muscles and segments) and movement modes (e.g., vestibular driven vs. cognitive driven); (3) it contains flexible changing representations/memory of physical properties of the body parts including muscle strength, segment inertia, joint viscosity, and segmental interaction torques (dynamics); (4) it contains mechanisms for learning and storage of the properties in item no. 3 through trial-and-error practice; (5) it provides for linkage of body parts, motor modes, and motordynamics via the parallel fiber system; (6) it combines and integrates the many factors so as to initiate coordinated movements of the many body parts; (7) it is thus enabled to play the unique role of initiating coordinated movements; and (8) this unique causative role is evidenced by the fact that: (a) electrical stimulation of the cerebellum can initiate compound coordinated movements; (b) in naturally initiated compound movements, cerebellar discharge precedes that in downstream target structures such as motor cerebral cortex; and (c) cerebellar ablation abolishes the natural production of compound movements in the awake alert individuals.

  12. Data-Driven Haptic Modeling and Rendering of Viscoelastic and Frictional Responses of Deformable Objects.

    PubMed

    Yim, Sunghoon; Jeon, Seokhee; Choi, Seungmoon

    2016-01-01

    In this paper, we present an extended data-driven haptic rendering method capable of reproducing force responses during pushing and sliding interaction on a large surface area. The main part of the approach is a novel input variable set for the training of an interpolation model, which incorporates the position of a proxy - an imaginary contact point on the undeformed surface. This allows us to estimate friction in both sliding and sticking states in a unified framework. Estimating the proxy position is done in real-time based on simulation using a sliding yield surface - a surface defining a border between the sliding and sticking regions in the external force space. During modeling, the sliding yield surface is first identified via an automated palpation procedure. Then, through manual palpation on a target surface, input data and resultant force data are acquired. The data are used to build a radial basis interpolation model. During rendering, this input-output mapping interpolation model is used to estimate force responses in real-time in accordance with the interaction input. Physical performance evaluation demonstrates that our approach achieves reasonably high estimation accuracy. A user study also shows plausible perceptual realism under diverse and extensive exploration.

  13. Color temperature measurement in laser-driven shock waves

    NASA Astrophysics Data System (ADS)

    Hall, T. A.; Benuzzi, A.; Batani, D.; Beretta, D.; Bossi, S.; Faral, B.; Koenig, M.; Krishnan, J.; Löautwer, Th.; Mahdieh, M.

    1997-06-01

    A simultaneous measurement of color temperature and shock velocity in laser-driven shocks is presented. The color temperature was measured from the target rear side emissivity, and the shock velocity by using stepped targets. A very good planarity of the shock was ensured by the phase zone plate smoothing technique. A simple model of the shock luminosity has been developed in order to estimate the shock temperature from the experimental rear side emissivity. Results have been compared to temperatures obtained from the shock velocity for a material of a known equation of state.

  14. Drug-Coated Balloon Treatment of Femoropopliteal Lesions for Patients With Intermittent Claudication and Ischemic Rest Pain: 2-Year Results From the IN.PACT Global Study.

    PubMed

    Micari, Antonio; Brodmann, Marianne; Keirse, Koen; Peeters, Patrick; Tepe, Gunnar; Frost, Martin; Wang, Hong; Zeller, Thomas

    2018-05-28

    The IN.PACT Global Study is the largest prospective, multicenter, independently adjudicated trial to evaluate a paclitaxel drug-coated balloon in patients with lifestyle-limiting claudication and/or ischemic rest pain due to atherosclerotic disease of the femoropopliteal artery and includes complex lesions beyond what are typically included in randomized controlled trials. Randomized controlled trials have demonstrated the safety and efficacy of drug-coated balloons for the treatment of Trans-Atlantic Inter-Society Consensus Document II A and B lesions, but there is a need for large-scale prospective studies to evaluate a broader range of lesions. The IN.PACT Global Study enrolled 1,535 subjects, and 1,406 (1,773 lesions) were included in the pre-defined clinical cohort analysis. Freedom from clinically driven target lesion revascularization was evaluated at 24 months. The safety composite endpoint was freedom from device- and procedure-related death through 30 days and freedom from target limb major amputation and clinically driven target vessel revascularization within 24 months. Mean lesion length was 12.1 cm, 35.5% were total occlusions, and 18.0% had in-stent restenosis. Freedom from clinically driven target lesion revascularization at 24 months was 83.3%, the composite safety endpoint was met in 81.7%, the 2-year all-cause mortality rate was 7.0%, and the major target limb amputation rate was 0.7%. Increased lesion length and the presence of de novo in-stent restenosis or coronary artery disease were associated with increased risk for clinically driven target lesion revascularization by 24 months. This real-world study of femoropopliteal artery disease treatment with drug-coated balloons confirmed positive findings reported from more strictly designed randomized controlled trials and showed that outcomes are durable in this population up to 2 years after treatment. (IN.PACT Global Clinical Study; NCT01609296). Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Machine Learning and Deep Learning Models to Predict Runoff Water Quantity and Quality

    NASA Astrophysics Data System (ADS)

    Bradford, S. A.; Liang, J.; Li, W.; Murata, T.; Simunek, J.

    2017-12-01

    Contaminants can be rapidly transported at the soil surface by runoff to surface water bodies. Physically-based models, which are based on the mathematical description of main hydrological processes, are key tools for predicting surface water impairment. Along with physically-based models, data-driven models are becoming increasingly popular for describing the behavior of hydrological and water resources systems since these models can be used to complement or even replace physically based-models. In this presentation we propose a new data-driven model as an alternative to a physically-based overland flow and transport model. First, we have developed a physically-based numerical model to simulate overland flow and contaminant transport (the HYDRUS-1D overland flow module). A large number of numerical simulations were carried out to develop a database containing information about the impact of various input parameters (weather patterns, surface topography, vegetation, soil conditions, contaminants, and best management practices) on runoff water quantity and quality outputs. This database was used to train data-driven models. Three different methods (Neural Networks, Support Vector Machines, and Recurrence Neural Networks) were explored to prepare input- output functional relations. Results demonstrate the ability and limitations of machine learning and deep learning models to predict runoff water quantity and quality.

  16. Scanning properties of a resonant fiber-optic piezoelectric scanner

    NASA Astrophysics Data System (ADS)

    Li, Zhi; Yang, Zhe; Fu, Ling

    2011-12-01

    We develop a resonant fiber-optic scanner using four piezoelectric elements arranged as a square tube, which is efficient to manufacture and drive. Using coupled-field model based on finite element method, scanning properties of the scanner, including vibration mode, resonant frequency, and scanning range, are numerically studied. We also physically measure the effects of geometry sizes and drive signals on the scanning properties, thus providing a foundation for general purpose designs. A scanner adopted in a prototype of imaging system, with a diameter of ˜2 mm and driven by a voltage of 10 V (peak to peak), demonstrates the scanning performance by obtaining an image of resolution target bars. The proposed fiber-optic scanner can be applied to micro-endoscopy that requires two-dimensional scanning of fibers.

  17. Laser-driven Ion Acceleration using Nanodiamonds

    NASA Astrophysics Data System (ADS)

    D'Hauthuille, Luc; Nguyen, Tam; Dollar, Franklin

    2016-10-01

    Interactions of high-intensity lasers with mass-limited nanoparticles enable the generation of extremely high electric fields. These fields accelerate ions, which has applications in nuclear medicine, high brightness radiography, as well as fast ignition for inertial confinement fusion. Previous studies have been performed with ensembles of nanoparticles, but this obscures the physics of the interaction due to the wide array of variables in the interaction. The work presented here looks instead at the interactions of a high intensity short pulse laser with an isolated nanodiamond. Specifically, we studied the effect of nanoparticle size and intensity of the laser on the interaction. A novel target scheme was developed to isolate the nanodiamond. Particle-in-cell simulations were performed using the EPOCH framework to show the sheath fields and resulting energetic ion beams.

  18. GridPP - Preparing for LHC Run 2 and the Wider Context

    NASA Astrophysics Data System (ADS)

    Coles, Jeremy

    2015-12-01

    This paper elaborates upon the operational status and directions within the UK Computing for Particle Physics (GridPP) project as it approaches LHC Run 2. It details the pressures that have been gradually reshaping the deployed hardware and middleware environments at GridPP sites - from the increasing adoption of larger multicore nodes to the move towards alternative batch systems and cloud alternatives - as well as changes being driven by funding considerations. The paper highlights work being done with non-LHC communities and describes some of the early outcomes of adopting a generic DIRAC based job submission and management framework. The paper presents results from an analysis of how GridPP effort is distributed across various deployment and operations tasks and how this may be used to target further improvements in efficiency.

  19. Jet-images — deep learning edition

    DOE PAGES

    de Oliveira, Luke; Kagan, Michael; Mackey, Lester; ...

    2016-07-13

    Building on the notion of a particle physics detector as a camera and the collimated streams of high energy particles, or jets, it measures as an image, we investigate the potential of machine learning techniques based on deep learning architectures to identify highly boosted W bosons. Modern deep learning algorithms trained on jet images can out-perform standard physically-motivated feature driven approaches to jet tagging. We develop techniques for visualizing how these features are learned by the network and what additional information is used to improve performance. Finally, this interplay between physically-motivated feature driven tools and supervised learning algorithms is generalmore » and can be used to significantly increase the sensitivity to discover new particles and new forces, and gain a deeper understanding of the physics within jets.« less

  20. Jet-images — deep learning edition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Oliveira, Luke; Kagan, Michael; Mackey, Lester

    Building on the notion of a particle physics detector as a camera and the collimated streams of high energy particles, or jets, it measures as an image, we investigate the potential of machine learning techniques based on deep learning architectures to identify highly boosted W bosons. Modern deep learning algorithms trained on jet images can out-perform standard physically-motivated feature driven approaches to jet tagging. We develop techniques for visualizing how these features are learned by the network and what additional information is used to improve performance. Finally, this interplay between physically-motivated feature driven tools and supervised learning algorithms is generalmore » and can be used to significantly increase the sensitivity to discover new particles and new forces, and gain a deeper understanding of the physics within jets.« less

  1. The GALAH Survey: Second Data Release

    NASA Astrophysics Data System (ADS)

    Buder, Sven; Asplund, Martin; Duong, Ly; Kos, Janez; Lind, Karin; Ness, Melissa K.; Sharma, Sanjib; Bland-Hawthorn, Joss; Casey, Andrew R.; De Silva, Gayandhi M.; D'Orazi, Valentina; Freeman, Ken C.; Lewis, Geraint F.; Lin, Jane; Martell, Sarah L.; Schlesinger, Katharine J.; Simpson, Jeffrey D.; Zucker, Daniel B.; Zwitter, Tomaž; Amarsi, Anish M.; Anguiano, Borja; Carollo, Daniela; Casagrande, Luca; Čotar, Klemen; Cottrell, Peter L.; Da Costa, Gary; Gao, Xudong D.; Hayden, Michael R.; Horner, Jonathan; Ireland, Michael J.; Kafle, Prajwal R.; Munari, Ulisse; Nataf, David M.; Nordlander, Thomas; Stello, Dennis; Ting, Yuan-Sen; Traven, Gregor; Watson, Fred; Wittenmyer, Robert A.; Wyse, Rosemary F. G.; Yong, David; Zinn, Joel C.; Žerjal, Maruša

    2018-05-01

    The Galactic Archaeology with HERMES (GALAH) survey is a large-scale stellar spectroscopic survey of the Milky Way, designed to deliver complementary chemical information to a large number of stars covered by the Gaia mission. We present the GALAH second public data release (GALAH DR2) containing 342,682 stars. For these stars, the GALAH collaboration provides stellar parameters and abundances for up to 23 elements to the community. Here we present the target selection, observation, data reduction and detailed explanation of how the spectra were analysed to estimate stellar parameters and element abundances. For the stellar analysis, we have used a multi-step approach. We use the physics-driven spectrum synthesis of Spectroscopy Made Easy (SME) to derive stellar labels (Teff, log g, [Fe/H], [X/Fe], vmic, vsin i, A_{K_S}) for a representative training set of stars. This information is then propagated to the whole sample with the data-driven method of The Cannon. Special care has been exercised in the spectral synthesis to only consider spectral lines that have reliable atomic input data and are little affected by blending lines. Departures from local thermodynamic equilibrium (LTE) are considered for several key elements, including Li, O, Na, Mg, Al, Si, and Fe, using 1D MARCS stellar atmosphere models. Validation tests including repeat observations, Gaia benchmark stars, open and globular clusters, and K2 asteroseismic targets lend confidence to our methods and results. Combining the GALAH DR2 catalogue with the kinematic information from Gaia will enable a wide range of Galactic Archaeology studies, with unprecedented detail, dimensionality, and scope.

  2. Measuring Energy Scaling of Laser Driven Magnetic Fields

    NASA Astrophysics Data System (ADS)

    Williams, Jackson; Goyon, Clement; Mariscal, Derek; Pollock, Brad; Patankar, Siddharth; Moody, John

    2016-10-01

    Laser-driven magnetic fields are of interest in particle confinement, fast ignition, and ICF platforms as an alternative to pulsed power systems to achieve many times higher fields. A comprehensive model describing the mechanism responsible for creating and maintaining magnetic fields from laser-driven coils has not yet been established. Understanding the scaling of key experimental parameters such as spatial and temporal uniformity and duration are necessary to implement coil targets in practical applications yet these measurements prove difficult due to the highly transient nature of the fields. We report on direct voltage measurements of laser-driven coil targets in which the laser energy spans more than four orders of magnitude. Results suggest that at low energies, laser-driven coils can be modeled as an electric circuit; however, at higher energies plasma effects dominate and a simple circuit treatment is insufficient to describe all observed phenomenon. The favorable scaling with laser power and pulse duration, observed in the present study and others at kilojoule energies, has positive implications for sustained, large magnetic fields for applications on the NIF. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  3. Drug nanocarrier, the future of atopic diseases: Advanced drug delivery systems and smart management of disease.

    PubMed

    Shao, Mei; Hussain, Zahid; Thu, Hnin Ei; Khan, Shahzeb; Katas, Haliza; Ahmed, Tarek A; Tripathy, Minaketan; Leng, Jing; Qin, Hua-Li; Bukhari, Syed Nasir Abbas

    2016-11-01

    Atopic dermatitis (AD) is a chronically relapsing skin inflammatory disorder characterized by perivascular infiltration of immunoglobulin-E (IgE), T-lymphocytes and mast cells. The key pathophysiological factors causing this disease are immunological disorders and the compromised epidermal barrier integrity. Pruritus, intense itching, psychological stress, deprived physical and mental performance and sleep disturbance are the hallmark features of this dermatological complication. Preventive interventions which include educational programs, avoidance of allergens, exclusive care towards skin, and the rational selection of therapeutic regimen play key roles in the treatment of dermatosis. In last two decades, it is evident from a plethora of studies that scientific focus is being driven from conventional therapies to the advanced nanocarrier-based regimen for an effective management of AD. These nanocarriers which include polymeric nanoparticles (NPs), hydrogel NPs, liposomes, ethosomes, solid lipid nanoparticles (SLNs) and nanoemulsion, provide efficient roles for the target specific delivery of the therapeutic payload. The success of these targeted therapies is due to their pharmaceutical versatility, longer retention time at the target site, avoiding off-target effects and preventing premature degradation of the incorporated drugs. The present review was therefore aimed to summarise convincing evidence for the therapeutic superiority of advanced nanocarrier-mediated strategies over the conventional therapies used in the treatment of AD. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. The Progression of Podcasting/Vodcasting in a Technical Physics Class

    NASA Astrophysics Data System (ADS)

    Glanville, Y. J.

    2010-11-01

    Technology such as Microsoft PowerPoint presentations, clickers, podcasting, and learning management suites is becoming prevalent in classrooms. Instructors are using these media in both large lecture hall settings and small classrooms with just a handful of students. Traditionally, each of these media is instructor driven. For instance, podcasting (audio recordings) provided my technical physics course with supplemental notes to accompany a traditional algebra-based physics lecture. Podcasting is an ideal tool for this mode of instruction, but podcasting/vodcasting is also an ideal technique for student projects and student-driven learning. I present here the various podcasting/vodcasting projects my students and I have undertaken over the last few years.

  5. IRON OPTIMIZATION FOR FENTON-DRIVEN OXIDATION OF MTBE-SPENT GRANULAR ACTIVATED CARBON

    EPA Science Inventory

    Fenton-driven chemical regeneration of granular activated carbon (GAC) is accomplished through the addition of H2O2 and iron (Fe) to spent GAC. The overall objective of this treatment process is to transform target contaminants into less toxic byproducts, re-establish the sorpti...

  6. High-Flux Neutron Generator Facility for Geochronology and Nuclear Physics Research

    NASA Astrophysics Data System (ADS)

    Waltz, Cory; HFNG Collaboration

    2015-04-01

    A facility based on a next-generation, high-flux D-D neutron generator (HFNG) is being commissioned at UC Berkeley. The generator is designed to produce monoenergetic 2.45 MeV neutrons at outputs exceeding 1011 n/s. The HFNG is designed around two RF-driven multi-cusp ion sources that straddle a titanium-coated copper target. D + ions, accelerated up to 150 keV from the ion sources, self-load the target and drive neutron generation through the d(d,n)3 He fusion reaction. A well-integrated cooling system is capable of handling beam power reaching 120 kW impinging on the target. The unique design of the HFNG target permits experimental samples to be placed inside the target volume, allowing the samples to receive the highest neutron flux (1011 cm-2 s-1) possible from the generator. In addition, external beams of neutrons will be available simultaneously, ranging from thermal to 2.45 MeV. Achieving the highest neutron yields required carefully designed schemes to mitigate back-streaming of high energy electrons liberated from the cathode target by deuteron bombardment. The proposed science program is focused on pioneering advances in the 40 Ar/39 Ar dating technique for geochronology, new nuclear data measurements, basic nuclear science, and education. An end goal is to become a user facility for researchers. This work is supported by NSF Grant No. EAR-0960138, U.S. DOE LBNL Contract No. DE-AC02-05CH11231, U.S. DOE LLNL Contract No. DE-AC52-07NA27344, and UC Office of the President Award 12-LR-238745.

  7. Dominance of hole-boring radiation pressure acceleration regime with thin ribbon of ionized solid hydrogen

    NASA Astrophysics Data System (ADS)

    Psikal, J.; Matys, M.

    2018-04-01

    Laser-driven proton acceleration from novel cryogenic hydrogen target of the thickness of tens of microns irradiated by multiPW laser pulse is investigated here for relevant laser parameters accessible in near future. It is demonstrated that the efficiency of proton acceleration from relatively thick hydrogen solid ribbon largely exceeds the acceleration efficiency for a thinner ionized plastic foil, which can be explained by enhanced hole boring (HB) driven by laser ponderomotive force in the case of light ions and lower target density. Three-dimensional particle-in-cell (PIC) simulations of laser pulse interaction with relatively thick hydrogen target show larger energies of protons accelerated in the target interior during the HB phase and reduced energies of protons accelerated from the rear side of the target by quasistatic electric field compared with the results obtained from two-dimensional PIC calculations. Linearly and circularly polarized multiPW laser pulses of duration exceeding 100 fs show similar performance in terms of proton acceleration from both the target interior as well as from the rear side of the target. When ultrashort pulse (∼30 fs) is assumed, the number of accelerated protons from the target interior is substantially reduced.

  8. Beyond synergies. Comment on "Hand synergies: Integration of robotics and neuroscience for understanding the control of biological and artificial hands" by Marco Santello et al.

    NASA Astrophysics Data System (ADS)

    Schwartz, Andrew B.

    2016-07-01

    The target paper by Santello et al. [1] uses the observation that hand shape during grasping can be described by a small set of basic postures, or ;synergies,; to describe the possible neural basis of motor control during this complex behavior. In the literature, the term ;synergy; has been used with a number of different meanings and is still loosely defined, making it difficult to derive concrete analogs of corresponding neural structure. Here, I will define ;synergy; broadly, as a set of parameters bound together by a pattern of correlation. With this definition, it can be argued that behavioral synergies are just one facet of the correlational structuring used by the brain to generate behavior. As pointed out in the target article, the structure found in synergies is driven by the physical constraints of our bodies and our surroundings, combined with the behavioral control imparted by our nervous system. This control itself is based on correlational structure which is likely to be a fundamental property of brain function.

  9. Measuring the temperature history of isochorically heated warm dense metals

    NASA Astrophysics Data System (ADS)

    McGuffey, Chris; Kim, J.; Park, J.; Moody, J.; Emig, J.; Heeter, B.; Dozieres, M.; Beg, Fn; McLean, Hs

    2017-10-01

    A pump-probe platform has been designed for soft X-ray absorption spectroscopy near edge structure measurements in isochorically heated Al or Cu samples with temperature of 10s to 100s of eV. The method is compatible with dual picosecond-class laser systems and may be used to measure the temperature of the sample heated directly by the pump laser or by a laser-driven proton beam Knowledge of the temperature history of warm dense samples will aid equation of state measurements. First, various low- to mid-Z targets were evaluated for their suitability as continuum X-ray backlighters over the range 200-1800 eV using a 10 J picosecond-class laser with relativistic peak intensity Alloys were found to be more suitable than single-element backlighters. Second, the heated sample package was designed with consideration of target thickness and tamp layers using atomic physics codes. The results of the first demonstration attempts will be presented. This work was supported by the U.S. DOE under Contract No. DE-SC0014600.

  10. Molecular pathways: targeting RAC-p21-activated serine-threonine kinase signaling in RAS-driven cancers.

    PubMed

    Baker, Nicole M; Yee Chow, Hoi; Chernoff, Jonathan; Der, Channing J

    2014-09-15

    Cancers driven by oncogenic Ras proteins encompass some of the most deadly human cancer types, and there is a pressing need to develop therapies for these diseases. Although recent studies suggest that mutant Ras proteins may yet be druggable, the most promising and advanced efforts involve inhibitors of Ras effector signaling. Most efforts to target Ras signaling have been aimed at the ERK mitogen-activated protein kinase and the phosphoinositide 3-kinase signaling networks. However, to date, no inhibitors of these Ras effector pathways have been effective against RAS-mutant cancers. This ineffectiveness is due, in part, to the involvement of additional effectors in Ras-dependent cancer growth, such as the Rac small GTPase and the p21-activated serine-threonine kinases (PAK). PAK proteins are involved in many survival, cell motility, and proliferative pathways in the cell and may present a viable new target in Ras-driven cancers. In this review, we address the role and therapeutic potential of Rac and group I PAK proteins in driving mutant Ras cancers. ©2014 American Association for Cancer Research.

  11. Dynamic control of laser driven proton beams by exploiting self-generated, ultrashort electromagnetic pulses

    NASA Astrophysics Data System (ADS)

    Kar, S.; Ahmed, H.; Nersisyan, G.; Brauckmann, S.; Hanton, F.; Giesecke, A. L.; Naughton, K.; Willi, O.; Lewis, C. L. S.; Borghesi, M.

    2016-05-01

    As part of the ultrafast charge dynamics initiated by high intensity laser irradiations of solid targets, high amplitude EM pulses propagate away from the interaction point and are transported along any stalks and wires attached to the target. The propagation of these high amplitude pulses along a thin wire connected to a laser irradiated target was diagnosed via the proton radiography technique, measuring a pulse duration of ˜20 ps and a pulse velocity close to the speed of light. The strong electric field associated with the EM pulse can be exploited for controlling dynamically the proton beams produced from a laser-driven source. Chromatic divergence control of broadband laser driven protons (upto 75% reduction in divergence of >5 MeV protons) was obtained by winding the supporting wire around the proton beam axis to create a helical coil structure. In addition to providing focussing and energy selection, the technique has the potential to post-accelerate the transiting protons by the longitudinal component of the curved electric field lines produced by the helical coil lens.

  12. Dynamic control of laser driven proton beams by exploiting self-generated, ultrashort electromagnetic pulses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kar, S., E-mail: s.kar@qub.ac.uk; Ahmed, H.; Nersisyan, G.

    As part of the ultrafast charge dynamics initiated by high intensity laser irradiations of solid targets, high amplitude EM pulses propagate away from the interaction point and are transported along any stalks and wires attached to the target. The propagation of these high amplitude pulses along a thin wire connected to a laser irradiated target was diagnosed via the proton radiography technique, measuring a pulse duration of ∼20 ps and a pulse velocity close to the speed of light. The strong electric field associated with the EM pulse can be exploited for controlling dynamically the proton beams produced from amore » laser-driven source. Chromatic divergence control of broadband laser driven protons (upto 75% reduction in divergence of >5 MeV protons) was obtained by winding the supporting wire around the proton beam axis to create a helical coil structure. In addition to providing focussing and energy selection, the technique has the potential to post-accelerate the transiting protons by the longitudinal component of the curved electric field lines produced by the helical coil lens.« less

  13. Dense blocks of energetic ions driven by multi-petawatt lasers

    PubMed Central

    Weng, S. M.; Liu, M.; Sheng, Z. M.; Murakami, M.; Chen, M.; Yu, L. L.; Zhang, J.

    2016-01-01

    Laser-driven ion accelerators have the advantages of compact size, high density, and short bunch duration over conventional accelerators. Nevertheless, it is still challenging to simultaneously enhance the yield and quality of laser-driven ion beams for practical applications. Here we propose a scheme to address this challenge via the use of emerging multi-petawatt lasers and a density-modulated target. The density-modulated target permits its ions to be uniformly accelerated as a dense block by laser radiation pressure. In addition, the beam quality of the accelerated ions is remarkably improved by embedding the target in a thick enough substrate, which suppresses hot electron refluxing and thus alleviates plasma heating. Particle-in-cell simulations demonstrate that almost all ions in a solid-density plasma of a few microns can be uniformly accelerated to about 25% of the speed of light by a laser pulse at an intensity around 1022 W/cm2. The resulting dense block of energetic ions may drive fusion ignition and more generally create matter with unprecedented high energy density. PMID:26924793

  14. DDB1-Mediated CRY1 Degradation Promotes FOXO1-Driven Gluconeogenesis in Liver.

    PubMed

    Tong, Xin; Zhang, Deqiang; Charney, Nicholas; Jin, Ethan; VanDommelen, Kyle; Stamper, Kenneth; Gupta, Neil; Saldate, Johnny; Yin, Lei

    2017-10-01

    Targeted protein degradation through ubiquitination is an important step in the regulation of glucose metabolism. Here, we present evidence that the DDB1-CUL4A ubiquitin E3 ligase functions as a novel metabolic regulator that promotes FOXO1-driven hepatic gluconeogenesis. In vivo, hepatocyte-specific Ddb1 deletion leads to impaired hepatic gluconeogenesis in the mouse liver but protects mice from high-fat diet-induced hyperglycemia. Lack of Ddb1 downregulates FOXO1 protein expression and impairs FOXO1-driven gluconeogenic response. Mechanistically, we discovered that DDB1 enhances FOXO1 protein stability via degrading the circadian protein cryptochrome 1 (CRY1), a known target of DDB1 E3 ligase. In the Cry1 depletion condition, insulin fails to reduce the nuclear FOXO1 abundance and suppress gluconeogenic gene expression. Chronic depletion of Cry1 in the mouse liver not only increases FOXO1 protein but also enhances hepatic gluconeogenesis. Thus, we have identified the DDB1-mediated CRY1 degradation as an important target of insulin action on glucose homeostasis. © 2017 by the American Diabetes Association.

  15. The fiber walk: a model of tip-driven growth with lateral expansion.

    PubMed

    Bucksch, Alexander; Turk, Greg; Weitz, Joshua S

    2014-01-01

    Tip-driven growth processes underlie the development of many plants. To date, tip-driven growth processes have been modeled as an elongating path or series of segments, without taking into account lateral expansion during elongation. Instead, models of growth often introduce an explicit thickness by expanding the area around the completed elongated path. Modeling expansion in this way can lead to contradictions in the physical plausibility of the resulting surface and to uncertainty about how the object reached certain regions of space. Here, we introduce fiber walks as a self-avoiding random walk model for tip-driven growth processes that includes lateral expansion. In 2D, the fiber walk takes place on a square lattice and the space occupied by the fiber is modeled as a lateral contraction of the lattice. This contraction influences the possible subsequent steps of the fiber walk. The boundary of the area consumed by the contraction is derived as the dual of the lattice faces adjacent to the fiber. We show that fiber walks generate fibers that have well-defined curvatures, and thus enable the identification of the process underlying the occupancy of physical space. Hence, fiber walks provide a base from which to model both the extension and expansion of physical biological objects with finite thickness.

  16. The Fiber Walk: A Model of Tip-Driven Growth with Lateral Expansion

    PubMed Central

    Bucksch, Alexander; Turk, Greg; Weitz, Joshua S.

    2014-01-01

    Tip-driven growth processes underlie the development of many plants. To date, tip-driven growth processes have been modeled as an elongating path or series of segments, without taking into account lateral expansion during elongation. Instead, models of growth often introduce an explicit thickness by expanding the area around the completed elongated path. Modeling expansion in this way can lead to contradictions in the physical plausibility of the resulting surface and to uncertainty about how the object reached certain regions of space. Here, we introduce fiber walks as a self-avoiding random walk model for tip-driven growth processes that includes lateral expansion. In 2D, the fiber walk takes place on a square lattice and the space occupied by the fiber is modeled as a lateral contraction of the lattice. This contraction influences the possible subsequent steps of the fiber walk. The boundary of the area consumed by the contraction is derived as the dual of the lattice faces adjacent to the fiber. We show that fiber walks generate fibers that have well-defined curvatures, and thus enable the identification of the process underlying the occupancy of physical space. Hence, fiber walks provide a base from which to model both the extension and expansion of physical biological objects with finite thickness. PMID:24465607

  17. Electron-rich driven electrochemical solid-state amorphization in Li-Si alloys.

    PubMed

    Wang, Zhiguo; Gu, Meng; Zhou, Yungang; Zu, Xiaotao; Connell, Justin G; Xiao, Jie; Perea, Daniel; Lauhon, Lincoln J; Bang, Junhyeok; Zhang, Shengbai; Wang, Chongmin; Gao, Fei

    2013-09-11

    The physical and chemical behaviors of materials used in energy storage devices, such as lithium-ion batteries (LIBs), are mainly controlled by an electrochemical process, which normally involves insertion/extraction of ions into/from a host lattice with a concurrent flow of electrons to compensate charge balance. The fundamental physics and chemistry governing the behavior of materials in response to the ions insertion/extraction is not known. Herein, a combination of in situ lithiation experiments and large-scale ab initio molecular dynamics simulations are performed to explore the mechanisms of the electrochemically driven solid-state amorphization in Li-Si systems. We find that local electron-rich condition governs the electrochemically driven solid-state amorphization of Li-Si alloys. This discovery provides the fundamental explanation of why lithium insertion in semiconductor and insulators leads to amorphization, whereas in metals, it leads to a crystalline alloy. The present work correlates electrochemically driven reactions with ion insertion, electron transfer, lattice stability, and phase equilibrium.

  18. Electron-Rich Driven Electrochemical Solid-State Amorphization in Li-Si Alloys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Zhiguo; Gu, Meng; Zhou, Yungang

    2013-08-14

    The physical and chemical behaviors of materials used in energy storage devices, such as lithium-ion batteries (LIBs), are mainly controlled by an electrochemical process, which normally involves insertion/extraction of ions into/from a host lattice with a concurrent flow of electrons to compensate charge balance. The fundamental physics and chemistry governing the behavior of materials in response to the ions insertion/extraction is not known. Herein, a combination of in situ lithiation experiments and large-scale ab initio molecular dynamics simulations are performed to explore the mechanisms of the electrochemically driven solid-state amorphization in Li-Si systems. We find that local electron-rich condition governsmore » the electrochemically driven solid-state amorphization of Li-Si alloys. This discovery provides the fundamental explanation of why lithium insertion in semiconductor and insulators leads to amorphization, whereas in metals, it leads to a crystalline alloy. The present work correlates electrochemically driven reactions with ion insertion, electron transfer, lattice stability and phase equilibrium.« less

  19. Modulation of auditory spatial attention by visual emotional cues: differential effects of attentional engagement and disengagement for pleasant and unpleasant cues.

    PubMed

    Harrison, Neil R; Woodhouse, Rob

    2016-05-01

    Previous research has demonstrated that threatening, compared to neutral pictures, can bias attention towards non-emotional auditory targets. Here we investigated which subcomponents of attention contributed to the influence of emotional visual stimuli on auditory spatial attention. Participants indicated the location of an auditory target, after brief (250 ms) presentation of a spatially non-predictive peripheral visual cue. Responses to targets were faster at the location of the preceding visual cue, compared to at the opposite location (cue validity effect). The cue validity effect was larger for targets following pleasant and unpleasant cues compared to neutral cues, for right-sided targets. For unpleasant cues, the crossmodal cue validity effect was driven by delayed attentional disengagement, and for pleasant cues, it was driven by enhanced engagement. We conclude that both pleasant and unpleasant visual cues influence the distribution of attention across modalities and that the associated attentional mechanisms depend on the valence of the visual cue.

  20. Coronal and Heliospheric Impacts of Reconnection-driven Coronal-Hole Jets, and Implications for Plume Formation

    NASA Astrophysics Data System (ADS)

    Karpen, J. T.; DeVore, C. R.; Antiochos, S. K.

    2016-12-01

    Jets from coronal holes on the Sun have been observed for decades, but the physical mechanism responsible for these events is still debated. An important clue about their origin lies in their association with small intrusions of minority polarity within the large-scale open magnetic field, strongly suggesting that these jets are powered by interchange reconnection between embedded bipoles (closed flux) and the surrounding open flux (Antiochos 1996). Through computational investigations of this embedded-bipole paradigm, we have demonstrated that energetic, collimated, Alfvénic flows can be driven by explosive reconnection between twisted closed flux of the minority polarity and the unstressed external field (e.g., Pariat et al. 2009, 2010, 2015, 2016). Our recent numerical study (Karpen et al. 2016) explored the dynamics and energetics of this process under the more realistic conditions of spherical geometry, solar gravity, and an isothermal solar wind out to 9 Rsun. We present results of an extension of this simulation to 30 Rsun, which allows us to predict observable signatures within the orbit of Solar Probe Plus (see Roberts et al. 2016, this meeting). Coronal-hole jets also have been implicated in the formation and maintenance of plumes (e.g., Raouafi & Stenborg 2014), but the physical relationship between the transient, narrow jets and the diffuse, longer-lived plumes is far from understood. To address this question, we analyze the mass density enhancements and fluctuations from the Sun to the inner heliosphere, driven by both slow and explosive reconnection in the embedded-bipole scenario and the associated nonlinear Alfvén wave. Our preliminary results indicate that a substantial ( 20%) density increase over background appears at the moving location of the wave front as far as 12 Rsun. We present the full spatial extent and temporal evolution of mass and momentum after reconnection onset, as well as synthetic coronagraph images of the perturbed corona and inner heliosphere, for comparison with AIA/SDO, LASCO/SOHO, and SECCHI/STEREO observations of jets and plumes. Our goal is to determine the contribution of individual reconnection-driven jets to a plume. This research was supported by NASA's Living With a Star Targeted Research and Technology and Heliophysics Supporting Research programs.

  1. High density laser-driven target

    DOEpatents

    Lindl, John D.

    1981-01-01

    A high density target for implosion by laser energy composed of a central quantity of fuel surrounded by a high-Z pusher shell with a low-Z ablator-pusher shell spaced therefrom forming a region filled with low-density material.

  2. The magnetically driven plasma jet produces a pressure of 33 GPa on PTS

    NASA Astrophysics Data System (ADS)

    Xu, Qiang; Dan, Jiakun; Wang, Guilin; Guo, Shuai; Zhang, Siqun; Cai, Hongchun; Ren, Xiao; Wang, Kunlun; Zhou, Shaotong; Zhang, Zhaohui; Huang, Xianbin

    2017-01-01

    We report on experiments in which a magnetically driven plasma jet was used to hit a 500 μm thick planar aluminum target. The plasma jet was produced by using a 50 μm thick aluminum radial foil, which was subjected to 4 MA, 90 ns rising time current on the primary test stand pulsed power facility. The subsequent magnetic bubbles propagate with radial velocity reaching 200 km/s and an axial velocity of 230 km/s. After the plasma knocks onto the target, a shock forms in the target. When the shock gets to the backside of the target, we measure the velocity of the moving surface using dual laser heterodyne velocimetry. By using the Hugoniot relations, we know that the plasma jet produced a pressure of 33 GPa. According to the measured pressure and the velocity of the plasma jet, the density of the jet can be also roughly estimated.

  3. Clinical proteomics-driven precision medicine for targeted cancer therapy: current overview and future perspectives.

    PubMed

    Zhou, Li; Wang, Kui; Li, Qifu; Nice, Edouard C; Zhang, Haiyuan; Huang, Canhua

    2016-01-01

    Cancer is a common disease that is a leading cause of death worldwide. Currently, early detection and novel therapeutic strategies are urgently needed for more effective management of cancer. Importantly, protein profiling using clinical proteomic strategies, with spectacular sensitivity and precision, offer excellent promise for the identification of potential biomarkers that would direct the development of targeted therapeutic anticancer drugs for precision medicine. In particular, clinical sample sources, including tumor tissues and body fluids (blood, feces, urine and saliva), have been widely investigated using modern high-throughput mass spectrometry-based proteomic approaches combined with bioinformatic analysis, to pursue the possibilities of precision medicine for targeted cancer therapy. Discussed in this review are the current advantages and limitations of clinical proteomics, the available strategies of clinical proteomics for the management of precision medicine, as well as the challenges and future perspectives of clinical proteomics-driven precision medicine for targeted cancer therapy.

  4. Modifiable risk factors of hypertension: A hospital-based case-control study from Kerala, India.

    PubMed

    Pilakkadavath, Zarin; Shaffi, Muhammed

    2016-01-01

    Hypertension is a major cause of cardiovascular morbidity and mortality in Kerala. Excess dietary salt, low dietary potassium, overweight and obesity, physical inactivity, excess alcohol, smoking, socioeconomic status, psychosocial stressors, and diabetes are considered as modifiable risk factors for hypertension. To estimate and compare the distribution of modifiable risk factors among hypertensive (cases) and nonhypertensive (controls) patients and to estimate the effect relationship of risk factors. Age- and sex-matched case-control study was conducted in a tertiary care hospital in Kerala using a pretested interviewer-administered structured questionnaire based on the WHO STEPS instrument for chronic disease risk factor surveillance. Bivariate and multiple logistic regression analyses were done. A total of 296 subjects were included in the study. The mean age of study sample was 50.13 years. All modifiable risk factors studied vis-ΰ-vis obesity, lack of physical activity, inadequate fruits and vegetable intake, diabetes, smoking, and alcohol use were significantly different in proportion among cases and controls. Obesity, lack of physical activity, smoking, and diabetes were found to be significant risk factors for hypertension after adjusting for other risk factors. Hypertension is strongly driven by a set of modifiable risk factors. Massive public awareness campaign targeting risk factors is essential in controlling hypertension in Kerala, especially focusing on physical exercise and control of diabetes, obesity, and on quitting smoking.

  5. Joint Loads and Cartilage Stress in Intact Joints of Military Transtibial Amputees: Enhancing Quality of Life

    DTIC Science & Technology

    2017-04-01

    crosstalk); analysis of tested subjects underway. 4) Developed analytical methods to obtain knee joint loads using EMG-driven inverse dynamics; analysis of...13/2018. Completion %: 40. Task 1.3: EMG-driven inverse dynamic (ID) analyses with OpenSim for amputee and control group subjects. Target date: 1...predicted by EMG-driven inverse dynamics. Two-three conference papers are being prepared for submission in February 2017. Other achievements. None

  6. Science Goal Driven Observing: A Step Towards Maximizing Science Returns and Spacecraft Autonomy

    NASA Technical Reports Server (NTRS)

    Koratkar, Anuradha; Grosvenor, Sandy; Jones, Jeremy; Memarsadeghi, Nargess; Wolf, Karl

    2002-01-01

    In the coming decade, the drive to increase the scientific returns on capital investment and to reduce costs will force automation to be implemented in many of the scientific tasks that have traditionally been manually overseen. Thus, spacecraft autonomy will become an even greater part of mission operations. While recent missions have made great strides in the ability to autonomously monitor and react to changing health and physical status of spacecraft, little progress has been made in responding quickly to science driven events. The new generation of space-based telescopes/observatories will see deeper, with greater clarity, and they will generate data at an unprecedented rate. Yet, while onboard data processing and storage capability will increase rapidly, bandwidth for downloading data will not increase as fast and can become a significant bottleneck and cost of a science program. For observations of inherently variable targets and targets of opportunity, the ability to recognize early if an observation will not meet the science goals of variability or minimum brightness, and react accordingly, can have a major positive impact on the overall scientific returns of an observatory and on its operational costs. If the observatory can reprioritize the schedule to focus on alternate targets, discard uninteresting observations prior to downloading, or download them at a reduced resolution its overall efficiency will be dramatically increased. We are investigating and developing tools for a science goal monitoring (SGM) system. The SGM will have an interface to help capture higher-level science goals from scientists and translate them into a flexible observing strategy that SGM can execute and monitor. SGM will then monitor the incoming data stream and interface with data processing systems to recognize significant events. When an event occurs, the system will use the science goals given it to reprioritize observations, and react appropriately and/or communicate with ground systems - both human and machine - for confirmation and/or further high priority analyses.

  7. Lifestyle Approaches for People With Intellectual Disabilities: A Systematic Multiple Case Analysis.

    PubMed

    Steenbergen, Henderika Annegien; Van der Schans, Cees P; Van Wijck, Ruud; De Jong, Johan; Waninge, Aly

    2017-11-01

    Health care organizations supporting individuals with intellectual disabilities (IDs) carry out a range of interventions to support and improve a healthy lifestyle. However, it is difficult to implement an active and healthy lifestyle into daily support. The presence of numerous intervention components, multiple levels of influence, and the explicit use of theory are factors that are considered to be essential for implementation in practice. A comprehensive written lifestyle policy provides for sustainability of a lifestyle approach. It is unknown to what extent these crucial factors for successful implementation are taken into consideration by health care organizations supporting this population. To analyze the intervention components, levels of influence, explicit use of theory, and conditions for sustainability of currently used lifestyle interventions within lifestyle approaches aiming at physical activity and nutrition in health care organizations supporting people with ID. In this descriptive multiple case study of 9 health care organizations, qualitative data of the lifestyle approaches with accompanying interventions and their components were compiled with a newly developed online inventory form. From 9 health care organizations, 59 interventions were included, of which 31% aimed to improve physical activity, 10% nutrition, and 59% a combination of both. Most (49%) interventions aimed at the educational component and less at daily (19%) and generic activities (16%) and the evaluation component (16%). Most interventions targeted individuals with ID and the professionals whereas social levels were underrepresented. Although 52% of the interventions were structurally embedded, only 10 of the 59 interventions were theory-driven. Health care organizations could improve their lifestyle approaches by using an explicit theoretical basis by expanding the current focus of the interventions that primarily concentrate on their clients and professionals toward also targeting the social and external environment as well as the introduction of a written lifestyle policy. This policy should encompass all interventions and should be the responsibility of those in the organization working with individuals with ID. In conclusion, comprehensive, integrated, and theory-driven approaches at multiple levels should be promoted. Copyright © 2017 AMDA – The Society for Post-Acute and Long-Term Care Medicine. Published by Elsevier Inc. All rights reserved.

  8. Active Targets For Capacitive Proximity Sensors

    NASA Technical Reports Server (NTRS)

    Jenstrom, Del T.; Mcconnell, Robert L.

    1994-01-01

    Lightweight, low-power active targets devised for use with improved capacitive proximity sensors described in "Capacitive Proximity Sensor Has Longer Range" (GSC-13377), and "Capacitive Proximity Sensors With Additional Driven Shields" (GSC-13475). Active targets are short-distance electrostatic beacons; they generate known alternating electro-static fields used for alignment and/or to measure distances.

  9. Targeting the human epidermal growth factor receptor 2 (HER2) oncogene in colorectal cancer

    PubMed Central

    Siena, S; Sartore-Bianchi, A; Marsoni, S; Hurwitz, H I; McCall, S J; Penault-Llorca, F; Srock, S; Bardelli, A; Trusolino, L

    2018-01-01

    Abstract Human epidermal growth factor receptor 2 (HER2) is an oncogenic driver, and a well-established therapeutic target in breast and gastric cancers. Using functional and genomic analyses of patient-derived xenografts, we previously showed that a subset (approximately 5%) of metastatic colorectal cancer (CRC) tumors is driven by amplification or mutation of HER2. This paper reviews the role of HER2 amplification as an oncogenic driver, a prognostic and predictive biomarker, and a clinically actionable target in CRC, considering the specifics of HER2 testing in this tumor type. While the role of HER2 as a biomarker for prognosis in CRC remains uncertain, its relevance as a therapeutic target has been established. Indeed, independent studies documented substantial clinical benefit in patients treated with biomarker-driven HER2-targeted therapies, with an impact on response rates and duration of response that compared favorably with immunotherapy and other examples of precision oncology. HER2-targeted therapeutic strategies have the potential to change the treatment paradigm for a clinically relevant subgroup of metastatic CRC patients. PMID:29659677

  10. Multiple-Color Optical Activation, Silencing, and Desynchronization of Neural Activity, with Single-Spike Temporal Resolution

    PubMed Central

    Han, Xue; Boyden, Edward S.

    2007-01-01

    The quest to determine how precise neural activity patterns mediate computation, behavior, and pathology would be greatly aided by a set of tools for reliably activating and inactivating genetically targeted neurons, in a temporally precise and rapidly reversible fashion. Having earlier adapted a light-activated cation channel, channelrhodopsin-2 (ChR2), for allowing neurons to be stimulated by blue light, we searched for a complementary tool that would enable optical neuronal inhibition, driven by light of a second color. Here we report that targeting the codon-optimized form of the light-driven chloride pump halorhodopsin from the archaebacterium Natronomas pharaonis (hereafter abbreviated Halo) to genetically-specified neurons enables them to be silenced reliably, and reversibly, by millisecond-timescale pulses of yellow light. We show that trains of yellow and blue light pulses can drive high-fidelity sequences of hyperpolarizations and depolarizations in neurons simultaneously expressing yellow light-driven Halo and blue light-driven ChR2, allowing for the first time manipulations of neural synchrony without perturbation of other parameters such as spiking rates. The Halo/ChR2 system thus constitutes a powerful toolbox for multichannel photoinhibition and photostimulation of virally or transgenically targeted neural circuits without need for exogenous chemicals, enabling systematic analysis and engineering of the brain, and quantitative bioengineering of excitable cells. PMID:17375185

  11. Casein kinase 1α–dependent feedback loop controls autophagy in RAS-driven cancers

    PubMed Central

    Cheong, Jit Kong; Zhang, Fuquan; Chua, Pei Jou; Bay, Boon Huat; Thorburn, Andrew; Virshup, David M.

    2015-01-01

    Activating mutations in the RAS oncogene are common in cancer but are difficult to therapeutically target. RAS activation promotes autophagy, a highly regulated catabolic process that metabolically buffers cells in response to diverse stresses. Here we report that casein kinase 1α (CK1α), a ubiquitously expressed serine/threonine kinase, is a key negative regulator of oncogenic RAS–induced autophagy. Depletion or pharmacologic inhibition of CK1α enhanced autophagic flux in oncogenic RAS–driven human fibroblasts and multiple cancer cell lines. FOXO3A, a master longevity mediator that transcriptionally regulates diverse autophagy genes, was a critical target of CK1α, as depletion of CK1α reduced levels of phosphorylated FOXO3A and increased expression of FOXO3A-responsive genes. Oncogenic RAS increased CK1α protein abundance via activation of the PI3K/AKT/mTOR pathway. In turn, elevated levels of CK1α increased phosphorylation of nuclear FOXO3A, thereby inhibiting transactivation of genes critical for RAS-induced autophagy. In both RAS-driven cancer cells and murine xenograft models, pharmacologic CK1α inactivation synergized with lysosomotropic agents to inhibit growth and promote tumor cell death. Together, our results identify a kinase feedback loop that influences RAS-dependent autophagy and suggest that targeting CK1α-regulated autophagy offers a potential therapeutic opportunity to treat oncogenic RAS–driven cancers. PMID:25798617

  12. Time-dependent, x-ray spectral unfolds and brightness temperatures for intense Li{sup +} ion beam-driven hohlraums

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fehl, D.L.; Chandler, G.A.; Biggs, F.

    X-ray-producing hohlraums are being studied as indirect drives for inertial confinement fusion targets. In a 1994 target series on the PBFAII accelerator, cylindrical hohlraum targets were heated by an intense Li{sup +} ion beam and viewed by an array of 13 time-resolved, filtered x-ray detectors (XRDs). The unfold operator (UFO) code and its suite of auxiliary functions were used extensively in obtaining time-resolved x-ray spectra and radiation temperatures from this diagnostic. The UFO was also used to obtain fitted response functions from calibration data, to simulate data from blackbody x-ray spectra of interest, to determine the suitability of various unfoldingmore » parameters (e.g., energy domain, energy partition, smoothing conditions, and basis functions), to interpolate the XRD signal traces, and to unfold experimental data. The simulation capabilities of the code were useful in understanding an anomalous feature in the unfolded spectra at low photon energies ({le}100 eV). Uncertainties in the differential and energy-integrated unfolded spectra were estimated from uncertainties in the data. The time{endash}history of the radiation temperature agreed well with independent calculations of the wall temperature in the hohlraum. {copyright} {ital 1997 American Institute of Physics.}« less

  13. Progress in Fast Ignition Studies with Electrons and Protons

    NASA Astrophysics Data System (ADS)

    MacKinnon, A. J.; Akli, K. U.; Bartal, T.; Beg, F. N.; Chawla, S.; Chen, C. D.; Chen, H.; Chen, S.; Chowdhury, E.; Fedosejevs, R.; Freeman, R. R.; Hey, D.; Higginson, D.; Key, M. H.; King, J. A.; Link, A.; Ma, T.; MacPhee, A. G.; Offermann, D.; Ovchinnikov, V.; Pasley, J.; Patel, P. K.; Ping, Y.; Schumacher, D. W.; Stephens, R. B.; Tsui, Y. Y.; Wei, M. S.; Van Woerkom, L. D.

    2009-09-01

    Isochoric heating of inertially confined fusion plasmas by laser driven MeV electrons or protons is an area of great topical interest in the inertial confinement fusion community, particularly with respect to the fast ignition (FI) concept for initiating burn in a fusion capsule. In order to investigate critical aspects needed for a FI point design, experiments were performed to study 1) laser-to-electrons or protons conversion issues and 2) laser-cone interactions including prepulse effects. A large suite of diagnostics was utilized to study these important parameters. Using cone—wire surrogate targets it is found that pre-pulse levels on medium scale lasers such as Titan at Lawrence Livermore National Laboratory produce long scale length plasmas that strongly effect coupling of the laser to FI relevant electrons inside cones. The cone wall thickness also affects coupling to the wire. Conversion efficiency to protons has also been measured and modeled as a function of target thickness, material. Conclusions from the proton and electron source experiments will be presented. Recent advances in modeling electron transport and innovative target designs for reducing igniter energy and increasing gain curves will also be discussed. In conclusion, a program of study will be presented based on understanding the fundamental physics of the electron or proton source relevant to FI.

  14. A geophysical shock and air blast simulator at the National Ignition Facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fournier, K. B.; Brown, C. G.; May, M. J.

    2014-09-15

    The energy partitioning energy coupling experiments at the National Ignition Facility (NIF) have been designed to measure simultaneously the coupling of energy from a laser-driven target into both ground shock and air blast overpressure to nearby media. The source target for the experiment is positioned at a known height above the ground-surface simulant and is heated by four beams from the NIF. The resulting target energy density and specific energy are equal to those of a low-yield nuclear device. The ground-shock stress waves and atmospheric overpressure waveforms that result in our test system are hydrodynamically scaled analogs of full-scale seismicmore » and air blast phenomena. This report summarizes the development of the platform, the simulations, and calculations that underpin the physics measurements that are being made, and finally the data that were measured. Agreement between the data and simulation of the order of a factor of two to three is seen for air blast quantities such as peak overpressure. Historical underground test data for seismic phenomena measured sensor displacements; we measure the stresses generated in our ground-surrogate medium. We find factors-of-a-few agreement between our measured peak stresses and predictions with modern geophysical computer codes.« less

  15. A geophysical shock and air blast simulator at the National Ignition Facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fournier, K. B.; Brown, C. G.; May, M. J.

    2014-09-01

    The energy partitioning energy coupling experiments at the National Ignition Facility (NIF) have been designed to measure simultaneously the coupling of energy from a laser-driven target into both ground shock and air blast overpressure to nearby media. The source target for the experiment is positioned at a known height above the ground-surface simulant and is heated by four beams from the NIF. The resulting target energy density and specific energy are equal to those of a low-yield nuclear device. The ground-shock stress waves and atmospheric overpressure waveforms that result in our test system are hydrodynamically scaled analogs of full-scale seismicmore » and air blast phenomena. This report summarizes the development of the platform, the simulations, and calculations that underpin the physics measurements that are being made, and finally the data that were measured. Agreement between the data and simulation of the order of a factor of two to three is seen for air blast quantities such as peak overpressure. Historical underground test data for seismic phenomena measured sensor displacements; we measure the stresses generated in our ground-surrogate medium. We find factors-of-a-few agreement between our measured peak stresses and predictions with modern geophysical computer codes.« less

  16. Dynamics of laser-driven proton beam focusing and transport into solid density matter

    NASA Astrophysics Data System (ADS)

    Kim, J.; McGuffey, C.; Beg, F.; Wei, M.; Mariscal, D.; Chen, S.; Fuchs, J.

    2016-10-01

    Isochoric heating and local energy deposition capabilities make intense proton beams appealing for studying high energy density physics and the Fast Ignition of inertial confinement fusion. To study proton beam focusing that results in high beam density, experiments have been conducted using different target geometries irradiated by a kilojoule, 10 ps pulse of the OMEGA EP laser. The beam focus was measured by imaging beam-induced Cu K-alpha emission on a Cu foil that was positioned at a fixed distance. Compared to a free target, structured targets having shapes of wedge and cone show a brighter and narrower K-alpha radiation emission spot on a Cu foil indicating higher beam focusability. Experimentally observed images with proton radiography demonstrate the existence of transverse fields on the structures. Full-scale simulations including the contribution of a long pulse duration of the laser confirm that such fields can be caused by hot electrons moving through the structures. The simulated fields are strong enough to reflect the diverging main proton beam and pinch a transverse probe beam. Detailed simulation results including the beam focusing and transport of the focused intense proton beam in Cu foil will be presented. This work was supported by the National Laser User Facility Program through Award DE-NA0002034.

  17. Magnetized Target Fusion Driven by Plasma Liners

    NASA Technical Reports Server (NTRS)

    Thio, Y. C. Francis; Kirkpatrick, Ronald C.; Knapp, Charles E.; Rodgers, Stephen L. (Technical Monitor)

    2002-01-01

    Magnetized target fusion is an emerging, relatively unexplored approach to fusion for electrical power and propulsion application. The physical principles of the concept are founded upon both inertial confinement fusion (ICF) and magnetic confinement fusion (MCF). It attempts to combine the favorable attributes of both these orthogonal approaches to fusion, but at the same time, avoiding the extreme technical challenges of both by exploiting a fusion regime intermediate between them. It uses a material liner to compress, heat and contain the fusion reacting plasma (the target plasma) mentally. By doing so, the fusion burn could be made to occur at plasma densities as high as six orders of magnitude higher than conventional MCF such as tokamak, thus leading to an approximately three orders of magnitude reduction in the plasma energy required for ignition. It also uses a transient magnetic field, compressed to extremely high intensity (100's T to 1000T) in the target plasma, to slow down the heat transport to the liner and to increase the energy deposition of charged-particle fusion products. This has several compounding beneficial effects. It leads to longer energy confinement time compared with conventional ICF without magnetized target, and thus permits the use of much lower plasma density to produce reasonable burn-up fraction. The compounding effects of lower plasma density and the magneto-insulation of the target lead to greatly reduced compressional heating power on the target. The increased energy deposition rate of charged-particle fusion products also helps to lower the energy threshold required for ignition and increasing the burn-up fraction. The reduction in ignition energy and the compressional power compound to lead to reduced system size, mass and R&D cost. It is a fusion approach that has an affordable R&D pathway, and appears attractive for propulsion application in the nearer term.

  18. Energy deposition and neutron flux study in a gravity-driven dense granular target (DGT) with GEANT4 toolkit

    NASA Astrophysics Data System (ADS)

    Zhao, Qiang; Cui, Wenjuan; He, Zhiyong; Zhang, Xueying; Ma, Wenjing

    2018-07-01

    China initiative Accelerator Driven System (CiADS) has been approved as a strategic plan to build an ADS demonstration facility in the next few years. It proposed a new concept for a high-power spallation target: the gravity-driven dense granular target (DGT). As the same with a monolithic target (MT), both solid and liquid target, energy deposition and neutron flux are two critical issues. In this paper, we focus on these two issues and long for some valuable results for the project. Unlike a solid target, the internal geometry structure of a DGT is very complicated. To be as much as closer with the reality, we designed an algorithm and firstly packed the grains randomly in a cylindrical container in GEANT4 software. The packing result was in great agreement with the experimentally measured results. It shows that the algorithm is practicable. In the next step, all the simulations about energy deposition and neutron flux of a DGT were performed with the GEANT4 codes, and the results were compared with the data of a MT. Compared to a MT, a DGT has inarguable advantages in both terms of energy deposition and neutron flux. In addition, the simulations with different radius of grains were also performed. Finally, we found that both the energy deposition and neutron flux are nearly irrelevant to the radius of the grains in the range of 0.5 mm-5 mm when the packing density is same by analyzing the results meticulously.

  19. 28 CFR 35.104 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... identity disorders not resulting from physical impairments, or other sexual behavior disorders; (ii... illegal use of drugs, when the public entity acts on the basis of such use. Other power-driven mobility... means a manually-operated or power-driven device designed primarily for use by an individual with a...

  20. 28 CFR 35.104 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... identity disorders not resulting from physical impairments, or other sexual behavior disorders; (ii... illegal use of drugs, when the public entity acts on the basis of such use. Other power-driven mobility... means a manually-operated or power-driven device designed primarily for use by an individual with a...

  1. 28 CFR 35.104 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... identity disorders not resulting from physical impairments, or other sexual behavior disorders; (ii... illegal use of drugs, when the public entity acts on the basis of such use. Other power-driven mobility... means a manually-operated or power-driven device designed primarily for use by an individual with a...

  2. 28 CFR 35.104 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... identity disorders not resulting from physical impairments, or other sexual behavior disorders; (ii... illegal use of drugs, when the public entity acts on the basis of such use. Other power-driven mobility... means a manually-operated or power-driven device designed primarily for use by an individual with a...

  3. Synchronizing the tracking eye movements with the motion of a visual target: Basic neural processes.

    PubMed

    Goffart, Laurent; Bourrelly, Clara; Quinet, Julie

    2017-01-01

    In primates, the appearance of an object moving in the peripheral visual field elicits an interceptive saccade that brings the target image onto the foveae. This foveation is then maintained more or less efficiently by slow pursuit eye movements and subsequent catch-up saccades. Sometimes, the tracking is such that the gaze direction looks spatiotemporally locked onto the moving object. Such a spatial synchronism is quite spectacular when one considers that the target-related signals are transmitted to the motor neurons through multiple parallel channels connecting separate neural populations with different conduction speeds and delays. Because of the delays between the changes of retinal activity and the changes of extraocular muscle tension, the maintenance of the target image onto the fovea cannot be driven by the current retinal signals as they correspond to past positions of the target. Yet, the spatiotemporal coincidence observed during pursuit suggests that the oculomotor system is driven by a command estimating continuously the current location of the target, i.e., where it is here and now. This inference is also supported by experimental perturbation studies: when the trajectory of an interceptive saccade is experimentally perturbed, a correction saccade is produced in flight or after a short delay, and brings the gaze next to the location where unperturbed saccades would have landed at about the same time, in the absence of visual feedback. In this chapter, we explain how such correction can be supported by previous visual signals without assuming "predictive" signals encoding future target locations. We also describe the basic neural processes which gradually yield the synchronization of eye movements with the target motion. When the process fails, the gaze is driven by signals related to past locations of the target, not by estimates to its upcoming locations, and a catch-up is made to reinitiate the synchronization. © 2017 Elsevier B.V. All rights reserved.

  4. Can We Practically Bring Physics-based Modeling Into Operational Analytics Tools?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Granderson, Jessica; Bonvini, Marco; Piette, Mary Ann

    We present that analytics software is increasingly used to improve and maintain operational efficiency in commercial buildings. Energy managers, owners, and operators are using a diversity of commercial offerings often referred to as Energy Information Systems, Fault Detection and Diagnostic (FDD) systems, or more broadly Energy Management and Information Systems, to cost-effectively enable savings on the order of ten to twenty percent. Most of these systems use data from meters and sensors, with rule-based and/or data-driven models to characterize system and building behavior. In contrast, physics-based modeling uses first-principles and engineering models (e.g., efficiency curves) to characterize system and buildingmore » behavior. Historically, these physics-based approaches have been used in the design phase of the building life cycle or in retrofit analyses. Researchers have begun exploring the benefits of integrating physics-based models with operational data analytics tools, bridging the gap between design and operations. In this paper, we detail the development and operator use of a software tool that uses hybrid data-driven and physics-based approaches to cooling plant FDD and optimization. Specifically, we describe the system architecture, models, and FDD and optimization algorithms; advantages and disadvantages with respect to purely data-driven approaches; and practical implications for scaling and replicating these techniques. Finally, we conclude with an evaluation of the future potential for such tools and future research opportunities.« less

  5. Enrichment Clusters: A Practical Plan for Real-World, Student-Driven Learning.

    ERIC Educational Resources Information Center

    Renzulli, Joseph S.; Gentry, Marcia; Reis, Sally M.

    This guidebook provides a rationale and guidelines for implementing a student-driven learning approach using enrichment clusters. Enrichment clusters allow students who share a common interest to meet each week to produce a product, performance, or targeted service based on that common interest. Chapter 1 discusses different models of learning.…

  6. Teachers' Response to Curriculum Change: Balancing External and Internal Change Forces

    ERIC Educational Resources Information Center

    Mellegård, Ingebjørg; Pettersen, Karin Dahlberg

    2016-01-01

    The present study investigates teachers' perceptions of curriculum change targeting the expanded freedom teachers were given as curriculum developers in the implementation process of the 2006 school reform in Norway. The new curriculum marks a distinct shift, moving from a content-driven to a learning outcomes-driven curriculum. Policy makers…

  7. Unlearning Overgenerated "Be" through Data-Driven Learning in the Secondary EFL Classroom

    ERIC Educational Resources Information Center

    Moon, Soyeon; Oh, Sun-Young

    2018-01-01

    This paper reports on the cognitive and affective benefits of data-driven learning (DDL), in which Korean EFL learners at the secondary level notice and unlearn their "overgenerated 'be'" by comparing native English-speaker and learner corpora with guided induction. To select the target language item and compile learner-corpus-based…

  8. CFD Analysis and Design of Detailed Target Configurations for an Accelerator-Driven Subcritical System

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraus, Adam; Merzari, Elia; Sofu, Tanju

    2016-08-01

    High-fidelity analysis has been utilized in the design of beam target options for an accelerator driven subcritical system. Designs featuring stacks of plates with square cross section have been investigated for both tungsten and uranium target materials. The presented work includes the first thermal-hydraulic simulations of the full, detailed target geometry. The innovative target cooling manifold design features many regions with complex flow features, including 90 bends and merging jets, which necessitate three-dimensional fluid simulations. These were performed using the commercial computational fluid dynamics code STAR-CCM+. Conjugate heat transfer was modeled between the plates, cladding, manifold structure, and fluid. Steady-statemore » simulations were performed but lacked good residual convergence. Unsteady simulations were then performed, which converged well and demonstrated that flow instability existed in the lower portion of the manifold. It was established that the flow instability had little effect on the peak plate temperatures, which were well below the melting point. The estimated plate surface temperatures and target region pressure were shown to provide sufficient margin to subcooled boiling for standard operating conditions. This demonstrated the safety of both potential target configurations during normal operation.« less

  9. Physics First: Impact on SAT Math Scores

    ERIC Educational Resources Information Center

    Bouma, Craig E.

    2013-01-01

    Improving science, technology, engineering, and mathematics (STEM) education has become a national priority and the call to modernize secondary science has been heard. A Physics First (PF) program with the curriculum sequence of physics, chemistry, and biology (PCB) driven by inquiry- and project-based learning offers a viable alternative to the…

  10. Integrating Undergraduate Students in Faculty-Driven Motor Behavior Research

    ERIC Educational Resources Information Center

    Robinson, Leah E.

    2013-01-01

    This article described the faculty-sponsored, faculty-driven approach to undergraduate research (UGR) at Auburn University. This approach is centered around research in the Pediatric Movement and Physical Activity Laboratory, and students can get elective course credit for their participation in UGR. The article also describes how students' roles…

  11. Active Gaming: The Future of Play?

    ERIC Educational Resources Information Center

    Witherspoon, Lisa; Manning, John P.

    2012-01-01

    The authors examine technology-driven games--especially active gaming--as an evolving form of children's play. They offer an overview of play and its developmental benefits, describe the literature on the emergence of technology-driven play, and reflect on the diminishment of physical play in contemporary culture. They suggest that active gaming,…

  12. Mechanics of interrill erosion with wind-driven rain

    USDA-ARS?s Scientific Manuscript database

    The vector physics of wind-driven rain (WDR) differs from that of wind-free rain, and the interrill soil detachment equations in the Water Erosion Prediction Project (WEPP) model were not originally developed to deal with this phenomenon. This article provides an evaluation of the performance of the...

  13. Damping-free collective oscillations of a driven two-component Bose gas in optical lattices

    NASA Astrophysics Data System (ADS)

    Shchedrin, Gavriil; Jaschke, Daniel; Carr, Lincoln D.

    2018-04-01

    We explore the quantum many-body physics of a driven Bose-Einstein condensate in optical lattices. The laser field induces a gap in the generalized Bogoliubov spectrum proportional to the effective Rabi frequency. The lowest-lying modes in a driven condensate are characterized by zero group velocity and nonzero current. Thus, the laser field induces roton modes, which carry interaction in a driven condensate. We show that collective excitations below the energy of the laser-induced gap remain undamped, while above the gap they are characterized by a significantly suppressed Landau damping rate.

  14. Shock propagation in locally driven granular systems

    NASA Astrophysics Data System (ADS)

    Joy, Jilmy P.; Pathak, Sudhir N.; Das, Dibyendu; Rajesh, R.

    2017-09-01

    We study shock propagation in a system of initially stationary hard spheres that is driven by a continuous injection of particles at the origin. The disturbance created by the injection of energy spreads radially outward through collisions between particles. Using scaling arguments, we determine the exponent characterizing the power-law growth of this disturbance in all dimensions. The scaling functions describing the various physical quantities are determined using large-scale event-driven simulations in two and three dimensions for both elastic and inelastic systems. The results are shown to describe well the data from two different experiments on granular systems that are similarly driven.

  15. Shock propagation in locally driven granular systems.

    PubMed

    Joy, Jilmy P; Pathak, Sudhir N; Das, Dibyendu; Rajesh, R

    2017-09-01

    We study shock propagation in a system of initially stationary hard spheres that is driven by a continuous injection of particles at the origin. The disturbance created by the injection of energy spreads radially outward through collisions between particles. Using scaling arguments, we determine the exponent characterizing the power-law growth of this disturbance in all dimensions. The scaling functions describing the various physical quantities are determined using large-scale event-driven simulations in two and three dimensions for both elastic and inelastic systems. The results are shown to describe well the data from two different experiments on granular systems that are similarly driven.

  16. Design and implementation of an inexpensive target scanner for the growth of thin films by the laser-ablation process

    NASA Astrophysics Data System (ADS)

    Rao, A. M.; Moodera, J. S.

    1991-04-01

    The design of a target scanner that is inexpensive and easy to construct is described. Our target scanner system does not require an expensive personal computer to raster the laser beam uniformily over the target material, unlike the computer driven target scanners that are currently being used in the thin-film industry. The main components of our target scanner comprise a bidirectional motor, a two-position switch, and a standard optical mirror mount.

  17. Cognitive load privileges memory-based over data-driven processing, not group-level over person-level processing.

    PubMed

    Skorich, Daniel P; Mavor, Kenneth I

    2013-09-01

    In the current paper, we argue that categorization and individuation, as traditionally discussed and as experimentally operationalized, are defined in terms of two confounded underlying dimensions: a person/group dimension and a memory-based/data-driven dimension. In a series of three experiments, we unconfound these dimensions and impose a cognitive load. Across the three experiments, two with laboratory-created targets and one with participants' friends as the target, we demonstrate that cognitive load privileges memory-based over data-driven processing, not group- over person-level processing. We discuss the results in terms of their implications for conceptualizations of the categorization/individuation distinction, for the equivalence of person and group processes, for the ultimate 'purpose' and meaningfulness of group-based perception and, fundamentally, for the process of categorization, broadly defined. © 2012 The British Psychological Society.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leistedt, Boris; Hogg, David W., E-mail: boris.leistedt@nyu.edu, E-mail: david.hogg@nyu.edu

    We present a new method for inferring photometric redshifts in deep galaxy and quasar surveys, based on a data-driven model of latent spectral energy distributions (SEDs) and a physical model of photometric fluxes as a function of redshift. This conceptually novel approach combines the advantages of both machine learning methods and template fitting methods by building template SEDs directly from the spectroscopic training data. This is made computationally tractable with Gaussian processes operating in flux–redshift space, encoding the physics of redshifts and the projection of galaxy SEDs onto photometric bandpasses. This method alleviates the need to acquire representative training datamore » or to construct detailed galaxy SED models; it requires only that the photometric bandpasses and calibrations be known or have parameterized unknowns. The training data can consist of a combination of spectroscopic and deep many-band photometric data with reliable redshifts, which do not need to entirely spatially overlap with the target survey of interest or even involve the same photometric bands. We showcase the method on the i -magnitude-selected, spectroscopically confirmed galaxies in the COSMOS field. The model is trained on the deepest bands (from SUBARU and HST ) and photometric redshifts are derived using the shallower SDSS optical bands only. We demonstrate that we obtain accurate redshift point estimates and probability distributions despite the training and target sets having very different redshift distributions, noise properties, and even photometric bands. Our model can also be used to predict missing photometric fluxes or to simulate populations of galaxies with realistic fluxes and redshifts, for example.« less

  19. Brackets, epitopes and flash memory cards: a futuristic view of clinical orthodontics.

    PubMed

    Sims, Milton R

    2017-02-01

    Orthodontics continues to be a profession anchored in traditional technology using appliances that cause inflammatory periodontal ligament (PDL) responses. Existing concepts of biological tooth movement based largely on histological tissue observations and the application of physical principles require major reassessment. In the next millennium, the genome revolution and knowledge of protein production and control could lead to the genetic correction of dentofacial anomalies and pain-free, biomolecular methods of malocclusion correction and long-term stability. A fundamental change is likely to be the abolition of bracket systems and their replacement with preprogrammed microchips driven by computers, and the control of PD[ blood vessels and cells by pharmacological targeting. Future survival of the profession will depend on a radically different specialist who will be educated with a postgraduate curriculum based on molecular biology and computer engineering.

  20. Does Arctic governance hold the key to achieving climate policy targets?

    NASA Astrophysics Data System (ADS)

    Forbis, Robert, Jr.; Hayhoe, Katharine

    2018-02-01

    Arctic feedbacks are increasingly viewed as the wild card in the climate system; but their most unpredictable and potentially dangerous aspect may lie in the human, rather than the physical, response to a warming climate. If Arctic policy is driven by agendas based on domestic resource development, the ensuing oil and gas extraction will ensure the failure of the Paris Agreement. If Arctic energy policy can be framed by the Arctic Council, however, its environmental agenda and fragmented governance structure offers the scientific community a fighting chance to determine the region’s energy future. Connecting Arctic climate science to resource economics via its unique governance structure is one of the most powerful ways the scientific community can protect the Arctic region’s environmental, cultural, and scientific resources, and influence international energy and climate policy.

  1. Laser-driven ion acceleration via target normal sheath acceleration in the relativistic transparency regime

    DOE PAGES

    Poole, P. L.; Obst, L.; Cochran, G. E.; ...

    2018-01-11

    Here we present an experimental study investigating laser-driven proton acceleration via target normal sheath acceleration (TNSA) over a target thickness range spanning the typical TNSA-dominant regime (~1 μm) down to below the onset of relativistic laser-transparency (<40 nm). This is done with a single target material in the form of freely adjustable films of liquid crystals along with high contrast (via plasma mirror) laser interaction (~2.65 J, 30 fs, I>1 x 10 21 W cm -2). Thickness dependent maximum proton energies scale well with TNSA models down to the thinnest targets, while those under ~40 nm indicate the influence ofmore » relativistic transparency on TNSA, observed via differences in light transmission, maximum proton energy, and proton beam spatial profile. Oblique laser incidence (45°) allowed the fielding of numerous diagnostics to determine the interaction quality and details: ion energy and spatial distribution was measured along the laser axis and both front and rear target normal directions; these along with reflected and transmitted light measurements on-shot verify TNSA as dominant during high contrast interaction, even for ultra-thin targets. Additionally, 3D particle-in-cell simulations qualitatively support the experimental observations of target-normal-directed proton acceleration from ultra-thin films.« less

  2. Laser-driven ion acceleration via target normal sheath acceleration in the relativistic transparency regime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poole, P. L.; Obst, L.; Cochran, G. E.

    Here we present an experimental study investigating laser-driven proton acceleration via target normal sheath acceleration (TNSA) over a target thickness range spanning the typical TNSA-dominant regime (~1 μm) down to below the onset of relativistic laser-transparency (<40 nm). This is done with a single target material in the form of freely adjustable films of liquid crystals along with high contrast (via plasma mirror) laser interaction (~2.65 J, 30 fs, I>1 x 10 21 W cm -2). Thickness dependent maximum proton energies scale well with TNSA models down to the thinnest targets, while those under ~40 nm indicate the influence ofmore » relativistic transparency on TNSA, observed via differences in light transmission, maximum proton energy, and proton beam spatial profile. Oblique laser incidence (45°) allowed the fielding of numerous diagnostics to determine the interaction quality and details: ion energy and spatial distribution was measured along the laser axis and both front and rear target normal directions; these along with reflected and transmitted light measurements on-shot verify TNSA as dominant during high contrast interaction, even for ultra-thin targets. Additionally, 3D particle-in-cell simulations qualitatively support the experimental observations of target-normal-directed proton acceleration from ultra-thin films.« less

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Omelchenko, Yuri A.

    Global interactions of energetic ions with magnetoplasmas and neutral gases lie at the core of many space and laboratory plasma phenomena ranging from solar wind entry into and transport within planetary magnetospheres and exospheres to fast-ion driven instabilities in fusion devices to astrophysics-in-lab experiments. The ability of computational models to properly account for physical effects that underlie such interactions, namely ion kinetic, ion cyclotron, Hall, collisional and ionization processes is important for the success and planning of experimental research in plasma physics. Understanding the physics of energetic ions, in particular their nonlinear resonance interactions with Alfvén waves, is central tomore » improving the heating performance of magnetically confined plasmas for future energy generation. Fluid models are not adequate for high-beta plasmas as they cannot fully capture ion kinetic and cyclotron physics (e.g., ion behavior in the presence of magnetic nulls, shock structures, plasma interpenetration, etc.). Recent results from global reconnection simulations show that even in a MHD-like regime there may be significant differences between kinetic and MHD simulations. Therefore, kinetic modeling becomes essential for meeting modern day challenges in plasma physics. The hybrid approximation is an intermediate approximation between the fluid and fully kinetic approximations. It eliminates light waves, removes the electron inertial temporal and spatial scales from the problem and enables full-orbit ion kinetics. As a result, hybrid codes have become effective tools for exploring ion-scale driven phenomena associated with ion beams, shocks, reconnection and turbulence that control the large-scale behavior of laboratory and space magnetoplasmas. A number of numerical issues, however, make three-dimensional (3D) large-scale hybrid simulations of inhomogeneous magnetized plasmas prohibitively expensive or even impossible. To resolve these difficulties we have developed a novel Event-driven Multiscale Asynchronous Parallel Simulation (EMAPS) technology that replaces time stepping with self-adaptive update events. Local calculations are carried out only on an “as needed basis”. EMAPS (i) guarantees accurate and stable processing of physical variables in time accurate simulations, and (ii) eliminates unnecessary computation. Applying EMAPS to the hybrid model has resulted in the development of a unique parallel code, dimension-independent (compile-time-configurable) HYPERS (Hybrid Parallel Event-Resolved Simulator) that scales to hundreds of thousands of parallel processors. HYPERS advances electromagnetic fields and particles asynchronously on time scales determined by local physical laws and mesh properties. To achieve high computational accuracy in complex device geometries, HYPERS employs high-fidelity Cartesian grids with masked conductive cells. The HYPERS model includes multiple ion species, energy and momentum conserving ion-ion collisions, and provides a number of approximations for plasma resistivity and vacuum regions. Both local and periodic boundary conditions are allowed. The HYPERS solver preserves zero divergence of magnetic field. The project has demonstrated HYPERS capabilities on a number of applications of interest to fusion and astrophysical plasma physics applications listed below. 1. Theta-pinch formation of FRCs The formation, spontaneous spin-up, and stability of theta-pinch formed field-reversed configurations have been studied self-consistently in 3D. The end-to-end hybrid simulations reveal poloidal profiles of implosion-driven fast toroidal plasma rotation and demonstrate three discharge regimes as a function of experimental parameters: the decaying stable configuration, the tilt unstable configuration, and the nonlinear evolution of a fast growing tearing mode. 2. FRC collisions with magnetic mirrors Interactions of fast plasma streams and objects with magnetic obstacles (dipoles, mirrors, etc) lie at the core of many space and laboratory plasma phenomena ranging from magnetoshells and solar wind interactions with planetary magnetospheres to compact fusion plasmas. HYPERS simulations are compared with data from the MSX experiment (LANL) that focuses on the physics of magnetized collisionless shocks through the acceleration and subsequent stagnation of FRC plasmoids against a strong magnetic mirrors and flux-conserving boundaries. 3. Exploding magnetoplasmas Results from hybrid simulations of two experiments at the LAPD and Nevada Terawatt Facility are discussed where short-pulse lasers are used to ablate solid targets to produce plasmas that expand across external magnetic fields. The first simulation recreates flutelike density striations observed at the leading edge of a carbon plasma and predicts an early destruction of the magnetic cavity in agreement with experimental evidence. In the second simulation a polyethylene target is ablated into a mixture of protons and carbon ions. A mechanism is demonstrated that allows protons to penetrate the magnetic field in the form of a collimated flow. The results are compared to experimental data and single-fluid MHD simulations. The EMAPS framework has the potential for wide application in many other engineering and scientific fields, such as climate models, biological systems, electronic devices, seismic events, oil reservation simulators that all involve advancing solutions of partial differential equations in time where the rate of activity can be adapted widely over the spatial domain depending on locally space/time phenomena (“events”).« less

  4. Comparison of driven and simulated "free" stall flutter in a wind tunnel

    NASA Astrophysics Data System (ADS)

    Culler, Ethan; Farnsworth, John; Fagley, Casey; Seidel, Jurgen

    2016-11-01

    Stall flutter and dynamic stall have received a significant amount of attention over the years. To experimentally study this problem, the body undergoing stall flutter is typically driven at a characteristic, single frequency sinusoid with a prescribed pitching amplitude and mean angle of attack offset. This approach allows for testing with repeatable kinematics, however it effectively decouples the structural motion from the aerodynamic forcing. Recent results suggest that this driven approach could misrepresent the forcing observed in a "free" stall flutter scenario. Specifically, a dynamically pitched rigid NACA 0018 wing section was tested in the wind tunnel under two modes of operation: (1) Cyber-Physical where "free" stall flutter was physically simulated through a custom motor-control system modeling a torsional spring and (2) Direct Motor-Driven Dynamic Pitch at a single frequency sinusoid representative of the cyber-physical motion. The time-resolved pitch angle and moment were directly measured and compared for each case. It was found that small deviations in the pitch angle trajectory between these two operational cases generate significantly different aerodynamic pitching moments on the wing section, with the pitching moments nearly 180o out of phase in some cases. This work is supported by the Air Force Office of Scientific Research through the Flow Interactions and Control Program and by the National Defense Science and Engineering Graduate Fellowship Program.

  5. Recent highlights in electro-driven separations- selected applications of alkylthiol gold nanoparticles in capillary electrophoresis and capillary electro-chromatography.

    PubMed

    Guihen, Elizabeth

    2017-09-01

    To date, alkylthiol gold nanoparticles (AuNPs) have been widely used in electro-chromatographic separation techniques as a viable alternative to traditional stationary phases. This is mainly due to their stability, chemical inertness, ease of functionality, increased phase ratio, ability to form self-assembled monolayers. They also yield versatile stationary phases with highly specific targeted functionalities. At the nanoscale region, the chemical and physical properties of a molecule display different attributes to that of the parent molecules or material, hence these features can be harnessed in electro-driven chromatographic separations. Application areas illustrating the use of AuNPs in separation science continue to grow and expand to cover many different kinds of analysis. The last decade has witnessed a successful trend in miniaturisation of chemical separation systems toward the micro and nanoscale ranges. Nanoparticle-based stationary phases fit well with performing chemical separations on microfluidic and capillary platforms. In this review the theory of the use of alkylthiol gold nanoparticles in electro-chromatographic driven separation methods will be discussed. This will be followed by details of recent and selected applications showing alkylthiol gold nanoparticles in capillary electrophoretic and open-tubular electro-chromatographic separations. This review will focus solely on alkylthiol based gold nanoparticles, therefore other kinds of chemical moieties bonded to gold nanoparticles are outside the scope of this review. Finally the future outlook of this exciting technology will be outlined in some detail in the final section. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A variable-instar climate-driven individual beetle-based phenology model for the invasive Asian longhorned beetle (Coleoptera: Cerambycidae)

    Treesearch

    R. Talbot Trotter, III; Melody A. Keena

    2016-01-01

    Efforts to manage and eradicate invasive species can benefit from an improved understanding of the physiology, biology, and behavior of the target species, and ongoing efforts to eradicate the Asian longhorned beetle (Anoplophora glabripennis Motschulsky) highlight the roles this information may play. Here, we present a climate-driven phenology...

  7. Lateralization of spatial rather than temporal attention underlies the left hemifield advantage in rapid serial visual presentation.

    PubMed

    Asanowicz, Dariusz; Kruse, Lena; Śmigasiewicz, Kamila; Verleger, Rolf

    2017-11-01

    In bilateral rapid serial visual presentation (RSVP), the second of two targets, T1 and T2, is better identified in the left visual field (LVF) than in the right visual field (RVF). This LVF advantage may reflect hemispheric asymmetry in temporal attention or/and in spatial orienting of attention. Participants performed two tasks: the "standard" bilateral RSVP task (Exp.1) and its unilateral variant (Exp.1 & 2). In the bilateral task, spatial location was uncertain, thus target identification involved stimulus-driven spatial orienting. In the unilateral task, the targets were presented block-wise in the LVF or RVF only, such that no spatial orienting was needed for target identification. Temporal attention was manipulated in both tasks by varying the T1-T2 lag. The results showed that the LVF advantage disappeared when involvement of stimulus-driven spatial orienting was eliminated, whereas the manipulation of temporal attention had no effect on the asymmetry. In conclusion, the results do not support the hypothesis of hemispheric asymmetry in temporal attention, and provide further evidence that the LVF advantage reflects right hemisphere predominance in stimulus-driven orienting of spatial attention. These conclusions fit evidence that temporal attention is implemented by bilateral parietal areas and spatial attention by the right-lateralized ventral frontoparietal network. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Student-Centred Learning and Disciplinary Enculturation: An Exploration through Physics

    ERIC Educational Resources Information Center

    Sin, Cristina

    2015-01-01

    This study argues that student-centred methods in the teaching of physics can be beneficial for students' enculturation into the discipline and into a physicist's profession. Interviews conducted with academics and students from six master degrees in physics in three different European countries suggest that student-driven classroom activities,…

  9. Probing High School Physics Students' Views and Concerns about Learning Activities

    ERIC Educational Resources Information Center

    Langley, Dorothy; Eylon, Bat-Sheva

    2006-01-01

    The current study is framed within an ongoing effort of probing students' attitudes and expectations about knowing and learning physics, which has driven several investigations during the past decade. The questionnaire we developed focuses on physics students' views regarding a variety of specific learning activities, which are presented by title…

  10. Observation of Gigawatt-Class THz Pulses from a Compact Laser-Driven Particle Accelerator

    NASA Astrophysics Data System (ADS)

    Gopal, A.; Herzer, S.; Schmidt, A.; Singh, P.; Reinhard, A.; Ziegler, W.; Brömmel, D.; Karmakar, A.; Gibbon, P.; Dillner, U.; May, T.; Meyer, H.-G.; Paulus, G. G.

    2013-08-01

    We report the observation of subpicosecond terahertz (T-ray) pulses with energies ≥460μJ from a laser-driven ion accelerator, thus rendering the peak power of the source higher even than that of state-of-the-art synchrotrons. Experiments were performed with intense laser pulses (up to 5×1019W/cm2) to irradiate thin metal foil targets. Ion spectra measured simultaneously showed a square law dependence of the T-ray yield on particle number. Two-dimensional particle-in-cell simulations show the presence of transient currents at the target rear surface which could be responsible for the strong T-ray emission.

  11. Role of attentional tags in working memory-driven attentional capture.

    PubMed

    Kuo, Chun-Yu; Chao, Hsuan-Fu

    2014-08-01

    Recent studies have demonstrated that the contents of working memory capture attention when performing a visual search task. However, it remains an intriguing and unresolved question whether all kinds of items stored in working memory capture attention. The present study investigated this issue by manipulating the attentional tags (target or distractor) associated with information maintained in working memory. The results showed that working memory-driven attentional capture is a flexible process, and that attentional tags associated with items stored in working memory do modulate attentional capture. When items were tagged as a target, they automatically captured attention; however, when items were tagged as a distractor, attentional capture was reduced.

  12. Theory-Driven Intervention for Changing Personality: Expectancy Value Theory, Behavioral Activation, and Conscientiousness

    PubMed Central

    Magidson, Jessica F.; Roberts, Brent; Collado-Rodriguez, Anahi; Lejuez, C.W.

    2013-01-01

    Considerable evidence suggests that personality traits may be changeable, raising the possibility that personality traits most linked to health problems can be modified with intervention. A growing body of research suggests that problematic personality traits may be altered with behavioral intervention using a bottom-approach. That is, by targeting core behaviors that underlie personality traits with the goal of engendering new, healthier patterns of behavior that over time become automatized and manifest in changes in personality traits. Nevertheless, a bottom-up model for changing personality traits is somewhat diffuse and requires clearer integration of theory and relevant interventions to enable real clinical application. As such, this manuscript proposes a set of guiding principles for theory-driven modification of targeted personality traits using a bottom-up approach, focusing specifically on targeting the trait of conscientiousness using a relevant behavioral intervention, Behavioral Activation (BA), considered within the motivational framework of Expectancy Value Theory (EVT). We conclude with a real case example of the application of BA to alter behaviors counter to conscientiousness in a substance dependent patient, highlighting the EVT principles most relevant to the approach and the importance and viability of a theoretically-driven, bottom-up approach to changing personality traits. PMID:23106844

  13. Investigating the Effect of Argument-Driven Inquiry in Laboratory Instruction

    ERIC Educational Resources Information Center

    Demircioglu, Tuba; Ucar, Sedat

    2015-01-01

    The aim of this study is to investigate the effect of argument-driven inquiry (ADI) based laboratory instruction on the academic achievement, argumentativeness, science process skills, and argumentation levels of pre-service science teachers in the General Physics Laboratory III class. The study was conducted with 79 pre-service science teachers.…

  14. Resonance Effects in Magnetically Driven Mass-Spring Oscillations

    ERIC Educational Resources Information Center

    Taylor, Ken

    2011-01-01

    Resonance effects are among the most intriguing phenomena in physics and engineering. The classical case of a mass-spring oscillator driven at its resonant frequency is one of the earliest examples that students encounter. Perhaps the most commonly depicted method of driving the vibrating system is mechanical. An alternative approach presented in…

  15. Influence of fracture network physical properties on stability criteria of density-driven flow in a dual-porosity system

    NASA Astrophysics Data System (ADS)

    Hassanzadeh, H.; Jafari Raad, S. M.

    2017-12-01

    Linear stability analysis is conducted to study the onset of buoyancy-driven convection involved in solubility trapping of CO2 into deep fractured aquifers. In this study, the effect of fracture network physical properties on the stability criteria in a brine-rich fractured porous layer is investigated using dual porosity concept for both single and variable matrix block size distributions. Linear stability analysis results show that both fracture interporosity flow and fracture storativity factors play an important role in the stability behavior of the system. It is shown that a diffusive boundary layer under the gravity field in a fractured rock with lower fracture storativity and/or higher fracture interporosity flow coefficient is more stable. We present scaling relations that relate the onset of convective instability in fractured aquifers. These findings improve our understanding of buoyancy driven flow in fractured aquifers and are particularly important in estimation of potential storage capacity, risk assessment, and storage sites characterization and screening.Keywords: CO2 sequestration; fractured rock; buoyancy-driven convection; stability analysis

  16. Above scaling short-pulse ion acceleration from flat foil and ``Pizza-top Cone'' targets at the Trident laser facility

    NASA Astrophysics Data System (ADS)

    Flippo, Kirk; Hegelich, B. Manuel; Cort Gautier, D.; Johnson, J. Randy; Kline, John L.; Shimada, Tsutomu; Fernández, Juan C.; Gaillard, Sandrine; Rassuchine, Jennifer; Le Galloudec, Nathalie; Cowan, Thomas E.; Malekos, Steve; Korgan, Grant

    2006-10-01

    Ion-driven Fast Ignition (IFI) has certain advantages over electron-driven FI due to a possible large reduction in the amount of energy required. Recent experiments at the Los Alamos National Laboratory's Trident facility have yielded ion energies and efficiencies many times in excess of recent published scaling laws, leading to even more potential advantages of IFI. Proton energies in excess of 35 MeV have been observed from targets produced by the University of Nevada, Reno - dubbed ``Pizza-top Cone'' targets - at intensities of only 1x10^19 W/cm^2 with 20 joules in 600 fs. Energies in excess of 24 MeV were observed from simple flat foil targets as well. The observed energies, above any published scaling laws, are attributed to target production, preparation, and shot to shot monitoring of many laser parameters, especially the laser ASE prepulse level and laser pulse duration. The laser parameters are monitored in real-time to keep the laser in optimal condition throughout the run providing high quality, reproducible shots.

  17. Generation of monoenergetic ion beams via ionization dynamics (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Lin, Chen; Kim, I. Jong; Yu, Jinqing; Choi, Il Woo; Ma, Wenjun; Yan, Xueqing; Nam, Chang Hee

    2017-05-01

    The research on ion acceleration driven by high intensity laser pulse has attracted significant interests in recent decades due to the developments of laser technology. The intensive study of energetic ion bunches is particularly stimulated by wide applications in nuclear fusion, medical treatment, warm dense matter production and high energy density physics. However, to implement such compact accelerators, challenges are still existing in terms of beam quality and stability, especially in applications that require higher energy and narrow bandwidth spectra ion beams. We report on the acceleration of quasi-mono-energetic ion beams via ionization dynamics in the interaction of an intense laser pulse with a solid target. Using ionization dynamics model in 2D particle-in-cell (PIC) simulations, we found that high charge state contamination ions can only be ionized in the central spot area where the intensity of sheath field surpasses their ionization threshold. These ions automatically form a microstructure target with a width of few micron scale, which is conducive to generate mono-energetic beams. In the experiment of ultraintense (< 10^21 W/cm^2) laser pulses irradiating ultrathin targets each attracted with a contamination layer of nm-thickness, high quality < 100 MeV mono-energetic ion bunches are generated. The peak energy of the self-generated micro-structured target ions with respect to different contamination layer thickness is also examined This is relatively newfound respect, which is confirmed by the consistence between experiment data and the simulation results.

  18. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  19. Epithelioid Sarcoma: Opportunities for Biology-Driven Targeted Therapy.

    PubMed

    Noujaim, Jonathan; Thway, Khin; Bajwa, Zia; Bajwa, Ayeza; Maki, Robert G; Jones, Robin L; Keller, Charles

    2015-01-01

    Epithelioid sarcoma (ES) is a soft tissue sarcoma of children and young adults for which the preferred treatment for localized disease is wide surgical resection. Medical management is to a great extent undefined, and therefore for patients with regional and distal metastases, the development of targeted therapies is greatly desired. In this review, we will summarize clinically relevant biomarkers (e.g., SMARCB1, CA125, dysadherin, and others) with respect to targeted therapeutic opportunities. We will also examine the role of EGFR, mTOR, and polykinase inhibitors (e.g., sunitinib) in the management of local and disseminated disease. Toward building a consortium of pharmaceutical, academic, and non-profit collaborators, we will discuss the state of resources for investigating ES with respect to cell line resources, tissue banks, and registries so that a roadmap can be developed toward effective biology-driven therapies.

  20. Biased and unbiased strategies to identify biologically active small molecules.

    PubMed

    Abet, Valentina; Mariani, Angelica; Truscott, Fiona R; Britton, Sébastien; Rodriguez, Raphaël

    2014-08-15

    Small molecules are central players in chemical biology studies. They promote the perturbation of cellular processes underlying diseases and enable the identification of biological targets that can be validated for therapeutic intervention. Small molecules have been shown to accurately tune a single function of pluripotent proteins in a reversible manner with exceptional temporal resolution. The identification of molecular probes and drugs remains a worthy challenge that can be addressed by the use of biased and unbiased strategies. Hypothesis-driven methodologies employs a known biological target to synthesize complementary hits while discovery-driven strategies offer the additional means of identifying previously unanticipated biological targets. This review article provides a general overview of recent synthetic frameworks that gave rise to an impressive arsenal of biologically active small molecules with unprecedented cellular mechanisms. Copyright © 2014. Published by Elsevier Ltd.

  1. The less healthy urban population: income-related health inequality in China.

    PubMed

    Yang, Wei; Kanavos, Panos

    2012-09-18

    Health inequality has been recognized as a problem all over the world. In China, the poor usually have less access to healthcare than the better-off, despite having higher levels of need. Since the proportion of the Chinese population living in urban areas increased tremendously with the urbanization movements, attention has been paid to the association between urban/rural residence and population health. It is important to understand the variation in health across income groups, and in particular to take into account the effects of urban/rural residence on the degree of income-related health inequalities. This paper empirically assesses the magnitude of rural/urban disparities in income-related adult health status, i.e., self-assessed health (SAH) and physical activity limitation, using Concentration Indices. It then uses decomposition methods to unravel the causes of inequalities and their variations across urban and rural populations. Data from the China Health and Nutrition Survey (CHNS) 2006 are used. The study finds that the poor are less likely to report their health status as "excellent or good" and are more likely to have physical activity limitation. Such inequality is more pronounced for the urban population than for the rural population. Results from the decomposition analysis suggest that, for the urban population, 76.47 per cent to 79.07 per cent of inequalities are driven by non-demographic/socioeconomic-related factors, among which income, job status and educational level are the most important factors. For the rural population, 48.19 per cent to 77.78 per cent of inequalities are driven by non-demographic factors. Income and educational attainment appear to have a prominent influence on inequality. The findings suggest that policy targeting the poor, especially the urban poor, is needed in order to reduce health inequality.

  2. The less healthy urban population: income-related health inequality in China

    PubMed Central

    2012-01-01

    Background Health inequality has been recognized as a problem all over the world. In China, the poor usually have less access to healthcare than the better-off, despite having higher levels of need. Since the proportion of the Chinese population living in urban areas increased tremendously with the urbanization movements, attention has been paid to the association between urban/rural residence and population health. It is important to understand the variation in health across income groups, and in particular to take into account the effects of urban/rural residence on the degree of income-related health inequalities. Methods This paper empirically assesses the magnitude of rural/urban disparities in income-related adult health status, i.e., self-assessed health (SAH) and physical activity limitation, using Concentration Indices. It then uses decomposition methods to unravel the causes of inequalities and their variations across urban and rural populations. Data from the China Health and Nutrition Survey (CHNS) 2006 are used. Results The study finds that the poor are less likely to report their health status as “excellent or good” and are more likely to have physical activity limitation. Such inequality is more pronounced for the urban population than for the rural population. Results from the decomposition analysis suggest that, for the urban population, 76.47 per cent to 79.07 per cent of inequalities are driven by non-demographic/socioeconomic-related factors, among which income, job status and educational level are the most important factors. For the rural population, 48.19 per cent to 77.78 per cent of inequalities are driven by non-demographic factors. Income and educational attainment appear to have a prominent influence on inequality. Conclusion The findings suggest that policy targeting the poor, especially the urban poor, is needed in order to reduce health inequality. PMID:22989200

  3. A hypothesis-driven physical examination learning and assessment procedure for medical students: initial validity evidence.

    PubMed

    Yudkowsky, Rachel; Otaki, Junji; Lowenstein, Tali; Riddle, Janet; Nishigori, Hiroshi; Bordage, Georges

    2009-08-01

    Diagnostic accuracy is maximised by having clinical signs and diagnostic hypotheses in mind during the physical examination (PE). This diagnostic reasoning approach contrasts with the rote, hypothesis-free screening PE learned by many medical students. A hypothesis-driven PE (HDPE) learning and assessment procedure was developed to provide targeted practice and assessment in anticipating, eliciting and interpreting critical aspects of the PE in the context of diagnostic challenges. This study was designed to obtain initial content validity evidence, performance and reliability estimates, and impact data for the HDPE procedure. Nineteen clinical scenarios were developed, covering 160 PE manoeuvres. A total of 66 Year 3 medical students prepared for and encountered three clinical scenarios during required formative assessments. For each case, students listed anticipated positive PE findings for two plausible diagnoses before examining the patient; examined a standardised patient (SP) simulating one of the diagnoses; received immediate feedback from the SP, and documented their findings and working diagnosis. The same students later encountered some of the scenarios during their Year 4 clinical skills examination. On average, Year 3 students anticipated 65% of the positive findings, correctly performed 88% of the PE manoeuvres and documented 61% of the findings. Year 4 students anticipated and elicited fewer findings overall, but achieved proportionally more discriminating findings, thereby more efficiently achieving a diagnostic accuracy equivalent to that of students in Year 3. Year 4 students performed better on cases on which they had received feedback as Year 3 students. Twelve cases would provide a reliability of 0.80, based on discriminating checklist items only. The HDPE provided medical students with a thoughtful, deliberate approach to learning and assessing PE skills in a valid and reliable manner.

  4. What Would You Ideally Do if There Were No Targets? An Ethnographic Study of the Unintended Consequences of Top-Down Governance in Two Clinical Settings

    ERIC Educational Resources Information Center

    Allard, Jon; Bleakley, Alan

    2016-01-01

    Top-down policy directives, such as targets and their associated protocols, may be driven politically rather than clinically and can be described as macro-political texts. While targets supposedly provide incentives for healthcare services, they may unintentionally shape practices of accommodation rather than implementation, deflecting…

  5. Target validation: linking target and chemical properties to desired product profile.

    PubMed

    Wyatt, Paul G; Gilbert, Ian H; Read, Kevin D; Fairlamb, Alan H

    2011-01-01

    The discovery of drugs is a lengthy, high-risk and expensive business taking at least 12 years and is estimated to cost upwards of US$800 million for each drug to be successfully approved for clinical use. Much of this cost is driven by the late phase clinical trials and therefore the ability to terminate early those projects destined to fail is paramount to prevent unwanted costs and wasted effort. Although neglected diseases drug discovery is driven more by unmet medical need rather than financial considerations, the need to minimise wasted money and resources is even more vital in this under-funded area. To ensure any drug discovery project is addressing the requirements of the patients and health care providers and delivering a benefit over existing therapies, the ideal attributes of a novel drug needs to be pre-defined by a set of criteria called a target product profile. Using a target product profile the drug discovery process, clinical study design, and compound characteristics can be defined all the way back through to the suitability or druggability of the intended biochemical target. Assessment and prioritisation of the most promising targets for entry into screening programmes is crucial for maximising chances of success.

  6. Laser pulse shape design for laser-indirect-driven quasi-isentropic compression experiments

    NASA Astrophysics Data System (ADS)

    Xue, Quanxi; Jiang, Shaoen; Wang, Zhebin; Wang, Feng; Zhao, Xueqing; Ding, Yongkun

    2018-02-01

    Laser pulse shape design is a key work in the design of indirect-laser-driven experiments, especially for long pulse laser driven quasi-isentropic compression experiments. A method for designing such a laser pulse shape is given here. What's more, application experiments were performed, and the results of a typical shot are presented. At last of this article, the details of the application of the method are discussed, such as the equation parameter choice, radiation ablation pressure expression, and approximations in the method. The application shows that the method can provide reliable descriptions of the energy distribution in a hohlraum target; thus, it can be used in the design of long-pulse laser driven quasi-isentropic compression experiments and even other indirect-laser-driven experiments.

  7. Minimizing masses in explosively driven two-shockwave physics applications

    NASA Astrophysics Data System (ADS)

    Buttler, William; Cherne, Frank; Furlanetto, Michael; Payton, Jeremy; Stone, Joseph; Tabaka, Leonard; Vincent, Samuel

    2015-06-01

    We have experimentally investigated different two-shockwave high-explosives (HE) physics package designs to maximize the variability of the second shockwave peak stress, while minimizing the total HE load of the physics tool. A critical requirement is to also have a large radial diameter of the second shockwave to maintain its value as an HE driven two-shockwave drive. We have previously shown that we could vary the peak-stress of the second-shockwave with a 76 mm diameter HE lens driving different composite boosters of PBX 9501 and TNT. Here we report on our results with a 56- and 50-mm diameter HE lens driving Baritol. The results indicate that the 56-mm diameter HE lens works well, as does the Baritol, giving total HE loads of about 250 mg TNT equivalent explosives.

  8. Physical dimensions, torsional performance, bending properties, and metallurgical characteristics of rotary endodontic instruments. VI. Canal Master drills.

    PubMed

    Luebke, N H; Brantley, W A; Sabri, Z I; Luebke, F L; Lausten, L L

    1995-05-01

    A laboratory study was performed on machine-driven Canal Master drills to determine their physical dimensions, torsional performance, bending properties, and metallurgical characteristics in fracture. Physical dimensions were determined for each of the available sizes (#50 to #100) of Canal Master drills from the manufacturer that distributes these instruments in the United States. Samples were also tested in clockwise torsion using a Maillefer memocouple. Bending properties of cantilever specimens were measured with a Tinius Olsen stiffness tester. Bending fatigue testing was performed on a unique laboratory apparatus. Scanning electron microscope examination confirmed visual observations that the stainless steel Canal Master drills exhibited ductile torsional fracture. This study is part of a continuing investigation to establish standards for all machine-driven rotary endodontic instruments.

  9. Attosecond Thomson-scattering x-ray source driven by laser-based electron acceleration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luo, W.; College of Science, National University of Defense Technology, Changsha 410073; Zhuo, H. B.

    2013-10-21

    The possibility of producing attosecond x-rays through Thomson scattering of laser light off laser-driven relativistic electron beams is investigated. For a ≤200-as, tens-MeV electron bunch produced with laser ponderomotive-force acceleration in a plasma wire, exceeding 10{sup 6} photons/s in the form of ∼160 as pulses in the range of 3–300 keV are predicted, with a peak brightness of ≥5 × 10{sup 20} photons/(s mm{sup 2} mrad{sup 2} 0.1% bandwidth). Our study suggests that the physical scheme discussed in this work can be used for an ultrafast (attosecond) x-ray source, which is the most beneficial for time-resolved atomic physics, dubbed “attosecondmore » physics.”.« less

  10. Between tide and wave marks: a unifying model of physical zonation on littoral shores

    PubMed Central

    Bird, Christopher E.; Franklin, Erik C.; Smith, Celia M.

    2013-01-01

    The effects of tides on littoral marine habitats are so ubiquitous that shorelines are commonly described as ‘intertidal’, whereas waves are considered a secondary factor that simply modifies the intertidal habitat. However mean significant wave height exceeds tidal range at many locations worldwide. Here we construct a simple sinusoidal model of coastal water level based on both tidal range and wave height. From the patterns of emergence and submergence predicted by the model, we derive four vertical shoreline benchmarks which bracket up to three novel, spatially distinct, and physically defined zones. The (1) emergent tidal zone is characterized by tidally driven emergence in air; the (2) wave zone is characterized by constant (not periodic) wave wash; and the (3) submergent tidal zone is characterized by tidally driven submergence. The decoupling of tidally driven emergence and submergence made possible by wave action is a critical prediction of the model. On wave-dominated shores (wave height ≫ tidal range), all three zones are predicted to exist separately, but on tide-dominated shores (tidal range ≫ wave height) the wave zone is absent and the emergent and submergent tidal zones overlap substantially, forming the traditional “intertidal zone”. We conclude by incorporating time and space in the model to illustrate variability in the physical conditions and zonation on littoral shores. The wave:tide physical zonation model is a unifying framework that can facilitate our understanding of physical conditions on littoral shores whether tropical or temperate, marine or lentic. PMID:24109544

  11. A model teaching session for the hypothesis-driven physical examination.

    PubMed

    Nishigori, Hiroshi; Masuda, Kozo; Kikukawa, Makoto; Kawashima, Atsushi; Yudkowsky, Rachel; Bordage, Georges; Otaki, Junji

    2011-01-01

    The physical examination is an essential clinical competence for all physicians. Most medical schools have students who learn the physical examination maneuvers using a head-to-toe approach. However, this promotes a rote approach to the physical exam, and it is not uncommon for students later on to fail to appreciate the meaning of abnormal findings and their contribution to the diagnostic reasoning process. The purpose of the project was to develop a model teaching session for the hypothesis-driven physical examination (HDPE) approach in which students could practice the physical examination in the context of diagnostic reasoning. We used an action research methodology to create this HDPE model by developing a teaching session, implementing it over 100 times with approximately 700 students, conducting internal reflection and external evaluations, and making adjustments as needed. A model nine-step HDPE teaching session was developed, including: (1) orientation, (2) anticipation, (3) preparation, (4) role play, (5) discussion-1, (6) answers, (7) discussion-2, (8) demonstration and (9) reflection. A structured model HDPE teaching session and tutor guide were developed into a workable instructional intervention. Faculty members are invited to teach the physical examination using this model.

  12. Paving the COWpath: data-driven design of pediatric order sets

    PubMed Central

    Zhang, Yiye; Padman, Rema; Levin, James E

    2014-01-01

    Objective Evidence indicates that users incur significant physical and cognitive costs in the use of order sets, a core feature of computerized provider order entry systems. This paper develops data-driven approaches for automating the construction of order sets that match closely with user preferences and workflow while minimizing physical and cognitive workload. Materials and methods We developed and tested optimization-based models embedded with clustering techniques using physical and cognitive click cost criteria. By judiciously learning from users’ actual actions, our methods identify items for constituting order sets that are relevant according to historical ordering data and grouped on the basis of order similarity and ordering time. We evaluated performance of the methods using 47 099 orders from the year 2011 for asthma, appendectomy and pneumonia management in a pediatric inpatient setting. Results In comparison with existing order sets, those developed using the new approach significantly reduce the physical and cognitive workload associated with usage by 14–52%. This approach is also capable of accommodating variations in clinical conditions that affect order set usage and development. Discussion There is a critical need to investigate the cognitive complexity imposed on users by complex clinical information systems, and to design their features according to ‘human factors’ best practices. Optimizing order set generation using cognitive cost criteria introduces a new approach that can potentially improve ordering efficiency, reduce unintended variations in order placement, and enhance patient safety. Conclusions We demonstrate that data-driven methods offer a promising approach for designing order sets that are generalizable, data-driven, condition-based, and up to date with current best practices. PMID:24674844

  13. A value-driven mechanism of attentional selection

    PubMed Central

    Anderson, Brian A.

    2013-01-01

    Attention selects stimuli for cognitive processing, and the mechanisms that underlie the process of attentional selection have been a major topic of psychological research for over 30 years. From this research, it has been well documented that attentional selection can proceed both voluntarily, driven by visual search goals, and involuntarily, driven by the physical salience of stimuli. In this review, I provide a conceptual framework for attentional control that emphasizes the need for stimulus selection to promote the survival and wellbeing of an organism. I argue that although goal-driven and salience-driven mechanisms of attentional selection fit within this framework, a central component that is missing is a mechanism of attentional selection that is uniquely driven by learned associations between stimuli and rewards. I go on to review recent evidence for such a value-driven mechanism of attentional selection, and describe how this mechanism functions independently of the well-documented salience-driven and goal-driven mechanisms. I conclude by arguing that reward learning modifies the attentional priority of stimuli, allowing them to compete more effectively for selection even when nonsalient and task-irrelevant. PMID:23589803

  14. Characterization of Particles Created By Laser-Driven Hydrothermal Processing

    DTIC Science & Technology

    2016-06-01

    created by laser-driven hydrothermal processing, an innovative technique used for the ablation of submerged materials. Two naturally occurring...processing, characterization, obsidian, tektite, natural glass 15. NUMBER OF PAGES 89 16. PRICE CODE 17. SECURITY CLASSIFICATION OF REPORT...technique used for the ablation of submerged materials. Two naturally occurring materials, obsidian and tektite, were used as targets for this technique

  15. Towards Ontology-Driven Information Systems: Guidelines to the Creation of New Methodologies to Build Ontologies

    ERIC Educational Resources Information Center

    Soares, Andrey

    2009-01-01

    This research targeted the area of Ontology-Driven Information Systems, where ontology plays a central role both at development time and at run time of Information Systems (IS). In particular, the research focused on the process of building domain ontologies for IS modeling. The motivation behind the research was the fact that researchers have…

  16. miR-1298 inhibits mutant KRAS-driven tumor growth by repressing FAK and LAMB3

    PubMed Central

    Zhou, Ying; Dang, Jason; Chang, Kung-Yen; Yau, Edwin; Aza-Blanc, Pedro; Moscat, Jorge; Rana, Tariq M.

    2016-01-01

    Global microRNA functional screens can offer a strategy to identify synthetic lethal interactions in cancer cells that might be exploited therapeutically. In this study, we applied this strategy to identify novel gene interactions in KRAS mutant cancer cells. In this manner, we discovered miR-1298, a novel miRNA that inhibited the growth of KRAS-driven cells both in vitro and in vivo. Using miR-TRAP affinity purification technology, we identified the tyrosine kinase FAK and the laminin subunit LAMB3 as functional targets of miR-1298. Silencing of FAK or LAMB3 recapitulated the synthetic lethal effects of miR-1298 expression in KRAS-driven cancer cells, whereas co-expression of both proteins was critical to rescue miR-1298-induced cell death. Expression of LAMB3 but not FAK was upregulated by mutant KRAS. In clinical specimens, elevated LAMB3 expression correlated with poorer survival in lung cancer patients with an oncogenic KRAS gene signature, suggesting a novel candidate biomarker in this disease setting. Our results define a novel regulatory pathway in KRAS-driven cancers which offers a potential therapeutic target for their eradication PMID:27698189

  17. Preschool Daily Patterns of Physical Activity Driven by Location and Social Context

    ERIC Educational Resources Information Center

    Schlechter, Chelsey R.; Rosenkranz, Richard R.; Fees, Bronwyn S.; Dzewaltowski, David A.

    2017-01-01

    Background: Preschool children are recommended to spend at least 15 minutes/hour (25% time) in light-to-vigorous physical activity (total physical activity, TPA). Preschool provider practices, such as whether children are put in small group or whole-group activities, are likely to affect children's TPA levels during preschool. The current study…

  18. Expanded Roles of Physical Education Teachers within a CSPAP and Implications for PETE

    ERIC Educational Resources Information Center

    Webster, Collin A.; Nesbitt, Danielle

    2017-01-01

    Since the early 1990s, notions about the purpose of physical education (PE) in the United States have increasingly aligned with a public health agenda driven by concerns that youth accrue too little physical activity (PA). In tandem with the shifting tides of thought about PE's purpose, authors have proposed numerous public health-aligned…

  19. The Electron Runaround: Understanding Electric Circuit Basics through a Classroom Activity

    ERIC Educational Resources Information Center

    Singh, Vandana

    2010-01-01

    Several misconceptions abound among college students taking their first general physics course, and to some extent pre-engineering physics students, regarding the physics and applications of electric circuits. Analogies used in textbooks, such as those that liken an electric circuit to a piped closed loop of water driven by a water pump, do not…

  20. Fusion in a staged Z-pinch

    NASA Astrophysics Data System (ADS)

    Wessel, F. J.; Rahman, H. U.; Ney, P.; Valenzuela, J.; Beg, F.; McKee, E.; Darling, T.

    2016-03-01

    This paper is dedicated to Norman Rostoker, our (FJW and HUR) mentor and long-term collaborator, who will always be remembered for the incredible inspiration that he has provided us. Norman's illustrious career dealt with a broad range of fundamental-physics problems and we were fortunate to have worked with him on many important topics: intense-charged-particle beams, field-reversed configurations, and Z-pinches. Rostoker 's group at the University of CA, Irvine was well known for having implemented many refinements to the Z-pinch, that make it more stable, scalable, and efficient, including the development of: the gas-puff Z-pinch [1], which provides for the use of an expanded range of pinch-load materials; the gas-mixture Z-pinch [2], which enhances the pinch stability and increases its radiation efficiency; e-beam pre-ionization [3], which enhances the uniformity of the initial-breakdown process in a gas pinch; magnetic-flux-compression [4, 5], which allows for the amplification of an axial-magnetic field Bz; the Z-θ pinch [6], which predicts fusion in a pinch-on-fiber configuration; the Staged Z-pinch (SZP) [7], which allows for the amplification of the pinch self-magnetic field, Bθ , in addition to a Bz, and leads to a stable implosion and high-gain fusion [8, 9, 10]. This paper describes the physical basis for a magneto-inertial compression in a liner-on-target SZP [11]. Initially a high-atomic-number liner implodes under the action of the J →×B → , Lorentz Force. As the implosion becomes super Alfvénic, magnetosonic waves form, transporting current and magnetic field through the liner toward the interface of the low-atomic-number target. The target implosion remains subsonic with its surface bounded by a stable-shock front. Shock waves that pass into the target provide a source of target plasma pre-heat. At peak compression the assembly is compressed by liner inertia, with flux compression producing an intense-magnetic field near the target. Instability develops at the interface, as the plasma decelerates, which promotes the formation of target-hot spots. Early experiments provide evidence for the magneto-inertial implosion [8, 9, 10]. Studies underway are designed to verify these predictions on the National Terawatt Facility, Zebra Generator, located at the University of Nevada, Reno. Simulations for an unmagnetized, silver-plasma liner imploding onto a deuterium-tritium plasma target, driven by a 200 TW generator, predict fusion beyond break-even, with a 200 MJ yield in an ignited plasma, with an engineering gain factor of, G = Efusion/Estored˜20.

  1. Range shortening, radiation transport, and Rayleigh-Taylor instability phenomena in ion-beam-driven inertial-fusion-reactor-size targets: Implosion, ignition, and burn phases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Long, K.A.; Tahir, N.A.

    In this paper we present an analysis of the theory of the energy deposition of ions in cold materials and hot dense plasmas together with numerical calculations for heavy and light ions of interest to ion-beam fusion. We have used the g-smcapso-smcapsr-smcapsg-smcapso-smcapsn-smcaps computer code of Long, Moritz, and Tahir (which is an extension of the code originally written for protons by Nardi, Peleg, and Zinamon) to carry out these calculations. The energy-deposition data calculated in this manner has been used in the design of heavy-ion-beam-driven fusion targets suitable for a reactor, by its inclusion in the m-smcapse-smcapsd-smcapsu-smcapss-smcapsa-smcaps code of Christiansen,more » Ashby, and Roberts as extended by Tahir and Long. A number of other improvements have been made in this code and these are also discussed. Various aspects of the theoretical analysis of such targets are discussed including the calculation of the hydrodynamic stability, the hydrodynamic efficiency, and the gain. Various different target designs have been used, some of them new. In general these targets are driven by Bi/sup +/ ions of energy 8--12 GeV, with an input energy of 4--6.5 MJ, with output energies in the range 600--900 MJ, and with gains in the range 120--180. The peak powers are in the range of 500--750 TW. We present detailed calculations of the ablation, compression, ignition, and burn phases. By the application of a new stability analysis which includes ablation and density-gradient effects we show that these targets appear to implode in a stable manner. Thus the targets designed offer working examples suited for use in a future inertial-confinement fusion reactor.« less

  2. Method and apparatus for producing cryogenic targets

    DOEpatents

    Murphy, James T.; Miller, John R.

    1984-01-01

    An improved method and apparatus are given for producing cryogenic inertially driven fusion targets in the fast isothermal freezing (FIF) method. Improved coupling efficiency and greater availability of volume near the target for diagnostic purposes and for fusion driver beam propagation result. Other embodiments include a new electrical switch and a new explosive detonator, all embodiments making use of a purposeful heating by means of optical fibers.

  3. Laser-driven proton acceleration with nanostructured targets

    NASA Astrophysics Data System (ADS)

    Vallières, Simon; Morabito, Antonia; Veltri, Simona; Scisciò, Massimiliano; Barberio, Marianna; Antici, Patrizio

    2017-05-01

    Laser-driven particle acceleration has become a growing field of research, in particular for its numerous interesting applications. One of the most common proton acceleration mechanism that is obtained on typically available multi-hundred TW laser systems is based on the irradiation of thin solid metal foils by the intense laser, generating the proton acceleration on its rear target surface. The efficiency of this acceleration scheme strongly depends on the type of target used. Improving the acceleration mechanism, i.e. enhancing parameters such as maximum proton energy, laminarity, efficiency, monocromaticy, and number of accelerated particles, is heavily depending on the laser-to-target absorption, where obviously cheap and easy to implement targets are best candidates. In this work, we present nanostructured targets that are able to increase the absorption of light compared to what can be achieved with a classical solid (non-nanostructured) target and are produced with a method that is much simpler and cheaper than conventional lithographic processes. Several layers of gold nanoparticles were deposited on solid targets (aluminum, Mylar and multiwalled carbon nanotube buckypaper) and allow for an increased photon absorption. This ultimately permits to increase the laser-to-particle energy transfer, and thus to enhance the yield in proton production. Experimental characterization results on the nanostructured films are presented (UV-Vis spectroscopy and AFM), along with preliminary experimental proton spectra obtained at the JLF-TITAN laser facility at LLNL.

  4. Mapping repulsive to attractive interaction in driven-dissipative quantum systems

    NASA Astrophysics Data System (ADS)

    Li, Andy C. Y.; Koch, Jens

    2017-11-01

    Repulsive and attractive interactions usually lead to very different physics. Striking exceptions exist in the dynamics of driven-dissipative quantum systems. For the example of a photonic Bose-Hubbard dimer, we establish a one-to-one mapping relating cases of onsite repulsion and attraction. We prove that the mapping is valid for an entire class of Markovian open quantum systems with a time-reversal-invariant Hamiltonian and physically meaningful inverse-sign Hamiltonian. To underline the broad applicability of the mapping, we illustrate the one-to-one correspondence between the nonequilibrium dynamics in a geometrically frustrated spin lattice and those in a non-frustrated partner lattice.

  5. Oral formulation strategies to improve solubility of poorly water-soluble drugs.

    PubMed

    Singh, Abhishek; Worku, Zelalem Ayenew; Van den Mooter, Guy

    2011-10-01

    In the past two decades, there has been a spiraling increase in the complexity and specificity of drug-receptor targets. It is possible to design drugs for these diverse targets with advances in combinatorial chemistry and high throughput screening. Unfortunately, but not entirely unexpectedly, these advances have been accompanied by an increase in the structural complexity and a decrease in the solubility of the active pharmaceutical ingredient. Therefore, the importance of formulation strategies to improve the solubility of poorly water-soluble drugs is inevitable, thus making it crucial to understand and explore the recent trends. Drug delivery systems (DDS), such as solid dispersions, soluble complexes, self-emulsifying drug delivery systems (SEDDS), nanocrystals and mesoporous inorganic carriers, are discussed briefly in this review, along with examples of marketed products. This article provides the reader with a concise overview of currently relevant formulation strategies and proposes anticipated future trends. Today, the pharmaceutical industry has at its disposal a series of reliable and scalable formulation strategies for poorly soluble drugs. However, due to a lack of understanding of the basic physical chemistry behind these strategies, formulation development is still driven by trial and error.

  6. New compact hohlraum configuration research at the 1.7 MA Z-pinch generator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kantsyrev, V. L., E-mail: victor@unr.edu; Shrestha, I. K.; Esaulov, A. A.

    A new compact Z-pinch x-ray hohlraum design with parallel-driven x-ray sources was experimentally demonstrated in a full configuration with a central target and tailored shine shields (to provide a symmetric temperature distribution on the target) at the 1.7 MA Zebra generator. This presentation reports on the joint success of two independent lines of research. One of these was the development of new sources – planar wire arrays (PWAs). PWAs turned out to be a prolific radiator. Another success was the drastic improvement in energy efficiency of pulsed-power systems, such as the Load Current Multiplier (LCM). The Zebra/LCM generator almost doubledmore » the plasma load current to 1.7 MA. The two above-mentioned innovative approaches were used in combination to produce a new compact hohlraum design for ICF, as jointly proposed by SNL and UNR. Good agreement between simulated and measured radiation temperature of the central target is shown. Experimental comparison of PWAs with planar foil liners (PFL) - another viable alternative to wire array loads at multi-MA generators show promising data. Results of research at the University of Nevada Reno allowed for the study of hohlraum coupling physics at University-scale generators. The advantages of new hohlraum design applications for multi-MA facilities with W or Au double PWAs or PFL x-ray sources are discussed.« less

  7. Active Debris Removal Using Modified Launch Vehicle Upper Stages

    NASA Astrophysics Data System (ADS)

    Nasseri, S. Ali; Emanuelli, Matteo; Raval, Siddharth; Turconi, Andrea

    2013-09-01

    During the past few years, several research programs have assessed the current state and future evolution of space debris in the Low Earth Orbit region. These studies indicate that space debris density could reach a critical level such that there will be a continuous increase in the number of debris objects, primarily driven by debris-debris collision activity known as the Kessler effect. These studies also highlight the urgency for active debris removal.An Active Debris Removal System (ADRS) is capable of approaching the debris object through a close-range rendezvous, stabilizing its attitude, establishing physical contact, and finally de-orbiting the debris object. The de-orbiting phase could be powered by propulsion systems such as chemical rockets or electrodynamic tether (EDT) systems.The aim of this project is to model and evaluate a debris removal mission in which an adapted rocket upper stage, equipped with an electrodynamic tether (EDT) system, is employed for de-orbiting a debris object. This ADRS package is installed initially as part of a launch vehicle on a normal satellite deployment mission, and a far-approach manoeuvre will be required to align the ADRS' orbit with that of the target debris. We begin by selecting a suitable target debris and launch vehicle, and then proceed with modelling the entire debris removal mission from launch to de-orbiting of the target debris object using Analytical Graphic Inc.'s Systems Tool Kit (STK).

  8. Direct measurement of kilo-tesla level magnetic field generated with laser-driven capacitor-coil target by proton deflectometry

    NASA Astrophysics Data System (ADS)

    Law, K. F. F.; Bailly-Grandvaux, M.; Morace, A.; Sakata, S.; Matsuo, K.; Kojima, S.; Lee, S.; Vaisseau, X.; Arikawa, Y.; Yogo, A.; Kondo, K.; Zhang, Z.; Bellei, C.; Santos, J. J.; Fujioka, S.; Azechi, H.

    2016-02-01

    A kilo-tesla level, quasi-static magnetic field (B-field), which is generated with an intense laser-driven capacitor-coil target, was measured by proton deflectometry with a proper plasma shielding. Proton deflectometry is a direct and reliable method to diagnose strong, mm3-scale laser-produced B-field; however, this was not successful in the previous experiment. A target-normal-sheath-accelerated proton beam is deflected by Lorentz force in the laser-produced magnetic field with the resulting deflection pattern recorded on a radiochromic film stack. A 610 ± 30 T of B-field amplitude was inferred by comparing the experimental proton pattern with Monte-Carlo calculations. The amplitude and temporal evolutions of the laser-generated B-field were also measured by a differential magnetic probe, independently confirming the proton deflectometry measurement results.

  9. Laser driven ion accelerator

    DOEpatents

    Tajima, Toshiki

    2006-04-18

    A system and method of accelerating ions in an accelerator to optimize the energy produced by a light source. Several parameters may be controlled in constructing a target used in the accelerator system to adjust performance of the accelerator system. These parameters include the material, thickness, geometry and surface of the target.

  10. Objective, Quantitative, Data-Driven Assessment of Chemical Probes.

    PubMed

    Antolin, Albert A; Tym, Joseph E; Komianou, Angeliki; Collins, Ian; Workman, Paul; Al-Lazikani, Bissan

    2018-02-15

    Chemical probes are essential tools for understanding biological systems and for target validation, yet selecting probes for biomedical research is rarely based on objective assessment of all potential compounds. Here, we describe the Probe Miner: Chemical Probes Objective Assessment resource, capitalizing on the plethora of public medicinal chemistry data to empower quantitative, objective, data-driven evaluation of chemical probes. We assess >1.8 million compounds for their suitability as chemical tools against 2,220 human targets and dissect the biases and limitations encountered. Probe Miner represents a valuable resource to aid the identification of potential chemical probes, particularly when used alongside expert curation. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Numerical study of core formation of asymmetrically driven cone-guided targets

    DOE PAGES

    Sawada, Hiroshi; Sakagami, Hitoshi

    2017-09-22

    Compression of a directly driven fast ignition cone-sphere target with a finite number of laser beams is numerically studied using a three-dimensional hydrodynamics code IMPACT-3D. The formation of a dense plasma core is simulated for 12-, 9-, 6-, and 4-beam configurations of the GEKKO XII laser. The complex 3D shapes of the cores are analyzed by elucidating synthetic 2D x-ray radiographic images in two orthogonal directions. Finally, the simulated x-ray images show significant differences in the core shape between the two viewing directions and rotation of the stagnating core axis in the top view for the axisymmetric 9- and 6-beammore » configurations.« less

  12. Intravascular ultrasound guided directional atherectomy versus directional atherectomy guided by angiography for the treatment of femoropopliteal in-stent restenosis.

    PubMed

    Krishnan, Prakash; Tarricone, Arthur; K-Raman, Purushothaman; Majeed, Farhan; Kapur, Vishal; Gujja, Karthik; Wiley, Jose; Vasquez, Miguel; Lascano, Rheoneil A; Quiles, Katherine G; Distin, Tashanne; Fontenelle, Ran; Atallah-Lajam, Farah; Kini, Annapoorna; Sharma, Samin

    2018-01-01

    The aim of this study was to compare 1-year outcomes for patients with femoropopliteal in-stent restenosis using directional atherectomy guided by intravascular ultrasound (IVUS) versus directional atherectomy guided by angiography. This was a retrospective analysis for patients with femoropopliteal in-stent restenosis treated with IVUS-guided directional atherectomy versus directional atherectomy guided by angiography from a single center between March 2012 and February 2016. Clinically driven target lesion revascularization was the primary endpoint and was evaluated through medical chart review as well as phone call follow up. Directional atherectomy guided by IVUS reduces clinically driven target lesion revascularization for patients with femoropopliteal in-stent restenosis.

  13. Numerical study of core formation of asymmetrically driven cone-guided targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sawada, Hiroshi; Sakagami, Hitoshi

    Compression of a directly driven fast ignition cone-sphere target with a finite number of laser beams is numerically studied using a three-dimensional hydrodynamics code IMPACT-3D. The formation of a dense plasma core is simulated for 12-, 9-, 6-, and 4-beam configurations of the GEKKO XII laser. The complex 3D shapes of the cores are analyzed by elucidating synthetic 2D x-ray radiographic images in two orthogonal directions. Finally, the simulated x-ray images show significant differences in the core shape between the two viewing directions and rotation of the stagnating core axis in the top view for the axisymmetric 9- and 6-beammore » configurations.« less

  14. 2016 New Horizons Lecture: Beyond Imaging-Radiology of Tomorrow.

    PubMed

    Hricak, Hedvig

    2018-03-01

    This article is based on the New Horizons lecture delivered at the 2016 Radiological Society of North America Annual Meeting. It addresses looming changes for radiology, many of which stem from the disruptive effects of the Fourth Industrial Revolution. This is an emerging era of unprecedented rapid innovation marked by the integration of diverse disciplines and technologies, including data science, machine learning, and artificial intelligence-technologies that narrow the gap between man and machine. Technologic advances and the convergence of life sciences, physical sciences, and bioengineering are creating extraordinary opportunities in diagnostic radiology, image-guided therapy, targeted radionuclide therapy, and radiology informatics, including radiologic image analysis. This article uses the example of oncology to make the case that, if members in the field of radiology continue to be innovative and continuously reinvent themselves, radiology can play an ever-increasing role in both precision medicine and value-driven health care. © RSNA, 2018.

  15. [Nanotechnology: a big revolution from the small world].

    PubMed

    Bassi, Matteo; Santinello, Irene; Bevilacqua, Andrea; Bassi, Pierfrancesco

    2013-01-01

    Nanotechnology is a multidisciplinary field originating from the interaction of several different disciplines, such as engineering, physics, biology and chemistry. New materials and devices effectively interact with the body at molecular level, yielding a brand new range of highly selective and targeted applications designed to maximize the therapeutic efficiency while reducing the side effects. Liposomes, quantum dots, carbon nanotubes and superparamagnetic nanoparticles are among the most assessed nanotechnologies. Meanwhile, other futuristic platforms are paving the way toward a new scientific paradigm, able to deeply change the research path in the medical science. The growth of nanotechnology, driven by the dramatic advances in science and technology, clearly creates new opportunities for the development of the medical science and disease treatment in human health care. Despite the concerns and the on-going studies about their safety, nanotechnology clearly emerges as holding the promise of delivering one of the greatest breakthroughs in the history of medical science.

  16. Capsule performance optimization in the National Ignition Campaigna)

    NASA Astrophysics Data System (ADS)

    Landen, O. L.; Boehly, T. R.; Bradley, D. K.; Braun, D. G.; Callahan, D. A.; Celliers, P. M.; Collins, G. W.; Dewald, E. L.; Divol, L.; Glenzer, S. H.; Hamza, A.; Hicks, D. G.; Hoffman, N.; Izumi, N.; Jones, O. S.; Kirkwood, R. K.; Kyrala, G. A.; Michel, P.; Milovich, J.; Munro, D. H.; Nikroo, A.; Olson, R. E.; Robey, H. F.; Spears, B. K.; Thomas, C. A.; Weber, S. V.; Wilson, D. C.; Marinak, M. M.; Suter, L. J.; Hammel, B. A.; Meyerhofer, D. D.; Atherton, J.; Edwards, J.; Haan, S. W.; Lindl, J. D.; MacGowan, B. J.; Moses, E. I.

    2010-05-01

    A capsule performance optimization campaign will be conducted at the National Ignition Facility [G. H. Miller et al., Nucl. Fusion 44, 228 (2004)] to substantially increase the probability of ignition by laser-driven hohlraums [J. D. Lindl et al., Phys. Plasmas 11, 339 (2004)]. The campaign will experimentally correct for residual uncertainties in the implosion and hohlraum physics used in our radiation-hydrodynamic computational models before proceeding to cryogenic-layered implosions and ignition attempts. The required tuning techniques using a variety of ignition capsule surrogates have been demonstrated at the OMEGA facility under scaled hohlraum and capsule conditions relevant to the ignition design and shown to meet the required sensitivity and accuracy. In addition, a roll-up of all expected random and systematic uncertainties in setting the key ignition laser and target parameters due to residual measurement, calibration, cross-coupling, surrogacy, and scale-up errors has been derived that meets the required budget.

  17. Capsule performance optimization in the National Ignition Campaign

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Landen, O. L.; Bradley, D. K.; Braun, D. G.

    2010-05-15

    A capsule performance optimization campaign will be conducted at the National Ignition Facility [G. H. Miller et al., Nucl. Fusion 44, 228 (2004)] to substantially increase the probability of ignition by laser-driven hohlraums [J. D. Lindl et al., Phys. Plasmas 11, 339 (2004)]. The campaign will experimentally correct for residual uncertainties in the implosion and hohlraum physics used in our radiation-hydrodynamic computational models before proceeding to cryogenic-layered implosions and ignition attempts. The required tuning techniques using a variety of ignition capsule surrogates have been demonstrated at the OMEGA facility under scaled hohlraum and capsule conditions relevant to the ignition designmore » and shown to meet the required sensitivity and accuracy. In addition, a roll-up of all expected random and systematic uncertainties in setting the key ignition laser and target parameters due to residual measurement, calibration, cross-coupling, surrogacy, and scale-up errors has been derived that meets the required budget.« less

  18. Broadband Laser Ranging for Position Measurements in Shock Physics Experiments

    NASA Astrophysics Data System (ADS)

    Rhodes, Michelle; Bennett, Corey; Daykin, Edward; Younk, Patrick; Lalone, Brandon; Kostinski, Natalie

    2017-06-01

    Broadband laser ranging (BLR) is a recently developed measurement system that provides an attractive option for determining the position of shock-driven surfaces. This system uses broadband, picosecond (or femtosecond) laser pulses and a fiber interferometer to measure relative travel time to a target and to a reference mirror. The difference in travel time produces a delay difference between pulse replicas that creates a spectral beat frequency. The spectral beating is recorded in real time using a dispersive Fourier transform and an oscilloscope. BLR systems have been designed that measure position at 12.5-40 MHz with better than 100 micron accuracy over ranges greater than 10 cm. We will give an overview of the basic operating principles of these systems. Prepared by LLNL under Contract DE-AC52-07NA27344, by LANL under Contract DE-AC52-06NA25396, and by NSTec Contract DE-AC52-06NA25946.

  19. Oscillation of the velvet worm slime jet by passive hydrodynamic instability

    PubMed Central

    Concha, Andrés; Mellado, Paula; Morera-Brenes, Bernal; Sampaio Costa, Cristiano; Mahadevan, L; Monge-Nájera, Julián

    2015-01-01

    The rapid squirt of a proteinaceous slime jet endows velvet worms (Onychophora) with a unique mechanism for defence from predators and for capturing prey by entangling them in a disordered web that immobilizes their target. However, to date, neither qualitative nor quantitative descriptions have been provided for this unique adaptation. Here we investigate the fast oscillatory motion of the oral papillae and the exiting liquid jet that oscillates with frequencies f~30–60 Hz. Using anatomical images, high-speed videography, theoretical analysis and a physical simulacrum, we show that this fast oscillatory motion is the result of an elastohydrodynamic instability driven by the interplay between the elasticity of oral papillae and the fast unsteady flow during squirting. Our results demonstrate how passive strategies can be cleverly harnessed by organisms, while suggesting future oscillating microfluidic devices, as well as novel ways for micro and nanofibre production using bioinspired strategies. PMID:25780995

  20. V&V Of CFD Modeling Of The Argonne Bubble Experiment: FY15 Summary Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoyt, Nathaniel C.; Wardle, Kent E.; Bailey, James L.

    2015-09-30

    In support of the development of accelerator-driven production of the fission product Mo 99, computational fluid dynamics (CFD) simulations of an electron-beam irradiated, experimental-scale bubble chamber have been conducted in order to aid in interpretation of existing experimental results, provide additional insights into the physical phenomena, and develop predictive thermal hydraulic capabilities that can be applied to full-scale target solution vessels. Toward that end, a custom hybrid Eulerian-Eulerian-Lagrangian multiphase solver was developed, and simulations have been performed on high-resolution meshes. Good agreement between experiments and simulations has been achieved, especially with respect to the prediction of the maximum temperature ofmore » the uranyl sulfate solution in the experimental vessel. These positive results suggest that the simulation methodology that has been developed will prove to be suitable to assist in the development of full-scale production hardware.« less

  1. Modeling the mechanics of cancer: effect of changes in cellular and extra-cellular mechanical properties.

    PubMed

    Katira, Parag; Bonnecaze, Roger T; Zaman, Muhammad H

    2013-01-01

    Malignant transformation, though primarily driven by genetic mutations in cells, is also accompanied by specific changes in cellular and extra-cellular mechanical properties such as stiffness and adhesivity. As the transformed cells grow into tumors, they interact with their surroundings via physical contacts and the application of forces. These forces can lead to changes in the mechanical regulation of cell fate based on the mechanical properties of the cells and their surrounding environment. A comprehensive understanding of cancer progression requires the study of how specific changes in mechanical properties influences collective cell behavior during tumor growth and metastasis. Here we review some key results from computational models describing the effect of changes in cellular and extra-cellular mechanical properties and identify mechanistic pathways for cancer progression that can be targeted for the prediction, treatment, and prevention of cancer.

  2. Influence of Chirality in Ordered Block Copolymer Phases

    NASA Astrophysics Data System (ADS)

    Prasad, Ishan; Grason, Gregory

    2015-03-01

    Block copolymers are known to assemble into rich spectrum of ordered phases, with many complex phases driven by asymmetry in copolymer architecture. Despite decades of study, the influence of intrinsic chirality on equilibrium mesophase assembly of block copolymers is not well understood and largely unexplored. Self-consistent field theory has played a major role in prediction of physical properties of polymeric systems. Only recently, a polar orientational self-consistent field (oSCF) approach was adopted to model chiral BCP having a thermodynamic preference for cholesteric ordering in chiral segments. We implement oSCF theory for chiral nematic copolymers, where segment orientations are characterized by quadrupolar chiral interactions, and focus our study on the thermodynamic stability of bi-continuous network morphologies, and the transfer of molecular chirality to mesoscale chirality of networks. Unique photonic properties observed in butterfly wings have been attributed to presence of chiral single-gyroid networks, this has made it an attractive target for chiral metamaterial design.

  3. First-Principles-Driven Model-Based Optimal Control of the Current Profile in NSTX-U

    NASA Astrophysics Data System (ADS)

    Ilhan, Zeki; Barton, Justin; Wehner, William; Schuster, Eugenio; Gates, David; Gerhardt, Stefan; Kolemen, Egemen; Menard, Jonathan

    2014-10-01

    Regulation in time of the toroidal current profile is one of the main challenges toward the realization of the next-step operational goals for NSTX-U. A nonlinear, control-oriented, physics-based model describing the temporal evolution of the current profile is obtained by combining the magnetic diffusion equation with empirical correlations obtained at NSTX-U for the electron density, electron temperature, and non-inductive current drives. In this work, the proposed model is embedded into the control design process to synthesize a time-variant, linear-quadratic-integral, optimal controller capable of regulating the safety factor profile around a desired target profile while rejecting disturbances. Neutral beam injectors and the total plasma current are used as actuators to shape the current profile. The effectiveness of the proposed controller in regulating the safety factor profile in NSTX-U is demonstrated via closed-loop predictive simulations carried out in PTRANSP. Supported by PPPL.

  4. Cross-species identification of genomic drivers of squamous cell carcinoma development across preneoplastic intermediates

    PubMed Central

    Chitsazzadeh, Vida; Coarfa, Cristian; Drummond, Jennifer A.; Nguyen, Tri; Joseph, Aaron; Chilukuri, Suneel; Charpiot, Elizabeth; Adelmann, Charles H.; Ching, Grace; Nguyen, Tran N.; Nicholas, Courtney; Thomas, Valencia D.; Migden, Michael; MacFarlane, Deborah; Thompson, Erika; Shen, Jianjun; Takata, Yoko; McNiece, Kayla; Polansky, Maxim A.; Abbas, Hussein A.; Rajapakshe, Kimal; Gower, Adam; Spira, Avrum; Covington, Kyle R.; Xiao, Weimin; Gunaratne, Preethi; Pickering, Curtis; Frederick, Mitchell; Myers, Jeffrey N.; Shen, Li; Yao, Hui; Su, Xiaoping; Rapini, Ronald P.; Wheeler, David A.; Hawk, Ernest T.; Flores, Elsa R.; Tsai, Kenneth Y.

    2016-01-01

    Cutaneous squamous cell carcinoma (cuSCC) comprises 15–20% of all skin cancers, accounting for over 700,000 cases in USA annually. Most cuSCC arise in association with a distinct precancerous lesion, the actinic keratosis (AK). To identify potential targets for molecularly targeted chemoprevention, here we perform integrated cross-species genomic analysis of cuSCC development through the preneoplastic AK stage using matched human samples and a solar ultraviolet radiation-driven Hairless mouse model. We identify the major transcriptional drivers of this progression sequence, showing that the key genomic changes in cuSCC development occur in the normal skin to AK transition. Our data validate the use of this ultraviolet radiation-driven mouse cuSCC model for cross-species analysis and demonstrate that cuSCC bears deep molecular similarities to multiple carcinogen-driven SCCs from diverse sites, suggesting that cuSCC may serve as an effective, accessible model for multiple SCC types and that common treatment and prevention strategies may be feasible. PMID:27574101

  5. Energetic electrons driven in the polarization direction of an intense laser beam incident normal to a solid target

    DOE PAGES

    Seely, J. F.; Hudson, L. T.; Pereira, N.; ...

    2016-02-24

    Experiments were performed at the LLNL Titan laser to measure the propagation direction of the energetic electrons that were generated during the interaction of the polarized laser beam with solid targets in the case of normal incidence. The energetic electrons propagated through vacuum to spectator metal wires in the polarization direction and in the perpendicular direction, and the K shell spectra from the different wire materials were recorded as functions of the distance from the laser focal spot. It was found that the fluence of the energetic electrons driven into the spectator wires in the polarization direction compared to themore » perpendicular direction was larger and increased with the distance from the focal spot. Finally, this indicates that energetic electrons are preferentially driven in the direction of the intense oscillating electric field of the incident laser beam in agreement with the multiphoton inverse Bremsstrahlung absorption process.« less

  6. Advances in Electrically Driven Thermal Management

    NASA Technical Reports Server (NTRS)

    Didion, Jeffrey R.

    2017-01-01

    Electrically Driven Thermal Management is a vibrant technology development initiative incorporating ISS based technology demonstrations, development of innovative fluid management techniques and fundamental research efforts. The program emphasizes high temperature high heat flux thermal management required for future generations of RF electronics and power electronic devices. This presentation reviews i.) preliminary results from the Electrohydrodynamic (EHD) Long Term Flight Demonstration launched on STP-H5 payload in February 2017 ii.) advances in liquid phase flow distribution control iii.) development of the Electrically Driven Liquid Film Boiling Experiment under the NASA Microgravity Fluid Physics Program.

  7. miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

    PubMed Central

    Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

    2015-01-01

    RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

  8. Data-driven risk identification in phase III clinical trials using central statistical monitoring.

    PubMed

    Timmermans, Catherine; Venet, David; Burzykowski, Tomasz

    2016-02-01

    Our interest lies in quality control for clinical trials, in the context of risk-based monitoring (RBM). We specifically study the use of central statistical monitoring (CSM) to support RBM. Under an RBM paradigm, we claim that CSM has a key role to play in identifying the "risks to the most critical data elements and processes" that will drive targeted oversight. In order to support this claim, we first see how to characterize the risks that may affect clinical trials. We then discuss how CSM can be understood as a tool for providing a set of data-driven key risk indicators (KRIs), which help to organize adaptive targeted monitoring. Several case studies are provided where issues in a clinical trial have been identified thanks to targeted investigation after the identification of a risk using CSM. Using CSM to build data-driven KRIs helps to identify different kinds of issues in clinical trials. This ability is directly linked with the exhaustiveness of the CSM approach and its flexibility in the definition of the risks that are searched for when identifying the KRIs. In practice, a CSM assessment of the clinical database seems essential to ensure data quality. The atypical data patterns found in some centers and variables are seen as KRIs under a RBM approach. Targeted monitoring or data management queries can be used to confirm whether the KRIs point to an actual issue or not.

  9. A retrospective review of safety using a nursing driven protocol for autonomic dysreflexia in patients with spinal cord injuries.

    PubMed

    Solinsky, Ryan; Svircev, Jelena N; James, Jennifer J; Burns, Stephen P; Bunnell, Aaron E

    2016-11-01

    Autonomic dysreflexia is a potentially life-threatening condition which afflicts a significant proportion of individuals with spinal cord injuries (SCI). To date, the safety and efficacy of several commonly used interventions for this condition have not been studied. A retrospective chart review of the safety of a previously implemented nursing driven inpatient autonomic dysreflexia protocol. Seventy-eight male patients with SCI who experienced autonomic dysreflexia while inpatient at our Veterans Affairs SCI unit over a 3-1/2-year period were included. The safety of a nursing driven protocol utilizing conservative measures, nitroglycerin paste, and oral hydralazine was evaluated. Occurrence of adverse events and relative hypotensive events during all episodes treated with the protocol, and efficacy of attaining target blood pressure for all episodes with protocol adherence and for initial episode experienced by each patient. Four hundred forty-five episodes of autonomic dysreflexia were recorded in the study period, with 92% adherence to the protocol. When the protocol was followed, target blood pressure was achieved for 97.6% of all episodes. Twenty-three total adverse events occurred (5.2% of all episodes). All adverse events were due to hypotension and only 0.9% required interventions beyond clinical monitoring. Of each patient's initial autonomic dysreflexia episode, 97.3% resolved using the protocol without need for further escalation of care. This inpatient nursing driven-protocol for treating autonomic dysreflexia utilizing conservative measures, nitroglycerin paste and oral hydralazine achieved target blood pressure with a high success rate and a low incidence of adverse events.

  10. Using Distractor-Driven Standards-Based Multiple-Choice Assessments and Rasch Modeling to Investigate Hierarchies of Chemistry Misconceptions and Detect Structural Problems with Individual Items

    ERIC Educational Resources Information Center

    Herrmann-Abell, Cari F.; DeBoer, George E.

    2011-01-01

    Distractor-driven multiple-choice assessment items and Rasch modeling were used as diagnostic tools to investigate students' understanding of middle school chemistry ideas. Ninety-one items were developed according to a procedure that ensured content alignment to the targeted standards and construct validity. The items were administered to 13360…

  11. The GBS code for tokamak scrape-off layer simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halpern, F.D., E-mail: federico.halpern@epfl.ch; Ricci, P.; Jolliet, S.

    2016-06-15

    We describe a new version of GBS, a 3D global, flux-driven plasma turbulence code to simulate the turbulent dynamics in the tokamak scrape-off layer (SOL), superseding the code presented by Ricci et al. (2012) [14]. The present work is driven by the objective of studying SOL turbulent dynamics in medium size tokamaks and beyond with a high-fidelity physics model. We emphasize an intertwining framework of improved physics models and the computational improvements that allow them. The model extensions include neutral atom physics, finite ion temperature, the addition of a closed field line region, and a non-Boussinesq treatment of the polarizationmore » drift. GBS has been completely refactored with the introduction of a 3-D Cartesian communicator and a scalable parallel multigrid solver. We report dramatically enhanced parallel scalability, with the possibility of treating electromagnetic fluctuations very efficiently. The method of manufactured solutions as a verification process has been carried out for this new code version, demonstrating the correct implementation of the physical model.« less

  12. Now That We're "Well Rounded," Let's Commit to Quality Physical Education Assessment

    ERIC Educational Resources Information Center

    Sundaresan, Nirup; Dashoush, Nermeen; Shangraw, Rebecca

    2017-01-01

    With the authorization of the Every Student Succeeds Act (ESSA) in December 2015, the role of physical education in public schools has the potential to change significantly. It is imperative that physical education be supported by assessment-driven evidence in order to reach and speak to legislators, national boards, school administrators,…

  13. Using a SWOT analysis to inform healthy eating and physical activity strategies for a remote First Nations community in Canada.

    PubMed

    Skinner, Kelly; Hanning, Rhona M; Sutherland, Celine; Edwards-Wheesk, Ruby; Tsuji, Leonard J S

    2012-01-01

    To plan community-driven health promotion strategies based on a strengths, weaknesses, opportunities, and threats (SWOT) analysis of the healthy eating and physical activity patterns of First Nation (FN) youth. Cross-sectional qualitative and quantitative data used to develop SWOT themes and strategies. Remote, subarctic FN community of Fort Albany, Ontario, Canada. Adult (n  =  25) and youth (n  =  66, grades 6-11) community members. Qualitative data were collected using five focus groups with adults (two focus groups) and youth (three focus groups), seven individual interviews with adults, and an environmental scan of 13 direct observations of events/locations (e.g., the grocery store). Quantitative data on food/physical activity behaviors were collected using a validated Web-based survey with youth. Themes were identified from qualitative and quantitative data and were analyzed and interpreted within a SWOT matrix. Thirty-two SWOT themes were identified (e.g., accessibility of existing facilities, such as the gymnasium). The SWOT analysis showed how these themes could be combined and transformed into 12 strategies (e.g., expanding and enhancing the school snack/breakfast program) while integrating suggestions from the community. SWOT analysis was a beneficial tool that facilitated the combination of local data and community ideas in the development of targeted health promotion strategies for the FN community of Fort Albany.

  14. Propagation of a laser-driven relativistic electron beam inside a solid dielectric.

    PubMed

    Sarkisov, G S; Ivanov, V V; Leblanc, P; Sentoku, Y; Yates, K; Wiewior, P; Chalyy, O; Astanovitskiy, A; Bychenkov, V Yu; Jobe, D; Spielman, R B

    2012-09-01

    Laser probe diagnostics: shadowgraphy, interferometry, and polarimetry were used for a comprehensive characterization of ionization wave dynamics inside a glass target induced by a laser-driven, relativistic electron beam. Experiments were done using the 50-TW Leopard laser at the University of Nevada, Reno. We show that for a laser flux of ∼2 × 10(18) W/cm2 a hemispherical ionization wave propagates at c/3 for 10 ps and has a smooth electron-density distribution. The maximum free-electron density inside the glass target is ∼2 × 10(19) cm-3, which corresponds to an ionization level of ∼0.1%. Magnetic fields and electric fields do not exceed ∼15 kG and ∼1 MV/cm, respectively. The electron temperature has a hot, ringlike structure with a maximum of ∼0.7 eV. The topology of the interference phase shift shows the signature of the "fountain effect", a narrow electron beam that fans out from the propagation axis and heads back to the target surface. Two-dimensional particle-in-cell (PIC) computer simulations demonstrate radial spreading of fast electrons by self-consistent electrostatic fields driven by laser. The very low ionization observed after the laser heating pulse suggests a fast recombination on the sub-ps time scale.

  15. Theory-driven intervention for changing personality: expectancy value theory, behavioral activation, and conscientiousness.

    PubMed

    Magidson, Jessica F; Roberts, Brent W; Collado-Rodriguez, Anahi; Lejuez, C W

    2014-05-01

    Considerable evidence suggests that personality traits may be changeable, raising the possibility that personality traits most linked to health problems can be modified with intervention. A growing body of research suggests that problematic personality traits may be altered with behavioral intervention using a bottom-up approach. That is, by targeting core behaviors that underlie personality traits with the goal of engendering new, healthier patterns of behavior that, over time, become automatized and manifest in changes in personality traits. Nevertheless, a bottom-up model for changing personality traits is somewhat diffuse and requires clearer integration of theory and relevant interventions to enable real clinical application. As such, this article proposes a set of guiding principles for theory-driven modification of targeted personality traits using a bottom-up approach, focusing specifically on targeting the trait of conscientiousness using a relevant behavioral intervention, Behavioral Activation (BA), considered within the motivational framework of expectancy value theory (EVT). We conclude with a real case example of the application of BA to alter behaviors counter to conscientiousness in a substance-dependent patient, highlighting the EVT principles most relevant to the approach and the importance and viability of a theoretically driven, bottom-up approach to changing personality traits. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  16. Review on the Modeling of Electrostatic MEMS

    PubMed Central

    Chuang, Wan-Chun; Lee, Hsin-Li; Chang, Pei-Zen; Hu, Yuh-Chung

    2010-01-01

    Electrostatic-driven microelectromechanical systems devices, in most cases, consist of couplings of such energy domains as electromechanics, optical electricity, thermoelectricity, and electromagnetism. Their nonlinear working state makes their analysis complex and complicated. This article introduces the physical model of pull-in voltage, dynamic characteristic analysis, air damping effect, reliability, numerical modeling method, and application of electrostatic-driven MEMS devices. PMID:22219707

  17. Hypothesis-driven physical examination curriculum.

    PubMed

    Allen, Sharon; Olson, Andrew; Menk, Jeremiah; Nixon, James

    2017-12-01

    Medical students traditionally learn physical examination skills as a rote list of manoeuvres. Alternatives like hypothesis-driven physical examination (HDPE) may promote students' understanding of the contribution of physical examination to diagnostic reasoning. We sought to determine whether first-year medical students can effectively learn to perform a physical examination using an HDPE approach, and then tailor the examination to specific clinical scenarios. Medical students traditionally learn physical examination skills as a rote list of manoeuvres CONTEXT: First-year medical students at the University of Minnesota were taught both traditional and HDPE approaches during a required 17-week clinical skills course in their first semester. The end-of-course evaluation assessed HDPE skills: students were assigned one of two cardiopulmonary cases. Each case included two diagnostic hypotheses. During an interaction with a standardised patient, students were asked to select physical examination manoeuvres in order to make a final diagnosis. Items were weighted and selection order was recorded. First-year students with minimal pathophysiology performed well. All students selected the correct diagnosis. Importantly, students varied the order when selecting examination manoeuvres depending on the diagnoses under consideration, demonstrating early clinical decision-making skills. An early introduction to HDPE may reinforce physical examination skills for hypothesis generation and testing, and can foster early clinical decision-making skills. This has important implications for further research in physical examination instruction. © 2016 John Wiley & Sons Ltd and The Association for the Study of Medical Education.

  18. An assessment of the evaporation and condensation phenomena of lithium during the operation of a Li(d,xn) fusion relevant neutron source.

    PubMed

    Knaster, J; Kanemura, T; Kondo, K

    2016-12-01

    The flowing lithium target of a Li(d,xn) fusion relevant neutron source must evacuate the deuteron beam power and generate in a stable manner a flux of neutrons with a broad peak at 14 MeV capable to cause similar phenomena as would undergo the structural materials of plasma facing components of a DEMO like reactors. Whereas the physics of the beam-target interaction are understood and the stability of the lithium screen flowing at the nominal conditions of IFMIF (25 mm thick screen with +/-1 mm surface amplitudes flowing at 15 m/s and 523 K) has been demonstrated, a conclusive assessment of the evaporation and condensation of lithium during operation was missing. First attempts to determine evaporation rates started by Hertz in 1882 and have since been subject of continuous efforts driven by its practical importance; however intense surface evaporation is essentially a non-equilibrium process with its inherent theoretical difficulties. Hertz-Knudsen-Langmuir (HKL) equation with Schrage's 'accommodation factor' η = 1.66 provide excellent agreement with experiments for weak evaporation under certain conditions, which are present during a Li(d,xn) facility operation. An assessment of the impact under the known operational conditions for IFMIF (574 K and 10 -3 Pa on the free surface), with the sticking probability of 1 inherent to a hot lithium gas contained in room temperature steel walls, is carried out. An explanation of the main physical concepts to adequately place needed assumptions is included.

  19. I'm hot, so i'd say you're not: the influence of objective physical attractiveness on mate selection.

    PubMed

    Montoya, R Matthew

    2008-10-01

    Four studies investigated the importance of objective and subjective attributes to mate selection. This research tested whether perceivers' objective physical attractiveness influenced how they evaluated the physical attractiveness of others and, if considered, may provide a parsimonious account for matching in mate selection. Study 1 (N = 102) demonstrated that ratings of targets' attractiveness decreased as perceivers' objective physical attractiveness increased. Studies 2 (N = 89) and 3 (N = 68) revealed that as perceivers' objective physical attractiveness increased, reductions in expected satisfaction and rejection were mediated by perceivers' reduced assessments of targets' attractiveness. Study 4 (N = 114) produced patterns of matching by finding that attractive perceivers expected to date more attractive targets while unattractive perceivers expected to date less attractive targets. This research emphasizes the importance of objective physical attractiveness to target evaluations and describes how matching results from the combined influence of objective and subjective attributes.

  20. Gamma source for active interrogation

    DOEpatents

    Leung, Ka-Ngo; Lou, Tak Pui; Barletta, William A.

    2012-10-02

    A cylindrical gamma generator includes a coaxial RF-driven plasma ion source and target. A hydrogen plasma is produced by RF excitation in a cylindrical plasma ion generator using an RF antenna. A cylindrical gamma generating target is coaxial with the ion generator, separated by plasma and extraction electrodes which has many openings. The plasma generator emanates ions radially over 360.degree. and the cylindrical target is thus irradiated by ions over its entire circumference. The plasma generator and target may be as long as desired.

  1. Gamma source for active interrogation

    DOEpatents

    Leung, Ka-Ngo [Hercules, CA; Lou, Tak Pui [Berkeley, CA; Barletta, William A [Oakland, CA

    2009-09-29

    A cylindrical gamma generator includes a coaxial RF-driven plasma ion source and target. A hydrogen plasma is produced by RF excitation in a cylindrical plasma ion generator using an RF antenna. A cylindrical gamma generating target is coaxial with the ion generator, separated by plasma and extraction electrodes which has many openings. The plasma generator emanates ions radially over 360.degree. and the cylindrical target is thus irradiated by ions over its entire circumference. The plasma generator and target may be as long as desired.

  2. Method and apparatus for producing cryogenic targets

    DOEpatents

    Murphy, J.T.; Miller, J.R.

    1984-08-07

    An improved method and apparatus are given for producing cryogenic inertially driven fusion targets in the fast isothermal freezing (FIF) method. Improved coupling efficiency and greater availability of volume near the target for diagnostic purposes and for fusion driver beam propagation result. Other embodiments include a new electrical switch and a new explosive detonator, all embodiments making use of a purposeful heating by means of optical fibers. 6 figs.

  3. Shock-induced perturbation evolution in planar laser targets

    NASA Astrophysics Data System (ADS)

    Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J. L.; Kessler, T. J.; Schmitt, A. J.; Obenschain, S. P.; Metzler, N.; Oh, J.

    2013-10-01

    Experimental studies of hydrodynamic perturbation evolution triggered by a laser-driven shock wave in a planar target done on the KrF Nike laser facility are reported. The targets were made of solid plastic and/or plastic foam with single mode sinusoidal perturbation on the front or back surface or plastic/foam interface. Two specific cases are discussed. When a planar solid plastic target rippled at the front side is irradiated with a 350 ps long laser pulse, ablative Richtmyer-Meshkov (RM) oscillation of its areal mass modulation amplitude is detected while the laser is on, followed by observed strong oscillations of the areal mass in the unsupported shock flow after the laser pulse ends. When the target is rippled at the rear side, the nature of the perturbation evolution after the shock breakout is determined by the strength of the laser-driven shock wave. At pressure below 1 Mbar shock interaction with rear-surface ripples produces planar collimated jets manifesting the development of a classical RM instability in a weakly compressible shocked fluid. At shock pressure ~ 8 Mbar sufficient for vaporizing the shocked target material we observed instead the strong areal mass oscillations characteristic of a rippled centered rarefaction wave. Work supported by US DOE, Defense Programs.

  4. Novel Anti-CRR9/CLPTM1L Antibodies with Antitumorigenic Activity Inhibit Cell Surface Accumulation, PI3K Interaction, and Survival Signaling

    PubMed Central

    Puskás, László G.; Mán, Imola; Szebeni, Gabor; Tiszlavicz, László; Tsai, Susan; James, Michael A.

    2016-01-01

    We and others have recently shown Cisplatin Resistance-Related Protein 9 (CRR9)/Cleft Lip and Palate Transmembrane 1-Like (CLPTM1L) to affect survival and proliferation in lung and pancreatic tumor cells. Our research has indicated that CLPTM1L affects multiple survival signaling pathways in tumor cells under oncogenic, genotoxic, and microenvironmental stress. We have confirmed the association of CLPTM1L with pancreatic cancer by demonstrating overexpression of CLPTM1L in pancreatic tumors and poor survival in patients with high tumor expression of CLPTM1L. Predicting a transmembrane structure, we determined that CLPTM1L could be targeted at the plasma membrane. Herein, we describe the development of monoclonal antibodies targeting CLPTM1L. Lead antibodies inhibited surface accumulation of CLPTM1L, Akt phosphorylation, anchorage-independent growth, and chemotherapeutic resistance in lung and pancreatic tumor cells. Gemcitabine promoted a physical interaction between CLPTM1L and p110α in pancreatic tumor cells, which was inhibited by anti-CLPTM1L. In-vivo treatment with anti-CLPTM1L robustly inhibited the growth of both lung and pancreatic adenocarcinoma xenografts. The efficacy of anti-CLPTM1L correlated with specific epitopes representing important targets in human cancers, particularly those driven by KRas, for which effective targeted therapies have been elusive. This study is the first to report cell-surface exposure of the tumor survival protein CLPTM1L and inhibition of the function of surface CLPTM1L with novel, systematically developed inhibitory monoclonal antibodies establishing proof of concept of clinically practical agents inhibiting this compelling new tumor survival target in cancer. PMID:26939707

  5. A biomechanical modeling-guided simultaneous motion estimation and image reconstruction technique (SMEIR-Bio) for 4D-CBCT reconstruction

    NASA Astrophysics Data System (ADS)

    Huang, Xiaokun; Zhang, You; Wang, Jing

    2018-02-01

    Reconstructing four-dimensional cone-beam computed tomography (4D-CBCT) images directly from respiratory phase-sorted traditional 3D-CBCT projections can capture target motion trajectory, reduce motion artifacts, and reduce imaging dose and time. However, the limited numbers of projections in each phase after phase-sorting decreases CBCT image quality under traditional reconstruction techniques. To address this problem, we developed a simultaneous motion estimation and image reconstruction (SMEIR) algorithm, an iterative method that can reconstruct higher quality 4D-CBCT images from limited projections using an inter-phase intensity-driven motion model. However, the accuracy of the intensity-driven motion model is limited in regions with fine details whose quality is degraded due to insufficient projection number, which consequently degrades the reconstructed image quality in corresponding regions. In this study, we developed a new 4D-CBCT reconstruction algorithm by introducing biomechanical modeling into SMEIR (SMEIR-Bio) to boost the accuracy of the motion model in regions with small fine structures. The biomechanical modeling uses tetrahedral meshes to model organs of interest and solves internal organ motion using tissue elasticity parameters and mesh boundary conditions. This physics-driven approach enhances the accuracy of solved motion in the organ’s fine structures regions. This study used 11 lung patient cases to evaluate the performance of SMEIR-Bio, making both qualitative and quantitative comparisons between SMEIR-Bio, SMEIR, and the algebraic reconstruction technique with total variation regularization (ART-TV). The reconstruction results suggest that SMEIR-Bio improves the motion model’s accuracy in regions containing small fine details, which consequently enhances the accuracy and quality of the reconstructed 4D-CBCT images.

  6. Goal-driven selective attention in patients with right hemisphere lesions: how intact is the ipsilesional field?

    PubMed

    Snow, Jacqueline C; Mattingley, Jason B

    2006-01-01

    Patients with right hemisphere (RH) lesions often display a spatial bias in attention towards the ipsilesional hemifield. The behavioural manifestations of this spatial bias are typically interpreted as reflecting increased or enhanced attention for stimuli within the 'intact' ipsilesional field, and impaired attentional functioning within the contralesional field. In the healthy brain, goal-driven and stimulus-driven attentional processes interact to determine which stimuli should be prioritized for selection. Although unilateral brain damage increases the relative attentional salience of stimuli within the ipsilesional field, it might also cause problems in filtering or attenuating task-irrelevant information. We examined whether goal-driven attention modulates the processing of ipsilesional and contralesional information in 6 patients with unilateral brain damage following RH stroke (5 male, 1 female; mean age 60.8 years) and a group of age and sex-matched controls. We used a flanker task in which participants made speeded judgements on a central target item (a coloured letter). On each trial the target was flanked by a coloured letter in the left and right hemifields. In separate blocks, participants were instructed to judge either the identity or the colour of the central target and to ignore the flankers. The flanker on one side could be congruent, incongruent or neutral with respect to the target, on either the letter or the colour dimension, whereas the flanker on the other side was always neutral on both dimensions. Healthy controls showed significant interference from incongruent flankers on either side. Crucially, however, this effect only occurred for the task-relevant dimension [F(2,10) = 24.60; P < 0.001]. For patients, however, both the task-relevant and task-irrelevant dimensions of ipsilesional flankers interfered with response times [task-relevant: F(2,10) = 7.50, P < 0.05; task-irrelevant: F(1,5) = 6.20, P < 0.05]. Conversely, contralesional flankers influenced response times only when the target and distractor were incongruent on the task-relevant dimension [F(2,10) = 4.85; P < 0.05]. Our findings demonstrate that following RH damage, goal-driven biases cannot constrain the processing of task-irrelevant features of ipsilesional stimuli. We speculate that a lateralized bias in spatial attention leads to unselective prioritization of all feature-based attributes of stimuli appearing within the ipsilesional hemifield, whether or not they are relevant to performance. Attentional selection for ipsilesional stimuli in disorders such as spatial neglect and extinction may not therefore be entirely normal, as previously assumed.

  7. Case Studies of Physics Graduates' Personal Theories of Evolution

    ERIC Educational Resources Information Center

    Chan, Ke-Sheng

    2005-01-01

    This paper reports an interview case study with two physics doctoral students designed to explore their conceptions about the theory of evolution. Analysis of interview transcripts reveals that both students mistakenly constructed a "theory of evolution by environmentally driven adaptation" instead of the commonly accepted "theory…

  8. Target-Driven Reforms: Education for All and the Translations of Equity and Inclusion in India

    ERIC Educational Resources Information Center

    Mukhopadhyay, Rahul; Sriprakash, Arathi

    2013-01-01

    This paper critically examines the ways in which inclusion and equity are constituted through education development policies in India. Programmes implemented under global and national Education for All (EFA) policies have largely involved the quantification of "equity" whereby schooling processes are measured against broad targets for…

  9. Development and characterization of plasma targets for controlled injection of electrons into laser-driven wakefields

    NASA Astrophysics Data System (ADS)

    Kleinwaechter, Tobias; Goldberg, Lars; Palmer, Charlotte; Schaper, Lucas; Schwinkendorf, Jan-Patrick; Osterhoff, Jens

    2012-10-01

    Laser-driven wakefield acceleration within capillary discharge waveguides has been used to generate high-quality electron bunches with GeV-scale energies. However, owing to fluctuations in laser and plasma conditions in combination with a difficult to control self-injection mechanism in the non-linear wakefield regime these bunches are often not reproducible and can feature large energy spreads. Specialized plasma targets with tailored density profiles offer the possibility to overcome these issues by controlling the injection and acceleration processes. This requires precise manipulation of the longitudinal density profile. Therefore our target concept is based on a capillary structure with multiple gas in- and outlets. Potential target designs are simulated using the fluid code OpenFOAM and those meeting the specified criteria are fabricated using femtosecond-laser machining of structures into sapphire plates. Density profiles are measured over a range of inlet pressures utilizing gas-density profilometry via Raman scattering and pressure calibration with longitudinal interferometry. In combination these allow absolute density mapping. Here we report the preliminary results.

  10. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    PubMed Central

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  11. A compact ion source for intense neutron generation

    NASA Astrophysics Data System (ADS)

    Perkins, Luke Torrilhon

    Today, numerous applications for neutrons, beyond those of the nuclear power industry, are beginning to emerge and become viable. From neutron radiography which, not unlike conventional X-rays, can provide an in-depth image through various materials, to neutron radiotherapy, for the treatment of certain forms of cancer, all these applications promise to improve our quality of life. To meet the growing need for neutrons, greater demands are being made on the neutron 'generator' technology, demands for improved neutron output and reliability at reduced physical sizes and costs. One such example in the field of borehole neutron generators, where, through neutron activation analysis, the elemental composition, concentration and location in the surrounding borehole media can be ascertained. These generators, which commonly rely on the fusion of deuterium (D) and tritium (T) at energies of the order of one hundred thousand Volts, seem to defy their physical limitations to provide neutron outputs approaching a billion per second in packages no greater than two inches in diameter. In an attempt to answer this demand, we, at Lawrence Berkeley National Laboratory (LBNL), have begun developing a new generation of neutron generators making use of recent developments in ion source technology. The specific application which motivates this development is in the environmental monitoring field, where pollutants and their concentrations in the subsurface must be assessed. To achieve the desired direction of low-level concentrations and obtain a better directional sensitivity, a neutron output of 109 to 1010 D-T neutrons per second was targeted for generator package which can fit inside a ~5 cm diameter borehole. To accomplish this performance, a radio-frequency (RF)- driven ion source developed at LBNL was adapted to the requirements of this application. The advantages of this type of ion source are its intrinsic ability to tailor the delivery of RF power to the ion source and therefore control the neutron output (pulse width, repetition rate and magnitude) while operating at low pressures (~5 mTorr). In the experimental testing presented herein, a prototype, 5 cm-diameter, inductively driven ion source has produced unsaturated hydrogen beam current densities in excess of 1 A/cm2 and monatomic species fractions in excess of 90%. This satisfactory performance, with respect to the targeted neutron output, was achieved with a 2 MHz, 60 kW pulse of RF to produce a ~20μs plasma pulse at <100 Hz.

  12. Stimulus- and goal-driven control of eye movements: action videogame players are faster but not better.

    PubMed

    Heimler, Benedetta; Pavani, Francesco; Donk, Mieke; van Zoest, Wieske

    2014-11-01

    Action videogame players (AVGPs) have been shown to outperform nongamers (NVGPs) in covert visual attention tasks. These advantages have been attributed to improved top-down control in this population. The time course of visual selection, which permits researchers to highlight when top-down strategies start to control performance, has rarely been investigated in AVGPs. Here, we addressed specifically this issue through an oculomotor additional-singleton paradigm. Participants were instructed to make a saccadic eye movement to a unique orientation singleton. The target was presented among homogeneous nontargets and one additional orientation singleton that was more, equally, or less salient than the target. Saliency was manipulated in the color dimension. Our results showed similar patterns of performance for both AVGPs and NVGPs: Fast-initiated saccades were saliency-driven, whereas later-initiated saccades were more goal-driven. However, although AVGPs were faster than NVGPs, they were also less accurate. Importantly, a multinomial model applied to the data revealed comparable underlying saliency-driven and goal-driven functions for the two groups. Taken together, the observed differences in performance are compatible with the presence of a lower decision bound for releasing saccades in AVGPs than in NVGPs, in the context of comparable temporal interplay between the underlying attentional mechanisms. In sum, the present findings show that in both AVGPs and NVGPs, the implementation of top-down control in visual selection takes time to come about, and they argue against the idea of a general enhancement of top-down control in AVGPs.

  13. Reduction of angular divergence of laser-driven ion beams during their acceleration and transport

    NASA Astrophysics Data System (ADS)

    Zakova, M.; Pšikal, Jan; Margarone, Daniele; Maggiore, Mario; Korn, G.

    2015-05-01

    Laser plasma physics is a field of big interest because of its implications in basic science, fast ignition, medicine (i.e. hadrontherapy), astrophysics, material science, particle acceleration etc. 100-MeV class protons accelerated from the interaction of a short laser pulse with a thin target have been demonstrated. With continuing development of laser technology, greater and greater energies are expected, therefore projects focusing on various applications are being formed, e.g. ELIMAIA (ELI Multidisciplinary Applications of laser-Ion Acceleration). One of the main characteristic and crucial disadvantage of ion beams accelerated by ultra-short intense laser pulses is their large divergence, not suitable for the most of applications. In this paper two ways how to decrease beam divergence are proposed. Firstly, impact of different design of targets on beam divergence is studied by using 2D Particlein-cell simulations (PIC). Namely, various types of targets include at foils, curved foil and foils with diverse microstructures. Obtained results show that well-designed microstructures, i.e. a hole in the center of the target, can produce proton beam with the lowest divergence. Moreover, the particle beam accelerated from a curved foil has lower divergence compared to the beam from a flat foil. Secondly, another proposed method for the divergence reduction is using of a magnetic solenoid. The trajectories of the laser accelerated particles passing through the solenoid are modeled in a simple Matlab program. Results from PIC simulations are used as input in the program. The divergence is controlled by optimizing the magnetic field inside the solenoid and installing an aperture in front of the device.

  14. Inhibition of BRD4 attenuates tumor cell self-renewal and suppresses stem cell signaling in MYC driven medulloblastoma

    PubMed Central

    Balakrishnan, Ilango; Harris, Peter; Birks, Diane K; Griesinger, Andrea; Amani, Vladimir; Cristiano, Brian; Remke, Marc; Taylor, Michael D; Handler, Michael; Foreman, Nicholas K; Vibhakar, Rajeev

    2014-01-01

    Medulloblastoma is a pediatric brain tumor with a variable prognosis due to clinical and genomic heterogeneity. Among the 4 major genomic sub-groups, patients with MYC amplified tumors have a particularly poor prognosis despite therapy with surgery, radiation and chemotherapy. Targeting the MYC oncogene has traditionally been problematic. Here we report that MYC driven medulloblastoma can be targeted by inhibition of the bromodomain protein BRD4. We show that bromodomain inhibition with JQ1 restricts c-MYC driven transcriptional programs in medulloblastoma, suppresses medulloblastoma cell growth and induces a cell cycle arrest. Importantly JQ1 suppresses stem cell associated signaling in medulloblastoma cells and inhibits medulloblastoma tumor cell self-renewal. Additionally JQ1 also promotes senescence in medulloblastoma cells by activating cell cycle kinase inhibitors and inhibiting activity of E2F1. Furthermore BRD4 inhibition displayed an anti-proliferative, pro-senescence effect in a medulloblastoma model in vivo. In clinical samples we found that transcriptional programs suppressed by JQ1 are associated with adverse risk in medulloblastoma patients. Our work indicates that BRD4 inhibition attenuates stem cell signaling in MYC driven medulloblastoma and demonstrates the feasibility BET domain inhibition as a therapeutic approach in vivo. PMID:24796395

  15. Pioglitazone inhibits mitochondrial pyruvate metabolism and glucose production in hepatocytes

    PubMed Central

    Shannon, Christopher E.; Daniele, Giuseppe; Galindo, Cynthia; Abdul-Ghani, Muhammad A.; DeFronzo, Ralph A.; Norton, Luke

    2017-01-01

    Pioglitazone is used globally for the treatment of type 2 diabetes mellitus (T2DM) and is one of the most effective therapies for improving glucose homeostasis and insulin resistance in T2DM patients. However, its mechanism of action in the tissues and pathways that regulate glucose metabolism are incompletely defined. Here we investigated the direct effects of pioglitazone on hepatocellular pyruvate metabolism and the dependency of these observations on the purported regulators of mitochondrial pyruvate transport, MPC1 and MPC2. In cultured H4IIE hepatocytes, pioglitazone inhibited [2-14C]-pyruvate oxidation and pyruvate-driven oxygen consumption and, in mitochondria isolated from both hepatocytes and human skeletal muscle, pioglitazone selectively and dose-dependently inhibited pyruvate-driven ATP synthesis. Pioglitazone also suppressed hepatocellular glucose production (HGP), without influencing the mRNA expression of key HGP regulatory genes. Targeted siRNA silencing of MPC1 and 2 caused a modest inhibition of pyruvate oxidation and pyruvate-driven ATP synthesis, but did not alter pyruvate-driven HGP and, importantly, it did not influence the actions of pioglitazone on either pathway. In summary, these findings outline a novel mode of action of pioglitazone relevant to the pathogenesis of T2DM and suggest that targeting pyruvate metabolism may lead to the development of effective new T2DM therapies. PMID:27987376

  16. Daily Physical Activity and Life Satisfaction across Adulthood

    PubMed Central

    Maher, Jaclyn P.; Pincus, Aaron L.; Ram, Nilam; Conroy, David E.

    2015-01-01

    Physical activity is considered a valuable tool for enhancing life satisfaction. However, the processes linking these constructs likely differ across the adult lifespan. In older adults the association between physical activity and life satisfaction appears to involve usual levels of physical activity (i.e., a between-person association driven by differences between more and less active people). In younger adults the association has consistently been based on day-to-day physical activity (i.e., a within-person association driven by differences between more and less active days). To resolve this inconsistency, a daily diary study was conducted with a lifespan sample of community-dwelling adults (age 18– 89 years; N = 150) over three 21-day measurement bursts. Usual physical activity was positively associated with life satisfaction in middle and older adulthood; however, this association was not present in young adulthood. When present, this between-person association was mediated by physical and mental health. A within-person association between physical activity and life satisfaction was also present (and did not differ across age). Generally, on days when people were more physically active then was typical for them, they experienced greater life satisfaction. Age differences in life satisfaction followed a cubic trajectory: lower during emerging adulthood, higher during midlife, and lower during older adulthood. This study adds to accumulating evidence that daily fluctuations in physical activity have important implications for well-being regardless of age, and clarifies developmental differences in life satisfaction dynamics that can inform strategies for enhancing life satisfaction. PMID:26280838

  17. Direct observation of oxygen vacancy-driven structural and resistive phase transitions in La2/3Sr1/3MnO3

    NASA Astrophysics Data System (ADS)

    Yao, Lide; Inkinen, Sampo; van Dijken, Sebastiaan

    2017-02-01

    Resistive switching in transition metal oxides involves intricate physical and chemical behaviours with potential for non-volatile memory and memristive devices. Although oxygen vacancy migration is known to play a crucial role in resistive switching of oxides, an in-depth understanding of oxygen vacancy-driven effects requires direct imaging of atomic-scale dynamic processes and their real-time impact on resistance changes. Here we use in situ transmission electron microscopy to demonstrate reversible switching between three resistance states in epitaxial La2/3Sr1/3MnO3 films. Simultaneous high-resolution imaging and resistance probing indicate that the switching events are caused by the formation of uniform structural phases. Reversible horizontal migration of oxygen vacancies within the manganite film, driven by combined effects of Joule heating and bias voltage, predominantly triggers the structural and resistive transitions. Our findings open prospects for ionotronic devices based on dynamic control of physical properties in complex oxide nanostructures.

  18. Verification Study of Buoyancy-Driven Turbulent Nuclear Combustion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    2010-01-01

    Buoyancy-driven turbulent nuclear combustion determines the rate of nuclear burning during the deflagration phase (i.e., the ordinary nuclear flame phase) of Type 1a supernovae, and hence the amount of nuclear energy released during this phase. It therefore determines the amount the white dwarf star expands prior to initiation of a detonation wave, and so the amount of radioactive nickel and thus the peak luminosity of the explosion. However, this key physical process is not fully understood. To better understand this process, the Flash Center has conducted an extensive series of large-scale 3D simulations of buoyancy-driven turbulent nuclear combustion for threemore » different physical situations. This movie shows the results for some of these simulations. Credits: Science: Ray Bair, Katherine Riley, Argonne National Laboratory; Anshu Dubey, Don Lamb, Dongwook Lee, University of Chicago; Robert Fisher, University of Massachusetts at Dartmouth and Dean Townsley, University of Alabama Visualization: Jonathan Gallagher, University of Chicago; Randy Hudson, John Norris and Michael E. Papka, Argonne National Laboratory/University of Chicago« less

  19. Artificial muscles driven by the cooperative actuation of electrochemical molecular machines. Persistent discrepancies and challenges

    NASA Astrophysics Data System (ADS)

    Otero

    2017-10-01

    Here we review the persisting conceptual discrepancies between different research groups working on artificial muscles based on conducting polymers and other electroactive material. The basic question is if they can be treated as traditional electro-mechanical (physical) actuators driven by electric fields and described by some adaptation of their physical models or if, replicating natural muscles, they are electro-chemo-mechanical actuators driven by electrochemical reaction of the constitutive molecular machines: the polymeric chains. In that case the charge consumed by the reaction will control the volume variation of the muscular material and the motor displacement, following the basic and single Faraday's laws: the charge consumed by the reaction determines the number of exchanged ions and solvent, the film volume variation to lodge/expel them and the amplitude of the movement. Deviations from the linear relationships are due to the osmotic exchange of solvent and to the presence of parallel reactions from the electrolyte, which originate creeping effects. Challenges and limitations are underlined.

  20. Simulation and Visualization of Chaos in a Driven Nonlinear Pendulum -- An Aid to Introducing Chaotic Systems in Physics

    NASA Astrophysics Data System (ADS)

    Akpojotor, Godfrey; Ehwerhemuepha, Louis; Amromanoh, Ogheneriobororue

    2013-03-01

    The presence of physical systems whose characteristics change in a seemingly erratic manner gives rise to the study of chaotic systems. The characteristics of these systems are due to their hypersensitivity to changes in initial conditions. In order to understand chaotic systems, some sort of simulation and visualization is pertinent. Consequently, in this work, we have simulated and graphically visualized chaos in a driven nonlinear pendulum as a means of introducing chaotic systems. The results obtained which highlight the hypersensitivity of the pendulum are used to discuss the effectiveness of teaching and learning the physics of chaotic system using Python. This study is one of the many studies under the African Computational Science and Engineering Tour Project (PASET) which is using Python to model, simulate and visualize concepts, laws and phenomena in Science and Engineering to compliment the teaching/learning of theory and experiment.

  1. Physics-driven Spatiotemporal Regularization for High-dimensional Predictive Modeling: A Novel Approach to Solve the Inverse ECG Problem

    NASA Astrophysics Data System (ADS)

    Yao, Bing; Yang, Hui

    2016-12-01

    This paper presents a novel physics-driven spatiotemporal regularization (STRE) method for high-dimensional predictive modeling in complex healthcare systems. This model not only captures the physics-based interrelationship between time-varying explanatory and response variables that are distributed in the space, but also addresses the spatial and temporal regularizations to improve the prediction performance. The STRE model is implemented to predict the time-varying distribution of electric potentials on the heart surface based on the electrocardiogram (ECG) data from the distributed sensor network placed on the body surface. The model performance is evaluated and validated in both a simulated two-sphere geometry and a realistic torso-heart geometry. Experimental results show that the STRE model significantly outperforms other regularization models that are widely used in current practice such as Tikhonov zero-order, Tikhonov first-order and L1 first-order regularization methods.

  2. Evaluation of the Influence of Wind-Driven Rain on Moisture in Cellular Concrete Wall Boards

    NASA Astrophysics Data System (ADS)

    Alsabry, A.; Nikitsin, V. I.; Kofanov, V. A.; Backiel-Brzozowska, B.

    2017-08-01

    The non-stationary moisture level of a cellular concrete wall board in a heated utility building located in the northern part of the town of Brest (Belarus), depending on the climatic influence, was assessed in this work. The results were obtained both in a calculation experiment and a physical test. It was observed that the main reason for the high moisture levels in cellular concrete is wind-driven rain intensifying the process of free capillary moisture transfer. A comparative analysis of the results of the physical test and the calculation experiment showed that the THSS software elaborated by the authors was able to predict the actual moisture levels of the shielding structure under study accurately enough when precise data concerning the thermal and physical characteristics of the materials as well as the occurring climatic influences were submitted.

  3. Intravascular ultrasound guided directional atherectomy versus directional atherectomy guided by angiography for the treatment of femoropopliteal in-stent restenosis

    PubMed Central

    Krishnan, Prakash; Tarricone, Arthur; K-Raman, Purushothaman; Majeed, Farhan; Kapur, Vishal; Gujja, Karthik; Wiley, Jose; Vasquez, Miguel; Lascano, Rheoneil A.; Quiles, Katherine G.; Distin, Tashanne; Fontenelle, Ran; Atallah-Lajam, Farah; Kini, Annapoorna; Sharma, Samin

    2017-01-01

    Background: The aim of this study was to compare 1-year outcomes for patients with femoropopliteal in-stent restenosis using directional atherectomy guided by intravascular ultrasound (IVUS) versus directional atherectomy guided by angiography. Methods and results: This was a retrospective analysis for patients with femoropopliteal in-stent restenosis treated with IVUS-guided directional atherectomy versus directional atherectomy guided by angiography from a single center between March 2012 and February 2016. Clinically driven target lesion revascularization was the primary endpoint and was evaluated through medical chart review as well as phone call follow up. Conclusions: Directional atherectomy guided by IVUS reduces clinically driven target lesion revascularization for patients with femoropopliteal in-stent restenosis. PMID:29265002

  4. Electron-beam-driven RI separator for SCRIT (ERIS) at RIKEN RI beam factory

    NASA Astrophysics Data System (ADS)

    Ohnishi, T.; Ichikawa, S.; Koizumi, K.; Kurita, K.; Miyashita, Y.; Ogawara, R.; Tamaki, S.; Togasaki, M.; Wakasugi, M.

    2013-12-01

    We constructed a radioactive isotope (RI) separator named ERIS (electron-beam-driven RI separator for SCRIT) for the SCRIT (Self-Confinement RI Target) electron scattering facility at RIKEN RI Beam Factory (RIBF). In ERIS, production rate of fission products in the photofission of uranium is estimated to be 2.2 ×1011 fissions/s with 30 g of uranium and a 1-kW electron beam. During the commissioning of ERIS, the mass resolution and overall efficiency, including ionization, extraction, and transmission, were found to be 1660 and 21%, respectively, using natural xenon gas. The preparation of uranium carbide (UC2) RI production targets is described from which a 132Sn beam was successfully separated in our first attempt at RI production.

  5. Commentary: China Will Change Our Teaching

    ERIC Educational Resources Information Center

    Parslow, Graham R.

    2013-01-01

    The current spurt in life science activity in China has been driven by repatriating researchers trained in the prestigious institutions of the world. China's publications show a clear concentration in the physical sciences and technology, with materials science, chemistry, and physics predominant. Also clear is that the growth areas include…

  6. Plasma Dynamics of the Arc-Driven Rail Gun

    DTIC Science & Technology

    1980-09-01

    Authors’ unpublished calculations. 11. A.B. Cambel , Plasma Physics and Magnetofluidmechanics (McGraw-Hill New York, 1963), Chap. 8. ’ 16 k T P = (1 +cO...Energy, and Forces (Wiley, New York, 1960), Chap. 9. 10. Authors’ unpublished calculations. 11. A.B. Cambel , Plasma Physics and Magnetofluidmechanics

  7. Studying Scientific Discovery by Computer Simulation.

    DTIC Science & Technology

    1983-03-30

    Mendel’s laws of inheritance, the law of Gay- Lussac for gaseous reactions, tile law of Dulong and Petit, the derivation of atomic weights by Avogadro...neceseary mid identify by block number) scientific discovery -ittri sic properties physical laws extensive terms data-driven heuristics intensive...terms theory-driven heuristics conservation laws 20. ABSTRACT (Continue on revere. side It necessary and identify by block number) Scientific discovery

  8. Mission Driven Science at Argonne

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thackery, Michael; Wang, Michael; Young, Linda

    2012-07-05

    Mission driven science at Argonne means applying science and scientific knowledge to a physical and "real world" environment. Examples include testing a theoretical model through the use of formal science or solving a practical problem through the use of natural science. At the laboratory, our materials scientists are leading the way in producing energy solutions today that could help reduce and remove the energy crisis of tomorrow.

  9. Magnetically driven oscillator and resonance: a teaching tool

    NASA Astrophysics Data System (ADS)

    Erol, M.; Çolak, İ. Ö.

    2018-05-01

    This paper reports a simple magnetically driven oscillator, designed and resolved in order to achieve a better student understanding and to overcome certain instructional difficulties. The apparatus is mainly comprised of an ordinary spring pendulum with a neodymium magnet attached to the bottom, a coil placed in the same vertical direction, an ordinary function generator, an oscilloscope and a smartphone. Driven oscillation and resonance is basically managed by applying a sinusoidal voltage to the coil and tuning the driving frequency to the natural frequency of the pendulum. The resultant oscillation is recorded by a smartphone video application and analyzed via a video analysis programme. The designed apparatus can easily be employed in basic physics laboratories to achieve an enhanced and deeper understanding of driven oscillation and resonance.

  10. A smart telerobotic system driven by monocular vision

    NASA Technical Reports Server (NTRS)

    Defigueiredo, R. J. P.; Maccato, A.; Wlczek, P.; Denney, B.; Scheerer, J.

    1994-01-01

    A robotic system that accepts autonomously generated motion and control commands is described. The system provides images from the monocular vision of a camera mounted on a robot's end effector, eliminating the need for traditional guidance targets that must be predetermined and specifically identified. The telerobotic vision system presents different views of the targeted object relative to the camera, based on a single camera image and knowledge of the target's solid geometry.

  11. Numerical Investigation of Magnetically Driven Isentropic Compression of Solid Aluminum Cylinders with a Semi-Analytical Code

    NASA Astrophysics Data System (ADS)

    Largent, Billy T.

    The state of matter at extremely high pressures and densities is of fundamental interest to many branches of research, including planetary science, material science, condensed matter physics, and plasma physics. Matter with pressures, or energy densities, above 1 megabar (100 gigapascal) are defined as High Energy Density (HED) plasmas. They are directly relevant to the interiors of planets such as Earth and Jupiter and to the dense fuels in Inertial Confinement Fusion (ICF) experiments. To create HEDP conditions in laboratories, a sample may be compressed by a smoothly varying pressure ramp with minimal temperature increase, following the isentropic thermodynamic process. Isentropic compression of aluminum targets has been done using magnetic pressure produced by megaampere, pulsed power currents having 100 ns rise times. In this research project, magnetically driven, cylindrical isentropic compression has been numerically studied. In cylindrical geometry, material compression and pressure become higher than in planar geometry due to geometrical effects. Based on a semi-analytical model for the Magnetized Liner Inertial Fusion (MagLIF) concept, a code called "SA" was written to design cylindrical compression experiments on the 1.0 MA Zebra pulsed power generator at the Nevada Terawatt Facility (NTF). To test the physics models in the code, temporal progresses of rod compression and pressure were calculated with SA and compared with 1-D magnetohydrodynamic (MHD) codes. The MHD codes incorporated SESAME tables, for equation of state and resistivity, or the classical Spitzer model. A series of simulations were also run to find optimum rod diameters for 1.0 MA and 1.8 MA Zebra current pulses. For a 1.0 MA current peak and 95 ns rise time, a maximum compression of 2.35 ( 6.3 g/cm3) and a pressure of 900 GPa within a 100 mum radius were found for an initial diameter of 1.05 mm. For 1.8 MA peak simulations with the same rise time, the initial diameter of 1.3 mm was optimal with 3.32 ( 9.0 g/cm 3) compression.

  12. Exploring complex causal pathways between urban renewal, health and health inequality using a theory-driven realist approach.

    PubMed

    Mehdipanah, Roshanak; Manzano, Ana; Borrell, Carme; Malmusi, Davide; Rodriguez-Sanz, Maica; Greenhalgh, Joanne; Muntaner, Carles; Pawson, Ray

    2015-01-01

    Urban populations are growing and to accommodate these numbers, cities are becoming more involved in urban renewal programs to improve the physical, social and economic conditions in different areas. This paper explores some of the complexities surrounding the link between urban renewal, health and health inequalities using a theory-driven approach. We focus on an urban renewal initiative implemented in Barcelona, the Neighbourhoods Law, targeting Barcelona's (Spain) most deprived neighbourhoods. We present evidence from two studies on the health evaluation of the Neighbourhoods Law, while drawing from recent urban renewal literature, to follow a four-step process to develop a program theory. We then use two specific urban renewal interventions, the construction of a large central plaza and the repair of streets and sidewalks, to further examine this link. In order for urban renewal programs to affect health and health inequality, neighbours must use and adapt to the changes produced by the intervention. However, there exist barriers that can result in negative outcomes including factors such as accessibility, safety and security. This paper provides a different perspective to the field that is largely dominated by traditional quantitative studies that are not always able to address the complexities such interventions provide. Furthermore, the framework and discussions serve as a guide for future research, policy development and evaluation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Towards a generalized energy prediction model for machine tools

    PubMed Central

    Bhinge, Raunak; Park, Jinkyoo; Law, Kincho H.; Dornfeld, David A.; Helu, Moneer; Rachuri, Sudarsan

    2017-01-01

    Energy prediction of machine tools can deliver many advantages to a manufacturing enterprise, ranging from energy-efficient process planning to machine tool monitoring. Physics-based, energy prediction models have been proposed in the past to understand the energy usage pattern of a machine tool. However, uncertainties in both the machine and the operating environment make it difficult to predict the energy consumption of the target machine reliably. Taking advantage of the opportunity to collect extensive, contextual, energy-consumption data, we discuss a data-driven approach to develop an energy prediction model of a machine tool in this paper. First, we present a methodology that can efficiently and effectively collect and process data extracted from a machine tool and its sensors. We then present a data-driven model that can be used to predict the energy consumption of the machine tool for machining a generic part. Specifically, we use Gaussian Process (GP) Regression, a non-parametric machine-learning technique, to develop the prediction model. The energy prediction model is then generalized over multiple process parameters and operations. Finally, we apply this generalized model with a method to assess uncertainty intervals to predict the energy consumed to machine any part using a Mori Seiki NVD1500 machine tool. Furthermore, the same model can be used during process planning to optimize the energy-efficiency of a machining process. PMID:28652687

  14. Towards a generalized energy prediction model for machine tools.

    PubMed

    Bhinge, Raunak; Park, Jinkyoo; Law, Kincho H; Dornfeld, David A; Helu, Moneer; Rachuri, Sudarsan

    2017-04-01

    Energy prediction of machine tools can deliver many advantages to a manufacturing enterprise, ranging from energy-efficient process planning to machine tool monitoring. Physics-based, energy prediction models have been proposed in the past to understand the energy usage pattern of a machine tool. However, uncertainties in both the machine and the operating environment make it difficult to predict the energy consumption of the target machine reliably. Taking advantage of the opportunity to collect extensive, contextual, energy-consumption data, we discuss a data-driven approach to develop an energy prediction model of a machine tool in this paper. First, we present a methodology that can efficiently and effectively collect and process data extracted from a machine tool and its sensors. We then present a data-driven model that can be used to predict the energy consumption of the machine tool for machining a generic part. Specifically, we use Gaussian Process (GP) Regression, a non-parametric machine-learning technique, to develop the prediction model. The energy prediction model is then generalized over multiple process parameters and operations. Finally, we apply this generalized model with a method to assess uncertainty intervals to predict the energy consumed to machine any part using a Mori Seiki NVD1500 machine tool. Furthermore, the same model can be used during process planning to optimize the energy-efficiency of a machining process.

  15. Design of a randomized controlled trial for multiple cancer risk behaviors among Spanish-speaking Mexican-origin smokers.

    PubMed

    Castro, Yessenia; Basen-Engquist, Karen; Fernandez, Maria E; Strong, Larkin L; Eakin, Elizabeth G; Resnicow, Ken; Li, Yisheng; Wetter, David W

    2013-03-18

    Smoking, poor diet, and physical inactivity account for as much as 60% of cancer risk. Latinos experience profound disparities in health behaviors, as well as the cancers associated with them. Currently, there is a dearth of controlled trials addressing these health behaviors among Latinos. Further, to the best of our knowledge, no studies address all three behaviors simultaneously, are culturally sensitive, and are guided by formative work with the target population. Latinos represent 14% of the U.S. population and are the fastest growing minority group in the country. Efforts to intervene on these important lifestyle factors among Latinos may accelerate the elimination of cancer-related health disparities. The proposed study will evaluate the efficacy of an evidence-based and theoretically-driven Motivation And Problem Solving (MAPS) intervention, adapted and culturally-tailored for reducing cancer risk related to smoking, poor diet, and physical inactivity among high-risk Mexican-origin smokers who are overweight/obese (n = 400). Participants will be randomly assigned to one of two groups: Health Education (HE) or MAPS (HE + up to 18 MAPS counseling calls over 18 months). Primary outcomes are smoking status, servings of fruits and vegetables, and both self-reported and objectively measured physical activity. Outcome assessments will occur at baseline, 6 months, 12 months, and 18 months. The current study will contribute to a very limited evidence base on multiple risk factor intervention studies on Mexican-origin individuals and has the potential to inform both future research and practice related to reducing cancer risk disparities. An effective program targeting multiple cancer risk behaviors modeled after chronic care programs has the potential to make a large public health impact because of the dearth of evidence-based interventions for Latinos and the extended period of support that is provided in such a program. National Institutes of Health Clinical Trials Registry # NCT01504919.

  16. Evolvability of flower geometry: Convergence in pollinator-driven morphological evolution of flowers.

    PubMed

    Woźniak, Natalia Joanna; Sicard, Adrien

    2018-07-01

    Flowers represent a key innovation during plant evolution. Driven by reproductive optimization, evolution of flower morphology has been central in boosting species diversification. In most cases, this has happened through specialized interactions with animal pollinators and subsequent reduction of gene flow between specialized morphs. While radiation has led to an enormous variability in flower forms and sizes, recurrent evolutionary patterns can be observed. Here, we discuss the targets of selection involved in major trends of pollinator-driven flower evolution. We review recent findings on their adaptive values, developmental grounds and genetic bases, in an attempt to better understand the repeated nature of pollinator-driven flower evolution. This analysis highlights how structural innovation can provide flexibility in phenotypic evolution, adaptation and speciation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Controlling laser driven protons acceleration using a deformable mirror at a high repetition rate

    NASA Astrophysics Data System (ADS)

    Noaman-ul-Haq, M.; Sokollik, T.; Ahmed, H.; Braenzel, J.; Ehrentraut, L.; Mirzaie, M.; Yu, L.-L.; Sheng, Z. M.; Chen, L. M.; Schnürer, M.; Zhang, J.

    2018-03-01

    We present results from a proof-of-principle experiment to optimize laser driven protons acceleration by directly feeding back its spectral information to a deformable mirror (DM) controlled by evolutionary algorithms (EAs). By irradiating a stable high-repetition rate tape driven target with ultra-intense pulses of intensities ∼1020 W/ cm2, we optimize the maximum energy of the accelerated protons with a stability of less than ∼5% fluctuations near optimum value. Moreover, due to spatio-temporal development of the sheath field, modulations in the spectrum are also observed. Particularly, a prominent narrow peak is observed with a spread of ∼15% (FWHM) at low energy part of the spectrum. These results are helpful to develop high repetition rate optimization techniques required for laser-driven ion accelerators.

  18. Yield Hardening of Electrorheological Fluids in Channel Flow

    NASA Astrophysics Data System (ADS)

    Helal, Ahmed; Qian, Bian; McKinley, Gareth H.; Hosoi, A. E.

    2016-06-01

    Electrorheological fluids offer potential for developing rapidly actuated hydraulic devices where shear forces or pressure-driven flow are present. In this study, the Bingham yield stress of electrorheological fluids with different particle volume fractions is investigated experimentally in wall-driven and pressure-driven flow modes using measurements in a parallel-plate rheometer and a microfluidic channel, respectively. A modified Krieger-Dougherty model can be used to describe the effects of the particle volume fraction on the yield stress and is in good agreement with the viscometric data. However, significant yield hardening in pressure-driven channel flow is observed and attributed to an increase and eventual saturation of the particle volume fraction in the channel. A phenomenological physical model linking the densification and consequent microstructure to the ratio of the particle aggregation time scale compared to the convective time scale is presented and used to predict the enhancement in yield stress in channel flow, enabling us to reconcile discrepancies in the literature between wall-driven and pressure-driven flows.

  19. Moving Computational Domain Method and Its Application to Flow Around a High-Speed Car Passing Through a Hairpin Curve

    NASA Astrophysics Data System (ADS)

    Watanabe, Koji; Matsuno, Kenichi

    This paper presents a new method for simulating flows driven by a body traveling with neither restriction on motion nor a limit of a region size. In the present method named 'Moving Computational Domain Method', the whole of the computational domain including bodies inside moves in the physical space without the limit of region size. Since the whole of the grid of the computational domain moves according to the movement of the body, a flow solver of the method has to be constructed on the moving grid system and it is important for the flow solver to satisfy physical and geometric conservation laws simultaneously on moving grid. For this issue, the Moving-Grid Finite-Volume Method is employed as the flow solver. The present Moving Computational Domain Method makes it possible to simulate flow driven by any kind of motion of the body in any size of the region with satisfying physical and geometric conservation laws simultaneously. In this paper, the method is applied to the flow around a high-speed car passing through a hairpin curve. The distinctive flow field driven by the car at the hairpin curve has been demonstrated in detail. The results show the promising feature of the method.

  20. Visual Benefits in Apparent Motion Displays: Automatically Driven Spatial and Temporal Anticipation Are Partially Dissociated

    PubMed Central

    Ahrens, Merle-Marie; Veniero, Domenica; Gross, Joachim; Harvey, Monika; Thut, Gregor

    2015-01-01

    Many behaviourally relevant sensory events such as motion stimuli and speech have an intrinsic spatio-temporal structure. This will engage intentional and most likely unintentional (automatic) prediction mechanisms enhancing the perception of upcoming stimuli in the event stream. Here we sought to probe the anticipatory processes that are automatically driven by rhythmic input streams in terms of their spatial and temporal components. To this end, we employed an apparent visual motion paradigm testing the effects of pre-target motion on lateralized visual target discrimination. The motion stimuli either moved towards or away from peripheral target positions (valid vs. invalid spatial motion cueing) at a rhythmic or arrhythmic pace (valid vs. invalid temporal motion cueing). Crucially, we emphasized automatic motion-induced anticipatory processes by rendering the motion stimuli non-predictive of upcoming target position (by design) and task-irrelevant (by instruction), and by creating instead endogenous (orthogonal) expectations using symbolic cueing. Our data revealed that the apparent motion cues automatically engaged both spatial and temporal anticipatory processes, but that these processes were dissociated. We further found evidence for lateralisation of anticipatory temporal but not spatial processes. This indicates that distinct mechanisms may drive automatic spatial and temporal extrapolation of upcoming events from rhythmic event streams. This contrasts with previous findings that instead suggest an interaction between spatial and temporal attention processes when endogenously driven. Our results further highlight the need for isolating intentional from unintentional processes for better understanding the various anticipatory mechanisms engaged in processing behaviourally relevant stimuli with predictable spatio-temporal structure such as motion and speech. PMID:26623650

  1. Myc-Driven Glycolysis Is a Therapeutic Target in Glioblastoma.

    PubMed

    Tateishi, Kensuke; Iafrate, A John; Ho, Quan; Curry, William T; Batchelor, Tracy T; Flaherty, Keith T; Onozato, Maristela L; Lelic, Nina; Sundaram, Sudhandra; Cahill, Daniel P; Chi, Andrew S; Wakimoto, Hiroaki

    2016-09-01

    Deregulated Myc drives an oncogenic metabolic state, including pseudohypoxic glycolysis, adapted for the constitutive production of biomolecular precursors to feed rapid tumor cell growth. In glioblastoma, Myc facilitates renewal of the tumor-initiating cell reservoir contributing to tumor maintenance. We investigated whether targeting the Myc-driven metabolic state could be a selectively toxic therapeutic strategy for glioblastoma. The glycolytic dependency of Myc-driven glioblastoma was tested using (13)C metabolic flux analysis, glucose-limiting culture assays, and glycolysis inhibitors, including inhibitors of the NAD(+) salvage enzyme nicotinamide phosphoribosyl-transferase (NAMPT), in MYC and MYCN shRNA knockdown and lentivirus overexpression systems and in patient-derived glioblastoma tumorspheres with and without MYC/MYCN amplification. The in vivo efficacy of glycolyic inhibition was tested using NAMPT inhibitors in MYCN-amplified patient-derived glioblastoma orthotopic xenograft mouse models. Enforced Myc overexpression increased glucose flux and expression of glycolytic enzymes in glioblastoma cells. Myc and N-Myc knockdown and Myc overexpression systems demonstrated that Myc activity determined sensitivity and resistance to inhibition of glycolysis. Small-molecule inhibitors of glycolysis, particularly NAMPT inhibitors, were selectively toxic to MYC/MYCN-amplified patient-derived glioblastoma tumorspheres. NAMPT inhibitors were potently cytotoxic, inducing apoptosis and significantly extended the survival of mice bearing MYCN-amplified patient-derived glioblastoma orthotopic xenografts. Myc activation in glioblastoma generates a dependency on glycolysis and an addiction to metabolites required for glycolysis. Glycolytic inhibition via NAMPT inhibition represents a novel metabolically targeted therapeutic strategy for MYC or MYCN-amplified glioblastoma and potentially other cancers genetically driven by Myc. Clin Cancer Res; 22(17); 4452-65. ©2016 AACR. ©2016 American Association for Cancer Research.

  2. Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53

    PubMed Central

    Rae, Joel; Hogan, Kate; Ejiama, Sarah; Girotti, Maria Romina; Cook, Martin; Dhomen, Nathalie; Marais, Richard

    2014-01-01

    Cutaneous melanoma is epidemiologically linked to ultraviolet radiation (UVR), but the molecular mechanisms by which UVR drives melanomagenesis remain unclear1,2. The most common somatic mutation in melanoma is a V600E substitution in BRAF, which is an early event3. To investigate how UVR accelerates oncogenic BRAF-driven melanomagenesis, we used a V600EBRAF mouse model. In mice expressing V600EBRAF in their melanocytes, a single dose of UVR that mimicked mild sunburn in humans induced clonal expansion of the melanocytes, and repeated doses of UVR increased melanoma burden. We show that sunscreen (UVA superior: UVB SPF50) delayed the onset of UVR-driven melanoma, but only provided partial protection. The UVR-exposed tumours presented increased numbers of single nucleotide variants (SNVs) and we observed mutations (H39Y, S124F, R245C, R270C, C272G) in the Trp53 tumour suppressor in ~40% of cases. TP53 is an accepted UVR target in non-melanoma skin cancer, but is not thought to play a major role in melanoma4. However, we show that mutant Trp53 accelerated V600EBRAF-driven melanomagenesis and that TP53 mutations are linked to evidence of UVR-induced DNA damage in human melanoma. Thus, we provide mechanistic insight into epidemiological data linking UVR to acquired naevi in humans5. We identify TP53/Trp53 as a UVR-target gene that cooperates with V600EBRAF to induce melanoma, providing molecular insight into how UVR accelerates melanomagenesis. Our study validates public health campaigns that promote sunscreen protection for individuals at risk of melanoma. PMID:24919155

  3. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    PubMed

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  4. Tertiary particle physics with ELI: from challenge to chance (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Drska, Ladislav

    2017-05-01

    nteraction of high-intensity laser pulses with solid state targets results in generation of intense pulses of secondary particles via electromagnetic interaction : electrons, ions, hard x-rays. The beams of these particles can be used to produce various types of third-generation particles, beyond electromagnetic also other types of fundamental interactions can be involved in this process [1]. As the most interesting tertiary particles could be mentioned positrons, neutron, muons. This paper shall extend our previous analysis of this topic [2]: it discusses selected technical problems of design and realization of applicable sources of these particles and presents some more elaborated proposals for potential meaningful / hopefuly realistic exploitations of this technology. (1)Tertiary Sources (TS) : First Development Steps. This part of the presentation includes the topics as follows: (11) Pulsed positron sources: Verified solutions of laser-driven positron sources [3] [4] [5], development towards applicable facilities. Some unconventional concepts of application of lasers for positron production [6]. Techniques for realization of low/very-low energy positrons. (12) Taylored neutron sources [7]: Neutron sources with demanded space distribution, strongly beamed and isotropic solutions [8] [9]. Neutron generation with taylored energy distribution. Problem of the direct production of neutrons with very low energy [10] [11]. (13) Potential muon sources: Proof-of-principle laser experiment on electron / photon driven muon production [12] [13]. Study of the possibility of effective generation of surface muons. Problems of the production of muons with very low energy. (2) Fundamental & Applied Physics with TS: This part of the talk presents the themes: (21) Diagnostic potential of TS: Lepton emission as a signature of processes in extreme systems. Passive and active diagnostics using positrons, problems of detection and evaluation. Potential diagnostic applications of muons. Concrete application study: muon tomography. (22) Antilepton gravity studies [14]: Possibility of antimattter gravity research using positronium and muonium [15] [16]. Lepton / antilepton gravity studiesactive with relativistic particle beams [17]. First-phase practical application : positron production for filling (commertial) particle traps, development base for multiple microtrap systems. (23) Hidden world searching [18] : Potential laser-based production / detection of selected dark mattter particles - axions, hidden photons [19] [20]. Search for hidden particles in nuclear decay processes [21]. Potential application output: intense positronium source. Conclusion: The extensive feasibility study confirms the potential of ELI to contribute to the solution of Grand Challenge Problems of physics. Laser-produced tertiary particles will play important role in this effort. : References [1] L.Drska et al.: Physics of Extreme Systems. Course ATHENS CTU18, Prague 12 - 19 Nov., 2016. http://vega.fjfi.cvut.cz/docs/athens2016/ [2] L.Drska : Lepton Diagnostics and Antimatter Physics. In: SPIE Optics+Optoelectronics, Prague, April 13 - 16, 2015 . [3] H. Chen et al.: Scaling the Yield of Laser-Driven Electron-Positron Jets to Laboratory Astrophysics Applications. Rep. LLNL-JRNL-665381, Dec. 11, 2014. [4] E Liang et al.: High e+ / e- Ratio Dense Pair Creation with 1022 W.cm-2 Laser Irradiating Solid Targets. Scientific Reports, Sept. 14, 2015. www.nature.com/scientificreports [5] G. Sarri et al.: Spectral and Spatial Characterization of Laser-driven Positron Beams. Plasma Phys. Control. Fusion 59 (2017) 014015. [6] B. Schoch: A Method to Produce Intense Positron Beams via Electro Pair Production on Electrons. arXiv:1607.03847v1 [physics.acc-ph] [7] I. Pomerantz: Laser Generation of Neutrons: Science and Applications. In: ELI-NP Summer School, Magurele, Sept. 21 - 25, 2015. http://www.eli-np.ro/2015-summer-school/presentations/23.09/Pomerantz_Eli-NP-Summer-school-2015.pdf [8] V.P. Kovalev: Secondary Radiation of Electron Accelerators (in Russian). Atomizdat 1969. [9] M. Lebois et al.: Development of a Kinematically Focused Neutron Source with p(Li7,n)Be7 Inverse Reaction. Nucl. Instr. Meth. Phys. Res. A 735 (2014), 145. [10] D. Habs et al.: Neutron Halo Isomers in Stable Nuclei and their Possible Application for the Production of Low Energy, Pulsed, Polarized Neutron Beams of High Intensity and High Brilliance. Appl. Phys B103 (2011),485. [11] T. Masuda et al.: A New Method of Creating High/Intensity Neutron Source. arXiv:1604.02818v1[nucl-ex] [12] A.I. Titov et al.: Dimuon Production by Laser-wakefield Accelerated Electrons. Phys. Rev. ST Accel. Beams 12 (2009) 111301. [13] W. Dreesen et al.: Detection of Petawatt Laser-Induced Muon Source for Rapid High-Gamma Material Detection. DOE/NV/25946-2262. [14] F. Castelli: Positronium and Fundamental Physics: What Next ? In: What Next, Florence 2015. [15] G. Dufour et al. : Prospects for Studies of the Free Fall and Gravitation Quantum States of Antimatter. Advances in High Energy Physics 2015 (2015) 379642. [16] D.M. Kaplan et al.. Antimatter Gravity with Muonium. IIT-CAPP-16-1. arXiv:1601.07222v2 [physics.ins-det] [17] T. Kalaydzhyan: Gravitational Mass of Positron from LEP Synchrotron Losses. arXiv:1508.04377v3 [hep-ph] [18] J. Alexander et al.: Dark Sector 2016 Workshop: Community Report. arXiv:1608.08632[hep-ph] [19] M.A. Wahud et al.: Axion-like Particle Production in a Laser-Induced Dynamical Spacertime. arXiv:1612.07743v1 [hep-ph] [20] V. Kozhuharov et al: New Projects on Dark Photon Search. arXiv:1610.04389v1 [hep-ex] [21] A.J. Krasznahorkay et al.: Observation of Anomalous Internal Pair Creation in Be8: A Possible Signature of a Light, Neutral Boson. arXiv:1504.01527v1 [nucl-ex

  5. Does availability of physical activity and food outlets differ by race and income? Findings from an enumeration study in a health disparate region.

    PubMed

    Hill, Jennie L; Chau, Clarice; Luebbering, Candice R; Kolivras, Korine K; Zoellner, Jamie

    2012-09-06

    Low-income, ethnic/racial minorities and rural populations are at increased risk for obesity and related chronic health conditions when compared to white, urban and higher-socio-economic status (SES) peers. Recent systematic reviews highlight the influence of the built environment on obesity, yet very few of these studies consider rural areas or populations. Utilizing a CBPR process, this study advances community-driven causal models to address obesity by exploring the difference in resources for physical activity and food outlets by block group race and income in a small regional city that anchors a rural health disparate region. To guide this inquiry we hypothesized that lower income and racially diverse block groups would have fewer food outlets, including fewer grocery stores and fewer physical activity outlets. We further hypothesized that walkability, as defined by a computed walkability index, would be lower in the lower income block groups. Using census data and GIS, base maps of the region were created and block groups categorized by income and race. All food outlets and physical activity resources were enumerated and geocoded and a walkability index computed. Analyses included one-way MANOVA and spatial autocorrelation. In total, 49 stores, 160 restaurants and 79 physical activity outlets were enumerated. There were no differences in the number of outlets by block group income or race. Further, spatial analyses suggest that the distribution of outlets is dispersed across all block groups. Under the larger CPBR process, this enumeration study advances the causal models set forth by the community members to address obesity by providing an overview of the food and physical activity environment in this region. This data reflects the food and physical activity resources available to residents in the region and will aid many of the community-academic partners as they pursue intervention strategies targeting obesity.

  6. Electrically Driven Thermal Management: Flight Validation, Experiment Development, Future Technologies

    NASA Technical Reports Server (NTRS)

    Didion, Jeffrey R.

    2018-01-01

    Electrically Driven Thermal Management is an active research and technology development initiative incorporating ISS technology flight demonstrations (STP-H5), development of Microgravity Science Glovebox (MSG) flight experiment, and laboratory-based investigations of electrically based thermal management techniques. The program targets integrated thermal management for future generations of RF electronics and power electronic devices. This presentation reviews four program elements: i.) results from the Electrohydrodynamic (EHD) Long Term Flight Demonstration launched in February 2017 ii.) development of the Electrically Driven Liquid Film Boiling Experiment iii.) two University based research efforts iv.) development of Oscillating Heat Pipe evaluation at Goddard Space Flight Center.

  7. Coloring of the past via respondent's current psychological state, mediation, and the association between childhood disadvantage and morbidity in adulthood.

    PubMed

    Sheikh, Mashhood Ahmed

    2018-05-31

    Many researchers view retrospective reports with skepticism. Indeed, the observed association between retrospectively-reported childhood disadvantage (CD) and morbidity in adulthood has been criticized as an artefactual correlation driven by the psychological state of the respondent at the time of reporting (current psychological state). The aim of this study was to assess the role of current psychological state in the association between childhood disadvantage and morbidity in adulthood. The present analysis used cross-sectional data collected in 2007-2008 within the framework of the Tromsø Study (N = 10,765), a representative study of adult men and women in Norway. The association between CD and the physical health outcomes heart attack, angina pectoris, chronic bronchitis/emphysema/COPD, diabetes mellitus, hypothyroid/low metabolism, migraine, hypertension, and comorbidity (i.e., the sum of these physical health outcomes) was assessed with Poisson regression models. Relative risks (RR) and 95% confidence intervals (CI) were estimated. A wide range of indicators of respondents' current psychological state were included in the models to assess the % attenuation in estimates. CD was associated with an increased risk of heart attack, angina pectoris, chronic bronchitis/emphysema/COPD, diabetes mellitus, hypothyroid/low metabolism, migraine, hypertension, and comorbidity (p < 0.05), independent of respondents' current psychological state. A sizeable proportion (23-42%) of the association between CD and physical health outcomes was driven by recall bias or mediation via respondents' current psychological state. Controlling for indicators of current psychological state reduced the strength of associations between CD and physical health outcomes; however, the independent associations remained in the same direction. The association between retrospectively-reported CD and physical health outcomes in adulthood is not driven entirely by respondent's current psychological state. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Top-Down-Driven Grouping Overrules the Central Attentional Bias

    ERIC Educational Resources Information Center

    Linnell, Karina J.; Humphreys, Glyn W.

    2007-01-01

    A central bias in spatial selection has been proposed to explain the decreasing search efficiency with increasing target eccentricity that results when distractors can occur closer to fixation than the target (J. M. Wolfe, P. O'Neill, & S. C. Bennett, 1998). The authors found evidence for such a bias using an odd-man-out variant of conjunction…

  9. A Critical Analysis of Approaches To Targeted PTSD Prevention: Current Status and Theoretically Derived Future Directions

    ERIC Educational Resources Information Center

    Feldner, Matthew T.; Monson, Candice M.; Friedman, Matthew J.

    2007-01-01

    Although efforts to prevent posttraumatic stress disorder (PTSD) have met with relatively limited success, theoretically driven preventive approaches with promising efficacy are emerging. The current article critically reviews investigations of PTSD prevention programs that target persons at risk for being exposed to a traumatic event or who have…

  10. High power neutron production targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wender, S.

    1996-06-01

    The author describes issues of concern in the design of targets and associated systems for high power neutron production facilities. The facilities include uses for neutron scattering, accelerator driven transmutation, accelerator production of tritium, short pulse spallation sources, and long pulse spallation sources. Each of these applications requires a source with different design needs and consequently different implementation in practise.

  11. Driven waves in a two-fluid plasma

    NASA Astrophysics Data System (ADS)

    Roberge, W. G.; Ciolek, Glenn E.

    2007-12-01

    We study the physics of wave propagation in a weakly ionized plasma, as it applies to the formation of multifluid, magnetohydrodynamics (MHD) shock waves. We model the plasma as separate charged and neutral fluids which are coupled by ion-neutral friction. At times much less than the ion-neutral drag time, the fluids are decoupled and so evolve independently. At later times, the evolution is determined by the large inertial mismatch between the charged and neutral particles. The neutral flow continues to evolve independently; the charged flow is driven by and slaved to the neutral flow by friction. We calculate this driven flow analytically by considering the special but realistic case where the charged fluid obeys linearized equations of motion. We carry out an extensive analysis of linear, driven, MHD waves. The physics of driven MHD waves is embodied in certain Green functions which describe wave propagation on short time-scales, ambipolar diffusion on long time-scales and transitional behaviour at intermediate times. By way of illustration, we give an approximate solution for the formation of a multifluid shock during the collision of two identical interstellar clouds. The collision produces forward and reverse J shocks in the neutral fluid and a transient in the charged fluid. The latter rapidly evolves into a pair of magnetic precursors on the J shocks, wherein the ions undergo force-free motion and the magnetic field grows monotonically with time. The flow appears to be self-similar at the time when linear analysis ceases to be valid.

  12. KRAS-driven lung adenocarcinoma: combined DDR1/Notch inhibition as an effective therapy

    PubMed Central

    Ambrogio, Chiara; Nadal, Ernest; Villanueva, Alberto; Gómez-López, Gonzalo; Cash, Timothy P; Barbacid, Mariano; Santamaría, David

    2016-01-01

    Understanding the early evolution of cancer heterogeneity during the initial steps of tumorigenesis can uncover vulnerabilities of cancer cells that may be masked at later stages. We describe a comprehensive approach employing gene expression analysis in early lesions to identify novel therapeutic targets and the use of mouse models to test synthetic lethal drug combinations to treat human Kirsten rat sarcoma viral oncogene homologue (KRAS)-driven lung adenocarcinoma. PMID:27843638

  13. Enhanced proton acceleration in an applied longitudinal magnetic field

    DOE PAGES

    Arefiev, A.; Toncian, T.; Fiksel, G.

    2016-10-31

    Using two-dimensional particle-in-cell simulations, we examine how an externally applied strong magnetic field impacts proton acceleration in laser-irradiated solid-density targets. We find that a kT-level external magnetic field can sufficiently inhibit transverse transport of hot electrons in a flat laser-irradiated target. While the electron heating by the laser remains mostly unaffected, the reduced electron transport during proton acceleration leads to an enhancement of maximum proton energies and the overall number of energetic protons. The resulting proton beam is much better collimated compared to a beam generated without applying a kT-level magnetic field. A factor of three enhancement of the lasermore » energy conversion efficiency into multi-MeV protons is another effect of the magnetic field. The required kT-level magnetic fields are becoming feasible due to a significant progress that has been made in generating magnetic fields with laser-driven coils using ns-long laser pulses. The possibility of improving characteristics of laser-driven proton beams using such fields is a strong motivation for further development of laser-driven magnetic field capabilities.« less

  14. Laser-ablation-based ion source characterization and manipulation for laser-driven ion acceleration

    NASA Astrophysics Data System (ADS)

    Sommer, P.; Metzkes-Ng, J.; Brack, F.-E.; Cowan, T. E.; Kraft, S. D.; Obst, L.; Rehwald, M.; Schlenvoigt, H.-P.; Schramm, U.; Zeil, K.

    2018-05-01

    For laser-driven ion acceleration from thin foils (∼10 μm–100 nm) in the target normal sheath acceleration regime, the hydro-carbon contaminant layer at the target surface generally serves as the ion source and hence determines the accelerated ion species, i.e. mainly protons, carbon and oxygen ions. The specific characteristics of the source layer—thickness and relevant lateral extent—as well as its manipulation have both been investigated since the first experiments on laser-driven ion acceleration using a variety of techniques from direct source imaging to knife-edge or mesh imaging. In this publication, we present an experimental study in which laser ablation in two fluence regimes (low: F ∼ 0.6 J cm‑2, high: F ∼ 4 J cm‑2) was applied to characterize and manipulate the hydro-carbon source layer. The high-fluence ablation in combination with a timed laser pulse for particle acceleration allowed for an estimation of the relevant source layer thickness for proton acceleration. Moreover, from these data and independently from the low-fluence regime, the lateral extent of the ion source layer became accessible.

  15. Enhanced proton acceleration in an applied longitudinal magnetic field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arefiev, A.; Toncian, T.; Fiksel, G.

    Using two-dimensional particle-in-cell simulations, we examine how an externally applied strong magnetic field impacts proton acceleration in laser-irradiated solid-density targets. We find that a kT-level external magnetic field can sufficiently inhibit transverse transport of hot electrons in a flat laser-irradiated target. While the electron heating by the laser remains mostly unaffected, the reduced electron transport during proton acceleration leads to an enhancement of maximum proton energies and the overall number of energetic protons. The resulting proton beam is much better collimated compared to a beam generated without applying a kT-level magnetic field. A factor of three enhancement of the lasermore » energy conversion efficiency into multi-MeV protons is another effect of the magnetic field. The required kT-level magnetic fields are becoming feasible due to a significant progress that has been made in generating magnetic fields with laser-driven coils using ns-long laser pulses. The possibility of improving characteristics of laser-driven proton beams using such fields is a strong motivation for further development of laser-driven magnetic field capabilities.« less

  16. Motor selection dynamics in FEF explain the reaction time variance of saccades to single targets

    PubMed Central

    Hauser, Christopher K; Zhu, Dantong; Stanford, Terrence R

    2018-01-01

    In studies of voluntary movement, a most elemental quantity is the reaction time (RT) between the onset of a visual stimulus and a saccade toward it. However, this RT demonstrates extremely high variability which, in spite of extensive research, remains unexplained. It is well established that, when a visual target appears, oculomotor activity gradually builds up until a critical level is reached, at which point a saccade is triggered. Here, based on computational work and single-neuron recordings from monkey frontal eye field (FEF), we show that this rise-to-threshold process starts from a dynamic initial state that already contains other incipient, internally driven motor plans, which compete with the target-driven activity to varying degrees. The ensuing conflict resolution process, which manifests in subtle covariations between baseline activity, build-up rate, and threshold, consists of fundamentally deterministic interactions, and explains the observed RT distributions while invoking only a small amount of intrinsic randomness. PMID:29652247

  17. Targeting RAS-driven human cancer cells with antibodies to upregulated and essential cell-surface proteins.

    PubMed

    Martinko, Alexander J; Truillet, Charles; Julien, Olivier; Diaz, Juan E; Horlbeck, Max A; Whiteley, Gordon; Blonder, Josip; Weissman, Jonathan S; Bandyopadhyay, Sourav; Evans, Michael J; Wells, James A

    2018-01-23

    While there have been tremendous efforts to target oncogenic RAS signaling from inside the cell, little effort has focused on the cell-surface. Here, we used quantitative surface proteomics to reveal a signature of proteins that are upregulated on cells transformed with KRAS G12V , and driven by MAPK pathway signaling. We next generated a toolkit of recombinant antibodies to seven of these RAS-induced proteins. We found that five of these proteins are broadly distributed on cancer cell lines harboring RAS mutations. In parallel, a cell-surface CRISPRi screen identified integrin and Wnt signaling proteins as critical to RAS-transformed cells. We show that antibodies targeting CDCP1, a protein common to our proteomics and CRISPRi datasets, can be leveraged to deliver cytotoxic and immunotherapeutic payloads to RAS-transformed cancer cells and report for RAS signaling status in vivo. Taken together, this work presents a technological platform for attacking RAS from outside the cell. © 2018, Martinko et al.

  18. Self-generated surface magnetic fields inhibit laser-driven sheath acceleration of high-energy protons.

    PubMed

    Nakatsutsumi, M; Sentoku, Y; Korzhimanov, A; Chen, S N; Buffechoux, S; Kon, A; Atherton, B; Audebert, P; Geissel, M; Hurd, L; Kimmel, M; Rambo, P; Schollmeier, M; Schwarz, J; Starodubtsev, M; Gremillet, L; Kodama, R; Fuchs, J

    2018-01-18

    High-intensity lasers interacting with solid foils produce copious numbers of relativistic electrons, which in turn create strong sheath electric fields around the target. The proton beams accelerated in such fields have remarkable properties, enabling ultrafast radiography of plasma phenomena or isochoric heating of dense materials. In view of longer-term multidisciplinary purposes (e.g., spallation neutron sources or cancer therapy), the current challenge is to achieve proton energies well in excess of 100 MeV, which is commonly thought to be possible by raising the on-target laser intensity. Here we present experimental and numerical results demonstrating that magnetostatic fields self-generated on the target surface may pose a fundamental limit to sheath-driven ion acceleration for high enough laser intensities. Those fields can be strong enough (~10 5  T at laser intensities ~10 21  W cm -2 ) to magnetize the sheath electrons and deflect protons off the accelerating region, hence degrading the maximum energy the latter can acquire.

  19. Laser-driven relativistic electron beam interaction with solid dielectric

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarkisov, G. S.; Ivanov, V. V.; Leblanc, P.

    2012-07-30

    The multi-frames shadowgraphy, interferometry and polarimetry diagnostics with sub-ps time resolution were used for an investigation of ionization wave dynamics inside a glass target induced by laser-driven relativistic electron beam. Experiments were done using the 50 TW Leopard laser at the UNR. For a laser flux of {approx}2 Multiplication-Sign 10{sup 18}W/cm{sup 2} a hemispherical ionization wave propagates at c/3. The maximum of the electron density inside the glass target is {approx}2 Multiplication-Sign 10{sup 19}cm{sup -3}. Magnetic and electric fields are less than {approx}15 kG and {approx}1 MV/cm, respectively. The electron temperature has a maximum of {approx}0.5 eV. 2D interference phasemore » shift shows the 'fountain effect' of electron beam. The very low ionization inside glass target {approx}0.1% suggests a fast recombination at the sub-ps time scale. 2D PIC-simulations demonstrate radial spreading of fast electrons by self-consistent electrostatic fields.« less

  20. Th and U fuel photofission study by NTD for AD-MSR subcritical assembly

    NASA Astrophysics Data System (ADS)

    Sajo-Bohus, Laszlo; Greaves, Eduardo D.; Davila, Jesus; Barros, Haydn; Pino, Felix; Barrera, Maria T.; Farina, Fulvio

    2015-07-01

    During the last decade a considerable effort has been devoted for developing energy generating systems based on advanced nuclear technology within the design concepts of GEN-IV. Thorium base fuel systems such as accelerator driven nuclear reactors are one of the often mentioned attractive and affordable options. Several radiotherapy linear accelerators are on the market and due to their reliability, they could be employed as drivers for subcritical liquid fuel assemblies. Bremsstrahlung photons with energies above 5.5MeV, induce (γ,n) and (e,e'n) reactions in the W-target. Resulting gamma radiation and photo or fission neutrons may be absorbed in target materials such as thorium and uranium isotopes to induce sustained fission or nuclear transmutation in waste radioactive materials. Relevant photo driven and photo-fission reaction cross sections are important for actinides 232Th, 238U and 237Np in the radiotherapy machines energy range of 10-20 MV. In this study we employ passive nuclear track detectors (NTD) to determine fission rates and neutron production rates with the aim to establish the feasibility for gamma and photo-neutron driven subcritical assemblies. To cope with these objectives a 20 MV radiotherapy machine has been employed with a mixed fuel target. Results will support further development for a subcritical assembly employing a thorium containing liquid fuel. It is expected that acquired technological knowledge will contribute to the Venezuelan nuclear energy program.

  1. Low Voltage Activated Calcium Channels - Their Role in HER2 Driven Breast Cancer and Potential as a New Therapeutic Target

    DTIC Science & Technology

    2016-10-01

    combined with chemotherapy , but chemotherapy causes undesirable side effects due to off-target effects on normal tissue, which diminishes quality of life...highest response rates when combined with chemotherapy , but chemotherapy causes undesirable side effects due to off-target effects on normal...patients. Therefore, the overall goal of this proposal is to develop a tumor-specific, safe and effective therapy for breast cancer. We concentrate on

  2. Visual attention to features by associative learning.

    PubMed

    Gozli, Davood G; Moskowitz, Joshua B; Pratt, Jay

    2014-11-01

    Expecting a particular stimulus can facilitate processing of that stimulus over others, but what is the fate of other stimuli that are known to co-occur with the expected stimulus? This study examined the impact of learned association on feature-based attention. The findings show that the effectiveness of an uninformative color transient in orienting attention can change by learned associations between colors and the expected target shape. In an initial acquisition phase, participants learned two distinct sequences of stimulus-response-outcome, where stimuli were defined by shape ('S' vs. 'H'), responses were localized key-presses (left vs. right), and outcomes were colors (red vs. green). Next, in a test phase, while expecting a target shape (80% probable), participants showed reliable attentional orienting to the color transient associated with the target shape, and showed no attentional orienting with the color associated with the alternative target shape. This bias seemed to be driven by learned association between shapes and colors, and not modulated by the response. In addition, the bias seemed to depend on observing target-color conjunctions, since encountering the two features disjunctively (without spatiotemporal overlap) did not replicate the findings. We conclude that associative learning - likely mediated by mechanisms underlying visual object representation - can extend the impact of goal-driven attention to features associated with a target stimulus. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. NURSE STAFFING AND RENAL ANAEMIA OUTCOMES IN HAEMODIALYSIS CARE.

    PubMed

    Erlingmark, Julia; Hedström, Mariann; Lindberg, Magnus

    2016-09-01

    Current trends in renal anaemia management place greater emphasis, and thus increased workload, on the role of the nurse in haemodialysis settings. However, there is little evidence that demonstrates the relationship between nurse staffing and patient outcomes. To describe nurse staffing in haemodialysis settings, its relationship with target levels of renal anaemia management and to describe target level achievement for different ways of organising anaemia management. Cross-sectional audit. Forty (out of 78) haemodialysis centres in Sweden reported quality assurance data. The numbers of bedside registered nurses, licensed nurse assistants and patients undergoing haemodialysis during a predefined morning shift; type of anaemia management and achieved target levels of anaemia management. The mean patient:registered nurse ratio was 2.4 and the mean patient:nurse assistant ratio was 12.8. There were no significant relationships between registered nurse staffing and target level achievement. On average, 45.6% of the patients had haemoglobin within the target levels at centres applying nurse-driven anaemia management, compared with 47.3% at physician-driven centres. These cross-sectional data suggest that renal anaemia outcomes are unrelated to the patient:registered nurse ratio. There is, however, room for improvement in renal anaemia management in the units included in this study, particularly the achievement of target levels of haemoglobin and transferrin saturation. © 2016 European Dialysis and Transplant Nurses Association/European Renal Care Association.

  4. Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice.

    PubMed

    Mikami, Masafumi; Toki, Seiichi; Endo, Masaki

    2015-08-01

    The CRISPR/Cas9 system is an efficient tool used for genome editing in a variety of organisms. Despite several recent reports of successful targeted mutagenesis using the CRISPR/Cas9 system in plants, in each case the target gene of interest, the Cas9 expression system and guide-RNA (gRNA) used, and the tissues used for transformation and subsequent mutagenesis differed, hence the reported frequencies of targeted mutagenesis cannot be compared directly. Here, we evaluated mutation frequency in rice using different Cas9 and/or gRNA expression cassettes under standardized experimental conditions. We introduced Cas9 and gRNA expression cassettes separately or sequentially into rice calli, and assessed the frequency of mutagenesis at the same endogenous targeted sequences. Mutation frequencies differed significantly depending on the Cas9 expression cassette used. In addition, a gRNA driven by the OsU6 promoter was superior to one driven by the OsU3 promoter. Using an all-in-one expression vector harboring the best combined Cas9/gRNA expression cassette resulted in a much improved frequency of targeted mutagenesis in rice calli, and bi-allelic mutant plants were produced in the T0 generation. The approach presented here could be adapted to optimize the construction of Cas9/gRNA cassettes for genome editing in a variety of plants.

  5. Adherence to and effectiveness of an individually tailored home-based exercise program for frail older adults, driven by mobility monitoring: design of a prospective cohort study.

    PubMed

    Geraedts, Hilde A E; Zijlstra, Wiebren; Zhang, Wei; Bulstra, Sjoerd; Stevens, Martin

    2014-06-07

    With the number of older adults in society rising, frailty becomes an increasingly prevalent health condition. Regular physical activity can prevent functional decline and reduce frailty symptoms. In particular, home-based exercise programs can be beneficial in reducing frailty of older adults and fall risk, and in improving associated physiological parameters. However, adherence to home-based exercise programs is generally low among older adults. Current developments in technology can assist in enlarging adherence to home-based exercise programs. This paper presents the rationale and design of a study evaluating the adherence to and effectiveness of an individually tailored, home-based physical activity program for frail older adults driven by mobility monitoring through a necklace-worn physical activity sensor and remote feedback using a tablet PC. Fifty transitionally frail community-dwelling older adults will join a 6-month home-based physical activity program in which exercises are provided in the form of exercise videos on a tablet PC and daily activity is monitored by means of a necklace-worn motion sensor. Participants exercise 5 times a week. Exercises are built up in levels and are individually tailored in consultation with a coach through weekly telephone contact. The physical activity program driven by mobility monitoring through a necklace-worn sensor and remote feedback using a tablet PC is an innovative method for physical activity stimulation in frail older adults. We hypothesize that, if participants are sufficiently adherent, the program will result in higher daily physical activity and higher strength and balance assessed by physical tests compared to baseline. If adherence to and effectiveness of the program is considered sufficient, the next step would be to evaluate the effectiveness with a randomised controlled trial. The knowledge gained in this study can be used to develop and fine-tune the application of innovative technology in home-based exercise programs. Nederlands Trial Register (NTR); trial number 4265. The study was prospectively registered (registration date 14/11/2013).

  6. Oral-Motor Function and Feeding Intervention

    ERIC Educational Resources Information Center

    Garber, June

    2013-01-01

    This article presents the elements of the Oral Motor Intervention section of the Infant Care Path for Physical Therapy in the Neonatal Intensive Care Unit (NICU). The types of physical therapy interventions presented in this path are evidence based as well as infant driven and family focused. In the context of anticipated maturation of…

  7. Weekend wanderings: Exploring the role of neighborhood design on leisure physical activity of urban youth

    USDA-ARS?s Scientific Manuscript database

    Driven largely by concerns over children’s sedentary behavior and high obesity rates, a growing body of literature focuses on the role of the built environment in children’s active commuting trips. Nonetheless, leisure physical activity among youth has been understudied. This paper explores the link...

  8. Teaching Standard Deviation by Building from Student Invention

    ERIC Educational Resources Information Center

    Day, James; Nakahara, Hiroko; Bonn, Doug

    2010-01-01

    First-year physics laboratories are often driven by a mix of goals that includes the illustration or discovery of basic physics principles and a myriad of technical skills involving specific equipment, data analysis, and report writing. The sheer number of such goals seems guaranteed to produce cognitive overload, even when highly detailed…

  9. Teachers' Professional Learning in a European Learning Society: The Case of Physical Education

    ERIC Educational Resources Information Center

    Makopoulou, Kyriaki; Armour, Kathleen

    2011-01-01

    Background: In the contemporary "knowledge-driven" European society, the quality and relevance of Continuing Professional Development (CPD) for teachers and Physical Education teachers (PE-CPD) has come under scrutiny. National contexts within Europe vary considerably, however, so there is a need to gain analytical insights into PE-CPD…

  10. West Coast Swing Dancing as a Driven Harmonic Oscillator Model

    NASA Astrophysics Data System (ADS)

    Ferrara, Davon; Holzer, Marie; Kyere, Shirley

    The study of physics in sports not only provides valuable insight for improved athletic performance and injury prevention, but offers undergraduate students an opportunity to engage in both short- and long-term research efforts. In this project, conducted by two non-physics majors, we hypothesized that a driven harmonic oscillator model can be used to better understand the interaction between two west coast swing dancers since the stiffness of the physical connection between dance partners is a known factor in the dynamics of the dance. The hypothesis was tested by video analysis of two dancers performing a west coast swing basic, the sugar push, while changing the stiffness of the physical connection. The difference in stiffness of the connection from the ideal was estimated by the leader; the position with time data from the video was used to measure changes in the amplitude and phase difference between the leader and follower. While several aspects of our results agree with the proposed model, some key characteristics do not, possibly due to the follower relying on visual leads. Corresponding author and principal investigator.

  11. Recent Developments in Non-Fermi Liquid Theory

    NASA Astrophysics Data System (ADS)

    Lee, Sung-Sik

    2018-03-01

    Non-Fermi liquids are unconventional metals whose physical properties deviate qualitatively from those of noninteracting fermions due to strong quantum fluctuations near Fermi surfaces. They arise when metals are subject to singular interactions mediated by soft collective modes. In the absence of well-defined quasiparticles, universal physics of non-Fermi liquids is captured by interacting field theories which replace Landau Fermi liquid theory. However, it has been difficult to understand their universal low-energy physics due to a lack of theoretical methods that take into account strong quantum fluctuations in the presence of abundant low-energy degrees of freedom. In this review, we discuss two approaches that have been recently developed for non-Fermi liquid theory with emphasis on two space dimensions. The first is a perturbative scheme based on a dimensional regularization, which achieves a controlled access to the low-energy physics by tuning the codimension of Fermi surface. The second is a nonperturbative approach which treats the interaction ahead of the kinetic term through a non-Gaussian scaling called interaction-driven scaling. Examples of strongly coupled non-Fermi liquids amenable to exact treatments through the interaction-driven scaling are discussed.

  12. Polarized targets in high energy physics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cates, G.D. Jr.

    1994-12-01

    Various approaches are discussed for producing polarized nuclear targets for high energy physics experiments. As a unifying theme, examples are drawn from experiments to measure spin dependent structure functions of nucleons in deep inelastic scattering. This single physics goal has, over roughly two decades, been a driving force in advances in target technology. Actual or planned approaches have included solid targets polarized by dynamic nuclear polarization (DNP), several types of internal targets for use in storage rings, and gaseous {sup 3}He targets polarized by spin-exchange optical pumping. This last approach is the type of target adopted for SLAC E-142, anmore » experiment to measure the spin structure function of the neutron, and is described in detail.« less

  13. Popcorn-shaped magnetic core-plasmonic shell multifunctional nanoparticles for the targeted magnetic separation and enrichment, label-free SERS imaging, and photothermal destruction of multidrug-resistant bacteria.

    PubMed

    Fan, Zhen; Senapati, Dulal; Khan, Sadia Afrin; Singh, Anant Kumar; Hamme, Ashton; Yust, Brian; Sardar, Dhiraj; Ray, Paresh Chandra

    2013-02-18

    Over the last few years, one of the most important and complex problems facing our society is treating infectious diseases caused by multidrug-resistant bacteria (MDRB), by using current market-existing antibiotics. Driven by this need, we report for the first time the development of the multifunctional popcorn-shaped iron magnetic core-gold plasmonic shell nanotechnology-driven approach for targeted magnetic separation and enrichment, label-free surface-enhanced Raman spectroscopy (SERS) detection, and the selective photothermal destruction of MDR Salmonella DT104. Due to the presence of the "lightning-rod effect", the core-shell popcorn-shaped gold-nanoparticle tips provided a huge field of SERS enhancement. The experimental data show that the M3038 antibody-conjugated nanoparticles can be used for targeted separation and SERS imaging of MDR Salmonella DT104. A targeted photothermal-lysis experiment, by using 670 nm light at 1.5 W cm(-2) for 10 min, results in selective and irreparable cellular-damage to MDR Salmonella. We discuss the possible mechanism and operating principle for the targeted separation, label-free SERS imaging, and photothermal destruction of MDRB by using the popcorn-shaped magnetic/plasmonic nanotechnology. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Treatment Targets in Inflammatory Bowel Disease: Current Status in Daily Practice.

    PubMed

    Römkens, Tessa E H; Gijsbers, Kim; Kievit, Wietske; Hoentjen, Frank; Drenth, Joost P H

    2016-12-01

    Recently, treatment goals in inflammatory bowel disease (IBD) in clinical trials have shifted from mainly symptom-based to more mucosa-driven. Real world data on treatment priorities are lacking. We aimed to investigate the current practice and most commonly used definitions of IBD treatment targets among Dutch gastroenterologists. Dutch gastroenterologists were asked to participate in a computer-based nation-wide survey. We asked questions on demographics, opinion and current practice regarding IBD treatment targets. Twenty-four percent (134/556) of the respondents completed the survey. For both Crohn's disease (CD) (47.3%, 61/129) and ulcerative colitis (UC)(45%, 58/129) the main treatment goal was to achieve and maintain deep remission, defined as clinical, biochemical and endoscopic remission. Seventy-six percent of the participants use mucosal healing (MH) as a potential treatment target for IBD, whereas 22.6% use histological remission. There is no single definition for MH in IBD. The majority use Mayo score ≤ 1 in UC (52%) and 'macroscopic normal mucosa' in CD (66%). More stringent and mucosa-driven treatment targets as 'deep remission' and 'mucosal healing' have found traction in clinical practice. The most commonly used definition for MH in routine practice is endoscopic MAYO score

  15. Experimental investigation of adiabatic compression and heating using collision of an MHD-driven jet with a gas target cloud for magnetized target fusion

    NASA Astrophysics Data System (ADS)

    Seo, Byonghoon; Li, Hui; Bellan, Paul

    2017-10-01

    We are studying magnetized target fusion using an experimental method where an imploding liner compressing a plasma is simulated by a high-speed MHD-driven plasma jet colliding with a gas target cloud. This has the advantage of being non-destructive so orders of magnitude more shots are possible. Since the actual density and temperature are much more modest than fusion-relevant values, the goal is to determine the scaling of the increase in density and temperature when an actual experimental plasma is adiabatically compressed. Two new-developed diagnostics are operating and providing data. The first new diagnostic is a fiber-coupled interferometer which measures line-integrated electron density not only as a function of time, but also as a function of position along the jet. The second new diagnostic is laser Thomson scattering which measures electron density and temperature at the location where the jet collides with the cloud. These diagnostics show that when the jet collides with a target cloud the jet slows down substantially and both the electron density and temperature increase. The experimental measurements are being compared with 3D MHD and hybrid kinetic numerical simulations that model the actual experimental geometry.

  16. Simulations of laser-driven ion acceleration from a thin CH target

    NASA Astrophysics Data System (ADS)

    Park, Jaehong; Bulanov, Stepan; Ji, Qing; Steinke, Sven; Treffert, Franziska; Vay, Jean-Luc; Schenkel, Thomas; Esarey, Eric; Leemans, Wim; Vincenti, Henri

    2017-10-01

    2D and 3D computer simulations of laser driven ion acceleration from a thin CH foil using code WARP were performed. As the foil thickness varies from a few nm to μm, the simulations confirm that the acceleration mechanism transitions from the RPA (radiation pressure acceleration) to the TNSA (target normal sheath acceleration). In the TNSA regime, with the CH target thickness of 1 μ m and a pre-plasma ahead of the target, the simulations show the production of the collimated proton beam with the maximum energy of about 10 MeV. This agrees with the experimental results obtained at the BELLA laser facility (I 5 × 18 W / cm2 , λ = 800 nm). Furthermore, the maximum proton energy dependence on different setups of the initialization, i.e., different angles of the laser incidence from the target normal axis, different gradient scales and distributions of the pre-plasma, was explored. This work was supported by LDRD funding from LBNL, provided by the U.S. DOE under Contract No. DE-AC02-05CH11231, and used resources of the NERSC, a DOE office of Science User Facility supported by the U.S. DOE under Contract No. DE-AC02-05CH11231.

  17. Neural correlates of the spatial and expectancy components of endogenous and stimulus-driven orienting of attention in the Posner task.

    PubMed

    Doricchi, Fabrizio; Macci, Enrica; Silvetti, Massimo; Macaluso, Emiliano

    2010-07-01

    Voluntary orienting of visual attention is conventionally measured in tasks with predictive central cues followed by frequent valid targets at the cued location and by infrequent invalid targets at the uncued location. This implies that invalid targets entail both spatial reorienting of attention and breaching of the expected spatial congruency between cues and targets. Here, we used event-related functional magnetic resonance imaging (fMRI) to separate the neural correlates of the spatial and expectancy components of both endogenous orienting and stimulus-driven reorienting of attention. We found that during endogenous orienting with predictive cues, there was a significant deactivation of the right Temporal-Parietal Junction (TPJ). We also discovered that the lack of an equivalent deactivation with nonpredictive cues was matched to drop in attentional costs and preservation of attentional benefits. The right TPJ showed equivalent responses to invalid targets following predictive and nonpredictive cues. On the contrary, infrequent-unexpected invalid targets following predictive cues specifically activated the right Middle and Inferior Frontal Gyrus (MFG-IFG). Additional comparisons with spatially neutral trials demonstrated that, independently of cue predictiveness, valid targets activate the left TPJ, whereas invalid targets activate both the left and right TPJs. These findings show that the selective right TPJ activation that is found in the comparison between invalid and valid trials results from the reciprocal cancelling of the different activations that in the left TPJ are related to the processing of valid and invalid targets. We propose that left and right TPJs provide "matching and mismatching to attentional template" signals. These signals enable reorienting of attention and play a crucial role in the updating of the statistical contingency between cues and targets.

  18. Targeting and tailoring physical activity information using print and information technologies.

    PubMed

    Napolitano, Melissa A; Marcus, Bess H

    2002-07-01

    With the large numbers of physically inactive individuals, it is important that interventions reach a broad spectrum of the population. This paper focuses on targeting and tailoring physical activity information, and the use of mediated interventions, specifically those using print, and other information technologies for promoting physical activity.

  19. Development of in situ time-resolved Raman spectroscopy facility for dynamic shock loading in materials

    NASA Astrophysics Data System (ADS)

    Chaurasia, S.; Rastogi, V.; Rao, U.; Sijoy, C. D.; Mishra, V.; Deo, M. N.

    2017-11-01

    The transient state of excitation and relaxation processes in materials under shock compression can be investigated by coupling the laser driven shock facility with Raman spectroscopy. For this purpose, a time resolved Raman spectroscopy setup has been developed to monitor the physical and the chemical changes such as phase transitions, chemical reactions, molecular kinetics etc., under shock compression with nanosecond time resolution. This system consist of mainly three parts, a 2 J/8 ns Nd:YAG laser system used for generation of pump and probe beams, a Raman spectrometer with temporal and spectral resolution of 1.2 ns and 3 cm-1 respectively and a target holder in confinement geometry assembly. Detailed simulation for the optimization of confinement geometry targets is performed. Time resolved measurement of polytetrafluoroethylene (PTFE) targets at focused laser intensity of 2.2 GW/cm2 has been done. The corresponding pressure in the Aluminum and PTFE are 3.6 and 1.7 GPa respectively. At 1.7 GPa in PTFE, a red shift of 5 cm-1 is observed for the CF2 twisting mode (291 cm-1). Shock velocity in PTFE is calculated by measuring rate of change of ratios of the intensity of Raman lines scattered from shocked volume to total volume of sample in the laser focal spot along the laser axis. The calculated shock velocity in PTFE is found to be 1.64 ± 0.16 km/s at shock pressure of 1.7 GPa, for present experimental conditions.

  20. Quasi-monoenergetic ion beam acceleration by laser-driven shock and solitary waves in near-critical plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, W. L.; Qiao, B., E-mail: bqiao@pku.edu.cn; Huang, T. W.

    2016-07-15

    Ion acceleration in near-critical plasmas driven by intense laser pulses is investigated theoretically and numerically. A theoretical model has been given for clarification of the ion acceleration dynamics in relation to different laser and target parameters. Two distinct regimes have been identified, where ions are accelerated by, respectively, the laser-induced shock wave in the weakly driven regime (comparatively low laser intensity) and the nonlinear solitary wave in the strongly driven regime (comparatively high laser intensity). Two-dimensional particle-in-cell simulations show that quasi-monoenergetic proton beams with a peak energy of 94.6 MeV and an energy spread 15.8% are obtained by intense laser pulsesmore » at intensity I{sub 0} = 3 × 10{sup 20 }W/cm{sup 2} and pulse duration τ = 0.5 ps in the strongly driven regime, which is more advantageous than that got in the weakly driven regime. In addition, 233 MeV proton beams with narrow spread can be produced by extending τ to 1.0 ps in the strongly driven regime.« less

  1. Memory-driven attentional capture reveals the waxing and waning of working memory activation due to dual-task interference.

    PubMed

    Sasin, Edyta; Nieuwenstein, Mark

    2016-12-01

    Previous studies have shown that information held in working memory (WM) actively or as a residue of previous processing can lead to attentional capture by corresponding stimuli in the environment. Here, we compared attentional capture by goal-driven and residual WM activation and examined how these effects are affected by dual-task interference. In two experiments, participants performed an animacy judgment task for a word that they did or did not have to remember for a later recognition test. The word was followed in half of the trials by an arithmetic task that served to disrupt the WM activation of the previously processed word. Subsequently, WM-driven capture was assessed by having participants perform a single-target rapid serial visual presentation task in which a line drawing corresponding to the word was presented shortly before a target. The results showed that the line drawing captured attention irrespective of the presence of the arithmetic task when the word had to be remembered. In comparison, the animacy judgment alone resulted in capture only when the arithmetic task was absent, and this effect was equally strong as the capture effect caused by a to-be-remembered word. Taken together, these findings show that although residual and goal-driven WM activation may be equally potent in guiding attentional selection, these two forms of WM activation differ in that residual activation is overwritten by an attention-demanding task, whereas goal-driven WM activation can lead to the reinstatement of a stimulus after performing such a task.

  2. About the RAS Initiative

    Cancer.gov

    The RAS Initiative, a "hub and spoke" model, connects researchers to better understand and target the more than 30% of cancers driven by mutations in RAS genes. Includes oversight and contact information.

  3. Dragging ras back in the ring.

    PubMed

    Stephen, Andrew G; Esposito, Dominic; Bagni, Rachel K; McCormick, Frank

    2014-03-17

    Ras proteins play a major role in human cancers but have not yielded to therapeutic attack. Ras-driven cancers are among the most difficult to treat and often excluded from therapies. The Ras proteins have been termed "undruggable," based on failures from an era in which understanding of signaling transduction, feedback loops, redundancy, tumor heterogeneity, and Ras' oncogenic role was poor. Structures of Ras oncoproteins bound to their effectors or regulators are unsolved, and it is unknown precisely how Ras proteins activate their downstream targets. These knowledge gaps have impaired development of therapeutic strategies. A better understanding of Ras biology and biochemistry, coupled with new ways of targeting undruggable proteins, is likely to lead to new ways of defeating Ras-driven cancers. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Optical simulation of flying targets using physically based renderer

    NASA Astrophysics Data System (ADS)

    Cheng, Ye; Zheng, Quan; Peng, Junkai; Lv, Pin; Zheng, Changwen

    2018-02-01

    The simulation of aerial flying targets is widely needed in many fields. This paper proposes a physically based method for optical simulation of flying targets. In the first step, three-dimensional target models are built and the motion speed and direction are defined. Next, the material of the outward appearance of a target is also simulated. Then the illumination conditions are defined. After all definitions are given, all settings are encoded in a description file. Finally, simulated results are generated by Monte Carlo ray tracing in a physically based renderer. Experiments show that this method is able to simulate materials, lighting and motion blur for flying targets, and it can generate convincing and highquality simulation results.

  5. A study on a robot arm driven by three-dimensional trajectories predicted from non-invasive neural signals.

    PubMed

    Kim, Yoon Jae; Park, Sung Woo; Yeom, Hong Gi; Bang, Moon Suk; Kim, June Sic; Chung, Chun Kee; Kim, Sungwan

    2015-08-20

    A brain-machine interface (BMI) should be able to help people with disabilities by replacing their lost motor functions. To replace lost functions, robot arms have been developed that are controlled by invasive neural signals. Although invasive neural signals have a high spatial resolution, non-invasive neural signals are valuable because they provide an interface without surgery. Thus, various researchers have developed robot arms driven by non-invasive neural signals. However, robot arm control based on the imagined trajectory of a human hand can be more intuitive for patients. In this study, therefore, an integrated robot arm-gripper system (IRAGS) that is driven by three-dimensional (3D) hand trajectories predicted from non-invasive neural signals was developed and verified. The IRAGS was developed by integrating a six-degree of freedom robot arm and adaptive robot gripper. The system was used to perform reaching and grasping motions for verification. The non-invasive neural signals, magnetoencephalography (MEG) and electroencephalography (EEG), were obtained to control the system. The 3D trajectories were predicted by multiple linear regressions. A target sphere was placed at the terminal point of the real trajectories, and the system was commanded to grasp the target at the terminal point of the predicted trajectories. The average correlation coefficient between the predicted and real trajectories in the MEG case was [Formula: see text] ([Formula: see text]). In the EEG case, it was [Formula: see text] ([Formula: see text]). The success rates in grasping the target plastic sphere were 18.75 and 7.50 % with MEG and EEG, respectively. The success rates of touching the target were 52.50 and 58.75 % respectively. A robot arm driven by 3D trajectories predicted from non-invasive neural signals was implemented, and reaching and grasping motions were performed. In most cases, the robot closely approached the target, but the success rate was not very high because the non-invasive neural signal is less accurate. However the success rate could be sufficiently improved for practical applications by using additional sensors. Robot arm control based on hand trajectories predicted from EEG would allow for portability, and the performance with EEG was comparable to that with MEG.

  6. Statistical Inference for Data Adaptive Target Parameters.

    PubMed

    Hubbard, Alan E; Kherad-Pajouh, Sara; van der Laan, Mark J

    2016-05-01

    Consider one observes n i.i.d. copies of a random variable with a probability distribution that is known to be an element of a particular statistical model. In order to define our statistical target we partition the sample in V equal size sub-samples, and use this partitioning to define V splits in an estimation sample (one of the V subsamples) and corresponding complementary parameter-generating sample. For each of the V parameter-generating samples, we apply an algorithm that maps the sample to a statistical target parameter. We define our sample-split data adaptive statistical target parameter as the average of these V-sample specific target parameters. We present an estimator (and corresponding central limit theorem) of this type of data adaptive target parameter. This general methodology for generating data adaptive target parameters is demonstrated with a number of practical examples that highlight new opportunities for statistical learning from data. This new framework provides a rigorous statistical methodology for both exploratory and confirmatory analysis within the same data. Given that more research is becoming "data-driven", the theory developed within this paper provides a new impetus for a greater involvement of statistical inference into problems that are being increasingly addressed by clever, yet ad hoc pattern finding methods. To suggest such potential, and to verify the predictions of the theory, extensive simulation studies, along with a data analysis based on adaptively determined intervention rules are shown and give insight into how to structure such an approach. The results show that the data adaptive target parameter approach provides a general framework and resulting methodology for data-driven science.

  7. A modeling approach for aerosol optical depth analysis during forest fire events

    NASA Astrophysics Data System (ADS)

    Aube, Martin P.; O'Neill, Normand T.; Royer, Alain; Lavoue, David

    2004-10-01

    Measurements of aerosol optical depth (AOD) are important indicators of aerosol particle behavior. Up to now the two standard techniques used for retrieving AOD are; (i) sun photometry which provides measurements of high temporal frequency and sparse spatial frequency, and (ii) satellite based approaches such as DDV (Dense Dark Vegetation) based inversion algorithms which yield AOD over dark targets in remotely sensed imagery. Although the latter techniques allow AOD retrieval over appreciable spatial domains, the irregular spatial pattern of dark targets and the typically low repeat frequencies of imaging satellites exclude the acquisition of AOD databases on a continuous spatio-temporal basis. We attempt to fill gaps in spatio-temporal AOD measurements using a new assimilation methodology that links AOD measurements and the predictions of a particulate matter Transport Model. This modelling package (AODSEM V2.0 for Aerosol Optical Depth Spatio-temporal Evolution Model) uses a size and aerosol type segregated semi-Lagrangian trajectory algorithm driven by analysed meteorological data. Its novelty resides in the fact that the model evolution may be tied to both ground based and satellite level AOD measurement and all physical processes have been optimized to track this important and robust parameter. We applied this methodology to a significant smoke event that occurred over the eastern part of North America in July 2002.

  8. Studies of Ion Beam Charge Neutralization by Ferroelectric Plasma Sources

    NASA Astrophysics Data System (ADS)

    Stepanov, A.; Gilson, E. P.; Grisham, L.; Davidson, R. C.

    2013-10-01

    Space-charge forces limit the possible transverse compression of high perveance ion beams that are used in ion-beam-driven high energy density physics applications; the minimum radius to which a beam can be focused is an increasing function of perveance. The limit can be overcome if a plasma is introduced in the beam path between the focusing element and the target in order to neutralize the space charge of the beam. This concept has been implemented on the Neutralized Drift Compression eXperiment (NDCX) at LBNL using Ferroelectric Plasma Sources (FEPS). In our experiment at PPPL, we propagate a perveance-dominated ion beam through a FEPS to study the effect of the neutralizing plasma on the beam envelope and its evolution in time. A 30-60 keV space-charge-dominated Argon beam is focused with an Einzel lens into a FEPS located at the beam waist. The beam is intercepted downstream from the FEPS by a movable Faraday cup that provides time-resolved 2D current density profiles of the beam spot on target. We report results on: (a) dependence of charge neutralization on FEPS plasma density; (b) effects on beam emittance, and (c) time evolution of the beam envelope after the FEPS pulse. Research supported by the U.S. Department of Energy.

  9. STEP signaling pathway mediates psychomotor stimulation and morphine withdrawal symptoms, but not for reward, analgesia and tolerance

    PubMed Central

    Kim, Yoon-Jung; Kang, Young; Park, Hye-Yeon; Lee, Jae-Ran; Yu, Dae-Yeul; Murata, Takuya; Gondo, Yoichi; Hwang, Jung Hwan; Kim, Yong-Hoon; Lee, Chul-Ho; Rhee, Myungchull; Han, Pyung-Lim; Chung, Bong-Hyun; Lee, Hyun-Jun; Kim, Kyoung-Shim

    2016-01-01

    Striatal-enriched protein tyrosine phosphatase (STEP) is abundantly expressed in the striatum, which strongly expresses dopamine and opioid receptors and mediates the effects of many drugs of abuse. However, little is known about the role of STEP in opioid receptor function. In the present study, we generated STEP-targeted mice carrying a nonsense mutation (C230X) in the kinase interaction domain of STEP by screening the N-ethyl-N-nitrosourea (ENU)-driven mutant mouse genomic DNA library and subsequent in vitro fertilization. It was confirmed that the C230X nonsense mutation completely abolished functional STEP protein expression in the brain. STEPC230X−/− mice showed attenuated acute morphine-induced psychomotor activity and withdrawal symptoms, whereas morphine-induced analgesia, tolerance and reward behaviors were unaffected. STEPC230X−/− mice displayed reduced hyperlocomotion in response to intrastriatal injection of the μ-opioid receptor agonist DAMGO, but the behavioral responses to δ- and κ-opioid receptor agonists remained intact. These results suggest that STEP has a key role in the regulation of psychomotor action and physical dependency to morphine. These data suggest that STEP inhibition may be a critical target for the treatment of withdrawal symptoms associated with morphine. PMID:26915673

  10. Symmetry breaking in clogging for oppositely driven particles

    NASA Astrophysics Data System (ADS)

    Glanz, Tobias; Wittkowski, Raphael; Löwen, Hartmut

    2016-11-01

    The clogging behavior of a symmetric binary mixture of colloidal particles that are driven in opposite directions through constrictions is explored by Brownian dynamics simulations and theory. A dynamical state with a spontaneously broken symmetry occurs where one species is flowing and the other is blocked for a long time, which can be tailored by the size of the constrictions. Moreover, we find self-organized oscillations in clogging and unclogging of the two species. Apart from statistical physics, our results are of relevance for fields like biology, chemistry, and crowd management, where ions, microparticles, pedestrians, or other particles are driven in opposite directions through constrictions.

  11. Identifying Androgen Receptor-Independent Mechanisms of Prostate Cancer Resistance to Second-Generation Antiandrogen Therapy

    DTIC Science & Technology

    2016-08-01

    expanded upon the relationship between GR and SGK1 in the context of enzalutamide-driven prostate cancer. We have generated CRISPR /Cas9 cell lines...Complete Generate SGK1 overexpressing cell models 50% Ongoing Clone SGK1 CRISPR 100% Complete Generate SGK1-deficient cell models 75% Ongoing Test...driven enzalutamide resistance, GR-expressing enzalutamide-resistant prostate cancer cells expressing CRISPR /Cas9 and a guide targeting SGK1 (sgSGK1

  12. Exploiting the bad eating habits of Ras-driven cancers.

    PubMed

    White, Eileen

    2013-10-01

    Oncogenic Ras promotes glucose fermentation and glutamine use to supply central carbon metabolism, but how and why have only emerged recently. Ras-mediated metabolic reprogramming generates building blocks for growth and promotes antioxidant defense. To fuel metabolic pathways, Ras scavenges extracellular proteins and lipids. To bolster metabolism and mitigate stress, Ras activates cellular self-cannibalization and recycling of proteins and organelles by autophagy. Targeting these distinct features of Ras-driven cancers provides novel approaches to cancer therapy.

  13. Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain

    PubMed Central

    Shimada, Naoto; Inami, Show; Sato, Shoma; Kitamoto, Toshihiro; Sakai, Takaomi

    2016-01-01

    Apterous (Ap), the best studied LIM-homeodomain transcription factor in Drosophila, cooperates with the cofactor Chip (Chi) to regulate transcription of specific target genes. Although Ap regulates various developmental processes, its function in the adult brain remains unclear. Here, we report that Ap and Chi in the neurons expressing PDF, a neuropeptide, play important roles in proper sleep/wake regulation in adult flies. PDF-expressing neurons consist of two neuronal clusters: small ventral-lateral neurons (s-LNvs) acting as the circadian pacemaker and large ventral-lateral neurons (l-LNvs) regulating light-driven arousal. We identified that Ap localizes to the nuclei of s-LNvs and l-LNvs. In light-dark (LD) cycles, RNAi knockdown or the targeted expression of dominant-negative forms of Ap or Chi in PDF-expressing neurons or l-LNvs promoted arousal. In contrast, in constant darkness, knockdown of Ap in PDF-expressing neurons did not promote arousal, indicating that a reduced Ap function in PDF-expressing neurons promotes light-driven arousal. Furthermore, Ap expression in l-LNvs showed daily rhythms (peaking at midnight), which are generated by a direct light-dependent mechanism rather than by the endogenous clock. These results raise the possibility that the daily oscillation of Ap expression in l-LNvs may contribute to the buffering of light-driven arousal in wild-type flies. PMID:27853240

  14. Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain.

    PubMed

    Shimada, Naoto; Inami, Show; Sato, Shoma; Kitamoto, Toshihiro; Sakai, Takaomi

    2016-11-17

    Apterous (Ap), the best studied LIM-homeodomain transcription factor in Drosophila, cooperates with the cofactor Chip (Chi) to regulate transcription of specific target genes. Although Ap regulates various developmental processes, its function in the adult brain remains unclear. Here, we report that Ap and Chi in the neurons expressing PDF, a neuropeptide, play important roles in proper sleep/wake regulation in adult flies. PDF-expressing neurons consist of two neuronal clusters: small ventral-lateral neurons (s-LNvs) acting as the circadian pacemaker and large ventral-lateral neurons (l-LNvs) regulating light-driven arousal. We identified that Ap localizes to the nuclei of s-LNvs and l-LNvs. In light-dark (LD) cycles, RNAi knockdown or the targeted expression of dominant-negative forms of Ap or Chi in PDF-expressing neurons or l-LNvs promoted arousal. In contrast, in constant darkness, knockdown of Ap in PDF-expressing neurons did not promote arousal, indicating that a reduced Ap function in PDF-expressing neurons promotes light-driven arousal. Furthermore, Ap expression in l-LNvs showed daily rhythms (peaking at midnight), which are generated by a direct light-dependent mechanism rather than by the endogenous clock. These results raise the possibility that the daily oscillation of Ap expression in l-LNvs may contribute to the buffering of light-driven arousal in wild-type flies.

  15. Evaluating data-driven causal inference techniques in noisy physical and ecological systems

    NASA Astrophysics Data System (ADS)

    Tennant, C.; Larsen, L.

    2016-12-01

    Causal inference from observational time series challenges traditional approaches for understanding processes and offers exciting opportunities to gain new understanding of complex systems where nonlinearity, delayed forcing, and emergent behavior are common. We present a formal evaluation of the performance of convergent cross-mapping (CCM) and transfer entropy (TE) for data-driven causal inference under real-world conditions. CCM is based on nonlinear state-space reconstruction, and causality is determined by the convergence of prediction skill with an increasing number of observations of the system. TE is the uncertainty reduction based on transition probabilities of a pair of time-lagged variables. With TE, causal inference is based on asymmetry in information flow between the variables. Observational data and numerical simulations from a number of classical physical and ecological systems: atmospheric convection (the Lorenz system), species competition (patch-tournaments), and long-term climate change (Vostok ice core) were used to evaluate the ability of CCM and TE to infer causal-relationships as data series become increasingly corrupted by observational (instrument-driven) or process (model-or -stochastic-driven) noise. While both techniques show promise for causal inference, TE appears to be applicable to a wider range of systems, especially when the data series are of sufficient length to reliably estimate transition probabilities of system components. Both techniques also show a clear effect of observational noise on causal inference. For example, CCM exhibits a negative logarithmic decline in prediction skill as the noise level of the system increases. Changes in TE strongly depend on noise type and which variable the noise was added to. The ability of CCM and TE to detect driving influences suggest that their application to physical and ecological systems could be transformative for understanding driving mechanisms as Earth systems undergo change.

  16. Personalizing Therapy in Advanced Non–Small Cell Lung Cancer

    PubMed Central

    Villaruz, Liza C.; Burns, Timothy F.; Ramfidis, Vasilis S.; Socinski, Mark A.

    2016-01-01

    The recognition that non–small cell lung cancer (NSCLC) is not a single disease entity, but rather a collection of distinct molecularly driven neoplasms, has permanently shifted the therapeutic landscape of NSCLC to a personalized approach. This personalization of NSCLC therapy is typified by the dramatic response rates seen in EGFR mutant NSCLC when treated with targeted tyrosine kinase inhibitor therapy and in ALK translocation–driven NSCLC when treated with ALK inhibitors. Targeted therapeutic approaches in NSCLC necessitate consideration of more invasive biopsy techniques aimed at providing sufficient tissue for both histological determination and molecular profiling in all patients with stage IV disease both at the time of diagnosis and at the time of disease progression. Comprehensive genotyping efforts have identified oncogenic drivers in 62% lung adenocarcinomas and an increasing proportion of squamous cell carcinomas of the lung. The identification of these oncogenic drivers and the triage of patients to clinical trials evaluating novel targeted therapeutic approaches will increasingly mold a landscape of personalized lung cancer therapy where each genotype has an associated targeted therapy. This review outlines the state of personalized lung cancer therapy as it pertains to individual NSCLC genotypes. PMID:24258572

  17. Numerical simulations to model laser-driven coil-capacitor targets for generation of kilo-Tesla magnetic fields

    NASA Astrophysics Data System (ADS)

    Schillaci, F.; De Marco, M.; Giuffrida, L.; Fujioka, S.; Zhang, Z.; Korn, G.; Margarone, D.

    2018-02-01

    A coil-capacitor target is modeled using FEM simulations and analytical calculations, which allow to explain the time evolution of such complex target during magnetic field production driven by the flow of an extremely high current generated through the interaction with a high power laser. The numerical model includes a detailed study of the magnetic field produced by the coil-capacitor target, both in the static and transient cases, as well as magnetic force and Joule heating. The model is validated by experimental data reported in literature and can be of interest for several applications. As an example, the combination of two synchronized nanosecond lasers with the purpose of producing a plasma responsible of the proton-boron (p+ + 11B → 8.5 MeV + 3α) fusion reaction, and energizing two multi-turn coils with the main purpose of confining such a plasma could enhance the reaction rate. The preliminary conceptual design of a magnetic mirror configuration to be used for confining protons and boron ions up to a few MeV/u in a region of less than 1 mm2 is briefly reported.

  18. Fc-receptor induced cell spreading during frustrated phagocytosis in J774A.1 macrophages

    NASA Astrophysics Data System (ADS)

    Kovari, Daniel; Curtis, Jennifer; Wei, Wenbin

    2014-03-01

    Phagocytosis is the process where by cells engulf foreign particles. It is the primary mechanism through which macrophages and neutrophils (white blood cells) eliminate pathogens and debris from the body. The behavior is the result of a cascade of chemical and mechanical cues, which result in the actin-driven expansion of the cell's membrane around its target. For macrophages undergoing Fc-mediated phagocytosis, we show that above a minimum threshold the spreading rate and maximum cell-target contact area are independent of the target's opsonin density. Qualitatively, macrophage phagocytic spreading is similar to the spreading of other cell types (e.g. fibroblasts, lymphocytes, and Dict.d.). Early spreading is most likely the result of ``passive'' alignment of the cell to the target surface. This is followed by an active expansion period driven by actin. Finally upon reaching a maximum contact area, typically 2-3 times the size of ``non-activated'' cells, macrophages often undergo a period of rapid contraction not reported in other cell types. We hypothesize that this, as yet unexplained, transition may be specific to the chemical and mechanical machinery associated with phagocytosis. This work was funded by NSF grant PHYS 0848797 and NSF grant DMR 0820382.

  19. A Potent, Imaging Adenoviral Vector Driven by the Cancer-selective Mucin-1 Promoter That Targets Breast Cancer Metastasis

    PubMed Central

    Huyn, Steven T.; Burton, Jeremy B.; Sato, Makoto; Carey, Michael; Gambhir, Sanjiv S.; Wu, Lily

    2009-01-01

    Purpose With breast cancer, early detection and proper staging are critical, and will often influence both the treatment regimen and the therapeutic outcome for those affected with this disease. Improvements in these areas will play a profound role in reducing mortality from breast cancer. Experimental Design In this work we developed a breast cancer – targeted serotype 5 adenoviral vector, utilizing the tumor-specific mucin-1 promoter in combination with the two-step transcriptional amplification system, a system used to augment the activity of weak tissue – specific promoters. Results We showed the strong specificity of this tumor-selective adenovirus to express the luciferase optical imaging gene, leading to diagnostic signals that enabled detection of sentinel lymph node metastasis of breast cancer. Furthermore, we were able to target hepatic metastases following systemic administration of this mucin-1 selective virus. Conclusions Collectively, we showed that the amplified mucin-1 promoter – driven vector is able to deliver to and selectively express a desirable transgene in metastatic lesions of breast tumors. This work has strong clinical relevance to current diagnostic staging approaches, and could add to targeted therapeutic strategies to advance the fight against breast cancer. PMID:19366829

  20. Challenges Surrounding the Injection and Arrival of Targets at LIFE Fusion Chamber Center

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miles, R; Spaeth, M; Manes, K

    2010-12-01

    IFE target designers must consider several engineering requirements in addition to the physics requirements for successful target implosion. These considerations include low target cost, high manufacturing throughput, the ability of the target to survive the injection into the fusion chamber and arrive in a condition and physical position consistent with proper laser-target interaction and ease of post-implosion debris removal. This article briefly describes these considerations for the Laser Inertial Fusion-based Energy (LIFE) targets currently being designed.

  1. Effects of repetitive or intensified instructions in telephone assisted, bystander cardiopulmonary resuscitation: an investigator-blinded, 4-armed, randomized, factorial simulation trial.

    PubMed

    van Tulder, R; Roth, D; Krammel, M; Laggner, R; Heidinger, B; Kienbacher, C; Novosad, H; Chwojka, C; Havel, C; Sterz, F; Schreiber, W; Herkner, H

    2014-01-01

    Compression depth is frequently suboptimal in cardiopulmonary resuscitation (CPR). We investigated effects of intensified wording and/or repetitive target depth instructions on compression depth in telephone-assisted, protocol driven, bystander CPR on a simulation manikin. Thirty-two volunteers performed 10 min of compression only-CPR in a prospective, investigator-blinded, 4-armed, factorial setting. Participants were randomized either to standard wording ("push down firmly 5 cm"), intensified wording ("it is very important to push down 5 cm every time") or standard or intensified wording repeated every 20s. Three dispatchers were randomized to give these instructions. Primary outcome was relative compression depth (absolute compression depth minus leaning depth). Secondary outcomes were absolute distance, hands-off times as well as BORG-scale and nine-hole peg test (NHPT), pulse rate and blood pressure to reflect physical exertion. We applied a random effects linear regression model. Relative compression depth was 35 ± 10 mm (standard) versus 31 ± 11 mm (intensified wording) versus 25 ± 8 mm (repeated standard) and 31 ± 14 mm (repeated intensified wording). Adjusted for design, body mass index and female sex, intensified wording and repetition led to decreased compression depth of 13 (95%CI -25 to -1) mm (p=0.04) and 9 (95%CI -21 to 3) mm (p=0.13), respectively. Secondary outcomes regarding intensified wording showed significant differences for absolute distance (43 ± 2 versus 20 (95%CI 3-37) mm; p=0.01) and hands-off times (60 ± 40 versus 157 (95%CI 63-251) s; p=0.04). In protocol driven, telephone-assisted, bystander CPR, intensified wording and/or repetitive target depth instruction will not improve compression depth compared to the standard instruction. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  2. The physics basis for ignition using indirect-drive targets on the National Ignition Facility

    NASA Astrophysics Data System (ADS)

    Lindl, John D.; Amendt, Peter; Berger, Richard L.; Glendinning, S. Gail; Glenzer, Siegfried H.; Haan, Steven W.; Kauffman, Robert L.; Landen, Otto L.; Suter, Laurence J.

    2004-02-01

    The 1990 National Academy of Science final report of its review of the Inertial Confinement Fusion Program recommended completion of a series of target physics objectives on the 10-beam Nova laser at the Lawrence Livermore National Laboratory as the highest-priority prerequisite for proceeding with construction of an ignition-scale laser facility, now called the National Ignition Facility (NIF). These objectives were chosen to demonstrate that there was sufficient understanding of the physics of ignition targets that the laser requirements for laboratory ignition could be accurately specified. This research on Nova, as well as additional research on the Omega laser at the University of Rochester, is the subject of this review. The objectives of the U.S. indirect-drive target physics program have been to experimentally demonstrate and predictively model hohlraum characteristics, as well as capsule performance in targets that have been scaled in key physics variables from NIF targets. To address the hohlraum and hydrodynamic constraints on indirect-drive ignition, the target physics program was divided into the Hohlraum and Laser-Plasma Physics (HLP) program and the Hydrodynamically Equivalent Physics (HEP) program. The HLP program addresses laser-plasma coupling, x-ray generation and transport, and the development of energy-efficient hohlraums that provide the appropriate spectral, temporal, and spatial x-ray drive. The HEP experiments address the issues of hydrodynamic instability and mix, as well as the effects of flux asymmetry on capsules that are scaled as closely as possible to ignition capsules (hydrodynamic equivalence). The HEP program also addresses other capsule physics issues associated with ignition, such as energy gain and energy loss to the fuel during implosion in the absence of alpha-particle deposition. The results from the Nova and Omega experiments approach the NIF requirements for most of the important ignition capsule parameters, including drive temperature, drive symmetry, and hydrodynamic instability. This paper starts with a review of the NIF target designs that have formed the motivation for the goals of the target physics program. Following that are theoretical and experimental results from Nova and Omega relevant to the requirements of those targets. Some elements of this work were covered in a 1995 review of indirect-drive [J. D. Lindl, ``Development of the indirect-drive approach to inertial confinement fusion and the target physics basis for ignition and gain,'' Phys. Plasmas 2, 3933 (1995)]. In order to present as complete a picture as possible of the research that has been carried out on indirect drive, key elements of that earlier review are also covered here, along with a review of work carried out since 1995.

  3. Selectable fragmentation warhead

    DOEpatents

    Bryan, Courtney S.; Paisley, Dennis L.; Montoya, Nelson I.; Stahl, David B.

    1993-01-01

    A selectable fragmentation warhead capable of producing a predetermined number of fragments from a metal plate, and accelerating the fragments toward a target. A first explosive located adjacent to the plate is detonated at selected number of points by laser-driven slapper detonators. In one embodiment, a smoother-disk and a second explosive, located adjacent to the first explosive, serve to increase acceleration of the fragments toward a target. The ability to produce a selected number of fragments allows for effective destruction of a chosen target.

  4. Low-dose fixed-target serial synchrotron crystallography.

    PubMed

    Owen, Robin L; Axford, Danny; Sherrell, Darren A; Kuo, Anling; Ernst, Oliver P; Schulz, Eike C; Miller, R J Dwayne; Mueller-Werkmeister, Henrike M

    2017-04-01

    The development of serial crystallography has been driven by the sample requirements imposed by X-ray free-electron lasers. Serial techniques are now being exploited at synchrotrons. Using a fixed-target approach to high-throughput serial sampling, it is demonstrated that high-quality data can be collected from myoglobin crystals, allowing room-temperature, low-dose structure determination. The combination of fixed-target arrays and a fast, accurate translation system allows high-throughput serial data collection at high hit rates and with low sample consumption.

  5. PAM multiplicity marks genomic target sites as inhibitory to CRISPR-Cas9 editing.

    PubMed

    Malina, Abba; Cameron, Christopher J F; Robert, Francis; Blanchette, Mathieu; Dostie, Josée; Pelletier, Jerry

    2015-12-08

    In CRISPR-Cas9 genome editing, the underlying principles for selecting guide RNA (gRNA) sequences that would ensure for efficient target site modification remain poorly understood. Here we show that target sites harbouring multiple protospacer adjacent motifs (PAMs) are refractory to Cas9-mediated repair in situ. Thus we refine which substrates should be avoided in gRNA design, implicating PAM density as a novel sequence-specific feature that inhibits in vivo Cas9-driven DNA modification.

  6. PAM multiplicity marks genomic target sites as inhibitory to CRISPR-Cas9 editing

    PubMed Central

    Malina, Abba; Cameron, Christopher J. F.; Robert, Francis; Blanchette, Mathieu; Dostie, Josée; Pelletier, Jerry

    2015-01-01

    In CRISPR-Cas9 genome editing, the underlying principles for selecting guide RNA (gRNA) sequences that would ensure for efficient target site modification remain poorly understood. Here we show that target sites harbouring multiple protospacer adjacent motifs (PAMs) are refractory to Cas9-mediated repair in situ. Thus we refine which substrates should be avoided in gRNA design, implicating PAM density as a novel sequence-specific feature that inhibits in vivo Cas9-driven DNA modification. PMID:26644285

  7. Plasma-Jet-Driven Magneto-Inertial Fusion (PJMIF): Physics and Design for a Plasma Liner Formation Experiment

    NASA Astrophysics Data System (ADS)

    Hsu, Scott; Cassibry, Jason; Witherspoon, F. Douglas

    2014-10-01

    Spherically imploding plasma liners are a potential standoff compression driver for magneto-inertial fusion, which is a hybrid of and operates in an intermediate density between those of magnetic and inertial fusion. We propose to use an array of merging supersonic plasma jets to form a spherically imploding plasma liner. The jets are to be formed by pulsed coaxial guns with contoured electrodes that are placed sufficiently far from the location of target compression such that no hardware is repetitively destroyed. As such, the repetition rate can be higher (e.g., 1 Hz) and ultimately the power-plant economics can be more attractive than most other MIF approaches. During the R&D phase, a high experimental shot rate at reasonably low cost (e.g., < 1 k/shot) may be achieved with excellent diagnostic access, thus enabling a rapid learning rate. After some background on PJMIF and its prospects for reactor-relevant energy gain, this poster describes the physics objectives and design of a proposed 60-gun plasma-liner-formation experiment, which will provide experimental data on: (i) scaling of peak liner ram pressure versus initial jet parameters, (ii) liner non-uniformity characterization and control, and (iii) control of liner profiles for eventual gain optimization.

  8. Stopping and Coulomb explosion of energetic carbon clusters in a plasma irradiated by an intense laser field

    NASA Astrophysics Data System (ADS)

    Wang, Guiqiu; Wang, Younian

    2015-09-01

    The interaction of a charged particle beam with a plasma is a very important subject of relevance for many fields of physics, such as inertial confinement fusion (ICF) driven by ion or electron beams, high energy density physics, and related astrophysical problems. Recently, a promising ICF scheme has been proposed, in which the plasma target is irradiated simultaneously by intense laser and ion beams. For molecular ion or cluster, slowing down process will company the Coulomb explosion phenomenon. In this paper, we present a study of the effects of intense radiation field (RF) on the interaction of energetic carbon clusters in a plasma. The emphasis is laid on the dynamic polarization and correlation effects of the constituent ions within the cluster in order to disclose the role of the vicinage effects on the Coulomb explosion and energy deposition of the clusters in plasma. On the other hand, affecting of a strong laser field on the cluster propagating in plasma is considered, the influence of a large range of laser parameters and plasma parameters on the Coulomb explosion and stopping power are discussed. This work is supported by the National Natural Science Foundation of China (11375034), and the Fundamental Research Funds for the Central Universities of China (3132015144, 3132014337).

  9. Responses of Aquatic Plants to Eutrophication in Rivers: A Revised Conceptual Model

    PubMed Central

    O’Hare, Matthew T.; Baattrup-Pedersen, Annette; Baumgarte, Inga; Freeman, Anna; Gunn, Iain D. M.; Lázár, Attila N.; Sinclair, Raeannon; Wade, Andrew J.; Bowes, Michael J.

    2018-01-01

    Compared to research on eutrophication in lakes, there has been significantly less work carried out on rivers despite the importance of the topic. However, over the last decade, there has been a surge of interest in the response of aquatic plants to eutrophication in rivers. This is an area of applied research and the work has been driven by the widespread nature of the impacts and the significant opportunities for system remediation. A conceptual model has been put forward to describe how aquatic plants respond to eutrophication. Since the model was created, there have been substantial increases in our understanding of a number of the underlying processes. For example, we now know the threshold nutrient concentrations at which nutrients no longer limit algal growth. We also now know that the physical habitat template of rivers is a primary selector of aquatic plant communities. As such, nutrient enrichment impacts on aquatic plant communities are strongly influenced, both directly and indirectly, by physical habitat. A new conceptual model is proposed that incorporates these findings. The application of the model to management, system remediation, target setting, and our understanding of multi-stressor systems is discussed. We also look to the future and the potential for new numerical models to guide management. PMID:29755484

  10. Toward high-efficiency and detailed Monte Carlo simulation study of the granular flow spallation target

    NASA Astrophysics Data System (ADS)

    Cai, Han-Jie; Zhang, Zhi-Lei; Fu, Fen; Li, Jian-Yang; Zhang, Xun-Chao; Zhang, Ya-Ling; Yan, Xue-Song; Lin, Ping; Xv, Jian-Ya; Yang, Lei

    2018-02-01

    The dense granular flow spallation target is a new target concept chosen for the Accelerator-Driven Subcritical (ADS) project in China. For the R&D of this kind of target concept, a dedicated Monte Carlo (MC) program named GMT was developed to perform the simulation study of the beam-target interaction. Owing to the complexities of the target geometry, the computational cost of the MC simulation of particle tracks is highly expensive. Thus, improvement of computational efficiency will be essential for the detailed MC simulation studies of the dense granular target. Here we present the special design of the GMT program and its high efficiency performance. In addition, the speedup potential of the GPU-accelerated spallation models is discussed.

  11. Data-Driven prioritisation of antibody-drug conjugate targets in head and neck squamous cell carcinoma.

    PubMed

    Hanemaaijer, Saskia H; van Gijn, Stephanie E; Oosting, Sjoukje F; Plaat, Boudewijn E C; Moek, Kirsten L; Schuuring, Ed M; van der Laan, Bernard F A M; Roodenburg, Jan L N; van Vugt, Marcel A T M; van der Vegt, Bert; Fehrmann, Rudolf S N

    2018-05-01

    For patients with recurrent or metastatic head and neck squamous cell carcinoma (HNSCC) palliative treatment options that improve overall survival are limited. The prognosis in this group remains poor and there is an unmet need for new therapeutic options. An emerging class of therapeutics, targeting tumor-specific antigens, are antibodies bound to a cytotoxic agent, known as antibody-drug conjugates (ADCs). The aim of this study was to prioritize ADC targets in HNSCC. With a systematic search, we identified 55 different ADC targets currently targeted by registered ADCs and ADCs under clinical evaluation. For these 55 ADC targets, protein overexpression was predicted in a dataset containing 344 HNSCC mRNA expression profiles by using a method called functional genomic mRNA profiling. The ADC target with the highest predicted overexpression was validated by performing immunohistochemistry (IHC) on an independent tissue microarray containing 414 HNSCC tumors. The predicted top 5 overexpressed ADC targets in HNSCC were: glycoprotein nmb (GPNMB), SLIT and NTRK-like family member 6, epidermal growth factor receptor, CD74 and CD44. IHC validation showed combined cytoplasmic and membranous GPNMB protein expression in 92.0% of the cases. Strong expression was seen in 65.9% of the cases. In addition, 86.5% and 67.7% of cases showed ≥5% and >25% GPNMB positive tumor cells, respectively. This study provides a data-driven prioritization of ADCs targets that will facilitate clinicians and drug developers in deciding which ADC should be taken for further clinical evaluation in HNSCC. This might help to improve disease outcome of HNSCC patients. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Basket Studies: Redefining Clinical Trials in the Era of Genome-Driven Oncology.

    PubMed

    Tao, Jessica J; Schram, Alison M; Hyman, David M

    2018-01-29

    Understanding a tumor's detailed molecular profile has become increasingly necessary to deliver the standard of care for patients with advanced cancer. Innovations in both tumor genomic sequencing technology and the development of drugs that target molecular alterations have fueled recent gains in genome-driven oncology care. "Basket studies," or histology-agnostic clinical trials in genomically selected patients, represent one important research tool to continue making progress in this field. We review key aspects of genome-driven oncology care, including the purpose and utility of basket studies, biostatistical considerations in trial design, genomic knowledgebase development, and patient matching and enrollment models, which are critical for translating our genomic knowledge into clinically meaningful outcomes.

  13. BNIP3 contributes to the glutamine-driven aggressive behavior of melanoma cells.

    PubMed

    Vara-Perez, Monica; Maes, Hannelore; Van Dingenen, Sarah; Agostinis, Patrizia

    2018-06-01

    Aerobic glycolysis (Warburg effect) is used by cancer cells to fuel tumor growth. Interestingly, metastatic melanoma cells rely on glutaminolysis rather than aerobic glycolysis for their bioenergetic needs through the tricarboxylic acid cycle. Here, we compared the effects of glucose or glutamine on melanoma cell proliferation, migration and oxidative phosphorylation in vitro. We found that glutamine-driven melanoma cell's aggressive traits positively correlated with increased expression of HIF1α and its pro-autophagic target BNIP3. BNIP3 silencing reduced glutamine-mediated effects on melanoma cell growth, migration and bioenergetics. Hence, BNIP3 is a vital component of the mitochondria quality control required for glutamine-driven melanoma aggressiveness.

  14. Target: Lifestyle.

    ERIC Educational Resources Information Center

    Poehlman, Eric T.

    1985-01-01

    "Target: Lifestyle" is a physical education curriculum adopted by Detroit Country Day School which incorporates instruction in nutrition, physical fitness, first aid, and lifetime sports. This curriculum aims to influence student attitudes and lifestyles in health and physical fitness. Four levels of instruction are described. (DF)

  15. Extended x-ray absorption fine structure measurements of quasi-isentropically compressed vanadium targets on the OMEGA laser

    NASA Astrophysics Data System (ADS)

    Yaakobi, B.; Boehly, T. R.; Sangster, T. C.; Meyerhofer, D. D.; Remington, B. A.; Allen, P. G.; Pollaine, S. M.; Lorenzana, H. E.; Lorenz, K. T.; Hawreliak, J. A.

    2008-06-01

    The use of in situ extended x-ray absorption fine structure (EXAFS) for characterizing nanosecond laser-shocked vanadium, titanium, and iron has recently been demonstrated. These measurements are extended to laser-driven, quasi-isentropic compression experiments (ICE). The radiation source (backlighter) for EXAFS in all of these experiments is obtained by imploding a spherical target on the OMEGA laser [T. R. Boehly et al., Rev. Sci. Instrum. 66, 508 (1995)]. Isentropic compression (where the entropy is kept constant) enables to reach high compressions at relatively low temperatures. The absorption spectra are used to determine the temperature and compression in a vanadium sample quasi-isentropically compressed to pressures of up to ˜0.75Mbar. The ability to measure the temperature and compression directly is unique to EXAFS. The drive pressure is calibrated by substituting aluminum for the vanadium and interferometrically measuring the velocity of the back target surface by the velocity interferometer system for any reflector (VISAR). The experimental results obtained by EXAFS and VISAR agree with each other and with the simulations of a hydrodynamic code. The role of a shield to protect the sample from impact heating is studied. It is shown that the shield produces an initial weak shock that is followed by a quasi-isentropic compression at a relatively low temperature. The role of radiation heating from the imploding target as well as from the laser-absorption region is studied. The results show that in laser-driven ICE, as compared with laser-driven shocks, comparable compressions can be achieved at lower temperatures. The EXAFS results show important details not seen in the VISAR results.

  16. Aerodynamically and acoustically driven modes of vibration in a physical model of the vocal folds.

    PubMed

    Zhang, Zhaoyan; Neubauer, Juergen; Berry, David A

    2006-11-01

    In a single-layered, isotropic, physical model of the vocal folds, distinct phonation types were identified based on the medial surface dynamics of the vocal fold. For acoustically driven phonation, a single, in-phase, x-10 like eigenmode captured the essential dynamics, and coupled with one of the acoustic resonances of the subglottal tract. Thus, the fundamental frequency appeared to be determined primarily by a subglottal acoustic resonance. In contrast, aerodynamically driven phonation did not naturally appear in the single-layered model, but was facilitated by the introduction of a vertical constraint. For this phonation type, fundamental frequency was relatively independent of the acoustic resonances, and two eigenmodes were required to capture the essential dynamics of the vocal fold, including an out-of-phase x-11 like eigenmode and an in-phase x-10 like eigenmode, as described in earlier theoretical work. The two eigenmodes entrained to the same frequency, and were decoupled from subglottal acoustic resonances. With this independence from the acoustic resonances, vocal fold dynamics appeared to be determined primarily by near-field, fluid-structure interactions.

  17. Beyond Triage: The Escalation of Empowerment by U.S. Military Forces in Support of International Disaster Response

    DTIC Science & Technology

    2008-06-13

    environment can be found in Soviet research on cultural-historical psychology. Lev Vygotsky , A.N. Leont’ev, A.R. Luria and others struggled to promote...Werner Heisenberg’s The Physical Principles of the Quantum Theory for post-relativity physics cast the problem of environmental interaction as driven...

  18. Using Tracker as a Pedagogical Tool for Understanding Projectile Motion

    ERIC Educational Resources Information Center

    Wee, Loo Kang; Chew, Charles; Goh, Giam Hwee; Tan, Samuel; Lee, Tat Leong

    2012-01-01

    This article reports on the use of Tracker as a pedagogical tool in the effective learning and teaching of projectile motion in physics. When a computer model building learning process is supported and driven by video analysis data, this free Open Source Physics tool can provide opportunities for students to engage in active enquiry-based…

  19. Physical Activity, Disordered Eating Risk, and Anthropometric Measurement: A Comparison of College Female Athletes and Non Athletes

    ERIC Educational Resources Information Center

    Malinauskas, Brenda M.; Cucchiara, Andrew J.; Aeby, Victor G.; Bruening, Christi C.

    2007-01-01

    Opportunities for women in sport have expanded, whereas the media-driven ideal female continues to have a slender body. To attain the body that society has promoted, college-age females are vulnerable to psychological disordered eating risk. This study examines relationships among physical activity, body composition, and psychological eating…

  20. Treatment Effect of Drug-Coated Balloons Is Durable to 3 Years in the Femoropopliteal Arteries

    PubMed Central

    Laird, John R.; Tepe, Gunnar; Brodmann, Marianne; Zeller, Thomas; Scheinert, Dierk; Metzger, Christopher; Micari, Antonio; Sachar, Ravish; Jaff, Michael R.; Wang, Hong; Hasenbank, Melissa S.; Krishnan, Prakash

    2018-01-01

    Background— Randomized controlled trials have reported favorable 1-year outcomes with drug-coated balloons (DCBs) for the treatment of symptomatic peripheral arterial disease when compared with standard percutaneous transluminal angioplasty (PTA). Evidence remains limited on the durability of the treatment effect with DCBs in the longer term. Methods and Results— IN.PACT SFA is a single-blind, randomized trial (Randomized Trial of IN.PACT Admiral Paclitaxel-Coated Percutaneous Transluminal Angioplasty [PTA] Balloon Catheter vs Standard PTA for the Treatment of Atherosclerotic Lesions in the Superficial Femoral Artery [SFA] and/or Proximal Popliteal Artery [PPA]) that enrolled 331 patients with symptomatic (Rutherford 2–4) femoropopliteal lesions up to 18 cm in length. Patients were randomized 2:1 to receive treatment with DCB or PTA. The 36-month assessments included primary patency, freedom from clinically driven target lesion revascularization, major adverse events, and functional outcomes. At 36 months, primary patency remained significantly higher among patients treated with DCB compared with PTA (69.5% versus 45.1%; log rank P<0.001). The rates of clinically driven target lesion revascularization were 15.2% and 31.1% (P=0.002) for the DCB and PTA groups, respectively. Functional outcomes were similarly improved between treatment groups even though subjects in the DCB group required significantly fewer reinterventions versus those in the PTA group (P<0.001 for target lesion revascularization, P=0.001 for target vessel revascularization). There were no device- or procedure-related deaths as adjudicated by an independent Clinical Events Committee. Conclusions— Three-year results demonstrate a durable and superior treatment effect among patients treated with DCB versus standard PTA, with significantly higher primary patency and lower clinically driven target lesion revascularization, resulting in similar functional improvements with reduced need for repeat interventions. Clinical Trial Registration— URL: http://www.clinicaltrials.gov. Unique identifiers: NCT01175850 for IN.PACT SFA phase I in the European Union and NCT01566461 for IN.PACT SFA phase II in the United States. PMID:29326153

  1. The role of popularity goal in early adolescents' behaviors and popularity status.

    PubMed

    Dawes, Molly; Xie, Hongling

    2014-02-01

    The effect of popularity goal on the use of 3 popularity-related behaviors and later popularity status was examined in a diverse sample of 314 6th-grade students (176 girls and 138 boys) in both fall (Time 1) and spring (Time 2) semesters. Popularity goal and the use of popularity-driven behaviors (e.g., "I change the way I dress in order to be more popular") were assessed by self-report survey items (Time 1). Physical aggression, social aggression (Time 1), and perceived popularity (Times 1 and 2) were assessed by peer nominations. Popularity goal was positively associated with popularity-driven behaviors, social aggression, and physical aggression. There was a significant interaction effect between popularity goal and popularity status on the use of concurrent social aggression at Time 1; a higher popularity goal was associated with greater usage of social aggression for high-popular adolescents. Popularity goal alone did not predict popularity status change at Time 2; rather, greater use of social aggression at Time 1 was associated with higher Time 2 popularity status for initially high-popular adolescents who had a high-popularity goal and for initially low-popular adolescents who had a low-popularity goal. A similar 3-way interaction effect was found for physical aggression. Results suggest that the adolescents' goal for popularity may help us better understand the functions of aggressive and popularity-driven behaviors in peer social networks.

  2. Physical phenomena and the microgravity response

    NASA Technical Reports Server (NTRS)

    Todd, Paul

    1989-01-01

    The living biological cell is not a sack of Newtonian fluid containing systems of chemical reactions at equilibrium. It is a kinetically driven system, not a thermodynamically driven system. While the cell as a whole might be considered isothermal, at the scale of individual macromolecular events there is heat generated, and presumably sharp thermal gradients exist at the submicron level. Basic physical phenomena to be considered when exploring the cell's response to inertial acceleration include particle sedimentation, solutal convection, motility electrokinetics, cytoskeletal work, and hydrostatic pressure. Protein crystal growth experiments, for example, illustrate the profound effects of convection currents on macromolecular assembly. Reaction kinetics in the cell vary all the way from diffusion-limited to life-time limited. Transport processes vary from free diffusion, to facilitated and active transmembrane transport, to contractile-protein-driven motility, to crystalline immobilization. At least four physical states of matter exist in the cell: aqueous, non-aqueous, immiscible-aqueous, and solid. Levels of order vary from crystalline to free solution. The relative volumes of these states profoundly influence the cell's response to inertial acceleration. Such subcellular phenomena as stretch-receptor activation, microtubule re-assembly, synaptic junction formation, chemotactic receptor activation, and statolith sedimentation were studied recently with respect to both their basic mechanisms and their responsiveness to inertial acceleration. From such studies a widespread role of cytoskeletal organization is becoming apparent.

  3. The Physics and Physical Chemistry of Molecular Machines.

    PubMed

    Astumian, R Dean; Mukherjee, Shayantani; Warshel, Arieh

    2016-06-17

    The concept of a "power stroke"-a free-energy releasing conformational change-appears in almost every textbook that deals with the molecular details of muscle, the flagellar rotor, and many other biomolecular machines. Here, it is shown by using the constraints of microscopic reversibility that the power stroke model is incorrect as an explanation of how chemical energy is used by a molecular machine to do mechanical work. Instead, chemically driven molecular machines operating under thermodynamic constraints imposed by the reactant and product concentrations in the bulk function as information ratchets in which the directionality and stopping torque or stopping force are controlled entirely by the gating of the chemical reaction that provides the fuel for the machine. The gating of the chemical free energy occurs through chemical state dependent conformational changes of the molecular machine that, in turn, are capable of generating directional mechanical motions. In strong contrast to this general conclusion for molecular machines driven by catalysis of a chemical reaction, a power stroke may be (and often is) an essential component for a molecular machine driven by external modulation of pH or redox potential or by light. This difference between optical and chemical driving properties arises from the fundamental symmetry difference between the physics of optical processes, governed by the Bose-Einstein relations, and the constraints of microscopic reversibility for thermally activated processes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Is there a link between selectivity and binding thermodynamics profiles?

    PubMed

    Tarcsay, Ákos; Keserű, György M

    2015-01-01

    Thermodynamics of ligand binding is influenced by the interplay between enthalpy and entropy contributions of the binding event. The impact of these binding free energy components, however, is not limited to the primary target only. Here, we investigate the relationship between binding thermodynamics and selectivity profiles by combining publicly available data from broad off-target assay profiling and the corresponding thermodynamics measurements. Our analysis indicates that compounds binding their primary targets with higher entropy contributions tend to hit more off-targets compared with those ligands that demonstrated enthalpy-driven binding. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Visual Target Tracking on the Mars Exploration Rovers

    NASA Technical Reports Server (NTRS)

    Kim, Won; Biesiadecki, Jeffrey; Ali, Khaled

    2008-01-01

    Visual target tracking (VTT) software has been incorporated into Release 9.2 of the Mars Exploration Rover (MER) flight software, now running aboard the rovers Spirit and Opportunity. In the VTT operation (see figure), the rover is driven in short steps between stops and, at each stop, still images are acquired by actively aimed navigation cameras (navcams) on a mast on the rover (see artistic rendition). The VTT software processes the digitized navcam images so as to track a target reliably and to make it possible to approach the target accurately to within a few centimeters over a 10-m traverse.

  6. Disciplinary reporting affects the interpretation of climate change impacts in global oceans.

    PubMed

    Hauser, Donna D W; Tobin, Elizabeth D; Feifel, Kirsten M; Shah, Vega; Pietri, Diana M

    2016-01-01

    Climate change is affecting marine ecosystems, but different investigative approaches in physical, chemical, and biological disciplines may influence interpretations of climate-driven changes in the ocean. Here, we review the ocean change literature from 2007 to 2012 based on 461 of the most highly cited studies in physical and chemical oceanography and three biological subdisciplines. Using highly cited studies, we focus on research that has shaped recent discourse on climate-driven ocean change. Our review identified significant differences in spatial and temporal scales of investigation among disciplines. Physical/chemical studies had a median duration of 29 years (n = 150) and covered the greatest study areas (median 1.41 × 10(7) km(2) , n = 148). Few biological studies were conducted over similar spatial and temporal scales (median 8 years, n = 215; median 302 km(2) , n = 196), suggesting a more limited ability to separate climate-related responses from natural variability. We linked physical/chemical and biological disciplines by tracking studies examining biological responses to changing ocean conditions. Of the 545 biological responses recorded, a single physical or chemical stressor was usually implicated as the cause (59%), with temperature as the most common primary stressor (44%). The most frequently studied biological responses were changes in physiology (31%) and population abundance (30%). Differences in disciplinary studies, as identified in this review, can ultimately influence how researchers interpret climate-related impacts in marine systems. We identified research gaps and the need for more discourse in (1) the Indian and other Southern Hemisphere ocean basins; (2) research themes such as archaea, bacteria, viruses, mangroves, turtles, and ocean acidification; (3) physical and chemical stressors such as dissolved oxygen, salinity, and upwelling; and (4) adaptive responses of marine organisms to climate-driven ocean change. Our findings reveal that highly cited biological studies are rarely conducted on scales that match those of physical and chemical studies. Rather, we suggest a need for measuring responses at biologically relevant scales. © 2015 The Authors. Global Change Biology Published by John Wiley & Sons Ltd.

  7. Causal reports: Context-dependent contributions of intuitive physics and visual impressions of launching.

    PubMed

    Vicovaro, Michele

    2018-05-01

    Everyday causal reports appear to be based on a blend of perceptual and cognitive processes. Causality can sometimes be perceived automatically through low-level visual processing of stimuli, but it can also be inferred on the basis of an intuitive understanding of the physical mechanism that underlies an observable event. We investigated how visual impressions of launching and the intuitive physics of collisions contribute to the formation of explicit causal responses. In Experiment 1, participants observed collisions between realistic objects differing in apparent material and hence implied mass, whereas in Experiment 2, participants observed collisions between abstract, non-material objects. The results of Experiment 1 showed that ratings of causality were mainly driven by the intuitive physics of collisions, whereas the results of Experiment 2 provide some support to the hypothesis that ratings of causality were mainly driven by visual impressions of launching. These results suggest that stimulus factors and experimental design factors - such as the realism of the stimuli and the variation in the implied mass of the colliding objects - may determine the relative contributions of perceptual and post-perceptual cognitive processes to explicit causal responses. A revised version of the impetus transmission heuristic provides a satisfactory explanation for these results, whereas the hypothesis that causal responses and intuitive physics are based on the internalization of physical laws does not. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. From X-Rays to MRI: Physics in GE

    NASA Astrophysics Data System (ADS)

    Schmitt, Roland W.

    2004-03-01

    The GE Research Laboratory, founded in 1900, became the first laboratory of scientific research in U.S. industry. William Coolidge, a physicist, joined the laboratory in 1905 and produced two advances of immense importance. The first, ductile tungsten, is still the heart of every incandescent light bulb. The second, the "Coolidge" X-Ray tube, remains an essential tool of modern medicine. In the process, Coolidge explored two main approaches of physics in industry. One addresses a commercial problem or opportunity (better light bulbs) and finds interesting physics. The other explores interesting physics (X-rays) and creates a commercial opportunity. This paper addresses the mix of these approaches during GE's years as an "electric" (and therefore physics-based) company. Episodes include the following: the work of Irving Langmuir (1932 Nobel laureate in chemistry, but as much physicist as chemist); the post-World War II "golden age of industrial physics" when the endless frontier offered opportunities from nuclear power to diamond making to superconductivity; the Nobel-prize winning work of Ivar Giaever; and interdisciplinary efforts that enabled GE to become a world business leader in two medical diagnostic technologies it did not invent: computed tomography and magnetic resonance imaging. I will speculate on whether this mix of problem-driven and opportunity-driven effort is as relevant to the 21st century as it was to the 20th.

  9. All for one and FOSL1 for all: FOSL1 at the crossroads of lung and pancreatic cancer driven by mutant KRAS.

    PubMed

    Vallejo, Adrian; Valencia, Karmele; Vicent, Silvestre

    2017-01-01

    KRAS proto-oncogene, GTPase ( KRAS ) remains refractory to current therapies. We devised an integrative cross-tumor approach to expose common core elements up-regulated in mutant KRAS cancers that could provide new treatment opportunities. This approach identified FOSL1 ( Fos-like antigen 1 ) as a clinically and functionally relevant gene in mutant KRAS -driven lung and pancreatic cancers, and unveiled downstream transcriptional targets amenable to pharmacological inhibition.

  10. Trains of electron micro-bunches in plasma wake-field acceleration

    NASA Astrophysics Data System (ADS)

    Lécz, Zsolt; Andreev, Alexander; Konoplev, Ivan; Seryi, Andrei; Smith, Jonathan

    2018-07-01

    Plasma-based charged particle accelerators have been intensively investigated in the past three decades due to their capability to open up new horizons in accelerator science and particle physics yielding electric field accelerating gradient more than three orders of magnitudes higher than in conventional devices. At the current stage the most advanced and reliable mechanism for accelerating electrons is based on the propagation of an intense laser pulse or a relativistic electron beam in a low density gaseous target. In this paper we concentrate on the electron beam-driven plasma wake-field acceleration and demonstrate using 3D PiC simulations that a train of electron micro-bunches with ∼10 fs period can be generated behind the driving beam propagating in a density down-ramp. We will discuss the conditions and properties of the micro-bunches generated aiming at understanding and study of multi-bunch mechanism of injection. It is show that the periodicity and duration of micro-bunches can be controlled by adjusting the plasma density gradient and driving beam charge.

  11. Dynein Clusters into Lipid Microdomains on Phagosomes to Drive Rapid Transport toward Lysosomes.

    PubMed

    Rai, Ashim; Pathak, Divya; Thakur, Shreyasi; Singh, Shampa; Dubey, Alok Kumar; Mallik, Roop

    2016-02-11

    Diverse cellular processes are driven by motor proteins that are recruited to and generate force on lipid membranes. Surprisingly little is known about how membranes control the force from motors and how this may impact specific cellular functions. Here, we show that dynein motors physically cluster into microdomains on the membrane of a phagosome as it matures inside cells. Such geometrical reorganization allows many dyneins within a cluster to generate cooperative force on a single microtubule. This results in rapid directed transport of the phagosome toward microtubule minus ends, likely promoting phagolysosome fusion and pathogen degradation. We show that lipophosphoglycan, the major molecule implicated in immune evasion of Leishmania donovani, inhibits phagosome motion by disrupting the clustering and therefore the cooperative force generation of dynein. These findings appear relevant to several pathogens that prevent phagosome-lysosome fusion by targeting lipid microdomains on phagosomes. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Ion-Ion Equilibration and Particle Distributions in a 3000 km s-1 Shock in SN 1006

    NASA Astrophysics Data System (ADS)

    Raymond, J. C.; Winkler, P. F.; Blair, W. P.; Laming, J. M.

    2017-12-01

    SN 1006 is the most attractive target for investigating the physics of collisionless shock waves faster than 2000 {km} {{{s}}}-1. We obtained UV and optical spectra and an Hα image of a 3000 {km} {{{s}}}-1 shock driven by a clump of ejecta that has overtaken the blast wave. It is 500 km s-1 faster than the filament studied earlier. We find kinetic temperatures of H, He, C, and N that are consistent with being mass proportional, suggesting little or no energy transfer among species. We also find evidence that the electron temperature is less than 10% of the proton temperature and that the velocity distribution of H atoms is non-Maxwellian. We measure a proper motion of 0.″34 ± 0.″01 yr-1 for the bow shock, which implies a distance to SN 1006 of 1.85 ± 0.25 kpc, and we discuss the role of plasma turbulence in determining the shape of the velocity distribution.

  13. Explosively driven two-shockwave tools with applications

    NASA Astrophysics Data System (ADS)

    Buttler, W. T.; Oró, D. M.; Mariam, F. G.; Saunders, A.; Andrews, M. J.; Cherne, F. J.; Hammerberg, J. E.; Hixson, R. S.; Monfared, S. K.; Morris, C.; Olson, R. T.; Preston, D. L.; Stone, J. B.; Terrones, G.; Tupa, D.; Vogan-McNeil, W.

    2014-05-01

    We present the development of an explosively driven physics tool to generate two mostly uniaxial shockwaves. The tool is being used to extend single shockwave ejecta models to account for a second shockwave a few microseconds later. We explore techniques to vary the amplitude of both the first and second shockwaves, and we apply the tool experimentally at the Los Alamos National Laboratory Proton Radiography (pRad)facility. The tools have been applied to Sn with perturbations of wavelength λ = 550 μm, and various amplitudes that give wavenumber amplitude products of kh in {3/4,1/2,1/4,1/8}, where h is the perturbation amplitude, and k = 2π/λ is the wavenumber. The pRad data suggest the development of a second shock ejecta model based on unstable Richtmyer-Meshkov physics.

  14. Hard Sphere Simulation by Event-Driven Molecular Dynamics: Breakthrough, Numerical Difficulty, and Overcoming the issues

    NASA Astrophysics Data System (ADS)

    Isobe, Masaharu

    Hard sphere/disk systems are among the simplest models and have been used to address numerous fundamental problems in the field of statistical physics. The pioneering numerical works on the solid-fluid phase transition based on Monte Carlo (MC) and molecular dynamics (MD) methods published in 1957 represent historical milestones, which have had a significant influence on the development of computer algorithms and novel tools to obtain physical insights. This chapter addresses the works of Alder's breakthrough regarding hard sphere/disk simulation: (i) event-driven molecular dynamics, (ii) long-time tail, (iii) molasses tail, and (iv) two-dimensional melting/crystallization. From a numerical viewpoint, there are serious issues that must be overcome for further breakthrough. Here, we present a brief review of recent progress in this area.

  15. Driven magnetic reconnection in three dimensions - Energy conversion and field-aligned current generation

    NASA Technical Reports Server (NTRS)

    Sato, T.; Walker, R. J.; Ashour-Abdalla, M.

    1984-01-01

    The energy conversion processes occurring in three-dimensional driven reconnection is analyzed. In particular, the energy conversion processes during localized reconnection in a taillike magnetic configuration are studied. It is found that three-dimensional driven reconnection is a powerful energy converter which transforms magnetic energy into plasma bulk flow and thermal energy. Three-dimensional driven reconnection is an even more powerful energy converter than two-dimensional reconnection, because in the three-dimensional case, plasmas were drawn into the reconnection region from the sides as well as from the top and bottom. Field-aligned currents are generated by three-dimensional driven reconnection. The physical mechanism responsible for these currents which flow from the tail toward the ionosphere on the dawnside of the reconnection region and from the ionosphere toward the tail on the duskside is identified. The field-aligned currents form as the neutral sheet current is diverted through the slow shocks which form on the outer edge of the reconnected field lines (outer edge of the plasma sheet).

  16. Microscopic origin and macroscopic implications of lane formation in mixtures of oppositely-driven particles

    NASA Astrophysics Data System (ADS)

    Whitelam, Stephen

    Colloidal particles of two types, driven in opposite directions, can segregate into lanes. I will describe some results on this phenomenon obtained by simple physical arguments and computer simulations. Laning results from rectification of diffusion on the scale of a particle diameter: oppositely-driven particles must, in the time taken to encounter each other in the direction of the drive, diffuse in the perpendicular direction by about one particle diameter. This geometric constraint implies that the diffusion constant of a particle, in the presence of those of the opposite type, grows approximately linearly with Peclet number, a prediction confirmed by our numerics. Such environment-dependent diffusion is statistically similar to an effective interparticle attraction; consistent with this observation, we find that oppositely-driven colloids display features characteristic of the simplest model system possessing both interparticle attractions and persistent motion, the driven Ising lattice gas. Office of Science, Office of Basic Energy Sciences, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

  17. Fault Detection for Nonlinear Process With Deterministic Disturbances: A Just-In-Time Learning Based Data Driven Method.

    PubMed

    Yin, Shen; Gao, Huijun; Qiu, Jianbin; Kaynak, Okyay

    2017-11-01

    Data-driven fault detection plays an important role in industrial systems due to its applicability in case of unknown physical models. In fault detection, disturbances must be taken into account as an inherent characteristic of processes. Nevertheless, fault detection for nonlinear processes with deterministic disturbances still receive little attention, especially in data-driven field. To solve this problem, a just-in-time learning-based data-driven (JITL-DD) fault detection method for nonlinear processes with deterministic disturbances is proposed in this paper. JITL-DD employs JITL scheme for process description with local model structures to cope with processes dynamics and nonlinearity. The proposed method provides a data-driven fault detection solution for nonlinear processes with deterministic disturbances, and owns inherent online adaptation and high accuracy of fault detection. Two nonlinear systems, i.e., a numerical example and a sewage treatment process benchmark, are employed to show the effectiveness of the proposed method.

  18. Position of Curiosity for Drilling at Cumberland

    NASA Image and Video Library

    2013-06-05

    This image produced from software used for planning drives of NASA Mars rover Curiosity depicts the location and size of the rover when it was driven into position for drilling into rock target Cumberland.

  19. Combining Active Learning with Service Learning: A Student-Driven Demonstration Project.

    ERIC Educational Resources Information Center

    Hatcher-Skeers, Mary; Aragon, Ellen

    2002-01-01

    Describes a project that integrates active learning into service learning targeting both college students and middle schools students wherein college students perform chemical demonstrations for middle school students. (YDS)

  20. Identifying Martian Hydrothermal Sites: Geological Investigation Utilizing Multiple Datasets

    NASA Technical Reports Server (NTRS)

    Dohm, J. M.; Baker, V. R.; Anderson, R. C.; Scott, D. H.; Rice, J. W., Jr.; Hare, T. M.

    2000-01-01

    Comprehensive geological investigations of martian landscapes that may have been modified by magmatic-driven hydrothermal activity, utilizing multiple datasets, will yield prime target sites for future hydrological, mineralogical, and biological investigations.

Top